WorldWideScience

Sample records for median final vf

  1. Sensorless V/f Control of Permanent Magnet Synchronous Motors

    OpenAIRE

    Montesinos-Miracle, Daniel; Perera, P. D. Chandana; Galceran-Arellano, Samuel; Blaabjerg, Frede

    2010-01-01

    V/f control strategy for permanent magnet synchronous motors can be useful for HVAC applications, where not high performance is required. Permanent magnet synchronous motors have efficiency advantages over the induction motor. But open loop V/f control is not stable in the whole frequency range. As demonstrated, the V/f control strategy becomes

  2. Personal dosimetry service of VF, a.s. company

    International Nuclear Information System (INIS)

    Prasek, P.

    2009-01-01

    The VF, a.s. Company will extend its services in the area of personal dosimetry at the end of 2008, which is fully in compliance with the requirements of the Atomic Act, section 9 paragraph (1) letter r) and Decree on Radiation Protection, section 59 paragraph (1) letter a). Optically stimulated luminescence was selected in VF .a.s. as the most advantageous and the most advanced technology for the integral personal dosimetry. Optically stimulated luminescence (OSL) has been using in dosimetry for more than ten years. Although it is relatively new technology , its indisputable advantages predetermine that technology has significantly benefited in personal dosimetry services within a short time all over the advanced world. The VF, a.s. personal dosimetry service is based on the licensed products of LANDAUER, the US company, which is the world leader in OSL dosimetry. Crystalline Al 2 O 3 :C was selected as the detection material. All equipment of personal dosimetry service is installed in the VF Centre of Technology in Cerna Hora. The personal dosimetry service is incorporated in the International LANDAUER Dosimetry Service Network, and in the European Union, it is directly linked to the LANDAUER European Headquarters with its office in Paris. As a part of the OSL technology licence, the VF personal dosimetry service was included in the inter-laboratory comparison programme of the LANDAUER syndicate. (author)

  3. Personal dosimetry service of VF, a.s. company

    International Nuclear Information System (INIS)

    Prasek, P.

    2008-01-01

    The VF, a.s. Company will extend its services in the area of personal dosimetry at the end of 2008, which is fully in compliance with the requirements of the Atomic Act, section 9 paragraph (1) letter r) and Decree on Radiation Protection, section 59 paragraph (1) letter a). Optically stimulated luminescence was selected in VF .a.s. as the most advantageous and the most advanced technology for the integral personal dosimetry . Optically stimulated luminescence (OSL) has been using in dosimetry for more than ten years. Although it is relatively new technology , its indisputable advantages predetermine that technology has significantly benefited in personal dosimetry services within a short time all over the advanced world. The VF, a.s. personal dosimetry service is based on the licensed products of LANDAUER, the US company, which is the world leader in OSL dosimetry. Crystalline Al 2 O 3 :C was selected as the detection material. All equipment of personal dosimetry service is installed in the VF Centre of Technology in Cerna Hora. The personal dosimetry service is incorporated in the International LANDAUER Dosimetry Service Network, and in the European Union, it is directly linked to the LANDAUER European Headquarters with its office in Paris. As a part of the OSL technology licence, the VF personal dosimetry service was included in the inter-laboratory comparison programme of the LANDAUER syndicate. (author)

  4. Validation and reliability of the VF-14 questionnaire in a German population.

    Science.gov (United States)

    Chiang, Peggy Pei-Chia; Fenwick, Eva; Marella, Manjula; Finger, Robert; Lamoureux, Ecosse

    2011-11-21

    To evaluate the validity, reliability, and measurement characteristics of the Visual Function 14 (VF-14) in a German sample using Rasch analysis. This was a clinic-based, cross-sectional study with 184 patients with low vision recruited from an outpatient clinic at a German eye hospital. Participants underwent a clinical examination and completed the German VF-14 scale. The validity of the VF-14 scale was assessed using Rasch analysis. The main outcome measure was the overall functional score provided by the VF-14. After collapsing two response categories for items 13 and 14, the VF-14 scale satisfied fundamental criteria to achieve fit to the Rasch model, namely, ordered thresholds, the ability to distinguish between different strata of participant ability, absence of misfitting items, no evidence of unidimensionality, and no significant differential item functioning for key sociodemographic covariates. The VF-14 is able to discriminate between participants with different levels of vision impairment and across different cultural groups. The VF-14 is a valid, reliable, and unidimensional questionnaire for use in a German population. These findings contribute to the growing evidence base for second generation patient reported outcome measures in ophthalmology, and support the use of the German VF-14 in tertiary eye clinics in Germany to capture the impact of visual impairment on visual function from the patient's perspective and to inform low vision rehabilitation and interventions.

  5. Investigation of the problems associated with the Pt-20 Rh clads of the viking heat sources VF-3 and VF-7

    International Nuclear Information System (INIS)

    Zielinski, R.E.

    1975-01-01

    The investigation was undertaken to determine why the emissive coatings of the Viking Heat Sources VF-3 and VF-7 had flaked off the Pt-20 Rh clad material. During the course of the investigation, two additional, unusual phenomena were observed: a surface reaction zone on the uncoated Pt-20 Rh surfaces and grain boundary reactions in the weld zone of the clad. It seems that all three phenomena were the result of a complicated reaction couple that involved the heat source materials, storage container materials, and environment. Vapor transport mechanisms were responsible for the phenomena which were observed. The vapor transport mechanisms were probably initiated because of the impurities that were in both the heat source and storage container materials. The mechanisms resulted in significant changes in these heat sources because vapor transport was allowed to continue in a static environment for an unusually long period of time. (U.S.)

  6. V.F. Gening and issues on the archaeology of Volga Bulgaria

    Directory of Open Access Journals (Sweden)

    Rudenko Konstantin A.

    2014-03-01

    Full Text Available V.F. Gening’s contribution to the study of the Volga Bulgaria and his views concerning the history and archaeology of this state formation are considered in the article. His sphere of interest first of all included the links between the Volga Bulgaria population and the tribes belonging to preceding cultures, such as Pyanoborye and Imenkovo ones. V.F. Gening investigated the Bolshie Tarkhany, Turaevo and Rozdestveno burial grounds dated by the 8-9th, 5th and 6-7th centuries A.D., and the materials collected modified the notion of the time and character of the Bulgars arrival in the Volga area. He reconsidered the chronology and interpretation of the archaeological monuments, which referred to the epoch preceding the Bulgars appearance on the Volga, and proposed a hypothesis of the Volga Bulgars as a Turkic-Ugrian ethnos. V.F. Gening created a periodization of the Bolgars history in Eastern Europe within the time span between 1st-3rd centuries AD and the early 13th century AD

  7. Development of the PANVAC-VF vaccine for pancreatic cancer.

    Science.gov (United States)

    Petrulio, Christian A; Kaufman, Howard L

    2006-02-01

    PANVAC-VF is a vaccine regimen composed of a priming dose of recombinant vaccinia virus and booster doses of recombinant fowlpox virus expressing carcinoembryonic antigen, mucin-1 and a triad of costimulatory molecules (TRICOM), which include B7.1, intercellular adhesion molecule-1 and leukocyte function-associated antigen-3. Vaccination is administered by subcutaneous injection followed by 4 days of local recombinant adjuvant granulocyte-macrophage colony-stimulating factor at the vaccination site. The vaccine has been developed for patients with advanced pancreatic cancer and has now entered a randomized Phase III clinical trial. This review will describe the background of recombinant poxvirus technology for tumor vaccine development, detail the key preclinical studies supporting the regimen, review the clinical trials supporting the current Phase III study, and highlight the key challenges and future obstacles to successful implementation of PANVAC-VF for pancreatic cancer.

