Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

OpenAIRE

İLHAK, O. İrfan; ARSLAN, Ali

2014-01-01

The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

Polymerase Chain Reaction (PCR) provides a superior tool for the ...

African Journals Online (AJOL)

Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...

NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

International Nuclear Information System (INIS)

Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie

2009-01-01

Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

Architecture of the RNA polymerase II-Mediator core initiation complex.

Science.gov (United States)

Plaschka, C; Larivière, L; Wenzeck, L; Seizl, M; Hemann, M; Tegunov, D; Petrotchenko, E V; Borchers, C H; Baumeister, W; Herzog, F; Villa, E; Cramer, P

2015-02-19

The conserved co-activator complex Mediator enables regulated transcription initiation by RNA polymerase (Pol) II. Here we reconstitute an active 15-subunit core Mediator (cMed) comprising all essential Mediator subunits from Saccharomyces cerevisiae. The cryo-electron microscopic structure of cMed bound to a core initiation complex was determined at 9.7 Å resolution. cMed binds Pol II around the Rpb4-Rpb7 stalk near the carboxy-terminal domain (CTD). The Mediator head module binds the Pol II dock and the TFIIB ribbon and stabilizes the initiation complex. The Mediator middle module extends to the Pol II foot with a 'plank' that may influence polymerase conformation. The Mediator subunit Med14 forms a 'beam' between the head and middle modules and connects to the tail module that is predicted to bind transcription activators located on upstream DNA. The Mediator 'arm' and 'hook' domains contribute to a 'cradle' that may position the CTD and TFIIH kinase to stimulate Pol II phosphorylation.

Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes

DEFF Research Database (Denmark)

Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S.

2018-01-01

Background and aim: Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriace...

RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

International Nuclear Information System (INIS)

Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

2006-01-01

RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

Structure of a Complete Mediator-RNA Polymerase II Pre-Initiation Complex.

Science.gov (United States)

Robinson, Philip J; Trnka, Michael J; Bushnell, David A; Davis, Ralph E; Mattei, Pierre-Jean; Burlingame, Alma L; Kornberg, Roger D

2016-09-08

A complete, 52-protein, 2.5 million dalton, Mediator-RNA polymerase II pre-initiation complex (Med-PIC) was assembled and analyzed by cryo-electron microscopy and by chemical cross-linking and mass spectrometry. The resulting complete Med-PIC structure reveals two components of functional significance, absent from previous structures, a protein kinase complex and the Mediator-activator interaction region. It thereby shows how the kinase and its target, the C-terminal domain of the polymerase, control Med-PIC interaction and transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

Identifying of meat species using polymerase chain reaction (PCR)

International Nuclear Information System (INIS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-01-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

Identifying of meat species using polymerase chain reaction (PCR)

Energy Technology Data Exchange (ETDEWEB)

Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

2013-11-27

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

NARCIS (Netherlands)

Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

2002-01-01

A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

Implementierung und Evaluierung eines tutoriell betreuten elektronischen Biochemie-Praktikumsversuchs "Polymerase-Kettenreaktion (PCR" im vorklinischen Studienabschnitt [Implementation and Evaluation of a Tutor-Supported Computer-Based Practical Biochemistry Course "Polymerase Chain Reaction (PCR" in Preclinical Education

Directory of Open Access Journals (Sweden)

Kröncke, Klaus-Dietrich

2008-08-01

Full Text Available [english] Background: The polymerase chain reaction (PCR is an example of a technology that for many medical students is not easy to understand. We investigated whether a tutor-supported e-learning teaching unit is suitable to teach undergraduate medical students the PCR. Methods: We developed a computer-based practical course (attendance is compulsory that uses an open source-based system as a learning platform. The students learned to search in scientific medical databases to find PCR-relevant data. In addition, they learned the essential features of the PCR with the aid of embedded textual information and audiovisual animations. To check that the learning objectives were fulfilled, the students had to solve medical-related PCR tasks on the computer. Results: In total, 311 students went through the course. They were satisfied with the e-learning teaching unit and evaluated it very positively, independently of their prior knowledge concerning the PCR. Students with low levels of computer skills did not feel over-challenged. Conclusion: Our results show that a computer-based practical training course is an excellent option for teaching undergraduate medical students complex technologies that could otherwise only be taught in a laboratory at great expense of time and effort. [german] Zielsetzung: Es sollte untersucht werden, ob ein E-Learning Praktikumsversuch geeignet ist, Medizin-Studierenden der Vorklinik die Polymerase-Kettenreaktion (PCR begreiflich zu machen. Methodik: Ein Computer-basierter Praktikumsversuch wurde entwickelt, der sowohl das Recherchieren in wissenschaftlich-medizinischen Datenbanken zum Auffinden von PCR-relevanten Informationen beinhaltet als auch Selbstlerneinheiten über die PCR. Als Lernzielkontrollen dienten Aufgaben aus der medizinischen PCR-Diagnostik. Die Akzeptanz der Lehrveranstaltung bei den Studierenden wurde mit einem Fragebogen ermittelt, der 19 Items enthielt. Ergebnisse: 311 Studierende absolvierten den

Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.

Science.gov (United States)

Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay

2018-01-10

Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.

Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls

OpenAIRE

Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

2010-01-01

Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...

High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

Science.gov (United States)

Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

2018-03-01

One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

International Nuclear Information System (INIS)

Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

2005-01-01

Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

International Nuclear Information System (INIS)

Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

2000-01-01

A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

Development of a high-throughput real time PCR based on a hot-start alternative for Pfu mediated by quantum dots

Science.gov (United States)

Sang, Fuming; Yang, Yang; Yuan, Lin; Ren, Jicun; Zhang, Zhizhou

2015-09-01

Hot start (HS) PCR is an excellent alternative for high-throughput real time PCR due to its ability to prevent nonspecific amplification at low temperature. Development of a cost-effective and simple HS PCR technique to guarantee high-throughput PCR specificity and consistency still remains a great challenge. In this study, we systematically investigated the HS characteristics of QDs triggered in real time PCR with EvaGreen and SYBR Green I dyes by the analysis of amplification curves, standard curves and melting curves. Two different kinds of DNA polymerases, Pfu and Taq, were employed. Here we showed that high specificity and efficiency of real time PCR were obtained in a plasmid DNA and an error-prone two-round PCR assay using QD-based HS PCR, even after an hour preincubation at 50 °C before real time PCR. Moreover, the results obtained by QD-based HS PCR were comparable to a commercial Taq antibody DNA polymerase. However, no obvious HS effect of QDs was found in real time PCR using Taq DNA polymerase. The findings of this study demonstrated that a cost-effective high-throughput real time PCR based on QD triggered HS PCR could be established with high consistency, sensitivity and accuracy.Hot start (HS) PCR is an excellent alternative for high-throughput real time PCR due to its ability to prevent nonspecific amplification at low temperature. Development of a cost-effective and simple HS PCR technique to guarantee high-throughput PCR specificity and consistency still remains a great challenge. In this study, we systematically investigated the HS characteristics of QDs triggered in real time PCR with EvaGreen and SYBR Green I dyes by the analysis of amplification curves, standard curves and melting curves. Two different kinds of DNA polymerases, Pfu and Taq, were employed. Here we showed that high specificity and efficiency of real time PCR were obtained in a plasmid DNA and an error-prone two-round PCR assay using QD-based HS PCR, even after an hour

Ligation-mediated PCR with a back-to-back adapter reduces amplification bias resulting from variations in GC content.

Science.gov (United States)

Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi

2017-08-15

Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

DEFF Research Database (Denmark)

Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen

2011-01-01

Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...

Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

Directory of Open Access Journals (Sweden)

U. Pagnini

2010-02-01

Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

The diagnosis of microorganism involved in infective endocarditis (IE by polymerase chain reaction (PCR and real-time PCR: A systematic review

Directory of Open Access Journals (Sweden)

Reza Faraji

2018-02-01

Full Text Available Broad-range bacterial rDNA polymerase chain reaction (PCR followed by sequencing may be identified as the etiology of infective endocarditis (IE from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery.

The diagnosis of microorganism involved in infective endocarditis (IE) by polymerase chain reaction (PCR) and real-time PCR: A systematic review.

Science.gov (United States)

Faraji, Reza; Behjati-Ardakani, Mostafa; Moshtaghioun, Seyed Mohammad; Kalantar, Seyed Mehdi; Namayandeh, Seyedeh Mahdieh; Soltani, Mohammadhossien; Emami, Mahmood; Zandi, Hengameh; Firoozabadi, Ali Dehghani; Kazeminasab, Mahmood; Ahmadi, Nastaran; Sarebanhassanabadi, Mohammadtaghi

2018-02-01

Broad-range bacterial rDNA polymerase chain reaction (PCR) followed by sequencing may be identified as the etiology of infective endocarditis (IE) from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery. Copyright © 2017. Published by Elsevier Taiwan.

Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

Science.gov (United States)

Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

1995-06-01

A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog

OpenAIRE

ÖZKUL, Aykut

2002-01-01

In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...

Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases.

Science.gov (United States)

Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes

2017-02-07

Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli

International Nuclear Information System (INIS)

Dorson, J.W.; Moses, R.E.

1978-01-01

DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair

One-stop polymerase chain reaction (PCR): An improved PCR ...

African Journals Online (AJOL)

Yomi

2011-12-21

Dec 21, 2011 ... membrane filtration was carried out with a commercial PCR product purification kit (Generay, Shanghai), according to the manufacture's instruction. In brief, 50 µl PCR product was mixed thoroughly with binding buffer, and the resultant mixture was loaded directly onto a silica membrane Gelclean column.

The Mediator Complex: At the Nexus of RNA Polymerase II Transcription.

Science.gov (United States)

Jeronimo, Célia; Robert, François

2017-10-01

Mediator is an essential, large, multisubunit, transcriptional co-activator highly conserved across eukaryotes. Mediator interacts with gene-specific transcription factors at enhancers as well as with the RNA polymerase II (RNAPII) transcription machinery bound at promoters. It also interacts with several other factors involved in various aspects of transcription, chromatin regulation, and mRNA processing. Hence, Mediator is at the nexus of RNAPII transcription, regulating its many steps and connecting transcription with co-transcriptional events. To achieve this flexible role, Mediator, which is divided into several functional modules, reorganizes its conformation and composition while making transient contacts with other components. Here, we review the mechanisms of action of Mediator and propose a unifying model for its function. Copyright © 2017 Elsevier Ltd. All rights reserved.

Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

Science.gov (United States)

Gahlon, Hailey L; Romano, Louis J; Rueda, David

2017-11-20

Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

Sources of PCR-induced distortions in high-throughput sequencing data sets

Science.gov (United States)

Kebschull, Justus M.; Zador, Anthony M.

2015-01-01

PCR permits the exponential and sequence-specific amplification of DNA, even from minute starting quantities. PCR is a fundamental step in preparing DNA samples for high-throughput sequencing. However, there are errors associated with PCR-mediated amplification. Here we examine the effects of four important sources of error—bias, stochasticity, template switches and polymerase errors—on sequence representation in low-input next-generation sequencing libraries. We designed a pool of diverse PCR amplicons with a defined structure, and then used Illumina sequencing to search for signatures of each process. We further developed quantitative models for each process, and compared predictions of these models to our experimental data. We find that PCR stochasticity is the major force skewing sequence representation after amplification of a pool of unique DNA amplicons. Polymerase errors become very common in later cycles of PCR but have little impact on the overall sequence distribution as they are confined to small copy numbers. PCR template switches are rare and confined to low copy numbers. Our results provide a theoretical basis for removing distortions from high-throughput sequencing data. In addition, our findings on PCR stochasticity will have particular relevance to quantification of results from single cell sequencing, in which sequences are represented by only one or a few molecules. PMID:26187991

Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

Science.gov (United States)

Mo, Yiqun; Wan, Rong; Zhang, Qunwei

2012-01-01

Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

DETEKSI MENGGUNAKAN PCR (POLYMERASE CHAIN REACTION CANDIDATUS LIBERIBACTER ASIATICUS, PENYEBAB HUANGLONGBING PADA JERUK SIEM DENGAN BEBERAPA TIPE GEJALA PADA DAUN

Directory of Open Access Journals (Sweden)

Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.

2011-11-01

Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms.  Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354.  The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.

Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

Science.gov (United States)

Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

2014-05-01

Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction.

Science.gov (United States)

Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A

2014-01-01

The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.

The TEL-AML1 real-time quantitative polymerase chain reaction (PCR) might replace the antigen receptor-based genomic PCR in clinical minimal residual disease studies in children with acute lymphoblastic leukaemia

NARCIS (Netherlands)

de Haas, V.; Breunis, W. B.; dee, R.; Verhagen, O. J. H. M.; Kroes, W.; van Wering, E. R.; van Dongen, J. J. M.; van den Berg, H.; van der Schoot, C. E.

2002-01-01

Prospective studies in children with B-precursor acute lymphoblastic leukaemia (ALL) have shown that polymerase chain reaction (PCR)-based detection of minimal residual disease (MRD) using immunoglobin (Ig) and T-cell receptor (TCR) gene rearrangements as targets can be used to identify patients

Application of PCR-mediated DNA typing in the molecular epidemiology of medically important microorganisms

NARCIS (Netherlands)

A.F. van Belkum (Alex)

1996-01-01

textabstractThis thesis describes the development, application and validation of the newer DNA analysis techniques within the field of microbiological epidemiology. Emphasis is placed on the use of the polymerase chain reaction (PCR), a test-tube technique enabling the amplification of (parts of)

Detection of early and single infections of Schistosoma japonicum in the intermediate host snail, Oncomelania hupensis, by PCR and loop-mediated isothermal amplification (LAMP) assay.

Science.gov (United States)

Kumagai, Takashi; Furushima-Shimogawara, Rieko; Ohmae, Hiroshi; Wang, Tian-Ping; Lu, Shaohong; Chen, Rui; Wen, Liyong; Ohta, Nobuo

2010-09-01

Polymerase chain reaction (PCR) with the specific primer set amplifying 28S ribosomal DNA (rDNA) of Schistosoma japonicum was able to detect genomic DNA of S. japonicum, but not S. mansoni, at 100 fg. This procedure enabled us to detect the DNA from a single miracidium and a snail infected with one miracidium at just 1 day after infection. We compared these results with those from loop-mediated isothermal amplification (LAMP) targeting 28S rDNA and found similar results. The LAMP could amplify the specific DNA from a group of 100 normal snails mixed with one infected snail A PCR screening of infected snails from endemic regions in Anhui Province revealed schistosomal DNA even in snails found negative by microscopy. PCR and LAMP show promise for monitoring the early infection rate in snails, and they may be useful for predicting the risk of infection in the endemic places.

Real-Time PCR (qPCR) Primer Design Using Free Online Software

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

Pyrovanadolysis: a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate MN2plus and DNA Polymerase of Bacteriophage T7

Energy Technology Data Exchange (ETDEWEB)

B Akabayov; A Kulczyk; S Akabayov; C Thiele; L McLaughlin; B Beauchamp; C Richardson

2011-12-31

DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PP{sub i}). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry of the oxygen connecting the two phosphorus atoms of PP{sub i}, a variety of compounds was examined for their ability to carry out a reaction similar to pyrophosphorolysis. We describe a manganese-mediated pyrophosphorolysis-like activity using pyrovanadate (VV) catalyzed by the DNA polymerase of bacteriophage T7. We designate this reaction pyrovanadolysis. X-ray absorption spectroscopy reveals a shorter Mn-V distance of the polymerase-VV complex than the Mn-P distance of the polymerase-PP{sub i} complex. This structural arrangement at the active site accounts for the enzymatic activation by Mn-VV. We propose that the Mn{sup 2+}, larger than Mg{sup 2+}, fits the polymerase active site to mediate binding of VV into the active site of the polymerase. Our results may be the first documentation that vanadium can substitute for phosphorus in biological processes.

Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

Energy Technology Data Exchange (ETDEWEB)

Frank F. Roberto

2008-08-01

Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Toshiaki Higashi

2012-04-01

Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

Mathematical analysis of the real time array PCR (RTA PCR) process

NARCIS (Netherlands)

Dijksman, Johan Frederik; Pierik, A.

2012-01-01

Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the

Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR technique among various cell types of bulls

Directory of Open Access Journals (Sweden)

Carroll Bernie

2010-03-01

Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic

Cloning-free genome alterations in Saccharomyces cerevisiae using adaptamer-mediated PCR

DEFF Research Database (Denmark)

Reid, Robert J D; Lisby, Michael; Rothstein, Rodney

2002-01-01

. Furthermore, many of the techniques described here rely on preexisting and commercially available adaptamer sets that can be obtained inexpensively rather than designing new primers for every experiment. Although a cost is incurred when performing multiple PCR amplifications, the increase in recombination...... efficiency is dramatic. Finally, the adaptamer-mediated PCR fusion methodology is versatile and can be applied to varied genome manipulations....

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

2013-01-01

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

Genome-wide association of mediator and RNA polymerase II in wild-type and mediator mutant yeast.

Science.gov (United States)

Paul, Emily; Zhu, Z Iris; Landsman, David; Morse, Randall H

2015-01-01

Mediator is a large, multisubunit complex that is required for essentially all mRNA transcription in eukaryotes. In spite of the importance of Mediator, the range of its targets and how it is recruited to these is not well understood. Previous work showed that in Saccharomyces cerevisiae, Mediator contributes to transcriptional activation by two distinct mechanisms, one depending on the tail module triad and favoring SAGA-regulated genes, and the second occurring independently of the tail module and favoring TFIID-regulated genes. Here, we use chromatin immunoprecipitation sequencing (ChIP-seq) to show that dependence on tail module subunits for Mediator recruitment and polymerase II (Pol II) association occurs preferentially at SAGA-regulated over TFIID-regulated genes on a genome-wide scale. We also show that recruitment of tail module subunits to active gene promoters continues genome-wide when Mediator integrity is compromised in med17 temperature-sensitive (ts) yeast, demonstrating the modular nature of the Mediator complex in vivo. In addition, our data indicate that promoters exhibiting strong and stable occupancy by Mediator have a wide range of activity and are enriched for targets of the Tup1-Cyc8 repressor complex. We also identify a number of strong Mediator occupancy peaks that overlap dubious open reading frames (ORFs) and are likely to include previously unrecognized upstream activator sequences. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Characterization of family IV UDG from Aeropyrum pernix and its application in hot-start PCR by family B DNA polymerase.

Directory of Open Access Journals (Sweden)

Xi-Peng Liu

Full Text Available Recombinant uracil-DNA glycosylase (UDG from Aeropyrum pernix (A. pernix was expressed in E. coli. The biochemical characteristics of A. pernix UDG (ApeUDG were studied using oligonucleotides carrying a deoxyuracil (dU base. The optimal temperature range and pH value for dU removal by ApeUDG were 55-65°C and pH 9.0, respectively. The removal of dU was inhibited by the divalent ions of Zn, Cu, Co, Ni, and Mn, as well as a high concentration of NaCl. The opposite base in the complementary strand affected the dU removal by ApeUDG as follows: U/C≈U/G>U/T≈U/AP≈U/->U/U≈U/I>U/A. The phosphorothioate around dU strongly inhibited dU removal by ApeUDG. Based on the above biochemical characteristics and the conservation of amino acid residues, ApeUDG was determined to belong to the IV UDG family. ApeUDG increased the yield of PCR by Pfu DNA polymerase via the removal of dU in amplified DNA. Using the dU-carrying oligonucleotide as an inhibitor and ApeUDG as an activator of Pfu DNA polymerase, the yield of undesired DNA fragments, such as primer-dimer, was significantly decreased, and the yield of the PCR target fragment was increased. This strategy, which aims to amplify the target gene with high specificity and yield, can be applied to all family B DNA polymerases.

Development of loop-mediated isothermal amplification and SYBR green real-time PCR methods for the detection of Citrus yellow mosaic badnavirus in citrus species.

Science.gov (United States)

Anthony Johnson, A M; Dasgupta, I; Sai Gopal, D V R

2014-07-01

Citrus yellow mosaic badnavirus (CMBV) is an important pathogen in southern India spread by infected citrus propagules. One of the measures to arrest the spread of CMBV is to develop methods to screen and certify citrus propagules as CMBV-free. The methods loop-mediated isothermal amplification (LAMP) and SYBR green real-time PCR (SGRTPCR) have been developed for the efficient detection of CMBV in citrus propagules. This paper compares the sensitivities of LAMP and SGRTPCR with polymerase chain reaction (PCR) for the detection of CMBV. Whereas PCR and LAMP were able to detect CMBV from a minimum of 10 ng of total DNA of infected leaf samples, SGRTPCR could detect the same from 1 ng of total DNA. Using SGRTPCR, the viral titres were estimated to be the highest in rough lemon and lowest in Nagpur Mandarin of the five naturally infected citrus species tested. The results will help in designing suitable strategies for the sensitive detection of CMBV from citrus propagules. Copyright © 2014 Elsevier B.V. All rights reserved.

A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

Science.gov (United States)

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Miltenberger blood group typing by real-time polymerase chain reaction (qPCR) melting curve analysis in Thai population.

Science.gov (United States)

Vongsakulyanon, A; Kitpoka, P; Kunakorn, M; Srikhirin, T

2015-12-01

To develop reliable and convenient methods for Miltenberger (Mi(a) ) blood group typing. To apply real-time polymerase chain reaction (qPCR) melting curve analysis to Mi(a) blood group typing. The Mi(a) blood group is the collective set of glycophorin hybrids in the MNS blood group system. Mi(a+) blood is common among East Asians and is also found in the Thai population. Incompatible Mi(a) blood transfusions pose the risk of life-threatening haemolysis; therefore, Mi(a) blood group typing is necessary in ethnicities where the Mi(a) blood group is prevalent. One hundred and forty-three blood samples from Thai blood donors were used in the study. The samples included 50 Mi(a+) samples and 93 Mi(a-) samples, which were defined by serology. The samples were typed by Mi(a) typing qPCR, and 50 Mi(a+) samples were sequenced to identify the Mi(a) subtypes. Mi(a) subtyping qPCR was performed to define GP.Mur. Both Mi(a) typing and Mi(a) subtyping were tested on a conventional PCR platform. The results of Mi(a) typing qPCR were all concordant with serology. Sequencing of the 50 Mi(a+) samples revealed 47 GP.Mur samples and 3 GP.Hop or Bun samples. Mi(a) subtyping qPCR was the supplementary test used to further define GP.Mur from other Mi(a) subtypes. Both Mi(a) typing and Mi(a) subtyping performed well using a conventional PCR platform. Mi(a) typing qPCR correctly identified Mi(a) blood groups in a Thai population with the feasibility of Mi(a) subtype discrimination, and Mi(a) subtyping qPCR was able to further define GP.Mur from other Mi(a) subtypes. © 2015 British Blood Transfusion Society.

Phage-Mediated Immuno-PCR for Ultrasensitive Detection of Cry1Ac Protein Based on Nanobody.

Science.gov (United States)

Liu, Yuanyuan; Jiang, Dongjian; Lu, Xin; Wang, Wei; Xu, Yang; He, Qinghua

2016-10-11

The widespread use of Cry proteins in transgenic plants for insect control has raised concerns about the environment and food safety in the public. An effective detection method for introduced Cry proteins is of significance for environmental risk assessment and product quality control. This paper describes a novel phage mediated immuno-PCR (iPCR) for the ultrasensitive determination of Cry proteins based on nanobodies. Three nanobodies against Cry1Ac protein were obtained from a naı̈ve phage displayed nanobody library without animal immunization process and were applied to the iPCR assay for Cry1Ac. The phage-mediated iPCR for Cry1Ac based on nanobodies showed a dynamic range of 0.001-100 ng/mL and a limit detection of 0.1 pg/mL. Specific measurement of this established method was performed by testing cross-reativity of other Cry1Ac analogues, and the result showed negligible cross-reactivity with other test Cry proteins (Cry1Ab, Cry1F, Cry3B). Furthermore, the phage-mediated iPCR based on nanobody should be easily applicable to the detection of many other Cry proteins.

Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

Science.gov (United States)

Takahashi, Masateru; Takahashi, Etsuko; Joudeh, Luay I; Marini, Monica; Das, Gobind; Elshenawy, Mohamed M; Akal, Anastassja; Sakashita, Kosuke; Alam, Intikhab; Tehseen, Muhammad; Sobhy, Mohamed A; Stingl, Ulrich; Merzaban, Jasmeen S; Di Fabrizio, Enzo; Hamdan, Samir M

2018-01-24

The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein's surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.-Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea

KAUST Repository

Takahashi, Masateru; Takahashi, Etsuko; Joudeh, Luay I.; Marini, Monica; Das, Gobind; Elshenawy, Mohamed; Akal, Anastassja; Sakashita, Kosuke; Alam, Intikhab; Tehseen, Muhammad; Sobhy, Mohamed Abdelmaboud; Stingl, Ulrich; Merzaban, Jasmeen; Di Fabrizio, Enzo M.; Hamdan, Samir

2018-01-01

The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein’s surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.—Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea

KAUST Repository

Takahashi, Masateru

2018-01-24

The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein’s surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.—Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

Detection of Vibrio spp. in shrimp from aquaculture sites in Iran using polymerase chain reaction (PCR)

OpenAIRE

Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy

2014-01-01

Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...

The cyclin-dependent kinase 8 module sterically blocks Mediator interactions with RNA polymerase II

DEFF Research Database (Denmark)

Elmlund, Hans; Baraznenok, Vera; Lindahl, Martin

2006-01-01

CDK8 (cyclin-dependent kinase 8), along with CycC, Med12, and Med13, form a repressive module (the Cdk8 module) that prevents RNA polymerase II (pol II) interactions with Mediator. Here, we report that the ability of the Cdk8 module to prevent pol II interactions is independent of the Cdk8......-dependent kinase activity. We use electron microscopy and single-particle reconstruction to demonstrate that the Cdk8 module forms a distinct structural entity that binds to the head and middle region of Mediator, thereby sterically blocking interactions with pol II....

Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR from sheep of Qom province, Iran

Directory of Open Access Journals (Sweden)

Abtin, A.R.

2013-05-01

Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.

Qualitative and quantitative polymerase chain reaction (PCR) for detection of Leishmania in spleen samples from naturally infected dogs.

Science.gov (United States)

Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares

2012-03-23

Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

zino

2014-02-05

Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

Directory of Open Access Journals (Sweden)

Olivier Martínez

Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

Polymerase chain Reaction in molecular biotechnology; appropriate technology for developing countries

NARCIS (Netherlands)

Felice, A. E.; Alshinawi, C.

1996-01-01

The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and

Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

DEFF Research Database (Denmark)

Høgdall, Estrid; Vuust, Jens; Lind, Peter

2000-01-01

of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

Science.gov (United States)

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-01

The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

Blood grouping based on PCR methods and agarose gel electrophoresis.

Science.gov (United States)

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Transformation of soybean Gy3 gene into Artemisaarenaria mediated by corona discharge

International Nuclear Information System (INIS)

Chao, Lu-meng; Na, Ri; Xue, Dan; Xu, Yongze; Liu, Teng

2013-01-01

In order to improve the protein content of desert plant, a method of genetic transformation mediated by corona discharge was established. Artemisia seeds were processed in corona electric field for 120 min at 12 kV, and then soaked in 0.1 SSC media that contained Soybean Gy3 gene DNA to incubate for 12 h at 26 °C. Finally the seeds were inoculated on the differentiation medium. Polymerase Chain Reaction (PCR) and Reverse Transcription Polymerase Chain Reaction (RT-PCR) detection showed that the Soybean Gy3 gene had been successfully introduced into genomic DNA of the regenerated plants of Artemisaarenaria. The study provided a new way for corona discharge in plant genetic modification.

A disposable laser print-cut-laminate polyester microchip for multiplexed PCR via infra-red-mediated thermal control

Energy Technology Data Exchange (ETDEWEB)

Ouyang, Yiwen [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Duarte, Gabriela R.M. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Universidade Federal de Goiás, Goiânia, GO 74690-900 (Brazil); Poe, Brian L.; Riehl, Paul S. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Santos, Fernando M. dos; Martin-Didonet, Claudia C.G. [Universidade Estadual de Goiás, Anápolis, GO 75132-400 (Brazil); Carrilho, Emanuel [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos, SP 13566-590 (Brazil); Instituto Nacional de Ciência e Tecnologia de Bioanalítica, CP 6154, Campinas, SP 13083-970 (Brazil); Landers, James P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia Health Science Center, Charlottesville, VA (United States)

2015-12-11

Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s{sup −1} with a cooling rate of roughly −12 ± 0.9 °C s{sup −1} assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low

A disposable laser print-cut-laminate polyester microchip for multiplexed PCR via infra-red-mediated thermal control

International Nuclear Information System (INIS)

Ouyang, Yiwen; Duarte, Gabriela R.M.; Poe, Brian L.; Riehl, Paul S.; Santos, Fernando M. dos; Martin-Didonet, Claudia C.G.; Carrilho, Emanuel; Landers, James P.

2015-01-01

Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s −1 with a cooling rate of roughly −12 ± 0.9 °C s −1 assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low-volume amplification

Two-temperature PCR for Microfluidics

KAUST Repository

Kodzius, Rimantas

2010-05-01

Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

Two-temperature PCR for Microfluidics

KAUST Repository

Kodzius, Rimantas; Chang, Donald Choy; Sheng, Ping; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yu, Vivian

2010-01-01

Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

International Nuclear Information System (INIS)

Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

2003-01-01

Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

DEFF Research Database (Denmark)

Atabay, H. I.; Bang, Dang Duong; Aydin, F.

2002-01-01

Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used...... to detect polymorphism within the isolates. Eleven distinct DNA profiles were obtained as follows: Of the 35 strains, 10 as profile 4; seven as profile 1; five as profile 3; three as profiles 2 and 9; two as profile 10; one as profiles 5, 6, 7, 8 and 11. Conclusions: Chicken carcasses sold in markets were...... found to be contaminated with several different strains of A. butzleri . RAPD-PCR technique was found to be a useful technique for distinguishing A. butzleri isolates. Significance and Impact of the Study: The presence of several different A. butzleri strains on chicken carcasses may indicate multiple...

Compartmentalized self-replication under fast PCR cycling conditions yields Taq DNA polymerase mutants with increased DNA-binding affinity and blood resistance.

Science.gov (United States)

Arezi, Bahram; McKinney, Nancy; Hansen, Connie; Cayouette, Michelle; Fox, Jeffrey; Chen, Keith; Lapira, Jennifer; Hamilton, Sarah; Hogrefe, Holly

2014-01-01

Faster-cycling PCR formulations, protocols, and instruments have been developed to address the need for increased throughput and shorter turn-around times for PCR-based assays. Although run times can be cut by up to 50%, shorter cycle times have been correlated with lower detection sensitivity and increased variability. To address these concerns, we applied Compartmentalized Self Replication (CSR) to evolve faster-cycling mutants of Taq DNA polymerase. After five rounds of selection using progressively shorter PCR extension times, individual mutations identified in the fastest-cycling clones were randomly combined using ligation-based multi-site mutagenesis. The best-performing combinatorial mutants exhibit 35- to 90-fold higher affinity (lower Kd ) for primed template and a moderate (2-fold) increase in extension rate compared to wild-type Taq. Further characterization revealed that CSR-selected mutations provide increased resistance to inhibitors, and most notably, enable direct amplification from up to 65% whole blood. We discuss the contribution of individual mutations to fast-cycling and blood-resistant phenotypes.

The Role of Polymerase Chain Reaction (PCR in Diagnosis of Spine Tuberculosis after Pre-operative Anti-tuberculosis Treatment

Directory of Open Access Journals (Sweden)

AH Rasit

2011-03-01

Full Text Available OBJECTIVE: The aim of this study was to evaluate the role of polymerase chain reaction (PCR in the diagnosis of spinal tuberculosis after 2 weeks of preoperative anti-tuberculosis treatment and to compare PCR to the Löwenstein - Jensen Culture (LJC and histopathological examination (HPE methods. METHODS: Twenty-five patients were included in this study. Sixteen patients were diagnosed and treated for spinal tuberculosis based on clinical and radiological evidence. Nine patients were controls. The LJC method and HPE of the specimen were performed according to hospital protocol. PCR was performed using primer encoding insertion of sequences IS6110 for mycobacterium tuberculosis complex. Clinical findings and radiological features were the gold standard for comparison. RESULTS: PCR results were 15 positive and one negative. The sensitivity and specificity of PCR was 94% and 100% respectively (with 95% confidence interval [CI] 67% to 99% and 63% to 100%, respectively. HPE results showed 13 were positive and 3 negative in the spinal tuberculosis group; for the control group, all were negative. Sensitivity and specificity value of HPE was 82 % and 100% respectively (with 95% confidence interval [CI] 54% to 95% and 63% to 100%, respectively. Use of LJC showed only one was positive and 15 were negative in the spinal tuberculosis group whole all nine in the control group were negative. Sensitivity and specificity value of LJC was 6% and 100% respectively (with 95% confidence interval [CI] 0.3% to 32% and 63% to 100%, respectively. CONCLUSION: Our findings showed that the PCR for Mycobacterium tuberculosis is reliable as a method for diagnosis of spinal tuberculosis, even after of 2 weeks of anti-TB treatment, with an overall sensitivity of 94% and specificity of 100%.

IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

Directory of Open Access Journals (Sweden)

Yuny Erwanto

2013-03-01

Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

FlindersTechnology Associates (FTA) filter paper-based DNA extraction with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii from respiratory specimens of immunocompromised patients.

Science.gov (United States)

Nuchprayoon, Surang; Saksirisampant, Wilai; Jaijakul, Siraya; Nuchprayoon, Issarang

2007-01-01

We evaluated the diagnostic value of Flinders Technology Associates (FTA) filter paper together with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii (carinii) from induced sputum (IS) and bronchoalveolar lavage fluid (BALF) samples. The study involved 162 patients with clinical diagnosis of pneumocystis pneumonia (PcP) of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) patients and other immunocompromised patients. P. jirovecii cysts or trophozoites were detected in IS and BALF by cytological method. The mitochondrial 5S ribosomal ribonucleic acid (rRNA) gene of P. jirovecii was amplified from these samples by using FTA filters together with a one-step PCR method (FTA-PCR). With the FTA-PCR method, the sensitivity and specificity of the test compared to microscopic examination were 67% and 90% for IS, while they were 67% and 91% for BALF, respectively. The sensitivity and specificity of the FTA-PCR test was also comparable to PCR with the conventional deoxyribonucleic acid (DNA) extraction method. We concluded that FTA-PCR is useful to detect P. jirovecii in noninvasive IS.

Evaluation of carrier-mediated siRNA delivery

DEFF Research Database (Denmark)

Colombo, Stefano; Nielsen, Hanne Mørck; Foged, Camilla

2013-01-01

RNA delivery. An in vitro cell culture model system expressing enhanced green fluorescent protein (EGFP) was used to develop the assay, which was based on the intracellular quantification of a full-length double-stranded Dicer substrate siRNA by stem-loop RT qPCR. The result is a well-documented protocol......RNA delivered by use of carriers remains an analytical challenge. The purpose of the present study was to optimize and validate an analytical protocol based on stem-loop reverse transcription quantitative polymerase chain reaction (RT qPCR) to quantitatively monitor the carrier-mediated intracellular si...

Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

Directory of Open Access Journals (Sweden)

Tian-Min Qiao

2016-10-01

Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

Science.gov (United States)

Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

2016-01-01

Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

Science.gov (United States)

Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

2016-10-01

Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

Science.gov (United States)

Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

2015-01-01

Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and

Determining Annealing Temperatures for Polymerase Chain Reaction

Science.gov (United States)

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

Compartmentalized self-replication (CSR) selection of Thermococcus litoralis Sh1B DNA polymerase for diminished uracil binding.

Science.gov (United States)

Tubeleviciute, Agne; Skirgaila, Remigijus

2010-08-01

The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.

Role for the MED21-MED7 Hinge in Assembly of the Mediator-RNA Polymerase II Holoenzyme*

Science.gov (United States)

Sato, Shigeo; Tomomori-Sato, Chieri; Tsai, Kuang-Lei; Yu, Xiaodi; Sardiu, Mihaela; Saraf, Anita; Washburn, Michael P.; Florens, Laurence; Asturias, Francisco J.; Conaway, Ronald C.

2016-01-01

Mediator plays an integral role in activation of RNA polymerase II (Pol II) transcription. A key step in activation is binding of Mediator to Pol II to form the Mediator-Pol II holoenzyme. Here, we exploit a combination of biochemistry and macromolecular EM to investigate holoenzyme assembly. We identify a subset of human Mediator head module subunits that bind Pol II independent of other subunits and thus probably contribute to a major Pol II binding site. In addition, we show that binding of human Mediator to Pol II depends on the integrity of a conserved “hinge” in the middle module MED21-MED7 heterodimer. Point mutations in the hinge region leave core Mediator intact but lead to increased disorder of the middle module and markedly reduced affinity for Pol II. These findings highlight the importance of Mediator conformation for holoenzyme assembly. PMID:27821593

Real-time PCR-based genotyping from whole blood using Taq DNA polymerase and a buffer supplemented with 1,2-propanediol and trehalose

Czech Academy of Sciences Publication Activity Database

Utekal, Pavol; Kocanda, Lukáš; Matoušek, P.; Wagner, P.; Bugajev, Viktor; Dráber, Petr

2015-01-01

Roč. 416, January (2015), s. 178-182 ISSN 0022-1759 R&D Projects: GA ČR(CZ) GBP302/12/G101; GA MPO FR-TI3/067; GA ČR(CZ) GA14-09807S; GA ČR(CZ) GA14-00703S Institutional support: RVO:68378050 Keywords : 1,2-Propanediol * real-time PCR * SYBR Green I * Taq DNA polymerase * trehalose * Unseparated blood Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.858, year: 2015

A Point-of-Need infrared mediated PCR platform with compatible lateral flow strip for HPV detection.

Science.gov (United States)

Liu, Wenjia; Zhang, Mingfang; Liu, Xiaoyan; Sharma, Alok; Ding, Xianting

2017-10-15

With the increasing need of monitoring the epidemiology of serious infectious diseases, food hygiene, food additives and pesticide residues, it is urgent to develop portable, easy-to-use, inexpensive and rapid molecular diagnostic tools. Herein, we demonstrate a prototype of IR mediated Conducting Oil and CarbOn Nanotube circUlaTing PCR (IR-COCONUT PCR) platform for nucleic acid amplification. The presented platform offers a new solution for miniaturized PCR instruments with non-contact heaters by using conducting oil and carbon nanotube as a medium in IR mediated PCR. This novel platform offers accurate and flexible control of temperature through the integration of PID (proportional-integral-derivative) algorithms to manipulate the duty cycle of the voltage signals of IR LED and a peristaltic pump. The ramping rate of the introduced platform in current study is 1.5°C/s for heating speed and -2.0°C/s for cooling speed. This platform fulfills 30 thermal cycles within 50min which is a match to the conventional bench-top PCR thermo cyclers. For demonstration purpose, human papillomavirus (HPV) patient cervical swab specimens were examined. Downstream lateral flow strip (LFS) was also developed to quantity the PCR products from the IR-COCONUT PCR device within 25min. This PCR platform together with the compatible LFS shows great potential for in-field and Point-of-Need (PoN) testing of genetic or contagious diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

Science.gov (United States)

Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

2013-05-30

Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

Directory of Open Access Journals (Sweden)

Yuny Erwanto

2014-10-01

Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

Science.gov (United States)

Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

2014-10-01

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

Science.gov (United States)

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

International Nuclear Information System (INIS)

Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

1995-01-01

Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil

Directory of Open Access Journals (Sweden)

Silvia Cristina Osaki

2013-06-01

Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

Science.gov (United States)

Lorenz, Todd C

2012-05-22

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

Polymerase chain reaction for the detection of Mycobacterium leprae

NARCIS (Netherlands)

Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

1989-01-01

A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

RT-PCR Protocols - Methods in Molecular Biology

Directory of Open Access Journals (Sweden)

Manuela Monti

2011-03-01

Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.

OpenAIRE

Gretch, D R; Wilson, J J; Carithers, R L; dela Rosa, C; Han, J H; Corey, L

1993-01-01

We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.

polymerase chain reaction (pcr) provides a superior tool

African Journals Online (AJOL)

boaz

Keywords: Streptococcus pneumoniae, meningitis, rt-PCR, standard bacteriological methods ... qualification de techniciens et les matériels pour son application constituent des ... Streptococcus pneumonia (pneumococcus) is a common.

Estimation of the reaction efficiency in polymerase chain reaction

NARCIS (Netherlands)

Lalam, N.

2006-01-01

Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

Real-time PCR in virology

OpenAIRE

Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas

2002-01-01

The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...

Polymerase chain reaction to search for Herpes viruses in uveitic ...

African Journals Online (AJOL)

Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.

A novel method for detection of dioxins. Exonuclease protection mediated PCR assay

Energy Technology Data Exchange (ETDEWEB)

Xu, S.Q.; Sun, X.; Li, F.; Li, B.S. [Huazhong Univ. of Science and Technology, Wuhan, HB (China). Tongji Medical College

2004-09-15

The aromatic hydrocarbon receptor (AhR) is a ligand-actived transcription factor that mediates many of the biologic and toxicologic effects of dioxin-like chemicals (DLCs), such as 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD). Numerous AhR-based bioassays for identification and detection of DLCs have been developed in vitro. Such as the chemical-activated luciferase gene expression (CALUX), ethoxyresolufin-O-deethylase (EROD) activity are sometimes represented as the next best system when compared with whole body or in vivo systems. However, cell systems can be affected by the toxic chemical itself during the assay, thus confusing problems couldn't be avoided in the assay. Incorporation of metabolism in cell systems with uncertain consequences prolongs assay complexity and time. Thus these drawbacks limit the utility of cell systems for screening purposes. Most cell-free bioassays require radioactivity, such as the gel retardation of AhR binding (GRAB) assay, or antibody of AhR or ligand, which are unfeasible for some laboratories. Here a cell-free bioanalysis method, Exonuclease Protection Mediated PCR (EPM-PCR) bioassay, was established for detection of AhR ligands based on the binding of the dioxin:AhR complex to the specific DNA. EPM-PCR can provide indirect detection of ligands by quantification of the specific AhR-binding DNA, no necessary of any DNA labeling and sophisticated equipments. This new bioassay not only has the higher sensitivity and specificity, but it is rapid and easy to perform.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)

2016-05-06

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

Detection of Giardia intestinalis in water samples collected from natural water reservoirs and wells in northern and north-eastern Poland using LAMP, real-time PCR and nested PCR.

Science.gov (United States)

Lass, Anna; Szostakowska, Beata; Korzeniewski, Krzysztof; Karanis, Panagiotis

2017-10-01

Giardia intestinalis is a protozoan parasite, transmitted to humans and animals by the faecal-oral route, mainly through contaminated water and food. Knowledge about the distribution of this parasite in surface water in Poland is fragmentary and incomplete. Accordingly, 36 environmental water samples taken from surface water reservoirs and wells were collected in Pomerania and Warmia-Masuria provinces, Poland. The 50 L samples were filtered and subsequently analysed with three molecular detection methods: loop-mediated isothermal amplification (LAMP), real-time polymerase chain reaction (real-time PCR) and nested PCR. Of the samples examined, Giardia DNA was found in 15 (42%) samples with the use of LAMP; in 12 (33%) of these samples, Giardia DNA from this parasite was also detected using real-time PCR; and in 9 (25%) using nested PCR. Sequencing of selected positive samples confirmed that the PCR products were fragments of the Giardia intestinalis small subunit rRNA gene. Genotyping using multiplex real-time PCR indicated the presence of assemblages A and B, with the latter predominating. The results indicate that surface water in Poland, as well as water taken from surface wells, may be a source of Giardia strains which are potentially pathogenic for humans. It was also demonstrated that LAMP assay is more sensitive than the other two molecular assays.

Development of the nested polymerase chain reaction (PCR) for detection of hepatitis C virus RNA in blood derivatives. Final report for the period 15 December 1994 - 15 December 1995

International Nuclear Information System (INIS)

Pavelic, J.

1996-07-01

Testing for the presence of hepatitis C virus (HCV) in blood derivatives used in clinical medicine is important to ensure the safety of such preparations. A reliable and reproducible method is described for the isolation of HCV RNA, subsequent reverse transcription and nested polymerase chain reaction (PCR) from blood derivatives. Of 17 batches of blood derivatives (14 negative for anti-HCV and 3 of unknown anti-HCV status) five were found to be positive in the nested PCR. (author). 4 refs, 3 figs, 1 tab

Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

Science.gov (United States)

Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

2017-01-01

Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

Multiplex polymerase chain reaction (PCR) and fluorescence-based ...

African Journals Online (AJOL)

reading 7

2011-12-28

Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.

It's fun to transcribe with Fun30: A model for nucleosome dynamics during RNA polymerase II-mediated elongation.

Science.gov (United States)

Lee, Junwoo; Choi, Eun Shik; Lee, Daeyoup

2018-01-01

The ability of elongating RNA polymerase II (RNAPII) to regulate the nucleosome barrier is poorly understood because we do not know enough about the involved factors and we lack a conceptual framework to model this process. Our group recently identified the conserved Fun30/SMARCAD1 family chromatin-remodeling factor, Fun30 Fft3 , as being critical for relieving the nucleosome barrier during RNAPII-mediated elongation, and proposed a model illustrating how Fun30 Fft3 may contribute to nucleosome disassembly during RNAPII-mediated elongation. Here, we present a model that describes nucleosome dynamics during RNAPII-mediated elongation in mathematical terms and addresses the involvement of Fun30 Fft3 in this process.

The application of polymerase chain reaction-denaturing gradient ...

African Journals Online (AJOL)

Jane

2011-05-23

May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.

KONSTRUKSI MUTAN PROTEIN FOSFATASE ptc2D Saccharomyces cerevisiae DENGAN METODE PENGGANTIAN GEN TARGET DENGAN POLYMERASE CHAIN REACTION (PCR

Directory of Open Access Journals (Sweden)

Hermansyah

2011-05-01

Full Text Available Yeast Saccharomyces cerevisiae is an excellent model to studi genes function of eukarotic cells such as study of gene encoding protein phosphatase PTC2. Novel phenotypic caused by mutated gene is an important step to study function of gene. In this study constructed mutant of PTC2 gene encoding protein phosphatase. Method that used in this construction was replacement of target gene (PTC2 with auxotroph marker Candida albicans HIS3 by Polymer Chain Reaction (PCR or called by PCR-mediated disruption. Mutant colonies which grew in selective medium SC without histidine were confirmed by PCR amplification. By using 1% Agarose gel electrophoresis the result showed that size of ptc2D::CgHIS3 transformant was 3.52 kb while wild type strain was 2.9 kb, indicated that ptc2D::CgHIS3 has integrated on chromosome V replacing PTC2 wild type.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

A Novel Low Temperature PCR Assured High-Fidelity DNA Amplification

Directory of Open Access Journals (Sweden)

Shaoxia Zhou

2013-06-01

Full Text Available As previously reported, a novel low temperature (LoTemp polymerase chain reaction (PCR catalyzed by a moderately heat-resistant (MHR DNA polymerase with a chemical-assisted denaturation temperature set at 85 °C instead of the conventional 94–96 °C can achieve high-fidelity DNA amplification of a target DNA, even after up to 120 PCR thermal cycles. Furthermore, such accurate amplification is not achievable with conventional PCR. Now, using a well-recognized L1 gene segment of the human papillomavirus (HPV type 52 (HPV-52 as the template for experiments, we demonstrate that the LoTemp high-fidelity DNA amplification is attributed to an unusually high processivity and stability of the MHR DNA polymerase whose high fidelity in template-directed DNA synthesis is independent of non-existent 3'–5' exonuclease activity. Further studies and understanding of the characteristics of the LoTemp PCR technology may facilitate implementation of DNA sequencing-based diagnostics at the point of care in community hospital laboratories.

Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

Directory of Open Access Journals (Sweden)

FIGUEIREDO Luiz Tadeu Moraes

1997-01-01

Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

Science.gov (United States)

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

Directory of Open Access Journals (Sweden)

Dyah Ayu Hewajuli

2014-03-01

Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

Bordetella pertussis diagnosed by polymerase chain reaction

DEFF Research Database (Denmark)

Birkebaek, N H; Heron, I; Skjødt, K

1994-01-01

The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...

