WorldWideScience

Sample records for mediated pcr polymerase

  1. Comparison of polymerase chain reaction (PCR) and loop-mediated ...

    African Journals Online (AJOL)

    Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...

  2. Loop mediated isothermal amplification assay using hydroxy naphthol blue, conventional polymerase chain reaction and real-time PCR in the diagnosis of intraocular tuberculosis

    Directory of Open Access Journals (Sweden)

    P K Balne

    2015-01-01

    Full Text Available This study is a comparative evaluation (Chi-square test of a closed tube loop mediated isothermal amplification assay using hydroxy naphthol blue dye (HNB-LAMP, real-time polymerase chain reaction (PCR and conventional PCR in the diagnosis of intraocular tuberculosis. Considering clinical presentation as the gold standard in 33 patients, the sensitivity of HNB-LAMP assay (75.8% was higher (not significant, P value 0.2 than conventional PCR (57.6% and lower than real-time PCR (90.9%. Specificity was 100% by all three methods. No amplification was observed in negative controls (n = 20 by all three methods. The cost of the HNB-LAMP assay was Rs. 500.00 and it does not require thermocycler, therefore, it can be used as an alternative to conventional PCR in resource-poor settings.

  3. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    Science.gov (United States)

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. DNA polymerase preference determines PCR priming efficiency.

    Science.gov (United States)

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

  5. Polymerase chain reaction methods (PCR in agrobiotechnology

    Directory of Open Access Journals (Sweden)

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  6. One-stop polymerase chain reaction (PCR): An improved PCR ...

    African Journals Online (AJOL)

    Yomi

    2011-12-21

    Dec 21, 2011 ... membrane filtration was carried out with a commercial PCR product purification kit (Generay, Shanghai), according to the manufacture's instruction. In brief, 50 µl PCR product was mixed thoroughly with binding buffer, and the resultant mixture was loaded directly onto a silica membrane Gelclean column.

  7. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Science.gov (United States)

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

    2014-01-01

    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

  8. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Directory of Open Access Journals (Sweden)

    Tom eKillelea

    2014-05-01

    Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

  9. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    African Journals Online (AJOL)

    Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

  10. Polymerase Chain Reaction (PCR) provides a superior tool for the ...

    African Journals Online (AJOL)

    Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...

  11. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

    OpenAIRE

    İLHAK, O. İrfan; ARSLAN, Ali

    2014-01-01

    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  12. PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.

    Science.gov (United States)

    Cline, J; Braman, J C; Hogrefe, H H

    1996-09-15

    The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.

  13. Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis.

    Science.gov (United States)

    Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping

    2015-11-01

    Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

  14. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  15. Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

    Science.gov (United States)

    Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

    2018-02-26

    Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

  16. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-01-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  17. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  18. COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

    Directory of Open Access Journals (Sweden)

    Masashi Miura

    2013-12-01

    Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

  19. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

    Science.gov (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

    2001-08-15

    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  20. PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.

    OpenAIRE

    Cline, J; Braman, J C; Hogrefe, H H

    1996-01-01

    The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) < Deep Vent (2.7 x 10(-6)) < Vent (2.8 x 10(-6)) < Taq (8.0 x 10(-6)) < < exo- Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at p...

  1. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

    NARCIS (Netherlands)

    Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

    2003-01-01

    Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

  2. A novel polymerase chain reaction (PCR) for rapid isolation of a new ...

    African Journals Online (AJOL)

    mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...

  3. polymerase chain reaction (pcr) provides a superior tool

    African Journals Online (AJOL)

    boaz

    Keywords: Streptococcus pneumoniae, meningitis, rt-PCR, standard bacteriological methods ... qualification de techniciens et les matériels pour son application constituent des ... Streptococcus pneumonia (pneumococcus) is a common.

  4. Multiplex polymerase chain reaction (PCR) and fluorescence-based ...

    African Journals Online (AJOL)

    reading 7

    2011-12-28

    Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.

  5. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    International Nuclear Information System (INIS)

    Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-01

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

  6. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  7. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    African Journals Online (AJOL)

    Rajeh Ali

    2014-06-20

    Jun 20, 2014 ... in 2013. Objectives: This study aimed to investigate S. aureus in some clinical samples by PCR and study .... culture, the isolates of S. aureus were incubated at 37 °C for. 18–24 h .... characteristics, and ability to form biofilm.

  8. an overview on the application of polymerase chain reaction (pcr)

    African Journals Online (AJOL)

    DR. AMINU

    Hill New York Pp818. Chul, W.P., Jang-Hee, H., Jin-Hyeok, J. et al (2004). Detection rates of Bacteria in chronic Otitis. Media with Effusion in Children, Journal of. Korean Medical Sciences 19: 735-738. Cockerill, F.R. and Smith, T.F. (2002). Rapid-Cycle real time PCR: A revolution of clinical. Microbiology. ASM News 68:2.

  9. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Lina MR; Dadang S; Budiman Bela

    2004-01-01

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  10. PEMERIKSAAN BAKTERI LEPTOSPIRA PADA SAMPEL DARAH MANUSIA SUSPECT LEPTOSPIROSIS MENGGUNAKAN METODE PCR (POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Sefrita Tri Utami

    2014-01-01

    Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

  11. Polymerase study: Improved detection of Salmonella and Campylobacter through the optimized use of DNA polymerases in diagnostic real-time PCR

    DEFF Research Database (Denmark)

    Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer

    DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...

  12. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

    2005-01-01

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  13. Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

    Science.gov (United States)

    Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

    1995-06-01

    A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

  14. Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.

    Science.gov (United States)

    Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay

    2018-01-10

    Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.

  15. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

    2000-01-01

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  16. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    Science.gov (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  17. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  18. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  19. Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

    NARCIS (Netherlands)

    Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

    2002-01-01

    A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

  20. Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.

    OpenAIRE

    Gretch, D R; Wilson, J J; Carithers, R L; dela Rosa, C; Han, J H; Corey, L

    1993-01-01

    We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.

  1. Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog

    OpenAIRE

    ÖZKUL, Aykut

    2002-01-01

    In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

  2. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...

  3. Implementierung und Evaluierung eines tutoriell betreuten elektronischen Biochemie-Praktikumsversuchs "Polymerase-Kettenreaktion (PCR" im vorklinischen Studienabschnitt [Implementation and Evaluation of a Tutor-Supported Computer-Based Practical Biochemistry Course "Polymerase Chain Reaction (PCR" in Preclinical Education

    Directory of Open Access Journals (Sweden)

    Kröncke, Klaus-Dietrich

    2008-08-01

    Full Text Available [english] Background: The polymerase chain reaction (PCR is an example of a technology that for many medical students is not easy to understand. We investigated whether a tutor-supported e-learning teaching unit is suitable to teach undergraduate medical students the PCR. Methods: We developed a computer-based practical course (attendance is compulsory that uses an open source-based system as a learning platform. The students learned to search in scientific medical databases to find PCR-relevant data. In addition, they learned the essential features of the PCR with the aid of embedded textual information and audiovisual animations. To check that the learning objectives were fulfilled, the students had to solve medical-related PCR tasks on the computer. Results: In total, 311 students went through the course. They were satisfied with the e-learning teaching unit and evaluated it very positively, independently of their prior knowledge concerning the PCR. Students with low levels of computer skills did not feel over-challenged. Conclusion: Our results show that a computer-based practical training course is an excellent option for teaching undergraduate medical students complex technologies that could otherwise only be taught in a laboratory at great expense of time and effort. [german] Zielsetzung: Es sollte untersucht werden, ob ein E-Learning Praktikumsversuch geeignet ist, Medizin-Studierenden der Vorklinik die Polymerase-Kettenreaktion (PCR begreiflich zu machen. Methodik: Ein Computer-basierter Praktikumsversuch wurde entwickelt, der sowohl das Recherchieren in wissenschaftlich-medizinischen Datenbanken zum Auffinden von PCR-relevanten Informationen beinhaltet als auch Selbstlerneinheiten über die PCR. Als Lernzielkontrollen dienten Aufgaben aus der medizinischen PCR-Diagnostik. Die Akzeptanz der Lehrveranstaltung bei den Studierenden wurde mit einem Fragebogen ermittelt, der 19 Items enthielt. Ergebnisse: 311 Studierende absolvierten den

  4. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    International Nuclear Information System (INIS)

    Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie

    2009-01-01

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  5. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen

    2011-01-01

    Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...

  6. The diagnosis of microorganism involved in infective endocarditis (IE by polymerase chain reaction (PCR and real-time PCR: A systematic review

    Directory of Open Access Journals (Sweden)

    Reza Faraji

    2018-02-01

    Full Text Available Broad-range bacterial rDNA polymerase chain reaction (PCR followed by sequencing may be identified as the etiology of infective endocarditis (IE from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery.

  7. The diagnosis of microorganism involved in infective endocarditis (IE) by polymerase chain reaction (PCR) and real-time PCR: A systematic review.

    Science.gov (United States)

    Faraji, Reza; Behjati-Ardakani, Mostafa; Moshtaghioun, Seyed Mohammad; Kalantar, Seyed Mehdi; Namayandeh, Seyedeh Mahdieh; Soltani, Mohammadhossien; Emami, Mahmood; Zandi, Hengameh; Firoozabadi, Ali Dehghani; Kazeminasab, Mahmood; Ahmadi, Nastaran; Sarebanhassanabadi, Mohammadtaghi

    2018-02-01

    Broad-range bacterial rDNA polymerase chain reaction (PCR) followed by sequencing may be identified as the etiology of infective endocarditis (IE) from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery. Copyright © 2017. Published by Elsevier Taiwan.

  8. Miltenberger blood group typing by real-time polymerase chain reaction (qPCR) melting curve analysis in Thai population.

    Science.gov (United States)

    Vongsakulyanon, A; Kitpoka, P; Kunakorn, M; Srikhirin, T

    2015-12-01

    To develop reliable and convenient methods for Miltenberger (Mi(a) ) blood group typing. To apply real-time polymerase chain reaction (qPCR) melting curve analysis to Mi(a) blood group typing. The Mi(a) blood group is the collective set of glycophorin hybrids in the MNS blood group system. Mi(a+) blood is common among East Asians and is also found in the Thai population. Incompatible Mi(a) blood transfusions pose the risk of life-threatening haemolysis; therefore, Mi(a) blood group typing is necessary in ethnicities where the Mi(a) blood group is prevalent. One hundred and forty-three blood samples from Thai blood donors were used in the study. The samples included 50 Mi(a+) samples and 93 Mi(a-) samples, which were defined by serology. The samples were typed by Mi(a) typing qPCR, and 50 Mi(a+) samples were sequenced to identify the Mi(a) subtypes. Mi(a) subtyping qPCR was performed to define GP.Mur. Both Mi(a) typing and Mi(a) subtyping were tested on a conventional PCR platform. The results of Mi(a) typing qPCR were all concordant with serology. Sequencing of the 50 Mi(a+) samples revealed 47 GP.Mur samples and 3 GP.Hop or Bun samples. Mi(a) subtyping qPCR was the supplementary test used to further define GP.Mur from other Mi(a) subtypes. Both Mi(a) typing and Mi(a) subtyping performed well using a conventional PCR platform. Mi(a) typing qPCR correctly identified Mi(a) blood groups in a Thai population with the feasibility of Mi(a) subtype discrimination, and Mi(a) subtyping qPCR was able to further define GP.Mur from other Mi(a) subtypes. © 2015 British Blood Transfusion Society.

  9. Implementation of polymerase chain reaction (PCR and Real-Time PCR in quick identification of bovine herpesvirus 1

    Directory of Open Access Journals (Sweden)

    Milić Nenad

    2010-01-01

    Full Text Available Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these cell lines. The application of polymerize chain reaction (PCR using a primer for glucoprotein B and thymidine - kinasis, established the presence of bovine herpes virus 1 nucleic acid in one sample of a bovine nasal smear, while the presence of this virus was established in three samples in an examination of the nasal smear samples using the Real-Time PCR method.

  10. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes

    DEFF Research Database (Denmark)

    Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S.

    2018-01-01

    Background and aim: Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriace...

  11. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  12. Analytical Performance of Four Polymerase Chain Reaction (PCR and Real Time PCR (qPCR Assays for the Detection of Six Leishmania Species DNA in Colombia

    Directory of Open Access Journals (Sweden)

    Cielo M. León

    2017-10-01

    Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.

  13. Analytical Performance of Four Polymerase Chain Reaction (PCR) and Real Time PCR (qPCR) Assays for the Detection of Six Leishmania Species DNA in Colombia

    Science.gov (United States)

    León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.

    2017-01-01

    Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670

  14. Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR from sheep of Qom province, Iran

    Directory of Open Access Journals (Sweden)

    Abtin, A.R.

    2013-05-01

    Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.

  15. Qualitative and quantitative polymerase chain reaction (PCR) for detection of Leishmania in spleen samples from naturally infected dogs.

    Science.gov (United States)

    Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares

    2012-03-23

    Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic

  16. DETEKSI MENGGUNAKAN PCR (POLYMERASE CHAIN REACTION CANDIDATUS LIBERIBACTER ASIATICUS, PENYEBAB HUANGLONGBING PADA JERUK SIEM DENGAN BEBERAPA TIPE GEJALA PADA DAUN

    Directory of Open Access Journals (Sweden)

    Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.

    2011-11-01

    Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms.  Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354.  The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.

  17. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls

    OpenAIRE

    Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

    2010-01-01

    Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...

  18. Structure of a Complete Mediator-RNA Polymerase II Pre-Initiation Complex.

    Science.gov (United States)

    Robinson, Philip J; Trnka, Michael J; Bushnell, David A; Davis, Ralph E; Mattei, Pierre-Jean; Burlingame, Alma L; Kornberg, Roger D

    2016-09-08

    A complete, 52-protein, 2.5 million dalton, Mediator-RNA polymerase II pre-initiation complex (Med-PIC) was assembled and analyzed by cryo-electron microscopy and by chemical cross-linking and mass spectrometry. The resulting complete Med-PIC structure reveals two components of functional significance, absent from previous structures, a protein kinase complex and the Mediator-activator interaction region. It thereby shows how the kinase and its target, the C-terminal domain of the polymerase, control Med-PIC interaction and transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Detection of Vibrio spp. in shrimp from aquaculture sites in Iran using polymerase chain reaction (PCR)

    OpenAIRE

    Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy

    2014-01-01

    Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...

  20. The Role of Polymerase Chain Reaction (PCR in Diagnosis of Spine Tuberculosis after Pre-operative Anti-tuberculosis Treatment

    Directory of Open Access Journals (Sweden)

    AH Rasit

    2011-03-01

    Full Text Available OBJECTIVE: The aim of this study was to evaluate the role of polymerase chain reaction (PCR in the diagnosis of spinal tuberculosis after 2 weeks of preoperative anti-tuberculosis treatment and to compare PCR to the Löwenstein - Jensen Culture (LJC and histopathological examination (HPE methods. METHODS: Twenty-five patients were included in this study. Sixteen patients were diagnosed and treated for spinal tuberculosis based on clinical and radiological evidence. Nine patients were controls. The LJC method and HPE of the specimen were performed according to hospital protocol. PCR was performed using primer encoding insertion of sequences IS6110 for mycobacterium tuberculosis complex. Clinical findings and radiological features were the gold standard for comparison. RESULTS: PCR results were 15 positive and one negative. The sensitivity and specificity of PCR was 94% and 100% respectively (with 95% confidence interval [CI] 67% to 99% and 63% to 100%, respectively. HPE results showed 13 were positive and 3 negative in the spinal tuberculosis group; for the control group, all were negative. Sensitivity and specificity value of HPE was 82 % and 100% respectively (with 95% confidence interval [CI] 54% to 95% and 63% to 100%, respectively. Use of LJC showed only one was positive and 15 were negative in the spinal tuberculosis group whole all nine in the control group were negative. Sensitivity and specificity value of LJC was 6% and 100% respectively (with 95% confidence interval [CI] 0.3% to 32% and 63% to 100%, respectively. CONCLUSION: Our findings showed that the PCR for Mycobacterium tuberculosis is reliable as a method for diagnosis of spinal tuberculosis, even after of 2 weeks of anti-TB treatment, with an overall sensitivity of 94% and specificity of 100%.

  1. Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR

    Directory of Open Access Journals (Sweden)

    Adrián Ruiz-Villalba

    2017-12-01

    Full Text Available Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated to Cq or PCR efficiency values. Titration experiments showed that the occurrence of low and high melting temperature artifacts was shown to be determined by annealing temperature, primer concentration and cDNA input. To explore the range of input variations that occur in the normal use of the Cre assay these conditions were mimicked in a complete two-way design of template −plasmid DNA- and non-template −mouse cDNA- concentrations. These experiments showed that the frequency of the amplification of the correct product and the artifact, as well as the valid quantification of the correct product, depended on the concentration of the non-template cDNA. This finding questions the interpretation of dilution series in which template as well as non-template concentrations are simultaneously decreasing. Repetition of this cDNA concentration experiment with other templates revealed that exact reproduction qPCR experiments was affected by the time it takes to complete the pipetting of a qPCR plate. Long bench times were observed to lead to significantly more artifacts. However, the measurement of artifact-associated fluorescence can be avoided by inclusion of a small heating step after the elongation phase in the amplification protocol. Taken together, this trouble-shooting journey showed that reliability and reproducibility of qPCR experiments not only depends on standardization and reporting of the biochemistry and technical aspects but also on hitherto neglected factors as sample dilution and waiting times in the laboratory work flow. Keywords: RT-qPCR, Melting curve analysis, Reaction parameters, Artifacts

  2. Ligation-mediated PCR with a back-to-back adapter reduces amplification bias resulting from variations in GC content.

    Science.gov (United States)

    Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi

    2017-08-15

    Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli

    International Nuclear Information System (INIS)

    Dorson, J.W.; Moses, R.E.

    1978-01-01

    DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair

  4. Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR)

    NARCIS (Netherlands)

    Ruiz-Villalba, Adrián; van Pelt-Verkuil, Elizabeth; Gunst, Quinn D.; Ruijter, Jan M.; van den Hoff, Maurice J. B.

    2017-01-01

    Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated

  5. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N

    1995-01-01

    (ASA) method, which together recognise eight alleles. In 146 unrelated Danish individuals, the HLA-DQA1 alleles were in Hardy-Weinberg equilibrium. For identity testing, the power of discrimination (PD) of HLA-DQA1 was 0.932 with the RDB method and 0.942 with the PCR-RFLP/ASA method. For paternity...

  6. KONSTRUKSI MUTAN PROTEIN FOSFATASE ptc2D Saccharomyces cerevisiae DENGAN METODE PENGGANTIAN GEN TARGET DENGAN POLYMERASE CHAIN REACTION (PCR

    Directory of Open Access Journals (Sweden)

    Hermansyah

    2011-05-01

    Full Text Available Yeast Saccharomyces cerevisiae is an excellent model to studi genes function of eukarotic cells such as study of gene encoding protein phosphatase PTC2. Novel phenotypic caused by mutated gene is an important step to study function of gene. In this study constructed mutant of PTC2 gene encoding protein phosphatase. Method that used in this construction was replacement of target gene (PTC2 with auxotroph marker Candida albicans HIS3 by Polymer Chain Reaction (PCR or called by PCR-mediated disruption. Mutant colonies which grew in selective medium SC without histidine were confirmed by PCR amplification. By using 1% Agarose gel electrophoresis the result showed that size of ptc2D::CgHIS3 transformant was 3.52 kb while wild type strain was 2.9 kb, indicated that ptc2D::CgHIS3 has integrated on chromosome V replacing PTC2 wild type.

  7. Opisthorchis viverrini: Detection by polymerase chain reaction (PCR) in human stool samples

    Digital Repository Service at National Institute of Oceanography (India)

    Umesha, K.R.; SanathKumar; Parvathi, A.; Duenngai, K.; Sithithaworn, P.; Karunasagar, Indrani; Karunasagar, Iddya

    Journal of Tropical Medicine and Public Health 22 (Suppl.), 174–178. Duenngai, K., Sithithaworn, P., Rudrappa, U.K., Karunasagar, I., Laha, T., Stensvold, C.R., Strandgaard, H., Johansen, M.V., 2008. Improvement of PCR for detection of Opisthrochis... and lecithodendriid trematodes. Southeast Asian Journal of Tropical Medicine and Public Health 22, 623–630. Kobayashi, J., Vannachone, B., Sato, Y., Manivong, K., Nambanya, S., Inthakone, S., 2000. An epidemiological study on Opisthorchis viverrini infection in Lao...

  8. Architecture of the RNA polymerase II-Mediator core initiation complex.

    Science.gov (United States)

    Plaschka, C; Larivière, L; Wenzeck, L; Seizl, M; Hemann, M; Tegunov, D; Petrotchenko, E V; Borchers, C H; Baumeister, W; Herzog, F; Villa, E; Cramer, P

    2015-02-19

    The conserved co-activator complex Mediator enables regulated transcription initiation by RNA polymerase (Pol) II. Here we reconstitute an active 15-subunit core Mediator (cMed) comprising all essential Mediator subunits from Saccharomyces cerevisiae. The cryo-electron microscopic structure of cMed bound to a core initiation complex was determined at 9.7 Å resolution. cMed binds Pol II around the Rpb4-Rpb7 stalk near the carboxy-terminal domain (CTD). The Mediator head module binds the Pol II dock and the TFIIB ribbon and stabilizes the initiation complex. The Mediator middle module extends to the Pol II foot with a 'plank' that may influence polymerase conformation. The Mediator subunit Med14 forms a 'beam' between the head and middle modules and connects to the tail module that is predicted to bind transcription activators located on upstream DNA. The Mediator 'arm' and 'hook' domains contribute to a 'cradle' that may position the CTD and TFIIH kinase to stimulate Pol II phosphorylation.

  9. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  10. The Mediator Complex: At the Nexus of RNA Polymerase II Transcription.

    Science.gov (United States)

    Jeronimo, Célia; Robert, François

    2017-10-01

    Mediator is an essential, large, multisubunit, transcriptional co-activator highly conserved across eukaryotes. Mediator interacts with gene-specific transcription factors at enhancers as well as with the RNA polymerase II (RNAPII) transcription machinery bound at promoters. It also interacts with several other factors involved in various aspects of transcription, chromatin regulation, and mRNA processing. Hence, Mediator is at the nexus of RNAPII transcription, regulating its many steps and connecting transcription with co-transcriptional events. To achieve this flexible role, Mediator, which is divided into several functional modules, reorganizes its conformation and composition while making transient contacts with other components. Here, we review the mechanisms of action of Mediator and propose a unifying model for its function. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. PCR (Polymerase Chain Reaction) Assay On Antibiotics Resistant Clinical Isolates Of Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    R, Maria Lina; S, Dadang; Suhadi, F.

    2000-01-01

    To detect to DNA of 9 drug-resistant isolates of m. tuberculosis such as isoniazid, streptomycin, isoniazid + streptomycin and isoniazid + rifampisin- resistant isolates, the DNA amplification by using PCR assay was carried out after lysing the bacterial cells. Two primer pairs for amplification used were Pt8 and Pt9 and Pt3 and Pt6. The amplified DNA taeget of 8 drug-resistant isolates and 1 drug-resistant isolate by means Pt8 8 Pt9 primer, gave the positive and negative result, respectively. Presence of amplified DNA target fragmens/bands on agarose gel, showed the positive result and vice verse. PCR process by using Pt3 and Pt6 primer revealed the positive results on 2 drug-resistant islates, whereas there was no amplified DNA bands from the other 7 isolates. DNA amplification by using either Pt8 and Pt9 or Pt3 and Pt6 primers occurred on H sub.37Rv strain DNA. Size of the amplified DNA products with Pt8 and Pt9 and Pt3 and Pt6 primers were 541 bp and 188 bp, respectively

  12. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    Science.gov (United States)

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  13. The cyclin-dependent kinase 8 module sterically blocks Mediator interactions with RNA polymerase II

    DEFF Research Database (Denmark)

    Elmlund, Hans; Baraznenok, Vera; Lindahl, Martin

    2006-01-01

    CDK8 (cyclin-dependent kinase 8), along with CycC, Med12, and Med13, form a repressive module (the Cdk8 module) that prevents RNA polymerase II (pol II) interactions with Mediator. Here, we report that the ability of the Cdk8 module to prevent pol II interactions is independent of the Cdk8......-dependent kinase activity. We use electron microscopy and single-particle reconstruction to demonstrate that the Cdk8 module forms a distinct structural entity that binds to the head and middle region of Mediator, thereby sterically blocking interactions with pol II....

  14. Identification of trypanosomes in wild animals from Southern Cameroon using the polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Herder S.

    2002-12-01

    Full Text Available One possible explanation of the maintenance of many historical foci of sleeping sickness in Central Africa could be the existence of a wild animal reservoir. In this study, PCR was used to detect the different trypanosome species present in wild animal captured by hunters in the southern forest belt of Cameroon (Bipindi. Trypanosomes were also detected by a parasitological method (Quantitative buffy coat : QBC. Parasite could not be isolated in culture medium (Kit for in vitro isolation : KIVI. Specific primers of T. brucei s.l., T. congolense forest type, T. congolense savannah type, T. vivax, T. simiae and T. b. gambiense group 1 were used to identify parasites in the blood of 164 animals belonging to 24 different species including ungulates, rodents, pangolins, carnivores, reptiles and primates. Of the 24 studied species, eight were carrying T. b. gambiense group 1. Those parasites pathogenic to man were found in monkeys (Cercocebus torquatus and Cercopithecus nictitans, in ungulates (Cephalophus dorsalis and C. monticola, in carnivores (Nandinia binotata and Genetta servalina and in rodents (Cricetomys gambianus and Atherurus africanus. 13 species (54 % were carrying T. brucei s.l. identified as non-gambiense group 1.

  15. A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

  16. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

    2013-01-01

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

  17. Genome-wide association of mediator and RNA polymerase II in wild-type and mediator mutant yeast.

    Science.gov (United States)

    Paul, Emily; Zhu, Z Iris; Landsman, David; Morse, Randall H

    2015-01-01

    Mediator is a large, multisubunit complex that is required for essentially all mRNA transcription in eukaryotes. In spite of the importance of Mediator, the range of its targets and how it is recruited to these is not well understood. Previous work showed that in Saccharomyces cerevisiae, Mediator contributes to transcriptional activation by two distinct mechanisms, one depending on the tail module triad and favoring SAGA-regulated genes, and the second occurring independently of the tail module and favoring TFIID-regulated genes. Here, we use chromatin immunoprecipitation sequencing (ChIP-seq) to show that dependence on tail module subunits for Mediator recruitment and polymerase II (Pol II) association occurs preferentially at SAGA-regulated over TFIID-regulated genes on a genome-wide scale. We also show that recruitment of tail module subunits to active gene promoters continues genome-wide when Mediator integrity is compromised in med17 temperature-sensitive (ts) yeast, demonstrating the modular nature of the Mediator complex in vivo. In addition, our data indicate that promoters exhibiting strong and stable occupancy by Mediator have a wide range of activity and are enriched for targets of the Tup1-Cyc8 repressor complex. We also identify a number of strong Mediator occupancy peaks that overlap dubious open reading frames (ORFs) and are likely to include previously unrecognized upstream activator sequences. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    Science.gov (United States)

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  19. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  20. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    Science.gov (United States)

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  1. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  2. Application of PCR-mediated DNA typing in the molecular epidemiology of medically important microorganisms

    NARCIS (Netherlands)

    A.F. van Belkum (Alex)

    1996-01-01

    textabstractThis thesis describes the development, application and validation of the newer DNA analysis techniques within the field of microbiological epidemiology. Emphasis is placed on the use of the polymerase chain reaction (PCR), a test-tube technique enabling the amplification of (parts of)

  3. pcr

    African Journals Online (AJOL)

    DR. AMINU

    Keywords: Polymerase chain reaction, Diagnosis, Bacteria, Infections. INTRODUCTION ... used to amplify a piece of DNA by in-vitro enzymatic replication (David and .... receiving antimicrobial treatment, or when the causative agents are small ...

  4. The TEL-AML1 real-time quantitative polymerase chain reaction (PCR) might replace the antigen receptor-based genomic PCR in clinical minimal residual disease studies in children with acute lymphoblastic leukaemia

    NARCIS (Netherlands)

    de Haas, V.; Breunis, W. B.; dee, R.; Verhagen, O. J. H. M.; Kroes, W.; van Wering, E. R.; van Dongen, J. J. M.; van den Berg, H.; van der Schoot, C. E.

    2002-01-01

    Prospective studies in children with B-precursor acute lymphoblastic leukaemia (ALL) have shown that polymerase chain reaction (PCR)-based detection of minimal residual disease (MRD) using immunoglobin (Ig) and T-cell receptor (TCR) gene rearrangements as targets can be used to identify patients

  5. Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

    DEFF Research Database (Denmark)

    Atabay, H. I.; Bang, Dang Duong; Aydin, F.

    2002-01-01

    Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used...... to detect polymorphism within the isolates. Eleven distinct DNA profiles were obtained as follows: Of the 35 strains, 10 as profile 4; seven as profile 1; five as profile 3; three as profiles 2 and 9; two as profile 10; one as profiles 5, 6, 7, 8 and 11. Conclusions: Chicken carcasses sold in markets were...... found to be contaminated with several different strains of A. butzleri . RAPD-PCR technique was found to be a useful technique for distinguishing A. butzleri isolates. Significance and Impact of the Study: The presence of several different A. butzleri strains on chicken carcasses may indicate multiple...

  6. Cloning-free genome alterations in Saccharomyces cerevisiae using adaptamer-mediated PCR

    DEFF Research Database (Denmark)

    Reid, Robert J D; Lisby, Michael; Rothstein, Rodney

    2002-01-01

    . Furthermore, many of the techniques described here rely on preexisting and commercially available adaptamer sets that can be obtained inexpensively rather than designing new primers for every experiment. Although a cost is incurred when performing multiple PCR amplifications, the increase in recombination...... efficiency is dramatic. Finally, the adaptamer-mediated PCR fusion methodology is versatile and can be applied to varied genome manipulations....

  7. Detection of Phakopsora pachyrhizi fungus by Polymerase Chain Reaction technique (PCR) after soy grains treatment by electron beams

    International Nuclear Information System (INIS)

    Fanaro, G.B.; Aquino, S.; Guedes, R.L.; Crede, R.G.; Sabundjian, I.T.; Ruiz, M.O.; Villavicencio, A.L.C.H.

    2005-01-01

    Today Brazil, as the largest soy exporter in the world, has undergone the consequences of the contamination of these crops by the Asian dust fungus, being harmed since the plantation up to the harvest, with losses in its productivity ranging 10-80%. As it is a new disease in the Americas, there are not any resistant species to this fungus attack. The grains contamination harms the exportation for countries which do not want to have their crops contaminated, affecting therefore the international commerce and agro-business relationship with those countries Brazil has trade with. The Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is of difficult control, since occurs through the wind dispersion. The P. pachyrhizi is an Asian fungus and was recently found in South Africa, Paraguay, Argentina and Brazil. As an alternative process to minimize these losses is the process to preserve the grains by radiation, the use of the electron accelerator was indicated, since its advantage for the grains exportation industry is fundamental. Besides the possibility of being disconnected when not in use, this source does not need to be recharged, is easily available and has high dose rate, streamlining the process and reducing logistics costs. The present work aims to identify, by the Polymerase Chain Reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soy grains, at doses 1 and 2 kGy, at the IPEN-CNEN electron Accelerator, a Dynamitron Machine (Radiation Dynamics Co. model JOB, New York, USA), with 1.5 MeV power and 2.5 mA electrical current. (author)

  8. A disposable laser print-cut-laminate polyester microchip for multiplexed PCR via infra-red-mediated thermal control

    International Nuclear Information System (INIS)

    Ouyang, Yiwen; Duarte, Gabriela R.M.; Poe, Brian L.; Riehl, Paul S.; Santos, Fernando M. dos; Martin-Didonet, Claudia C.G.; Carrilho, Emanuel; Landers, James P.

    2015-01-01

    Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s −1 with a cooling rate of roughly −12 ± 0.9 °C s −1 assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low-volume amplification

  9. Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

    NARCIS (Netherlands)

    Ursi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, H

    PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No

  10. Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

    NARCIS (Netherlands)

    Ursi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, H

    1994-01-01

    PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No

  11. Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

    Science.gov (United States)

    Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

    2013-05-30

    Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

  12. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nagorsen Dirk

    2003-12-01

    Full Text Available Abstract The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV and Influenza (Flu, were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ, Interleukin-2 (IL-2, Interleukin-4 (IL-4, and Interleukin-10 (IL-10. We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization.