  8. The VASIMR[registered trademark] VF-200-1 ISS Experiment as a Laboratory for Astrophysics

    Science.gov (United States)

    Glover Tim W.; Squire, Jared P.; Longmier, Benjamin; Cassady, Leonard; Ilin, Andrew; Carter, Mark; Olsen, Chris S.; McCaskill, Greg; Diaz, Franklin Chang; Girimaji, Sharath; hide

    2010-01-01

    The VASIMR[R] Flight Experiment (VF-200-1) will be tested in space aboard the International Space Station (ISS) in about four years. It will consist of two 100 kW parallel plasma engines with opposite magnetic dipoles, resulting in a near zero-torque magnetic system. Electrical energy will come from ISS at low power level, be stored in batteries and used to fire the engine at 200 kW. The VF-200-1 project will provide a unique opportunity on the ISS National Laboratory for astrophysicists and space physicists to study the dynamic evolution of an expanding and reconnecting plasma loop. Here, we review the status of the project and discuss our current plans for computational modeling and in situ observation of a dynamic plasma loop on an experimental platform in low-Earth orbit. The VF-200-1 project is still in the early stages of development and we welcome new collaborators.

  9. Analysis, design and implementation of sensorless V/f control in a ...

    Indian Academy of Sciences (India)

    SOURABH PAITANDI

    Keywords. Surface-mounted PMSM; V/f control; sensorless control; stabilisation of PMSM; efficiency optimisation. ..... The power balance equation can be written as, pe ¼ Pe ю .... loading the actual speed falls for a very short transient period.

  10. New sensorless, efficient optimized and stabilized v/f control for pmsm machines

    Science.gov (United States)

    Jafari, Seyed Hesam

    With the rapid advances in power electronics and motor drive technologies in recent decades, permanent magnet synchronous machines (PMSM) have found extensive applications in a variety of industrial systems due to its many desirable features such as high power density, high efficiency, and high torque to current ratio, low noise, and robustness. In low dynamic applications like pumps, fans and compressors where the motor speed is nearly constant, usage of a simple control algorithm that can be implemented with least number of the costly external hardware can be highly desirable for industry. In recent published works, for low power PMSMs, a new sensorless volts-per-hertz (V/f) controlling method has been proposed which can be used for PMSM drive applications where the motor speed is constant. Moreover, to minimize the cost of motor implementation, the expensive rotor damper winding was eliminated. By removing the damper winding, however, instability problems normally occur inside of the motor which in some cases can be harmful for a PMSM drive. As a result, to address the instability issue, a stabilizing loop was developed and added to the conventional V/f. By further studying the proposed sensorless stabilized V/f, and calculating power loss, it became known that overall motor efficiency still is needed to be improved and optimized. This thesis suggests a new V/f control method for PMSMs, where both efficiency and stability problems are addressed. Also, although in nearly all recent related research, methods have been applied to low power PMSM, for the first time, in this thesis, the suggested method is implemented for a medium power 15 kW PMSM. A C2000 F2833x Digital Signal Processor (DSP) is used as controller part for the student custom built PMSM drive, but instead of programming the DSP in Assembly or C, the main control algorithm was developed in a rapid prototype software environment which here Matlab Simulink embedded code library is used.

  11. Using commodity accelerometers and gyroscopes to improve speed and accuracy of JanusVF

    Science.gov (United States)

    Hutson, Malcolm; Reiners, Dirk

    2010-01-01

    Several critical limitations exist in the currently available commercial tracking technologies for fully-enclosed virtual reality (VR) systems. While several 6DOF solutions can be adapted to work in fully-enclosed spaces, they still include elements of hardware that can interfere with the user's visual experience. JanusVF introduced a tracking solution for fully-enclosed VR displays that achieves comparable performance to available commercial solutions but without artifacts that can obscure the user's view. JanusVF employs a small, high-resolution camera that is worn on the user's head, but faces backwards. The VR rendering software draws specific fiducial markers with known size and absolute position inside the VR scene behind the user but in view of the camera. These fiducials are tracked by ARToolkitPlus and integrated by a single-constraint-at-a-time (SCAAT) filter to update the head pose. In this paper we investigate the addition of low-cost accelerometers and gyroscopes such as those in Nintendo Wii remotes, the Wii Motion Plus, and the Sony Sixaxis controller to improve the precision and accuracy of JanusVF. Several enthusiast projects have implemented these units as basic trackers or for gesture recognition, but none so far have created true 6DOF trackers using only the accelerometers and gyroscopes. Our original experiments were repeated after adding the low-cost inertial sensors, showing considerable improvements and noise reduction.

  12. Serial in-office laser treatment of vocal fold leukoplakia: Disease control and voice outcomes.

    Science.gov (United States)

    Koss, Shira L; Baxter, Peter; Panossian, Haig; Woo, Peak; Pitman, Michael J

    2017-07-01

    Although vocal fold (VF) leukoplakia is commonly treated with in-office laser, there is no data on its long-term effectiveness. This study hypothesizes that VF leukoplakia treated by serial in-office laser results in long-term disease control with maintenance of voice and minimal morbidity. Retrospective review (2008-2015). Forty-six patients with VF leukoplakia treated by in-office KTP (potassium titanyl phosphate) or PDL (pulsed dye laser) were included. Median follow-up from final laser treatment was 19.6 months. Main outcomes included: 1) rate of disease control, 2) percentage of disease regression using ImageJ analysis. Secondary outcomes included vocal assessment using the Voice Handicap Index-10 (VHI-10). Patients underwent a median of 2 (range: 1-6) in-office laser treatments. Time between treatments was median 7.6 months. After final treatment, 19 patients (41.3%) had no disease; two patients (4.3%) progressed to invasive cancer; overall disease regression was median 77.1% (P office treatment only); failures were 13 patients (28.3%) who required operative intervention and two patients (4%) who underwent radiation. Compared to responders, failures demonstrated significantly shorter duration between treatments (median 2.3 vs. 8.9 months, P = 0.038) and significantly less regression (median 49.3% vs. 100%, P = 0.006). Serial outpatient KTP or PDL treatment of VF leukoplakia is effective for disease control with minimal morbidity and preservation of voice quality. We suggest that patients requiring repeated in-office treatment every 6 months may benefit from earlier operative intervention; other factors associated with in-office success remain unclear. 4. Laryngoscope, 127:1644-1651, 2017. © 2017 The American Laryngological, Rhinological and Otological Society, Inc.

  13. Sensorless Sinusoidal Drives for Fan and Pump Motors by V/f Control

    Science.gov (United States)

    Kiuchi, Mitsuyuki; Ohnishi, Tokuo

    This paper proposes sensorless sinusoidal driving methods of permanent magnet synchronous motors for fans and pumps by V/f control. The proposed methods are simple methods that control the motor peak current constant by voltage or frequency control, and are characterized by DC link current detection using a single shunt resistor at carrier wave signal bottom timing. As a result of the dumping factor from square torque load characteristics of fan and pump motors, it is possible to control stable starting and stable steady state by V/f control. In general, pressure losses as a result of the fluid pass of fan and pump systems are nearly constant; therefore, the flow rate and motor torque are determined by revolutions. Accordingly, high efficiency driving is possible by setting corresponding currents to q-axis currents (torque currents) at target revolutions. Because of the simple current detection and motor control methods, the proposed methods are optimum for fan and pump motor driving systems of home appliances.