Emulating a crowded intracellular environment in vitro dramatically improves RT-PCR performance

International Nuclear Information System (INIS)

Lareu, Ricky R.; Harve, Karthik S.; Raghunath, Michael

2007-01-01

The polymerase chain reaction's (PCR) phenomenal success in advancing fields as diverse as Medicine, Agriculture, Conservation, or Paleontology is based on the ability of using isolated prokaryotic thermostable DNA polymerases in vitro to copy DNA irrespective of origin. This process occurs intracellularly and has evolved to function efficiently under crowded conditions, namely in an environment packed with macromolecules. However, current in vitro practice ignores this important biophysical parameter of life. In order to more closely emulate conditions of intracellular biochemistry in vitro we added inert macromolecules into reverse transcription (RT) and PCR. We show dramatic improvements in all parameters of RT-PCR including 8- to 10-fold greater sensitivity, enhanced polymerase processivity, higher specific amplicon yield, greater primer annealing and specificity, and enhanced DNA polymerase thermal stability. The faster and more efficient reaction kinetics was a consequence of the cumulative molecular and thermodynamic effects of the excluded volume effect created by macromolecular crowding

Use of length heterogeneity polymerase chain reaction (LH-PCR as non-invasive approach for dietary analysis of Svalbard reindeer, Rangifer tarandus platyrhynchus.

Directory of Open Access Journals (Sweden)

Sungbae Joo

Full Text Available To efficiently investigate the forage preference of Svalbard reindeer (Rangifer tarandus platyrhynchus, we applied length-heterogeneity polymerase chain reaction (LH-PCR based on length differences of internal transcribed spacer (ITS regions of ribosomal RNA (rRNA to fecal samples from R. tarandus platyrhynchus. A length-heterogeneity (LH database was constructed using both collected potential food sources of Svalbard reindeer and fecal samples, followed by PCR, cloning and sequencing. In total, eighteen fecal samples were collected between 2011 and 2012 from 2 geographic regions and 15 samples were successfully amplified by PCR. The LH-PCR analysis detected abundant peaks, 18.6 peaks on an average per sample, ranging from 100 to 500 bp in size and showing distinct patterns associated with both regions and years of sample collection. Principal component analysis (PCA resulted in clustering of 15 fecal samples into 3 groups by the year of collection and region with a statistically significant difference at 99.9% level. The first 2 principal components (PCs explained 71.1% of the total variation among the samples. Through comparison with LH database and identification by cloning and sequencing, lichens (Stereocaulon sp. and Ochrolechia sp. and plant species (Salix polaris and Saxifraga oppositifolia were detected as the food sources that contributed most to the Svalbard reindeer diet. Our results suggest that the use of LH-PCR analysis would be a non-invasive and efficient monitoring tool for characterizing the foraging strategy of Svalbard reindeer. Additionally, combining sequence information would increase its resolving power in identification of foraged diet components.

PCR and magnetic bead-mediated target capture for the isolation of short interspersed nucleotide elements in fishes.

Science.gov (United States)

Liu, Dong; Zhu, Guoli; Tang, Wenqiao; Yang, Jinquan; Guo, Hongyi

2012-01-01

Short interspersed nucleotide elements (SINEs), a type of retrotransposon, are widely distributed in various genomes with multiple copies arranged in different orientations, and cause changes to genes and genomes during evolutionary history. This can provide the basis for determining genome diversity, genetic variation and molecular phylogeny, etc. SINE DNA is transcribed into RNA by polymerase III from an internal promoter, which is composed of two conserved boxes, box A and box B. Here we present an approach to isolate novel SINEs based on these promoter elements. Box A of a SINE is obtained via PCR with only one primer identical to box B (B-PCR). Box B and its downstream sequence are acquired by PCR with one primer corresponding to box A (A-PCR). The SINE clone produced by A-PCR is selected as a template to label a probe with biotin. The full-length SINEs are isolated from the genomic pool through complex capture using the biotinylated probe bound to magnetic particles. Using this approach, a novel SINE family, Cn-SINE, from the genomes of Coilia nasus, was isolated. The members are 180-360 bp long. Sequence homology suggests that Cn-SINEs evolved from a leucine tRNA gene. This is the first report of a tRNA(Leu)-related SINE obtained without the use of a genomic library or inverse PCR. These results provide new insights into the origin of SINEs.

PCR and Magnetic Bead-Mediated Target Capture for the Isolation of Short Interspersed Nucleotide Elements in Fishes

Directory of Open Access Journals (Sweden)

Dong Liu

2012-02-01

Full Text Available Short interspersed nucleotide elements (SINEs, a type of retrotransposon, are widely distributed in various genomes with multiple copies arranged in different orientations, and cause changes to genes and genomes during evolutionary history. This can provide the basis for determining genome diversity, genetic variation and molecular phylogeny, etc. SINE DNA is transcribed into RNA by polymerase III from an internal promoter, which is composed of two conserved boxes, box A and box B. Here we present an approach to isolate novel SINEs based on these promoter elements. Box A of a SINE is obtained via PCR with only one primer identical to box B (B-PCR. Box B and its downstream sequence are acquired by PCR with one primer corresponding to box A (A-PCR. The SINE clone produced by A-PCR is selected as a template to label a probe with biotin. The full-length SINEs are isolated from the genomic pool through complex capture using the biotinylated probe bound to magnetic particles. Using this approach, a novel SINE family, Cn-SINE, from the genomes of Coilia nasus, was isolated. The members are 180–360 bp long. Sequence homology suggests that Cn-SINEs evolved from a leucine tRNA gene. This is the first report of a tRNALeu-related SINE obtained without the use of a genomic library or inverse PCR. These results provide new insights into the origin of SINEs.

Polymerase chain reaction: Theory, practice and application: A review

Directory of Open Access Journals (Sweden)

S E Atawodi

2010-01-01

Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

SAF-A forms a complex with BRG1 and both components are required for RNA polymerase II mediated transcription.

Directory of Open Access Journals (Sweden)

Dzeneta Vizlin-Hodzic

Full Text Available BACKGROUND: Scaffold attachment factor A (SAF-A participates in the regulation of gene expression by organizing chromatin into transcriptionally active domains and by interacting directly with RNA polymerase II. METHODOLOGY: Here we use co-localization, co-immunoprecipitation (co-IP and in situ proximity ligation assay (PLA to identify Brahma Related Gene 1 (BRG1, the ATP-driven motor of the human SWI-SNF chromatin remodeling complex, as another SAF-A interaction partner in mouse embryonic stem (mES cells. We also employ RNA interference to investigate functional aspects of the SAF-A/BRG1 interaction. PRINCIPAL FINDINGS: We find that endogenous SAF-A protein interacts with endogenous BRG1 protein in mES cells, and that the interaction does not solely depend on the presence of mRNA. Moreover the interaction remains intact when cells are induced to differentiate. Functional analyses reveal that dual depletion of SAF-A and BRG1 abolishes global transcription by RNA polymerase II, while the nucleolar RNA polymerase I transcription machinery remains unaffected. CONCLUSIONS: We demonstrate that SAF-A interacts with BRG1 and that both components are required for RNA Polymerase II Mediated Transcription.

Agrobacterium-mediated transformation of grapefruit with the wild-type and mutant RNA-dependent RNA polymerase genes of Citrus tristeza virus

Science.gov (United States)

Citrus paradisi Macf. cv. Duncan was transformed with constructs coding for the wild-type and mutant RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) for exploring replicase-mediated pathogen-derived resistance (RM-PDR). The RdRp gene was amplified from CTV genome and used to gener...

Loop-mediated Isothermal Amplification Assay to Rapidly Detect Wheat Streak Mosaic Virus in Quarantined Plants

Directory of Open Access Journals (Sweden)

Siwon Lee

2015-12-01

Full Text Available We developed a loop-mediated isothermal amplification (LAMP method to rapidly diagnose Wheat streak mosaic virus (WSMV during quarantine inspections of imported wheat, corn, oats, and millet. The LAMP method was developed as a plant quarantine inspection method for the first time, and its simplicity, quickness, specificity and sensitivity were verified compared to current reverse transcription-polymerase chain reaction (RT-PCR and nested PCR quarantine methods. We were able to quickly screen for WSMV at quarantine sites with many test samples; thus, this method is expected to contribute to plant quarantine inspections.

Testing for Genetically Modified Foods Using PCR

Science.gov (United States)

Taylor, Ann; Sajan, Samin

2005-01-01

The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…

Development of nested polymerase chain reaction-based diagnosis of duck enteritis virus and detection of DNA polymerase gene from non-descriptive duck breeds of West Bengal, India

Directory of Open Access Journals (Sweden)

Partha Sarathi Mandal

2017-03-01

Full Text Available Aim: The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP infected eggs, and histopathological changes of chorioallantoic membrane (CAM in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR. Materials and Methods: After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Results: Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076 showed homology with the sequences data available in GenBank. Conclusion: The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP.

Eliminating PCR contamination

International Nuclear Information System (INIS)

Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

1991-01-01

The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

Detection of enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification.

Science.gov (United States)

Wang, D; Wang, X; Geng, Y; An, C

2014-01-01

The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD) for an early treatment by using loop-mediated isothermal amplification (LAMP) technique. A reverse-transcription loop-mediated isothermal amplification (RT-LAMP) for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR) and real-time PCR. A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.

Analytical Performance of Four Polymerase Chain Reaction (PCR and Real Time PCR (qPCR Assays for the Detection of Six Leishmania Species DNA in Colombia

Directory of Open Access Journals (Sweden)

Cielo M. León

2017-10-01

Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.

Analytical Performance of Four Polymerase Chain Reaction (PCR) and Real Time PCR (qPCR) Assays for the Detection of Six Leishmania Species DNA in Colombia

Science.gov (United States)

León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.

2017-01-01

Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670

Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

Directory of Open Access Journals (Sweden)

Marcin Olszewski

Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

Inhibitory effect of common microfluidic materials on PCR outcome

KAUST Repository

Kodzius, Rimantas

2012-02-20

Microfluidic chips have a variety of applications in the biological sciences and medicine. In contrast with traditional experimental approaches, microfluidics entails lower sample and reagent consumption, allows faster reactions and enables efficient separation. Additionally microfluidics offers other advantages accruing from the fluids’ various distinct behaviors, such as energy dissipation, fluidic resistance, laminar flow, and surface tension. Biological molecules suspended in fluid and transported through microfluidics channels interact with the channel-wall material. This interaction is even stronger in high surface-area-to-volume ratio (SAVR) microfluidic channels. Adsorption and inhibition of biomolecules occur when these materials come in contact with biomolecular reaction components. Polymerase chain reaction (PCR) is a thermal cycling procedure for amplifying target DNA. The PCR compatibility of silicon, silicon dioxide (SiO2) and other surfaces have been studied; however the results are inconclusive. Usually for protein-surface interaction measurements, bulky and expensive equipment is used, such as Atomic Force Microscopy (AFM), Scanning or Transmission Electron Microscopy (SEM, TEM), spectrophotometric protein concentration measurement, Fourier transform infrared spectroscopy (FTIR) or X-Ray photoelectron spectroscopy (XPS). \\tThe PCR reaction components include the DNA template, primers, DNA polymerase (the main component), dNTPs, a buffer, divalent ions (MgCl2), and KCl. \\tWe designed a simple, relatively quick measurement that only requires a PCR cycler; thus it mimics actual conditions in PCR cycling. In our study, we evaluated the inhibitory affect of different materials on PCR, which is one of the most frequently used enzymatic reactions in microfluidics. PCR reaction optimization through choice of surface materials is of the upmost importance, as it enables and improves enzymatic reaction in microfluidics. Our assessment of the PCR

Multiplex PCR Study of Plasmid-Mediated AmpC Beta-Lactamases Genes in Clinical Isolates of Escherichia coli

Directory of Open Access Journals (Sweden)

Maryam Dehghani

2017-02-01

Full Text Available Background:   AmpC β-lactamases are important cephalosporinases chromosomally encoded in many of Enterobacteriaceae and a few other organisms where they mediate resistance to cephalothin, cefazolin, cefoxitin and penicillins. The six different families of plasmid-mediated AmpC β-lactamases have been described, but no phenotypic test can discriminate among them. AmpC multiplex PCR has been successfully used to discriminate plasmid-mediated ampC specific families in organisms such as Klebsiella pneumonia and Escherichia coli. The aim of this study was to indicate the prevalence of AmpC β-lactamase genes by specifically designed primers through PCR test.Methods:   243 total clinical urine samples were collected, and 227 isolates were identified as Escherichia coli based on standard biochemical tests. Subsequently, the isolates were screened by disc diffusion and combined disc test for β-lactamase production. Resistant isolates were evaluated by PCR for ampC family determination. Results:  Antibiotic resistance pattern were observed as follows: cefepime (%25, ceftazidime (%31, ceftriaxone (%37, cefotaxime (%38. The ratio of isolates was detected as ESBLs and AmpC producers were 34% and 5.2%, respectively. PCR performed on 12 selected isolates via phenotypic tests and the results revealed that among 12 isolates, 11 contained blaCMY-42. Conclusion:  Unfortunately, antibiotic resistance has become an increasingly critical problem in many countries like Iran and occurrence of isolates co-expressing AmpC-β-lactamases and ESBLs can create serious problems in the future. As antibiotic options in the treatment of AmpC β-lactamases and ESBLs producing organisms are extremely limited, molecular screening by laboratories is suggested to reduce the risk of therapeutic defeat.

Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR

Directory of Open Access Journals (Sweden)

Adrián Ruiz-Villalba

2017-12-01

Full Text Available Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated to Cq or PCR efficiency values. Titration experiments showed that the occurrence of low and high melting temperature artifacts was shown to be determined by annealing temperature, primer concentration and cDNA input. To explore the range of input variations that occur in the normal use of the Cre assay these conditions were mimicked in a complete two-way design of template −plasmid DNA- and non-template −mouse cDNA- concentrations. These experiments showed that the frequency of the amplification of the correct product and the artifact, as well as the valid quantification of the correct product, depended on the concentration of the non-template cDNA. This finding questions the interpretation of dilution series in which template as well as non-template concentrations are simultaneously decreasing. Repetition of this cDNA concentration experiment with other templates revealed that exact reproduction qPCR experiments was affected by the time it takes to complete the pipetting of a qPCR plate. Long bench times were observed to lead to significantly more artifacts. However, the measurement of artifact-associated fluorescence can be avoided by inclusion of a small heating step after the elongation phase in the amplification protocol. Taken together, this trouble-shooting journey showed that reliability and reproducibility of qPCR experiments not only depends on standardization and reporting of the biochemistry and technical aspects but also on hitherto neglected factors as sample dilution and waiting times in the laboratory work flow. Keywords: RT-qPCR, Melting curve analysis, Reaction parameters, Artifacts

Proliferating cell nuclear antigen binds DNA polymerase-β and mediates 1-methyl-4-phenylpyridinium-induced neuronal death.

Directory of Open Access Journals (Sweden)

Zhentao Zhang

Full Text Available The mechanisms leading to dopaminergic neuronal loss in the substantia nigra of patients with Parkinson disease (PD remain poorly understood. We recently reported that aberrant DNA replication mediated by DNA polymerase-β (DNA pol-β plays a causal role in the death of postmitotic neurons in an in vitro model of PD. In the present study, we show that both proliferating cell nuclear antigen (PCNA and DNA pol-β are required for MPP(+-induced neuronal death. PCNA binds to the catalytic domain of DNA pol-β in MPP(+-treated neurons and in post-mortem brain tissues of PD patients. The PCNA-DNA pol-β complex is loaded into DNA replication forks and mediates DNA replication in postmitotic neurons. The aberrant DNA replication mediated by the PCNA-DNA pol-β complex induces p53-dependent neuronal cell death. Our results indicate that the interaction of PCNA and DNA pol-β contributes to neuronal death in PD.

Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

International Nuclear Information System (INIS)

Lina MR; Dadang S; Budiman Bela

2004-01-01

Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

Directory of Open Access Journals (Sweden)

Kordo B. A. Saeed

2013-11-01

Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

Rapid establishment of polymerase chain reaction-restriction ...

African Journals Online (AJOL)

2012-03-30

Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...

Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

Directory of Open Access Journals (Sweden)

Lisha, V.

2017-01-01

Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

Comparison between ICT and PCR for diagnosis of Chlamydia trachomatis.

Science.gov (United States)

Khan, E R; Hossain, M A; Paul, S K; Mahmud, C; Hasan, M M; Rahman, M M; Nahar, K; Kubayashi, N

2012-04-01

Chlamydia trachomatis is an obligate intracellular gram-negative bacterium which is the most prevalent cause of bacterial sexually transmitted infections (STI). The present study was carried to diagnose genital Chlamydia trachomatis infection among women of reproductive age, attending Mymensingh Medical College Hospital, during July 2009 to June 2010 by Immunochromatographic test (ICT) and Polymerase chain reaction (PCR). A total of 70 females were included in this study. Out of 70 cases 56 were symptomatic and 14 asymptomatic. Endocervical swabs were collected from each of the cases and examined by Immunochromatographic test (ICT) for antigen detection and Polymerase chain reaction (PCR) for detection of endogenous plasmid-based nucleic acid. A total 29(41.4%) of the cases were found positive for C. trachomatis either by ICT or PCR. Of the 56 symptomatic cases, 19(33.9%) were found ICT positive and 17(30.4%) were PCR positive. Among 14 asymptomatic females, 2(14.3%) were ICT positive and none were PCR positive. Though PCR is highly sensitive but a total of twelve cases were found ICT positive but PCR negative. It may be due to presence of plasmid deficient strain of C trachomatis which could be amplified by ompA based (Chromosomal gene) multiplex PCR.

The Arabidopsis mediator complex subunits MED16, MED14, and MED2 regulate mediator and RNA polymerase II recruitment to CBF-responsive cold-regulated genes.

Science.gov (United States)

Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather

2014-01-01

The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

Science.gov (United States)

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

Comparative validation using quantitative real-time PCR (qPCR and conventional PCR of bovine semen centrifuged in continuous density gradient

Directory of Open Access Journals (Sweden)

M.V. Resende

2011-06-01

Full Text Available The objective of the present study was to determine the sperm enrichment with X-bearing spermatozoa, after one centrifugation in a Percoll or OptiPrep continuous density gradient, using quantitative real-time polymerase chain reaction (qPCR of sperm DNA and resultant in vitro-produced bovine embryos by PCR. Frozen/thawed sperm was layered on density gradients and the tubes were centrifuged. Supernatants were gently aspirated and the sperm recovered from the bottom of the tubes. Cleavage and blastocyst rates were determined through in vitro production of embryos and PCR was performed to identify the embryos' genetic sex. A difference in blastocyst rate was found in the Percoll treatment compared to OptiPrep (P<0.05. The percentage of female embryos in the Percoll and OptiPrep groups was 62.0% and 47.1%, respectively. These results were confirmed by qPCR of spermatozoa DNA and underestimation was seen only in the Percoll group. It was possible to sexing sperm using simple approach.

Detection of Enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification

Directory of Open Access Journals (Sweden)

D Wang

2014-01-01

Full Text Available Purpose : The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD for an early treatment by using loop-mediated isothermal amplification (LAMP technique. Materials and Methods : A reverse-transcription loop-mediated isothermal amplification (RT-LAMP for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR and real-time PCR. Results : A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. Conclusions : The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.

A polymerase chain reaction strategy for the diagnosis of camelpox.

Science.gov (United States)

Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

2009-03-01

Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

A novel polymerase chain reaction (PCR) - denaturing gradient gel electrophoresis (DGGE) for the identification of Micrococcaceae strains involved in meat fermentations. Its application to naturally fermented Italian sausages.

Science.gov (United States)

Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G

2001-05-01

A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.

Pathogen detection by the polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

1994-05-01

In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

DEFF Research Database (Denmark)

Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre

2013-01-01

Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

OpenAIRE

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-01-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...

Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

Science.gov (United States)

Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

2005-09-15

In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

Detection of chromosome abnormalities by quantitative fluorescent PCR in ectopic pregnancies

NARCIS (Netherlands)

Goddijn, Mariette; van Stralen, Marja; Schuring-Blom, Heleen; Redeker, Bert; van Leeuwen, Liesbeth; Repping, Sjoerd; Leschot, Nico; van der Veen, Fulco

2005-01-01

Objective: To evaluate the potential value of quantitative fluorescent polymerase chain reaction (QF-PCR) in the detection of chromosome abnormalities in ectopic pregnancies. Methods: Seventy chorionic villi samples of ectopic pregnancies were studied by QF-PCR. Primers for chromosomes 16, 21, X and

Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

Science.gov (United States)

Altınel, Ahmet

2017-01-01

Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

Directory of Open Access Journals (Sweden)

Wen-Pin Chou

2017-02-01

Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

Identifikasi Cendawan Endofit Menggunakan Teknik Polymerase Chain Reaction (Detection of Endophytic Fungi Using Polymerase Chain Reaction Technique

Directory of Open Access Journals (Sweden)

Tuti Susanti Legiastuti

2013-04-01

Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction

The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

LENUS (Irish Health Repository)

Drew, Richard J

2012-03-01

Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

Thermally multiplexed polymerase chain reaction.

Science.gov (United States)

Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

2015-07-01

Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods.

Science.gov (United States)

Nixon, Gavin J; Svenstrup, Helle F; Donald, Carol E; Carder, Caroline; Stephenson, Judith M; Morris-Jones, Stephen; Huggett, Jim F; Foy, Carole A

2014-12-01

Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR). There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These 'isothermal' methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT), akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP) assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.

Theory and applications of the polymerase chain reaction.

Science.gov (United States)

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

Optimizing Taq polymerase concentration for improved signal-to-noise in the broad range detection of low abundance bacteria.

Directory of Open Access Journals (Sweden)

Rudolph Spangler

Full Text Available BACKGROUND: PCR in principle can detect a single target molecule in a reaction mixture. Contaminating bacterial DNA in reagents creates a practical limit on the use of PCR to detect dilute bacterial DNA in environmental or public health samples. The most pernicious source of contamination is microbial DNA in DNA polymerase preparations. Importantly, all commercial Taq polymerase preparations inevitably contain contaminating microbial DNA. Removal of DNA from an enzyme preparation is problematical. METHODOLOGY/PRINCIPAL FINDINGS: This report demonstrates that the background of contaminating DNA detected by quantitative PCR with broad host range primers can be decreased greater than 10-fold through the simple expedient of Taq enzyme dilution, without altering detection of target microbes in samples. The general method is: For any thermostable polymerase used for high-sensitivity detection, do a dilution series of the polymerase crossed with a dilution series of DNA or bacteria that work well with the test primers. For further work use the concentration of polymerase that gave the least signal in its negative control (H(2O while also not changing the threshold cycle for dilutions of spiked DNA or bacteria compared to higher concentrations of Taq polymerase. CONCLUSIONS/SIGNIFICANCE: It is clear from the studies shown in this report that a straightforward procedure of optimizing the Taq polymerase concentration achieved "treatment-free" attenuation of interference by contaminating bacterial DNA in Taq polymerase preparations. This procedure should facilitate detection and quantification with broad host range primers of a small number of bona fide bacteria (as few as one in a sample.

Interlaboratory comparison of three microbial source tracking quantitative polymerase chain reaction (qPCR) assays from fecal-source and environmental samples

Science.gov (United States)

Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.

2012-01-01

During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.

Polymerase chain reaction: A molecular diagnostic tool in periodontology

Science.gov (United States)

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses

Directory of Open Access Journals (Sweden)

Kieu The Loan Trinh

2016-05-01

Full Text Available Purpose: We aim to fabricate a thermoplastic poly(methylmethacrylate (PMMA Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs for rapid molecular detection of foodborne pathogen bacteria. Methods: A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. Results: A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. Conclusions: In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately.

A dominant mutation in mediator of paramutation2, one of three second-largest subunits of a plant-specific RNA polymerase, disrupts multiple siRNA silencing processes.

Science.gov (United States)

Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L

2009-11-01

Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance

Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR

Directory of Open Access Journals (Sweden)

Sérgio Monteiro de Almeida

Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.

Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

Science.gov (United States)

Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

2005-01-01

AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

Science.gov (United States)

Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

2015-08-01

This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Diagnosis of lymphoma in paraffin wax sections by nested PCR and immunohistochemistry.

OpenAIRE

Kitamura, Y; Nanba, E; Inui, S; Tanigawa, T; Ichihara, K

1996-01-01

AIMS: To investigate whether nested polymerase chain reaction (PCR) and immunohistochemistry can be used to diagnose malignant lymphoma. METHODS: Paraffin wax embedded tissue sections from 31 patients with malignant lymphoma were analysed by nested PCR and immunohistochemistry using standard protocols. RESULTS: Nested PCR amplification of 1 pg DNA confirmed monoclonality in B cell lymphoma; PCR amplification of 10 pg DNA confirmed monoclonality in T cell lymphoma. Twenty seven (87%) samples w...