  13. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR)

    Science.gov (United States)

    Provenzano, Maurizio; Mocellin, Simone; Bonginelli, Paola; Nagorsen, Dirk; Kwon, Seog-Woon; Stroncek, David

    2003-01-01

    The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA) polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs) from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV) and Influenza (Flu), were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR) was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ), Interleukin-2 (IL-2), Interleukin-4 (IL-4), and Interleukin-10 (IL-10). We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization. PMID:14675481

  14. Clinical profile of uveitis in Hansen’s disease after completion of treatment – A study of 50 cases using Polymerase Chain Reaction (PCR on aqueous humour

    Directory of Open Access Journals (Sweden)

    Radha Annamalai

    2016-05-01

    Full Text Available Chronic low grade anterior uveitis is the commonest cause of blindness in leprosy. It is usually asymptomatic until the late stages and patients seek help only after irreversible visual loss. We analysed patients who had a recurrence of uveitis after completion of treatment with anti-leprosy drugs and had been proven as histopathologically negative. The presence of chronic uveitis, complications and the extent of ocular damage it may cause, can continue even after treatment, emphasising the importance of follow-up, early detection and treatment. This is a prospective cohort study. Ophthalmic evaluation was performed using slit lamp examination, biomicroscopy, indirect ophthalmoscopy, applanation tonometry, corneal sensation and Schirmer’s test. Split skin microscopy was done to confirm the activity of leprosy. In patients with recalcitrant iridocyclitis, anterior chamber paracentesis was performed. The sample was analysed both by smear and polymerase chain reaction. The sequences that were targeted using PCR included genes encoding the DNA of 36-kDa antigen, 18-kDa antigen, 65-kDa antigen and the repetitive sequences among other M. leprae genes. Aqueous aspirate showed copies of mycobacterium leprae DNA in five out of twelve patients with recalcitrant anterior uveitis. Direct smear and staining with Ziehl- Neelson staining for mycobacteria was positive showing both live and dead bacilli. Live bacilli can persist in the aqueous humour even after completion of treatment. In our study this was more frequently observed in tuberculoid leprosy. This is possibly due to an immune mediated response combined with inadequate treatment dose in these patients.

  15. Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Silvia Cristina Osaki

    2013-06-01

    Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

  16. FlindersTechnology Associates (FTA) filter paper-based DNA extraction with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii from respiratory specimens of immunocompromised patients.

    Science.gov (United States)

    Nuchprayoon, Surang; Saksirisampant, Wilai; Jaijakul, Siraya; Nuchprayoon, Issarang

    2007-01-01

    We evaluated the diagnostic value of Flinders Technology Associates (FTA) filter paper together with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii (carinii) from induced sputum (IS) and bronchoalveolar lavage fluid (BALF) samples. The study involved 162 patients with clinical diagnosis of pneumocystis pneumonia (PcP) of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) patients and other immunocompromised patients. P. jirovecii cysts or trophozoites were detected in IS and BALF by cytological method. The mitochondrial 5S ribosomal ribonucleic acid (rRNA) gene of P. jirovecii was amplified from these samples by using FTA filters together with a one-step PCR method (FTA-PCR). With the FTA-PCR method, the sensitivity and specificity of the test compared to microscopic examination were 67% and 90% for IS, while they were 67% and 91% for BALF, respectively. The sensitivity and specificity of the FTA-PCR test was also comparable to PCR with the conventional deoxyribonucleic acid (DNA) extraction method. We concluded that FTA-PCR is useful to detect P. jirovecii in noninvasive IS.

  17. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR technique among various cell types of bulls

    Directory of Open Access Journals (Sweden)

    Carroll Bernie

    2010-03-01

    Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic

  18. Pyrovanadolysis: a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate MN2plus and DNA Polymerase of Bacteriophage T7

    Energy Technology Data Exchange (ETDEWEB)

    B Akabayov; A Kulczyk; S Akabayov; C Thiele; L McLaughlin; B Beauchamp; C Richardson

    2011-12-31

    DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PP{sub i}). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry of the oxygen connecting the two phosphorus atoms of PP{sub i}, a variety of compounds was examined for their ability to carry out a reaction similar to pyrophosphorolysis. We describe a manganese-mediated pyrophosphorolysis-like activity using pyrovanadate (VV) catalyzed by the DNA polymerase of bacteriophage T7. We designate this reaction pyrovanadolysis. X-ray absorption spectroscopy reveals a shorter Mn-V distance of the polymerase-VV complex than the Mn-P distance of the polymerase-PP{sub i} complex. This structural arrangement at the active site accounts for the enzymatic activation by Mn-VV. We propose that the Mn{sup 2+}, larger than Mg{sup 2+}, fits the polymerase active site to mediate binding of VV into the active site of the polymerase. Our results may be the first documentation that vanadium can substitute for phosphorus in biological processes.

  19. Detection of early and single infections of Schistosoma japonicum in the intermediate host snail, Oncomelania hupensis, by PCR and loop-mediated isothermal amplification (LAMP) assay.

    Science.gov (United States)

    Kumagai, Takashi; Furushima-Shimogawara, Rieko; Ohmae, Hiroshi; Wang, Tian-Ping; Lu, Shaohong; Chen, Rui; Wen, Liyong; Ohta, Nobuo

    2010-09-01

    Polymerase chain reaction (PCR) with the specific primer set amplifying 28S ribosomal DNA (rDNA) of Schistosoma japonicum was able to detect genomic DNA of S. japonicum, but not S. mansoni, at 100 fg. This procedure enabled us to detect the DNA from a single miracidium and a snail infected with one miracidium at just 1 day after infection. We compared these results with those from loop-mediated isothermal amplification (LAMP) targeting 28S rDNA and found similar results. The LAMP could amplify the specific DNA from a group of 100 normal snails mixed with one infected snail A PCR screening of infected snails from endemic regions in Anhui Province revealed schistosomal DNA even in snails found negative by microscopy. PCR and LAMP show promise for monitoring the early infection rate in snails, and they may be useful for predicting the risk of infection in the endemic places.

  20. Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

    Science.gov (United States)

    Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

    2015-01-01

    Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and

  1. Role for the MED21-MED7 Hinge in Assembly of the Mediator-RNA Polymerase II Holoenzyme*

    Science.gov (United States)

    Sato, Shigeo; Tomomori-Sato, Chieri; Tsai, Kuang-Lei; Yu, Xiaodi; Sardiu, Mihaela; Saraf, Anita; Washburn, Michael P.; Florens, Laurence; Asturias, Francisco J.; Conaway, Ronald C.

    2016-01-01

    Mediator plays an integral role in activation of RNA polymerase II (Pol II) transcription. A key step in activation is binding of Mediator to Pol II to form the Mediator-Pol II holoenzyme. Here, we exploit a combination of biochemistry and macromolecular EM to investigate holoenzyme assembly. We identify a subset of human Mediator head module subunits that bind Pol II independent of other subunits and thus probably contribute to a major Pol II binding site. In addition, we show that binding of human Mediator to Pol II depends on the integrity of a conserved “hinge” in the middle module MED21-MED7 heterodimer. Point mutations in the hinge region leave core Mediator intact but lead to increased disorder of the middle module and markedly reduced affinity for Pol II. These findings highlight the importance of Mediator conformation for holoenzyme assembly. PMID:27821593

  2. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  3. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.

    1999-01-01

    . salmonicida subsp. salmonicida isolates tested, belonged to group 1. The PCR primer-sets separated A. salmonicida from other reference strains of Aeromonas species and related bacteria with the exception of Aeromonas hydrophila. The results indicated that PCR typing is a useful framework for characterization...

  4. Detection of Hepatitis B Virus (HBV) in Blood Serum By Means of PCR (Polymerase Chain Reaction) Technique

    International Nuclear Information System (INIS)

    Lina, M.; Dadang, S.; Suhadi, F.

    2002-01-01

    Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer

  5. Real-time PCR-based genotyping from whole blood using Taq DNA polymerase and a buffer supplemented with 1,2-propanediol and trehalose

    Czech Academy of Sciences Publication Activity Database

    Utekal, Pavol; Kocanda, Lukáš; Matoušek, P.; Wagner, P.; Bugajev, Viktor; Dráber, Petr

    2015-01-01

    Roč. 416, January (2015), s. 178-182 ISSN 0022-1759 R&D Projects: GA ČR(CZ) GBP302/12/G101; GA MPO FR-TI3/067; GA ČR(CZ) GA14-09807S; GA ČR(CZ) GA14-00703S Institutional support: RVO:68378050 Keywords : 1,2-Propanediol * real-time PCR * SYBR Green I * Taq DNA polymerase * trehalose * Unseparated blood Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.858, year: 2015

  6. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea

    KAUST Repository

    Takahashi, Masateru; Takahashi, Etsuko; Joudeh, Luay I.; Marini, Monica; Das, Gobind; Elshenawy, Mohamed; Akal, Anastassja; Sakashita, Kosuke; Alam, Intikhab; Tehseen, Muhammad; Sobhy, Mohamed Abdelmaboud; Stingl, Ulrich; Merzaban, Jasmeen; Di Fabrizio, Enzo M.; Hamdan, Samir

    2018-01-01

    The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein’s surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.—Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

  7. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

    Science.gov (United States)

    Takahashi, Masateru; Takahashi, Etsuko; Joudeh, Luay I; Marini, Monica; Das, Gobind; Elshenawy, Mohamed M; Akal, Anastassja; Sakashita, Kosuke; Alam, Intikhab; Tehseen, Muhammad; Sobhy, Mohamed A; Stingl, Ulrich; Merzaban, Jasmeen S; Di Fabrizio, Enzo; Hamdan, Samir M

    2018-01-24

    The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein's surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.-Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

  8. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea

    KAUST Repository

    Takahashi, Masateru

    2018-01-24

    The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein’s surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.—Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

  9. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2014-10-01

    Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  10. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

    Science.gov (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-10-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  11. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    Science.gov (United States)

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  12. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

    1995-01-01

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  13. Characterization of family IV UDG from Aeropyrum pernix and its application in hot-start PCR by family B DNA polymerase.

    Directory of Open Access Journals (Sweden)

    Xi-Peng Liu

    Full Text Available Recombinant uracil-DNA glycosylase (UDG from Aeropyrum pernix (A. pernix was expressed in E. coli. The biochemical characteristics of A. pernix UDG (ApeUDG were studied using oligonucleotides carrying a deoxyuracil (dU base. The optimal temperature range and pH value for dU removal by ApeUDG were 55-65°C and pH 9.0, respectively. The removal of dU was inhibited by the divalent ions of Zn, Cu, Co, Ni, and Mn, as well as a high concentration of NaCl. The opposite base in the complementary strand affected the dU removal by ApeUDG as follows: U/C≈U/G>U/T≈U/AP≈U/->U/U≈U/I>U/A. The phosphorothioate around dU strongly inhibited dU removal by ApeUDG. Based on the above biochemical characteristics and the conservation of amino acid residues, ApeUDG was determined to belong to the IV UDG family. ApeUDG increased the yield of PCR by Pfu DNA polymerase via the removal of dU in amplified DNA. Using the dU-carrying oligonucleotide as an inhibitor and ApeUDG as an activator of Pfu DNA polymerase, the yield of undesired DNA fragments, such as primer-dimer, was significantly decreased, and the yield of the PCR target fragment was increased. This strategy, which aims to amplify the target gene with high specificity and yield, can be applied to all family B DNA polymerases.

  14. A disposable laser print-cut-laminate polyester microchip for multiplexed PCR via infra-red-mediated thermal control

    Energy Technology Data Exchange (ETDEWEB)

    Ouyang, Yiwen [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Duarte, Gabriela R.M. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Universidade Federal de Goiás, Goiânia, GO 74690-900 (Brazil); Poe, Brian L.; Riehl, Paul S. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Santos, Fernando M. dos; Martin-Didonet, Claudia C.G. [Universidade Estadual de Goiás, Anápolis, GO 75132-400 (Brazil); Carrilho, Emanuel [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos, SP 13566-590 (Brazil); Instituto Nacional de Ciência e Tecnologia de Bioanalítica, CP 6154, Campinas, SP 13083-970 (Brazil); Landers, James P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia Health Science Center, Charlottesville, VA (United States)

    2015-12-11

    Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s{sup −1} with a cooling rate of roughly −12 ± 0.9 °C s{sup −1} assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low

  15. Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

    Science.gov (United States)

    Rozi; Rahayu, K.; Daruti, D. N.

    2018-04-01

    The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

  16. Cost-effective optimization of real-time PCR based detection of Campylobacter and Salmonella with inhibitor tolerant DNA polymerases

    DEFF Research Database (Denmark)

    Fachmann, Mette Sofie Rousing; Josefsen, Mathilde Hasseldam; Hoorfar, Jeffrey

    2015-01-01

    bacterial cells in two validated real-time PCR assays for Campylobacter and Salmonella. The five best performing (based on: limit of detection (LOD), maximum fluorescence, shape of amplification curves, and amplification efficiency) were subsequently applied to meat and fecal samples. The VeriQuest q......PCR master mix performed best for both meat and fecal samples (LODs of 102 and 104 CFU ml-1 in the purest and crudest DNA extractions, respectively) compared with Tth (LOD=102 -103 and 105 -106 CFU ml-1 ). AmpliTaqGold and HotMasterTaq both performed well (LOD=102 -104 CFU ml-1 ) with meat samples and poorly...... (LOD=103 -106 CFU ml-1 /not detected) with fecal samples. CONCLUSIONS: Applying the VeriQuest qPCR master mix in the two tested real-time PCR assays could allow for simpler sample preparation and thus a reduction in cost. SIGNIFICANCE AND IMPACT OF STUDY: This work exemplifies a cost-effective strategy...

  17. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  18. Use of length heterogeneity polymerase chain reaction (LH-PCR as non-invasive approach for dietary analysis of Svalbard reindeer, Rangifer tarandus platyrhynchus.

    Directory of Open Access Journals (Sweden)

    Sungbae Joo

    Full Text Available To efficiently investigate the forage preference of Svalbard reindeer (Rangifer tarandus platyrhynchus, we applied length-heterogeneity polymerase chain reaction (LH-PCR based on length differences of internal transcribed spacer (ITS regions of ribosomal RNA (rRNA to fecal samples from R. tarandus platyrhynchus. A length-heterogeneity (LH database was constructed using both collected potential food sources of Svalbard reindeer and fecal samples, followed by PCR, cloning and sequencing. In total, eighteen fecal samples were collected between 2011 and 2012 from 2 geographic regions and 15 samples were successfully amplified by PCR. The LH-PCR analysis detected abundant peaks, 18.6 peaks on an average per sample, ranging from 100 to 500 bp in size and showing distinct patterns associated with both regions and years of sample collection. Principal component analysis (PCA resulted in clustering of 15 fecal samples into 3 groups by the year of collection and region with a statistically significant difference at 99.9% level. The first 2 principal components (PCs explained 71.1% of the total variation among the samples. Through comparison with LH database and identification by cloning and sequencing, lichens (Stereocaulon sp. and Ochrolechia sp. and plant species (Salix polaris and Saxifraga oppositifolia were detected as the food sources that contributed most to the Svalbard reindeer diet. Our results suggest that the use of LH-PCR analysis would be a non-invasive and efficient monitoring tool for characterizing the foraging strategy of Svalbard reindeer. Additionally, combining sequence information would increase its resolving power in identification of foraged diet components.

  19. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  20. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  1. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  2. Compartmentalized self-replication under fast PCR cycling conditions yields Taq DNA polymerase mutants with increased DNA-binding affinity and blood resistance.

    Science.gov (United States)

    Arezi, Bahram; McKinney, Nancy; Hansen, Connie; Cayouette, Michelle; Fox, Jeffrey; Chen, Keith; Lapira, Jennifer; Hamilton, Sarah; Hogrefe, Holly

    2014-01-01

    Faster-cycling PCR formulations, protocols, and instruments have been developed to address the need for increased throughput and shorter turn-around times for PCR-based assays. Although run times can be cut by up to 50%, shorter cycle times have been correlated with lower detection sensitivity and increased variability. To address these concerns, we applied Compartmentalized Self Replication (CSR) to evolve faster-cycling mutants of Taq DNA polymerase. After five rounds of selection using progressively shorter PCR extension times, individual mutations identified in the fastest-cycling clones were randomly combined using ligation-based multi-site mutagenesis. The best-performing combinatorial mutants exhibit 35- to 90-fold higher affinity (lower Kd ) for primed template and a moderate (2-fold) increase in extension rate compared to wild-type Taq. Further characterization revealed that CSR-selected mutations provide increased resistance to inhibitors, and most notably, enable direct amplification from up to 65% whole blood. We discuss the contribution of individual mutations to fast-cycling and blood-resistant phenotypes.

  3. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus

    OpenAIRE

    Wong Min-Liang; Hsu Tien-Huan; Lin Fong-Yuan; Lin Kuan-Hsun; Chiou Shyan-Song; Wang Chi-Young; Lee Min-Shiuh; Chulakasian Songkhla; Chang Tien-Jye; Hsu Wei-Li

    2010-01-01

    Abstract Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hen...

  4. Development of a high-throughput real time PCR based on a hot-start alternative for Pfu mediated by quantum dots

    Science.gov (United States)

    Sang, Fuming; Yang, Yang; Yuan, Lin; Ren, Jicun; Zhang, Zhizhou

    2015-09-01

    Hot start (HS) PCR is an excellent alternative for high-throughput real time PCR due to its ability to prevent nonspecific amplification at low temperature. Development of a cost-effective and simple HS PCR technique to guarantee high-throughput PCR specificity and consistency still remains a great challenge. In this study, we systematically investigated the HS characteristics of QDs triggered in real time PCR with EvaGreen and SYBR Green I dyes by the analysis of amplification curves, standard curves and melting curves. Two different kinds of DNA polymerases, Pfu and Taq, were employed. Here we showed that high specificity and efficiency of real time PCR were obtained in a plasmid DNA and an error-prone two-round PCR assay using QD-based HS PCR, even after an hour preincubation at 50 °C before real time PCR. Moreover, the results obtained by QD-based HS PCR were comparable to a commercial Taq antibody DNA polymerase. However, no obvious HS effect of QDs was found in real time PCR using Taq DNA polymerase. The findings of this study demonstrated that a cost-effective high-throughput real time PCR based on QD triggered HS PCR could be established with high consistency, sensitivity and accuracy.Hot start (HS) PCR is an excellent alternative for high-throughput real time PCR due to its ability to prevent nonspecific amplification at low temperature. Development of a cost-effective and simple HS PCR technique to guarantee high-throughput PCR specificity and consistency still remains a great challenge. In this study, we systematically investigated the HS characteristics of QDs triggered in real time PCR with EvaGreen and SYBR Green I dyes by the analysis of amplification curves, standard curves and melting curves. Two different kinds of DNA polymerases, Pfu and Taq, were employed. Here we showed that high specificity and efficiency of real time PCR were obtained in a plasmid DNA and an error-prone two-round PCR assay using QD-based HS PCR, even after an hour

  5. SAF-A forms a complex with BRG1 and both components are required for RNA polymerase II mediated transcription.

    Directory of Open Access Journals (Sweden)

    Dzeneta Vizlin-Hodzic

    Full Text Available BACKGROUND: Scaffold attachment factor A (SAF-A participates in the regulation of gene expression by organizing chromatin into transcriptionally active domains and by interacting directly with RNA polymerase II. METHODOLOGY: Here we use co-localization, co-immunoprecipitation (co-IP and in situ proximity ligation assay (PLA to identify Brahma Related Gene 1 (BRG1, the ATP-driven motor of the human SWI-SNF chromatin remodeling complex, as another SAF-A interaction partner in mouse embryonic stem (mES cells. We also employ RNA interference to investigate functional aspects of the SAF-A/BRG1 interaction. PRINCIPAL FINDINGS: We find that endogenous SAF-A protein interacts with endogenous BRG1 protein in mES cells, and that the interaction does not solely depend on the presence of mRNA. Moreover the interaction remains intact when cells are induced to differentiate. Functional analyses reveal that dual depletion of SAF-A and BRG1 abolishes global transcription by RNA polymerase II, while the nucleolar RNA polymerase I transcription machinery remains unaffected. CONCLUSIONS: We demonstrate that SAF-A interacts with BRG1 and that both components are required for RNA Polymerase II Mediated Transcription.

  6. Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

    Directory of Open Access Journals (Sweden)

    W. Ali

    2017-06-01

    Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

  7. Identifikasi Gen Transgenik pada Produk Susu Bubuk Kedelai dan Susu Formula Soya dengan Metode PCR (Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Agustin Krisna Wardani

    2018-01-01

      Kebutuhan kedelai yang mencapai 2,2 juta ton/tahun memaksa Indonesia mengimpor sebanyak 1,62 juta ton. Sebagian besar kedelai impor berupa kedelai transgenik. Dengan munculnya kedelai transgenik di Indonesia, perlu adanya pelabelan Produk Rekayasa Genetika (PRG untuk memenuhi hak-hak konsumen. Teknik yang dilakukan untuk mendeteksi PRG salah satunya menggunakan metode PCR. Penelitian ini bertujuan untuk mengetahui ada tidaknya gen transgenik pada produk susu bubuk kedelai dan formula soya, sehingga produk dapat digolongkan sebagai PRG atau tidak. Selain itu juga bertujuan untuk mengetahui suhu annealing optimum pada primer yang digunakan. Hasil penelitian didapatkan suhu annealing optimum primer CaMV 35S promotor adalah 60oC. Sedangkan untuk primer gen EPSPS-CP4 suhu annealing optimumnya 59oC. Untuk primer NOS terminator suhu annealing optimum tidak ditemukan. Dari amplifikasi DNA sampel, 6 sampel susu bubuk kedelai dan 5 sampel formula soya terdapat sisipan gen EPSPS-CP4 dan gen Promotor CaMV 35S. Dengan demikian 11 sampel tersebut dapat dikatakan sebagai PRG.   Kata kunci: Produk rekayasa genetika; PCR; formula soya; susu kedelai bubuk; kedelai transgenik

  8. It's fun to transcribe with Fun30: A model for nucleosome dynamics during RNA polymerase II-mediated elongation.

    Science.gov (United States)

    Lee, Junwoo; Choi, Eun Shik; Lee, Daeyoup

    2018-01-01

    The ability of elongating RNA polymerase II (RNAPII) to regulate the nucleosome barrier is poorly understood because we do not know enough about the involved factors and we lack a conceptual framework to model this process. Our group recently identified the conserved Fun30/SMARCAD1 family chromatin-remodeling factor, Fun30 Fft3 , as being critical for relieving the nucleosome barrier during RNAPII-mediated elongation, and proposed a model illustrating how Fun30 Fft3 may contribute to nucleosome disassembly during RNAPII-mediated elongation. Here, we present a model that describes nucleosome dynamics during RNAPII-mediated elongation in mathematical terms and addresses the involvement of Fun30 Fft3 in this process.

  9. Intracellular alkaline proteases produced by thermoacidophiles: detection of protease heterogeneity by gelatin zymography and polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Kocab, S.; Erdem, B. [Middle East Technical University, Ankara (Turkey). Dept. of Biological Sciences

    2002-08-01

    In this study 24 thermoacidophilic archeal and bacterial strains isolated from hot-springs and hot-soils were screened for their ability to produce intracellular alkaline proteases. The protease activities of the strains, based on azocasein hydrolysis, showed a variation from 0.6 to 5.1 U. The cell extracts of three most potent producers were further examined and it was found that their proteases exhibited maximum activity at 60-70{sup o}C and showed a pH optimum over a range of pH 7.0-8.5. Gelatin zymography revealed that two of the selected archeal strains produced multiple active SDS-resistant proteases. On the other hand, PCR amplification of alkaline serine protease gene sequences of total DNA from all isolates yielded four distinct amplification fragments of 650, 450, 400 and 300 bp, which might have been derived from different serine protease genes. (author)

  10. Genotyping of Trypanosoma cruzi Sublineage in Human Samples from a North-East Argentina Area by Hybridization with DNA Probes and Specific Polymerase Chain Reaction (PCR)

    Science.gov (United States)

    Diez, Cristina; Lorenz, Virginia; Ortiz, Silvia; Gonzalez, Verónica; Racca, Andrea; Bontempi, Iván; Manattini, Silvia; Solari, Aldo; Marcipar, Iván

    2010-01-01

    We have evaluated blood samples of chronic and congenital Trypanosoma cruzi-infected patients from the city of Reconquista located in the northeast of Argentina where no information was previously obtained about the genotype of infecting parasites. Fourteen samples of congenital and 19 chronical patients were analyzed by hybridization with DNA probes of minicircle hypervariable regions (mHVR). In congenital patients, 50% had single infections with TcIId, 7% single infections with TcIIe, 29% mixed infections with TcIId/e, and 7% had mixed infections with TcIId/b and 7% TcIId/b, respectively. In Chronical patients, 52% had single infections with TcIId, 11% single infections with TcIIe, 26% had mixed infections with TcIId/e, and 11% had non-identified genotypes. With these samples, we evaluated the minicircle lineage-specific polymerase chain reaction assay (MLS-PCR), which involves a nested PCR to HVR minicircle sequences and we found a correlation with hybridization probes of 96.4% for TcIId and 54.8% for TcIIe. PMID:20064998

  11. Mediator, TATA-binding Protein, and RNA Polymerase II Contribute to Low Histone Occupancy at Active Gene Promoters in Yeast*

    Science.gov (United States)

    Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.

    2014-01-01

    Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477

  12. Interlaboratory comparison of three microbial source tracking quantitative polymerase chain reaction (qPCR) assays from fecal-source and environmental samples

    Science.gov (United States)

    Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.

    2012-01-01

    During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.

  13. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR for diagnosis of natural infection with canine distemper virus

    Directory of Open Access Journals (Sweden)

    Wong Min-Liang

    2010-06-01

    Full Text Available Abstract Background Canine distemper virus (CDV is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR of the matrix (M gene to the fusion (F gene (designated M-F UTR in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Results Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. Conclusions The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

  14. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus.

    Science.gov (United States)

    Chulakasian, Songkhla; Lee, Min-Shiuh; Wang, Chi-Young; Chiou, Shyan-Song; Lin, Kuan-Hsun; Lin, Fong-Yuan; Hsu, Tien-Huan; Wong, Min-Liang; Chang, Tien-Jye; Hsu, Wei-Li

    2010-06-10

    Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR) of the matrix (M) gene to the fusion (F) gene (designated M-F UTR) in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

  15. Divergence of RNA polymerase ? subunits in angiosperm plastid genomes is mediated by genomic rearrangement

    OpenAIRE

    Blazier, J. Chris; Ruhlman, Tracey A.; Weng, Mao-Lun; Rehman, Sumaiyah K.; Sabir, Jamal S. M.; Jansen, Robert K.

    2016-01-01

    Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP ? subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled an...

  16. Metabolic consequences of DNA damage: The role of poly (ADP-ribose) polymerase as mediator of the suicide response

    International Nuclear Information System (INIS)

    Berger, N.A.; Berger, S.J.

    1986-01-01

    Recent studies show that DNA damage can produce rapid alterations in steady state levels of deoxynucleoside triphosphate pools, for example, MNNG or uv-irradiation cause rapid increases in dATP and dTTP pools without significant changes in dGTP or dCTP pools. In vitro, studies with purified eukaryotic DNA polymerases show that the frequency of nucleotide misincorporation was affected by alterations in relative concentrations of the deoxynucleoside triphosphates. Thus the alterations in dNTP pool sizes that occur consequent to DNA damage may contribute to an increased mutagenic frequency. Poly(ADP-ribose) polymerase mediated suicide mechanism may participate in the toxicity of adenosine deaminase deficiency and severe combined immune deficiency disease in humans. Individuals with this disease suffer severe lymphopenia due to the toxic effects of deoxyadenosine. The lymphocytotoxic effect of adenosine deaminase deficiency can be simulated in lymphocyte cell lines from normal individuals by incubating them with the adenosine deaminase inhibitor, deoxycoformycin. Incubation of such leukocytes with deoxycoformycin and deoxyadenosine results in the gradual accumulation of DNA strand breaks and the depletion of NAD + leading to cell death over a period of several days. This depletion of NAD and loss of cell viability were effectively blocked by nicotinamide or 3-amino benzamide. Thus, persistent activation of poly(ADP-ribose) polymerase by unrepaired or recurrent DNA strand breaks may activate the suicide mechanism of cell death. This study provides a basis for the interesting suggestion that treatment with nicotinamide could block the persistent activity of poly(ADP-ribose) polymerase and may help preserve lymphocyte function in patients with adenosine deaminase deficiency. 16 refs., 3 figs., 2 tabs

  17. The Arabidopsis mediator complex subunits MED16, MED14, and MED2 regulate mediator and RNA polymerase II recruitment to CBF-responsive cold-regulated genes.

    Science.gov (United States)

    Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather

    2014-01-01

    The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced.

  18. Development of loop-mediated isothermal amplification and SYBR green real-time PCR methods for the detection of Citrus yellow mosaic badnavirus in citrus species.

    Science.gov (United States)

    Anthony Johnson, A M; Dasgupta, I; Sai Gopal, D V R

    2014-07-01

    Citrus yellow mosaic badnavirus (CMBV) is an important pathogen in southern India spread by infected citrus propagules. One of the measures to arrest the spread of CMBV is to develop methods to screen and certify citrus propagules as CMBV-free. The methods loop-mediated isothermal amplification (LAMP) and SYBR green real-time PCR (SGRTPCR) have been developed for the efficient detection of CMBV in citrus propagules. This paper compares the sensitivities of LAMP and SGRTPCR with polymerase chain reaction (PCR) for the detection of CMBV. Whereas PCR and LAMP were able to detect CMBV from a minimum of 10 ng of total DNA of infected leaf samples, SGRTPCR could detect the same from 1 ng of total DNA. Using SGRTPCR, the viral titres were estimated to be the highest in rough lemon and lowest in Nagpur Mandarin of the five naturally infected citrus species tested. The results will help in designing suitable strategies for the sensitive detection of CMBV from citrus propagules. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. A novel method for detection of dioxins. Exonuclease protection mediated PCR assay

    Energy Technology Data Exchange (ETDEWEB)

    Xu, S.Q.; Sun, X.; Li, F.; Li, B.S. [Huazhong Univ. of Science and Technology, Wuhan, HB (China). Tongji Medical College

    2004-09-15

    The aromatic hydrocarbon receptor (AhR) is a ligand-actived transcription factor that mediates many of the biologic and toxicologic effects of dioxin-like chemicals (DLCs), such as 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD). Numerous AhR-based bioassays for identification and detection of DLCs have been developed in vitro. Such as the chemical-activated luciferase gene expression (CALUX), ethoxyresolufin-O-deethylase (EROD) activity are sometimes represented as the next best system when compared with whole body or in vivo systems. However, cell systems can be affected by the toxic chemical itself during the assay, thus confusing problems couldn't be avoided in the assay. Incorporation of metabolism in cell systems with uncertain consequences prolongs assay complexity and time. Thus these drawbacks limit the utility of cell systems for screening purposes. Most cell-free bioassays require radioactivity, such as the gel retardation of AhR binding (GRAB) assay, or antibody of AhR or ligand, which are unfeasible for some laboratories. Here a cell-free bioanalysis method, Exonuclease Protection Mediated PCR (EPM-PCR) bioassay, was established for detection of AhR ligands based on the binding of the dioxin:AhR complex to the specific DNA. EPM-PCR can provide indirect detection of ligands by quantification of the specific AhR-binding DNA, no necessary of any DNA labeling and sophisticated equipments. This new bioassay not only has the higher sensitivity and specificity, but it is rapid and easy to perform.

  20. Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique

    Science.gov (United States)

    Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah

    2018-04-01

    The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

  1. Mediator, TATA-binding protein, and RNA polymerase II contribute to low histone occupancy at active gene promoters in yeast.

    Science.gov (United States)

    Ansari, Suraiya A; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z; Rode, Kara A; Barber, Wesley T; Ellis, Laura C; LaPorta, Erika; Orzechowski, Amanda M; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H

    2014-05-23

    Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Proliferating cell nuclear antigen binds DNA polymerase-β and mediates 1-methyl-4-phenylpyridinium-induced neuronal death.

    Directory of Open Access Journals (Sweden)

    Zhentao Zhang

    Full Text Available The mechanisms leading to dopaminergic neuronal loss in the substantia nigra of patients with Parkinson disease (PD remain poorly understood. We recently reported that aberrant DNA replication mediated by DNA polymerase-β (DNA pol-β plays a causal role in the death of postmitotic neurons in an in vitro model of PD. In the present study, we show that both proliferating cell nuclear antigen (PCNA and DNA pol-β are required for MPP(+-induced neuronal death. PCNA binds to the catalytic domain of DNA pol-β in MPP(+-treated neurons and in post-mortem brain tissues of PD patients. The PCNA-DNA pol-β complex is loaded into DNA replication forks and mediates DNA replication in postmitotic neurons. The aberrant DNA replication mediated by the PCNA-DNA pol-β complex induces p53-dependent neuronal cell death. Our results indicate that the interaction of PCNA and DNA pol-β contributes to neuronal death in PD.

  3. PCR and magnetic bead-mediated target capture for the isolation of short interspersed nucleotide elements in fishes.

    Science.gov (United States)

    Liu, Dong; Zhu, Guoli; Tang, Wenqiao; Yang, Jinquan; Guo, Hongyi

    2012-01-01

    Short interspersed nucleotide elements (SINEs), a type of retrotransposon, are widely distributed in various genomes with multiple copies arranged in different orientations, and cause changes to genes and genomes during evolutionary history. This can provide the basis for determining genome diversity, genetic variation and molecular phylogeny, etc. SINE DNA is transcribed into RNA by polymerase III from an internal promoter, which is composed of two conserved boxes, box A and box B. Here we present an approach to isolate novel SINEs based on these promoter elements. Box A of a SINE is obtained via PCR with only one primer identical to box B (B-PCR). Box B and its downstream sequence are acquired by PCR with one primer corresponding to box A (A-PCR). The SINE clone produced by A-PCR is selected as a template to label a probe with biotin. The full-length SINEs are isolated from the genomic pool through complex capture using the biotinylated probe bound to magnetic particles. Using this approach, a novel SINE family, Cn-SINE, from the genomes of Coilia nasus, was isolated. The members are 180-360 bp long. Sequence homology suggests that Cn-SINEs evolved from a leucine tRNA gene. This is the first report of a tRNA(Leu)-related SINE obtained without the use of a genomic library or inverse PCR. These results provide new insights into the origin of SINEs.