  14. Systematic benchmark of substructure search in molecular graphs - From Ullmann to VF2

    Directory of Open Access Journals (Sweden)

    Ehrlich Hans-Christian

    2012-07-01

    Full Text Available Abstract Background Searching for substructures in molecules belongs to the most elementary tasks in cheminformatics and is nowadays part of virtually every cheminformatics software. The underlying algorithms, used over several decades, are designed for the application to general graphs. Applied on molecular graphs, little effort has been spend on characterizing their performance. Therefore, it is not clear how current substructure search algorithms behave on such special graphs. One of the main reasons why such an evaluation was not performed in the past was the absence of appropriate data sets. Results In this paper, we present a systematic evaluation of Ullmann’s and the VF2 subgraph isomorphism algorithms on molecular data. The benchmark set consists of a collection of 1235 SMARTS substructure expressions and selected molecules from the ZINC database. The benchmark evaluates substructures search times for complete database scans as well as individual substructure-molecule pairs. In detail, we focus on the influence of substructure formulation and size, the impact of molecule size, and the ability of both algorithms to be used on multiple cores. Conclusions The results show a clear superiority of the VF2 algorithm in all test scenarios. In general, both algorithms solve most instances in less than one millisecond, which we consider to be acceptable. Still, in direct comparison, the VF2 is most often several folds faster than Ullmann’s algorithm. Additionally, Ullmann’s algorithm shows a surprising number of run time outliers.

  15. Effects of Load and Speed Variations in a Modified Closed Loop V/F ...

    African Journals Online (AJOL)

    This paper investigates the eects of load and reference speed variations in a modied closed loopv=f induction motor drive. A modied approach, involving the addition of a low frequency boostvoltage, is developed and adopted as an enhancement to the conventional closed loop v=f speedcontrol of a three phase squirrel ...

  16. New web interface for Personal dosimetry VF, a.s

    International Nuclear Information System (INIS)

    Studeny, J.

    2014-01-01

    The lecture will introduce new functions and graphic design WebSOD - web interface Personal dosimetry Service VF. a.s. which will be updated in November 2014. The new interface will have a new graphic design, intuitive control system and will be providing a range of new functions: - Personal doses - display of personal doses from personal, extremity and neutron dosimeters including graphs, annual and electronic listings of doses; - Collective doses - display of group doses for selected periods of time; Reference levels - setting and display of three reference levels; - Evidence - enables administration of monitored individuals - beginning, ending of monitoring, or editing the data of monitored persons and centers. (author)

  17. Cellular Mechanism Underlying Hypothermia-Induced VT/VF in the Setting of Early Repolarization and the Protective Effect of Quinidine, Cilostazol and Milrinone

    Science.gov (United States)

    Gurabi, Zsolt; Koncz, István; Patocskai, Bence; Nesterenko, Vladislav V.; Antzelevitch, Charles

    2014-01-01

    Background Hypothermia has been reported to induce ventricular tachycardia and fibrillation (VT/VF) in patients with early repolarization (ER) pattern. This study examines the cellular mechanisms underlying VT/VF associated with hypothermia in an experimental model of ER syndrome (ERS) and examines the effectiveness of quinidine, cilostazol and milrinone to prevent hypothermia-induced arrhythmias. Method and Results Transmembrane action potentials (AP) were simultaneously recorded from 2 epicardial and 1 endocardial site of coronary-perfused canine left-ventricular wedge preparations, together with a pseudo-ECG. A combination of NS5806 (3–10 µM) and verapamil (1µM) was used to pharmacologically model the genetic mutations responsible for ERS. Acetylcholine (3µM) was used to simulate increased parasympathetic tone, which is known to promote ER. In control, lowering the temperature of the coronary perfusate to induce mild hypothermia (32°C-34°C) resulted in increased J wave area on the ECG and accentuated epicardial AP notch but no arrhythmic activity. In the setting of ER, hypothermia caused further accentuation of the epicardial AP notch, leading to loss of the AP dome at some sites but not others, thus creating the substrate for development of phase-2-reentry and VT/VF. Addition of the Ito antagonist quinidine (5 µM) or the phosphodiesterase III inhibitors cilostazol (10 µM) or milrinone (5 µM), diminished the ER manifestations and prevented the hypothermia-induced phase 2 reentry and VT/VF. Conclusions Hypothermia leads to VT/VF in the setting of ER by exaggerating repolarization abnormalities, leading to development of phase-2-reentry. Quinidine, cilostazol and milrinone suppress the hypothermia-induced VT/VF by reversing the repolarization abnormalities. PMID:24429494

  18. mer-Triammine trifluorido vanadium(III), mer-[VF{sub 3}(NH{sub 3}){sub 3}]. Synthesis and crystal structure

    Energy Technology Data Exchange (ETDEWEB)

    Woidy, Patrick [Technische Univ. Muenchen, Garching (Germany). Zentrale Technisch-Wissenschaftliche Betriebseinheit Radiochemie Muenchen RCM; Kraus, Florian [Marburg Univ. (Germany). Anorganische und Fluorchemie

    2015-07-01

    Vanadium trifluoride reacts with dry liquid ammonia under the formation of lilac plate-shaped crystals of mer-triammine trifluorido vanadium(III) (1), mer-[VF{sub 3}(NH{sub 3}){sub 3}]. Single-crystal X-ray analysis was carried out at low temperature to elucidate the structure. The compound crystallizes in the monoclinic space group P2{sup 1}/c with a = 5.7284(4), b = 9.2033(5), c = 10.5271(6) Aa, beta = 91.795(6)°, and V = 554.72(6) Aa{sup 3} at 123 K with Z = 4. The discrete [VF{sub 3}(NH{sub 3}){sub 3}] molecules are interconnected by hydrogen bonds.

  19. 75 FR 64699 - Grant of Authority for Subzone Status; VF Corporation (Apparel, Footwear and Luggage Distribution...

    Science.gov (United States)

    2010-10-20

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [Order No. 1714] Grant of Authority for Subzone Status; VF Corporation (Apparel, Footwear and Luggage Distribution), Martinsville, VA Pursuant to its... authority for subzone status for activity related to apparel, footwear and luggage warehousing and...

  20. Development of visual field defect after first-detected optic disc hemorrhage in preperimetric open-angle glaucoma.

    Science.gov (United States)

    Kim, Hae Jin; Song, Yong Ju; Kim, Young Kook; Jeoung, Jin Wook; Park, Ki Ho

    2017-07-01

    To evaluate functional progression in preperimetric glaucoma (PPG) with disc hemorrhage (DH) and to determine the time interval between the first-detected DH and development of glaucomatous visual field (VF) defect. A total of 87 patients who had been first diagnosed with PPG were enrolled. The medical records of PPG patients without DH (Group 1) and with DH (Group 2) were reviewed. When glaucomatous VF defect appeared, the time interval from the diagnosis of PPG to the development of VF defect was calculated and compared between the two groups. In group 2, the time intervals from the first-detected DH to VF defect of the single- and recurrent-DH were compared. Of the enrolled patients, 45 had DH in the preperimetric stage. The median time interval from the diagnosis of PPG to the development of VF defect was 73.3 months in Group 1, versus 45.4 months in Group 2 (P = 0.042). The cumulative probability of development of VF defect after diagnosis of PPG was significantly greater in Group 2 than in Group 1. The median time interval from first-detected DH to the development of VF defect was 37.8 months. The median time interval from DH to VF defect and cumulative probability of VF defect after DH did not show a statistical difference between single and recurrent-DH patients. The median time interval between the diagnosis of PPG and the development of VF defect was significantly shorter in PPG with DH. The VF defect appeared 37.8 months after the first-detected DH in PPG.