Reduction of heteroduplex formation in PCR amplification

Czech Academy of Sciences Publication Activity Database

Michu, Elleni; Mráčková, Martina; Vyskot, Boris; Žlůvová, Jitka

2010-01-01

Roč. 54, č. 1 (2010), s. 173-176 ISSN 0006-3134 R&D Projects: GA AV ČR(CZ) KJB600040801; GA ČR(CZ) GD204/09/H002; GA AV ČR(CZ) IAA600040801; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : polymerase chain reaction * reconditioning PCR * mixed-template PCR Subject RIV: BO - Biophysics Impact factor: 1.582, year: 2010

Impact of PCR for respiratory viruses on antibiotic use : Theory and practice

NARCIS (Netherlands)

van de Pol, Alma C.; Wolfs, Tom F. W.; Tacke, Carline E. A.; Uiterwaal, Cuno S. P.; Forster, Johannes; van Loon, Anton M.; Kimpen, Jan L. L.; Rossen, John W. A.; Jansen, Nicolaas J. G.

RATIONALE FOR THE STUDY: Real-time polymerase chain reaction (PCR) for respiratory viruses is more sensitive, yet more expensive, than conventionally used direct immunofluorescence (DIF). We determined the impact of real-time PCR, additional to DIF, on antibiotic prescription in ventilated children

Variants of sequence family B Thermococcus kodakaraensis DNA polymerase with increased mismatch extension selectivity.

Directory of Open Access Journals (Sweden)

Claudia Huber

Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.

PCR IN TRAUMATOLOGY AND ORTHOPAEDICS: METHOD DESCRIPTION AND APPLICABILITY

Directory of Open Access Journals (Sweden)

E. M. Polyakova

2014-01-01

Full Text Available Review brief presents description of polymerase chain reaction method (PCR and its most common variants. Three PCR-based lines of research, carried out in the traumatology and orthopaedics, include identifying a causative agents of the implant-associated infection after orthopaedic surgery; detection of antibiotic resistance genes and biofilm forming genes. It was shown that PCR can be used as additional method for detection of genetic disorders, significant for traumatology and orthopaedics, and for investigation of cartilage and bone regeneration.

ReadqPCR and NormqPCR: R packages for the reading, quality checking and normalisation of RT-qPCR quantification cycle (Cq data

Directory of Open Access Journals (Sweden)

Perkins James R

2012-07-01

Full Text Available Abstract Background Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s. Results We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html Conclusions These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples.

Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies

DEFF Research Database (Denmark)

Hum, S.; Quinn, K.; Brunner, J.

1997-01-01

methods were attributed to methodological differences used in various laboratories. Conclusion Our results indicate that misidentification of C fetus in routine diagnostic laboratories may be relatively common. The PCR assay evaluated gave rapid and reproducible results and is thus a valuable adjunctive......Objective To evaluate a polymerase chain reaction assay for identification of Campylobacter fetus and differentiation of the defined subspecies. Design Characterisation of bacterial strains by traditional phenotyping, polymerase chain reaction, a probabilistic identification scheme...... by traditional phenotypic methods and the PCR assay was found to be 80.8%. The polymerase chain reaction proved to be a reliable technique for the species and subspecies identification of C fetus; equivocal results were obtained in only two instances. Initial misidentifications by conventional phenotyping...

MULTIPLEX SYBR® GREEN-REAL TIME PCR (qPCR ASSAY FOR THE DETECTION AND DIFFERENTIATION OF Bartonella henselae AND Bartonella clarridgeiae IN CATS

Directory of Open Access Journals (Sweden)

Rodrigo Staggemeier

2014-04-01

Full Text Available A novel SYBR® green-real time polymerase chain reaction (qPCR was developed to detect two Bartonella species, B. henselae and B. clarridgeiae, directly from blood samples. The test was used in blood samples obtained from cats living in animal shelters in Southern Brazil. Results were compared with those obtained by conventional PCR targeting Bartonella spp. Among the 47 samples analyzed, eight were positive using the conventional PCR and 12 were positive using qPCR. Importantly, the new qPCR detected the presence of both B. henselae and B. clarridgeiae in two samples. The results show that the qPCR described here may be a reliable tool for the screening and differentiation of two important Bartonella species.

A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods

Directory of Open Access Journals (Sweden)

Gavin J. Nixon

2014-12-01

Full Text Available Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR. There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These ‘isothermal’ methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT, akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.

A naked-eye colorimetric "PCR developer"

Science.gov (United States)

Valentini, Paola; Pompa, Pier Paolo

2016-04-01

Despite several advances in molecular biology and diagnostics, Polymerase Chain Reaction (PCR) is currently the gold standard for nucleic acids amplification and detection, due to its versatility, low-cost and universality, with estimated genetically modified organisms, and pathogens). The PCR developer proved to be highly specific and ultra-sensitive, discriminating down to few copies of HIV viral DNA, diluted in an excess of interfering human genomic DNA, which is a clinically relevant viral load. Hence, it could be a valuable tool for both academic research and clinical applications.

Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

Science.gov (United States)

Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

2018-04-01

Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

Loop-mediated isothermal amplification assay for rapid and sensitive detection of sheep pox and goat pox viruses in clinical samples.

Science.gov (United States)

Venkatesan, G; Balamurugan, V; Bhanuprakash, V; Singh, R K; Pandey, A B

2016-06-01

A Loop-mediated isothermal amplification (LAMP) assay targeting the highly conserved DNA polymerase gene of capripox virus genome was developed and evaluated for rapid detection of sheep pox and goat pox viruses. The optimized LAMP assay is found specific and sensitive for amplification of target DNA with a diagnostic sensitivity and specificity of 96.6% and 100% respectively compared to quantitative PCR. The detection rate of LAMP, PCR and Q-PCR assays is found to be 81.5%, 67% and 83% respectively. This LAMP assay has the potential for rapid clinical diagnosis and surveillance of sheep pox and goat pox in field diagnostic laboratories. Copyright © 2016 Elsevier Ltd. All rights reserved.

Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

Directory of Open Access Journals (Sweden)

María-José Chapela

2015-12-01

Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

DEFF Research Database (Denmark)

Munch, M.; Nielsen, L.P.; Handberg, Kurt

2001-01-01

A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

Use of polymerase chain reaction for detection of Chlamydia trachomatis

DEFF Research Database (Denmark)

Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

1990-01-01

A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

Metabolic consequences of DNA damage: The role of poly (ADP-ribose) polymerase as mediator of the suicide response

International Nuclear Information System (INIS)

Berger, N.A.; Berger, S.J.

1986-01-01

Recent studies show that DNA damage can produce rapid alterations in steady state levels of deoxynucleoside triphosphate pools, for example, MNNG or uv-irradiation cause rapid increases in dATP and dTTP pools without significant changes in dGTP or dCTP pools. In vitro, studies with purified eukaryotic DNA polymerases show that the frequency of nucleotide misincorporation was affected by alterations in relative concentrations of the deoxynucleoside triphosphates. Thus the alterations in dNTP pool sizes that occur consequent to DNA damage may contribute to an increased mutagenic frequency. Poly(ADP-ribose) polymerase mediated suicide mechanism may participate in the toxicity of adenosine deaminase deficiency and severe combined immune deficiency disease in humans. Individuals with this disease suffer severe lymphopenia due to the toxic effects of deoxyadenosine. The lymphocytotoxic effect of adenosine deaminase deficiency can be simulated in lymphocyte cell lines from normal individuals by incubating them with the adenosine deaminase inhibitor, deoxycoformycin. Incubation of such leukocytes with deoxycoformycin and deoxyadenosine results in the gradual accumulation of DNA strand breaks and the depletion of NAD + leading to cell death over a period of several days. This depletion of NAD and loss of cell viability were effectively blocked by nicotinamide or 3-amino benzamide. Thus, persistent activation of poly(ADP-ribose) polymerase by unrepaired or recurrent DNA strand breaks may activate the suicide mechanism of cell death. This study provides a basis for the interesting suggestion that treatment with nicotinamide could block the persistent activity of poly(ADP-ribose) polymerase and may help preserve lymphocyte function in patients with adenosine deaminase deficiency. 16 refs., 3 figs., 2 tabs

Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR

Science.gov (United States)

Droplet digital Polymerase chain reaction (ddPCR) is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. It is a promising DNA quantification technology for medical diagnostics but there are only a few reports of its use for plant pat...

Detection of Mycobacterium Tuberculosis by using PCR

International Nuclear Information System (INIS)

Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.

1996-01-01

Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g

Cutaneous and visceral leishmaniasis co-infection in dogs from Rio de Janeiro, Brazil: evaluation by specific PCR and RFLP-PCR assays

Directory of Open Access Journals (Sweden)

Marize Quinhones Pires

2014-04-01

Full Text Available Introduction During a diagnostic evaluation of canine visceral leishmaniasis (VL, two of seventeen dogs were found to be co-infected by Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi. Methods Specific polymerase chain reaction (PCR and restriction fragment length polymorphism-PCR (RFLP-PCR assays were performed. Results PCR assays for Leishmania subgenus identification followed by RFLP-PCR analysis in biopsies from cutaneous lesions and the spleen confirmed the presence of Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi in those fragments. Conclusions This report reinforces the importance of using serological and molecular techniques in the epidemiological surveillance of canine populations in endemic areas in which both diseases are known to co-exist. In such cases, a reassessment of the control measures is required.

Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

Science.gov (United States)

Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

2012-11-16

The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

Improved thermal cycling durability and PCR compatibility of polymer coated quantum dot

International Nuclear Information System (INIS)

Xun Zhe; Guan Yifu; Zhao Xiaoyun

2013-01-01

Quantum dots have experienced rapid development in imaging, labeling and sensing in medicine and life science. To be suitable for polymerase chain reaction (PCR) assay, we have tested QD thermal cycling durability and compatibility, which have not been addressed in previous reports. In this study, we synthesized CdSe/ZnS QDs with a surface modification with high-MW amphiphilic copolymers and observed that Mg 2+ ions in the PCR reaction could induce the QDs to precipitate and reduce their fluorescence signal significantly after thermal cycling. To overcome this problem, we used mPEG2000 to conjugate the QD surface for further protection, and found that this modification enables QDs to endure 40 thermal cycles in the presence of other components essential for PCR reactions. We have also identified that QDs have different effects on rTaq and Ex Taq polymerization systems. A high QD concentration could apparently reduce the PCR efficiency, but this inhibition was relieved significantly in the Ex PCR system as the concentration of Ex Taq polymerase was increased. Real-time PCR amplification results showed that QDs could provide a sufficiently measurable fluorescence signal without excessively inhibiting the DNA amplification. Based on this improved thermal cycling durability and compatibility with the PCR system, QDs have the potential to be developed as stable fluorescent sensors in PCR and real-time PCR amplification. (paper)

SAD1, an RNA polymerase I subunit A34.5 of rice, interacts with Mediator and controls various aspects of plant development.

Science.gov (United States)

Li, Weiqiang; Yoshida, Akiko; Takahashi, Megumu; Maekawa, Masahiko; Kojima, Mikiko; Sakakibara, Hitoshi; Kyozuka, Junko

2015-01-01

The DWARF14 (D14) gene of rice functions within the signaling pathway of strigolactones, a group of plant hormones that inhibits shoot branching. We isolated a recessive mutant named super apical dormant (sad1-1) from a suppressor screen of d14-1. The growth of tillers (vegetative shoot branches) is suppressed in both the d14-1 sad1-1 double mutant and the sad1-1 single mutant. In addition, the sad1-1 mutant shows pleiotropic defects throughout development. SAD1 encodes an ortholog of RPA34.5, a subunit of RNA polymerase I (Pol I). Consequently, the level of ribosomal RNA (rRNA) is severely reduced in the sad1-1 mutant. These results indicate that proper ribosome function is a prerequisite for normal development in plants. The Arabidopsis ortholog of SAD1 was previously isolated as a Mediator-interacting protein. Here we show that SAD1 interacts physically with the Mediator complex through direct binding with OsMED4, a component of the middle module of the Mediator complex in rice. It is known that Mediator interacts with Pol II, which transcribes mRNAs and functions as a central regulator of transcription. This study indicates a novel aspect of Mediator function in Pol I-controlled rRNA transcription. TFIIF2 and RPC53 are the counterparts of RPA34.5 in Pol II and Pol III, respectively. We demonstrate that the rice orthologs of these proteins also interact with OsMED4. Our results suggest that interaction with MED4 in the Mediator complex is a common feature of the three types of RNA polymerases. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Role of Polymerase Chain Reaction (PCR) in the detection of ...

African Journals Online (AJOL)

Rajeh Ali

2014-06-20

Jun 20, 2014 ... in 2013. Objectives: This study aimed to investigate S. aureus in some clinical samples by PCR and study .... culture, the isolates of S. aureus were incubated at 37 °C for. 18–24 h .... characteristics, and ability to form biofilm.

Influenza polymerase encoding mRNAs utilize atypical mRNA nuclear export.

Science.gov (United States)

Larsen, Sean; Bui, Steven; Perez, Veronica; Mohammad, Adeba; Medina-Ramirez, Hilario; Newcomb, Laura L

2014-08-28

Influenza is a segmented negative strand RNA virus. Each RNA segment is encapsulated by influenza nucleoprotein and bound by the viral RNA dependent RNA polymerase (RdRP) to form viral ribonucleoproteins responsible for RNA synthesis in the nucleus of the host cell. Influenza transcription results in spliced mRNAs (M2 and NS2), intron-containing mRNAs (M1 and NS1), and intron-less mRNAs (HA, NA, NP, PB1, PB2, and PA), all of which undergo nuclear export into the cytoplasm for translation. Most cellular mRNA nuclear export is Nxf1-mediated, while select mRNAs utilize Crm1. Here we inhibited Nxf1 and Crm1 nuclear export prior to infection with influenza A/Udorn/307/1972(H3N2) virus and analyzed influenza intron-less mRNAs using cellular fractionation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR). We examined direct interaction between Nxf1 and influenza intron-less mRNAs using immuno purification of Nxf1 and RT-PCR of associated RNA. Inhibition of Nxf1 resulted in less influenza intron-less mRNA export into the cytoplasm for HA and NA influenza mRNAs in both human embryonic kidney cell line (293 T) and human lung adenocarcinoma epithelial cell line (A549). However, in 293 T cells no change was observed for mRNAs encoding the components of the viral ribonucleoproteins; NP, PA, PB1, and PB2, while in A549 cells, only PA, PB1, and PB2 mRNAs, encoding the RdRP, remained unaffected; NP mRNA was reduced in the cytoplasm. In A549 cells NP, NA, HA, mRNAs were found associated with Nxf1 but PA, PB1, and PB2 mRNAs were not. Crm1 inhibition also resulted in no significant difference in PA, PB1, and PB2 mRNA nuclear export. These results further confirm Nxf1-mediated nuclear export is functional during the influenza life cycle and hijacked for select influenza mRNA nuclear export. We reveal a cell type difference for Nxf1-mediated nuclear export of influenza NP mRNA, a reminder that cell type can influence molecular mechanisms. Importantly, we

Evolving a polymerase for hydrophobic base analogues.

Science.gov (United States)

Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

2009-10-21

Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction.

Science.gov (United States)

Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František

2017-05-01

The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.

Evaluation of loop-mediated isothermal amplification assay for rapid diagnosis of Acanthamoeba keratitis

Directory of Open Access Journals (Sweden)

Abhishek Mewara

2017-01-01

Full Text Available Background: The clinical features of Acanthamoeba keratitis (AK are non-specific and closely resemble bacterial, viral and fungal keratitis. Materials and Methods: We compared loop-mediated isothermal amplification (LAMP with microscopy, non-nutrient agar (NNA culture and polymerase chain reaction (PCR in clinical suspects of AK. Results: Of 52 clinical samples (42 AK suspects and 10 proven bacterial, viral or fungal keratitis, 3 were positive by direct microscopy (sensitivity 60%, confidence interval [CI]: 17%–92.7%, and 5 by NNA culture, 18S rDNA PCR and LAMP (sensitivity 100%, CI: 46.3%–100%. The limit of detection of Acanthamoeba DNA was 1 pg/μl by both LAMP and PCR. Conclusion: PCR and LAMP assays targeting 18S rDNA gene were found particularly suitable for a rapid and accurate diagnosis of AK. LAMP assay takes 2–3 h lesser than PCR, and thus offers a rapid, highly sensitive and specific, simple and affordable diagnostic modality for patients suspected of AK, especially in resource limited settings

The Arabidopsis Mediator Complex Subunits MED16, MED14, and MED2 Regulate Mediator and RNA Polymerase II Recruitment to CBF-Responsive Cold-Regulated Genes[C][W][OPEN

Science.gov (United States)

Hemsley, Piers A.; Hurst, Charlotte H.; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R.; De Cothi, Elizabeth A.; Steele, John F.; Knight, Heather

2014-01-01

The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation–induced freezing tolerance. In addition, these three subunits are required for low temperature–induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced. PMID:24415770

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

Science.gov (United States)

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Genotyping of Trypanosoma cruzi Sublineage in Human Samples from a North-East Argentina Area by Hybridization with DNA Probes and Specific Polymerase Chain Reaction (PCR)

Science.gov (United States)

Diez, Cristina; Lorenz, Virginia; Ortiz, Silvia; Gonzalez, Verónica; Racca, Andrea; Bontempi, Iván; Manattini, Silvia; Solari, Aldo; Marcipar, Iván

2010-01-01

We have evaluated blood samples of chronic and congenital Trypanosoma cruzi-infected patients from the city of Reconquista located in the northeast of Argentina where no information was previously obtained about the genotype of infecting parasites. Fourteen samples of congenital and 19 chronical patients were analyzed by hybridization with DNA probes of minicircle hypervariable regions (mHVR). In congenital patients, 50% had single infections with TcIId, 7% single infections with TcIIe, 29% mixed infections with TcIId/e, and 7% had mixed infections with TcIId/b and 7% TcIId/b, respectively. In Chronical patients, 52% had single infections with TcIId, 11% single infections with TcIIe, 26% had mixed infections with TcIId/e, and 11% had non-identified genotypes. With these samples, we evaluated the minicircle lineage-specific polymerase chain reaction assay (MLS-PCR), which involves a nested PCR to HVR minicircle sequences and we found a correlation with hybridization probes of 96.4% for TcIId and 54.8% for TcIIe. PMID:20064998

Pressure-driven one-step solid phase-based on-chip sample preparation on a microfabricated plastic device and integration with flow-through polymerase chain reaction (PCR).

Science.gov (United States)

Tran, Hong Hanh; Trinh, Kieu The Loan; Lee, Nae Yoon

2013-10-01

In this study, we fabricate a monolithic poly(methylmethacrylate) (PMMA) microdevice on which solid phase-based DNA preparation and flow-through polymerase chain reaction (PCR) units were functionally integrated for one-step sample preparation and amplification operated by pressure. Chelex resin, which is used as a solid support for DNA preparation, can capture denatured proteins but releases DNA, and the purified DNA can then be used as a template in a subsequent amplification process. Using the PMMA microdevices, DNA was successfully purified from both Escherichia coli and human hair sample, and the plasmid vector inserted in E. coli and the D1S80 locus in human genomic DNA were successfully amplified from on-chip purified E. coli and human hair samples. Furthermore, the integration potential of the proposed sample preparation and flow-through PCR units was successfully demonstrate on a monolithic PMMA microdevice with a seamless flow, which could pave the way for a pressure-driven, simple one-step sample preparation and amplification with greatly decreased manufacture cost and enhanced device disposability. Copyright © 2013 Elsevier B.V. All rights reserved.

Optimisation of the PCR-invA primers for the detection of Salmonella ...

African Journals Online (AJOL)

A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

Directory of Open Access Journals (Sweden)

Trioso Purnawarman

2014-04-01

Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

OpenAIRE

Robertson, Amber L.; Phillips, Allison R.

2008-01-01

Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

Development of a panel of seven duplex real-time PCR assays for detecting 13 streptococcal superantigens.

Science.gov (United States)

Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi

2013-07-30

Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.

Comparison of toxicity neutralization-, ELISA- and PCR tests for typing of Clostridium perfringens and detection of the enterotoxin gene by PCR

DEFF Research Database (Denmark)

Møller, Kristian; Ahrens, Peter

1996-01-01

A polymerase chain reaction (PCR) was developed for the specific amplification of a part of each of the five Clostridium perfringens toxin genes: alpha (alpha), beta (beta), epsilon (epsilon), iota (iota), and enterotoxin (CPE). While the toxicity neutralization test (TNT) only showed limited...

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

A survey of tools for the analysis of quantitative PCR (qPCR) data.

Science.gov (United States)

Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas

2014-09-01

Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.

Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

NARCIS (Netherlands)

Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

Pneumocystis PCR: It Is Time to Make PCR the Test of Choice.

Science.gov (United States)

Doyle, Laura; Vogel, Sherilynn; Procop, Gary W

2017-01-01

The testing strategy for Pneumocystis at the Cleveland Clinic changed from toluidine blue staining to polymerase chain reaction (PCR). We studied the differences in positivity rates for these assays and compared each with the detection of Pneumocystis in companion specimens by cytology and surgical pathology. We reviewed the results of all Pneumocystis test orders 1 year before and 1 year after the implementation of a Pneumocystis -specific PCR. We also reviewed the corresponding cytology and surgical pathology results, if performed. Finally, we reviewed the medical records of patients with rare Pneumocystis detected by PCR in an effort to differentiate colonization vs true disease. Toluidine blue staining and surgical pathology had similar sensitivities and negative predictive values, both of which were superior to cytology. There was a >4-fold increase in the annual detection of Pneumocystis by PCR compared with toluidine blue staining (toluidine blue staining: 11/1583 [0.69%] vs PCR: 44/1457 [3.0%]; chi-square P < .001). PCR detected 1 more case than surgical pathology and was far more sensitive than cytology. Chart review demonstrated that the vast majority of patients with rare Pneumocystis detected were immunosuppressed, had radiologic findings supportive of this infection, had no other pathogens detected, and were treated for pneumocystosis by the clinical team. PCR was the most sensitive method for the detection of Pneumocystis and should be considered the diagnostic test of choice. Correlation with clinical and radiologic findings affords discrimination of early true disease from the far rarer instances of colonization.

an overview on the application of polymerase chain reaction (pcr)

African Journals Online (AJOL)

DR. AMINU

Hill New York Pp818. Chul, W.P., Jang-Hee, H., Jin-Hyeok, J. et al (2004). Detection rates of Bacteria in chronic Otitis. Media with Effusion in Children, Journal of. Korean Medical Sciences 19: 735-738. Cockerill, F.R. and Smith, T.F. (2002). Rapid-Cycle real time PCR: A revolution of clinical. Microbiology. ASM News 68:2.

Nanoparticles affect PCR primarily via surface interactions with PCR components: using amino-modified silica-coated magnetic nanoparticles as a main model

Science.gov (United States)

Nanomaterials have been widely reported to affect the polymerase chain reaction (PCR). However, many studies in which these effects were observed were not comprehensive, and many of the proposed mechanisms have been primarily speculative. In this work, we used amino-modified silica-coated magnetic n...

Evaluation of a new HTLV-I/II polymerase chain reaction

NARCIS (Netherlands)

Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.

1997-01-01

AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA

Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.

Science.gov (United States)

Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide

2018-05-05

Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.

Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

KAUST Repository

Wen, Weijia; Wu, Jinbo; Kodzius, Rimantas

2011-01-01

A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable

Real-time PCR in virology.

Science.gov (United States)

Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas

2002-03-15

The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.

Molecular analysis of the genera eremopyrum (ledeb). jaub. and spach and agropyron gaertner (poaceae) by pcr methods

International Nuclear Information System (INIS)

Yilmaz, R.; Cabi, E.; Dogan, M.

2014-01-01

RAPD-PCR (Random Amplified Polymorphic DNA Polymerase Chain Reaction) and Post PCR (Polymerase Chain Reaction) Melting Curve Analysis (MCA) have been used to investigate the pattern of genetic variation among some species in the genera Eremopyrum (Ledeb.) Jaub. and Spach and Agropyron Gaertner (Poaceae). Thirteen primers have been used in the study based on the RAPD-PCR and MCA analyses. Each species produced a distinct pattern of DNA fragments which have been used as a measure of the degree of relationship between species by means of using the RAPD-PCR results with three primers selected for identifying the genetic similarities. Polymorphic melting profiles have been obtained with Post PCR MCA method using three primers. Genetic similarities are calculated for all the species studied with RAPD-PCR and MCA methods, the dendrograms are obtained with the MVSP (Multi Variate Statistical Package) software using UPGMA (Unweighted Pair Group Method with Arithmetic Averages) and Jaccard's Coefficient. Polymorphism between 18 populations of Eremopyrum and 6 Agropyron populations and within the species are determined by using RAPD-PCR and Post PCR melting curve analysis (MCA) respectively. (author)

Inhibitory effect of common microfluidic materials on PCR outcome

KAUST Repository

Kodzius, Rimantas; Xiao, Kang; Wu, Jinbo; Yi, Xin; Gong, Xiuqing; Foulds, Ian G.; Wen, Weijia

2013-01-01

In this study, we established a simple method for evaluating the PCR compatibility of various common materials employed when fabricating microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most cases, adding bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, although they noticeably interacted with the polymerase. We provide a simple method of performing PCR-compatibility testing of materials using inexpensive instrumentation that is common in molecular biology laboratories. Furthermore, our method is direct, being performed under actual PCR conditions with high temperature. Our results provide an overview of materials that are PCR-friendly for fabricating microfluidic devices. The PCR reaction, without any additives, performed best with pyrex glass, and it performed worst with PMMA or acrylic glue materials.