  4. PCR and Magnetic Bead-Mediated Target Capture for the Isolation of Short Interspersed Nucleotide Elements in Fishes

    Directory of Open Access Journals (Sweden)

    Dong Liu

    2012-02-01

    Full Text Available Short interspersed nucleotide elements (SINEs, a type of retrotransposon, are widely distributed in various genomes with multiple copies arranged in different orientations, and cause changes to genes and genomes during evolutionary history. This can provide the basis for determining genome diversity, genetic variation and molecular phylogeny, etc. SINE DNA is transcribed into RNA by polymerase III from an internal promoter, which is composed of two conserved boxes, box A and box B. Here we present an approach to isolate novel SINEs based on these promoter elements. Box A of a SINE is obtained via PCR with only one primer identical to box B (B-PCR. Box B and its downstream sequence are acquired by PCR with one primer corresponding to box A (A-PCR. The SINE clone produced by A-PCR is selected as a template to label a probe with biotin. The full-length SINEs are isolated from the genomic pool through complex capture using the biotinylated probe bound to magnetic particles. Using this approach, a novel SINE family, Cn-SINE, from the genomes of Coilia nasus, was isolated. The members are 180–360 bp long. Sequence homology suggests that Cn-SINEs evolved from a leucine tRNA gene. This is the first report of a tRNALeu-related SINE obtained without the use of a genomic library or inverse PCR. These results provide new insights into the origin of SINEs.

  5. Divergence of RNA polymerase α subunits in angiosperm plastid genomes is mediated by genomic rearrangement.

    Science.gov (United States)

    Blazier, J Chris; Ruhlman, Tracey A; Weng, Mao-Lun; Rehman, Sumaiyah K; Sabir, Jamal S M; Jansen, Robert K

    2016-04-18

    Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP α subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled and analyzed from each of the three angiosperm families. Multiple lines of evidence indicated that the rpoA sequences are likely functional despite retaining as low as 30% nucleotide sequence identity with rpoA genes from outgroups in the same angiosperm order. The ratio of non-synonymous to synonymous substitutions indicated that these genes are under purifying selection, and bioinformatic prediction of conserved domains indicated that functional domains are preserved. One of the lineages (Pelargonium, Geraniaceae) contains species with multiple rpoA-like ORFs that show evidence of ongoing inter-paralog gene conversion. The plastid genomes containing these divergent rpoA genes have experienced extensive structural rearrangement, including large expansions of the inverted repeat. We propose that illegitimate recombination, not positive selection, has driven the divergence of rpoA.

  6. Human herpesvirus 8 (HHV-8 detected by nested polymerase chain reaction (PCR in HIV patients with or without Kaposi's sarcoma. An analytic cross-sectional study

    Directory of Open Access Journals (Sweden)

    Paula Renata Lima Machado

    Full Text Available CONTEXT AND OBJECTIVE: Kaposi's sarcoma (KS is a common neoplastic disease in AIDS patients. The aim of this study was to evaluate the frequency of human herpesvirus 8 (HHV-8 infection in human immunodeficiency virus (HIV-infected patients, with or without KS manifestations and correlate HHV-8 detection with KS staging. DESIGN AND SETTING: Analytic cross-sectional study conducted in a public tertiary-level university hospital in Ribeirão Preto, São Paulo, Brazil. METHODS: Antibodies against HHV-8 lytic-phase antigens were detected by means of the immunofluorescence assay. HHV-8 DNA was detected in the patient samples through a nested polymerase chain reaction (nested PCR that amplified a region of open reading frame (ORF-26 of HHV-8. RESULTS: Anti-HHV-8 antibodies were detected in 30% of non-KS patients and 100% of patients with KS. Furthermore, the HHV-8 DNA detection rates observed in HIV-positive patients with KS were 42.8% in serum, 95.4% in blood samples and 100% in skin biopsies; and in patients without KS, the detection rate was 4% in serum. Out of the 16 serum samples from patients with KS-AIDS who were classified as stage II, two were positive (12.5%; and out of the 33 samples from patients in stage IV, 19 (57.6% were positive. CONCLUSION: We observed an association between HHV-8 detection and disease staging, which was higher in the serum of patients in stage IV. This suggests that detection of HHV-8 DNA in serum could be very useful for clinical assessment of patients with KS and for monitoring disease progression.

  7. Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach.

    Science.gov (United States)

    Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A

    2001-06-01

    A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

  8. Development of the nested polymerase chain reaction (PCR) for detection of hepatitis C virus RNA in blood derivatives. Final report for the period 15 December 1994 - 15 December 1995

    International Nuclear Information System (INIS)

    Pavelic, J.

    1996-07-01

    Testing for the presence of hepatitis C virus (HCV) in blood derivatives used in clinical medicine is important to ensure the safety of such preparations. A reliable and reproducible method is described for the isolation of HCV RNA, subsequent reverse transcription and nested polymerase chain reaction (PCR) from blood derivatives. Of 17 batches of blood derivatives (14 negative for anti-HCV and 3 of unknown anti-HCV status) five were found to be positive in the nested PCR. (author). 4 refs, 3 figs, 1 tab

  9. Signal-off Electrochemiluminescence Biosensor Based on Phi29 DNA Polymerase Mediated Strand Displacement Amplification for MicroRNA Detection.

    Science.gov (United States)

    Chen, Anyi; Gui, Guo-Feng; Zhuo, Ying; Chai, Ya-Qin; Xiang, Yun; Yuan, Ruo

    2015-06-16

    A target induced cycling strand displacement amplification (SDA) mediated by phi29 DNA polymerase (phi29) was first investigated and applied in a signal-off electrochemiluminescence (ECL) biosensor for microRNA (miRNA) detection. Herein, the target miRNA triggered the phi29-mediated SDA which could produce amounts of single-stranded DNA (assistant probe) with accurate and comprehensive nucleotide sequence. Then, the assistant probe hybridized with the capture probe and the ferrocene-labeled probe (Fc-probe) to form a ternary "Y" structure for ECL signal quenching by ferrocene. Therefore, the ECL intensity would decrease with increasing concentration of the target miRNA, and the sensitivity of biosensor would be promoted on account of the efficient signal amplification of the target induced cycling reaction. Besides, a self-enhanced Ru(II) ECL system was designed to obtain a stable and strong initial signal to further improve the sensitivity. The ECL assay for miRNA-21 detection is developed with excellent sensitivity of a concentration variation from 10 aM to 1.0 pM and limit of detection down to 3.3 aM.

  10. Agrobacterium-mediated transformation of grapefruit with the wild-type and mutant RNA-dependent RNA polymerase genes of Citrus tristeza virus

    Science.gov (United States)

    Citrus paradisi Macf. cv. Duncan was transformed with constructs coding for the wild-type and mutant RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) for exploring replicase-mediated pathogen-derived resistance (RM-PDR). The RdRp gene was amplified from CTV genome and used to gener...

  11. Phage-Mediated Immuno-PCR for Ultrasensitive Detection of Cry1Ac Protein Based on Nanobody.

    Science.gov (United States)

    Liu, Yuanyuan; Jiang, Dongjian; Lu, Xin; Wang, Wei; Xu, Yang; He, Qinghua

    2016-10-11

    The widespread use of Cry proteins in transgenic plants for insect control has raised concerns about the environment and food safety in the public. An effective detection method for introduced Cry proteins is of significance for environmental risk assessment and product quality control. This paper describes a novel phage mediated immuno-PCR (iPCR) for the ultrasensitive determination of Cry proteins based on nanobodies. Three nanobodies against Cry1Ac protein were obtained from a naı̈ve phage displayed nanobody library without animal immunization process and were applied to the iPCR assay for Cry1Ac. The phage-mediated iPCR for Cry1Ac based on nanobodies showed a dynamic range of 0.001-100 ng/mL and a limit detection of 0.1 pg/mL. Specific measurement of this established method was performed by testing cross-reativity of other Cry1Ac analogues, and the result showed negligible cross-reactivity with other test Cry proteins (Cry1Ab, Cry1F, Cry3B). Furthermore, the phage-mediated iPCR based on nanobody should be easily applicable to the detection of many other Cry proteins.

  12. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  13. A Point-of-Need infrared mediated PCR platform with compatible lateral flow strip for HPV detection.

    Science.gov (United States)

    Liu, Wenjia; Zhang, Mingfang; Liu, Xiaoyan; Sharma, Alok; Ding, Xianting

    2017-10-15

    With the increasing need of monitoring the epidemiology of serious infectious diseases, food hygiene, food additives and pesticide residues, it is urgent to develop portable, easy-to-use, inexpensive and rapid molecular diagnostic tools. Herein, we demonstrate a prototype of IR mediated Conducting Oil and CarbOn Nanotube circUlaTing PCR (IR-COCONUT PCR) platform for nucleic acid amplification. The presented platform offers a new solution for miniaturized PCR instruments with non-contact heaters by using conducting oil and carbon nanotube as a medium in IR mediated PCR. This novel platform offers accurate and flexible control of temperature through the integration of PID (proportional-integral-derivative) algorithms to manipulate the duty cycle of the voltage signals of IR LED and a peristaltic pump. The ramping rate of the introduced platform in current study is 1.5°C/s for heating speed and -2.0°C/s for cooling speed. This platform fulfills 30 thermal cycles within 50min which is a match to the conventional bench-top PCR thermo cyclers. For demonstration purpose, human papillomavirus (HPV) patient cervical swab specimens were examined. Downstream lateral flow strip (LFS) was also developed to quantity the PCR products from the IR-COCONUT PCR device within 25min. This PCR platform together with the compatible LFS shows great potential for in-field and Point-of-Need (PoN) testing of genetic or contagious diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Detection of apoptotic DNA ladder in pig leukocytes and its precision using LM - PCR (ligation mediated polymerase chain reaction)

    Czech Academy of Sciences Publication Activity Database

    Matalová, Eva; Španová, A.

    2002-01-01

    Roč. 71, č. 3 (2002), s. 163-168 ISSN 0001-7213 R&D Projects: GA ČR GA304/01/0850; GA AV ČR KSK6005114 Keywords : apoptosis * phagocytosis * DNA ladder Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.370, year: 2002

  15. Evaluation of Polymerase Chain Reaction (PCR with Slit Skin Smear Examination (SSS to Confirm Clinical Diagnosis of Leprosy in Eastern Nepal.

    Directory of Open Access Journals (Sweden)

    Shraddha Siwakoti

    2016-12-01

    Full Text Available Detection of Mycobacterium leprae in slit skin smear (SSS is a gold standard technique for the leprosy diagnosis. Over recent years, molecular diagnosis by using PCR has been increasingly used as an alternative for its diagnosis due to its higher sensitivity. This study was carried out for comparative evaluation of PCR and SSS microscopy in a cohort of new leprosy cases diagnosed in B. P. Koirala Institute of health Sciences, Dharan, Nepal.In this prospective crossectional study, 50 new clinically diagnosed cases of leprosy were included. DNA was extracted from SSS and PCR was carried out to amplify 129 bp sequence of M. leprae repetitive element. Sensitivity of SSS and PCR was 18% and 72% respectively. Improvement of 54% case detection by PCR clearly showed its advantage over SSS. Furthermore, PCR could confirm the leprosy diagnosis in 66% of AFB negative cases indicating its superiority over SSS. In the paucibacillary (PB patients, whose BI was zero; sensitivity of PCR was 44%, whereas it was 78% in the multibacillary patients.Our study showed PCR to be more sensitive than SSS microscopy in diagnosing leprosy. Moreover, it explored the characteristic feature of PCR which detected higher level of early stage(PB cases tested negative by SSS. Being an expensive technique, PCR may not be feasible in all the cases, however, it would be useful in diagnosis of early cases of leprosy as opposed to SSS.

  16. Evaluation of Polymerase Chain Reaction (PCR) with Slit Skin Smear Examination (SSS) to Confirm Clinical Diagnosis of Leprosy in Eastern Nepal.

    Science.gov (United States)

    Siwakoti, Shraddha; Rai, Keshav; Bhattarai, Narayan Raj; Agarwal, Sudha; Khanal, Basudha

    2016-12-01

    Detection of Mycobacterium leprae in slit skin smear (SSS) is a gold standard technique for the leprosy diagnosis. Over recent years, molecular diagnosis by using PCR has been increasingly used as an alternative for its diagnosis due to its higher sensitivity. This study was carried out for comparative evaluation of PCR and SSS microscopy in a cohort of new leprosy cases diagnosed in B. P. Koirala Institute of health Sciences, Dharan, Nepal. In this prospective crossectional study, 50 new clinically diagnosed cases of leprosy were included. DNA was extracted from SSS and PCR was carried out to amplify 129 bp sequence of M. leprae repetitive element. Sensitivity of SSS and PCR was 18% and 72% respectively. Improvement of 54% case detection by PCR clearly showed its advantage over SSS. Furthermore, PCR could confirm the leprosy diagnosis in 66% of AFB negative cases indicating its superiority over SSS. In the paucibacillary (PB) patients, whose BI was zero; sensitivity of PCR was 44%, whereas it was 78% in the multibacillary patients. Our study showed PCR to be more sensitive than SSS microscopy in diagnosing leprosy. Moreover, it explored the characteristic feature of PCR which detected higher level of early stage(PB) cases tested negative by SSS. Being an expensive technique, PCR may not be feasible in all the cases, however, it would be useful in diagnosis of early cases of leprosy as opposed to SSS.

  17. Label-free detection of gliadin food allergen mediated by real-time apta-PCR.

    Science.gov (United States)

    Pinto, Alessandro; Polo, Pedro Nadal; Henry, Olivier; Redondo, M Carmen Bermudo; Svobodova, Marketa; O'Sullivan, Ciara K

    2014-01-01

    Celiac disease is an immune-mediated enteropathy triggered by the ingestion of gluten. The only effective treatment consists in a lifelong gluten-free diet, requiring the food industry to tightly control the gluten contents of their products. To date, several gluten quantification approaches using antibodies are available and recommended by the legal authorities, such as Codex Alimentarius. However, whilst these antibody-based tests exhibit high sensitivity and specificity, the production of antibodies inherently requires the killing of host animals and is time-consuming and relatively expensive. Aptamers are structured single-stranded nucleic acid ligands that bind with high affinity and specificity to their cognate target, and aiming for a cost-effective viable alternative to the use of antibodies. Herein, we report the systematic evolution of ligands by exponential enrichment (SELEX)-based selection of a DNA aptamer against gliadin from a combinatorial DNA library and its application in a novel detection assay. Taking into account the hydrophobic nature of the gliadin target, a microtitre plate format was exploited for SELEX, where the target was immobilised via hydrophobic interactions, thus exposing aptatopes accessible for interaction with the DNA library. Evolution was followed using surface plasmon resonance, and following eight rounds of SELEX, the enriched DNA pool was cloned, sequenced and a clear consensus motif was identified. An apta-PCR assay was developed where competition for the aptamer takes place between the surface-immobilised gliadin and gliadin in the target sample, akin to an ELISA competitive format where the more target present in the sample, the less aptamer will bind to the immobilised gliadin. Following competition, any aptamer bound to the immobilised gliadin was heat-eluted and quantitatively amplified using real-time PCR, achieving a detection limit of approx. 2 nM (100 ng mL(-1)). The specificity of the selected aptamer was

  18. Time Course of Detection of Human Male DNA from Stained Blood Sample on Various Surfaces by Loop Mediated Isothermal Amplification and Polymerase Chain Reaction

    OpenAIRE

    Panan Kanchanaphum

    2018-01-01

    This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP), and LAMP-Lateral Flow Dipstick (LFD). For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, w...

  19. Comparison between Radioisotopic and Non-radioisotopic Polymerase Chain Reaction-Single Strand Conformation Polymorphism (PCR-SSCP) Procedures in the Detection of Mutations at the rpoB Gene Associated with Rifampicin Resistance in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr

    2006-01-01

    Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB

  20. DNA polymerase gamma inhibition by vitamin K3 induces mitochondria-mediated cytotoxicity in human cancer cells.

    Science.gov (United States)

    Sasaki, Ryohei; Suzuki, Yoko; Yonezawa, Yuko; Ota, Yosuke; Okamoto, Yoshiaki; Demizu, Yusuke; Huang, Peng; Yoshida, Hiromi; Sugimura, Kazuro; Mizushina, Yoshiyuki

    2008-05-01

    Among the vitamin K (VK) compounds, VK3 exhibits distinct cytotoxic activity in cancer cells and is thought to affect redox cycling; however, the underlying mechanisms remain unclear. Here we demonstrate that VK3 selectively inhibits DNA polymerase (pol) gamma, the key enzyme responsible for mitochondrial DNA replication and repair. VK3 at 30 microM inhibited pol gamma by more than 80%, caused impairment of mitochondrial DNA replication and repair, and induced a significant increase in reactive oxygen species (ROS), leading to apoptosis. At a lower concentration (3 microM), VK3 did not cause a significant increase in ROS, but was able to effectively inhibit cell proliferation, which could be reversed by supplementing glycolytic substrates. The cytotoxic action of VK3 was independent of p53 tumor suppressor gene status. Interestingly, VK3 only inhibited pol gamma but did not affect other pol including human pol alpha, pol beta, pol delta, and pol epsilon. VK1 and VK2 exhibited no inhibitory effect on any of the pol tested. These data together suggest that the inhibition of pol gamma by VK3 is relatively specific, and that this compound seems to exert its anticancer activity by two possible mechanisms in a concentration-dependent manner: (1) induction of ROS-mediated cell death at high concentrations; and (2) inhibition of cell proliferation at lower concentrations likely through the suppression of mitochondrial respiratory function. These findings may explain various cytotoxic actions induced by VK3, and may pave the way for the further use of VK3.

  1. DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

    Directory of Open Access Journals (Sweden)

    Elena K Braithwaite

    2010-08-01

    Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

  2. A novel polymerase chain reaction (PCR) - denaturing gradient gel electrophoresis (DGGE) for the identification of Micrococcaceae strains involved in meat fermentations. Its application to naturally fermented Italian sausages.

    Science.gov (United States)

    Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G

    2001-05-01

    A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.

  3. Detection of rabies in camel, goat and cattle in Sudan using Fluorescent antibody test (FAT and hemi nested Polymerase Chain Reaction (hnRT-PCR

    Directory of Open Access Journals (Sweden)

    Baraa Abdalaziz Ahmed

    2016-09-01

    Full Text Available Objective: The objective of this study was to identify rabies virus in camels and other animals in Sudan. Materials and methods: Four camel samples were collected from Garraht Elzawia, Kab-kabia and North Darfur areas in Sudan. The samples were collected based on clinical signs. In addition, two camel samples were obtained from Khartoum and Tambool, one goat sample was collected from El-Fashir, and one cattle sample was obtained from Atbara. The samples were transported to the Veterinary Research Institute (VRI at Khartoum, Sudan for further studies. The samples were subjected for nested and hemi nested RT-PCR (hnRT-PCR along with the gold standard Fluorescent antibody test (FAT to diagnose rabies. Results: Out of eight samples, seven were found to be positive by both FAT and RT-PCR methods. The remaining one sample was positive by FAT but negative by hnRT-PCR indicating the suitablity of hnRT-PCR along with FAT for accurate diagnosis of rabies in animals. Conclusion: The study concluded that FAT and RT-PCR are useful tools for research and diagnosis of rabies. [J Adv Vet Anim Res 2016; 3(3.000: 274-277

  4. Multiplex PCR Study of Plasmid-Mediated AmpC Beta-Lactamases Genes in Clinical Isolates of Escherichia coli

    Directory of Open Access Journals (Sweden)

    Maryam Dehghani

    2017-02-01

    Full Text Available Background:   AmpC β-lactamases are important cephalosporinases chromosomally encoded in many of Enterobacteriaceae and a few other organisms where they mediate resistance to cephalothin, cefazolin, cefoxitin and penicillins. The six different families of plasmid-mediated AmpC β-lactamases have been described, but no phenotypic test can discriminate among them. AmpC multiplex PCR has been successfully used to discriminate plasmid-mediated ampC specific families in organisms such as Klebsiella pneumonia and Escherichia coli. The aim of this study was to indicate the prevalence of AmpC β-lactamase genes by specifically designed primers through PCR test.Methods:   243 total clinical urine samples were collected, and 227 isolates were identified as Escherichia coli based on standard biochemical tests. Subsequently, the isolates were screened by disc diffusion and combined disc test for β-lactamase production. Resistant isolates were evaluated by PCR for ampC family determination. Results:  Antibiotic resistance pattern were observed as follows: cefepime (%25, ceftazidime (%31, ceftriaxone (%37, cefotaxime (%38. The ratio of isolates was detected as ESBLs and AmpC producers were 34% and 5.2%, respectively. PCR performed on 12 selected isolates via phenotypic tests and the results revealed that among 12 isolates, 11 contained blaCMY-42. Conclusion:  Unfortunately, antibiotic resistance has become an increasingly critical problem in many countries like Iran and occurrence of isolates co-expressing AmpC-β-lactamases and ESBLs can create serious problems in the future. As antibiotic options in the treatment of AmpC β-lactamases and ESBLs producing organisms are extremely limited, molecular screening by laboratories is suggested to reduce the risk of therapeutic defeat.

  5. Detection of Aspergillus flavus and A. fumigatus in Bronchoalveolar Lavage Specimens of Hematopoietic Stem Cell Transplants and Hematological Malignancies Patients by Real-Time Polymerase Chain Reaction, Nested PCR and Mycological Assays

    Science.gov (United States)

    Zarrinfar, Hossein; Mirhendi, Hossein; Fata, Abdolmajid; Khodadadi, Hossein; Kordbacheh, Parivash

    2015-01-01

    Background: Pulmonary aspergillosis (PA) is one of the most serious complications in immunocompromised patients, in particular among hematopoietic stem cell transplants (HSCT) and patients with hematological malignancies. Objectives: The current study aimed to evaluate the incidence of PA and utility of molecular methods in HSCT and patients with hematological malignancies, four methods including direct examination, culture, nested polymerase chain reaction (PCR) and real-time PCR were performed on bronchoalveolar lavage (BAL) specimens in Tehran, Iran. Patients and Methods: During 16 months, 46 BAL specimens were obtained from individuals with allogeneic HSCT (n = 18) and patients with hematological malignancies (n = 28). Direct wet mounts with 20% potassium hydroxide (KOH) and culture on mycological media were performed. The molecular detection of Aspergillus fumigatus and A. flavus was done by amplifying the conserved sequences of internal transcribed spacer 1 (ITS1) ribosomal DNA by nested-PCR and the β-tubulin gene by TaqMan real-time PCR. Results: Seven (15.2%) out of 46 specimens were positive in direct examination and showed branched septate hyphae; 11 (23.9%) had positive culture including eight (72.7%) A. flavus and three (27.3%) A. fumigatus; 22 (47.8%) had positive nested-PCR and eight (17.4%) had positive real-time PCR. The incidence of invasive pulmonary aspergillosis (IPA) in these patients included proven IPA in 1 (2.2%), probable IPA in 10 (21.7%), possible IPA in 19 (41.3%) and not IPA in 16 cases (34.8%). Conclusions: The incidence of IPA in allogeneic HSCT and patients with hematological malignancies was relatively high and A. flavus was the most common cause of PA. As molecular methods had higher sensitivity, it may be useful as screening methods in HSCT and patients with hematological malignancies, or to determine when empirical antifungal therapy can be withheld. PMID:25763133

  6. Droplet digital polymerase chain reaction (ddPCR assays integrated with an internal control for quantification of bovine, porcine, chicken and turkey species in food and feed.

    Directory of Open Access Journals (Sweden)

    Hanan R Shehata

    Full Text Available Food adulteration and feed contamination are significant issues in the food/feed industry, especially for meat products. Reliable techniques are needed to monitor these issues. Droplet Digital PCR (ddPCR assays were developed and evaluated for detection and quantification of bovine, porcine, chicken and turkey DNA in food and feed samples. The ddPCR methods were designed based on mitochondrial DNA sequences and integrated with an artificial recombinant plasmid DNA to control variabilities in PCR procedures. The specificity of the ddPCR assays was confirmed by testing both target species and additional 18 non-target species. Linear regression established a detection range between 79 and 33200 copies of the target molecule from 0.26 to 176 pg of fresh animal tissue DNA with a coefficient of determination (R2 of 0.997-0.999. The quantification ranges of the methods for testing fortified heat-processed food and feed samples were 0.05-3.0% (wt/wt for the bovine and turkey targets, and 0.01-1.0% (wt/wt for pork and chicken targets. Our methods demonstrated acceptable repeatability and reproducibility for the analytical process for food and feed samples. Internal validation of the PCR process was monitored using a control chart for 74 consecutive ddPCR runs for quantifying bovine DNA. A matrix effect was observed while establishing calibration curves with the matrix type under testing, and the inclusion of an internal control in DNA extraction provides a useful means to overcome this effect. DNA degradation caused by heating, sonication or Taq I restriction enzyme digestion was found to reduce ddPCR readings by as much as 4.5 fold. The results illustrated the applicability of the methods to quantify meat species in food and feed samples without the need for a standard curve, and to potentially support enforcement activities for food authentication and feed control. Standard reference materials matching typical manufacturing processes are needed for

  7. Detection of Salmonella Spp., Shigella (Flexneri and Sonnei) and Vibrio Cholerae O1 by Polymerase Chain Reaction (PCR) in Exported Shrimp from the Mexican Northeast Coast

    Energy Technology Data Exchange (ETDEWEB)

    Perez, L.; Nuñez, F.; Rubio, M.; Nicoli, M. [Universidad Nacional Autónoma de México, Facultad de Medicina Veterinaria y Zootecnia (Mexico)

    2005-01-15

    The objective of the present work was to use the PCR technique for the simultaneous detection of Salmonella spp and Vibrio cholerae O1 in frozen shrimp for export. The DNA segments located in the gene A [284 pairs of bases (pb)] from Salmonella spp. locus ial (217 and 320 pb) from Shigella flexneri and Shigella sonnei and the gene ctxA and ctxB (777 pb) from Vibrio cholerae O1 were amplified. The different primers that amplify these segments were assayed in a PCR reaction for the simultaneous detection of DNA from the microorganisms. It was not possible to amplify the gene of Shigella sonnei and Shigella flexneri under the assay’s conditions, whilst those of Salmonella spp. and Vibrio cholerae O1 were successfully amplified. The amplification conditions for the PCR were: 94° C, 58° C and 72° C during 30 cycles, allowing a reduction from 15 days test time with the official microbiological methods to 28 hours (24 for the pre-enrichment and four for the PCR). Samples of raw-frozen-headless shrimps were taken from production plants located in the State of Sinaloa, Mexico. A random sampling procedure was used, according to the guidelines described by the International Commission of Microbiological Specifications for Foods (ICMSF, 1999). Five packages per lot per production plant were obtained. From each individual package (5 pounds 80 OZ ≈ 2.27 kg) three samples were taken for the bacteriological assays to search for Salmonella spp. and Vibrio cholerae O1, respectively. The samples were also analyzed by PCR. Results showed that none of the samples were positive by PCR to any of the studied bacteria. Salmonella spp. and Vibrio cholerae O1 were not detected in these samples by the official methods. However, the latter were able to identify other Vibrio species and enterobacteria like Proteus and Acromobacter. These results confirmed PCR’s rapidity, sensitivity and specificity. (author)

  8. A novel nested multiplex polymerase chain reaction (PCR assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    Directory of Open Access Journals (Sweden)

    Parija Subhash C

    2007-05-01

    Full Text Available Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific. The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens.

  9. Diagnostic accuracy of a loop-mediated isothermal PCR assay for detection of Orientia tsutsugamushi during acute Scrub Typhus infection.

    Science.gov (United States)

    Paris, Daniel H; Blacksell, Stuart D; Nawtaisong, Pruksa; Jenjaroen, Kemajittra; Teeraratkul, Achara; Chierakul, Wirongrong; Wuthiekanun, Vanaporn; Kantipong, Pacharee; Day, Nicholas P J

    2011-09-01

    There is an urgent need to develop rapid and accurate point-of-care (POC) technologies for acute scrub typhus diagnosis in low-resource, primary health care settings to guide clinical therapy. In this study we present the clinical evaluation of loop-mediated isothermal PCR assay (LAMP) in the context of a prospective fever study, including 161 patients from scrub typhus-endemic Chiang Rai, northern Thailand. A robust reference comparator set comprising following 'scrub typhus infection criteria' (STIC) was used: a) positive cell culture isolate and/or b) an admission IgM titer ≥1∶12,800 using the 'gold standard' indirect immunofluorescence assay (IFA) and/or c) a 4-fold rising IFA IgM titer and/or d) a positive result in at least two out of three PCR assays. Compared to the STIC criteria, all PCR assays (including LAMP) demonstrated high specificity ranging from 96-99%, with sensitivities varying from 40% to 56%, similar to the antibody based rapid test, which had a sensitivity of 47% and a specificity of 95%. The diagnostic accuracy of the LAMP assay was similar to realtime and nested conventional PCR assays, but superior to the antibody-based rapid test in the early disease course. The combination of DNA- and antibody-based detection methods increased sensitivity with minimal reduction of specificity, and expanded the timeframe of adequate diagnostic coverage throughout the acute phase of scrub typhus.

  10. SAD1, an RNA polymerase I subunit A34.5 of rice, interacts with Mediator and controls various aspects of plant development.

    Science.gov (United States)

    Li, Weiqiang; Yoshida, Akiko; Takahashi, Megumu; Maekawa, Masahiko; Kojima, Mikiko; Sakakibara, Hitoshi; Kyozuka, Junko

    2015-01-01

    The DWARF14 (D14) gene of rice functions within the signaling pathway of strigolactones, a group of plant hormones that inhibits shoot branching. We isolated a recessive mutant named super apical dormant (sad1-1) from a suppressor screen of d14-1. The growth of tillers (vegetative shoot branches) is suppressed in both the d14-1 sad1-1 double mutant and the sad1-1 single mutant. In addition, the sad1-1 mutant shows pleiotropic defects throughout development. SAD1 encodes an ortholog of RPA34.5, a subunit of RNA polymerase I (Pol I). Consequently, the level of ribosomal RNA (rRNA) is severely reduced in the sad1-1 mutant. These results indicate that proper ribosome function is a prerequisite for normal development in plants. The Arabidopsis ortholog of SAD1 was previously isolated as a Mediator-interacting protein. Here we show that SAD1 interacts physically with the Mediator complex through direct binding with OsMED4, a component of the middle module of the Mediator complex in rice. It is known that Mediator interacts with Pol II, which transcribes mRNAs and functions as a central regulator of transcription. This study indicates a novel aspect of Mediator function in Pol I-controlled rRNA transcription. TFIIF2 and RPC53 are the counterparts of RPA34.5 in Pol II and Pol III, respectively. We demonstrate that the rice orthologs of these proteins also interact with OsMED4. Our results suggest that interaction with MED4 in the Mediator complex is a common feature of the three types of RNA polymerases. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  11. A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

    Directory of Open Access Journals (Sweden)

    Karolina Stojowska

    Full Text Available We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s, while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR, whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR. The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

  12. A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

    Science.gov (United States)

    Stojowska, Karolina; Krawczyk, Beata

    2014-01-01

    We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

  13. PCR-mediated recombination in amplification products derived from polyploid cotton.

    Science.gov (United States)

    Richard C. Cronn; M. Cedroni; T. Haselkorn; C. Grover; Jonathan F. Wendel

    2002-01-01

    PCR recombination describes a process of in vitro chimera formation from non-identical templates. The key requirements of this process is the inclusion of two partially homologous templates in one reaction, a condition met when amplifying any locus from polyploid organisms and members of multigene families from diploid organisms. Because polyploids possess two or more...