  1. Nonlinear Dynamics of Permanent-magnet Synchronous Motor with v/f Control

    International Nuclear Information System (INIS)

    Wei Du-Qu; Luo Xiao-Shu; Zhang Bo; Qiu Dong-Yuan

    2013-01-01

    The nonlinear dynamics of permanent-magnet synchronous motor (PMSM) with v/f control signals is investigated intensively. First, the equilibria and steady-state characteristics of the system are formulated by analytical analysis. Then, some of its basic dynamical properties, such as characteristic eigenvalues, Lyapunov exponents and phase trajectories are studied by varying the values of system parameters. It is found that when the values of the system parameters are smaller, the PMSM operates in stable domains, no matter what the values of control gains are. With the values of parameters increasing, the unstability appears and PMSM falls into chaotic operation. Furthermore, the complex dynamic behaviors are verified by means of simulation. (general)

  2. Evolution of V.F. Gening’s views and other researcher’s ones on the Mazuninskaya culture

    Directory of Open Access Journals (Sweden)

    Ostanina Taisiya I.

    2014-03-01

    Full Text Available The history of studies of the Mazunino culture (3rd -5th centuries AD located in the Middle Kama region is traced. Vladimir Fyodorovich Gening, a prominent Soviet archaeologist, was the first to start research on this culture and offer its theoretical substantiation. As a result of surveys and excavations conducted in Udmurtia and Bashkiria starting 1954, he accumulated a vast archaeological material related to the culture. A thorough analysis of V.F. Gening’s publications and essays on the Mazunino culture sites is provided. The evolution of the scholar’s views regarding the culture basic elements (territory, implements, burial rite, dating, origin, cultural ties and further fate are traced in the article. Later on, the study of new, previously unknown monuments made it possible to expand the knowledge of quite a number of problems related to the early Middle Ages in the Middle Kama River region, including those regarding the Mazunino culture. This resulted in the formation of differing viewpoints concerning the culture among both V.F. Gening’s contemporaries and further generation of researchers, and their views are also discussed and analyzed.

  3. Variable-Volume Flushing (V-VF) device for water conservation in toilets

    Science.gov (United States)

    Jasper, Louis J., Jr.

    1993-01-01

    Thirty five percent of residential indoor water used is flushed down the toilet. Five out of six flushes are for liquid waste only, which requires only a fraction of the water needed for solid waste. Designers of current low-flush toilets (3.5-gal. flush) and ultra-low-flush toilets (1.5-gal. flush) did not consider the vastly reduced amount of water needed to flush liquid waste versus solid waste. Consequently, these toilets are less practical than desired and can be improved upon for water conservation. This paper describes a variable-volume flushing (V-VF) device that is more reliable than the currently used flushing devices (it will not leak), is simple, more economical, and more water conserving (allowing one to choose the amount of water to use for flushing solid and liquid waste).

  4. Izviđanje radio-komunikacija u VF opsegu u funkciji savremenih operacija / Communication intelligence in HF range as support of modern operations

    Directory of Open Access Journals (Sweden)

    Miljko Erić

    2004-05-01

    Full Text Available U ovom radu je, polazeći od opštih principa izviđanja radio-komunikacija analiziran problem izviđanja radio-komunikacija u VF opsegu 1,6-30 MHz na operativno-strategijskom nivou koje se sprovodi u funkciji obaveštajnog obezbeđenja. Izložen je koncept širokopojasnog multifunkcionalnog radio-goniometra u kojem su integrisane funkcije automatskog presretanja i goniometrisanja signala, koji treba da omogući trenutni i potpuni nadzor (otkrivanje i goniometrisanje svih aktivnih emisija u kompletnom VF frekvencijskom opsegu koje nisu kraće od 10 ms. Ovaj goniometar predstavlja osnovicu budućeg automatizovanog radioizviđačkog sistema za VF opseg, koji sistemu komandovanja savremenim operacijama treba da omogući potpuni uvid u stanje, odnosno praćenje aktivnosti radio-komunikacija u kompletnom VF opsegu, što postojeći sistem za izviđanje VF frekvencijskog opsega ne obezbeđuje. Izložena problematika zasniva se na analizi iskustava i trendova u ovoj oblasti u svetu, na iskustvima stečenim u VTI kroz dosadašnje istraživačke i razvojne zadatke, posebno kroz razvoj i terenska ispitivanja radio-goniometra za VVF/UVF opseg. / Starting from the elaboration of the basic principles of communication intelligence, a problem of communication intelligence in HF range 1,6-30 MHz on the operational-strategic level is analyzed in detail. A concept of the wide-band multifunctional direction finder with integrated intercept and direction finding functions is presented. The direction finder should provide complete surveillance of the HF range and interception with direction finding of all active signals in given frequency range which are not shorter than 10 ms. The direction finder is the key element of the future automated radio reconnaissance system for the HF range, that should provide a complete insight of the signal activities in the HF range, which the existing communication intelligence system does not provide. The subject matter of this paper

  5. Functional Median Polish

    KAUST Repository

    Sun, Ying

    2012-08-03

    This article proposes functional median polish, an extension of univariate median polish, for one-way and two-way functional analysis of variance (ANOVA). The functional median polish estimates the functional grand effect and functional main factor effects based on functional medians in an additive functional ANOVA model assuming no interaction among factors. A functional rank test is used to assess whether the functional main factor effects are significant. The robustness of the functional median polish is demonstrated by comparing its performance with the traditional functional ANOVA fitted by means under different outlier models in simulation studies. The functional median polish is illustrated on various applications in climate science, including one-way and two-way ANOVA when functional data are either curves or images. Specifically, Canadian temperature data, U. S. precipitation observations and outputs of global and regional climate models are considered, which can facilitate the research on the close link between local climate and the occurrence or severity of some diseases and other threats to human health. © 2012 International Biometric Society.

  6. Thermal fluctuations induced in a conducting wall by mixing sodium jets: an application of TRIO-VF using Large Eddy Simulation modelling

    International Nuclear Information System (INIS)

    Menant, B.; Villand, M.

    1994-01-01

    The general-purpose thermal-hydraulics program TRIO-VF allows explicit simulation of the main instabilities in an un-compressible flow: it has been applied to the prediction of flow instabilities in a sodium hot jet through a transverse cold flow. in front of a conducting wall. The temperature fluctuations induced in the flow and the wall are studied and an acute skin-effect is evidenced. The temperature gradients (including three components) are analysed: temperature gradients up to 20000 degrees per meter are currently seen in the skin. They are due to the very strong value of the unstationary component normal to the fluid-wall interface. The limitations of TRIO-VF in the present state, and the lack of experimental support for validation does not allow to promise quantitative applications of this modelling to complex industrial situations nowadays, but we hope these applications are for tomorrow. (author)

  7. Myofibroma in the Palm Presenting with Median Nerve Compression Symptoms

    Directory of Open Access Journals (Sweden)

    Heidi Sarkozy, PA-C, BS

    2014-08-01

    Full Text Available Summary: A myofibroma is a benign proliferation of myofibroblasts in the connective tissue. Solitary myofibromas are a rare finding especially in an adult. We report a case of a 23-year-old man presenting with an enlarging mass over his right palm. The patient is an active weight lifter. He reported numbness and tingling in the median nerve distribution. Nerve conduction studies and magnetic resonance imaging scans suggested a tumor involving or compressing the median nerve. The final diagnosis of myofibroma was made only after the histopathological diagnosis.