Inhibitory effect of common microfluidic materials on PCR outcome

KAUST Repository

Kodzius, Rimantas

2013-10-10

In this study, we established a simple method for evaluating the PCR compatibility of various common materials employed when fabricating microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most cases, adding bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, although they noticeably interacted with the polymerase. We provide a simple method of performing PCR-compatibility testing of materials using inexpensive instrumentation that is common in molecular biology laboratories. Furthermore, our method is direct, being performed under actual PCR conditions with high temperature. Our results provide an overview of materials that are PCR-friendly for fabricating microfluidic devices. The PCR reaction, without any additives, performed best with pyrex glass, and it performed worst with PMMA or acrylic glue materials.

Mediator, TATA-binding Protein, and RNA Polymerase II Contribute to Low Histone Occupancy at Active Gene Promoters in Yeast*

Science.gov (United States)

Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.

2014-01-01

Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477

An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

NARCIS (Netherlands)

Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

The RNA Polymerase II C-Terminal Domain Phosphatase-Like Protein FIERY2/CPL1 Interacts with eIF4AIII and Is Essential for Nonsense-Mediated mRNA Decay in Arabidopsis

KAUST Repository

Cui, Peng; Chen, Tao; Qin, Tao; Ding, Feng; Wang, Zhenyu; Chen, Hao; Xiong, Liming

2016-01-01

© 2016 American Society of Plant Biologists. All rights reserved. Nonsense-mediated decay (NMD) is a posttranscriptional surveillance mechanism in eukaryotes that recognizes and degrades transcripts with premature translation-termination codons. The RNA polymerase II C-terminal domain phosphatase-like protein FIERY2 (FRY2; also known as C-TERMINAL DOMAIN PHOSPHATASE-LIKE1 [CPL1]) plays multiple roles in RNA processing in Arabidopsis thaliana. Here, we found that FRY2/CPL1 interacts with two NMD factors, eIF4AIII and UPF3, and is involved in the dephosphorylation of eIF4AIII. This dephosphorylation retains eIF4AIII in the nucleus and limits its accumulation in the cytoplasm. By analyzing RNA-seq data combined with quantitative RT-PCR validation, we found that a subset of alternatively spliced transcripts and 59-extended mRNAs with NMD-eliciting features accumulated in the fry2-1 mutant, cycloheximidetreated wild type, and upf3 mutant plants, indicating that FRY2 is essential for the degradation of these NMD transcripts.

The RNA Polymerase II C-Terminal Domain Phosphatase-Like Protein FIERY2/CPL1 Interacts with eIF4AIII and Is Essential for Nonsense-Mediated mRNA Decay in Arabidopsis

KAUST Repository

Cui, Peng

2016-02-18

© 2016 American Society of Plant Biologists. All rights reserved. Nonsense-mediated decay (NMD) is a posttranscriptional surveillance mechanism in eukaryotes that recognizes and degrades transcripts with premature translation-termination codons. The RNA polymerase II C-terminal domain phosphatase-like protein FIERY2 (FRY2; also known as C-TERMINAL DOMAIN PHOSPHATASE-LIKE1 [CPL1]) plays multiple roles in RNA processing in Arabidopsis thaliana. Here, we found that FRY2/CPL1 interacts with two NMD factors, eIF4AIII and UPF3, and is involved in the dephosphorylation of eIF4AIII. This dephosphorylation retains eIF4AIII in the nucleus and limits its accumulation in the cytoplasm. By analyzing RNA-seq data combined with quantitative RT-PCR validation, we found that a subset of alternatively spliced transcripts and 59-extended mRNAs with NMD-eliciting features accumulated in the fry2-1 mutant, cycloheximidetreated wild type, and upf3 mutant plants, indicating that FRY2 is essential for the degradation of these NMD transcripts.

Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

NARCIS (Netherlands)

Gamper, H.A.; Leuchtmann, A.

2007-01-01

Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

Directory of Open Access Journals (Sweden)

Luiz Tadeu M Figueiredo

1997-05-01

Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

Implementation of polymerase chain reaction (PCR and Real-Time PCR in quick identification of bovine herpesvirus 1

Directory of Open Access Journals (Sweden)

Milić Nenad

2010-01-01

Full Text Available Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these cell lines. The application of polymerize chain reaction (PCR using a primer for glucoprotein B and thymidine - kinasis, established the presence of bovine herpes virus 1 nucleic acid in one sample of a bovine nasal smear, while the presence of this virus was established in three samples in an examination of the nasal smear samples using the Real-Time PCR method.

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.

Science.gov (United States)

Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José

2013-01-01

Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Evidence of simian retrovirus type D by polymerase chain reaction.

Science.gov (United States)

Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

2017-06-01

Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.

Science.gov (United States)

Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

2009-01-01

Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.

Validation of the DNATyper™15 PCR Genotyping System for Forensic Application

OpenAIRE

Jian Ye; Chengtao Jiang; Xingchun Zhao; Le Wang; Caixia Li; Anquan Ji; Li Yuan; Jing Sun; Shuaifeng Chen

2015-01-01

We describe the optimization and validation of the DNATyper™15 multiplex polymerase chain reaction (PCR) genotyping system for autosomal short tandem repeat (STR) amplification at 14 autosomal loci (D6S1043, D21S11, D7S820, CSF1PO, D2S1338, D3S1358, D13S317, D8S1179, D16S539, Penta E, D5S818, vWA, D18S51, and FGA) and  amelogenin, a sex-determining locus. Several DNATyper™15 assay variables were optimized, including hot start Taq polymerase concentration, Taq polymerase activation time, magne...

Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

Science.gov (United States)

Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

2004-03-01

Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

Standardization of diagnostic PCR for the detection of foodborne pathogens

DEFF Research Database (Denmark)

Malorny, B.; Tassios, P.T.; Radstrom, P.

2003-01-01

In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

Material Biocompatibility for PCR Microfluidic Chips

KAUST Repository

Kodzius, Rimantas

2010-04-23

As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

Material Biocompatibility for PCR Microfluidic Chips

KAUST Repository

Kodzius, Rimantas; Chang, Donald Choy; Gong, Xiuqing; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yi, Xin

2010-01-01

As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

Detection of five potentially periodontal pathogenic bacteria in peri-implant disease: A comparison of PCR and real-time PCR.

Science.gov (United States)

Schmalz, Gerhard; Tsigaras, Sandra; Rinke, Sven; Kottmann, Tanja; Haak, Rainer; Ziebolz, Dirk

2016-07-01

The aim of this study was to compare the microbial analysis methods of polymerase chain reaction (PCR) and real-time PCR (RT-PCR) in terms of detection of five selected potentially periodontal pathogenic bacteria in peri-implant disease. Therefore 45 samples of healthy, mucositis and peri-implantitis (n = 15 each) were assessed according to presence of the following bacteria using PCR (DNA-strip technology) and RT-PCR (fluorescent dye SYBR green-system): Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Treponema denticola (Td), Tanerella forsythia (Tf), and Fusobacterium nucleatum (Fn). There were no significant correlations between the bacterial and disease patterns, so the benefit of using microbiological tests for the diagnosis of peri-implant diseases is questionable. Correlations between the methods were highest for Tf (Kendall's Tau: 0.65, Spearman: 0.78), Fn (0.49, 0.61) and Td (0.49, 0.59). For Aa (0.38, 0.42) and Pg (0.04, 0.04), lower correlation values were detected. Accordingly, conventional semi-quantitative PCR seems to be sufficient for analyzing potentially periodontal pathogenic bacterial species. Copyright © 2016 Elsevier Inc. All rights reserved.

Clinical profile of uveitis in Hansen’s disease after completion of treatment – A study of 50 cases using Polymerase Chain Reaction (PCR on aqueous humour

Directory of Open Access Journals (Sweden)

Radha Annamalai

2016-05-01

Full Text Available Chronic low grade anterior uveitis is the commonest cause of blindness in leprosy. It is usually asymptomatic until the late stages and patients seek help only after irreversible visual loss. We analysed patients who had a recurrence of uveitis after completion of treatment with anti-leprosy drugs and had been proven as histopathologically negative. The presence of chronic uveitis, complications and the extent of ocular damage it may cause, can continue even after treatment, emphasising the importance of follow-up, early detection and treatment. This is a prospective cohort study. Ophthalmic evaluation was performed using slit lamp examination, biomicroscopy, indirect ophthalmoscopy, applanation tonometry, corneal sensation and Schirmer’s test. Split skin microscopy was done to confirm the activity of leprosy. In patients with recalcitrant iridocyclitis, anterior chamber paracentesis was performed. The sample was analysed both by smear and polymerase chain reaction. The sequences that were targeted using PCR included genes encoding the DNA of 36-kDa antigen, 18-kDa antigen, 65-kDa antigen and the repetitive sequences among other M. leprae genes. Aqueous aspirate showed copies of mycobacterium leprae DNA in five out of twelve patients with recalcitrant anterior uveitis. Direct smear and staining with Ziehl- Neelson staining for mycobacteria was positive showing both live and dead bacilli. Live bacilli can persist in the aqueous humour even after completion of treatment. In our study this was more frequently observed in tuberculoid leprosy. This is possibly due to an immune mediated response combined with inadequate treatment dose in these patients.

How useful is PCR in the diagnosis of malaria?

NARCIS (Netherlands)

Hänscheid, Thomas; Grobusch, Martin P.

2002-01-01

Polymerase chain reaction (PCR) assays are the most sensitive and specific method to detect malaria parasites, and have acknowledged value in research settings. However, the time lag between sample collection, transportation and processing, and dissemination of results back to the physician limits

Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY)

OpenAIRE

Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati

2014-01-01

Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...

Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

DEFF Research Database (Denmark)

Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

2018-01-01

Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR.

Directory of Open Access Journals (Sweden)

Yogita Maheshwari

Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.

PCR detection of Bartonella spp. in the dog

Directory of Open Access Journals (Sweden)

Jarmila Konvalinová

2014-01-01

Full Text Available Our study aimed at using PCR to identify the incidence of Bartonella spp. in blood of dogs. Altogether 286 dogs of 92 breeds aged 3 month to 17 years were tested from October 2008 to December 2009. Healthy dogs as well as dogs with various clinical symptoms of disease were included in the group. Samples were tested by polymerase chain reaction (PCR specific for the presence of Bartonella spp. Following the DNA examination in 286 dogs by PCR and subsequent sequencing, two samples were identified as Bartonella henselae (0.7%. Other species of Bartonella were not found. It was the first time in the Czech Republic when incidence of Bartonella spp. was determined in dogs.

IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR

Directory of Open Access Journals (Sweden)

Ervi Salwati

2012-09-01

Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results.   Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction

Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

Science.gov (United States)

Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

2018-05-01

As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

DEFF Research Database (Denmark)

Skøt, J; Lerche, A G; Kolmos, H J

1995-01-01

To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

Quadruplex genotype analysis at HumTH01, HumTPOX, HumCSF1PO and amelogenin Loci by FoLT-PCR

Energy Technology Data Exchange (ETDEWEB)

Lee, Y.H.; Lim, S.K.; Kang, P.W.; Choi, D.H.; Yoon, S.R.; Han, M.S. [National Institute of Scientific Investigation, Seoul (Korea)

1999-06-01

A simple and rapid procedure, called FoLT-PCR(Formamide Low Temperature-Polymerase Chain Reaction) was applied to amplifying DNA directly from various forensic biological evidences including human blood, saliva, hair root, or semen without any DNA preparative steps. We added washing step with non-ionic detergent, 1% Triton X-100, and used Taq DNA polymerase instead of Tth DNA polymerase to amplify 3 STR loci and gender allele simultaneously. Optimal concentration of formamide and annealing temperature were determined empirically to 8%(v/v), and 48{sup o} C respectively. We also compared this method with standard PCR. 8 refs., 4 figs.

Fidelity and Mutational Spectrum of Pfu DNA Polymerase on a Human Mitochondrial DNA Sequence

Science.gov (United States)

André, Paulo; Kim, Andrea; Khrapko, Konstantin; Thilly, William G.

1997-01-01

The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10−6 must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or “PCR noise”. Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 × 10−7, and five of its more frequent mutations (hot spots) consisted of three transversions (GC → TA, AT → TA, and AT → CG), one transition (AT → GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be

Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence.

Science.gov (United States)

André, P; Kim, A; Khrapko, K; Thilly, W G

1997-08-01

The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.

Validation of kinetics similarity in qPCR

Czech Academy of Sciences Publication Activity Database

Bar, T.; Kubista, Mikael; Tichopád, Aleš

2012-01-01

Roč. 40, č. 4 (2012), s. 1395-1406 ISSN 0305-1048 R&D Projects: GA ČR GAP303/10/1338; GA ČR GA301/09/1752 Institutional research plan: CEZ:AV0Z50520701 Keywords : REAL-TIME PCR * POLYMERASE-CHAIN-REACTION * SYBR-GREEN-I Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.278, year: 2012

Detection of bovine herpesvirus 4 glycoprotein B and thymidine kinase DNA by PCR assays in bovine milk

NARCIS (Netherlands)

Wellenberg, G.J.; Verstraten, E.; Belak, S.; Verschuren, S.B.E.; Rijsewijk, F.A.M.; Peshev, R.; Oirschot, van J.T.

2001-01-01

A polymerase chain reaction (PCR) assay was developed to detect bovine herpesvirus 4 (BHV4) glycoprotein B (gB) DNA, and a nested-PCR assay was modified for the detection of BHV4 thymidine kinase (TK) DNA in bovine milk samples. To identify false-negative PCR results, internal control templates were

Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

Science.gov (United States)

Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

2002-12-20

A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments

Czech Academy of Sciences Publication Activity Database

Huggett, J.F.; Foy, C.A.; Benes, V.; Emslie, K.; Garson, J.A.; Haynes, R.; Hellemans, J.; Kubista, Mikael; Mueller, R.D.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; Vandesompele, J.; Wittwer, C.T.; Bustin, S.A.

2013-01-01

Roč. 59, č. 6 (2013), s. 892-902 ISSN 0009-9147 R&D Projects: GA ČR GAP303/10/1338 Institutional research plan: CEZ:AV0Z50520701 Keywords : REAL - TIME PCR * POLYMERASE-CHAIN-REACTION * COPY NUMBER VARIATION * RT-PCR Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.768, year: 2013

A Trio of Human Molecular Genetics PCR Assays

Science.gov (United States)

Reinking, Jeffrey L.; Waldo, Jennifer T.; Dinsmore, Jannett

2013-01-01

This laboratory exercise demonstrates three different analytical forms of the polymerase chain reaction (PCR) that allow students to genotype themselves at four different loci. Here, we present protocols to allow students to a) genotype a non-coding polymorphic Variable Number of Tandem Repeat (VNTR) locus on human chromosome 5 using conventional…

Pure chromosome-specific PCR libraries from single sorted chromosomes

NARCIS (Netherlands)

VanDevanter, D. R.; Choongkittaworn, N. M.; Dyer, K. A.; Aten, J. A.; Otto, P.; Behler, C.; Bryant, E. M.; Rabinovitch, P. S.

1994-01-01

Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted

Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR)

NARCIS (Netherlands)

Ruiz-Villalba, Adrián; van Pelt-Verkuil, Elizabeth; Gunst, Quinn D.; Ruijter, Jan M.; van den Hoff, Maurice J. B.

2017-01-01

Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated

Application of polymerase chain reaction to differentiate herpes simplex virus 1 and 2 serotypes in culture negative intraocular aspirates

Directory of Open Access Journals (Sweden)

Shyamal G

2005-01-01

Full Text Available Purpose: To standardize and apply a polymerase chain reaction (PCR on the glycoprotein D gene to differentiate Herpes simplex virus (HSV 1 & 2 serotypes in culture negative intraocular specimens. Methods: Twenty-one intraocular fluids collected from 19 patients were subjected to cultures for HSV and uniplex PCR (uPCR for DNA polymerase gene. To differentiate HSV serotypes, as 1 & 2, a seminested PCR (snPCR targeting the glycoprotein D gene was standardised and applied onto 21 intraocular fluids. The specificity of the snPCR was verified by application onto ATCC strains of HSV 1 and 2, clinical isolates and DNA sequencing of the amplified products. All specimens were also tested for the presence of cytomegalovirus (CMV and varicella zoster virus (VZV by nucleic acid amplification methods. Results: Four of the 21 intraocular fluids were positive for HSV by uPCR. snPCR detected HSV in three additional specimens (total of seven specimens, and identified three as HSV 1 and four as HSV 2. DNA sequencing of PCR products showed 100% homology with the standard strains of HSV 1 and 2 respectively. None of the samples were positive in culture. Among the other patients, CMV DNA was detected in two and VZV DNA in five others. Conclusions: The standardized snPCR can be applied directly onto the culture negative specimens for rapid differentiation of HSV serotypes.

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection

Directory of Open Access Journals (Sweden)

Amanda de Faveri Pitz

2013-12-01

Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

Science.gov (United States)

Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

2011-08-01

DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

Mediator, TATA-binding protein, and RNA polymerase II contribute to low histone occupancy at active gene promoters in yeast.

Science.gov (United States)

Ansari, Suraiya A; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z; Rode, Kara A; Barber, Wesley T; Ellis, Laura C; LaPorta, Erika; Orzechowski, Amanda M; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H

2014-05-23

Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Molecular methods (digital PCR and real-time PCR) for the quantification of low copy DNA of Phytophthora nicotianae in environmental samples.

Science.gov (United States)

Blaya, Josefa; Lloret, Eva; Santísima-Trinidad, Ana B; Ros, Margarita; Pascual, Jose A

2016-04-01

Currently, real-time polymerase chain reaction (qPCR) is the technique most often used to quantify pathogen presence. Digital PCR (dPCR) is a new technique with the potential to have a substantial impact on plant pathology research owing to its reproducibility, sensitivity and low susceptibility to inhibitors. In this study, we evaluated the feasibility of using dPCR and qPCR to quantify Phytophthora nicotianae in several background matrices, including host tissues (stems and roots) and soil samples. In spite of the low dynamic range of dPCR (3 logs compared with 7 logs for qPCR), this technique proved to have very high precision applicable at very low copy numbers. The dPCR was able to detect accurately the pathogen in all type of samples in a broad concentration range. Moreover, dPCR seems to be less susceptible to inhibitors than qPCR in plant samples. Linear regression analysis showed a high correlation between the results obtained with the two techniques in soil, stem and root samples, with R(2) = 0.873, 0.999 and 0.995 respectively. These results suggest that dPCR is a promising alternative for quantifying soil-borne pathogens in environmental samples, even in early stages of the disease. © 2015 Society of Chemical Industry.

Case Report:False-negative HIV-1 polymerase chain reaction in a ...

African Journals Online (AJOL)

Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...

Validation of chimerism in pediatric recipients of allogeneic hematopoietic stem cell transplantation (HSCT) a comparison between two methods: real-time PCR (qPCR) vs. variable number tandem repeats PCR (VNTR PCR).

Science.gov (United States)

Kletzel, Morris; Huang, Wei; Olszewski, Marie; Khan, Sana

2013-01-01

Post-hematopoietic stem cell transplantation (HSCT) chimerism monitoring is important to assess relapse and therapeutic intervention. The purpose of our study is to compare two methods variable number tandem repeats (VNTR) vs. quantitative real- time polymerase chain reaction (qPCR) in terms of determining chimerism. 127 (peripheral blood n=112, bone marrow n=15) samples were simultaneously tested by VNTR using APO-B, D1S80, D1S111, D17S30, gene loci SRY and ZP3 and qPCR using 34 assays (CA001-CA034) that are designed to a bi-allelic insertion/deletion (indel) polymorphism in the human genome. Samples were separated in three subsets: total WBC, T-cell and Myeloid cells. Extraction of DNA was performed then quantified. We analyzed column statistics, paired t-test and regression analysis for both methods. There was complete correlation between the two methods. The simplicity and rapidity of the test results from the qPCR method is more efficient and accurate to assess chimerism.

DNA repair synthesis in human fibroblasts requires DNA polymerase delta

International Nuclear Information System (INIS)

Nishida, C.; Reinhard, P.; Linn, S.

1988-01-01

When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

Time Course of Detection of Human Male DNA from Stained Blood Sample on Various Surfaces by Loop Mediated Isothermal Amplification and Polymerase Chain Reaction

OpenAIRE

Panan Kanchanaphum

2018-01-01

This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP), and LAMP-Lateral Flow Dipstick (LFD). For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, w...

Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges

Science.gov (United States)

Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

2016-01-01

Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR. PMID:27956830

Utility of loop-mediated isothermal amplification assay, polymerase chain reaction, and elisa for diagnosis of leptospirosis in South Indian patients

Directory of Open Access Journals (Sweden)

Mallika Sengupta

2017-01-01

Full Text Available Background: Leptospirosis is a zoonotic disease which requires laboratory diagnosis for confirmation. Materials and Methods: In this study serum samples from adults with acute undifferentiated fever (duration ≤15 days were tested for IgM antibodies to Leptospira by ELISA, PCR for rrs gene and loop-mediated isothermal amplification (LAMP assay for LipL32 and LipL41. Results: Among the 150 sera tested, three were positive by PCR, LAMP and IgM ELISA/modified Faines' criteria, two by only PCR; seven only by LAMP assay and forty fulfilled modified Faine's criteria (illness clinically compatible and IgM ELISA positive for leptospirosis. Clinical correlation revealed renal compromise, low platelet count and severe jaundice were significantly related to leptospirosis (P < 0.05. Conclusion: This study suggests that LAMP assay could be useful for diagnosis of leptospirosis during the 1st week of illness whereas IgM ELISA forms the mainstay of diagnosis from the 2nd week onward. Further studies especially community based, comparing ELISA, PCR, LAMP, culture and microscopic agglutination test are required to evaluate the veracity of these findings.

Evaluation of a Solid Phase DNA Binding Matrix for Downstream PCR Analysis

National Research Council Canada - National Science Library

Bader, Douglas E; Fisher, Glen R; Stratilo, Chad W

2005-01-01

A commercially available solid-phase DNA binding matrix (FTA cards) was evaluated for its ability to capture and release DNA for downstream gene amplification and detection assays using polymerase chain reaction (PCR...

Early detection of typhoid by polymerase chain reaction

International Nuclear Information System (INIS)

Haque, A.; Qureshi, Javed A.; Ahmed, J.

1999-01-01

Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

Comparison of LAMP and PCR for molecular mass screening of sand flies for Leishmania martiniquensis infection.