  14. Molecular identification of dermatophytosis by polymerase chain reaction (PCR and detection of source of infection by restricted fragment length polymorphism (RFLP

    Directory of Open Access Journals (Sweden)

    BK Jha

    2013-09-01

    Full Text Available Introduction Dermatophytes are responsible for most superficial fungal infections and the estimated lifetime risk of acquiring a dermatophyte infection is between 10-20%. These fungi are mainly classified in three major genera Microsporum, Trichophyton and Epidermophyton. Materials and Methods Clinically suspected 200 cases of dermatophyte infected patients from K. R. Hospital Mysore and Mission Hospital Mysore were included in this descriptive study from January 2011 to June 2012. All the culture positive smear- 10% Potassium Hydroxide (KOH and culture in different dermatophytic medium patients were confirmed by PCR and source of infection was detected (n=10 from PCR positive patients and (n=10 from their domestic animals by PCR-RFLP methods targeting 18S rDNA regions of fungi. Results Out of 200 clinically suspected cases KOH mount was positive in 143 (71.5% cases and culture was positive in 132(66% cases. The isolates belonged to three genera and eight species as T.mentagrophytes 52(39.4%, T.rubrum 30(22.7%, T.violacium 18(13.6%, T.verrucosum 11(8.3%, E.floccosum 10(7.6%, M.canis 6(4.5%, T.tonsurans 03(2.3% and T.schollenii 2(1.5%. To identify the source of infection 10 animals ,one each from the houses of 10 patients who were PCR positive were also subjected to PCR and RFLP. The animals and the patients were found to be infected by same organisms T.verrucosum .This indicates that T.verrucosum infection is from animal source. Conclusion Dermatophytic infections are more common infectious disease. Preliminary diagnosis of dermatophytosis can be done by KOH mount and culture, which takes longer time to report and cannot differentiate at the genus and species level. Results indicate that PCR-RFLP may be considered as gold standard for the diagnosis and confirmation of source of infection of dermatophytosis and can aid the clinician in initiating prompt and appropriate antifungal therapy. Journal of College of Medical Sciences-Nepal, 2012, Vol-8

  15. Pyrovanadolysis, a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate, Mn2+, and DNA Polymerase of Bacteriophage T7

    NARCIS (Netherlands)

    Akabayov, Barak; Kulczyk, Arkadiusz W.; Akabayov, Sabine R.; Theile, Christopher; McLaughlin, Larry W.; Beauchamp, Benjamin; van Oijen, Antoine M.; Richardson, Charles C.

    2011-01-01

    DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PPi). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry

  16. Thrombomodulin Is Silenced in Malignant Mesothelioma by a Poly(ADP-ribose) Polymerase-1-mediated Epigenetic Mechanism

    Czech Academy of Sciences Publication Activity Database

    Nocchi, L.; Tomasetti, M.; Amati, M.; Neužil, Jiří; Santarelli, L.; Saccucci, F.

    2011-01-01

    Roč. 286, č. 22 (2011), s. 19478-19488 ISSN 0021-9258 R&D Projects: GA ČR(CZ) GA204/08/0811 Institutional research plan: CEZ:AV0Z50520701 Keywords : Thrombomodulin gene promoter * malignant mesothelioma * poly(ADP-ribose) polymerase-1 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.773, year: 2011

  17. Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

    Science.gov (United States)

    Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2018-05-01

    As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

  18. Measurement of indicator genes using global complementary DNA (cDNA) amplification, by polyadenylic acid reverse transcriptase polymerase chain reaction (poly A RT-PCR): A feasibility study using paired samples from tissue and ductal juice in patients undergoing pancreatoduodenectomy.

    Science.gov (United States)

    Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard

    2018-06-01

    The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  19. Multiplex quantification of 16S rDNA of predominant bacteria group within human fecal samples by polymerase chain reaction--ligase detection reaction (PCR-LDR).

    Science.gov (United States)

    Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua

    2009-03-01

    A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.

  20. Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

    Science.gov (United States)

    2007-05-08

    deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

  1. [Usefulness of a real-time quantitative polymerase-chain reaction (PCR) assay for the diagnosis of congenital and postnatal cytomegalovirus infection].

    Science.gov (United States)

    Reina, J; Weber, I; Riera, E; Busquets, M; Morales, C

    2014-05-01

    Cytomegalovirus (CMV) is the main virus causing congenital and postnatal infections in the pediatric population. The aim of this study is to evaluate the usefulness of a quantitative real-time PCR in the diagnosis of these infections using urine as a single sample. We studied all the urine samples of newborns (< 7 days) with suspected congenital infection, and urine of patients with suspected postnatal infection (urine negative at birth). Urines were simultaneously studied by cell culture, qualitative PCR (PCRc), and quantitative real-time PCR (PCRq). We analyzed 332 urine samples (270 to rule out congenital infection and 62 postnatal infections). Of the first, 22 were positive in the PCRq, 19 in the PCRc, and 17 in the culture. PCRq had a sensitivity of 100%, on comparing the culture with the rest of the techniques. Using the PCRq as a reference method, culture had a sensitivity of 77.2%, and PCRc 86.3%. In cases of postnatal infection, PCRq detected 16 positive urines, the PCRq 12, and the cell culture 10. The urines showed viral loads ranging from 2,178 to 116,641 copies/ml. The genomic amplification technique PCRq in real time was more sensitive than the other techniques evaluated. This technique should be considered as a reference (gold standard), leaving the cell culture as a second diagnostic level. The low cost and the automation of PCRq would enable the screening for CMV infection in large neonatal and postnatal populations. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

  2. Analysing mass balance of viruses in a coagulation-ceramic microfiltration hybrid system by a combination of the polymerase chain reaction (PCR) method and the plaque forming units (PFU) method.

    Science.gov (United States)

    Matsushita, T; Matsui, Y; Shirasaki, N

    2006-01-01

    Virus removal experiments using river water spiked with bacteriophages were conducted by an in-line coagulation-ceramic microfiltration hybrid system to investigate the effects of filtration flux (62.5 and 125 L/(m2 x h)) and type of virus (Qbeta and MS2) on virus removal. In addition, the mass balance of viruses through the hybrid system was analysed by quantifying the infectious and inactive viruses by a combination of the polymerase chain reaction (PCR) method and the plaque forming units (PFU) method. Even when the system was operated at high filtration flux (125 L/(m2 x h)), high virus removal (> 6 log) with short coagulation time (2.4 s) was successfully achieved by dosing polyaluminium chloride (PACI) at more than 1.08 mg-Al/L. Removal performances were different between Qbeta and MS2, although their diameters are almost the same: greater virus removal was achieved for MS2 at PACI dosing of 0.54 mg-Al/L, and for Qbeta at PACI dosing of more than 1.08 mg-Al/L. The combination of the PCR and PFU methods revealed that two phenomena, adsorption to/entrapment in aluminium floc and virucidal activity of PACI, partially account for the high virus removal in the coagulation-MF hybrid system.

  3. Pressure-driven one-step solid phase-based on-chip sample preparation on a microfabricated plastic device and integration with flow-through polymerase chain reaction (PCR).

    Science.gov (United States)

    Tran, Hong Hanh; Trinh, Kieu The Loan; Lee, Nae Yoon

    2013-10-01

    In this study, we fabricate a monolithic poly(methylmethacrylate) (PMMA) microdevice on which solid phase-based DNA preparation and flow-through polymerase chain reaction (PCR) units were functionally integrated for one-step sample preparation and amplification operated by pressure. Chelex resin, which is used as a solid support for DNA preparation, can capture denatured proteins but releases DNA, and the purified DNA can then be used as a template in a subsequent amplification process. Using the PMMA microdevices, DNA was successfully purified from both Escherichia coli and human hair sample, and the plasmid vector inserted in E. coli and the D1S80 locus in human genomic DNA were successfully amplified from on-chip purified E. coli and human hair samples. Furthermore, the integration potential of the proposed sample preparation and flow-through PCR units was successfully demonstrate on a monolithic PMMA microdevice with a seamless flow, which could pave the way for a pressure-driven, simple one-step sample preparation and amplification with greatly decreased manufacture cost and enhanced device disposability. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. The RNA Polymerase II C-Terminal Domain Phosphatase-Like Protein FIERY2/CPL1 Interacts with eIF4AIII and Is Essential for Nonsense-Mediated mRNA Decay in Arabidopsis

    KAUST Repository

    Cui, Peng

    2016-02-18

    © 2016 American Society of Plant Biologists. All rights reserved. Nonsense-mediated decay (NMD) is a posttranscriptional surveillance mechanism in eukaryotes that recognizes and degrades transcripts with premature translation-termination codons. The RNA polymerase II C-terminal domain phosphatase-like protein FIERY2 (FRY2; also known as C-TERMINAL DOMAIN PHOSPHATASE-LIKE1 [CPL1]) plays multiple roles in RNA processing in Arabidopsis thaliana. Here, we found that FRY2/CPL1 interacts with two NMD factors, eIF4AIII and UPF3, and is involved in the dephosphorylation of eIF4AIII. This dephosphorylation retains eIF4AIII in the nucleus and limits its accumulation in the cytoplasm. By analyzing RNA-seq data combined with quantitative RT-PCR validation, we found that a subset of alternatively spliced transcripts and 59-extended mRNAs with NMD-eliciting features accumulated in the fry2-1 mutant, cycloheximidetreated wild type, and upf3 mutant plants, indicating that FRY2 is essential for the degradation of these NMD transcripts.

  5. The RNA Polymerase II C-Terminal Domain Phosphatase-Like Protein FIERY2/CPL1 Interacts with eIF4AIII and Is Essential for Nonsense-Mediated mRNA Decay in Arabidopsis

    KAUST Repository

    Cui, Peng; Chen, Tao; Qin, Tao; Ding, Feng; Wang, Zhenyu; Chen, Hao; Xiong, Liming

    2016-01-01

    © 2016 American Society of Plant Biologists. All rights reserved. Nonsense-mediated decay (NMD) is a posttranscriptional surveillance mechanism in eukaryotes that recognizes and degrades transcripts with premature translation-termination codons. The RNA polymerase II C-terminal domain phosphatase-like protein FIERY2 (FRY2; also known as C-TERMINAL DOMAIN PHOSPHATASE-LIKE1 [CPL1]) plays multiple roles in RNA processing in Arabidopsis thaliana. Here, we found that FRY2/CPL1 interacts with two NMD factors, eIF4AIII and UPF3, and is involved in the dephosphorylation of eIF4AIII. This dephosphorylation retains eIF4AIII in the nucleus and limits its accumulation in the cytoplasm. By analyzing RNA-seq data combined with quantitative RT-PCR validation, we found that a subset of alternatively spliced transcripts and 59-extended mRNAs with NMD-eliciting features accumulated in the fry2-1 mutant, cycloheximidetreated wild type, and upf3 mutant plants, indicating that FRY2 is essential for the degradation of these NMD transcripts.

  6. A kinetic-based sigmoidal model for the polymerase chain reaction and its application to high-capacity absolute quantitative real-time PCR

    Directory of Open Access Journals (Sweden)

    Stewart Don

    2008-05-01

    Full Text Available Abstract Background Based upon defining a common reference point, current real-time quantitative PCR technologies compare relative differences in amplification profile position. As such, absolute quantification requires construction of target-specific standard curves that are highly resource intensive and prone to introducing quantitative errors. Sigmoidal modeling using nonlinear regression has previously demonstrated that absolute quantification can be accomplished without standard curves; however, quantitative errors caused by distortions within the plateau phase have impeded effective implementation of this alternative approach. Results Recognition that amplification rate is linearly correlated to amplicon quantity led to the derivation of two sigmoid functions that allow target quantification via linear regression analysis. In addition to circumventing quantitative errors produced by plateau distortions, this approach allows the amplification efficiency within individual amplification reactions to be determined. Absolute quantification is accomplished by first converting individual fluorescence readings into target quantity expressed in fluorescence units, followed by conversion into the number of target molecules via optical calibration. Founded upon expressing reaction fluorescence in relation to amplicon DNA mass, a seminal element of this study was to implement optical calibration using lambda gDNA as a universal quantitative standard. Not only does this eliminate the need to prepare target-specific quantitative standards, it relegates establishment of quantitative scale to a single, highly defined entity. The quantitative competency of this approach was assessed by exploiting "limiting dilution assay" for absolute quantification, which provided an independent gold standard from which to verify quantitative accuracy. This yielded substantive corroborating evidence that absolute accuracies of ± 25% can be routinely achieved. Comparison

  7. Utility of loop-mediated isothermal amplification assay, polymerase chain reaction, and elisa for diagnosis of leptospirosis in South Indian patients

    Directory of Open Access Journals (Sweden)

    Mallika Sengupta

    2017-01-01

    Full Text Available Background: Leptospirosis is a zoonotic disease which requires laboratory diagnosis for confirmation. Materials and Methods: In this study serum samples from adults with acute undifferentiated fever (duration ≤15 days were tested for IgM antibodies to Leptospira by ELISA, PCR for rrs gene and loop-mediated isothermal amplification (LAMP assay for LipL32 and LipL41. Results: Among the 150 sera tested, three were positive by PCR, LAMP and IgM ELISA/modified Faines' criteria, two by only PCR; seven only by LAMP assay and forty fulfilled modified Faine's criteria (illness clinically compatible and IgM ELISA positive for leptospirosis. Clinical correlation revealed renal compromise, low platelet count and severe jaundice were significantly related to leptospirosis (P < 0.05. Conclusion: This study suggests that LAMP assay could be useful for diagnosis of leptospirosis during the 1st week of illness whereas IgM ELISA forms the mainstay of diagnosis from the 2nd week onward. Further studies especially community based, comparing ELISA, PCR, LAMP, culture and microscopic agglutination test are required to evaluate the veracity of these findings.

  8. Effect of gamma radiation on the growth of Aspergillus Flavus aflatoxins producer and on the use of polymerase chain reaction technique (PCR) in samples of maize grains artificially inoculated

    International Nuclear Information System (INIS)

    Aquino, Simone

    2003-01-01

    The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x10 6 spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB 1 and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)

  9. Clinical evaluation and validation of laboratory methods for the diagnosis of Bordetella pertussis infection: Culture, polymerase chain reaction (PCR) and anti-pertussis toxin IgG serology (IgG-PT).

    Science.gov (United States)

    Lee, Adria D; Cassiday, Pamela K; Pawloski, Lucia C; Tatti, Kathleen M; Martin, Monte D; Briere, Elizabeth C; Tondella, M Lucia; Martin, Stacey W

    2018-01-01

    The appropriate use of clinically accurate diagnostic tests is essential for the detection of pertussis, a poorly controlled vaccine-preventable disease. The purpose of this study was to estimate the sensitivity and specificity of different diagnostic criteria including culture, multi-target polymerase chain reaction (PCR), anti-pertussis toxin IgG (IgG-PT) serology, and the use of a clinical case definition. An additional objective was to describe the optimal timing of specimen collection for the various tests. Clinical specimens were collected from patients with cough illness at seven locations across the United States between 2007 and 2011. Nasopharyngeal and blood specimens were collected from each patient during the enrollment visit. Patients who had been coughing for ≤ 2 weeks were asked to return in 2-4 weeks for collection of a second, convalescent blood specimen. Sensitivity and specificity of each diagnostic test were estimated using three methods-pertussis culture as the "gold standard," composite reference standard analysis (CRS), and latent class analysis (LCA). Overall, 868 patients were enrolled and 13.6% were B. pertussis positive by at least one diagnostic test. In a sample of 545 participants with non-missing data on all four diagnostic criteria, culture was 64.0% sensitive, PCR was 90.6% sensitive, and both were 100% specific by LCA. CRS and LCA methods increased the sensitivity estimates for convalescent serology and the clinical case definition over the culture-based estimates. Culture and PCR were most sensitive when performed during the first two weeks of cough; serology was optimally sensitive after the second week of cough. Timing of specimen collection in relation to onset of illness should be considered when ordering diagnostic tests for pertussis. Consideration should be given to including IgG-PT serology as a confirmatory test in the Council of State and Territorial Epidemiologists (CSTE) case definition for pertussis.

  10. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium.

    Science.gov (United States)

    Die, Jose V; Baldwin, Ransom L; Rowland, Lisa J; Li, Robert; Oh, Sunghee; Li, Congjun; Connor, Erin E; Ranilla, Maria-Jose

    2017-01-01

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following introduction of solid feed to the weaning neonate as well as affecting the metabolism of other nutrients and absorption of nutrients in in vitro experiments. The objective of the present study was to validate expression stability of eight putative reference genes bovine rumen, considering the intrinsic heterogeneity of bovine rumen with regard to different luminal characteristics due to direct infusion of butyrate to double the intra-ruminal content of the rumen liquor. Our focus was on identifying stable reference genes which are suitable to normalize real-time RT-qPCR experiments from rumen samples collected from clinical assays, irrespective of localization within the organ and the across physiological state. The most stably expressed genes included: ACTB, UXT, DBNDD2, RPS9, DDX54 and HMBS. Their high stability values suggest these reference genes will facilitate better evaluation of variation of across an array of conditions including: localization within the rumen, differences among cattle fed an array of rations, as well as response to development in the weaning animal. Moreover, we anticipate these reference genes may be useful for expression studies in other ruminants.

  11. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR analysis in the rumen epithelium.

    Directory of Open Access Journals (Sweden)

    Jose V Die

    Full Text Available The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following introduction of solid feed to the weaning neonate as well as affecting the metabolism of other nutrients and absorption of nutrients in in vitro experiments. The objective of the present study was to validate expression stability of eight putative reference genes bovine rumen, considering the intrinsic heterogeneity of bovine rumen with regard to different luminal characteristics due to direct infusion of butyrate to double the intra-ruminal content of the rumen liquor. Our focus was on identifying stable reference genes which are suitable to normalize real-time RT-qPCR experiments from rumen samples collected from clinical assays, irrespective of localization within the organ and the across physiological state. The most stably expressed genes included: ACTB, UXT, DBNDD2, RPS9, DDX54 and HMBS. Their high stability values suggest these reference genes will facilitate better evaluation of variation of across an array of conditions including: localization within the rumen, differences among cattle fed an array of rations, as well as response to development in the weaning animal. Moreover, we anticipate these reference genes may be useful for expression studies in other ruminants.

  12. Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

    Science.gov (United States)

    Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2017-11-01

    Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  13. The Arabidopsis Mediator Complex Subunits MED16, MED14, and MED2 Regulate Mediator and RNA Polymerase II Recruitment to CBF-Responsive Cold-Regulated Genes[C][W][OPEN

    Science.gov (United States)

    Hemsley, Piers A.; Hurst, Charlotte H.; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R.; De Cothi, Elizabeth A.; Steele, John F.; Knight, Heather

    2014-01-01

    The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation–induced freezing tolerance. In addition, these three subunits are required for low temperature–induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced. PMID:24415770

  14. Time Course of Detection of Human Male DNA from Stained Blood Sample on Various Surfaces by Loop Mediated Isothermal Amplification and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Panan Kanchanaphum

    2018-01-01

    Full Text Available This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP, and LAMP-Lateral Flow Dipstick (LFD. For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, wood, clay, and tile. Then, the samples were stored at room temperature for 1, 7, 30, and 60 day(s. After the DNA amplification, the gel electrophoresis process was applied to detect LAMP product. The LFD was combined with the LAMP to detect LAMP product on the male cloth samples. For the male samples, the time course of detection on the first and seventh days indicated positive for both LAMP and PCR products on all the surfaces while no DNA amplification was found on any of the female samples. On day 30, positive LAMP product was still found on all the male samples. However, it had faded on the tiles. Moreover, all the male samples, which had tested positive for PCR product, were blurred and unclear. On day 60, LAMP product was still found on all the male samples. Conversely, the PCR method resulted in no bands showing for any of the male samples. However, the LAMP-LFD method detected product on all the male samples of cloth. The results show that the LAMP is an effective, practical, and reliable molecular-biological method. Moreover, the LFD can increase the efficiency and sensitivity of the LAMP, making it more suitable for field studies because gel electrophoresis apparatus is not required.

  15. Endoplasmic reticulum stress-responsive transcription factor ATF6α directs recruitment of the Mediator of RNA polymerase II transcription and multiple histone acetyltransferase complexes.

    Science.gov (United States)

    Sela, Dotan; Chen, Lu; Martin-Brown, Skylar; Washburn, Michael P; Florens, Laurence; Conaway, Joan Weliky; Conaway, Ronald C

    2012-06-29

    The basic leucine zipper transcription factor ATF6α functions as a master regulator of endoplasmic reticulum (ER) stress response genes. Previous studies have established that, in response to ER stress, ATF6α translocates to the nucleus and activates transcription of ER stress response genes upon binding sequence specifically to ER stress response enhancer elements in their promoters. In this study, we investigate the biochemical mechanism by which ATF6α activates transcription. By exploiting a combination of biochemical and multidimensional protein identification technology-based mass spectrometry approaches, we have obtained evidence that ATF6α functions at least in part by recruiting to the ER stress response enhancer elements of ER stress response genes a collection of RNA polymerase II coregulatory complexes, including the Mediator and multiple histone acetyltransferase complexes, among which are the Spt-Ada-Gcn5 acetyltransferase (SAGA) and Ada-Two-A-containing (ATAC) complexes. Our findings shed new light on the mechanism of action of ATF6α, and they outline a straightforward strategy for applying multidimensional protein identification technology mass spectrometry to determine which RNA polymerase II transcription factors and coregulators are recruited to promoters and other regulatory elements to control transcription.

  16. Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

    Science.gov (United States)

    Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

    2018-01-01

    Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

  17. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  18. Arabidopsis RNA Polymerase V Mediates Enhanced Compaction and Silencing of Geminivirus and Transposon Chromatin during Host Recovery from Infection.

    Science.gov (United States)

    Coursey, Tami; Regedanz, Elizabeth; Bisaro, David M

    2018-04-01

    Plants employ RNA-directed DNA methylation (RdDM) and dimethylation of histone 3 lysine 9 (H3K9me2) to silence geminiviruses and transposable elements (TEs). We previously showed that canonical RdDM (Pol IV-RdDM) involving RNA polymerases IV and V (Pol IV and Pol V) is required for Arabidopsis thaliana to recover from infection with Beet curly top virus lacking a suppressor protein that inhibits methylation (BCTV L2 - ). Recovery, which is characterized by reduced viral DNA levels and symptom remission, allows normal floral development. Here, we used formaldehyde-assisted isolation of regulatory elements (FAIRE) to confirm that >90% of BCTV L2 - chromatin is highly compacted during recovery, and a micrococcal nuclease-chromatin immunoprecipitation assay showed that this is largely due to increased nucleosome occupancy. Physical compaction correlated with augmented cytosine and H3K9 methylation and with reduced viral gene expression. We additionally demonstrated that these phenomena are dependent on Pol V and by extension the Pol IV-RdDM pathway. BCTV L2 - was also used to evaluate the impact of viral infection on host loci, including repressed retrotransposons Ta3 and Athila6A Remarkably, an unexpected Pol V-dependent hypersuppression of these TEs was observed, resulting in transcript levels even lower than those detected in uninfected plants. Hypersuppression is likely to be especially important for natural recovery from wild-type geminiviruses, as viral L2 and AL2 proteins cause ectopic TE expression. Thus, Pol IV-RdDM targets both viral and TE chromatin during recovery, simultaneously silencing the majority of viral genomes and maintaining host genome integrity by enforcing tighter control of TEs in future reproductive tissues. IMPORTANCE In plants, RdDM pathways use small RNAs to target cytosine and H3K9 methylation, thereby silencing DNA virus genomes and transposable elements (TEs). Further, Pol IV-RdDM involving Pol IV and Pol V is a key aspect of host

  19. Two-temperature PCR for Microfluidics

    KAUST Repository

    Kodzius, Rimantas

    2010-05-01

    Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

  20. Two-temperature PCR for Microfluidics

    KAUST Repository

    Kodzius, Rimantas; Chang, Donald Choy; Sheng, Ping; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yu, Vivian

    2010-01-01

    Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

  1. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  2. Human Mediator Enhances Activator-Facilitated Recruitment of RNA Polymerase II and Promoter Recognition by TATA-Binding Protein (TBP) Independently of TBP-Associated Factors

    OpenAIRE

    Wu, Shwu-Yuan; Zhou, Tianyuan; Chiang, Cheng-Ming

    2003-01-01

    Mediator is a general cofactor implicated in the functions of many transcriptional activators. Although Mediator with different protein compositions has been isolated, it remains unclear how Mediator facilitates activator-dependent transcription, independent of its general stimulation of basal transcription. To define the mechanisms of Mediator function, we isolated two forms of human Mediator complexes (Mediator-P.5 and Mediator-P.85) and demonstrated that Mediator-P.5 clearly functions by e...

  3. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  4. Eliminating PCR contamination

    International Nuclear Information System (INIS)

    Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

    1991-01-01

    The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

  5. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  6. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

    Science.gov (United States)

    Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

    2011-02-01

    Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

  7. Polymerase chain Reaction in molecular biotechnology; appropriate technology for developing countries

    NARCIS (Netherlands)

    Felice, A. E.; Alshinawi, C.

    1996-01-01

    The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and

  8. Sources of PCR-induced distortions in high-throughput sequencing data sets

    Science.gov (United States)

    Kebschull, Justus M.; Zador, Anthony M.

    2015-01-01

    PCR permits the exponential and sequence-specific amplification of DNA, even from minute starting quantities. PCR is a fundamental step in preparing DNA samples for high-throughput sequencing. However, there are errors associated with PCR-mediated amplification. Here we examine the effects of four important sources of error—bias, stochasticity, template switches and polymerase errors—on sequence representation in low-input next-generation sequencing libraries. We designed a pool of diverse PCR amplicons with a defined structure, and then used Illumina sequencing to search for signatures of each process. We further developed quantitative models for each process, and compared predictions of these models to our experimental data. We find that PCR stochasticity is the major force skewing sequence representation after amplification of a pool of unique DNA amplicons. Polymerase errors become very common in later cycles of PCR but have little impact on the overall sequence distribution as they are confined to small copy numbers. PCR template switches are rare and confined to low copy numbers. Our results provide a theoretical basis for removing distortions from high-throughput sequencing data. In addition, our findings on PCR stochasticity will have particular relevance to quantification of results from single cell sequencing, in which sequences are represented by only one or a few molecules. PMID:26187991

  9. A dominant mutation in mediator of paramutation2, one of three second-largest subunits of a plant-specific RNA polymerase, disrupts multiple siRNA silencing processes.

    Science.gov (United States)

    Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L

    2009-11-01

    Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance

  10. Thermally multiplexed polymerase chain reaction.

    Science.gov (United States)

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  11. The use of real-time polymerase chain reaction with high resolution melting (real-time PCR-HRM) analysis for the detection and discrimination of nematodes Bursaphelenchus xylophilus and Bursaphelenchus mucronatus.

    Science.gov (United States)

    Filipiak, Anna; Hasiów-Jaroszewska, Beata

    2016-04-01

    The real-time PCR-HRM analysis was developed for the detection and discrimination of the quarantine nematode Bursaphelenchus xylophilus and Bursaphelenchus mucronatus. A set of primers was designed to target the ITS region of rDNA. The results have demonstrated that this analysis is a valuable tool for differentiation of these both species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Assessing HER2 amplification by IHC, FISH, and real-time polymerase chain reaction analysis (real-time PCR) following LCM in formalin-fixed paraffin embedded tissue from 40 women with ovarian cancer

    DEFF Research Database (Denmark)

    Hillig, Thore; Thode, Jørgen; Breinholt, Ellen Marie

    2012-01-01

    . Only few ovarian cancer patients were HER2 overexpressed measured by IHC or FISH and thus could be eligible for antibody-based therapy with trastuzumab (Herceptin). Interestingly, we find an increased number of HER2 positive patients by real-time PCR analysis on microdissected cancer cells, suggesting...

  13. The normally expressed kappa immunoglobulin light chain gene repertoire and somatic mutations studied by single-sided specific polymerase chain reaction (PCR); frequent occurrence of features often assigned to autoimmunity

    DEFF Research Database (Denmark)

    Juul, L; Hougs, L; Andersen, V

    1997-01-01

    The expressed human kappa light chain gene repertoire utilized by healthy individuals was studied by two different single-sided specific PCR techniques to avoid bias for certain V genes. A total of 103 rearranged kappa sequences from peripheral blood mononuclear cells from healthy individuals were...

  14. Mathematical analysis of the real time array PCR (RTA PCR) process

    NARCIS (Netherlands)

    Dijksman, Johan Frederik; Pierik, A.

    2012-01-01

    Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the

  15. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  16. The application of polymerase chain reaction-denaturing gradient ...

    African Journals Online (AJOL)

    Jane

    2011-05-23

    May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.

  17. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...

  18. H5N1 Influenza A Virus PB1-F2 Relieves HAX-1-Mediated Restriction of Avian Virus Polymerase PA in Human Lung Cells.

    Science.gov (United States)

    Mazel-Sanchez, B; Boal-Carvalho, I; Silva, F; Dijkman, R; Schmolke, M

    2018-06-01

    Highly pathogenic influenza A viruses (IAV) from avian hosts were first reported to directly infect humans 20 years ago. However, such infections are rare events, and our understanding of factors promoting or restricting zoonotic transmission is still limited. One accessory protein of IAV, PB1-F2, was associated with pathogenicity of pandemic and zoonotic IAV. This short (90-amino-acid) peptide does not harbor an enzymatic function. We thus identified host factors interacting with H5N1 PB1-F2, which could explain its importance for virulence. PB1-F2 binds to HCLS1-associated protein X1 (HAX-1), a recently identified host restriction factor of the PA subunit of IAV polymerase complexes. We demonstrate that the PA of a mammal-adapted H1N1 IAV is resistant to HAX-1 imposed restriction, while the PA of an avian-origin H5N1 IAV remains sensitive. We also showed HAX-1 sensitivity for PAs of A/Brevig Mission/1/1918 (H1N1) and A/Shanghai/1/2013 (H7N9), two avian-origin zoonotic IAV. Inhibition of H5N1 polymerase by HAX-1 can be alleviated by its PB1-F2 through direct competition. Accordingly, replication of PB1-F2-deficient H5N1 IAV is attenuated in the presence of large amounts of HAX-1. Mammal-adapted H1N1 and H3N2 viruses do not display this dependence on PB1-F2 for efficient replication in the presence of HAX-1. We propose that PB1-F2 plays a key role in zoonotic transmission of avian H5N1 IAV into humans. IMPORTANCE Aquatic and shore birds are the natural reservoir of influenza A viruses from which the virus can jump into a variety of bird and mammal host species, including humans. H5N1 influenza viruses are a good model for this process. They pose an ongoing threat to human and animal health due to their high mortality rates. However, it is currently unclear what restricts these interspecies jumps on the host side or what promotes them on the virus side. Here we show that a short viral peptide, PB1-F2, helps H5N1 bird influenza viruses to overcome a human restriction

  19. DNA polymerase I-mediated repair of 365 nm-induced single-strand breaks in the DNA of Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Ley, R D; Sedita, B A; Boye, E [Argonne National Lab., Ill. (USA)

    1978-03-01

    Irradiation of closed circular phage lambda DNA in vivo at 365 nm results in the induction of single-strand breaks and alkali-labile lesions at rates of 1.1 x 10/sup -14/ and 0.2 x 10/sup -14//dalton/J/m/sup 2/, respectively. The sum of the induction rates is similar to the rate of induction of single-strand breaks plus alkali-labile lesions (1 x 10/sup -14//dalton/J/m/sup 2/) observed in the E. coli genome. Postirradiation incubation of wild-type cells in buffer results in rapid repair of the breaks (up to 80% repaired in 10 min). No repair was observed in a DNA polymerase I-deficient mutant of E.coli.

  20. Polymerase chain reaction to search for Herpes viruses in uveitic ...

    African Journals Online (AJOL)

    Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.

  1. Polymerase chain reaction for the detection of Mycobacterium leprae

    NARCIS (Netherlands)

    Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

    1989-01-01

    A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

  2. High-resolution melting-curve analysis of ligation-mediated real-time PCR for rapid evaluation of an epidemiological outbreak of extended-spectrum-beta-lactamase-producing Escherichia coli.

    Science.gov (United States)

    Woksepp, Hanna; Jernberg, Cecilia; Tärnberg, Maria; Ryberg, Anna; Brolund, Alma; Nordvall, Michaela; Olsson-Liljequist, Barbro; Wisell, Karin Tegmark; Monstein, Hans-Jürg; Nilsson, Lennart E; Schön, Thomas

    2011-12-01

    Methods for the confirmation of nosocomial outbreaks of bacterial pathogens are complex, expensive, and time-consuming. Recently, a method based on ligation-mediated PCR (LM/PCR) using a low denaturation temperature which produces specific melting-profile patterns of DNA products has been described. Our objective was to further develop this method for real-time PCR and high-resolution melting analysis (HRM) in a single-tube system optimized in order to achieve results within 1 day. Following the optimization of LM/PCR for real-time PCR and HRM (LM/HRM), the method was applied for a nosocomial outbreak of extended-spectrum-beta-lactamase (ESBL)-producing and ST131-associated Escherichia coli isolates (n = 15) and control isolates (n = 29), including four previous clusters. The results from LM/HRM were compared to results from pulsed-field gel electrophoresis (PFGE), which served as the gold standard. All isolates from the nosocomial outbreak clustered by LM/HRM, which was confirmed by gel electrophoresis of the LM/PCR products and PFGE. Control isolates that clustered by LM/PCR (n = 4) but not by PFGE were resolved by confirmatory gel electrophoresis. We conclude that LM/HRM is a rapid method for the detection of nosocomial outbreaks of bacterial infections caused by ESBL-producing E. coli strains. It allows the analysis of isolates in a single-tube system within a day, and the discriminatory power is comparable to that of PFGE.