  8. Range Selection and Median

    DEFF Research Database (Denmark)

    Jørgensen, Allan Grønlund; Larsen, Kasper Green

    2011-01-01

    and several natural special cases thereof. The rst special case is known as range median, which arises when k is xed to b(j 􀀀 i + 1)=2c. The second case, denoted prex selection, arises when i is xed to 0. Finally, we also consider the bounded rank prex selection problem and the xed rank range......Range selection is the problem of preprocessing an input array A of n unique integers, such that given a query (i; j; k), one can report the k'th smallest integer in the subarray A[i];A[i+1]; : : : ;A[j]. In this paper we consider static data structures in the word-RAM for range selection...... selection problem. In the former, data structures must support prex selection queries under the assumption that k for some value n given at construction time, while in the latter, data structures must support range selection queries where k is xed beforehand for all queries. We prove cell probe lower bounds...

  9. vfødte børn og deres livsbetingelser

    DEFF Research Database (Denmark)

    Bengtsson, Steen; Larsen, Lena Bech; Lindsay Sommer, Mette

    Formålet med denne rapport er at give et bredt billede af levevilkår for den første generation af døvfødte børn, som er vokset op med behandlingen Cochlear Implantat (CI), og derved får bedre mulighed for at lære at lytte og tale. CI har betydet et stort fremskridt for mennesker, der bliver født...... døve. De får således lært at læse meget bedre end gruppen tidligere gjorde. CI løser dog langtfra alle problemer. Rapporten viser, at selv om børnene nu har mulighed for at kommunikere ved at lytte og tale, er de slet ikke kommet på linje med gruppen af børn, som er født uden hørehandicap. Baggrunden...... for dette er dels, at deres hørelse begynder at fungere senere end andre børns, dels at hørelse med CI slet ikke har samme kvalitet som naturlig hørelse. Det er vanskeligt at følge med, når flere mennesker deltager i samtaler, og i uformelle sammenhænge, fx sammen med kammerater. Undersøgelsen er bestilt af...

  10. Verbal Final Exam in Introductory Biology Yields Gains in Student Content Knowledge and Longitudinal Performance

    Science.gov (United States)

    Luckie, Douglas B.; Rivkin, Aaron M.; Aubry, Jacob R.; Marengo, Benjamin J.; Creech, Leah R.; Sweeder, Ryan D.

    2013-01-01

    We studied gains in student learning over eight semesters in which an introductory biology course curriculum was changed to include optional verbal final exams (VFs). Students could opt to demonstrate their mastery of course material via structured oral exams with the professor. In a quantitative assessment of cell biology content knowledge, students who passed the VF outscored their peers on the medical assessment test (MAT), an exam built with 40 Medical College Admissions Test (MCAT) questions (66.4% [n = 160] and 62% [n = 285], respectively; p students performed better on MCAT questions in all topic categories tested; the greatest gain occurred on the topic of cellular respiration. Because the VF focused on a conceptually parallel topic, photosynthesis, there may have been authentic knowledge transfer. In longitudinal tracking studies, passing the VF also correlated with higher performance in a range of upper-level science courses, with greatest significance in physiology, biochemistry, and organic chemistry. Participation had a wide range but not equal representation in academic standing, gender, and ethnicity. Yet students nearly unanimously (92%) valued the option. Our findings suggest oral exams at the introductory level may allow instructors to assess and aid students striving to achieve higher-level learning. PMID:24006399

  11. [French translation and validation of a short version of the Suicide Intervention Response Inventory-2 (SIRI-2-VF)].

    Science.gov (United States)

    Kopp-Bigault, C; Audouard-Marzin, Y; Scouarnec, P; Beauchamp, G; Séguin, M; Walter, M

    2017-10-30

    Training health professionals about suicidal crisis is one major line of suicide prevention worldwide. France has one of the highest suicide rates in Europe, and although crisis intervention training has been set up since 2001, there presently is no training assessment tool in the French language for health professionals trained in suicide prevention. In the four levels of Kirpatrick's education pyramid, training that takes place in France today solely assesses level one status, that is to say relative to the level of satisfaction of participants (self-report). This study proposes a validated short French version of the Suicide Intervention Response Inventory-2 (SIRI-2) of Neimeyer & Mc Innes. The SIRI-2 questionnaire assesses the ability of first line intervention in dealing with suicidal individuals. The translation methodology was inspired from Vallerand's model of cross-cultural back translation. This method is regularly used for translating from the English language to a French version. In order to translate the English version, we used an extensive 7-step methodology implicating several bilingual translators, expert reviewers (psychologists and psychiatrists) and a scientific committee. Participants were 107 students from different French universities and study programs: psychology, medicine and nursing (17 were men; average age was 26.6). Fifteen of these participants answered the SIRI-2-VF on two occasions (separated by a 15-day interval) in order to estimate the temporal stability of the instrument. The scores of the students were compared to six French experts in suicide prevention and with the original expert group who worked on the development of SIRI-2 (n=7). We used Student t Test for construct validity, Cronbach's Alpha for internal consistency and Pearson's correlation coefficient for temporal stability. Following a fidelity comparison of the results of the French experts with those of the American experts, ten items presenting the least good

  12. Sosiaalisen median mahdollisuudet Tilastokeskukselle

    OpenAIRE

    Vesterinen, Anu

    2011-01-01

    Tämän opinnäytetyön aiheena oli sosiaalisen median mahdollisuudet Tilastokeskuksen viestinnässä. Työn tavoitteena oli kartoittaa sosiaalisen median käyttöön liittyviä mahdollisuuksia ja haasteita sekä selvittää siihen liittyviä odotuksia Tilastokeskuksen henkilöstön keskuudessa. Työn teoriaosuudessa tarkasteltiin sosiaalista mediaa käsitteenä ja esiteltiin sosiaalisen median käyttöä organisaation ulkoisen viestinnän välineenä. Opinnäytetyössä selvitettiin teoriatietoon pohjautuen sekä ca...

  13. Sosiaalisen median markkinointistrategia

    OpenAIRE

    Tran, Jenny

    2017-01-01

    Insinöörityön tavoitteena oli suunnitella toimeksiantajayritykselle sopiva sosiaalisen median markkinointistrategia ja avustaa sen toteutuksessa sekä tuottaen sisältöä sovittuihin kanaviin. Pyrkimyksenä oli myös kouluttaa yrityksen henkilökuntaa käyttämään sosiaalista mediaa yleisellä tasolla ja markkinoinnissa tutustuttamalla heidät sosiaalisen median erilaisiin kanaviin ja mainostyökaluihin. Opinnäytetyössä keskityttiin tutkimaan Facebookissa toimivaa markkinointia ja siinä toimivia mai...

  14. Development and validation of a Luminex assay for detection of a predictive biomarker for PROSTVAC-VF therapy

    Science.gov (United States)

    Lucas, Julie L.; Tacheny, Erin A.; Ferris, Allison; Galusha, Michelle; Srivastava, Apurva K.; Ganguly, Aniruddha; Williams, P. Mickey; Sachs, Michael C.; Thurin, Magdalena; Tricoli, James V.; Ricker, Winnie; Gildersleeve, Jeffrey C.