Science.gov (United States)

Tiwananthagorn, Saruda; Kato, Hirotomo; Yeewa, Ranchana; Muengpan, Amontip; Polseela, Raxsina; Leelayoova, Saovanee

2017-02-01

Leishmaniasis caused by Leishmania martiniquensis infection has been reported in human and domestic animals of Martinique Island, Germany, Switzerland, USA, Myanmar and Thailand. The peculiar clinical features of disseminated cutaneous and visceral forms co-existence render the urgent need of specific diagnostic tool to identify the natural sand fly vectors for effective prevention and control strategies. Loop-mediated isothermal amplification (LAMP) of 18S rRNA gene as well as polymerase chain reaction (PCR) of minicircle kinetoplast DNA gene (PCR-mkDNA) have never been applied to detect L. martiniquensis and L. siamensis in sand fly vectors. The present study was aimed to validate malachite green-LAMP (MG-LAMP) and PCR-mkDNA techniques to detect L. martiniquensis in sand fly vectors, compared with the conventional PCR of internal transcribed spacer 1 (PCR-ITS1). We compared the validity of LAMP of 18S rRNA gene and PCR-mkDNA, to PCR-ITS1 in simulation model of L. martiniquensis infection in Sergentomyia gemmea sand flies. Attributable to the sensitivity and specificity, PCR-mkDNA was consecutively applied to detect L. martiniquensis in 380 female sand fly individuals captured in the newly identified affected region of Lamphun Province, Thailand. Results showed that PCR-mkDNA could detect at least one promastigote per sand fly, which was 10-time superior to LAMP and PCR-ITS1. In addition, PCR-mkDNA was more specific, able to differentiate L. martiniquensis from other viscerotropic Leishmania species, such as L. siamensis, L. (L.) donovani, and L. (L.) infantum. Consecutively, mass screening of L. martiniquensis in 380 female sand fly individuals by PCR-mkDNA was implemented in a new affected area of Thailand where a patient with leishmaniasis/HIV co-infection resides; however Leishmania DNA was undetected. In conclusion, PCR-mkDNA is a promising tool for molecular mass screening of L. martiniquensis infection in outbreak areas where several species of Leishmania

Comparison of LAMP and PCR for molecular mass screening of sand flies for Leishmania martiniquensis infection

Science.gov (United States)

Tiwananthagorn, Saruda; Kato, Hirotomo; Yeewa, Ranchana; Muengpan, Amontip; Polseela, Raxsina; Leelayoova, Saovanee

2017-01-01

BACKGROUND Leishmaniasis caused by Leishmania martiniquensis infection has been reported in human and domestic animals of Martinique Island, Germany, Switzerland, USA, Myanmar and Thailand. The peculiar clinical features of disseminated cutaneous and visceral forms co-existence render the urgent need of specific diagnostic tool to identify the natural sand fly vectors for effective prevention and control strategies. Loop-mediated isothermal amplification (LAMP) of 18S rRNA gene as well as polymerase chain reaction (PCR) of minicircle kinetoplast DNA gene (PCR-mkDNA) have never been applied to detect L. martiniquensis and L. siamensis in sand fly vectors. OBJECTIVE The present study was aimed to validate malachite green-LAMP (MG-LAMP) and PCR-mkDNA techniques to detect L. martiniquensis in sand fly vectors, compared with the conventional PCR of internal transcribed spacer 1 (PCR-ITS1). METHODS We compared the validity of LAMP of 18S rRNA gene and PCR-mkDNA, to PCR-ITS1 in simulation model of L. martiniquensis infection in Sergentomyia gemmea sand flies. Attributable to the sensitivity and specificity, PCR-mkDNA was consecutively applied to detect L. martiniquensis in 380 female sand fly individuals captured in the newly identified affected region of Lamphun Province, Thailand. FINDINGS AND MAIN CONCLUSIONS Results showed that PCR-mkDNA could detect at least one promastigote per sand fly, which was 10-time superior to LAMP and PCR-ITS1. In addition, PCR-mkDNA was more specific, able to differentiate L. martiniquensis from other viscerotropic Leishmania species, such as L. siamensis, L. (L.) donovani, and L. (L.) infantum. Consecutively, mass screening of L. martiniquensis in 380 female sand fly individuals by PCR-mkDNA was implemented in a new affected area of Thailand where a patient with leishmaniasis/HIV co-infection resides; however Leishmania DNA was undetected. In conclusion, PCR-mkDNA is a promising tool for molecular mass screening of L. martiniquensis

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

Science.gov (United States)

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

Phosphorylation of ETS-1 is a critical event in DNA polymerase iota-induced invasion and metastasis of esophageal squamous cell carcinoma.

Science.gov (United States)

He, Chao; Wu, Shuhua; Gao, Aidi; Su, Ye; Min, Han; Shang, Zeng-Fu; Wu, Jinchang; Yang, Li; Ding, Wei-Qun; Zhou, Jundong

2017-12-01

An aberrantly elevated expression of DNA polymerase ι (Pol ι) is significantly associated with poor prognosis of patients with esophageal squamous cell carcinoma (ESCC), yet the mechanisms behind this phenomenon remain obscure. Based on the RNA-Seq transcriptome and real-time PCR analysis, we identified ETS-1 as a candidate gene involved in Pol ι-mediated progression of ESCC. Wound-healing and transwell assay indicated that downregulation of ETS-1 attenuates Pol ι-mediated invasiveness of ESCC. Signaling pathway analysis showed that Pol ι enhances ETS-1 phosphorylation at threonine-38 through the Erk signaling pathway in ESCC cells. Kaplan-Meier analysis, based on 93 clinical tissue samples, revealed that ETS-1 phosphorylation at threonine-38 is associated with poor prognosis of ESCC patients. The present study thus demonstrates that phosphorylation of ETS-1 is a critical event in the Pol ι-induced invasion and metastasis of ESCC. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Signal-off Electrochemiluminescence Biosensor Based on Phi29 DNA Polymerase Mediated Strand Displacement Amplification for MicroRNA Detection.

Science.gov (United States)

Chen, Anyi; Gui, Guo-Feng; Zhuo, Ying; Chai, Ya-Qin; Xiang, Yun; Yuan, Ruo

2015-06-16

A target induced cycling strand displacement amplification (SDA) mediated by phi29 DNA polymerase (phi29) was first investigated and applied in a signal-off electrochemiluminescence (ECL) biosensor for microRNA (miRNA) detection. Herein, the target miRNA triggered the phi29-mediated SDA which could produce amounts of single-stranded DNA (assistant probe) with accurate and comprehensive nucleotide sequence. Then, the assistant probe hybridized with the capture probe and the ferrocene-labeled probe (Fc-probe) to form a ternary "Y" structure for ECL signal quenching by ferrocene. Therefore, the ECL intensity would decrease with increasing concentration of the target miRNA, and the sensitivity of biosensor would be promoted on account of the efficient signal amplification of the target induced cycling reaction. Besides, a self-enhanced Ru(II) ECL system was designed to obtain a stable and strong initial signal to further improve the sensitivity. The ECL assay for miRNA-21 detection is developed with excellent sensitivity of a concentration variation from 10 aM to 1.0 pM and limit of detection down to 3.3 aM.

Application and evaluation of RT-PCR-ELISA for the nucleoprotein and RT-PCR for detection of low-pathogenic H5 and H7 subtypes of avian influenza virus

DEFF Research Database (Denmark)

Dybkær, Karen; Munch, Mette; Handberg, Kurt J.

2004-01-01

Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...

PCR cycles above routine numbers do not compromise high-throughput DNA barcoding results.

Science.gov (United States)

Vierna, J; Doña, J; Vizcaíno, A; Serrano, D; Jovani, R

2017-10-01

High-throughput DNA barcoding has become essential in ecology and evolution, but some technical questions still remain. Increasing the number of PCR cycles above the routine 20-30 cycles is a common practice when working with old-type specimens, which provide little amounts of DNA, or when facing annealing issues with the primers. However, increasing the number of cycles can raise the number of artificial mutations due to polymerase errors. In this work, we sequenced 20 COI libraries in the Illumina MiSeq platform. Libraries were prepared with 40, 45, 50, 55, and 60 PCR cycles from four individuals belonging to four species of four genera of cephalopods. We found no relationship between the number of PCR cycles and the number of mutations despite using a nonproofreading polymerase. Moreover, even when using a high number of PCR cycles, the resulting number of mutations was low enough not to be an issue in the context of high-throughput DNA barcoding (but may still remain an issue in DNA metabarcoding due to chimera formation). We conclude that the common practice of increasing the number of PCR cycles should not negatively impact the outcome of a high-throughput DNA barcoding study in terms of the occurrence of point mutations.

Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR

Directory of Open Access Journals (Sweden)

Nagorsen Dirk

2003-12-01

Full Text Available Abstract The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV and Influenza (Flu, were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ, Interleukin-2 (IL-2, Interleukin-4 (IL-4, and Interleukin-10 (IL-10. We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization.

Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR)

Science.gov (United States)

Provenzano, Maurizio; Mocellin, Simone; Bonginelli, Paola; Nagorsen, Dirk; Kwon, Seog-Woon; Stroncek, David

2003-01-01

The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA) polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs) from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV) and Influenza (Flu), were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR) was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ), Interleukin-2 (IL-2), Interleukin-4 (IL-4), and Interleukin-10 (IL-10). We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization. PMID:14675481

Whole blood Nested PCR and Real-time PCR amplification of Talaromyces marneffei specific DNA for diagnosis.

Science.gov (United States)

Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan

2016-02-01

Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A Highly Sensitive Telomerase Activity Assay that Eliminates False-Negative Results Caused by PCR Inhibitors

Directory of Open Access Journals (Sweden)

Hidenobu Yaku

2013-09-01

Full Text Available An assay for telomerase activity based on asymmetric polymerase chain reaction (A-PCR on magnetic beads (MBs and subsequent application of cycling probe technology (CPT is described. In this assay, the telomerase reaction products are immobilized on MBs, which are then washed to remove PCR inhibitors that are commonly found in clinical samples. The guanine-rich sequences (5'-(TTAGGGn-3' of the telomerase reaction products are then preferentially amplified by A-PCR, and the amplified products are subsequently detected via CPT, where a probe RNA with a fluorophore at the 5' end and a quencher at the 3' end is hydrolyzed by RNase H in the presence of the target DNA. The catalyst-mediated cleavage of the probe RNA enhances fluorescence from the 5' end of the probe. The assay allowed us to successfully detect HeLa cells selectively over normal human dermal fibroblast (NHDF cells. Importantly, this selectivity produced identical results with regard to detection of HeLa cells in the absence and presence of excess NHDF cells; therefore, this assay can be used for practical clinical applications. The lower limit of detection for HeLa cells was 50 cells, which is lower than that achieved with a conventional telomeric repeat amplification protocol assay. Our assay also eliminated false-negative results caused by PCR inhibitors. Furthermore, we show that this assay is appropriate for screening among G-quadruplex ligands to find those that inhibit telomerase activity.

Typing of Y chromosome SNPs with multiplex PCR methods

DEFF Research Database (Denmark)

Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

2005-01-01

We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....

False-negative HIV-1 polymerase chain reaction in a 15-month-old ...

African Journals Online (AJOL)

Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.

Science.gov (United States)

Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S

2010-03-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

Science.gov (United States)

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Critical analysis: use of polymerase chain reaction to diagnose leprosy

Directory of Open Access Journals (Sweden)

Flaviane Granero Maltempe

Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.

Development of the polymerase chain reaction for diagnosis of chancroid.

Science.gov (United States)

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

Loop-Mediated Isothermal Amplification untuk Mendeteksi Gen blaTEM sebagai Penyandi Extended-Spectrum Beta-Lactamase pada Isolat Enterobacteriaceae

Directory of Open Access Journals (Sweden)

Bayu A. P. Wilopo

2015-12-01

Full Text Available Extended-spectrum beta-lactamase (ESBL is a beta-lactamase enzyme that is capable of hydrolyzing penicillin, cephalosporin, and monobactam, and can be inhibited by clavulanic acid. This enzyme is encoded by multiple genes, one of them is blaTEM. Polymerase chain reaction (PCR is one of the DNA amplification methods that are frequently used; however, there are other methods that can be used including, among others, loop-mediated isothermal amplification (LAMP. LAMP requires simple equipment with quicker and easy-to-read results compared to PCR. This study was a diagnostic test to explore the sensitivity and specificity of LAMP method compared to PCR in detecting blaTEM gene. Furthermore, the concordance between LAMP and PCR methods was assessed. A total of 92 Enterobacteriaceae isolates were examined by PCR and LAMP methods and compared. The result showed that the LAMP method had a sensitivity of 91.4% and a specificity of 91.2% with a concordance value (kappa of 85.4%. In conclusion, LAMP method has a good validity and a very good conformity compared to the PCR method. Therefore, LAMP method can be used as an alternative diagnostic test, especially in limited settings.

RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

DEFF Research Database (Denmark)

Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

2003-01-01

A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

Single base pair mutation analysis by PNA directed PCR clamping

DEFF Research Database (Denmark)

Ørum, H.; Nielsen, P.E.; Egholm, M.

1993-01-01

A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

Directory of Open Access Journals (Sweden)

Karolina Stojowska

Full Text Available We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s, while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR, whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR. The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

Science.gov (United States)

Stojowska, Karolina; Krawczyk, Beata

2014-01-01

We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

Science.gov (United States)

Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

2001-07-01

Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

Energy Technology Data Exchange (ETDEWEB)

Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.

2017-10-31

Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.

The quantification of spermatozoa by real-time quantitative PCR, spectrophotometry, and spermatophore cap size.

Science.gov (United States)

Doyle, Jacqueline M; McCormick, Cory R; DeWoody, J Andrew

2011-01-01

Many animals, such as crustaceans, insects, and salamanders, package their sperm into spermatophores, and the number of spermatozoa contained in a spermatophore is relevant to studies of sexual selection and sperm competition. We used two molecular methods, real-time quantitative polymerase chain reaction (RT-qPCR) and spectrophotometry, to estimate sperm numbers from spermatophores. First, we designed gene-specific primers that produced a single amplicon in four species of ambystomatid salamanders. A standard curve generated from cloned amplicons revealed a strong positive relationship between template DNA quantity and cycle threshold, suggesting that RT-qPCR could be used to quantify sperm in a given sample. We then extracted DNA from multiple Ambystoma maculatum spermatophores, performed RT-qPCR on each sample, and estimated template copy numbers (i.e. sperm number) using the standard curve. Second, we used spectrophotometry to determine the number of sperm per spermatophore by measuring DNA concentration relative to the genome size. We documented a significant positive relationship between the estimates of sperm number based on RT-qPCR and those based on spectrophotometry. When these molecular estimates were compared to spermatophore cap size, which in principle could predict the number of sperm contained in the spermatophore, we also found a significant positive relationship between sperm number and spermatophore cap size. This linear model allows estimates of sperm number strictly from cap size, an approach which could greatly simplify the estimation of sperm number in future studies. These methods may help explain variation in fertilization success where sperm competition is mediated by sperm quantity. © 2010 Blackwell Publishing Ltd.

DNA repair in DNA-polymerase-deficient mutants of Escherichia coli

International Nuclear Information System (INIS)

Smith, D.W.; Tait, R.C.; Harris, A.L.

1975-01-01

Escherichia coli mutants deficient in DNA polymerase I, in DNA polymerases I and II, or in DNA polymerase III can efficiently and completely execute excision-repair and postreplication repair of the uv-damaged DNA at 30 0 C and 43 0 C when assayed by alkaline sucrose gradients. Repair by Pol I - and Pol I - , Pol II - cells is inhibited by 1-β-D-arabinofuranosylcytosine (araC) at 43 0 C but not at 30 0 C, whereas that by Pol III - cells is insensitive to araC at any temperature. Thus, either Pol I or Pol III is required for complete and efficient repair, and in their absence Pol II mediates a limited, incomplete dark repair of uv-damaged DNA

Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

Directory of Open Access Journals (Sweden)

W. Ali

2017-06-01

Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

Science.gov (United States)

Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

2011-01-01

It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

UVB DNA dosimeters analyzed by polymerase chain reactors

International Nuclear Information System (INIS)

Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL

1997-01-01

Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)

A PCR-based method for identification of bifidobacteria from the human alimentary tract at the species level

NARCIS (Netherlands)

Venema, K.; Maathuis, A.J.H.

2003-01-01

A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12

Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

Directory of Open Access Journals (Sweden)

Daniela Camargos Costa

2014-02-01

Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

Science.gov (United States)

Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

2015-01-01

The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

DEFF Research Database (Denmark)

Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper

2007-01-01

OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...

Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

Directory of Open Access Journals (Sweden)

Anupam Berwal

2017-01-01

Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains

Directory of Open Access Journals (Sweden)

Nowak Magdalena

2009-11-01

Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.

Detection of Aspergillus flavus and A. fumigatus in Bronchoalveolar Lavage Specimens of Hematopoietic Stem Cell Transplants and Hematological Malignancies Patients by Real-Time Polymerase Chain Reaction, Nested PCR and Mycological Assays

Science.gov (United States)

Zarrinfar, Hossein; Mirhendi, Hossein; Fata, Abdolmajid; Khodadadi, Hossein; Kordbacheh, Parivash

2015-01-01

Background: Pulmonary aspergillosis (PA) is one of the most serious complications in immunocompromised patients, in particular among hematopoietic stem cell transplants (HSCT) and patients with hematological malignancies. Objectives: The current study aimed to evaluate the incidence of PA and utility of molecular methods in HSCT and patients with hematological malignancies, four methods including direct examination, culture, nested polymerase chain reaction (PCR) and real-time PCR were performed on bronchoalveolar lavage (BAL) specimens in Tehran, Iran. Patients and Methods: During 16 months, 46 BAL specimens were obtained from individuals with allogeneic HSCT (n = 18) and patients with hematological malignancies (n = 28). Direct wet mounts with 20% potassium hydroxide (KOH) and culture on mycological media were performed. The molecular detection of Aspergillus fumigatus and A. flavus was done by amplifying the conserved sequences of internal transcribed spacer 1 (ITS1) ribosomal DNA by nested-PCR and the β-tubulin gene by TaqMan real-time PCR. Results: Seven (15.2%) out of 46 specimens were positive in direct examination and showed branched septate hyphae; 11 (23.9%) had positive culture including eight (72.7%) A. flavus and three (27.3%) A. fumigatus; 22 (47.8%) had positive nested-PCR and eight (17.4%) had positive real-time PCR. The incidence of invasive pulmonary aspergillosis (IPA) in these patients included proven IPA in 1 (2.2%), probable IPA in 10 (21.7%), possible IPA in 19 (41.3%) and not IPA in 16 cases (34.8%). Conclusions: The incidence of IPA in allogeneic HSCT and patients with hematological malignancies was relatively high and A. flavus was the most common cause of PA. As molecular methods had higher sensitivity, it may be useful as screening methods in HSCT and patients with hematological malignancies, or to determine when empirical antifungal therapy can be withheld. PMID:25763133

Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

NARCIS (Netherlands)

Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

1999-01-01

Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

A primer on on-demand polymerase chain reaction technology.

Science.gov (United States)

Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

2015-10-01

Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

DEFF Research Database (Denmark)

Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

2017-01-01

, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

Directory of Open Access Journals (Sweden)

JANNOTTI-PASSOS Liana Konovaloff

2000-01-01

Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

Poly(ADP-ribose) polymerase-independent potentiation of nitrosourea cytotoxicity by 3-aminobenzamide in human malignant glioma cells.

Science.gov (United States)

Winter, S; Weller, M

2000-06-16

Poly(ADP-ribose) polymerase is a zinc-finger DNA-binding protein that detects specifically DNA strand breaks generated by genotoxic agents and is thought to be involved in DNA repair. Here, we examined the effects of 3-aminobenzamide, a poly(ADP-ribose) polymerase inhibitor, on the chemosensitivity of human malignant glioma cells. 3-Aminobenzamide selectively potentiated the cytotoxicity of the nitrosoureas, nimustine, carmustine and lomustine in 10 of 12 human malignant glioma cell lines. In contrast, 3-aminobenzamide did not modulate the cytotoxic effects of doxorubicine, teniposide, vincristine, camptothecin or cytarabine. The nitrosoureas did not induce poly(ADP-ribose) polymerase activity in the glioma cells. Ectopic expression of truncated poly(ADP-ribose) polymerase containing the poly(ADP-ribose) polymerase DNA-binding domain, which acts as a dominant-negative mutant, in LN-18 or LN-229 cells did not alter the 3-aminobenzamide effect on nitrosourea-mediated cytotoxicity. Thus, 3-aminobenzamide may target another nicotinamide adenine dinucleotide (NAD)-requiring enzyme, but not poly(ADP-ribose) polymerase, when enhancing nitrosourea cytotoxicity in human malignant glioma cells. Carmustine cytotoxicity was associated with a G2/M arrest. Coexposure to carmustine and 3-aminobenzamide overcame this G2/M arrest in T98G cells, which are sensitized to carmustine by 3-aminobenzamide, but not in U251MG cells, which are refractory to 3-aminobenzamide-mediated sensitization to carmustine. Thus, 3-aminobenzamide-mediated sensitization to carmustine cytotoxicity may result from interference with the stable G2/M arrest response to carmustine in human glioma cells.

Water Bridging Dynamics of Polymerase Chain Reaction in the Gauge Theory Paradigm of Quantum Fields

Directory of Open Access Journals (Sweden)

L. Montagnier

2017-05-01

Full Text Available We discuss the role of water bridging the DNA-enzyme interaction by resorting to recent results showing that London dispersion forces between delocalized electrons of base pairs of DNA are responsible for the formation of dipole modes that can be recognized by Taq polymerase. We describe the dynamic origin of the high efficiency and precise targeting of Taq activity in PCR. The spatiotemporal distribution of interaction couplings, frequencies, amplitudes, and phase modulations comprise a pattern of fields which constitutes the electromagnetic image of DNA in the surrounding water, which is what the polymerase enzyme actually recognizes in the DNA water environment. The experimental realization of PCR amplification, achieved through replacement of the DNA template by the treatment of pure water with electromagnetic signals recorded from viral and bacterial DNA solutions, is found consistent with the gauge theory paradigm of quantum fields.

Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus

DEFF Research Database (Denmark)

Dukes, J.P.; King, D.P.; Alexandersen, Søren

2006-01-01

Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour...... in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV...... vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan (R) assay, RT-LAMP appears...

Comparison between Radioisotopic and Non-radioisotopic Polymerase Chain Reaction-Single Strand Conformation Polymorphism (PCR-SSCP) Procedures in the Detection of Mutations at the rpoB Gene Associated with Rifampicin Resistance in Mycobacterium tuberculosis

International Nuclear Information System (INIS)

Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr

2006-01-01

Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB

Quantification of algal endosymbionts (Symbiodinium) in coral tissue using real-time PCR

NARCIS (Netherlands)

Mieog, J. C.; Van Oppen, M. J. H.; Berkelmans, R.; Stam, W. T.; Olsen, J. L.

Understanding the flexibility of the endosymbioses between scleractinian corals and single-cell algae of the genus Symbiodinium will provide valuable insights into the future of coral reefs. Here, a real-time polymerase chain reaction (PCR) assay is presented to accurately determine the cell

Portable low-power thermal cycler with dual thin-film Pt heaters for a polymeric PCR chip.

Science.gov (United States)

Jeong, Sangdo; Lim, Juhun; Kim, Mi-Young; Yeom, JiHye; Cho, Hyunmin; Lee, Hyunjung; Shin, Yong-Beom; Lee, Jong-Hyun

2018-01-29

Polymerase chain reaction (PCR) has been widely used for major definite diagnostic tool, but very limited its place used only indoor such as hospital or diagnosis lab. For the rapid on-site detection of pathogen in an outdoor environment, a low-power cordless polymerase chain reaction (PCR) thermal cycler is crucial module. At this point of view, we proposed a low-power PCR thermal cycler that could be operated in an outdoor anywhere. The disposable PCR chip was made of a polymeric (PI/PET) film to reduce the thermal mass. A dual arrangement of the Pt heaters, which were positioned on the top and bottom of the PCR chip, improved the temperature uniformity. The temperature sensor, which was made of the same material as the heater, utilized the temperature dependence of the Pt resistor to ensure simple fabrication of the temperature sensor. Cooling the PCR chip using dual blower fans enabled thermal cycling to operate with a lower power than that of a Peltier element with a high power consumption. The PCR components were electrically connected to a control module that could be operated with a Li-ion battery (12 V), and the PCR conditions (temperature, time, cycle, etc.) were inputted on a touch screen. For 30 PCR cycles, the accumulated power consumption of heating and cooling was 7.3 Wh, which is easily available from a compact battery. Escherichia coli genomic DNA (510 bp) was amplified using the proposed PCR thermal cycler and the disposable PCR chip. A similar DNA amplification capability was confirmed using the proposed portable and low-power thermal cycler compared with a conventional thermal cycler.

HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

DEFF Research Database (Denmark)

Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

1992-01-01

We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

A high-throughput pipeline for the design of real-time PCR signatures

Directory of Open Access Journals (Sweden)

Reifman Jaques

2010-06-01

Full Text Available Abstract Background Pathogen diagnostic assays based on polymerase chain reaction (PCR technology provide high sensitivity and specificity. However, the design of these diagnostic assays is computationally intensive, requiring high-throughput methods to identify unique PCR signatures in the presence of an ever increasing availability of sequenced genomes. Results We present the Tool for PCR Signature Identification (TOPSI, a high-performance computing pipeline for the design of PCR-based pathogen diagnostic assays. The TOPSI pipeline efficiently designs PCR signatures common to multiple bacterial genomes by obtaining the shared regions through pairwise alignments between the input genomes. TOPSI successfully designed PCR signatures common to 18 Staphylococcus aureus genomes in less than 14 hours using 98 cores on a high-performance computing system. Conclusions TOPSI is a computationally efficient, fully integrated tool for high-throughput design of PCR signatures common to multiple bacterial genomes. TOPSI is freely available for download at http://www.bhsai.org/downloads/topsi.tar.gz.