  3. High-Resolution Melting-Curve Analysis of Ligation-Mediated Real-Time PCR for Rapid Evaluation of an Epidemiological Outbreak of Extended-Spectrum-Beta-Lactamase-Producing Escherichia coli ▿

    Science.gov (United States)

    Woksepp, Hanna; Jernberg, Cecilia; Tärnberg, Maria; Ryberg, Anna; Brolund, Alma; Nordvall, Michaela; Olsson-Liljequist, Barbro; Wisell, Karin Tegmark; Monstein, Hans-Jürg; Nilsson, Lennart E.; Schön, Thomas

    2011-01-01

    Methods for the confirmation of nosocomial outbreaks of bacterial pathogens are complex, expensive, and time-consuming. Recently, a method based on ligation-mediated PCR (LM/PCR) using a low denaturation temperature which produces specific melting-profile patterns of DNA products has been described. Our objective was to further develop this method for real-time PCR and high-resolution melting analysis (HRM) in a single-tube system optimized in order to achieve results within 1 day. Following the optimization of LM/PCR for real-time PCR and HRM (LM/HRM), the method was applied for a nosocomial outbreak of extended-spectrum-beta-lactamase (ESBL)-producing and ST131-associated Escherichia coli isolates (n = 15) and control isolates (n = 29), including four previous clusters. The results from LM/HRM were compared to results from pulsed-field gel electrophoresis (PFGE), which served as the gold standard. All isolates from the nosocomial outbreak clustered by LM/HRM, which was confirmed by gel electrophoresis of the LM/PCR products and PFGE. Control isolates that clustered by LM/PCR (n = 4) but not by PFGE were resolved by confirmatory gel electrophoresis. We conclude that LM/HRM is a rapid method for the detection of nosocomial outbreaks of bacterial infections caused by ESBL-producing E. coli strains. It allows the analysis of isolates in a single-tube system within a day, and the discriminatory power is comparable to that of PFGE. PMID:21956981

  4. Testing for Genetically Modified Foods Using PCR

    Science.gov (United States)

    Taylor, Ann; Sajan, Samin

    2005-01-01

    The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…

  5. Reação em Cadeia da Polimerase (PCR baseada no gene cpx para detecção de Actinobacillus pleuropneumoniae em suínos natural e experimentalmente infectados Polymerase Chain Reaction (PCR based on the cpx gene for detection of Actinobacillus pleuropneumoniae in natural and experimentally infected pigs

    Directory of Open Access Journals (Sweden)

    Karina Koerich de Souza

    2008-10-01

    Full Text Available A pleuropneumonia suína é uma das mais importantes doenças respiratórias dos suínos, estando presente em todos os países produtores. Para o controle e o monitoramento da pleuropneumonia, é necessário o desenvolvimento de métodos rápidos e acurados de diagnóstico. Com o objetivo de validar a técnica da PCR, baseada no gene cpx de Actinobacillus pleuropneumoniae, em suínos sabidamente positivos, primeiramente foi realizada inoculação experimental com amostras de A. pleuropneumoniae sorotipo 5B e coletadas amostras por meio de suabe de tonsila, biópsia de tonsila e sangue para realização da técnica de PCR, isolamento bacteriológico e teste de ELISA, respectivamente. Posteriormente, estas técnicas foram aplicadas em suínos naturalmente infectados, em três rebanhos com diferentes situações sanitárias quanto à apresentação clínica da doença. De cada rebanho, foram analisados cinco grupos de suínos com idades diferentes, sendo coletado de cada animal biópsia de tonsila para isolamento bacteriológico e PCR e sangue para determinação do perfil sorológico. Os resultados obtidos na inoculação experimental confirmaram que, mesmo com o estabelecimento da infecção comprovada pelo isolamento bacteriológico, após o período de 45 dias, não foi possível detectar o agente pela técnica de PCR. Em animais naturalmente infectados, a técnica de PCR apresentou maior sensibilidade quando comparado com o isolamento. A associação entre PCR e ELISA demonstrou ser uma boa alternativa para definir a situação sanitária do rebanho quanto à infecção por A. pleuropneumoniae.Swine pleuropneumonia is one of the most important pig respiratory diseases and has been found in all producer countries. For control and monitoring of pleuropneumonia, it is necessary the development of fast and specific methods of diagnosis. To validate PCR based on the cpx gene of Actinobacillus pleuropneumoniae in positive pigs, an experimental

  6. Are There Mutator Polymerases?

    Directory of Open Access Journals (Sweden)

    Miguel Garcia-Diaz

    2003-01-01

    Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.

  7. Effect of gamma radiation on the growth of Aspergillus Flavus aflatoxins producer and on the use of polymerase chain reaction technique (PCR) in samples of maize grains artificially inoculated; Efeitos da radiacao gama no crescimento de Aspergillus flavus produtor de aflatoxinas e no emprego da tecnica da Reacao em Cadeia da Polimerase (RCP) em amostras de graos de milho inoculadas artificialmente

    Energy Technology Data Exchange (ETDEWEB)

    Aquino, Simone

    2003-07-01

    The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x10{sup 6} spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB{sub 1} and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)

  8. Estimation of the reaction efficiency in polymerase chain reaction

    NARCIS (Netherlands)

    Lalam, N.

    2006-01-01

    Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

  9. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  10. Comparison of loop-mediated isothermal amplification (LAMP) and nested-PCR assay targeting the RE and B1 gene for detection of Toxoplasma gondii in blood samples of children with leukaemia.

    Science.gov (United States)

    Fallahi, Shirzad; Seyyed Tabaei, Seyyed Javad; Pournia, Yadollah; Zebardast, Nozhat; Kazemi, Bahram

    2014-07-01

    Toxoplasmosis diagnosis constitutes an important measure for disease prevention and control. In this paper, a newly described DNA amplification technique, loop-mediated isothermal amplification (LAMP), and nested-PCR targeting the repeated element (RE) and B1 gene, were compared to each other for the detection of Toxoplasma gondii DNA in blood samples of children with leukaemia. One hundred ten blood samples from these patients were analyzed by LAMP and nested-PCR. Out of 50 seropositive samples (IgM+, IgG+), positive results were obtained with 92% and 86% on RE, B1-LAMP and 82% and 68% on RE, B1-nested PCR analyses, respectively. Of the 50 seronegative samples, three, two and one samples were detected positive by RE-LAMP, B1-LAMP and RE-nested PCR assays, respectively, while none were detected positive by B1-nested PCR. None of the 10 IgM-, IgG+ samples was detected positive after testing LAMP and nested-PCR assays in duplicate. This is the first report of a study in which the LAMP method was applied with high sensitivity and efficacy for the diagnosis of T. gonii in blood samples of children with leukaemia. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases.

    Science.gov (United States)

    Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes

    2017-02-07

    Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

  12. Inhibiting HER3-mediated tumor cell growth with affibody molecules engineered to low picomolar affinity by position-directed error-prone PCR-like diversification.

    Science.gov (United States)

    Malm, Magdalena; Kronqvist, Nina; Lindberg, Hanna; Gudmundsdotter, Lindvi; Bass, Tarek; Frejd, Fredrik Y; Höidén-Guthenberg, Ingmarie; Varasteh, Zohreh; Orlova, Anna; Tolmachev, Vladimir; Ståhl, Stefan; Löfblom, John

    2013-01-01

    The HER3 receptor is implicated in the progression of various cancers as well as in resistance to several currently used drugs, and is hence a potential target for development of new therapies. We have previously generated Affibody molecules that inhibit heregulin-induced signaling of the HER3 pathways. The aim of this study was to improve the affinity of the binders to hopefully increase receptor inhibition efficacy and enable a high receptor-mediated uptake in tumors. We explored a novel strategy for affinity maturation of Affibody molecules that is based on alanine scanning followed by design of library diversification to mimic the result from an error-prone PCR reaction, but with full control over mutated positions and thus less biases. Using bacterial surface display and flow-cytometric sorting of the maturation library, the affinity for HER3 was improved more than 30-fold down to 21 pM. The affinity is among the higher that has been reported for Affibody molecules and we believe that the maturation strategy should be generally applicable for improvement of affinity proteins. The new binders also demonstrated an improved thermal stability as well as complete refolding after denaturation. Moreover, inhibition of ligand-induced proliferation of HER3-positive breast cancer cells was improved more than two orders of magnitude compared to the previously best-performing clone. Radiolabeled Affibody molecules showed specific targeting of a number of HER3-positive cell lines in vitro as well as targeting of HER3 in in vivo mouse models and represent promising candidates for future development of targeted therapies and diagnostics.

  13. Evolving a polymerase for hydrophobic base analogues.

    Science.gov (United States)

    Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

    2009-10-21

    Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

  14. Sixty-five radiation hybrids for the short arm of human chromosome 6: their value as a mapping panel and as a source for rapid isolation of new probes using repeat element-mediated PCR

    International Nuclear Information System (INIS)

    Zoghbi, H.Y.; McCall, A.E.; LeBorgne-Demarquoy, F.

    1991-01-01

    We have used an irradiation and fusion procedure to generate somatic cell hybrids that retain fragments of the short arm of human chromosome 6 (6p). To identify hybrids retaining human material, we performed repeat element-mediated PCR on crude lysates of cells from individual clones. Sixty-five hybrids were shown to contain human material and fifty of those contained one or more 6p-specific probes. Detailed characterization of these hybrids identified a subset that divides 6p into ten mapping intervals. Using repeat element-mediated PCR, we were able to isolate and map 61 new DNA fragments from specific regions of 6p. Fifteen of these fragments were used to screen for restriction fragment length polymorphisms (RFLPs), and nine identified RFLPs with one or more enzymes. The radiation hybrids described in this study provide a valuable resource for high-resolution mapping of 6p and for the rapid isolation of region-specific markers

  15. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2014-03-01

    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  16. Mediatization

    DEFF Research Database (Denmark)

    Hjarvard, Stig

    2017-01-01

    Mediatization research shares media effects studies' ambition of answering the difficult questions with regard to whether and how media matter and influence contemporary culture and society. The two approaches nevertheless differ fundamentally in that mediatization research seeks answers...... to these general questions by distinguishing between two concepts: mediation and mediatization. The media effects tradition generally considers the effects of the media to be a result of individuals being exposed to media content, i.e. effects are seen as an outcome of mediated communication. Mediatization...... research is concerned with long-term structural changes involving media, culture, and society, i.e. the influences of the media are understood in relation to how media are implicated in social and cultural changes and how these processes come to create new conditions for human communication and interaction...

  17. Reacción en cadena de la polimerasa: una contribución para el diagnóstico de la tuberculosis extrapulmonar y de las micobacteriosis Polymerase chain reaction (PCR: a contribution for diagnosis of extrapulmonary tuberculosis and micobacteriosis

    Directory of Open Access Journals (Sweden)

    GLORIA PUERTO

    2007-06-01

    tuberculosas en 6 (10,3% pacientes, así: 4 (7% en esputo, 1 (1,75% en secreción de abdomen y 1 (1,75% en secreción de lesiones en piel. Un aislamiento de Mycobacterium chelonae de piel se asoció con un tratamiento previo con mesoterapia. No se encontró relación entre el estado de ¿portador de? VIH, con las patologías estudiadas. Discusión. Se presenta la PCR como una buena ayuda diagnóstica, específicamente, por la obtención de resultados en un lapso de 3 días.Introduction: The World Health Organization defines extrapulmonary tuberculosis as the disease located in any type of organ different from the lungs, and mycobacteriosis as the bacterial infection produced by environmental Mycobacteria. The diagnosis of extrapulmonary tuberculosis and mycobacteriosis is achieved fundamentally by culture and later identification of bacteria by biochemical tests, as well as by sputum smear for the first case. Culture presents limitations specially related with the time of incubation that can last up to 12 weeks and with the sensitivity to the presence of the microorganism. Currently, molecular tools allow a decrease in the time of diagnosis. Among these tools, the polymerase chain reaction (PCR is a rapid test with good sensitivity and specificity for the identification of pathogenic Mycobacteria. Objective: To implement PCR as support to the diagnosis of extrapulmonary tuberculosis and mycobacteriosis to decrease the time in obtaining results and to contribute to the implementation of appropriate treatments for these diseases. Materials and methods: The study was carried out between June 2005 and August 2006. 57 clinical samples of 15 hospitals throughout the country were analyzed by PCR for the sequence of insertion of IS6110 and for the gene hsp65. Clinical information of the patients, age, sex, and VIH test were included. Results: Results of amplification for PCR IS6110 were positive in 6 patients suggesting extrapulmonary tuberculosis and for PCR hsp65 in an equivalent

  18. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  19. A novel RT-PCR for the detection of Helicobacter pylori and identification of clarithromycin resistance mediated by mutations in the 23S rRNA gene.

    Science.gov (United States)

    Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline

    2018-01-01

    In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

    Science.gov (United States)

    Vela, J; Vitorica, J; Ruano, D

    2001-12-01

    We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

  1. The expanding polymerase universe.

    Science.gov (United States)

    Goodman, M F; Tippin, B

    2000-11-01

    Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.

  2. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  3. Evaluation of carrier-mediated siRNA delivery

    DEFF Research Database (Denmark)

    Colombo, Stefano; Nielsen, Hanne Mørck; Foged, Camilla

    2013-01-01

    RNA delivery. An in vitro cell culture model system expressing enhanced green fluorescent protein (EGFP) was used to develop the assay, which was based on the intracellular quantification of a full-length double-stranded Dicer substrate siRNA by stem-loop RT qPCR. The result is a well-documented protocol......RNA delivered by use of carriers remains an analytical challenge. The purpose of the present study was to optimize and validate an analytical protocol based on stem-loop reverse transcription quantitative polymerase chain reaction (RT qPCR) to quantitatively monitor the carrier-mediated intracellular si...

  4. Blood grouping based on PCR methods and agarose gel electrophoresis.

    Science.gov (United States)

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  5. Pathogen detection by the polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

    1994-05-01

    In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

  6. Polymerase chain reaction (PCR) detection of mixed trypanosome ...

    African Journals Online (AJOL)

    user

    2012-10-02

    Oct 2, 2012 ... trypanosome infection and blood meal origin in field-captured tsetse flies ... species of protozoan parasites of the genus. Trypanosoma. ..... and leopard. .... McNamara J, Dukes P, Snow WF, Gibson WC (1989). Use of DNA.

  7. Polymerase Chain Reaction (PCR) Detection Of The Genome Of ...

    African Journals Online (AJOL)

    ... cycling of virus between argasid soft ticks (Ornithodoros moubata complex) and wild ... The technique consists essentially of the enzymatic synthesis of millions of ... hybridization of specific DNA primers to the template and extension of the ...

  8. Multiplex polymerase chain reaction (PCR) assay for simultaneous ...

    African Journals Online (AJOL)

    To evaluate the etiology of shiga toxin-producing E. coli (STEC), enteropathogenic E. coli (EPEC) and enteroinvasive E. coli (EIEC) in children with diarrhea in Iran a total 300 stool specimens from children with diarrhea were tested for the detection of E.coli. Out of 300 samples, 39 were identified as E. coli by biochemical ...

  9. Multiplex polymerase chain reaction (PCR) assay for simultaneous ...

    African Journals Online (AJOL)

    user

    2011-02-28

    Feb 28, 2011 ... To evaluate the etiology of shiga toxin-producing E. coli (STEC), enteropathogenic E. ... National Center for Biotechnology Information; BLAST, Basic ... Poor sanitation, personal ..... Mem Inst Oswaldo Cruz, Rio de Janeiro.

  10. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

    Science.gov (United States)

    Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

    2012-11-16

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

  11. Comparison of DNA Microarray, Loop-Mediated Isothermal Amplification (LAMP) and Real-Time PCR with DNA Sequencing for Identification of Fusarium spp. Obtained from Patients with Hematologic Malignancies.

    Science.gov (United States)

    de Souza, Marcela; Matsuzawa, Tetsuhiro; Sakai, Kanae; Muraosa, Yasunori; Lyra, Luzia; Busso-Lopes, Ariane Fidelis; Levin, Anna Sara Shafferman; Schreiber, Angélica Zaninelli; Mikami, Yuzuru; Gonoi, Tohoru; Kamei, Katsuhiko; Moretti, Maria Luiza; Trabasso, Plínio

    2017-08-01

    The performance of three molecular biology techniques, i.e., DNA microarray, loop-mediated isothermal amplification (LAMP), and real-time PCR were compared with DNA sequencing for properly identification of 20 isolates of Fusarium spp. obtained from blood stream as etiologic agent of invasive infections in patients with hematologic malignancies. DNA microarray, LAMP and real-time PCR identified 16 (80%) out of 20 samples as Fusarium solani species complex (FSSC) and four (20%) as Fusarium spp. The agreement among the techniques was 100%. LAMP exhibited 100% specificity, while DNA microarray, LAMP and real-time PCR showed 100% sensitivity. The three techniques had 100% agreement with DNA sequencing. Sixteen isolates were identified as FSSC by sequencing, being five Fusarium keratoplasticum, nine Fusarium petroliphilum and two Fusarium solani. On the other hand, sequencing identified four isolates as Fusarium non-solani species complex (FNSSC), being three isolates as Fusarium napiforme and one isolate as Fusarium oxysporum. Finally, LAMP proved to be faster and more accessible than DNA microarray and real-time PCR, since it does not require a thermocycler. Therefore, LAMP signalizes as emerging and promising methodology to be used in routine identification of Fusarium spp. among cases of invasive fungal infections.

  12. Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

    KAUST Repository

    Wen, Weijia; Wu, Jinbo; Kodzius, Rimantas

    2011-01-01

    A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable

  13. DNA repair synthesis in human fibroblasts requires DNA polymerase delta

    International Nuclear Information System (INIS)

    Nishida, C.; Reinhard, P.; Linn, S.

    1988-01-01

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

  14. Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses

    Directory of Open Access Journals (Sweden)

    Kieu The Loan Trinh

    2016-05-01

    Full Text Available Purpose: We aim to fabricate a thermoplastic poly(methylmethacrylate (PMMA Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs for rapid molecular detection of foodborne pathogen bacteria. Methods: A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. Results: A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. Conclusions: In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately.

  15. Detection of Mycobacterium Tuberculosis by using PCR

    International Nuclear Information System (INIS)

    Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.

    1996-01-01

    Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g

  16. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  17. Real-time PCR in virology

    OpenAIRE

    Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas

    2002-01-01

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...

  18. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  19. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    2012-03-30

    Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...

  20. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  1. Multiplex-PCR-Based Screening and Computational Modeling of Virulence Factors and T-Cell Mediated Immunity in Helicobacter pylori Infections for Accurate Clinical Diagnosis.

    Directory of Open Access Journals (Sweden)

    Sinem Oktem-Okullu

    Full Text Available The outcome of H. pylori infection is closely related with bacteria's virulence factors and host immune response. The association between T cells and H. pylori infection has been identified, but the effects of the nine major H. pylori specific virulence factors; cagA, vacA, oipA, babA, hpaA, napA, dupA, ureA, ureB on T cell response in H. pylori infected patients have not been fully elucidated. We developed a multiplex- PCR assay to detect nine H. pylori virulence genes with in a three PCR reactions. Also, the expression levels of Th1, Th17 and Treg cell specific cytokines and transcription factors were detected by using qRT-PCR assays. Furthermore, a novel expert derived model is developed to identify set of factors and rules that can distinguish the ulcer patients from gastritis patients. Within all virulence factors that we tested, we identified a correlation between the presence of napA virulence gene and ulcer disease as a first data. Additionally, a positive correlation between the H. pylori dupA virulence factor and IFN-γ, and H. pylori babA virulence factor and IL-17 was detected in gastritis and ulcer patients respectively. By using computer-based models, clinical outcomes of a patients infected with H. pylori can be predicted by screening the patient's H. pylori vacA m1/m2, ureA and cagA status and IFN-γ (Th1, IL-17 (Th17, and FOXP3 (Treg expression levels. Herein, we report, for the first time, the relationship between H. pylori virulence factors and host immune responses for diagnostic prediction of gastric diseases using computer-based models.

  2. Multiplex-PCR-Based Screening and Computational Modeling of Virulence Factors and T-Cell Mediated Immunity in Helicobacter pylori Infections for Accurate Clinical Diagnosis.

    Science.gov (United States)

    Oktem-Okullu, Sinem; Tiftikci, Arzu; Saruc, Murat; Cicek, Bahattin; Vardareli, Eser; Tozun, Nurdan; Kocagoz, Tanil; Sezerman, Ugur; Yavuz, Ahmet Sinan; Sayi-Yazgan, Ayca

    2015-01-01

    The outcome of H. pylori infection is closely related with bacteria's virulence factors and host immune response. The association between T cells and H. pylori infection has been identified, but the effects of the nine major H. pylori specific virulence factors; cagA, vacA, oipA, babA, hpaA, napA, dupA, ureA, ureB on T cell response in H. pylori infected patients have not been fully elucidated. We developed a multiplex- PCR assay to detect nine H. pylori virulence genes with in a three PCR reactions. Also, the expression levels of Th1, Th17 and Treg cell specific cytokines and transcription factors were detected by using qRT-PCR assays. Furthermore, a novel expert derived model is developed to identify set of factors and rules that can distinguish the ulcer patients from gastritis patients. Within all virulence factors that we tested, we identified a correlation between the presence of napA virulence gene and ulcer disease as a first data. Additionally, a positive correlation between the H. pylori dupA virulence factor and IFN-γ, and H. pylori babA virulence factor and IL-17 was detected in gastritis and ulcer patients respectively. By using computer-based models, clinical outcomes of a patients infected with H. pylori can be predicted by screening the patient's H. pylori vacA m1/m2, ureA and cagA status and IFN-γ (Th1), IL-17 (Th17), and FOXP3 (Treg) expression levels. Herein, we report, for the first time, the relationship between H. pylori virulence factors and host immune responses for diagnostic prediction of gastric diseases using computer-based models.

  3. Polymerase chain reaction: Theory, practice and application: A review

    Directory of Open Access Journals (Sweden)

    S E Atawodi

    2010-01-01

    Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

  4. Comparison of LAMP and PCR for molecular mass screening of sand flies for Leishmania martiniquensis infection.

    Science.gov (United States)

    Tiwananthagorn, Saruda; Kato, Hirotomo; Yeewa, Ranchana; Muengpan, Amontip; Polseela, Raxsina; Leelayoova, Saovanee

    2017-02-01

    Leishmaniasis caused by Leishmania martiniquensis infection has been reported in human and domestic animals of Martinique Island, Germany, Switzerland, USA, Myanmar and Thailand. The peculiar clinical features of disseminated cutaneous and visceral forms co-existence render the urgent need of specific diagnostic tool to identify the natural sand fly vectors for effective prevention and control strategies. Loop-mediated isothermal amplification (LAMP) of 18S rRNA gene as well as polymerase chain reaction (PCR) of minicircle kinetoplast DNA gene (PCR-mkDNA) have never been applied to detect L. martiniquensis and L. siamensis in sand fly vectors. The present study was aimed to validate malachite green-LAMP (MG-LAMP) and PCR-mkDNA techniques to detect L. martiniquensis in sand fly vectors, compared with the conventional PCR of internal transcribed spacer 1 (PCR-ITS1). We compared the validity of LAMP of 18S rRNA gene and PCR-mkDNA, to PCR-ITS1 in simulation model of L. martiniquensis infection in Sergentomyia gemmea sand flies. Attributable to the sensitivity and specificity, PCR-mkDNA was consecutively applied to detect L. martiniquensis in 380 female sand fly individuals captured in the newly identified affected region of Lamphun Province, Thailand. Results showed that PCR-mkDNA could detect at least one promastigote per sand fly, which was 10-time superior to LAMP and PCR-ITS1. In addition, PCR-mkDNA was more specific, able to differentiate L. martiniquensis from other viscerotropic Leishmania species, such as L. siamensis, L. (L.) donovani, and L. (L.) infantum. Consecutively, mass screening of L. martiniquensis in 380 female sand fly individuals by PCR-mkDNA was implemented in a new affected area of Thailand where a patient with leishmaniasis/HIV co-infection resides; however Leishmania DNA was undetected. In conclusion, PCR-mkDNA is a promising tool for molecular mass screening of L. martiniquensis infection in outbreak areas where several species of Leishmania

  5. Comparison of LAMP and PCR for molecular mass screening of sand flies for Leishmania martiniquensis infection

    Science.gov (United States)

    Tiwananthagorn, Saruda; Kato, Hirotomo; Yeewa, Ranchana; Muengpan, Amontip; Polseela, Raxsina; Leelayoova, Saovanee

    2017-01-01

    BACKGROUND Leishmaniasis caused by Leishmania martiniquensis infection has been reported in human and domestic animals of Martinique Island, Germany, Switzerland, USA, Myanmar and Thailand. The peculiar clinical features of disseminated cutaneous and visceral forms co-existence render the urgent need of specific diagnostic tool to identify the natural sand fly vectors for effective prevention and control strategies. Loop-mediated isothermal amplification (LAMP) of 18S rRNA gene as well as polymerase chain reaction (PCR) of minicircle kinetoplast DNA gene (PCR-mkDNA) have never been applied to detect L. martiniquensis and L. siamensis in sand fly vectors. OBJECTIVE The present study was aimed to validate malachite green-LAMP (MG-LAMP) and PCR-mkDNA techniques to detect L. martiniquensis in sand fly vectors, compared with the conventional PCR of internal transcribed spacer 1 (PCR-ITS1). METHODS We compared the validity of LAMP of 18S rRNA gene and PCR-mkDNA, to PCR-ITS1 in simulation model of L. martiniquensis infection in Sergentomyia gemmea sand flies. Attributable to the sensitivity and specificity, PCR-mkDNA was consecutively applied to detect L. martiniquensis in 380 female sand fly individuals captured in the newly identified affected region of Lamphun Province, Thailand. FINDINGS AND MAIN CONCLUSIONS Results showed that PCR-mkDNA could detect at least one promastigote per sand fly, which was 10-time superior to LAMP and PCR-ITS1. In addition, PCR-mkDNA was more specific, able to differentiate L. martiniquensis from other viscerotropic Leishmania species, such as L. siamensis, L. (L.) donovani, and L. (L.) infantum. Consecutively, mass screening of L. martiniquensis in 380 female sand fly individuals by PCR-mkDNA was implemented in a new affected area of Thailand where a patient with leishmaniasis/HIV co-infection resides; however Leishmania DNA was undetected. In conclusion, PCR-mkDNA is a promising tool for molecular mass screening of L. martiniquensis

  6. Theory and applications of the polymerase chain reaction.

    Science.gov (United States)

    Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

    1990-04-01

    The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

  7. Loop-mediated Isothermal Amplification Assay to Rapidly Detect Wheat Streak Mosaic Virus in Quarantined Plants

    Directory of Open Access Journals (Sweden)

    Siwon Lee

    2015-12-01

    Full Text Available We developed a loop-mediated isothermal amplification (LAMP method to rapidly diagnose Wheat streak mosaic virus (WSMV during quarantine inspections of imported wheat, corn, oats, and millet. The LAMP method was developed as a plant quarantine inspection method for the first time, and its simplicity, quickness, specificity and sensitivity were verified compared to current reverse transcription-polymerase chain reaction (RT-PCR and nested PCR quarantine methods. We were able to quickly screen for WSMV at quarantine sites with many test samples; thus, this method is expected to contribute to plant quarantine inspections.

  8. DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction.

    Science.gov (United States)

    Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A

    2014-01-01

    The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.

  9. Detection of Giardia intestinalis in water samples collected from natural water reservoirs and wells in northern and north-eastern Poland using LAMP, real-time PCR and nested PCR.

    Science.gov (United States)

    Lass, Anna; Szostakowska, Beata; Korzeniewski, Krzysztof; Karanis, Panagiotis

    2017-10-01

    Giardia intestinalis is a protozoan parasite, transmitted to humans and animals by the faecal-oral route, mainly through contaminated water and food. Knowledge about the distribution of this parasite in surface water in Poland is fragmentary and incomplete. Accordingly, 36 environmental water samples taken from surface water reservoirs and wells were collected in Pomerania and Warmia-Masuria provinces, Poland. The 50 L samples were filtered and subsequently analysed with three molecular detection methods: loop-mediated isothermal amplification (LAMP), real-time polymerase chain reaction (real-time PCR) and nested PCR. Of the samples examined, Giardia DNA was found in 15 (42%) samples with the use of LAMP; in 12 (33%) of these samples, Giardia DNA from this parasite was also detected using real-time PCR; and in 9 (25%) using nested PCR. Sequencing of selected positive samples confirmed that the PCR products were fragments of the Giardia intestinalis small subunit rRNA gene. Genotyping using multiplex real-time PCR indicated the presence of assemblages A and B, with the latter predominating. The results indicate that surface water in Poland, as well as water taken from surface wells, may be a source of Giardia strains which are potentially pathogenic for humans. It was also demonstrated that LAMP assay is more sensitive than the other two molecular assays.

  10. Detection of siRNA Mediated Target mRNA Cleavage Activities in Human Cells by a Novel Stem-Loop Array RT-PCR Analysis

    Science.gov (United States)

    2016-09-07

    sequences of the target mRNA, and a double stranded stem at the 5′ end that forms a stem -loop to function as a forceps to stabilize the secondary...E-mjournal homepage: www.elsevier.com/locate/bbrepDetection of siRNA-mediated target mRNA cleavage activities in human cells by a novel stem -loop...challenges for the accurate and efficient detection and verification of cleavage sites on target mRNAs. Here we used a sensitive stem -loop array reverse

  11. A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods.

    Science.gov (United States)

    Nixon, Gavin J; Svenstrup, Helle F; Donald, Carol E; Carder, Caroline; Stephenson, Judith M; Morris-Jones, Stephen; Huggett, Jim F; Foy, Carole A

    2014-12-01

    Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR). There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These 'isothermal' methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT), akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP) assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.

  12. A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods

    Directory of Open Access Journals (Sweden)

    Gavin J. Nixon

    2014-12-01

    Full Text Available Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR. There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These ‘isothermal’ methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT, akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.

  13. A polymerase chain reaction strategy for the diagnosis of camelpox.

    Science.gov (United States)

    Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

    2009-03-01

    Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

  14. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    Science.gov (United States)

    Lorenz, Todd C

    2012-05-22

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  15. α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Olivier Martínez

    Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

  16. Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

    Science.gov (United States)

    Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

    2011-08-01

    DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

  17. Reduction of heteroduplex formation in PCR amplification

    Czech Academy of Sciences Publication Activity Database

    Michu, Elleni; Mráčková, Martina; Vyskot, Boris; Žlůvová, Jitka

    2010-01-01

    Roč. 54, č. 1 (2010), s. 173-176 ISSN 0006-3134 R&D Projects: GA AV ČR(CZ) KJB600040801; GA ČR(CZ) GD204/09/H002; GA AV ČR(CZ) IAA600040801; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : polymerase chain reaction * reconditioning PCR * mixed-template PCR Subject RIV: BO - Biophysics Impact factor: 1.582, year: 2010

  18. A naked-eye colorimetric "PCR developer"

    Science.gov (United States)

    Valentini, Paola; Pompa, Pier Paolo

    2016-04-01

    Despite several advances in molecular biology and diagnostics, Polymerase Chain Reaction (PCR) is currently the gold standard for nucleic acids amplification and detection, due to its versatility, low-cost and universality, with estimated genetically modified organisms, and pathogens). The PCR developer proved to be highly specific and ultra-sensitive, discriminating down to few copies of HIV viral DNA, diluted in an excess of interfering human genomic DNA, which is a clinically relevant viral load. Hence, it could be a valuable tool for both academic research and clinical applications.

  19. Critical analysis: use of polymerase chain reaction to diagnose leprosy

    Directory of Open Access Journals (Sweden)

    Flaviane Granero Maltempe

    Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.

  20. A Highly Sensitive Telomerase Activity Assay that Eliminates False-Negative Results Caused by PCR Inhibitors

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2013-09-01

    Full Text Available An assay for telomerase activity based on asymmetric polymerase chain reaction (A-PCR on magnetic beads (MBs and subsequent application of cycling probe technology (CPT is described. In this assay, the telomerase reaction products are immobilized on MBs, which are then washed to remove PCR inhibitors that are commonly found in clinical samples. The guanine-rich sequences (5'-(TTAGGGn-3' of the telomerase reaction products are then preferentially amplified by A-PCR, and the amplified products are subsequently detected via CPT, where a probe RNA with a fluorophore at the 5' end and a quencher at the 3' end is hydrolyzed by RNase H in the presence of the target DNA. The catalyst-mediated cleavage of the probe RNA enhances fluorescence from the 5' end of the probe. The assay allowed us to successfully detect HeLa cells selectively over normal human dermal fibroblast (NHDF cells. Importantly, this selectivity produced identical results with regard to detection of HeLa cells in the absence and presence of excess NHDF cells; therefore, this assay can be used for practical clinical applications. The lower limit of detection for HeLa cells was 50 cells, which is lower than that achieved with a conventional telomeric repeat amplification protocol assay. Our assay also eliminated false-negative results caused by PCR inhibitors. Furthermore, we show that this assay is appropriate for screening among G-quadruplex ligands to find those that inhibit telomerase activity.

  1. Polymerase chain reaction for detection of invasive Shigella flexneri in food.

    OpenAIRE

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

    1990-01-01

    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...

  2. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  3. Transformation of soybean Gy3 gene into Artemisaarenaria mediated by corona discharge

    International Nuclear Information System (INIS)

    Chao, Lu-meng; Na, Ri; Xue, Dan; Xu, Yongze; Liu, Teng

    2013-01-01

    In order to improve the protein content of desert plant, a method of genetic transformation mediated by corona discharge was established. Artemisia seeds were processed in corona electric field for 120 min at 12 kV, and then soaked in 0.1 SSC media that contained Soybean Gy3 gene DNA to incubate for 12 h at 26 °C. Finally the seeds were inoculated on the differentiation medium. Polymerase Chain Reaction (PCR) and Reverse Transcription Polymerase Chain Reaction (RT-PCR) detection showed that the Soybean Gy3 gene had been successfully introduced into genomic DNA of the regenerated plants of Artemisaarenaria. The study provided a new way for corona discharge in plant genetic modification.