    2017-01-01

    Cancer therapies can provide substantially improved survival in some patients while other seemingly similar patients receive little or no benefit. Strategies to identify patients likely to respond well to a given therapy could significantly improve health care outcomes by maximizing clinical benefits while reducing toxicities and adverse effects. Using a glycan microarray assay, we recently reported that pretreatment serum levels of IgM specific to blood group A trisaccharide (BG-Atri) correlate positively with overall survival of cancer patients on PROSTVAC-VF therapy. The results suggested anti-BG-Atri IgM measured prior to treatment could serve as a biomarker for identifying patients likely to benefit from PROSTVAC-VF. For continued development and clinical application of serum IgM specific to BG-Atri as a predictive biomarker, a clinical assay was needed. In this study, we developed and validated a Luminex-based clinical assay for measuring serum IgM specific to BG-Atri. IgM levels were measured with the Luminex assay and compared to levels measured using the microarray for 126 healthy individuals and 77 prostate cancer patients. This assay provided reproducible and consistent results with low %CVs, and tolerance ranges were established for the assay. IgM levels measured using the Luminex assay were found to be highly correlated to the microarray results with R values of 0.93–0.95. This assay is a Laboratory Developed Test (LDT) and is suitable for evaluating thousands of serum samples in CLIA certified laboratories that have validated the assay. In addition, the study demonstrates that discoveries made using neoglycoprotein-based microarrays can be readily migrated to a clinical assay. PMID:28771597

  15. [Autism spectrum disorder and evaluation of perceived stress parents and professionals: Study of the psychometric properties of a French adaptation of the Appraisal of Life Event Scale (ALES-vf)].

    Science.gov (United States)

    Cappe, É; Poirier, N; Boujut, É; Nader-Grosbois, N; Dionne, C; Boulard, A

    2017-08-01

    from the original three-factor model of Ferguson and his collaborators. Confirmatory analyzes were conducted on data from 173 other parents to test two exploratory models and the original model of Ferguson. It has also been tested on data from 305 professionals (paramedical professionals and teachers) and on the whole sample (parents and professionals). The results suggest a better match of the original three-factor model. In addition, Cronbach's alpha coefficients and inter-item correlations showed a good internal consistency for these three factors. Finally, variance analysis and regressions were performed to test the effect of the nationality of the parents, the child's level of autonomy, the child's level of communication, and on the perceived stress by experienced professionals. ALES-vf, after our adaptation has good psychometric properties for use not only with parents but also with professionals (teachers, educators, psychologists) working with children with ASD. Our analyses showed that the nationality of the parents does not significantly influence the subscales « threat » and « challenge » of ALES-vf, which makes it usable in other Francophone countries. Specificities in the subscales were identified based on group membership (parents and professionals). For example parents get higher average scores on subscales « loss » and « threat » and a lower average score on the subscale « challenge », compared to professionals. Finally, regarding the specifics found among professionals, the results show that the years of experience have an effect on perceived stress. Specifically, teachers and educators who have more experience perceive their work with children with ASD as a challenge. This is consistent with the results of studies showing that teachers who have had experience with children with ASD had less difficulty in their interventions. Copyright © 2016 L'Encéphale, Paris. Published by Elsevier Masson SAS. All rights reserved.

  16. Thrombosed persistent median artery causing carpal tunnel syndrome associated with bifurcated median nerve: A case report

    International Nuclear Information System (INIS)

    Salter, M.; Sinha, N. R.; Szmigielski, W.

    2011-01-01

    Background: Carpal tunnel syndrome is a sporadically occurring abnormality due to compression of median nerve. It is exceedingly rare for it to be caused by thrombosis of persistent median artery. Case Report: A forty two year old female was referred for ultrasound examination due to ongoing wrist pain, not relived by pain killers and mild paraesthesia on the radial side of the hand. High resolution ultrasound and Doppler revealed a thrombosed persistent median artery and associated bifurcated median nerve. The thrombus resolved on treatment with anticoagulants. Conclusions: Ultrasound examination of the wrist when done for patients with carpal tunnel syndrome should preferably include looking for persistent median artery and its patency. (authors)

  17. Plasma nitriding and simultaneous tempering of VF 800AT tool steel; Nitretacao por plasma com revenimento simultaneo do aco ferramenta VF 800AT

    Energy Technology Data Exchange (ETDEWEB)

    Prass, Andre Ricardo; Fontana, Luis Cesar; Recco, Abel Andre Candido, E-mail: prass.andrericardo@gmail.com, E-mail: luis.fontana@udesc.br, E-mail: abel.recco@udesc.br [Universidade do Estado de Santa Catarina (UDESC), Joinville, SC (Brazil)

    2017-04-15

    Plasma nitriding of tool steels improves the surface hardness due to formation of diffusion zone and/or compound layer. The process parameters such as temperature, gas composition and dwell time, allow to control the layer thickness, the microstructure, the crystalline phases and the type of layer (for example white layer or diffusion zone). This paper discusses an alternative procedure for the heat treatment of tempering and surface treatment, both in plasma or combining conventional heat treatment with subsequent plasma nitriding. Carrying out both treatments in plasma could enable reduction in manufacturing costs, lower energy consumption and less time for tools manufacturing. Samples of VF800AT steel were treated and characterized (at surface and core of samples) through the following technique: X-ray diffraction, optical microscopy, scanning electron microscopy, micro-hardness profile and Rockwell C measurement. Temperature measurements during the plasma treatment, show that arise thermal gradient between the surface and the core of the samples. In this work, it was observed that the surface was up to 7% hotter than the core of sample, during the plasma treatment with temperature of magnitude about 5 x 10{sup 2} °C. This thermal gradient seems inherent to the plasma process, so that it can produce different microstructure, hardness and crystalline phases between core and edge of samples. However, when two tempering operations are prior carried out in a muffle furnace and the third tempering treatment is subsequently carried out simultaneously with the plasma nitriding, it is observed that the microstructure, the crystalline phases, hardness and micro hardness (in both, edge and core) are similar to treatments done in conventional mode cycle (in muffle furnace) with subsequent plasma nitriding. (author)

  18. A comparison of freeway median crash frequency, severity, and barrier strike outcomes by median barrier type.

    Science.gov (United States)

    Russo, Brendan J; Savolainen, Peter T

    2018-08-01

    Median-crossover crashes are among the most hazardous events that can occur on freeways, often resulting in severe or fatal injuries. The primary countermeasure to reduce the occurrence of such crashes is the installation of a median barrier. When installation of a median barrier is warranted, transportation agencies are faced with the decision among various alternatives including concrete barriers, beam guardrail, or high-tension cable barriers. Each barrier type differs in terms of its deflection characteristics upon impact, the required installation and maintenance costs, and the roadway characteristics (e.g., median width) where installation would be feasible. This study involved an investigation of barrier performance through an in-depth analysis of crash frequency and severity data from freeway segments where high-tension cable, thrie-beam, and concrete median barriers were installed. A comprehensive manual review of crash reports was conducted to identify crashes in which a vehicle left the roadway and encroached into the median. This review also involved an examination of crash outcomes when a barrier strike occurred, which included vehicle containment, penetration, or re-direction onto the travel lanes. The manual review of crash reports provided critical supplementary information through narratives and diagrams not normally available through standard fields on police crash report forms. Statistical models were estimated to identify factors that affect the frequency, severity, and outcomes of median-related crashes, with particular emphases on differences between segments with varying median barrier types. Several roadway-, traffic-, and environmental-related characteristics were found to affect these metrics, with results varying across the different barrier types. The results of this study provide transportation agencies with important guidance as to the in-service performance of various types of median barrier. Copyright © 2018 Elsevier Ltd. All rights

  19. Sosiaalisen median riskit yritysmaailmassa

    OpenAIRE

    Kilpinen, Joni

    2015-01-01

    Sosiaalisen median palveluista on kirjoitettu lukuisia kirjoja ja artikkeleita, joissa niitä ylistetään varsinkin yritysnäkökulmasta. Vaikka sosiaalinen media on muuttanut olennaisesti tapaa, jolla keskustella, mainostaa, etsiä ja jakaa tietoa, piilee sen palveluiden käytössä kuitenkin erilaisia uhkakuvia. Yritykset ja asiantuntijat pelkäävät sosiaalisen median avoimuuden aiheuttavan suuria tietoturvariskejä. Lisäksi asiantuntijat ovat varoitelleet sosiaalisessa mediassa olevista haittaohjelm...