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

Science.gov (United States)

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

Detection of Hepatitis B Virus (HBV) in Blood Serum By Means of PCR (Polymerase Chain Reaction) Technique

International Nuclear Information System (INIS)

Lina, M.; Dadang, S.; Suhadi, F.

2002-01-01

Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer

Genetic variability and discrimination of low doses of Toxocara spp. from public areas soil inferred by loop-mediated isothermal amplification assay as a field-friendly molecular tool

OpenAIRE

Ozlati, Maryam; Spotin, Adel; Shahbazi, Abbas; Mahami-Oskouei, Mahmoud; Hazratian, Teimour; Adibpor, Mohammad; Ahmadpour, Ehsan; Dolatkhah, Afsaneh; Khoshakhlagh, Paria

2016-01-01

Abstract: Aim: One of the main diagnostic problems of conventional polymerase chain reaction (PCR) is indiscrimination of low parasitic loads in soil samples. The aim of this study is to determine the genetic diversity and identification of Toxocara spp. from public areas soil inferred by loop-mediated isothermal amplification (LAMP) assay. Materials and Methods: A total of 180 soil samples were collected from various streets and public parks of northwest Iran. The DNA of recovered Toxocara e...

Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Radji, M.

2010-01-01

Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

Sexagem de embriões bovinos fecundados in vitro pela técnica de PCR multiplex

Directory of Open Access Journals (Sweden)

Marcelo Rezende Luz

2000-12-01

Full Text Available In the present study the polymerase chain reaction (PCR was used for sexing ninety-two in vitro fertilized bovine embryos. The embryos were obtained after in vitro fertilization of oocytes from slaughterhouses. The oocytes were matured, fertilized, and cultured until the blastocyst stage. The embryos were washed in PBS solution, and transferred to polypropylene tubes with containing ultrapure water and immediately frozen at -196ºC. The embryos were thawed on ice and treated with proteinase K. For the PCR reaction, aliquots of 34 µl from each tube were mixed to the primers BC1.2 and microsatellite sequence 1715, dNTPs, MgCl2, 10X PCR buffer, Taq DNA polymerase and water in a final volume of 50 µl. The samples were amplified and the PCR products separated by electrophoresis in a 8% polyacrylamide gel. The gels were stained in ethidium bromide solution and vizualized under UV-light. The amplification rate was 93.47%, with 41 (47.67% male embryos and 45 (52.32% female embryos. The use of 8% polyacrylamide gel was efficient for separating DNA fragments of very similar size.

Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.

Science.gov (United States)

Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François

2010-04-01

To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.

[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

Science.gov (United States)

Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

2015-01-01

Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

Science.gov (United States)

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-06-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

Comparison of a conventional and nested PCR for diagnostic confirmation and genotyping of Orientia tsutsugamushi.

Science.gov (United States)

Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M

2014-05-01

A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.

Polymerase matters: non-proofreading enzymes inflate fungal community richness estimates by up to 15 %

Science.gov (United States)

Alena K. Oliver; Shawn P. Brown; Mac A. Callaham; Ari Jumpponen

2015-01-01

Rare taxa overwhelm metabarcoding data generated using next-generation sequencing (NGS). Low frequency Operational Taxonomic Units (OTUs) may be artifacts generated by PCR-amplification errors resulting from polymerase mispairing. We analyzed two Internal Transcribed Spacer 2 (ITS2) MiSeq libraries generated with proofreading (ThermoScientific Phusion

Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

NARCIS (Netherlands)

Hatta, Mochammad; Smits, Henk L.

2007-01-01

A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

DEFF Research Database (Denmark)

Høie, S.; Dalsgaard, Inger; Aase, I.L.

1999-01-01

. salmonicida subsp. salmonicida isolates tested, belonged to group 1. The PCR primer-sets separated A. salmonicida from other reference strains of Aeromonas species and related bacteria with the exception of Aeromonas hydrophila. The results indicated that PCR typing is a useful framework for characterization...

Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

OpenAIRE

Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

1993-01-01

Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

Polymerase chain reaction fingerprints of methicillin-resistant Staphylococcus aureus clinical isolates in Greece are related to certain antibiotypes.

Science.gov (United States)

Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris

2003-06-01

Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.

Differentiation of bacterial feeding nematodes in soil ecological studies by means of arbitrarily primed PCR

Science.gov (United States)

Van Der Knaap, Esther; Rodriguez, Russell J.; Freckman, Diana W.

1993-01-01

Arbitrarily-primed polymerase chain reaction (ap-PCR) was used to differentiate closely related bacterial-feeding nematodes of the genera: Caenorhabditis, Acrobeloides, Cephalobus and Zeldia. Average percentage similarity of bands generated by ap-PCR with seven different primers between 14 isolates of Caenorhabditis elegans was ⪢ 90%, whereas between C. elegans, C. briggsae and C. remanei similarity was nematode populations were also obtained from ap-PCR analysis of single worms. Due to the difficulty of identification of soil nematodes, the ap-PCR offers potential as a rapid and reliable technique to assess biodiversity. Ap-PCR will make it feasible, for the first time, to study the ecological interactions of unique nematode genotypes in soil habitats.

Powerful strategy for polymerase chain reaction-based clonality assessment in T-cell malignancies Report of the BIOMED-2 Concerted Action BHM4 CT98-3936

NARCIS (Netherlands)

Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.

2007-01-01

Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.

A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

Science.gov (United States)

Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

Evaluation of the polymerase chain reaction in the diagnosis of cutaneous leishmaniasis due to Leishmania major: a comparison with direct microscopy of smears and sections from lesions

DEFF Research Database (Denmark)

Andresen, K; Gaafar, A; El-Hassan, A M

1996-01-01

We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....

MEDIATOR18 and MEDIATOR20 confer susceptibility to Fusarium oxysporum in Arabidopsis thaliana

OpenAIRE

Fallath, Thorya; Kidd, Brendan N.; Stiller, Jiri; Davoine, Celine; Bj?rklund, Stefan; Manners, John M.; Kazan, Kemal; Schenk, Peer M.

2017-01-01

The conserved protein complex known as Mediator conveys transcriptional signals by acting as an intermediary between transcription factors and RNA polymerase II. As a result, Mediator subunits play multiple roles in regulating developmental as well as abiotic and biotic stress pathways. In this report we identify the head domain subunits MEDIATOR18 and MEDIATOR20 as important susceptibility factors for Fusarium oxysporum infection in Arabidopsis thaliana. Mutants of MED18 and MED20 display do...

DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

Directory of Open Access Journals (Sweden)

Elena K Braithwaite

2010-08-01

Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

Science.gov (United States)

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Helicobacter-negative gastritis: polymerase chain reaction for Helicobacter DNA is a valuable tool to elucidate the diagnosis.

Science.gov (United States)

Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G

2016-04-01

Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P gastritis. © 2016 John Wiley & Sons Ltd.

A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.

Directory of Open Access Journals (Sweden)

Grace Wong

Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular

PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

Science.gov (United States)

Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

2009-01-01

Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique

Science.gov (United States)

Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah

2018-04-01

The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

Science.gov (United States)

Suo, Zucai

2014-01-01

Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

Development of a Rapid Detection Method for Potato virus X by Reverse Transcription Loop-Mediated Isothermal Amplification

Directory of Open Access Journals (Sweden)

Joojin Jeong

2015-09-01

Full Text Available The primary step for efficient control of viral diseases is the development of simple, rapid, and sensitive virus detection. Reverse transcription loop-mediated isothermal amplification (RT-LAMP has been used to detect viral RNA molecules because of its simplicity and high sensitivity for a number of viruses. RT-LAMP for the detection of Potato virus X (PVX was developed and compared with conventional reverse transcription polymerase chain reaction (RT-PCR to demonstrate its advantages over RT-PCR. RT-LAMP reactions were conducted with or without a set of loop primers since one out of six primers showed PVX specificity. Based on real-time monitoring, RT-LAMP detected PVX around 30 min, compared to 120 min for RT-PCR. By adding a fluorescent reagent during the reaction, the extra step of visualization by gel electrophoresis was not necessary. RT-LAMP was conducted using simple inexpensive instruments and a regular incubator to evaluate whether RNA could be amplified at a constant temperature instead of using an expensive thermal cycler. This study shows the potential of RT-LAMP for the diagnosis of viral diseases and PVX epidemiology because of its simplicity and rapidness compared to RT-PCR.

Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

Directory of Open Access Journals (Sweden)

Vlademir Cantarelli

2011-10-01

Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

Fast detection of genetic information by an optimized PCR in an interchangeable chip.

KAUST Repository

Wu, Jinbo

2012-02-01

In this paper, we report the construction of a polymerase chain reaction (PCR) device for fast amplification and detection of DNA. This device consists of an interchangeable PCR chamber, a temperature control component as well as an optical detection system. The DNA amplification happens on an interchangeable chip with the volumes as low as 1.25 μl, while the heating and cooling rate was as fast as 12.7°C/second ensuring that the total time needed of only 25 min to complete the 35 cycle PCR amplification. An optimized PCR with two-temperature approach for denaturing and annealing (Td and Ta) of DNA was also formulated with the PCR chip, with which the amplification of male-specific sex determining region Y (SRY) gene marker by utilizing raw saliva was successfully achieved and the genetic identification was in-situ detected right after PCR by the optical detection system.

Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

Science.gov (United States)

Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

2016-05-01

In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

DEFF Research Database (Denmark)

Skøt, J; Lerche, A G; Kolmos, H J

1995-01-01

was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

Simulation and experimental validation of a SU-8 based PCR thermocycler chip with integrated heaters and temperature sensor

DEFF Research Database (Denmark)

El-Ali, Jamil; Perch-Nielsen, Ivan R.; Poulsen, Claus Riber

2004-01-01

We present a SU-8 based polymerase chain reaction (PCR) chip with integrated platinum thin film heaters and temperature sensor. The device is fabricated in SU-8 on a glass substrate. The use of SU-8 provides a simple microfabrication process for the PCR chamber, controllable surface properties......C/s, respectively, the performance of the chip is comparable with the best silicon micromachined PCR chips presented in the literature. The SU-8 chamber surface was found to be PCR compatible by amplification of yeast gene ribosomal protein S3 and Campylobacter gene cadF. The PCR compatibility of the chamber...

Quantitative analysis of food and feed samples with droplet digital PCR.

Directory of Open Access Journals (Sweden)

Dany Morisset

Full Text Available In this study, the applicability of droplet digital PCR (ddPCR for routine analysis in food and feed samples was demonstrated with the quantification of genetically modified organisms (GMOs. Real-time quantitative polymerase chain reaction (qPCR is currently used for quantitative molecular analysis of the presence of GMOs in products. However, its use is limited for detecting and quantifying very small numbers of DNA targets, as in some complex food and feed matrices. Using ddPCR duplex assay, we have measured the absolute numbers of MON810 transgene and hmg maize reference gene copies in DNA samples. Key performance parameters of the assay were determined. The ddPCR system is shown to offer precise absolute and relative quantification of targets, without the need for calibration curves. The sensitivity (five target DNA copies of the ddPCR assay compares well with those of individual qPCR assays and of the chamber digital PCR (cdPCR approach. It offers a dynamic range over four orders of magnitude, greater than that of cdPCR. Moreover, when compared to qPCR, the ddPCR assay showed better repeatability at low target concentrations and a greater tolerance to inhibitors. Finally, ddPCR throughput and cost are advantageous relative to those of qPCR for routine GMO quantification. It is thus concluded that ddPCR technology can be applied for routine quantification of GMOs, or any other domain where quantitative analysis of food and feed samples is needed.

Prospective comparison of the detection rates of human enterovirus and parechovirus RT-qPCR and viral culture in different pediatric specimens

NARCIS (Netherlands)

de Crom, S C M; Obihara, C C; de Moor, R A; Veldkamp, E J M; van Furth, A M; Rossen, J W A

2013-01-01

BACKGROUND: Reverse-transcriptase quantitative real-time polymerase chain reaction (RT-qPCR) has become the gold standard for the diagnosis of human enterovirus (EV) and parechovirus (HPeV) infections. The detection rate of RT-qPCR in different pediatric body specimens has not been compared

Agrobacterium tumefaciens-MEDIATED IN-PLANTA TRANSFORMATION OF INDONESIAN MAIZE USING pIG121Hm-Cs PLASMID CONTAINING nptII AND hpt GENES

Directory of Open Access Journals (Sweden)

Edy Listanto

2017-05-01

Full Text Available Maize (Zea mays L. productivity in Indonesia is challenged to be increased using genetic engineering. Recent advances in Agrobacterium tumefaciens-mediated in-planta transforma-tion makes it possible to transform maize with low cost, and simple method. This study aimed to confirm pIG121Hm-Cs plasmid in A. tumefaciens, and to estimate the efficiency level of  A. tumefaciens-mediated in-planta transformation of Indonesian maize by using pIG121Hm-Cs plasmid containing nptII and hpt genes. A series of studies were conducted including confirmation of gene construct of pIG121Hm-Cs plasmid in A. tumefaciens, transformation of four maize lines through A. tumefaciens-mediated in-planta technique, acclimatization of transformant plants and molecular analysis of selected plants using polymerase chain reaction (PCR. The pIG121Hm-Cs plasmid was confirmed via PCR analysis using specific primers of nptII and hpt genes and resulted 700 bp and 500 bp for fragments of nptII and hpt, respectively. After selection, acclimatization and molecular analysis steps, the efficiency levels of transformation of four maize lines were low, ranging from 3.8% to 12.8%. The level of transformation efficiency of ST-27 line was the highest accounting for 12.8% of 45 planted embryos on selection medium based on PCR analysis using specific primer for nptII gene. Overall, A. tumefaciens-mediated in planta transformation on maize floral pistil in this study proved to be successful and rapid. Therefore, this enhanced transformation method will be beneficial for Indonesian maize genetic engineering.

RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

DEFF Research Database (Denmark)

Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

2003-01-01

A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...

Development of a Real-time PCR test for porcine group A rotavirus diagnosis

OpenAIRE

Marconi, Elizabeth C.M.; Bernardes, Nara T.C.G.; Beserra, Laila A.R.; Silva, Fernanda D.F.; Gregori, Fabio

2015-01-01

Group A Rotavirus (RVA) is one of the most common causes of diarrhea in humans and several animal species. A SYBR-Green Real-Time polymerase chain reaction (PCR) was developed to diagnose RVA from porcine fecal samples, targeting amplification of a 137-bp fragment of nonstructural protein 5 (NSP5) gene using mRNA of bovine NADH-desidrogenase-5 as exogenous internal control. Sixty-five samples were tested (25 tested positive for conventional PCR and genetic sequencing). The overall agreement (...

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

Science.gov (United States)

Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime

Czech Academy of Sciences Publication Activity Database

Laurell, H.; Iacovoni, J.S.; Abot, A.; Švec, David; Maoret, J.-J.; Arnal, J.-F.; Kubista, Mikael

2012-01-01

Roč. 40, č. 7 (2012), s. 1-10 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z50520701 Keywords : TIME QUANTITATIVE PCR * POLYMERASE-CHAIN-REACTION * GENE-EXPRESSION Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.278, year: 2012

Agrobacterium-mediated transformation of Jatropha curcas leaf ...

African Journals Online (AJOL)

AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING ... One, two and three copies of the introduced gene were confirmed in nine ... quantitative real-time polymerase chain reaction (PCR), transgene copy number.

Proteomic Analysis of the Mediator Complex Interactome in Saccharomyces cerevisiae.

Science.gov (United States)

Uthe, Henriette; Vanselow, Jens T; Schlosser, Andreas

2017-02-27

Here we present the most comprehensive analysis of the yeast Mediator complex interactome to date. Particularly gentle cell lysis and co-immunopurification conditions allowed us to preserve even transient protein-protein interactions and to comprehensively probe the molecular environment of the Mediator complex in the cell. Metabolic 15 N-labeling thereby enabled stringent discrimination between bona fide interaction partners and nonspecifically captured proteins. Our data indicates a functional role for Mediator beyond transcription initiation. We identified a large number of Mediator-interacting proteins and protein complexes, such as RNA polymerase II, general transcription factors, a large number of transcriptional activators, the SAGA complex, chromatin remodeling complexes, histone chaperones, highly acetylated histones, as well as proteins playing a role in co-transcriptional processes, such as splicing, mRNA decapping and mRNA decay. Moreover, our data provides clear evidence, that the Mediator complex interacts not only with RNA polymerase II, but also with RNA polymerases I and III, and indicates a functional role of the Mediator complex in rRNA processing and ribosome biogenesis.

Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Stephen Duffett

2012-01-01

Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.

Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

Science.gov (United States)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

Identification of a conserved archaeal RNA polymerase subunit contacted by the basal transcription factor TFB.

Science.gov (United States)

Magill, C P; Jackson, S P; Bell, S D

2001-12-14

Archaea possess two general transcription factors that are required to recruit RNA polymerase (RNAP) to promoters in vitro. These are TBP, the TATA-box-binding protein and TFB, the archaeal homologue of TFIIB. Thus, the archaeal and eucaryal transcription machineries are fundamentally related. In both RNAP II and archaeal transcription systems, direct contacts between TFB/TFIIB and the RNAP have been demonstrated to mediate recruitment of the polymerase to the promoter. However the subunit(s) directly contacted by these factors has not been identified. Using systematic yeast two-hybrid and biochemical analyses we have identified an interaction between the N-terminal domain of TFB and an evolutionarily conserved subunit of the RNA polymerase, RpoK. Intriguingly, homologues of RpoK are found in all three nuclear RNA polymerases (Rpb6) and also in the bacterial RNA polymerase (omega-subunit).

Trends and advances in food analysis by real-time polymerase chain reaction.

Science.gov (United States)

Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

2016-05-01

Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

Directory of Open Access Journals (Sweden)

Bruynseels Peggy

2009-07-01

Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

Intrapartum PCR assay versus antepartum culture for assessment of vaginal carriage of group B streptococci in a Danish cohort at birth

DEFF Research Database (Denmark)

Khalil, Mohammed Rohi; Uldbjerg, Niels; Thorsen, Poul Bak

2017-01-01

The aim of this study was to compare the performances of two strategies for predicting intrapartum vaginal carriage of group B streptococci (GBS). One strategy was based on an antepartum culture and the other on an intrapartum polymerase chain reaction (PCR). We conducted a prospective observatio......The aim of this study was to compare the performances of two strategies for predicting intrapartum vaginal carriage of group B streptococci (GBS). One strategy was based on an antepartum culture and the other on an intrapartum polymerase chain reaction (PCR). We conducted a prospective...... observational study enrolling 902 pregnant women offered GBS screening before delivery by two strategies. The Culture-strategy was based on vaginal and rectal cultures at 35-37 weeks' gestation, whereas the PCR-strategy was based on PCR assay on intrapartum vaginal swab samples. An intrapartum vaginal culture...... (NPV) of 98%, and Likelihood ratio (LH+) of 9.2. The PCR-strategy showed corresponding values as sensitivity of 83%, specificity of 97%, PPV of 78%, NPV of 98%, and LH+ of 27.5. We conclude that in a Danish population with a low rate of early-onset neonatal infection with GBS, the intrapartum PCR assay...

Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.

Science.gov (United States)

Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck

2013-01-01

Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering.

Science.gov (United States)

Nørholm, Morten H H

2010-03-16

The combined use of restriction enzymes with PCR has revolutionized molecular cloning, but is inherently restricted by the content of the manipulated DNA sequences. Uracil-excision based cloning is ligase and sequence independent and allows seamless fusion of multiple DNA sequences in simple one-tube reactions, with higher accuracy than overlapping PCR. Here, the addition of a highly efficient DNA polymerase and a low-background-, large-insertion- compatible site-directed mutagenesis protocol is described, largely expanding the versatility of uracil-excision DNA engineering. The different uracil-excision based molecular tools that have been developed in an open-source fashion, constitute a comprehensive, yet simple and inexpensive toolkit for any need in molecular cloning.

Mediator structure and rearrangements required for holoenzyme formation.

Science.gov (United States)

Tsai, Kuang-Lei; Yu, Xiaodi; Gopalan, Sneha; Chao, Ti-Chun; Zhang, Ying; Florens, Laurence; Washburn, Michael P; Murakami, Kenji; Conaway, Ronald C; Conaway, Joan W; Asturias, Francisco J

2017-04-13

The conserved Mediator co-activator complex has an essential role in the regulation of RNA polymerase II transcription in all eukaryotes. Understanding the structure and interactions of Mediator is crucial for determining how the complex influences transcription initiation and conveys regulatory information to the basal transcription machinery. Here we present a 4.4 Å resolution cryo-electron microscopy map of Schizosaccharomyces pombe Mediator in which conserved Mediator subunits are individually resolved. The essential Med14 subunit works as a central backbone that connects the Mediator head, middle and tail modules. Comparison with a 7.8 Å resolution cryo-electron microscopy map of a Mediator-RNA polymerase II holoenzyme reveals that changes in the structure of Med14 facilitate a large-scale Mediator rearrangement that is essential for holoenzyme formation. Our study suggests that access to different conformations and crosstalk between structural elements are essential for the Mediator regulation mechanism, and could explain the capacity of the complex to integrate multiple regulatory signals.

Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells.

Science.gov (United States)

Pierce, Kenneth E; Wangh, Lawrence J

2007-01-01

Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.

Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis.

Science.gov (United States)

Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette

2017-09-27

Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

Applying real-time quantitative PCR to diagnosis of freemartin in Holstein cattle by quantifying SRY gene: a comparison experiment

Directory of Open Access Journals (Sweden)

Qinghua Qiu

2018-04-01

Full Text Available Background Freemartinism generally occurs in female offspring of dizygotic twins in a mixed-sex pregnancy. Most bovine heterosexual twin females are freemartins. However, about 10% of bovine heterosexual twin females are fertile. Farmers mostly cull bovine fertile heterosexual twin females due to the lack of a practical diagnostic approach. Culling of such animals results in economic and genetic-material losses both for dairy and beef industry. Methods In this study, a comparative test, including qualitative detection of SRY gene by polymerase chain reaction (PCR, quantitative detection of relative content of SRY by real-time quantitative polymerase chain reaction (qPCR, and quantitative detection of H-Y antigen, was performed to establish the most accurate diagnosis for freemartin. Twelve Holstein heterosexual twin females were used in this study, while three normal Holstein bulls and three normal Holstein cows were used as a positive and negative control, respectively. Results Polymerase chain reaction results revealed that SRY gene were absent in three heterosexual twin females and only two of them were verified as fertile in later age. The qPCR results showed that relative content of SRY was more than 14.2% in freemartins and below 0.41% in fertile heterosexual twin females. The H-Y antigen test showed no significant numerical difference between freemartin and fertile heterosexual twin female. Discussion Our results show that relative content of SRY quantified by qPCR is a better detection method for diagnosis of freemartin in Holstein cattle as compare to qualitative detection of SRY gene by PCR or quantitative detection of H-Y antigen. To the authors’ knowledge, this is the first time we applied qPCR to diagnosing freemartin by quantifying SRY gene and got relative SRY content of each freemartin and fertile heterosexual twin female. We concluded that low-level of SRY would not influence fertility of bovine heterosexual twin female.

Multi-laboratory survey of qPCR enterococci analysis method performance in U.S. coastal and inland surface waters

Data.gov (United States)

U.S. Environmental Protection Agency — Quantitative polymerase chain reaction (qPCR) has become a frequently used technique for quantifying enterococci in recreational surface waters, but there are...

The generation of radiolabeled DNA and RNA probes with polymerase chain reaction

International Nuclear Information System (INIS)

Schowalter, D.B.; Sommer, S.S.

1989-01-01

By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence

Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Mohammad Rubayet Hasan

2014-01-01

Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

Development of a Real-time PCR test for porcine group A rotavirus diagnosis

Directory of Open Access Journals (Sweden)

Elizabeth C.M. Marconi

2015-01-01

Full Text Available Group A Rotavirus (RVA is one of the most common causes of diarrhea in humans and several animal species. A SYBR-Green Real-Time polymerase chain reaction (PCR was developed to diagnose RVA from porcine fecal samples, targeting amplification of a 137-bp fragment of nonstructural protein 5 (NSP5 gene using mRNA of bovine NADH-desidrogenase-5 as exogenous internal control. Sixty-five samples were tested (25 tested positive for conventional PCR and genetic sequencing. The overall agreement (kappa was 0.843, indicating 'very good' concordance between tests, presenting 100% of relative sensitivity (25+ Real Time PCR/25+ Conventional PCR and 87.5% of relative sensitivity (35- Real Time PCR/40- Conventional PCR. The results also demonstrated high intra- and inter-assay reproducibility (coefficient of variation ≤1.42%; thus, this method proved to be a fast and sensitive approach for the diagnosis of RVA in pigs.