  4. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    Science.gov (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Detection of enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification.

    Science.gov (United States)

    Wang, D; Wang, X; Geng, Y; An, C

    2014-01-01

    The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD) for an early treatment by using loop-mediated isothermal amplification (LAMP) technique. A reverse-transcription loop-mediated isothermal amplification (RT-LAMP) for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR) and real-time PCR. A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.

  6. Detection of Enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification

    Directory of Open Access Journals (Sweden)

    D Wang

    2014-01-01

    Full Text Available Purpose : The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD for an early treatment by using loop-mediated isothermal amplification (LAMP technique. Materials and Methods : A reverse-transcription loop-mediated isothermal amplification (RT-LAMP for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR and real-time PCR. Results : A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. Conclusions : The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.

  7. Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

    Science.gov (United States)

    Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

    2005-09-15

    In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

  8. Material Biocompatibility for PCR Microfluidic Chips

    KAUST Repository

    Kodzius, Rimantas; Chang, Donald Choy; Gong, Xiuqing; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yi, Xin

    2010-01-01

    As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

  9. Material Biocompatibility for PCR Microfluidic Chips

    KAUST Repository

    Kodzius, Rimantas

    2010-04-23

    As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

  10. Development of a panel of seven duplex real-time PCR assays for detecting 13 streptococcal superantigens.

    Science.gov (United States)

    Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi

    2013-07-30

    Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.

  11. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR.

    Directory of Open Access Journals (Sweden)

    Yogita Maheshwari

    Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.

  12. Real-time PCR in virology.

    Science.gov (United States)

    Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas

    2002-03-15

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.

  13. Evaluación de la reacción en cadena de la polimerasa para el diagnóstico de la brucelosis en un rebaño lechero infectado con Brucellaspp Assessment of polymerase chain reaction (PCR to diagnose brucellosis in a Brucella infected herd

    Directory of Open Access Journals (Sweden)

    O. Lavaroni

    2004-09-01

    Full Text Available Para el diagnóstico de la brucelosis bovina en muestras de sangre y/o leche, se comparó la reacción en cadena de la polimerasa (PCR con el aislamiento in vitro de Brucella abortus, las pruebas serológicas defijación del complemento (FC e inmunoenzimáticas de competición (ELISA-C en suero e indirecto (ELISA-I en leche. Se analizaron muestras de vacas lecheras de un rebaño infectado “A”, vacunadas con B. abortus cepa 19 antes de los 8 meses de edad y revacunadas con B. abortus cepa RB51 como adultas (n= 99 y de otro “B”, libre de brucelosis (n=100, como control. En A, la PCR identificó 14 vacas infectadas con B. abortus: nueve con cepa silvestre y cinco con cepa silvestre y RB51. No se identificó B. abortus cepa 19. El biotipo 1 se aisló en un caso. Las 14 vacas infectadas con la cepa silvestre resultaron positivas en las tres pruebas serológicas. En B, por PCR no se identificó Brucella. Las pruebas serológicas mostraron una sensibilidad del 100% respecto de PCR. La especificidad para FC, ELISA-C y ELISA-I fue del 100%, 99% y 95%, respectivamente. Se concluye que la PCR sería útil como complemento de las pruebas serológicas o cuando no hay un resultado concluyente.The diagnosis of bovine brucellosis using PCR in blood and milk samples from two dairy herds were compared to in vitro isolation, complement fixation test (CF, competitive ELISA (C-ELISA in serum, and indirect ELISA (I-ELISA in milk. Samples were obtained from 99 cows vaccinated with Brucella abortus strain 19, from a naturally infected herd (A, whose cows were also vaccinated with B. abortus strain RB51 as adults, and 100 from brucellosis free herd (B. In herd A, PCR identified 14 B. abortus infected cows: nine infected with wild type, and five with wild type and RB51, B. abortus S 19 was not identified. B. abortus biotype 1 was isolated from one cow. All cows infected with a wild strain of B. abortus were positive in serologic tests. Brucella was not found in

  14. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)

    2016-05-06

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  15. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    Science.gov (United States)

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  16. Influenza polymerase encoding mRNAs utilize atypical mRNA nuclear export.

    Science.gov (United States)

    Larsen, Sean; Bui, Steven; Perez, Veronica; Mohammad, Adeba; Medina-Ramirez, Hilario; Newcomb, Laura L

    2014-08-28

    Influenza is a segmented negative strand RNA virus. Each RNA segment is encapsulated by influenza nucleoprotein and bound by the viral RNA dependent RNA polymerase (RdRP) to form viral ribonucleoproteins responsible for RNA synthesis in the nucleus of the host cell. Influenza transcription results in spliced mRNAs (M2 and NS2), intron-containing mRNAs (M1 and NS1), and intron-less mRNAs (HA, NA, NP, PB1, PB2, and PA), all of which undergo nuclear export into the cytoplasm for translation. Most cellular mRNA nuclear export is Nxf1-mediated, while select mRNAs utilize Crm1. Here we inhibited Nxf1 and Crm1 nuclear export prior to infection with influenza A/Udorn/307/1972(H3N2) virus and analyzed influenza intron-less mRNAs using cellular fractionation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR). We examined direct interaction between Nxf1 and influenza intron-less mRNAs using immuno purification of Nxf1 and RT-PCR of associated RNA. Inhibition of Nxf1 resulted in less influenza intron-less mRNA export into the cytoplasm for HA and NA influenza mRNAs in both human embryonic kidney cell line (293 T) and human lung adenocarcinoma epithelial cell line (A549). However, in 293 T cells no change was observed for mRNAs encoding the components of the viral ribonucleoproteins; NP, PA, PB1, and PB2, while in A549 cells, only PA, PB1, and PB2 mRNAs, encoding the RdRP, remained unaffected; NP mRNA was reduced in the cytoplasm. In A549 cells NP, NA, HA, mRNAs were found associated with Nxf1 but PA, PB1, and PB2 mRNAs were not. Crm1 inhibition also resulted in no significant difference in PA, PB1, and PB2 mRNA nuclear export. These results further confirm Nxf1-mediated nuclear export is functional during the influenza life cycle and hijacked for select influenza mRNA nuclear export. We reveal a cell type difference for Nxf1-mediated nuclear export of influenza NP mRNA, a reminder that cell type can influence molecular mechanisms. Importantly, we

  17. Diagnosis of lymphoma in paraffin wax sections by nested PCR and immunohistochemistry.

    OpenAIRE

    Kitamura, Y; Nanba, E; Inui, S; Tanigawa, T; Ichihara, K

    1996-01-01

    AIMS: To investigate whether nested polymerase chain reaction (PCR) and immunohistochemistry can be used to diagnose malignant lymphoma. METHODS: Paraffin wax embedded tissue sections from 31 patients with malignant lymphoma were analysed by nested PCR and immunohistochemistry using standard protocols. RESULTS: Nested PCR amplification of 1 pg DNA confirmed monoclonality in B cell lymphoma; PCR amplification of 10 pg DNA confirmed monoclonality in T cell lymphoma. Twenty seven (87%) samples w...

  18. Evaluation of a Solid Phase DNA Binding Matrix for Downstream PCR Analysis

    National Research Council Canada - National Science Library

    Bader, Douglas E; Fisher, Glen R; Stratilo, Chad W

    2005-01-01

    A commercially available solid-phase DNA binding matrix (FTA cards) was evaluated for its ability to capture and release DNA for downstream gene amplification and detection assays using polymerase chain reaction (PCR...

  19. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    Science.gov (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  20. Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction.

    Science.gov (United States)

    Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František

    2017-05-01

    The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Faulty DNA-polymerase δ/ε-mediated excision-repair in response to gamma-radiation or ultraviolet-light in P53-deficient fibroblast strains from affected members of a cancer-prone family with Li-Fraumeni syndrome

    International Nuclear Information System (INIS)

    Mirzayans, R.; Enns, L.; Dietrich, K.; Barley, R.D.C.; Paterson, M.C.; Alberta Univ., Edmonton, AB; Alberta Univ., Edmonton, AB

    1996-01-01

    Dermal fibroblast strains cultured from affected members of a cancer-prone family with Li-Fraumeni syndrome (LFS) harbor a point mutation in one allele of the p53 tumor suppressor gene, resulting in loss of normal p53-deficient strains to carry out the long-patch mode of excision repair, mediated by DNA polymerases delta and epsilon, after exposure to Co-60 gamma radiation or far ultraviolet (UV) (chiefly 254 mm) light. Repair was monitored by incubation of the irradiated cultures in the presence of aphidicolin (ape) or 1-beta-D-arabinofuranosylcytosine (araC), each a specific inhibitor of long-patch repair, followed by measurement of drug-induced DNA strand breaks (reflecting non-ligated strand incision events) by alkaline surcrose velocity sedimentation. The LFS strains displayed deficient repair capacity in response to both gamma rays and UV light. The repair anomaly in UV-irradiated LFS cultures was manifested not only in the overall genome, but also in the transcriptionally active, preferentially repaired c-myc gene. Using autoradiography we also assessed unscheduled DNA synthesis (UDS) after UV irradiation and found this conventional measure of repair replication to be deficient in LFS strains. Moreover, both ape and araC decreased the level of UV-induced UDS by similar to 75% in normal cells, but each had only a marginal effect on LFS cells. We further demonstrated that the LFS strains are impaired in the recovery of both RNA and replicative DNA syntheses after UV treatment, two molecular anomalies of the DNA repair deficiency disorders xeroderma pigmentosum and Cockayne's syndrome. Together these results imply a critical role for wild-type p53 protein in DNA polymerase delta/epsilon-mediated excision repair, both the mechanism operating on the entire genome and that acting on expressed genes. (Author)

  2. (PCR) and loop-mediated isothermal amplification

    African Journals Online (AJOL)

    SAM

    2014-03-26

    Mar 26, 2014 ... Einsele H, Herbart H, Roller G (1997). Detection and identification of fungal pathogens in blood by using molecular probes. J. Clin. Microbiol. 35:1353-60. PMid:9163443 PMCid:PMC229748. Eljaschewitsch J, Sandfort J, Tintelnot K, Horbach I, Ruf B (1996).Port- a-cath-related Fusariumoxysporum infection ...

  3. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  4. Development of the polymerase chain reaction for diagnosis of chancroid.

    Science.gov (United States)

    Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

    1993-01-01

    The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

  5. Standardization of diagnostic PCR for the detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Malorny, B.; Tassios, P.T.; Radstrom, P.

    2003-01-01

    In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

  6. Comparison between ICT and PCR for diagnosis of Chlamydia trachomatis.

    Science.gov (United States)

    Khan, E R; Hossain, M A; Paul, S K; Mahmud, C; Hasan, M M; Rahman, M M; Nahar, K; Kubayashi, N

    2012-04-01

    Chlamydia trachomatis is an obligate intracellular gram-negative bacterium which is the most prevalent cause of bacterial sexually transmitted infections (STI). The present study was carried to diagnose genital Chlamydia trachomatis infection among women of reproductive age, attending Mymensingh Medical College Hospital, during July 2009 to June 2010 by Immunochromatographic test (ICT) and Polymerase chain reaction (PCR). A total of 70 females were included in this study. Out of 70 cases 56 were symptomatic and 14 asymptomatic. Endocervical swabs were collected from each of the cases and examined by Immunochromatographic test (ICT) for antigen detection and Polymerase chain reaction (PCR) for detection of endogenous plasmid-based nucleic acid. A total 29(41.4%) of the cases were found positive for C. trachomatis either by ICT or PCR. Of the 56 symptomatic cases, 19(33.9%) were found ICT positive and 17(30.4%) were PCR positive. Among 14 asymptomatic females, 2(14.3%) were ICT positive and none were PCR positive. Though PCR is highly sensitive but a total of twelve cases were found ICT positive but PCR negative. It may be due to presence of plasmid deficient strain of C trachomatis which could be amplified by ompA based (Chromosomal gene) multiplex PCR.

  7. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.

    Science.gov (United States)

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.

  8. A Trio of Human Molecular Genetics PCR Assays

    Science.gov (United States)

    Reinking, Jeffrey L.; Waldo, Jennifer T.; Dinsmore, Jannett

    2013-01-01

    This laboratory exercise demonstrates three different analytical forms of the polymerase chain reaction (PCR) that allow students to genotype themselves at four different loci. Here, we present protocols to allow students to a) genotype a non-coding polymorphic Variable Number of Tandem Repeat (VNTR) locus on human chromosome 5 using conventional…

  9. How useful is PCR in the diagnosis of malaria?

    NARCIS (Netherlands)

    Hänscheid, Thomas; Grobusch, Martin P.

    2002-01-01

    Polymerase chain reaction (PCR) assays are the most sensitive and specific method to detect malaria parasites, and have acknowledged value in research settings. However, the time lag between sample collection, transportation and processing, and dissemination of results back to the physician limits

  10. Pure chromosome-specific PCR libraries from single sorted chromosomes

    NARCIS (Netherlands)

    VanDevanter, D. R.; Choongkittaworn, N. M.; Dyer, K. A.; Aten, J. A.; Otto, P.; Behler, C.; Bryant, E. M.; Rabinovitch, P. S.

    1994-01-01

    Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted

  11. Variants of sequence family B Thermococcus kodakaraensis DNA polymerase with increased mismatch extension selectivity.

    Directory of Open Access Journals (Sweden)

    Claudia Huber

    Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.

  12. A survey of tools for the analysis of quantitative PCR (qPCR) data.

    Science.gov (United States)

    Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas

    2014-09-01

    Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.

  13. Pneumocystis PCR: It Is Time to Make PCR the Test of Choice.

    Science.gov (United States)

    Doyle, Laura; Vogel, Sherilynn; Procop, Gary W

    2017-01-01

    The testing strategy for Pneumocystis at the Cleveland Clinic changed from toluidine blue staining to polymerase chain reaction (PCR). We studied the differences in positivity rates for these assays and compared each with the detection of Pneumocystis in companion specimens by cytology and surgical pathology. We reviewed the results of all Pneumocystis test orders 1 year before and 1 year after the implementation of a Pneumocystis -specific PCR. We also reviewed the corresponding cytology and surgical pathology results, if performed. Finally, we reviewed the medical records of patients with rare Pneumocystis detected by PCR in an effort to differentiate colonization vs true disease. Toluidine blue staining and surgical pathology had similar sensitivities and negative predictive values, both of which were superior to cytology. There was a >4-fold increase in the annual detection of Pneumocystis by PCR compared with toluidine blue staining (toluidine blue staining: 11/1583 [0.69%] vs PCR: 44/1457 [3.0%]; chi-square P < .001). PCR detected 1 more case than surgical pathology and was far more sensitive than cytology. Chart review demonstrated that the vast majority of patients with rare Pneumocystis detected were immunosuppressed, had radiologic findings supportive of this infection, had no other pathogens detected, and were treated for pneumocystosis by the clinical team. PCR was the most sensitive method for the detection of Pneumocystis and should be considered the diagnostic test of choice. Correlation with clinical and radiologic findings affords discrimination of early true disease from the far rarer instances of colonization.

  14. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  15. Detection of bovine herpesvirus 4 glycoprotein B and thymidine kinase DNA by PCR assays in bovine milk

    NARCIS (Netherlands)

    Wellenberg, G.J.; Verstraten, E.; Belak, S.; Verschuren, S.B.E.; Rijsewijk, F.A.M.; Peshev, R.; Oirschot, van J.T.

    2001-01-01

    A polymerase chain reaction (PCR) assay was developed to detect bovine herpesvirus 4 (BHV4) glycoprotein B (gB) DNA, and a nested-PCR assay was modified for the detection of BHV4 thymidine kinase (TK) DNA in bovine milk samples. To identify false-negative PCR results, internal control templates were

  16. An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

    NARCIS (Netherlands)

    Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

    The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

  17. Genetic variability and discrimination of low doses of Toxocara spp. from public areas soil inferred by loop-mediated isothermal amplification assay as a field-friendly molecular tool

    OpenAIRE

    Ozlati, Maryam; Spotin, Adel; Shahbazi, Abbas; Mahami-Oskouei, Mahmoud; Hazratian, Teimour; Adibpor, Mohammad; Ahmadpour, Ehsan; Dolatkhah, Afsaneh; Khoshakhlagh, Paria

    2016-01-01

    Abstract: Aim: One of the main diagnostic problems of conventional polymerase chain reaction (PCR) is indiscrimination of low parasitic loads in soil samples. The aim of this study is to determine the genetic diversity and identification of Toxocara spp. from public areas soil inferred by loop-mediated isothermal amplification (LAMP) assay. Materials and Methods: A total of 180 soil samples were collected from various streets and public parks of northwest Iran. The DNA of recovered Toxocara e...

  18. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR

    Science.gov (United States)

    Droplet digital Polymerase chain reaction (ddPCR) is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. It is a promising DNA quantification technology for medical diagnostics but there are only a few reports of its use for plant pat...

  19. PCR IN TRAUMATOLOGY AND ORTHOPAEDICS: METHOD DESCRIPTION AND APPLICABILITY

    Directory of Open Access Journals (Sweden)

    E. M. Polyakova

    2014-01-01

    Full Text Available Review brief presents description of polymerase chain reaction method (PCR and its most common variants. Three PCR-based lines of research, carried out in the traumatology and orthopaedics, include identifying a causative agents of the implant-associated infection after orthopaedic surgery; detection of antibiotic resistance genes and biofilm forming genes. It was shown that PCR can be used as additional method for detection of genetic disorders, significant for traumatology and orthopaedics, and for investigation of cartilage and bone regeneration.

  20. Compartmentalized self-replication (CSR) selection of Thermococcus litoralis Sh1B DNA polymerase for diminished uracil binding.

    Science.gov (United States)

    Tubeleviciute, Agne; Skirgaila, Remigijus

    2010-08-01

    The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.

  1. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    Science.gov (United States)

    Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

  2. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  3. External PCR, ASN's decision

    International Nuclear Information System (INIS)

    Anon.

    2012-01-01

    The French law imposes in some situations the presence of a person skilled in radiation protection (PCR). This article describes the cases when this person must belong to the staff of the enterprise or when this person may be sub-contracted. For instance in most nuclear facilities the PCR must be on the payroll, for enterprises dedicated to nuclear transport the PCR's job can be sub-contracted. A decision given by the ASN (French Nuclear Safety Authority) sets the minimal requests (in terms of training, job contract, activities) of the sub-contracted PCR. (A.C.)

  4. UVB DNA dosimeters analyzed by polymerase chain reactors

    International Nuclear Information System (INIS)

    Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL

    1997-01-01

    Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)

  5. The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments

    Czech Academy of Sciences Publication Activity Database

    Huggett, J.F.; Foy, C.A.; Benes, V.; Emslie, K.; Garson, J.A.; Haynes, R.; Hellemans, J.; Kubista, Mikael; Mueller, R.D.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; Vandesompele, J.; Wittwer, C.T.; Bustin, S.A.

    2013-01-01

    Roč. 59, č. 6 (2013), s. 892-902 ISSN 0009-9147 R&D Projects: GA ČR GAP303/10/1338 Institutional research plan: CEZ:AV0Z50520701 Keywords : REAL - TIME PCR * POLYMERASE-CHAIN-REACTION * COPY NUMBER VARIATION * RT-PCR Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.768, year: 2013

  6. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  7. Impact of PCR for respiratory viruses on antibiotic use : Theory and practice

    NARCIS (Netherlands)

    van de Pol, Alma C.; Wolfs, Tom F. W.; Tacke, Carline E. A.; Uiterwaal, Cuno S. P.; Forster, Johannes; van Loon, Anton M.; Kimpen, Jan L. L.; Rossen, John W. A.; Jansen, Nicolaas J. G.

    RATIONALE FOR THE STUDY: Real-time polymerase chain reaction (PCR) for respiratory viruses is more sensitive, yet more expensive, than conventionally used direct immunofluorescence (DIF). We determined the impact of real-time PCR, additional to DIF, on antibiotic prescription in ventilated children

  8. Detection of chromosome abnormalities by quantitative fluorescent PCR in ectopic pregnancies

    NARCIS (Netherlands)

    Goddijn, Mariette; van Stralen, Marja; Schuring-Blom, Heleen; Redeker, Bert; van Leeuwen, Liesbeth; Repping, Sjoerd; Leschot, Nico; van der Veen, Fulco

    2005-01-01

    Objective: To evaluate the potential value of quantitative fluorescent polymerase chain reaction (QF-PCR) in the detection of chromosome abnormalities in ectopic pregnancies. Methods: Seventy chorionic villi samples of ectopic pregnancies were studied by QF-PCR. Primers for chromosomes 16, 21, X and

  9. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  10. Emulating a crowded intracellular environment in vitro dramatically improves RT-PCR performance

    International Nuclear Information System (INIS)

    Lareu, Ricky R.; Harve, Karthik S.; Raghunath, Michael

    2007-01-01

    The polymerase chain reaction's (PCR) phenomenal success in advancing fields as diverse as Medicine, Agriculture, Conservation, or Paleontology is based on the ability of using isolated prokaryotic thermostable DNA polymerases in vitro to copy DNA irrespective of origin. This process occurs intracellularly and has evolved to function efficiently under crowded conditions, namely in an environment packed with macromolecules. However, current in vitro practice ignores this important biophysical parameter of life. In order to more closely emulate conditions of intracellular biochemistry in vitro we added inert macromolecules into reverse transcription (RT) and PCR. We show dramatic improvements in all parameters of RT-PCR including 8- to 10-fold greater sensitivity, enhanced polymerase processivity, higher specific amplicon yield, greater primer annealing and specificity, and enhanced DNA polymerase thermal stability. The faster and more efficient reaction kinetics was a consequence of the cumulative molecular and thermodynamic effects of the excluded volume effect created by macromolecular crowding

  11. [REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

    Science.gov (United States)

    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

    2015-01-01

    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  12. Evidence of simian retrovirus type D by polymerase chain reaction.

    Science.gov (United States)

    Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

    2017-06-01

    Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

    DEFF Research Database (Denmark)

    Munch, M.; Nielsen, L.P.; Handberg, Kurt

    2001-01-01

    A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

  14. Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

    Directory of Open Access Journals (Sweden)

    Wen-Pin Chou

    2017-02-01

    Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

  15. Advancing Polymerase Ribozymes Towards Self-Replication

    Science.gov (United States)

    Tjhung, K. F.; Joyce, G. F.

    2017-07-01

    Autocatalytic replication and evolution in vitro by (i) a cross-chiral RNA polymerase catalyzing polymerization of mononucleotides of the opposite handedness; (ii) non-covalent assembly of component fragments of an existing RNA polymerase ribozyme.

  16. Inverse fusion PCR cloning.

    Directory of Open Access Journals (Sweden)

    Markus Spiliotis

    Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.

  17. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Directory of Open Access Journals (Sweden)

    Daniela Camargos Costa

    2014-02-01

    Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  18. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  19. False-negative HIV-1 polymerase chain reaction in a 15-month-old ...

    African Journals Online (AJOL)

    Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...

  20. Polymerase matters: non-proofreading enzymes inflate fungal community richness estimates by up to 15 %

    Science.gov (United States)

    Alena K. Oliver; Shawn P. Brown; Mac A. Callaham; Ari Jumpponen

    2015-01-01

    Rare taxa overwhelm metabarcoding data generated using next-generation sequencing (NGS). Low frequency Operational Taxonomic Units (OTUs) may be artifacts generated by PCR-amplification errors resulting from polymerase mispairing. We analyzed two Internal Transcribed Spacer 2 (ITS2) MiSeq libraries generated with proofreading (ThermoScientific Phusion

  1. Evaluation of a new HTLV-I/II polymerase chain reaction

    NARCIS (Netherlands)

    Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.

    1997-01-01

    AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA

  2. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

  3. Case Report:False-negative HIV-1 polymerase chain reaction in a ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...

  4. Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

    NARCIS (Netherlands)

    Hatta, Mochammad; Smits, Henk L.

    2007-01-01

    A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

  5. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

    Science.gov (United States)

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

    2017-09-01

    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

  6. Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre

    2013-01-01

    Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

  7. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline

    2015-01-01

    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...

  8. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    OpenAIRE

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  9. ReadqPCR and NormqPCR: R packages for the reading, quality checking and normalisation of RT-qPCR quantification cycle (Cq data

    Directory of Open Access Journals (Sweden)

    Perkins James R

    2012-07-01

    Full Text Available Abstract Background Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s. Results We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html Conclusions These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples.

  10. The quantification of spermatozoa by real-time quantitative PCR, spectrophotometry, and spermatophore cap size.

    Science.gov (United States)

    Doyle, Jacqueline M; McCormick, Cory R; DeWoody, J Andrew

    2011-01-01

    Many animals, such as crustaceans, insects, and salamanders, package their sperm into spermatophores, and the number of spermatozoa contained in a spermatophore is relevant to studies of sexual selection and sperm competition. We used two molecular methods, real-time quantitative polymerase chain reaction (RT-qPCR) and spectrophotometry, to estimate sperm numbers from spermatophores. First, we designed gene-specific primers that produced a single amplicon in four species of ambystomatid salamanders. A standard curve generated from cloned amplicons revealed a strong positive relationship between template DNA quantity and cycle threshold, suggesting that RT-qPCR could be used to quantify sperm in a given sample. We then extracted DNA from multiple Ambystoma maculatum spermatophores, performed RT-qPCR on each sample, and estimated template copy numbers (i.e. sperm number) using the standard curve. Second, we used spectrophotometry to determine the number of sperm per spermatophore by measuring DNA concentration relative to the genome size. We documented a significant positive relationship between the estimates of sperm number based on RT-qPCR and those based on spectrophotometry. When these molecular estimates were compared to spermatophore cap size, which in principle could predict the number of sperm contained in the spermatophore, we also found a significant positive relationship between sperm number and spermatophore cap size. This linear model allows estimates of sperm number strictly from cap size, an approach which could greatly simplify the estimation of sperm number in future studies. These methods may help explain variation in fertilization success where sperm competition is mediated by sperm quantity. © 2010 Blackwell Publishing Ltd.

  11. Identification of a conserved archaeal RNA polymerase subunit contacted by the basal transcription factor TFB.

    Science.gov (United States)

    Magill, C P; Jackson, S P; Bell, S D

    2001-12-14

    Archaea possess two general transcription factors that are required to recruit RNA polymerase (RNAP) to promoters in vitro. These are TBP, the TATA-box-binding protein and TFB, the archaeal homologue of TFIIB. Thus, the archaeal and eucaryal transcription machineries are fundamentally related. In both RNAP II and archaeal transcription systems, direct contacts between TFB/TFIIB and the RNAP have been demonstrated to mediate recruitment of the polymerase to the promoter. However the subunit(s) directly contacted by these factors has not been identified. Using systematic yeast two-hybrid and biochemical analyses we have identified an interaction between the N-terminal domain of TFB and an evolutionarily conserved subunit of the RNA polymerase, RpoK. Intriguingly, homologues of RpoK are found in all three nuclear RNA polymerases (Rpb6) and also in the bacterial RNA polymerase (omega-subunit).

  12. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin

    2005-01-01

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  13. Early detection of typhoid by polymerase chain reaction

    International Nuclear Information System (INIS)

    Haque, A.; Qureshi, Javed A.; Ahmed, J.

    1999-01-01

    Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

  14. Protective effect of the poly(ADP-ribose polymerase inhibitor PJ34 on mitochondrial depolarization-mediated cell death in hepatocellular carcinoma cells involves attenuation of c-Jun N-terminal kinase-2 and protein kinase B/Akt activation

    Directory of Open Access Journals (Sweden)

    Radnai Balazs

    2012-05-01

    Full Text Available Abstract Background 2,4-Dimethoxyphenyl-E-4-arylidene-3-isochromanone (IK11 was previously described to induce apoptotic death of A431 tumor cells. In this report, we investigated the molecular action of IK11 in the HepG2 human hepatocellular carcinoma cell line to increase our knowledge of the role of poly (ADP-ribose-polymerase (PARP, protein kinase B/Akt and mitogen activated protein kinase (MAPK activation in the survival and death of tumor cells and to highlight the possible role of PARP-inhibitors in co-treatments with different cytotoxic agents in cancer therapy. Results We found that sublethal concentrations of IK11 prevented proliferation, migration and entry of the cells into their G2 phase. At higher concentrations, IK11 induced reactive oxygen species (ROS production, mitochondrial membrane depolarization, activation of c-Jun N-terminal kinase 2 (JNK2, and substantial loss of HepG2 cells. ROS production appeared marginal in mediating the cytotoxicity of IK11 since N-acetyl cysteine was unable to prevent it. However, the PARP inhibitor PJ34, although not a ROS scavenger, strongly inhibited both IK11-induced ROS production and cell death. JNK2 activation seemed to be a major mediator of the effect of IK11 since inhibition of JNK resulted in a substantial cytoprotection while inhibitors of the other kinases failed to do so. Inhibition of Akt slightly diminished the effect of IK11, while the JNK and Akt inhibitor and ROS scavenger trans-resveratrol completely protected against it. Conclusions These results indicate significant involvement of PARP, a marginal role of ROS and a pro-apoptotic role of Akt in this system, and raise attention to a novel mechanism that should be considered when cancer therapy is augmented with PARP-inhibition, namely the cytoprotection by inhibition of JNK2.

  15. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Science.gov (United States)

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  16. Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

    Directory of Open Access Journals (Sweden)

    Anupam Berwal

    2017-01-01

    Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

  17. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  18. PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains

    Directory of Open Access Journals (Sweden)

    Nowak Magdalena

    2009-11-01

    Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.

  19. Molecular diagnostic PCR handbook

    International Nuclear Information System (INIS)

    Viljoen, G.J.; Crowther, J.R.; Nel, L.H.

    2005-01-01

    The uses of nucleic acid-directed methods have increased significantly in the past five years and have made important contributions to disease control country programmes for improving national and international trade. These developments include the more routine use of PCR as a diagnostic tool in veterinary diagnostic laboratories. However, there are many problems associated with the transfer and particularly, the application of this technology. These include lack of consideration of: the establishment of quality-assured procedures, the required set-up of the laboratory and the proper training of staff. This can lead to a situation where results are not assured. This book gives a comprehensive account of the practical aspects of PCR and strong consideration is given to ensure its optimal use in a laboratory environment. This includes the setting-up of a PCR laboratory; Good Laboratory Practice and standardised PCR protocols to detect animal disease pathogens. Examples of Standard Operating Procedures as used in individual specialist laboratories and an outline of training materials necessary for PCR technology transfer are presented. The difficulties, advantages and disadvantages in PCR applications are explained and placed in context with other test systems. Emphasis is placed on the use of PCR for detection of pathogens, with a particular focus on diagnosticians and scientists from the developing world. It is hoped that this book will enable readers from various disciplines and levels of expertise to better judge the merits of PCR and to increase their skills and knowledge in order to assist in a more logical, efficient and assured use of this technology

  20. Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

    Science.gov (United States)

    Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

    2004-03-01

    Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

  1. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    Science.gov (United States)

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  2. Inhibitory effect of common microfluidic materials on PCR outcome

    KAUST Repository

    Kodzius, Rimantas

    2012-02-20

    Microfluidic chips have a variety of applications in the biological sciences and medicine. In contrast with traditional experimental approaches, microfluidics entails lower sample and reagent consumption, allows faster reactions and enables efficient separation. Additionally microfluidics offers other advantages accruing from the fluids’ various distinct behaviors, such as energy dissipation, fluidic resistance, laminar flow, and surface tension. Biological molecules suspended in fluid and transported through microfluidics channels interact with the channel-wall material. This interaction is even stronger in high surface-area-to-volume ratio (SAVR) microfluidic channels. Adsorption and inhibition of biomolecules occur when these materials come in contact with biomolecular reaction components. Polymerase chain reaction (PCR) is a thermal cycling procedure for amplifying target DNA. The PCR compatibility of silicon, silicon dioxide (SiO2) and other surfaces have been studied; however the results are inconclusive. Usually for protein-surface interaction measurements, bulky and expensive equipment is used, such as Atomic Force Microscopy (AFM), Scanning or Transmission Electron Microscopy (SEM, TEM), spectrophotometric protein concentration measurement, Fourier transform infrared spectroscopy (FTIR) or X-Ray photoelectron spectroscopy (XPS). \\tThe PCR reaction components include the DNA template, primers, DNA polymerase (the main component), dNTPs, a buffer, divalent ions (MgCl2), and KCl. \\tWe designed a simple, relatively quick measurement that only requires a PCR cycler; thus it mimics actual conditions in PCR cycling. In our study, we evaluated the inhibitory affect of different materials on PCR, which is one of the most frequently used enzymatic reactions in microfluidics. PCR reaction optimization through choice of surface materials is of the upmost importance, as it enables and improves enzymatic reaction in microfluidics. Our assessment of the PCR

  3. Application of polymerase chain reaction to differentiate herpes simplex virus 1 and 2 serotypes in culture negative intraocular aspirates

    Directory of Open Access Journals (Sweden)

    Shyamal G

    2005-01-01

    Full Text Available Purpose: To standardize and apply a polymerase chain reaction (PCR on the glycoprotein D gene to differentiate Herpes simplex virus (HSV 1 & 2 serotypes in culture negative intraocular specimens. Methods: Twenty-one intraocular fluids collected from 19 patients were subjected to cultures for HSV and uniplex PCR (uPCR for DNA polymerase gene. To differentiate HSV serotypes, as 1 & 2, a seminested PCR (snPCR targeting the glycoprotein D gene was standardised and applied onto 21 intraocular fluids. The specificity of the snPCR was verified by application onto ATCC strains of HSV 1 and 2, clinical isolates and DNA sequencing of the amplified products. All specimens were also tested for the presence of cytomegalovirus (CMV and varicella zoster virus (VZV by nucleic acid amplification methods. Results: Four of the 21 intraocular fluids were positive for HSV by uPCR. snPCR detected HSV in three additional specimens (total of seven specimens, and identified three as HSV 1 and four as HSV 2. DNA sequencing of PCR products showed 100% homology with the standard strains of HSV 1 and 2 respectively. None of the samples were positive in culture. Among the other patients, CMV DNA was detected in two and VZV DNA in five others. Conclusions: The standardized snPCR can be applied directly onto the culture negative specimens for rapid differentiation of HSV serotypes.