  20. GPU Accelerated Vector Median Filter

    Science.gov (United States)

    Aras, Rifat; Shen, Yuzhong

    2011-01-01

    Noise reduction is an important step for most image processing tasks. For three channel color images, a widely used technique is vector median filter in which color values of pixels are treated as 3-component vectors. Vector median filters are computationally expensive; for a window size of n x n, each of the n(sup 2) vectors has to be compared with other n(sup 2) - 1 vectors in distances. General purpose computation on graphics processing units (GPUs) is the paradigm of utilizing high-performance many-core GPU architectures for computation tasks that are normally handled by CPUs. In this work. NVIDIA's Compute Unified Device Architecture (CUDA) paradigm is used to accelerate vector median filtering. which has to the best of our knowledge never been done before. The performance of GPU accelerated vector median filter is compared to that of the CPU and MPI-based versions for different image and window sizes, Initial findings of the study showed 100x improvement of performance of vector median filter implementation on GPUs over CPU implementations and further speed-up is expected after more extensive optimizations of the GPU algorithm .

  1. Switching non-local median filter

    Science.gov (United States)

    Matsuoka, Jyohei; Koga, Takanori; Suetake, Noriaki; Uchino, Eiji

    2015-06-01

    This paper describes a novel image filtering method for removal of random-valued impulse noise superimposed on grayscale images. Generally, it is well known that switching-type median filters are effective for impulse noise removal. In this paper, we propose a more sophisticated switching-type impulse noise removal method in terms of detail-preserving performance. Specifically, the noise detector of the proposed method finds out noise-corrupted pixels by focusing attention on the difference between the value of a pixel of interest (POI) and the median of its neighboring pixel values, and on the POI's isolation tendency from the surrounding pixels. Furthermore, the removal of the detected noise is performed by the newly proposed median filter based on non-local processing, which has superior detail-preservation capability compared to the conventional median filter. The effectiveness and the validity of the proposed method are verified by some experiments using natural grayscale images.

  2. Molecular beam electric deflection of the tetrahalides CF4, CCl4, SiF4, SiCl4, GeCl4, TiF4, TiCl4, VF4, and VCl4

    International Nuclear Information System (INIS)

    Muenter, A.A.; Dyke, T.R.; Falconer, W.E.; Klemperer, W.

    1975-01-01

    Using molecular beam electric deflection, the temperature dependence of polar behavior has been studied for the molecules CF 4 , CCl 4 , SiF 4 , SiCl 4 , GeCl 4 , TiF 4 TiCl 4 , VF 4 , VF 4 , and VCl 4 . A number of these molecules show polar behavior consistent with a vibrationally induced dipole moment for states with one or both of the triply degenerate vibrations excited. In four of the tetrachloride species, the presence of a vibrationally induced dipole moment was confirmed by the change in polar behavior with isotopic substituion of the Cl atoms. The deflection behavior of the transition metal tetrahalides varied from nonpolar in VCl 4 to very polar in TiF 4

  3. Functional Median Polish

    KAUST Repository

    Sun, Ying; Genton, Marc G.

    2012-01-01

    polish is demonstrated by comparing its performance with the traditional functional ANOVA fitted by means under different outlier models in simulation studies. The functional median polish is illustrated on various applications in climate science

  4. Five Roots Pattern of Median Nerve Formation

    Directory of Open Access Journals (Sweden)

    Konstantinos Natsis

    2016-04-01

    Full Text Available An unusual combination of median nerve’s variations has been encountered in a male cadaver during routine educational dissection. In particular, the median nerve was formed by five roots; three roots originated from the lateral cord of the brachial plexus joined individually the median nerve’s medial root. The latter (fourth root was united with the lateral (fifth root of the median nerve forming the median nerve distally in the upper arm and not the axilla as usually. In addition, the median nerve was situated medial to the brachial artery. We review comprehensively the relevant variants, their embryologic development and their potential clinical applications.

  5. A Zinc-Finger-Family Transcription Factor, AbVf19, Is Required for the Induction of a Gene Subset Important for Virulence in Alternaria brassicicola

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Akhil [Univ. of Hawaii, Manoa, HI (United States); Ohm, Robin A. [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Oxiles, Lindsay [Univ. of Hawaii, Manoa, HI (United States); Brooks, Fred [Univ. of Hawaii, Manoa, HI (United States); Lawrence, Christopher B. [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States); Grigoriev, Igor V. [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Cho, Yangrae [Univ. of Hawaii, Manoa, HI (United States)

    2011-10-26

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen with a broad host range within the family Brassicaceae. It produces secondary metabolites that marginally affect virulence. Cell wall degrading enzymes (CDWE) have been considered important for pathogenesis but none of them individually have been identified as significant virulence factors in A. brassicicola. In this study, knockout mutants of a gene, AbVf19, were created and produced considerably smaller lesions than the wild type on inoculated host plants. The presence of tandem zinc-finger domains in the predicted amino acid sequence and nuclear localization of AbVf19- reporter protein suggested that it was a transcription factor. Gene expression comparisons using RNA-seq identified 74 genes being downregulated in the mutant during a late stage of infection. Among the 74 downregulated genes, 28 were putative CWDE genes. These were hydrolytic enzyme genes that composed a small fraction of genes within each family of cellulases, pectinases, cutinases, and proteinases. The mutants grew slower than the wild type on an axenic medium with pectin as a major carbon source. This study demonstrated the existence and the importance of a transcription factor that regulates a suite of genes that are important for decomposing and utilizing plant material during the late stage of plant infection.

  6. Permasalahan P-Hub Median Dengan Lintasan Terpendek

    OpenAIRE

    Pasaribu, Raja David

    2013-01-01

    Hub are facilities that serve as sorting, switching, and transhipment in a transportation network. P-hub median problem is a discrete case location allocation problem which all hub is fully connected. In this paper will be intoduced Mixed Integrer Linear Programming (MILP) formulation models of cost for p-hub median problem allocation for uncapacitaced single allocation p-hub median(USApHMP). In this paper also introduced Floyd-Warshall shortest path algorithm to solve p-hub median problems a...

  7. Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization.