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Directory of Open Access Journals (Sweden)

Laurent Dacheux

2016-07-01

Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Science.gov (United States)

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

Effect of gamma radiation on the growth of Aspergillus Flavus aflatoxins producer and on the use of polymerase chain reaction technique (PCR) in samples of maize grains artificially inoculated

International Nuclear Information System (INIS)

Aquino, Simone

2003-01-01

The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x10 6 spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB 1 and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)

Opisthorchis viverrini: Detection by polymerase chain reaction (PCR) in human stool samples

Digital Repository Service at National Institute of Oceanography (India)

Umesha, K.R.; SanathKumar; Parvathi, A.; Duenngai, K.; Sithithaworn, P.; Karunasagar, Indrani; Karunasagar, Iddya

Journal of Tropical Medicine and Public Health 22 (Suppl.), 174–178. Duenngai, K., Sithithaworn, P., Rudrappa, U.K., Karunasagar, I., Laha, T., Stensvold, C.R., Strandgaard, H., Johansen, M.V., 2008. Improvement of PCR for detection of Opisthrochis... and lecithodendriid trematodes. Southeast Asian Journal of Tropical Medicine and Public Health 22, 623–630. Kobayashi, J., Vannachone, B., Sato, Y., Manivong, K., Nambanya, S., Inthakone, S., 2000. An epidemiological study on Opisthorchis viverrini infection in Lao...

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

DEFF Research Database (Denmark)

Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline

2015-01-01

BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...

Diagnostic accuracy of a loop-mediated isothermal PCR assay for detection of Orientia tsutsugamushi during acute Scrub Typhus infection.

Science.gov (United States)

Paris, Daniel H; Blacksell, Stuart D; Nawtaisong, Pruksa; Jenjaroen, Kemajittra; Teeraratkul, Achara; Chierakul, Wirongrong; Wuthiekanun, Vanaporn; Kantipong, Pacharee; Day, Nicholas P J

2011-09-01

There is an urgent need to develop rapid and accurate point-of-care (POC) technologies for acute scrub typhus diagnosis in low-resource, primary health care settings to guide clinical therapy. In this study we present the clinical evaluation of loop-mediated isothermal PCR assay (LAMP) in the context of a prospective fever study, including 161 patients from scrub typhus-endemic Chiang Rai, northern Thailand. A robust reference comparator set comprising following 'scrub typhus infection criteria' (STIC) was used: a) positive cell culture isolate and/or b) an admission IgM titer ≥1∶12,800 using the 'gold standard' indirect immunofluorescence assay (IFA) and/or c) a 4-fold rising IFA IgM titer and/or d) a positive result in at least two out of three PCR assays. Compared to the STIC criteria, all PCR assays (including LAMP) demonstrated high specificity ranging from 96-99%, with sensitivities varying from 40% to 56%, similar to the antibody based rapid test, which had a sensitivity of 47% and a specificity of 95%. The diagnostic accuracy of the LAMP assay was similar to realtime and nested conventional PCR assays, but superior to the antibody-based rapid test in the early disease course. The combination of DNA- and antibody-based detection methods increased sensitivity with minimal reduction of specificity, and expanded the timeframe of adequate diagnostic coverage throughout the acute phase of scrub typhus.

Real time quantitative amplification detection on a microarray: towards high multiplex quantitative PCR.

NARCIS (Netherlands)

Pierik, A.; Moamfa, M; van Zelst, M.; Clout, D.; Stapert, H.; Dijksman, Johan Frederik; Broer, D.; Wimberger-Friedl, R.

2012-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

Real time quantitative amplification detection on a microarray : towards high multiplex quantitative PCR

NARCIS (Netherlands)

Pierik, Anke; Boamfa, M.; Zelst, van M.; Clout, D.; Stapert, H.R.; Dijksman, J.F.; Broer, D.J.; Wimberger-Friedl, R.

2012-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

KAUST Repository

Wen, Weijia

2011-03-03

A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable chip with volumes as small as 1.25 µl, while the heating and cooling rate may be as fast as 12.7 °C/second ensuring that the total time needed of only 25 minutes to complete the 35 cycle PCR amplification. The PCR may be performed according to a two-temperature approach for denaturing and annealing (Td and Ta) of DNA with the PCR chip, with which the amplification of male-specific SRY gene marker by utilizing raw saliva may be achieved. The genetic identification may be in-situ detected after PCR by the optical detection system.

Crystal structure of Pfu, the high fidelity DNA polymerase from Pyrococcus furiosus.

Science.gov (United States)

Kim, Suhng Wook; Kim, Dong-Uk; Kim, Jin Kwang; Kang, Lin-Woo; Cho, Hyun-Soo

2008-05-01

We have determined a 2.6A resolution crystal structure of Pfu DNA polymerase, the most commonly used high fidelity PCR enzyme, from Pyrococcus furiosus. Although the structures of Pfu and KOD1 are highly similar, the structure of Pfu elucidates the electron density of the interface between the exonuclease and thumb domains, which has not been previously observed in the KOD1 structure. The interaction of these two domains is known to coordinate the proofreading and polymerization activity of DNA polymerases, especially via H147 that is present within the loop (residues 144-158) of the exonuclease domain. In our structure of Pfu, however, E148 rather than H147 is located at better position to interact with the thumb domain. In addition, the structural analysis of Pfu and KOD1 shows that both the Y-GG/A and beta-hairpin motifs of Pfu are found to differ with that of KOD1, and may explain differences in processivity. This information enables us to better understand the mechanisms of polymerization and proofreading of DNA polymerases.

Analysing mass balance of viruses in a coagulation-ceramic microfiltration hybrid system by a combination of the polymerase chain reaction (PCR) method and the plaque forming units (PFU) method.

Science.gov (United States)

Matsushita, T; Matsui, Y; Shirasaki, N

2006-01-01

Virus removal experiments using river water spiked with bacteriophages were conducted by an in-line coagulation-ceramic microfiltration hybrid system to investigate the effects of filtration flux (62.5 and 125 L/(m2 x h)) and type of virus (Qbeta and MS2) on virus removal. In addition, the mass balance of viruses through the hybrid system was analysed by quantifying the infectious and inactive viruses by a combination of the polymerase chain reaction (PCR) method and the plaque forming units (PFU) method. Even when the system was operated at high filtration flux (125 L/(m2 x h)), high virus removal (> 6 log) with short coagulation time (2.4 s) was successfully achieved by dosing polyaluminium chloride (PACI) at more than 1.08 mg-Al/L. Removal performances were different between Qbeta and MS2, although their diameters are almost the same: greater virus removal was achieved for MS2 at PACI dosing of 0.54 mg-Al/L, and for Qbeta at PACI dosing of more than 1.08 mg-Al/L. The combination of the PCR and PFU methods revealed that two phenomena, adsorption to/entrapment in aluminium floc and virucidal activity of PACI, partially account for the high virus removal in the coagulation-MF hybrid system.

Developmental stage of strongyle eggs affects the outcome variations of real-time PCR analysis

DEFF Research Database (Denmark)

Andersen, Ulla Vestergaard; Haakansson, I. T.; Roust, Tina

2013-01-01

extent developmental stages can affect the variation of diagnostic test results. This study investigated the influence of developmental stages of strongyle eggs on the variation real-time polymerase chain reaction (PCR) results. Mixed species strongyle eggs were obtained from the faeces of a naturally...

Analysis of the bacterial community in aged and aging pit mud of Chinese Luzhou-flavour liquor by combined PCR-DGGE and quantitative PCR assay.

Science.gov (United States)

Liang, Huipeng; Li, Wenfang; Luo, Qingchun; Liu, Chaolan; Wu, Zhengyun; Zhang, Wenxue

2015-10-01

The community structure of bacteria in aged and aging pit mud, which was judged according to their sensory and physicochemical characteristics, was analysed using polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) and quantitative real-time PCR (qPCR). The phyla Firmicutes, Actinobacteria, Proteobacteria, Synergistetes and Unclassified Bacteria were detected and the fermentative Firmicutes was predominant in both types of pit mud in the PCR-DGGE analysis. Among Firmicutes, Clostridiales was dominant in aged pit mud while Bacillales and Lactobacillales were dominant in aging pit mud. The diversity of bacterial communities in aged pit mud was higher than that in aging pit mud. In the qPCR analysis the abundance of Clostridium IV in aged pit mud was higher than that in aging pit mud and there were significant differences in the quantity of Clostridium IV between aged and aging pit mud of the same cellar (P mud. The differences in the quantity of Clostridium IV might be involved in the distinction that the aged pit mud has a strong aroma while the aging pit mud does not. © 2014 Society of Chemical Industry.

Detection of Phakopsora pachyrhizi fungus by Polymerase Chain Reaction technique (PCR) after soy grains treatment by electron beams

International Nuclear Information System (INIS)

Fanaro, G.B.; Aquino, S.; Guedes, R.L.; Crede, R.G.; Sabundjian, I.T.; Ruiz, M.O.; Villavicencio, A.L.C.H.

2005-01-01

Today Brazil, as the largest soy exporter in the world, has undergone the consequences of the contamination of these crops by the Asian dust fungus, being harmed since the plantation up to the harvest, with losses in its productivity ranging 10-80%. As it is a new disease in the Americas, there are not any resistant species to this fungus attack. The grains contamination harms the exportation for countries which do not want to have their crops contaminated, affecting therefore the international commerce and agro-business relationship with those countries Brazil has trade with. The Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is of difficult control, since occurs through the wind dispersion. The P. pachyrhizi is an Asian fungus and was recently found in South Africa, Paraguay, Argentina and Brazil. As an alternative process to minimize these losses is the process to preserve the grains by radiation, the use of the electron accelerator was indicated, since its advantage for the grains exportation industry is fundamental. Besides the possibility of being disconnected when not in use, this source does not need to be recharged, is easily available and has high dose rate, streamlining the process and reducing logistics costs. The present work aims to identify, by the Polymerase Chain Reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soy grains, at doses 1 and 2 kGy, at the IPEN-CNEN electron Accelerator, a Dynamitron Machine (Radiation Dynamics Co. model JOB, New York, USA), with 1.5 MeV power and 2.5 mA electrical current. (author)

Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

DEFF Research Database (Denmark)

Blair, D.; Waycott, M.; Byrne, L.

2006-01-01

This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...

PCR Expression Analysis Of the Estrogeninducible Gene Bcei in Gastrointestinal and Other Human Tumors

Directory of Open Access Journals (Sweden)

Iris Wundrack

1994-01-01

Full Text Available A polymerase chain reaction (PCR assay was developed to test for tumor cell specific expression of the BCEI gene. This new marker gene, reported at first for human breast cancer, was found specifically active in various gastrointestinal carcinomas by previously applying immunohistochemistry and RNA (Northern blot analysis. Presently, by using reverse transcription -PCR analysis, a series of primary tumor tissues and established tumor cell lines were testcd for BCEI transcription. This approach was compared to immunostaining achieved by an antibody directed against the BCEI gene’s product. The result demonstrate the superior sensitivity of PCR by indicating the gene’ s expression in cases where immunohistochemical testing remained negative.

Mediator subunit18 controls flowering time and floral organ identity in Arabidopsis.

Directory of Open Access Journals (Sweden)

Zhengui Zheng

Full Text Available Mediator is a conserved multi-protein complex that plays an important role in regulating transcription by mediating interactions between transcriptional activator proteins and RNA polymerase II. Much evidence exists that Mediator plays a constitutive role in the transcription of all genes transcribed by RNA polymerase II. However, evidence is mounting that specific Mediator subunits may control the developmental regulation of specific subsets of RNA polymerase II-dependent genes. Although the Mediator complex has been extensively studied in yeast and mammals, only a few reports on Mediator function in flowering time control of plants, little is known about Mediator function in floral organ identity. Here we show that in Arabidopsis thaliana, MEDIATOR SUBUNIT 18 (MED18 affects flowering time and floral organ formation through FLOWERING LOCUS C (FLC and AGAMOUS (AG. A MED18 loss-of-function mutant showed a remarkable syndrome of later flowering and altered floral organ number. We show that FLC and AG mRNA levels and AG expression patterns are altered in the mutant. Our results support parallels between the regulation of FLC and AG and demonstrate a developmental role for Mediator in plants.

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

Science.gov (United States)

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Quantification of viable bacteria in wastewater treatment plants by using propidium monoazide combined with quantitative PCR (PMA-qPCR).

Science.gov (United States)

Li, Dan; Tong, Tiezheng; Zeng, Siyu; Lin, Yiwen; Wu, Shuxu; He, Miao

2014-02-01

The detection of viable bacteria in wastewater treatment plants (WWTPs) is very important for public health, as WWTPs are a medium with a high potential for waterborne disease transmission. The aim of this study was to use propidium monoazide (PMA) combined with the quantitative polymerase chain reaction (PMA-qPCR) to selectively detect and quantify viable bacteria cells in full-scale WWTPs in China. PMA was added to the concentrated WWTP samples at a final concentration of 100 micromol/L and the samples were incubated in the dark for 5 min, and then lighted for 4 min prior to DNA extraction and qPCR with specific primers for Escherichia coli and Enterococci, respectively. The results showed that PMA treatment removed more than 99% of DNA from non-viable cells in all the WWTP samples, while matrices in sludge samples markedly reduced the effectiveness of PMA treatment. Compared to qPCR, PMA-qPCR results were similar and highly linearly correlated to those obtained by culture assay, indicating that DNA from non-viable cells present in WWTP samples can be eliminated by PMA treatment, and that PMA-qPCR is a reliable method for detection of viable bacteria in environmental samples. This study demonstrated that PMA-qPCR is a rapid and selective detection method for viable bacteria in WWTP samples, and that WWTPs have an obvious function in removing both viable and non-viable bacteria. The results proved that PMA-qPCR is a promising detection method that has a high potential for application as a complementary method to the standard culture-based method in the future.

Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide γ-phosphate derivative

Science.gov (United States)

Hansen, Connie J.; Wu, Lydia; Fox, Jeffrey D.; Arezi, Bahram; Hogrefe, Holly H.

2011-01-01

Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (−1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure. PMID:21062827

Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide gamma-phosphate derivative.

Science.gov (United States)

Hansen, Connie J; Wu, Lydia; Fox, Jeffrey D; Arezi, Bahram; Hogrefe, Holly H

2011-03-01

Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (-1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure.

A simple and efficient Agrobacterium-mediated procedure for ...

Indian Academy of Sciences (India)

Prakash

production of insect- and disease-resistant plants, herbicide ... indole-3-acetic acid; MS, Murashige and Skoog; OD, optical density; PCR, polymerase chain reaction; SDS, sodium .... soil for hardening. ..... be adapted for other tomato cultivars.

Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses

Science.gov (United States)

Chen, Hongjun; Ye, Jianqiang; Xu, Kemin; Angel, Matthew; Shao, Hongxia; Ferrero, Andrea; Sutton, Troy; Perez, Daniel R.

2012-01-01

Since 1999, plasmid-based reverse genetics (RG) systems have revolutionized the way influenza viruses are studied. However, it is not unusual to encounter cloning difficulties for one or more influenza genes while attempting to recover virus de novo. To overcome some of these shortcomings we sought to develop partial or full plasmid-free RG systems. The influenza gene of choice is assembled into a RG competent unit by virtue of overlapping PCR reactions containing a cDNA copy of the viral gene segment under the control of RNA polymerase I promoter (pol1) and termination (t1) signals – herein referred to as Flu PCR amplicons. Transfection of tissue culture cells with either HA or NA Flu PCR amplicons and 7 plasmids encoding the remaining influenza RG units, resulted in efficient virus rescue. Likewise, transfections including both HA and NA Flu PCR amplicons and 6 RG plasmids also resulted in efficient virus rescue. In addition, influenza viruses were recovered from a full set of Flu PCR amplicons without the use of plasmids. PMID:23029501

Development of Quantitative Competitive PCR and Absolute Based Real-Time PCR Assays for Quantification of The Butyrate Producing Bacterium: Butyrivibrio fibrisolvens

Directory of Open Access Journals (Sweden)

Mojtaba Tahmoorespur

2016-04-01

Full Text Available Introduction Butyrivibrio fibrisolvens strains are presently recognized as the major butyrate-producing bacteria found in the rumen and digestive track of many animals and also in the human gut. In this study we reported the development of two DNA based techniques, quantitative competitive (QC PCR and absolute based Real-Time PCR, for enumerating Butyrivibrio fibrisolvens strains. Despite the recent introduction of real-time PCR method for the rapid quantification of the target DNA sequences, use of quantitative competitive PCR (QC-PCR technique continues to play an important role in nucleic acid quantification since it is more cost effective. The procedure relies on the co-amplification of the sequence of interest with a serially diluted synthetic DNA fragment of the known concentration (competitor, using the single set primers. A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR. It monitors the amplification of a targeted DNA molecule during the PCR. Materials and Methods At first reported species-specific primers targeting the 16S rDNA region of the bacterium Butyrivibrio fibrisolvens were used for amplifying a 213 bp fragment. A DNA competitor differing by 50 bp in length from the 213 bp fragment was constructed and cloned into pTZ57R/T vector. The competitor was quantified by NanoDrop spectrophotometer and serially diluted and co-amplified by PCR with total extracted DNA from rumen fluid samples. PCR products were quantified by photographing agarose gels and analyzed with Image J software and the amount of amplified target DNA was log plotted against the amount of amplified competitor. Coefficient of determination (R2 was used as a criterion of methodology precision. For developing the Real-time PCR technique, the 213 bp fragment was amplified and cloned into pTZ57R/T was used to draw a standard curve. Results and Discussion The specific primers of Butyrivibrio

Genetic variability of Pantaneiro horse using RAPD-PCR markers

OpenAIRE

Egito,Andréa Alves do; Fuck,Beatriz Helena; McManus,Concepta; Paiva,Samuel Rezende; Albuquerque,Maria do Socorro Maués; Santos,Sandra Aparecida; Abreu,Urbano Gomes Pinto de; Silva,Joaquim Augusto da; Sereno,Fabiana Tavares Pires de Souza; Mariante,Arthur da Silva

2007-01-01

Blood samples were collected from Pantaneiro Horses in five regions of Mato Grosso do Sul and Mato Grosso States. Arabian, Mangalarga Marchador and Thoroughbred were also included to estimate genetic distances and the existing variability among and within these breeds by RAPD-PCR (Random Amplified Polymorphic DNA - Polymerase Chain Reaction) molecular markers. From 146 primers, 13 were chosen for amplification and 44 polymorphic bands were generated. The analysis of molecular variance (AMOVA)...

Transcription regulation by the Mediator complex.

Science.gov (United States)

Soutourina, Julie

2018-04-01

Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.

Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB

Directory of Open Access Journals (Sweden)

Lenice Roteia Cardoso Jung

2015-06-01

Full Text Available Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR. The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.

Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB).

Science.gov (United States)

Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini

2015-06-01

Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.

Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis

Directory of Open Access Journals (Sweden)

V Hallur

2015-01-01

Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

Data of self-made Taq DNA polymerase prepared for screening purposes

Directory of Open Access Journals (Sweden)

E.V. Konovalova

2017-04-01

Full Text Available DNA analysis is a key procedure in genetic engineering. Nowadays the analysis is often done by PCR with Taq DNA polymerase. Although the last enzyme price is quite low, demand for numerous analyses results in much money expenditure which are not affordable for many laboratories. In a meanwhile, many screening tasks do not require the highly purified enzyme. Taking into account the enzyme unique properties it makes possible to marginally simplify its production without resorting to costly or lengthy techniques such as column chromatography and/or dialysis. Here the data of routine usage of Taq DNA polymerase prepared according to the protocol developed in our laboratory is presented. The protocol takes only several hours to realize and does not need qualified personnel or expensive equipment. Yet it gives the enzyme preparation suitable for most screening purposes. The isolated Taq DNA polymerase stock can be stored as ammonium sulfate suspension in a refrigerator for prolonged period, not less than 6 months. The working enzyme solution is prepared from the stock suspension on demand, not more than once in a month and can be stored also in a refrigerator.

Use of PCR on lymph-node sample as test of cure of visceral leishmaniasis

NARCIS (Netherlands)

Osman, O. F.; Kager, P. A.; Zijlstra, E. E.; El-Hassan, A. M.; Oskam, L.

1997-01-01

When the polymerase chain reaction (PCR) was used to test lymph-node aspirates from 35 patients from eastern Sudan, who had had visceral leishmaniasis but were believed cured, leishmanial DNA was detected in samples from 14 of the patients. There were no significant differences between the

Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

OpenAIRE

Lee, Da-Sheng

2010-01-01

Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DN...

Transient neonatal diabetes mellitus with macroglossia diagnosed by methylation specific PCR (MS-PCR

Directory of Open Access Journals (Sweden)

Hye Young Jin

2010-03-01

Full Text Available Transient neonatal diabetes mellitus (TNDM has been associated with paternal uniparental isodisomy of chromosome 6, paternally inherited duplication of 6q24, or a methylation defect at a CpG island of the ZAC or HYMAI gene. We experienced a case of TNDM in which the patient presented with hyperglycemia, macroglossia, and intrauterine growth retardation, caused by a paternally derived HYMAI. An 18-day-old female infant was admitted to the hospital because of macroglossia and recurrent hyperglycemia. In addition to the macroglossia, she also presented with large fontanelles, micrognathia, and prominent eyes. Serum glucose levels were 200&#8211;300 mg/dL and they improved spontaneously 2 days after admission. To identify the presence of a maternal methylated allele, bisulfite-treated genomic DNA from peripheral blood was prepared and digested with BssHII after polymerase chain reaction (PCR amplification with methylation-specific HYMAI primers. PCR and restriction fragment length polymorphism analysis showed that the patient had only the paternal origin of the HYMA1 gene. TNDM is associated with a methylation defect in chromosome 6, suggesting that an imprinted gene on chromosome 6 is responsible for this phenotype.

Routine clinical application of the FRAXA Pfu PCR assay: limits and utility.

Science.gov (United States)

Condorelli, D F; Milana, G; Dell'Albani, P; Roccazzello, A M; Insirello, E; Pavone, L; Mollica, F

1996-11-01

Fragile X genotype is characterized by the excessive amplification of an unstable region of DNA: a trinucleotide repeat CGG of variable copy number present in the FRAXA locus. Methods based on polymerase chain reaction (PCR) amplification of the CGG repeat region could facilitate the development of a rapid screening assay. Unfortunately, amplification across CGG repeats can be inefficient and unreliable due to their 100% G + C base composition. The utility of the exonuclease-deficient Pfu polymerase for amplification and detection of the CGG repeats at the FRAXA locus has been reported. In the present study we analysed the utility of a Pfu PCR assay as a rapid initial screening method to rule out a diagnosis of fragile X syndrome in males with mental retardation. Affected males did not show any amplification products or a smear of amplification products between 350 and 550 bp. Only 10% of affected male samples did not show any amplification products, while the vast majority showed the amplification smear. The amplification smears represent a serious drawback of the method, since they cannot be distinguished from the amplification products of normal samples after separation in 1% agarose gel. Several modifications of the PCR conditions were attempted to eliminate this problem, but none was appropriate for clinical applications. However, the problem was easily solved by using a higher resolution electrophoretic system that allows a clear distinction of normal bands from pathological smears. We tested the specificity of the Pfu PCR assay, followed by an improved MetaPhor gel electrophoretic separation of PCR products, on 50 samples from normal males and 24 samples form affected males. The results showed that this method is a rapid, sensitive and specific assay for the exclusion of fragile X syndrome diagnosis in mentally retarded males.

Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

Directory of Open Access Journals (Sweden)

Da-Sheng Lee

2010-01-01

Full Text Available Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design.

Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

Science.gov (United States)

Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2015-07-01

Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

Quantification of organellar DNA and RNA using real-time PCR.

Science.gov (United States)

Weihe, Andreas

2014-01-01

Quantitative (real-time) polymerase chain reaction (PCR) allows the measurement of relative organellar gene copy numbers as well as transcript abundance of individual mitochondrial or plastidial genes. Requiring only minute amounts of total DNA or RNA, the described method can replace traditional analyses like Southern or Northern hybridization which require large amounts of organellar nucleic acids and usually provide only semiquantitative data. Here we describe prerequisites, reaction conditions, and data analysis principles, which should be applicable for a wide range of plant species and experimental situations where comparative and precise determination of gene copy numbers or transcript abundance is requested. Sequences of amplification primers for qPCR of organellar genes from Arabidopsis are provided.