  4. Inhibitory effect of common microfluidic materials on PCR outcome

    KAUST Repository

    Kodzius, Rimantas

    2013-10-10

    In this study, we established a simple method for evaluating the PCR compatibility of various common materials employed when fabricating microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most cases, adding bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, although they noticeably interacted with the polymerase. We provide a simple method of performing PCR-compatibility testing of materials using inexpensive instrumentation that is common in molecular biology laboratories. Furthermore, our method is direct, being performed under actual PCR conditions with high temperature. Our results provide an overview of materials that are PCR-friendly for fabricating microfluidic devices. The PCR reaction, without any additives, performed best with pyrex glass, and it performed worst with PMMA or acrylic glue materials.

  5. Inhibitory effect of common microfluidic materials on PCR outcome

    KAUST Repository

    Kodzius, Rimantas; Xiao, Kang; Wu, Jinbo; Yi, Xin; Gong, Xiuqing; Foulds, Ian G.; Wen, Weijia

    2013-01-01

    In this study, we established a simple method for evaluating the PCR compatibility of various common materials employed when fabricating microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most cases, adding bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, although they noticeably interacted with the polymerase. We provide a simple method of performing PCR-compatibility testing of materials using inexpensive instrumentation that is common in molecular biology laboratories. Furthermore, our method is direct, being performed under actual PCR conditions with high temperature. Our results provide an overview of materials that are PCR-friendly for fabricating microfluidic devices. The PCR reaction, without any additives, performed best with pyrex glass, and it performed worst with PMMA or acrylic glue materials.

  6. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  7. Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    JANNOTTI-PASSOS Liana Konovaloff

    2000-01-01

    Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

  8. Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.

    2017-10-31

    Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.

  9. Identifikasi Cendawan Endofit Menggunakan Teknik Polymerase Chain Reaction (Detection of Endophytic Fungi Using Polymerase Chain Reaction Technique

    Directory of Open Access Journals (Sweden)

    Tuti Susanti Legiastuti

    2013-04-01

    Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction

  10. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

  11. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  12. Typing of Y chromosome SNPs with multiplex PCR methods

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

    2005-01-01

    We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....

  13. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  14. Genetic variability of Pantaneiro horse using RAPD-PCR markers

    OpenAIRE

    Egito,Andréa Alves do; Fuck,Beatriz Helena; McManus,Concepta; Paiva,Samuel Rezende; Albuquerque,Maria do Socorro Maués; Santos,Sandra Aparecida; Abreu,Urbano Gomes Pinto de; Silva,Joaquim Augusto da; Sereno,Fabiana Tavares Pires de Souza; Mariante,Arthur da Silva

    2007-01-01

    Blood samples were collected from Pantaneiro Horses in five regions of Mato Grosso do Sul and Mato Grosso States. Arabian, Mangalarga Marchador and Thoroughbred were also included to estimate genetic distances and the existing variability among and within these breeds by RAPD-PCR (Random Amplified Polymorphic DNA - Polymerase Chain Reaction) molecular markers. From 146 primers, 13 were chosen for amplification and 44 polymorphic bands were generated. The analysis of molecular variance (AMOVA)...

  15. Validation of kinetics similarity in qPCR

    Czech Academy of Sciences Publication Activity Database

    Bar, T.; Kubista, Mikael; Tichopád, Aleš

    2012-01-01

    Roč. 40, č. 4 (2012), s. 1395-1406 ISSN 0305-1048 R&D Projects: GA ČR GAP303/10/1338; GA ČR GA301/09/1752 Institutional research plan: CEZ:AV0Z50520701 Keywords : REAL-TIME PCR * POLYMERASE-CHAIN-REACTION * SYBR-GREEN-I Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.278, year: 2012

  16. Implementation of polymerase chain reaction (PCR) and Real-Time PCR in quick identification of bovine herpesvirus 1

    OpenAIRE

    Milić Nenad; Nišavić Jakov; Ašanin Ružica; Knežević Aleksandra; Ašanin Jelena; Vidanović D.; Šekler Milanko

    2010-01-01

    Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE) was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these ...

  17. Introduction of a dermatophyte polymerase chain reaction assay to the diagnostic mycology service in Scotland.

    Science.gov (United States)

    Alexander, C L; Shankland, G S; Carman, W; Williams, C

    2011-05-01

    Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  18. Value of polymerase chain reaction in patients with presumptively diagnosed and treated as tuberculous pericardial effusion

    International Nuclear Information System (INIS)

    Rehman, H.; Hafizullah, M.; Shah, S.T.; Khan, S.B.; Hadi, A.; Ahmad, F.; Shah, I.; Gul, A.M.

    2012-01-01

    Objective: To know the sensitivity of polymerase chain reaction (PCR) in pericardial fluid and response to antituberculous treatment (ATT) in PCR positive patients who were presumptively diagnosed and treated as tuberculous pericardial effusion. Methodology: This was a descriptive cross sectional study carried out from June 1, 2009 to 31 May 2010 at Cardiology Department, Lady Reading Hospital, Peshawar. Patients with presumptive diagnosis and receiving treatment for tuberculous pericardial effusion were included. Pericardial fluid sample was aspirated under fluoroscopy for the routine work up. The specimens were subjected to PCR detection of mycobacterium tuberculous DNA. Results: During 12 month study period, a total of 54 patients with large pericardial effusion presented to Cardiology department, Lady Reading Hospital, Peshawar. Of them, 46 patients fulfilled the criteria for presumptive diagnosis of tuberculous pericardial effusion. PCR for mycobacterium tuberculous DNA in pericardial fluid was positive in 45.7%(21). Patients were followed for three months. In PCR positive group, 01 patient while in PCR negative group 3 patients were lost to follow up. Among PCR positive patients 17(85%) while in PCR negative group 11(47.82%) patient responded to ATT both clinically and echo-cardio graphically. We found that patients who were PCR positive responded better to therapy than those who were PCR negative and this finding was statistically significant (p=0.035). Conclusion: PCR, with all its limitations, is potentially a useful diagnostic test in patients with presumptively diagnosed tuberculous pericardial effusion. A PCR positive patient responds better to therapy as compared to PCR negative patient. (author)

  19. Powerful strategy for polymerase chain reaction-based clonality assessment in T-cell malignancies Report of the BIOMED-2 Concerted Action BHM4 CT98-3936

    NARCIS (Netherlands)

    Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.

    2007-01-01

    Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.

  20. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    Science.gov (United States)

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  1. Loop-mediated isothermal amplification assay for rapid and sensitive detection of sheep pox and goat pox viruses in clinical samples.

    Science.gov (United States)

    Venkatesan, G; Balamurugan, V; Bhanuprakash, V; Singh, R K; Pandey, A B

    2016-06-01

    A Loop-mediated isothermal amplification (LAMP) assay targeting the highly conserved DNA polymerase gene of capripox virus genome was developed and evaluated for rapid detection of sheep pox and goat pox viruses. The optimized LAMP assay is found specific and sensitive for amplification of target DNA with a diagnostic sensitivity and specificity of 96.6% and 100% respectively compared to quantitative PCR. The detection rate of LAMP, PCR and Q-PCR assays is found to be 81.5%, 67% and 83% respectively. This LAMP assay has the potential for rapid clinical diagnosis and surveillance of sheep pox and goat pox in field diagnostic laboratories. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.

    Science.gov (United States)

    Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q

    2011-03-01

    The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

  3. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M Figueiredo

    1997-05-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  4. A PCR-based method for identification of bifidobacteria from the human alimentary tract at the species level

    NARCIS (Netherlands)

    Venema, K.; Maathuis, A.J.H.

    2003-01-01

    A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12

  5. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  6. Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

    Science.gov (United States)

    Altınel, Ahmet

    2017-01-01

    Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

  7. Scarless and sequential gene modification in Pseudomonas using PCR product flanked by short homology regions

    Directory of Open Access Journals (Sweden)

    Liang Rubing

    2010-08-01

    Full Text Available Abstract Background The lambda Red recombination system has been used to inactivate chromosomal genes in various bacteria and fungi. The procedure consists of electroporating a polymerase chain reaction (PCR fragment containing antibiotic cassette flanked by homology regions to the target locus into a strain that can express the lambda Red proteins (Gam, Bet, Exo. Results Here a scarless gene modification strategy based on the Red recombination system has been developed to modify Pseudomonas genome DNA via sequential deletion of multiple targets. This process was mediated by plasmid pRKaraRed encoding the Red proteins regulated by PBAD promoter, which was functional in P. aeruginosa as well as in other bacteria. First the target gene was substituted for the sacB-bla cassette flanked by short homology regions (50 bp, and then this marker gene cassette could be replaced by the PCR fragment flanking itself, generating target-deleted genome without any remnants and no change happened to the surrounding region. Twenty genes involved in the synthesis and regulation pathways of the phenazine derivate, pyocyanin, were modified, including one single-point mutation and deletion of two large operons. The recombination efficiencies ranged from 88% to 98%. Multiple-gene modification was also achieved, generating a triple-gene deletion strain PCA (PAO1, ΔphzHΔphzMΔphzS, which could produce another phenazine derivate, phenazine-1-carboxylic acid (PCA, efficiently and exclusively. Conclusions This lambda Red-based technique can be used to generate scarless and sequential gene modification mutants of P. aeruginosa efficiently, using one-step PCR product flanked by short homology regions. Single-point mutation, scarless deletion of genes can be achieved easily in less than three days. This method may give a new way to construct genetically modified P. aeruginosa strains more efficiently and advance the regulatory network study of this organism.

  8. IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR

    Directory of Open Access Journals (Sweden)

    Ervi Salwati

    2012-09-01

    Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results.   Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction

  9. An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection

    Directory of Open Access Journals (Sweden)

    Amanda de Faveri Pitz

    2013-12-01

    Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

  10. An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.

    Science.gov (United States)

    Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José

    2013-01-01

    Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

  11. Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY)

    OpenAIRE

    Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati

    2014-01-01

    Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...

  12. Evaluation of loop-mediated isothermal amplification assay for rapid diagnosis of Acanthamoeba keratitis

    Directory of Open Access Journals (Sweden)

    Abhishek Mewara

    2017-01-01

    Full Text Available Background: The clinical features of Acanthamoeba keratitis (AK are non-specific and closely resemble bacterial, viral and fungal keratitis. Materials and Methods: We compared loop-mediated isothermal amplification (LAMP with microscopy, non-nutrient agar (NNA culture and polymerase chain reaction (PCR in clinical suspects of AK. Results: Of 52 clinical samples (42 AK suspects and 10 proven bacterial, viral or fungal keratitis, 3 were positive by direct microscopy (sensitivity 60%, confidence interval [CI]: 17%–92.7%, and 5 by NNA culture, 18S rDNA PCR and LAMP (sensitivity 100%, CI: 46.3%–100%. The limit of detection of Acanthamoeba DNA was 1 pg/μl by both LAMP and PCR. Conclusion: PCR and LAMP assays targeting 18S rDNA gene were found particularly suitable for a rapid and accurate diagnosis of AK. LAMP assay takes 2–3 h lesser than PCR, and thus offers a rapid, highly sensitive and specific, simple and affordable diagnostic modality for patients suspected of AK, especially in resource limited settings

  13. MULTIPLEX SYBR® GREEN-REAL TIME PCR (qPCR ASSAY FOR THE DETECTION AND DIFFERENTIATION OF Bartonella henselae AND Bartonella clarridgeiae IN CATS

    Directory of Open Access Journals (Sweden)

    Rodrigo Staggemeier

    2014-04-01

    Full Text Available A novel SYBR® green-real time polymerase chain reaction (qPCR was developed to detect two Bartonella species, B. henselae and B. clarridgeiae, directly from blood samples. The test was used in blood samples obtained from cats living in animal shelters in Southern Brazil. Results were compared with those obtained by conventional PCR targeting Bartonella spp. Among the 47 samples analyzed, eight were positive using the conventional PCR and 12 were positive using qPCR. Importantly, the new qPCR detected the presence of both B. henselae and B. clarridgeiae in two samples. The results show that the qPCR described here may be a reliable tool for the screening and differentiation of two important Bartonella species.

  14. Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus

    DEFF Research Database (Denmark)

    Dukes, J.P.; King, D.P.; Alexandersen, Søren

    2006-01-01

    Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour...... in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV...... vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan (R) assay, RT-LAMP appears...

  15. A simple and efficient Agrobacterium-mediated procedure for ...

    Indian Academy of Sciences (India)

    Prakash

    production of insect- and disease-resistant plants, herbicide ... indole-3-acetic acid; MS, Murashige and Skoog; OD, optical density; PCR, polymerase chain reaction; SDS, sodium .... soil for hardening. ..... be adapted for other tomato cultivars.

  16. Agrobacterium-mediated transformation of Jatropha curcas leaf ...

    African Journals Online (AJOL)

    AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING ... One, two and three copies of the introduced gene were confirmed in nine ... quantitative real-time polymerase chain reaction (PCR), transgene copy number.

  17. Polymerase Gamma Disease through the Ages

    Science.gov (United States)

    Saneto, Russell P.; Naviaux, Robert K.

    2010-01-01

    The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…

  18. DNA Polymerase Fidelity: Beyond Right and Wrong.

    Science.gov (United States)

    Washington, M Todd

    2016-11-01

    Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Validation of the DNATyper™15 PCR Genotyping System for Forensic Application

    OpenAIRE

    Jian Ye; Chengtao Jiang; Xingchun Zhao; Le Wang; Caixia Li; Anquan Ji; Li Yuan; Jing Sun; Shuaifeng Chen

    2015-01-01

    We describe the optimization and validation of the DNATyper™15 multiplex polymerase chain reaction (PCR) genotyping system for autosomal short tandem repeat (STR) amplification at 14 autosomal loci (D6S1043, D21S11, D7S820, CSF1PO, D2S1338, D3S1358, D13S317, D8S1179, D16S539, Penta E, D5S818, vWA, D18S51, and FGA) and  amelogenin, a sex-determining locus. Several DNATyper™15 assay variables were optimized, including hot start Taq polymerase concentration, Taq polymerase activation time, magne...

  20. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

    OpenAIRE

    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

    1993-01-01

    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  1. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    OpenAIRE

    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

    2004-01-01

    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  2. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade

    2013-01-01

    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  3. Optimizing Taq polymerase concentration for improved signal-to-noise in the broad range detection of low abundance bacteria.

    Directory of Open Access Journals (Sweden)

    Rudolph Spangler

    Full Text Available BACKGROUND: PCR in principle can detect a single target molecule in a reaction mixture. Contaminating bacterial DNA in reagents creates a practical limit on the use of PCR to detect dilute bacterial DNA in environmental or public health samples. The most pernicious source of contamination is microbial DNA in DNA polymerase preparations. Importantly, all commercial Taq polymerase preparations inevitably contain contaminating microbial DNA. Removal of DNA from an enzyme preparation is problematical. METHODOLOGY/PRINCIPAL FINDINGS: This report demonstrates that the background of contaminating DNA detected by quantitative PCR with broad host range primers can be decreased greater than 10-fold through the simple expedient of Taq enzyme dilution, without altering detection of target microbes in samples. The general method is: For any thermostable polymerase used for high-sensitivity detection, do a dilution series of the polymerase crossed with a dilution series of DNA or bacteria that work well with the test primers. For further work use the concentration of polymerase that gave the least signal in its negative control (H(2O while also not changing the threshold cycle for dilutions of spiked DNA or bacteria compared to higher concentrations of Taq polymerase. CONCLUSIONS/SIGNIFICANCE: It is clear from the studies shown in this report that a straightforward procedure of optimizing the Taq polymerase concentration achieved "treatment-free" attenuation of interference by contaminating bacterial DNA in Taq polymerase preparations. This procedure should facilitate detection and quantification with broad host range primers of a small number of bona fide bacteria (as few as one in a sample.

  4. Whole blood Nested PCR and Real-time PCR amplification of Talaromyces marneffei specific DNA for diagnosis.

    Science.gov (United States)

    Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan

    2016-02-01

    Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Detection of Legionella species in environmental water by the quantitative PCR method in combination with ethidium monoazide treatment.

    Science.gov (United States)

    Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio

    2015-01-01

    We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.

  6. The Schizosaccharomyces pombe Mediator

    DEFF Research Database (Denmark)

    Venturi, Michela

    , Schizosaccharomyces pombe and mammalian Mediator. In our study, we have taken the S. pombe Mediator into consideration and characterized genetically and biochemically two subunits already know in S. cerevisiae, Med9 and Med11, but still not identified in the S. pombe Mediator. Genetic analysis has shown that med9......In the past several years great attention has been dedicated to the characterization of the Mediator complex in a different range of model organisms. Mediator is a conserved co-activator complex involved in transcriptional regulation and it conveys signals from regulatory transcription factors...... to the basal transcription machinery. Mediator was initially isolated from Saccharomyces cerevisiae based on its ability to render a RNA polymerase II in vitro transcription system responsive to activators. Additionally, structural studies have revealed striking structural similarities between S. cerevisiae...

  7. Molecular methods (digital PCR and real-time PCR) for the quantification of low copy DNA of Phytophthora nicotianae in environmental samples.

    Science.gov (United States)

    Blaya, Josefa; Lloret, Eva; Santísima-Trinidad, Ana B; Ros, Margarita; Pascual, Jose A

    2016-04-01

    Currently, real-time polymerase chain reaction (qPCR) is the technique most often used to quantify pathogen presence. Digital PCR (dPCR) is a new technique with the potential to have a substantial impact on plant pathology research owing to its reproducibility, sensitivity and low susceptibility to inhibitors. In this study, we evaluated the feasibility of using dPCR and qPCR to quantify Phytophthora nicotianae in several background matrices, including host tissues (stems and roots) and soil samples. In spite of the low dynamic range of dPCR (3 logs compared with 7 logs for qPCR), this technique proved to have very high precision applicable at very low copy numbers. The dPCR was able to detect accurately the pathogen in all type of samples in a broad concentration range. Moreover, dPCR seems to be less susceptible to inhibitors than qPCR in plant samples. Linear regression analysis showed a high correlation between the results obtained with the two techniques in soil, stem and root samples, with R(2) = 0.873, 0.999 and 0.995 respectively. These results suggest that dPCR is a promising alternative for quantifying soil-borne pathogens in environmental samples, even in early stages of the disease. © 2015 Society of Chemical Industry.

  8. Comparison of toxicity neutralization-, ELISA- and PCR tests for typing of Clostridium perfringens and detection of the enterotoxin gene by PCR

    DEFF Research Database (Denmark)

    Møller, Kristian; Ahrens, Peter

    1996-01-01

    A polymerase chain reaction (PCR) was developed for the specific amplification of a part of each of the five Clostridium perfringens toxin genes: alpha (alpha), beta (beta), epsilon (epsilon), iota (iota), and enterotoxin (CPE). While the toxicity neutralization test (TNT) only showed limited...

  9. Nanoparticles affect PCR primarily via surface interactions with PCR components: using amino-modified silica-coated magnetic nanoparticles as a main model

    Science.gov (United States)

    Nanomaterials have been widely reported to affect the polymerase chain reaction (PCR). However, many studies in which these effects were observed were not comprehensive, and many of the proposed mechanisms have been primarily speculative. In this work, we used amino-modified silica-coated magnetic n...

  10. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

    Science.gov (United States)

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

    2016-01-01

    Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

  11. Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.

    Science.gov (United States)

    Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne

    2017-06-01

    To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.

  12. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.

    Science.gov (United States)

    Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S

    2010-03-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  13. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  14. Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis.

    Science.gov (United States)

    Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette

    2017-09-27

    Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

  15. Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

    Science.gov (United States)

    Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

    2017-01-01

    Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

  16. Improved thermal cycling durability and PCR compatibility of polymer coated quantum dot

    International Nuclear Information System (INIS)

    Xun Zhe; Guan Yifu; Zhao Xiaoyun

    2013-01-01

    Quantum dots have experienced rapid development in imaging, labeling and sensing in medicine and life science. To be suitable for polymerase chain reaction (PCR) assay, we have tested QD thermal cycling durability and compatibility, which have not been addressed in previous reports. In this study, we synthesized CdSe/ZnS QDs with a surface modification with high-MW amphiphilic copolymers and observed that Mg 2+ ions in the PCR reaction could induce the QDs to precipitate and reduce their fluorescence signal significantly after thermal cycling. To overcome this problem, we used mPEG2000 to conjugate the QD surface for further protection, and found that this modification enables QDs to endure 40 thermal cycles in the presence of other components essential for PCR reactions. We have also identified that QDs have different effects on rTaq and Ex Taq polymerization systems. A high QD concentration could apparently reduce the PCR efficiency, but this inhibition was relieved significantly in the Ex PCR system as the concentration of Ex Taq polymerase was increased. Real-time PCR amplification results showed that QDs could provide a sufficiently measurable fluorescence signal without excessively inhibiting the DNA amplification. Based on this improved thermal cycling durability and compatibility with the PCR system, QDs have the potential to be developed as stable fluorescent sensors in PCR and real-time PCR amplification. (paper)

  17. PCR in forensic genetics

    DEFF Research Database (Denmark)

    Morling, Niels

    2009-01-01

    Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...... and more advanced, special investigations in cases concerning crime, paternity, relationship, disaster victim identification etc. The present review gives an update on the use of DNA investigations in forensic genetics.......Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...

  18. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  19. Simulation and experimental validation of a SU-8 based PCR thermocycler chip with integrated heaters and temperature sensor

    DEFF Research Database (Denmark)

    El-Ali, Jamil; Perch-Nielsen, Ivan R.; Poulsen, Claus Riber

    2004-01-01

    We present a SU-8 based polymerase chain reaction (PCR) chip with integrated platinum thin film heaters and temperature sensor. The device is fabricated in SU-8 on a glass substrate. The use of SU-8 provides a simple microfabrication process for the PCR chamber, controllable surface properties......C/s, respectively, the performance of the chip is comparable with the best silicon micromachined PCR chips presented in the literature. The SU-8 chamber surface was found to be PCR compatible by amplification of yeast gene ribosomal protein S3 and Campylobacter gene cadF. The PCR compatibility of the chamber...

  20. Reference gene identification for reliable normalisation of quantitative RT-PCR data in Setaria viridis.

    Science.gov (United States)

    Nguyen, Duc Quan; Eamens, Andrew L; Grof, Christopher P L

    2018-01-01

    Quantitative real-time polymerase chain reaction (RT-qPCR) is the key platform for the quantitative analysis of gene expression in a wide range of experimental systems and conditions. However, the accuracy and reproducibility of gene expression quantification via RT-qPCR is entirely dependent on the identification of reliable reference genes for data normalisation. Green foxtail ( Setaria viridis ) has recently been proposed as a potential experimental model for the study of C 4 photosynthesis and is closely related to many economically important crop species of the Panicoideae subfamily of grasses, including Zea mays (maize), Sorghum bicolor (sorghum) and Sacchurum officinarum (sugarcane). Setaria viridis (Accession 10) possesses a number of key traits as an experimental model, namely; (i) a small sized, sequenced and well annotated genome; (ii) short stature and generation time; (iii) prolific seed production, and; (iv) is amendable to Agrobacterium tumefaciens -mediated transformation. There is currently however, a lack of reference gene expression information for Setaria viridis ( S. viridis ). We therefore aimed to identify a cohort of suitable S. viridis reference genes for accurate and reliable normalisation of S. viridis RT-qPCR expression data. Eleven putative candidate reference genes were identified and examined across thirteen different S. viridis tissues. Of these, the geNorm and NormFinder analysis software identified SERINE / THERONINE - PROTEIN PHOSPHATASE 2A ( PP2A ), 5 '- ADENYLYLSULFATE REDUCTASE 6 ( ASPR6 ) and DUAL SPECIFICITY PHOSPHATASE ( DUSP ) as the most suitable combination of reference genes for the accurate and reliable normalisation of S. viridis RT-qPCR expression data. To demonstrate the suitability of the three selected reference genes, PP2A , ASPR6 and DUSP , were used to normalise the expression of CINNAMYL ALCOHOL DEHYDROGENASE ( CAD ) genes across the same tissues. This approach readily demonstrated the suitably of the three

  1. Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.

    Science.gov (United States)

    Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck

    2013-01-01

    Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

  2. Water Bridging Dynamics of Polymerase Chain Reaction in the Gauge Theory Paradigm of Quantum Fields

    Directory of Open Access Journals (Sweden)

    L. Montagnier

    2017-05-01

    Full Text Available We discuss the role of water bridging the DNA-enzyme interaction by resorting to recent results showing that London dispersion forces between delocalized electrons of base pairs of DNA are responsible for the formation of dipole modes that can be recognized by Taq polymerase. We describe the dynamic origin of the high efficiency and precise targeting of Taq activity in PCR. The spatiotemporal distribution of interaction couplings, frequencies, amplitudes, and phase modulations comprise a pattern of fields which constitutes the electromagnetic image of DNA in the surrounding water, which is what the polymerase enzyme actually recognizes in the DNA water environment. The experimental realization of PCR amplification, achieved through replacement of the DNA template by the treatment of pure water with electromagnetic signals recorded from viral and bacterial DNA solutions, is found consistent with the gauge theory paradigm of quantum fields.

  3. PCR detection of Bartonella spp. in the dog

    Directory of Open Access Journals (Sweden)

    Jarmila Konvalinová

    2014-01-01

    Full Text Available Our study aimed at using PCR to identify the incidence of Bartonella spp. in blood of dogs. Altogether 286 dogs of 92 breeds aged 3 month to 17 years were tested from October 2008 to December 2009. Healthy dogs as well as dogs with various clinical symptoms of disease were included in the group. Samples were tested by polymerase chain reaction (PCR specific for the presence of Bartonella spp. Following the DNA examination in 286 dogs by PCR and subsequent sequencing, two samples were identified as Bartonella henselae (0.7%. Other species of Bartonella were not found. It was the first time in the Czech Republic when incidence of Bartonella spp. was determined in dogs.

  4. Detection of a putative virulence cadF gene of Campylobacter jejuni obtained from different sources using a microfabricated PCR chip

    DEFF Research Database (Denmark)

    Poulsen, Claus Riber; El-Ali, Jamil; Perch-Nielsen, Ivan R.

    2005-01-01

    A microfabricated polymerase chain reaction (PCR) chip made of epoxy-based photoresist (SU-8) was recently designed and developed. In this study, we tested whether the PCR chip could be used for rapid detection of a potential virulence determinant, the cadF gene of Campylobacter jejuni. PCR...... was performed using published PCR conditions and primers for the C. jejuni cadF gene. DNA isolated from a C. jejuni reference strain CCUG 11284, C. jejuni isolates obtained from different sources (chicken and human), and Campylobacter whole cells were used as templates in the PCR tests. Conventional PCR in tube...... was used as the control. After optimization of the PCR chip, PCR positives on the chip were obtained from 91.0% (10/11) of the tested chips. A fast transition time was achieved with the PCR chip, and therefore a faster cycling time and a shorter PCR program were obtained. Using the PCR chip, the cadF gene...

  5. Analysis of minimal residual disease by Ig/TCR gene rearrangements: guidelines for interpretation of real-time quantitative PCR data

    NARCIS (Netherlands)

    van der Velden, V. H. J.; Cazzaniga, G.; Schrauder, A.; Hancock, J.; Bader, P.; Panzer-Grumayer, E. R.; Flohr, T.; Sutton, R.; Cave, H.; Madsen, H. O.; Cayuela, J. M.; Trka, J.; Eckert, C.; Foroni, L.; Zur Stadt, U.; Beldjord, K.; Raff, T.; van der Schoot, C. E.; van Dongen, J. J. M.

    2007-01-01

    Most modern treatment protocols for acute lymphoblastic leukaemia (ALL) include the analysis of minimal residual disease (MRD). To ensure comparable MRD results between different MRD-polymerase chain reaction (PCR) laboratories, standardization and quality control are essential. The European Study

  6. Multi-laboratory survey of qPCR enterococci analysis method performance in U.S. coastal and inland surface waters

    Data.gov (United States)

    U.S. Environmental Protection Agency — Quantitative polymerase chain reaction (qPCR) has become a frequently used technique for quantifying enterococci in recreational surface waters, but there are...

  7. Comparison of a conventional and nested PCR for diagnostic confirmation and genotyping of Orientia tsutsugamushi.

    Science.gov (United States)

    Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M

    2014-05-01

    A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

    Directory of Open Access Journals (Sweden)

    Bruynseels Peggy

    2009-07-01

    Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

  9. Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence.

    Science.gov (United States)

    André, P; Kim, A; Khrapko, K; Thilly, W G

    1997-08-01

    The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.

  10. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  11. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

    Science.gov (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-09-09

    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  12. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    Gokahmetoglu, S.; Deniz, E.

    2007-01-01

    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  13. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....

  14. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  15. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.

    2006-01-01

    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...

  16. Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection.

    Directory of Open Access Journals (Sweden)

    Ahmed Abd El Wahed

    Full Text Available Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF. Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR are the standard method for molecular detection of the dengue virus (DENV. Real-time RT-PCR analysis is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA assays were developed to detect DENV1-4.Using two quantitative RNA molecular standards, the analytical sensitivity of a RT-RPA targeting the 3´non-translated region of DENV1-4 was found to range from 14 (DENV4 to 241 (DENV1-3 RNA molecules detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile laboratory combining magnetic-bead based total nucleic acid extraction and a portable detection device in Kedougou (Senegal and in Bangkok (Thailand. In Kedougou, the RT-RPA was operated at an ambient temperature of 38 °C with auxiliary electricity tapped from a motor vehicle and yielded a clinical sensitivity and specificity of 98% (n=31 and 100% (n=23, respectively. While in the field trial in Bangkok, the clinical sensitivity and specificity were 72% (n=90 and 100%(n=41, respectively.During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations.

  17. Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells.

    Science.gov (United States)

    Pierce, Kenneth E; Wangh, Lawrence J

    2007-01-01

    Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.

  18. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    Science.gov (United States)

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  19. Prospective evaluation of commercial antibody-based rapid tests in combination with a loop-mediated isothermal amplification PCR assay for detection of Orientia tsutsugamushi during the acute phase of scrub typhus infection.

    Science.gov (United States)

    Blacksell, Stuart D; Paris, Daniel H; Chierakul, Wirongrong; Wuthiekanun, Vanaporn; Teeratakul, Achara; Kantipong, Pacharee; Day, Nicholas P J

    2012-03-01

    Samples from 160 prospectively recruited febrile patients with typhus-like illness in an area of Thailand (Chiang Rai, northern Thailand) where scrub typhus is endemic were used to evaluate the diagnostic capabilities of four rapid immunochromatographic tests (ICTs) for the detection of Orientia tsutsugamushi IgM and total antibodies during acute scrub typhus infection. Of the 160 cases, 54 (34%) had been confirmed to have scrub typhus using the reference scrub typhus infection criteria (STIC), i.e., positive cell culture isolation, an admission IgM antibody titer of ≥1:12,800, a 4-fold rising IgM antibody titer, and/or positivity for ≥2 out of 3 PCR gene targets). The ICTs gave the following sensitivities and specificities: the Panbio IgM ICT, 46% (95% confidence interval [CI], 33 to 60) and 95% (95% CI, 89 to 98), respectively; the Standard Diagnostics IgM ICT, 68% (95% CI, 60 to 75) and 73% (95% CI, 68 to 78), respectively; the AccessBio IgM ICT, 56% (95% CI, 48 to 63) and 90% (95% CI, 87 to 94), respectively; and the AccessBio total antibody ABt ICT, 61% (95% CI, 53 to 68) and 68% (95% CI, 63 to 73), respectively. An isothermal loop amplification (LAMP) PCR assay for scrub typhus demonstrated a sensitivity of 52% (95% CI, 38 to 66) and a specificity of 94% (95% CI, 88 to 98). This study has revealed the diagnostic limitations of antibody-based assays in an acute care setting. However, the combination of ICTs with LAMP usually increased sensitivity with a minimal reduction in specificity. The best combination, the Panbio IgM ICT and LAMP, resulted in a sensitivity of 67% (95% CI, 53 to 79) and a specificity of 91% (95% CI, 83 to 95). The combination of antibody-based assays with DNA- or antigen-based tests shows promise for improved diagnostic sensitivity.

  20. Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

    Science.gov (United States)

    Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

    2002-12-20

    A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

  1. Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

    KAUST Repository

    Wen, Weijia

    2011-03-03

    A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable chip with volumes as small as 1.25 µl, while the heating and cooling rate may be as fast as 12.7 °C/second ensuring that the total time needed of only 25 minutes to complete the 35 cycle PCR amplification. The PCR may be performed according to a two-temperature approach for denaturing and annealing (Td and Ta) of DNA with the PCR chip, with which the amplification of male-specific SRY gene marker by utilizing raw saliva may be achieved. The genetic identification may be in-situ detected after PCR by the optical detection system.

  2. Development of a Real-time PCR test for porcine group A rotavirus diagnosis

    Directory of Open Access Journals (Sweden)

    Elizabeth C.M. Marconi

    2015-01-01

    Full Text Available Group A Rotavirus (RVA is one of the most common causes of diarrhea in humans and several animal species. A SYBR-Green Real-Time polymerase chain reaction (PCR was developed to diagnose RVA from porcine fecal samples, targeting amplification of a 137-bp fragment of nonstructural protein 5 (NSP5 gene using mRNA of bovine NADH-desidrogenase-5 as exogenous internal control. Sixty-five samples were tested (25 tested positive for conventional PCR and genetic sequencing. The overall agreement (kappa was 0.843, indicating 'very good' concordance between tests, presenting 100% of relative sensitivity (25+ Real Time PCR/25+ Conventional PCR and 87.5% of relative sensitivity (35- Real Time PCR/40- Conventional PCR. The results also demonstrated high intra- and inter-assay reproducibility (coefficient of variation ≤1.42%; thus, this method proved to be a fast and sensitive approach for the diagnosis of RVA in pigs.

  3. Fast detection of genetic information by an optimized PCR in an interchangeable chip.

    KAUST Repository

    Wu, Jinbo

    2012-02-01

    In this paper, we report the construction of a polymerase chain reaction (PCR) device for fast amplification and detection of DNA. This device consists of an interchangeable PCR chamber, a temperature control component as well as an optical detection system. The DNA amplification happens on an interchangeable chip with the volumes as low as 1.25 μl, while the heating and cooling rate was as fast as 12.7°C/second ensuring that the total time needed of only 25 min to complete the 35 cycle PCR amplification. An optimized PCR with two-temperature approach for denaturing and annealing (Td and Ta) of DNA was also formulated with the PCR chip, with which the amplification of male-specific sex determining region Y (SRY) gene marker by utilizing raw saliva was successfully achieved and the genetic identification was in-situ detected right after PCR by the optical detection system.

  4. Polymerase chain reaction fingerprints of methicillin-resistant Staphylococcus aureus clinical isolates in Greece are related to certain antibiotypes.

    Science.gov (United States)

    Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris

    2003-06-01

    Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.

  5. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    Science.gov (United States)

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  6. The multitalented Mediator complex.

    Science.gov (United States)

    Carlsten, Jonas O P; Zhu, Xuefeng; Gustafsson, Claes M

    2013-11-01

    The Mediator complex is needed for regulated transcription of RNA polymerase II (Pol II)-dependent genes. Initially, Mediator was only seen as a protein bridge that conveyed regulatory information from enhancers to the promoter. Later studies have added many other functions to the Mediator repertoire. Indeed, recent findings show that Mediator influences nearly all stages of transcription and coordinates these events with concomitant changes in chromatin organization. We review the multitude of activities associated with Mediator and discuss how this complex coordinates transcription with other cellular events. We also discuss the inherent difficulties associated with in vivo characterization of a coactivator complex that can indirectly affect diverse cellular processes via changes in gene transcription. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR

    Directory of Open Access Journals (Sweden)

    Sérgio Monteiro de Almeida

    Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.

  8. Polymerase Chain Reaction (PCR) Analysis of Microbial Consortia on Wastewater Treatment Processes for High Explosives

    Science.gov (United States)

    2009-09-01

    DISCLAIMER: The contents of this report are not to be used for advertising, publication, or promotional purposes. Citation of trade names does not...other authorized documents. DESTROY THIS REPORT WHEN NO LONGER NEEDED. DO NOT RETURN IT TO THE ORIGINATOR. ERDC/CERL TR-09-34 iii Table of Contents ...Bacteroidetes/unclassified 90%, uncultured rumen bacterium; SR24; DQ394627 10 14.1 UI-15 Bacteroidales/unclassified 99%, uncultured bacterium; B103

  9. Enzymological description of multitemplate PCR-Shrinking amplification bias by optimizing the polymerase-template ratio

    Czech Academy of Sciences Publication Activity Database

    Ingr, M.; Dostál, Jiří; Majerová, Taťána

    2015-01-01

    Roč. 382, Oct 7 (2015), s. 178-186 ISSN 0022-5193 R&D Projects: GA MŠk LO1302; GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : amplification efficiency * amplicons pooling * species diversity * library preparation * processivity Subject RIV: CE - Biochemistry Impact factor: 2.049, year: 2015

  10. Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR).

    Science.gov (United States)

    Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A

    2005-12-01

    Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

  11. Development of nested polymerase chain reaction-based diagnosis of duck enteritis virus and detection of DNA polymerase gene from non-descriptive duck breeds of West Bengal, India

    Directory of Open Access Journals (Sweden)

    Partha Sarathi Mandal

    2017-03-01

    Full Text Available Aim: The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP infected eggs, and histopathological changes of chorioallantoic membrane (CAM in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR. Materials and Methods: After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Results: Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076 showed homology with the sequences data available in GenBank. Conclusion: The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP.

  12. Cutaneous and visceral leishmaniasis co-infection in dogs from Rio de Janeiro, Brazil: evaluation by specific PCR and RFLP-PCR assays

    Directory of Open Access Journals (Sweden)

    Marize Quinhones Pires

    2014-04-01

    Full Text Available Introduction During a diagnostic evaluation of canine visceral leishmaniasis (VL, two of seventeen dogs were found to be co-infected by Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi. Methods Specific polymerase chain reaction (PCR and restriction fragment length polymorphism-PCR (RFLP-PCR assays were performed. Results PCR assays for Leishmania subgenus identification followed by RFLP-PCR analysis in biopsies from cutaneous lesions and the spleen confirmed the presence of Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi in those fragments. Conclusions This report reinforces the importance of using serological and molecular techniques in the epidemiological surveillance of canine populations in endemic areas in which both diseases are known to co-exist. In such cases, a reassessment of the control measures is required.

  13. Large-scale multiplex polymerase chain reaction assay for diagnosis of viral reactivations after allogeneic hematopoietic stem cell transplantation.

    Science.gov (United States)

    Inazawa, Natsuko; Hori, Tsukasa; Hatakeyama, Naoki; Yamamoto, Masaki; Yoto, Yuko; Nojima, Masanori; Suzuki, Nobuhiro; Shimizu, Norio; Tsutsumi, Hiroyuki

    2015-08-01

    Viral reactivations following hematopoietic stem cell transplantation are thought to result from the breakdown of both cell-mediated and humoral immunity. As a result, many viruses could be reactivated individually or simultaneously. Using a multiplex polymerase chain reaction (PCR), we prospectively examined many kinds of viral DNAs at a time in 105 patients who underwent allogeneic hematopoietic stem cell transplantation. In total, 591 whole blood samples were collected weekly from pre- to 42 days post-transplantation and the following 13 viruses were tested; herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), human herpes virus 6 (HHV-6), HHV-7, HHV-8, adenovirus, BK virus (BKV), JC virus (JCV), parvovirus B19, and hepatitis B virus (HBV). Several viral DNAs were detected in 12 patients before hematopoietic stem cell transplantation. The detection rate gradually increased after transplantation and peaked at 21 days. The most frequently detected virus was HHV-6 (n = 63; 60.0%), followed by EBV (n = 11; 10.5%), CMV (n = 11; 10.5%), and HHV-7 (n = 9; 8.6%). Adenovirus and HBV were each detected in one patient (1.0%). Detection of HHV-6 DNA was significantly more common among patients undergoing cord blood transplantation or with steroid treatment. EBV DNA tended to be more common in patients treated with anti-thymocyte globulin. Multiplex PCR was useful for detecting many viral reactivations after hematopoietic stem cell transplantation, simultaneously. Cord blood transplantation, steroid treatment, or anti-thymocyte globulin use was confirmed to be risk factors after transplantation. © 2015 Wiley Periodicals, Inc.

  14. PCR, exit stage left ...

    CERN Multimedia

    2004-01-01

    The Prevessin Control Room during LEP's start up in 1989. The Prévessin Control Room (PCR) was recently engulfed in a wave of nostalgia. The PCR, scene of some of the greatest moments in CERN's history, is being dismantled to prepare for a complete overhaul. In February 2006, a new combined control centre for all the accelerators will open its doors on the same site, together with a new building currently under construction (see Bulletin issue 27/2004 of 28 June 2004). This marks the end of an important chapter in CERN's history. The Prévessin Control Room saw its first momentous event 28 years ago when the 400 GeV beam for the SPS was commissioned in the presence of Project Leader John Adams. It was also here that the first proton-antiproton collisions were observed, in 1981. Eight years later, in 1989, operators and directors alike jumped for joy at the announcement of the first electron-positron collisions at the start up of LEP, the biggest accelerator in the world. Today the 80 terminals and PCs have b...

  15. Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges

    Science.gov (United States)

    Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

    2016-01-01

    Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR. PMID:27956830

  16. Loop-Mediated Isothermal Amplification untuk Mendeteksi Gen blaTEM sebagai Penyandi Extended-Spectrum Beta-Lactamase pada Isolat Enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    Bayu A. P. Wilopo

    2015-12-01

    Full Text Available Extended-spectrum beta-lactamase (ESBL is a beta-lactamase enzyme that is capable of hydrolyzing penicillin, cephalosporin, and monobactam, and can be inhibited by clavulanic acid. This enzyme is encoded by multiple genes, one of them is blaTEM. Polymerase chain reaction (PCR is one of the DNA amplification methods that are frequently used; however, there are other methods that can be used including, among others, loop-mediated isothermal amplification (LAMP. LAMP requires simple equipment with quicker and easy-to-read results compared to PCR. This study was a diagnostic test to explore the sensitivity and specificity of LAMP method compared to PCR in detecting blaTEM gene. Furthermore, the concordance between LAMP and PCR methods was assessed. A total of 92 Enterobacteriaceae isolates were examined by PCR and LAMP methods and compared. The result showed that the LAMP method had a sensitivity of 91.4% and a specificity of 91.2% with a concordance value (kappa of 85.4%. In conclusion, LAMP method has a good validity and a very good conformity compared to the PCR method. Therefore, LAMP method can be used as an alternative diagnostic test, especially in limited settings.

  17. Does Polymerase Chain Reaction of Tissue Specimens Aid in the Diagnosis of Tuberculosis?

    Directory of Open Access Journals (Sweden)

    Yoo Jin Lee

    2016-11-01

    Full Text Available Background Mycobacterial culture is the gold standard test for diagnosing tuberculosis (TB, but it is time-consuming. Polymerase chain reaction (PCR is a highly sensitive and specific method that can reduce the time required for diagnosis. The diagnostic efficacy of PCR differs, so this study determined the actual sensitivity of TB-PCR in tissue specimens. Methods We retrospectively reviewed 574 cases. The results of the nested PCR of the IS6110 gene, mycobacterial culture, TB-specific antigen-induced interferon-γ release assay (IGRA, acid-fast bacilli (AFB staining, and histological findings were evaluated. Results The positivity rates were 17.6% for PCR, 3.3% for the AFB stain, 22.2% for mycobacterial culture, and 55.4% for IGRA. PCR had a low sensitivity (51.1% and a high specificity (86.3% based on the culture results of other studies. The sensitivity was higher (65.5% in cases with necrotizing granuloma but showed the highest sensitivity (66.7% in those with necrosis only. The concordance rate between the methods indicated that PCR was the best method compared to mycobacterial culture, and the concordance rate increased for the methods using positive result for PCR or histologic features. Conclusions PCR of tissue specimens is a good alternative to detect tuberculosis, but it may not be as sensitive as previously suggested. Its reliability may also be influenced by some histological features. Our data showed a higher sensitivity when specimens contained necrosis, which indicated that only specimens with necrosis should be used for PCR to detect tuberculosis.

  18. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  19. Quantification of algal endosymbionts (Symbiodinium) in coral tissue using real-time PCR

    NARCIS (Netherlands)

    Mieog, J. C.; Van Oppen, M. J. H.; Berkelmans, R.; Stam, W. T.; Olsen, J. L.

    Understanding the flexibility of the endosymbioses between scleractinian corals and single-cell algae of the genus Symbiodinium will provide valuable insights into the future of coral reefs. Here, a real-time polymerase chain reaction (PCR) assay is presented to accurately determine the cell

  20. Developmental stage of strongyle eggs affects the outcome variations of real-time PCR analysis

    DEFF Research Database (Denmark)

    Andersen, Ulla Vestergaard; Haakansson, I. T.; Roust, Tina

    2013-01-01

    extent developmental stages can affect the variation of diagnostic test results. This study investigated the influence of developmental stages of strongyle eggs on the variation real-time polymerase chain reaction (PCR) results. Mixed species strongyle eggs were obtained from the faeces of a naturally...

  1. Real time quantitative amplification detection on a microarray: towards high multiplex quantitative PCR.

    NARCIS (Netherlands)

    Pierik, A.; Moamfa, M; van Zelst, M.; Clout, D.; Stapert, H.; Dijksman, Johan Frederik; Broer, D.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  2. Real time quantitative amplification detection on a microarray : towards high multiplex quantitative PCR

    NARCIS (Netherlands)

    Pierik, Anke; Boamfa, M.; Zelst, van M.; Clout, D.; Stapert, H.R.; Dijksman, J.F.; Broer, D.J.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  3. Use of PCR on lymph-node sample as test of cure of visceral leishmaniasis

    NARCIS (Netherlands)

    Osman, O. F.; Kager, P. A.; Zijlstra, E. E.; El-Hassan, A. M.; Oskam, L.

    1997-01-01

    When the polymerase chain reaction (PCR) was used to test lymph-node aspirates from 35 patients from eastern Sudan, who had had visceral leishmaniasis but were believed cured, leishmanial DNA was detected in samples from 14 of the patients. There were no significant differences between the

  4. PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

    Science.gov (United States)

    Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

    2009-01-01

    Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

  5. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...

  6. Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

    Science.gov (United States)

    Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

    2018-04-01

    Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

  7. Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies

    DEFF Research Database (Denmark)

    Hum, S.; Quinn, K.; Brunner, J.

    1997-01-01

    methods were attributed to methodological differences used in various laboratories. Conclusion Our results indicate that misidentification of C fetus in routine diagnostic laboratories may be relatively common. The PCR assay evaluated gave rapid and reproducible results and is thus a valuable adjunctive......Objective To evaluate a polymerase chain reaction assay for identification of Campylobacter fetus and differentiation of the defined subspecies. Design Characterisation of bacterial strains by traditional phenotyping, polymerase chain reaction, a probabilistic identification scheme...... by traditional phenotypic methods and the PCR assay was found to be 80.8%. The polymerase chain reaction proved to be a reliable technique for the species and subspecies identification of C fetus; equivocal results were obtained in only two instances. Initial misidentifications by conventional phenotyping...

  8. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...

  9. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

  10. PCR Expression Analysis Of the Estrogeninducible Gene Bcei in Gastrointestinal and Other Human Tumors

    Directory of Open Access Journals (Sweden)

    Iris Wundrack

    1994-01-01

    Full Text Available A polymerase chain reaction (PCR assay was developed to test for tumor cell specific expression of the BCEI gene. This new marker gene, reported at first for human breast cancer, was found specifically active in various gastrointestinal carcinomas by previously applying immunohistochemistry and RNA (Northern blot analysis. Presently, by using reverse transcription -PCR analysis, a series of primary tumor tissues and established tumor cell lines were testcd for BCEI transcription. This approach was compared to immunostaining achieved by an antibody directed against the BCEI gene’s product. The result demonstrate the superior sensitivity of PCR by indicating the gene’ s expression in cases where immunohistochemical testing remained negative.

  11. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  12. Phosphorylation of ETS-1 is a critical event in DNA polymerase iota-induced invasion and metastasis of esophageal squamous cell carcinoma.

    Science.gov (United States)

    He, Chao; Wu, Shuhua; Gao, Aidi; Su, Ye; Min, Han; Shang, Zeng-Fu; Wu, Jinchang; Yang, Li; Ding, Wei-Qun; Zhou, Jundong

    2017-12-01

    An aberrantly elevated expression of DNA polymerase ι (Pol ι) is significantly associated with poor prognosis of patients with esophageal squamous cell carcinoma (ESCC), yet the mechanisms behind this phenomenon remain obscure. Based on the RNA-Seq transcriptome and real-time PCR analysis, we identified ETS-1 as a candidate gene involved in Pol ι-mediated progression of ESCC. Wound-healing and transwell assay indicated that downregulation of ETS-1 attenuates Pol ι-mediated invasiveness of ESCC. Signaling pathway analysis showed that Pol ι enhances ETS-1 phosphorylation at threonine-38 through the Erk signaling pathway in ESCC cells. Kaplan-Meier analysis, based on 93 clinical tissue samples, revealed that ETS-1 phosphorylation at threonine-38 is associated with poor prognosis of ESCC patients. The present study thus demonstrates that phosphorylation of ETS-1 is a critical event in the Pol ι-induced invasion and metastasis of ESCC. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  13. Real-time PCR analysis of carbon catabolite repression of cellobiose gene transcription in Trametes versicolor

    Energy Technology Data Exchange (ETDEWEB)

    Stapleton, P. C.; O' Mahoney, J.; Dobson, A. D. W. [National University of Ireland, Microbiology Department, Cork (Ireland)

    2004-02-01

    Previous reports indicate that in white rot fungi such as Trametes versicolor, the production of cellobiose dehydrogenase (CDH), an extracellular haemo-flavo-enzyme, is subject to carbon catabolite repression by both glucose and maltose, and that the repression is mediated at the transcriptional level. This paper describes the results of an investigation of CDH gene transcription in cellulolytic cultures of T. versicolor, in the presence of other additional carbon sources such as glucose, arabinose, and xylose. Using real time polymerase chain reaction (RT-PCR) assay methods in the presence of these other additional carbon sources, the levels of repression observed are quantitatively determined in an effort to obtain more accurate measurements of carbon catabolite repression of CDH production in this ligninolytic fungus. Ninety-six hours after addition, results of the analysis showed reduction in CDH transcript levels of 19-fold for galactose, 92-fold for arabinose and 114-fold for xylose. The greatest repressive effect was exhibited by glucose. In this case the reduction in CDH transcript levels was 3400-fold. CDH plays an important role in lignin degradation, and there is also substantial interest in the biotechnological applications of CDH, most particularly in the pulp and paper industry. 24 refs., 4 figs.

  14. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  15. Quadruplex genotype analysis at HumTH01, HumTPOX, HumCSF1PO and amelogenin Loci by FoLT-PCR

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Y.H.; Lim, S.K.; Kang, P.W.; Choi, D.H.; Yoon, S.R.; Han, M.S. [National Institute of Scientific Investigation, Seoul (Korea)

    1999-06-01

    A simple and rapid procedure, called FoLT-PCR(Formamide Low Temperature-Polymerase Chain Reaction) was applied to amplifying DNA directly from various forensic biological evidences including human blood, saliva, hair root, or semen without any DNA preparative steps. We added washing step with non-ionic detergent, 1% Triton X-100, and used Taq DNA polymerase instead of Tth DNA polymerase to amplify 3 STR loci and gender allele simultaneously. Optimal concentration of formamide and annealing temperature were determined empirically to 8%(v/v), and 48{sup o} C respectively. We also compared this method with standard PCR. 8 refs., 4 figs.

  16. PCR em tempo real para diagnóstico da leucose enzoótica bovina Enzootic bovine leukosis real time PCR

    Directory of Open Access Journals (Sweden)

    Natanael Lamas Dias

    2012-08-01

    Full Text Available O objetivo deste trabalho foi realizar a validação de uma reação em cadeia da polimerase em tempo real com o sistema Plexor® (qPCR para o diagnóstico da Leucose Enzoótica Bovina (LEB, por meio da comparação com testes de diagnóstico recomendados pela Organização Mundial de Saúde Animal (OIE. A qPCR foi comparada com duas outras técnicas: a PCR nested (nPCR e a imunodifusão em gel de ágar (IDGA. Das 82 amostras analisadas pela qPCR e nPCR, 79 apresentaram resultados concordantes, sendo a concordância, classificada pelo Índice Kappa, como alta. Entre as PCRs e a IDGA, o número de resultados concordantes foi de 71 e 69, respectivamente, para qPCR e nPCR, sendo a concordância classificada como considerável. A qPCR apresentou altos valores de sensibilidade e especificidade. Os valores preditivos da qPCR observados demonstraram a alta capacidade de classificação dos casos positivos e negativos. A qPCR não foi capaz de detectar três amostras positivas e tem custo ligeiramente superior que a nPCR. Entretanto, a qPCR é uma técnica mais rápida, menos susceptível a contaminações, tem alta sensibilidade, não utiliza e não gera resíduos carcinogênicos. Concluímos que a qPCR pode substituir a nPCR recomendada pela OIE no diagnóstico de rotina em áreas em que a LEB é endêmica, como no Brasil.The goal of this research was to validate a Plexor® real time Polymerase Chain Reaction (qPCR for Enzootic Bovine Leukosis (EBL diagnosis by comparison with methods recommend by the World Animal Health Organization (OIE. The qPCR was compared with two other techniques: the nested PCR (nPCR and to the agar gel immunodiffusion (AGID. Of 82 qPCR and nPCR analysed samples, 79 presented concordant results, being the concordance classified by Kappa Index as high. Between the PCRs and AGID, the number of concordant results was 71 and 69, out of 82, to qPCR and nPCR, respectively, being the concordance classified as considerable, in both

  17. Droplet digital PCR technology promises new applications and research areas.

    Science.gov (United States)

    Manoj, P

    2016-01-01

    Digital Polymerase Chain Reaction (dPCR) is used to quantify nucleic acids and its applications are in the detection and precise quantification of low-level pathogens, rare genetic sequences, quantification of copy number variants, rare mutations and in relative gene expressions. Here the PCR is performed in large number of reaction chambers or partitions and the reaction is carried out in each partition individually. This separation allows a more reliable collection and sensitive measurement of nucleic acid. Results are calculated by counting amplified target sequence (positive droplets) and the number of partitions in which there is no amplification (negative droplets). The mean number of target sequences was calculated by Poisson Algorithm. Poisson correction compensates the presence of more than one copy of target gene in any droplets. The method provides information with accuracy and precision which is highly reproducible and less susceptible to inhibitors than qPCR. It has been demonstrated in studying variations in gene sequences, such as copy number variants and point mutations, distinguishing differences between expression of nearly identical alleles, assessment of clinically relevant genetic variations and it is routinely used for clonal amplification of samples for NGS methods. dPCR enables more reliable predictors of tumor status and patient prognosis by absolute quantitation using reference normalizations. Rare mitochondrial DNA deletions associated with a range of diseases and disorders as well as aging can be accurately detected with droplet digital PCR.

  18. Reference gene validation for qPCR in rat carotid body during postnatal development

    Directory of Open Access Journals (Sweden)

    Carroll John L

    2011-10-01

    Full Text Available Abstract Background The carotid bodies are the main arterial oxygen chemoreceptors in mammals. Afferent neural output from the carotid bodies to brainstem respiratory and cardiovascular nuclei provides tonic input and mediates important protective responses to acute and chronic hypoxia. It is widely accepted that the selection of reference genes for mRNA normalization in quantitative real-time PCR must be validated for a given tissue and set of conditions. This is particularly important for studies in carotid body during early postnatal maturation as the arterial oxygen tension undergoes major changes from fetal to postnatal life, which may affect reference gene expression. In order to determine the most stable and suitable reference genes for the study of rat carotid body during development, six commonly used reference genes, β-actin, RPII (RNA polymerase II, PPIA (peptidyl-proyl-isomerase A, TBP (TATA-box binding protein, GAPDH, and 18s rRNA, were evaluated in two age groups (P0-1 and P14-16 under three environmental oxygen conditions (normoxia, chronic hypoxia and chronic hyperoxia using the three most commonly used software programs, geNorm, NormFinder and BestKeeper. Findings The three programs produced similar results but the reference gene rankings were not identical between programs or experimental conditions. Overall, 18s rRNA was the least stable reference gene for carotid body and, when hyperoxia and/or hypoxia conditions were included, actin was similarly unstable. Conclusions Reference or housekeeping gene expression for qPCR studies of carotid body during postnatal development may vary with developmental stage and environmental conditions. Selection of the best reference gene or combination of reference genes for carotid body development studies should take environmental conditions into account. Two commonly used reference genes, 18s rRNA and actin, may be unsuitable for studies of carotid body maturation, especially if the study

  19. Quantitative analysis of food and feed samples with droplet digital PCR.

    Directory of Open Access Journals (Sweden)

    Dany Morisset

    Full Text Available In this study, the applicability of droplet digital PCR (ddPCR for routine analysis in food and feed samples was demonstrated with the quantification of genetically modified organisms (GMOs. Real-time quantitative polymerase chain reaction (qPCR is currently used for quantitative molecular analysis of the presence of GMOs in products. However, its use is limited for detecting and quantifying very small numbers of DNA targets, as in some complex food and feed matrices. Using ddPCR duplex assay, we have measured the absolute numbers of MON810 transgene and hmg maize reference gene copies in DNA samples. Key performance parameters of the assay were determined. The ddPCR system is shown to offer precise absolute and relative quantification of targets, without the need for calibration curves. The sensitivity (five target DNA copies of the ddPCR assay compares well with those of individual qPCR assays and of the chamber digital PCR (cdPCR approach. It offers a dynamic range over four orders of magnitude, greater than that of cdPCR. Moreover, when compared to qPCR, the ddPCR assay showed better repeatability at low target concentrations and a greater tolerance to inhibitors. Finally, ddPCR throughput and cost are advantageous relative to those of qPCR for routine GMO quantification. It is thus concluded that ddPCR technology can be applied for routine quantification of GMOs, or any other domain where quantitative analysis of food and feed samples is needed.

  20. Structure and function of DNA polymerase μ

    International Nuclear Information System (INIS)

    Matsumoto, Takuro; Maezawa, So

    2013-01-01

    DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)

  1. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  2. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  3. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  4. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

    Science.gov (United States)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

    1989-04-01

    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  5. Quantitative (real-time) PCR

    International Nuclear Information System (INIS)

    Denman, S.E.; McSweeney, C.S.

    2005-01-01

    Many nucleic acid-based probe and PCR assays have been developed for the detection tracking of specific microbes within the rumen ecosystem. Conventional PCR assays detect PCR products at the end stage of each PCR reaction, where exponential amplification is no longer being achieved. This approach can result in different end product (amplicon) quantities being generated. In contrast, using quantitative, or real-time PCR, quantification of the amplicon is performed not at the end of the reaction, but rather during exponential amplification, where theoretically each cycle will result in a doubling of product being created. For real-time PCR, the cycle at which fluorescence is deemed to be detectable above the background during the exponential phase is termed the cycle threshold (Ct). The Ct values obtained are then used for quantitation, which will be discussed later

  6. Comparative validation using quantitative real-time PCR (qPCR and conventional PCR of bovine semen centrifuged in continuous density gradient

    Directory of Open Access Journals (Sweden)

    M.V. Resende

    2011-06-01

    Full Text Available The objective of the present study was to determine the sperm enrichment with X-bearing spermatozoa, after one centrifugation in a Percoll or OptiPrep continuous density gradient, using quantitative real-time polymerase chain reaction (qPCR of sperm DNA and resultant in vitro-produced bovine embryos by PCR. Frozen/thawed sperm was layered on density gradients and the tubes were centrifuged. Supernatants were gently aspirated and the sperm recovered from the bottom of the tubes. Cleavage and blastocyst rates were determined through in vitro production of embryos and PCR was performed to identify the embryos' genetic sex. A difference in blastocyst rate was found in the Percoll treatment compared to OptiPrep (P<0.05. The percentage of female embryos in the Percoll and OptiPrep groups was 62.0% and 47.1%, respectively. These results were confirmed by qPCR of spermatozoa DNA and underestimation was seen only in the Percoll group. It was possible to sexing sperm using simple approach.

  7. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  8. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Natália Malaguti

    2015-01-01

    Full Text Available Bacterial vaginosis (BV is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%, and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

  9. Polymerase chain reaction for detection of invasive Shigella flexneri in food.

    Science.gov (United States)

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

    1990-06-01

    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

  10. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction.

    Science.gov (United States)

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

    2017-11-27

    Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  11. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan

    2014-09-01

    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  12. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

    2004-01-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  13. Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

    Science.gov (United States)

    White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

    2015-01-01

    Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

  14. Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

    Directory of Open Access Journals (Sweden)

    Zhouli Wang

    Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

  15. Towards the molecular bases of polymerase dynamics

    International Nuclear Information System (INIS)

    Chela Flores, J.

    1991-03-01

    One aspect of the strong relationship that is known to exist between the processes of DNA replication and transcription is manifest in the coupling of the rates of movement of the replication fork (r f ) and RNA polymerase (r t ). We address two issues concerning the largely unexplored area of polymerase dynamics: (i) The validity of an approximate kinematic formula linking r f and r t suggested by experiments in which transcription is initiated in some prokaryotes with the antibiotic streptolydigin, and (ii) What are the molecular bases of the kinematic formula? An analysis of the available data suggests possible molecular bases for polymerase dynamics. In particular, we are led to a hypothesis: In active chromatin r t may depend on the length (λ t ) of the transcript of the primary messenger RNA (pre-mRNA). This new effect is subject to experimental verification. We discuss possible experiments that may be performed in order to test this prediction. (author). Refs, 6 tabs

  16. DNA repair in DNA-polymerase-deficient mutants of Escherichia coli

    International Nuclear Information System (INIS)

    Smith, D.W.; Tait, R.C.; Harris, A.L.

    1975-01-01

    Escherichia coli mutants deficient in DNA polymerase I, in DNA polymerases I and II, or in DNA polymerase III can efficiently and completely execute excision-repair and postreplication repair of the uv-damaged DNA at 30 0 C and 43 0 C when assayed by alkaline sucrose gradients. Repair by Pol I - and Pol I - , Pol II - cells is inhibited by 1-β-D-arabinofuranosylcytosine (araC) at 43 0 C but not at 30 0 C, whereas that by Pol III - cells is insensitive to araC at any temperature. Thus, either Pol I or Pol III is required for complete and efficient repair, and in their absence Pol II mediates a limited, incomplete dark repair of uv-damaged DNA

  17. Prospective comparison of the detection rates of human enterovirus and parechovirus RT-qPCR and viral culture in different pediatric specimens

    NARCIS (Netherlands)

    de Crom, S C M; Obihara, C C; de Moor, R A; Veldkamp, E J M; van Furth, A M; Rossen, J W A

    2013-01-01

    BACKGROUND: Reverse-transcriptase quantitative real-time polymerase chain reaction (RT-qPCR) has become the gold standard for the diagnosis of human enterovirus (EV) and parechovirus (HPeV) infections. The detection rate of RT-qPCR in different pediatric body specimens has not been compared

  18. Identification of duck plague virus by polymerase chain reaction

    Science.gov (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  19. FACT facilitates chromatin transcription by RNA polymerases I and III

    DEFF Research Database (Denmark)

    Birch, Joanna L; Tan, Bertrand C-M; Panov, Kostya I

    2009-01-01

    Efficient transcription elongation from a chromatin template requires RNA polymerases (Pols) to negotiate nucleosomes. Our biochemical analyses demonstrate that RNA Pol I can transcribe through nucleosome templates and that this requires structural rearrangement of the nucleosomal core particle....... The subunits of the histone chaperone FACT (facilitates chromatin transcription), SSRP1 and Spt16, co-purify and co-immunoprecipitate with mammalian Pol I complexes. In cells, SSRP1 is detectable at the rRNA gene repeats. Crucially, siRNA-mediated repression of FACT subunit expression in cells results...... in a significant reduction in 47S pre-rRNA levels, whereas synthesis of the first 40 nt of the rRNA is not affected, implying that FACT is important for Pol I transcription elongation through chromatin. FACT also associates with RNA Pol III complexes, is present at the chromatin of genes transcribed by Pol III...

  20. Detecting Newcastle disease virus in combination of RT-PCR with red blood cell absorption

    Directory of Open Access Journals (Sweden)

    Liu Chengqian

    2011-05-01

    Full Text Available Abstract Reverse transcription-polymerase chain reaction (RT-PCR has limited sensitivity when treating complicated samples, such as feces, waste-water in farms, and nucleic acids, protein rich tissue samples, all the factors may interfere with the sensitivity of PCR test or generate false results. In this study, we developed a sensitive RT-PCR, combination of red blood cell adsorption, for detecting Newcastle disease virus (NDV. One pair of primers which was highly homologous to three NDV pathotypes was designed according to the consensus nucleocapsid protein (NP gene sequence. To eliminate the interfere of microbes and toxic substances, we concentrated and purified NDV from varied samples utilizing the ability of NDV binding red blood cells (RBCs. The RT-PCR coupled with red blood cell adsorption was much more sensitive in comparison with regular RT-PCR. The approach could also be used to detect other viruses with the property of hemagglutination, such as influenza viruses.