    Science.gov (United States)

    Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya

    2015-01-01

    Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

  8. Effect of therapy switch on time to second-line antiretroviral treatment failure in HIV-infected patients.

    Science.gov (United States)

    Häggblom, Amanda; Santacatterina, Michele; Neogi, Ujjwal; Gisslen, Magnus; Hejdeman, Bo; Flamholc, Leo; Sönnerborg, Anders

    2017-01-01

    Switch from first line antiretroviral therapy (ART) to second-line ART is common in clinical practice. However, there is limited knowledge of to which extent different reason for therapy switch are associated with differences in long-term consequences and sustainability of the second line ART. Data from 869 patients with 14601 clinical visits between 1999-2014 were derived from the national cohort database. Reason for therapy switch and viral load (VL) levels at first-line ART failure were compared with regard to outcome of second line ART. Using the Laplace regression model we analyzed the median, 10th, 20th, 30th and 40th percentile of time to viral failure (VF). Most patients (n = 495; 57.0%) switched from first-line to second-line ART without VF. Patients switching due to detectable VL with (n = 124; 14.2%) or without drug resistance mutations (DRM) (n = 250; 28.8%) experienced VF to their second line regimen sooner (median time, years: 3.43 (95% CI 2.90-3.96) and 3.20 (95% 2.65-3.75), respectively) compared with those who switched without VF (4.53 years). Furthermore level of VL at first-line ART failure had a significant impact on failure of second-line ART starting after 2.5 years of second-line ART. In the context of life-long therapy, a median time on second line ART of 4.53 years for these patients is short. To prolong time on second-line ART, further studies are needed on the reasons for therapy changes. Additionally patients with a high VL at first-line VF should be more frequently monitored the period after the therapy switch.

  9. Effect of therapy switch on time to second-line antiretroviral treatment failure in HIV-infected patients.

    Directory of Open Access Journals (Sweden)

    Amanda Häggblom

    Full Text Available Switch from first line antiretroviral therapy (ART to second-line ART is common in clinical practice. However, there is limited knowledge of to which extent different reason for therapy switch are associated with differences in long-term consequences and sustainability of the second line ART.Data from 869 patients with 14601 clinical visits between 1999-2014 were derived from the national cohort database. Reason for therapy switch and viral load (VL levels at first-line ART failure were compared with regard to outcome of second line ART. Using the Laplace regression model we analyzed the median, 10th, 20th, 30th and 40th percentile of time to viral failure (VF.Most patients (n = 495; 57.0% switched from first-line to second-line ART without VF. Patients switching due to detectable VL with (n = 124; 14.2% or without drug resistance mutations (DRM (n = 250; 28.8% experienced VF to their second line regimen sooner (median time, years: 3.43 (95% CI 2.90-3.96 and 3.20 (95% 2.65-3.75, respectively compared with those who switched without VF (4.53 years. Furthermore level of VL at first-line ART failure had a significant impact on failure of second-line ART starting after 2.5 years of second-line ART.In the context of life-long therapy, a median time on second line ART of 4.53 years for these patients is short. To prolong time on second-line ART, further studies are needed on the reasons for therapy changes. Additionally patients with a high VL at first-line VF should be more frequently monitored the period after the therapy switch.

  10. The mean, the median, and the St. Petersburg paradox.

    Science.gov (United States)

    Hayden, Benjamin Y; Platt, Michael L

    2009-06-01

    The St. Petersburg Paradox is a famous economic and philosophical puzzle that has generated numerous conflicting explanations. To shed empirical light on this phenomenon, we examined subjects' bids for one St. Petersburg gamble with a real monetary payment. We found that bids were typically lower than twice the smallest payoff, and thus much lower than is generally supposed. We also examined bids offered for several hypothetical variants of the St. Petersburg Paradox. We found that bids were weakly affected by truncating the gamble, were strongly affected by repeats of the gamble, and depended linearly on the initial "seed" value of the gamble. One explanation, which we call the median heuristic , strongly predicts these data. Subjects following this strategy evaluate a gamble as if they were taking the median rather than the mean of the payoff distribution. Finally, we argue that the distribution of outcomes embodied in the St. Petersburg paradox is so divergent from the Gaussian form that the statistical mean is a poor estimator of expected value, so that the expected value of the St. Petersburg gamble is undefined. These results suggest that this classic paradox has a straightforward explanation rooted in the use of a statistical heuristic.

  11. The Ultrasonographic Findings of Bifid Median Nerve

    International Nuclear Information System (INIS)

    Park, Hee Jin; Park, Noh Hyuck; Joh, Joon Hee; Lee, Sung Moon

    2009-01-01

    We wanted to evaluate the ultrasonographic findings of bifid median nerve and its clinical significance. We retrospectively reviewed five cases (three men and two women, mean age: 54 years) of incidentally found bifid median nerve from 264 cases of clinically suspected carpal-tunnel syndrome that were seen at our hospital during last 6 years. Doppler sonography was performed in all five cases and MR angiography was done in one case for detecting a persistent median artery. The difference (ΔCSA) between the sum of the cross-sectional areas of the bifid median nerve at the pisiform level (CSA2) and the cross-sectional area proximal to the bifurcation(CSA1) was calculated. The incidence of a bifid median nerve was 1.9%. All the patients presented with a tingling sensation on a hand and two patients had nocturnal pain. All the cases showed bifurcation of the nerve bundle proximal to the carpal tunnel. The margins appeared relatively smooth and each bundle showed a characteristic fascicular pattern. A persistent median artery was noted between the bundles in four cases. ΔCSA was more than 2 mm 2 in four cases. Bifid median nerve with a persistent median artery is a relatively rare normal variance and these are very important findings before performing surgical intervention to avoid potential nerve injury and massive bleeding. We highly suggest that radiologists should understand the anatomical characteristics of this anomaly and make efforts to detect it

  12. Educational system, income inequality and growth: the median voter's decision

    Directory of Open Access Journals (Sweden)

    Joilson Dias

    2005-03-01

    Full Text Available I analyze a long run educational policy as a mechanism to close the income gap among low, median and high-income families. If the choice is made endogenous by the use of the median voter theorem, the results are as follow: i public education system guarantees income convergence, however the income growth rate of the median voter is smaller; ii the combination public and private (hybrid educational system allows faster income growth rate, but income inequality is almost the natural outcome. The ending result is that the combination public and private system will prevail, since the income growth rate of the median voter is higher in this system. This might explain the persistence and differences of income inequality among the economies.O objetivo deste artigo é analisar a utilização da política educacional no longo prazo como mecanismo para a redução da desigualdade de renda entre famílias de renda baixa, mediana e alta. Se a decisão sobre a política for endogeneizada, de acordo com o teorema do eleitor mediano, os resultados são os seguintes: i o sistema educacional público para todos, apesar de garantir convergência de renda, produz uma menor taxa de crescimento da renda do eleitor mediano; ii a combinação público-privado (sistema educacional híbrido permite uma maior taxa de crescimento da renda do eleitor mediano, no entanto a desigualdade de renda é inerente a este sistema. Como resultado final, o eleitor mediano irá escolher o sistema público-privado, pois o crescimento da sua renda é maior, o que pode explicar a persistência e as diferenças na desigualdade de renda das economias.

  13. Testing the gravity p-median model empirically

    Directory of Open Access Journals (Sweden)

    Kenneth Carling

    2015-12-01

    Full Text Available Regarding the location of a facility, the presumption in the widely used p-median model is that the customer opts for the shortest route to the nearest facility. However, this assumption is problematic on free markets since the customer is presumed to gravitate to a facility by the distance to and the attractiveness of it. The recently introduced gravity p-median model offers an extension to the p-median model that account for this. The model is therefore potentially interesting, although it has not yet been implemented and tested empirically. In this paper, we have implemented the model in an empirical problem of locating vehicle inspections, locksmiths, and retail stores of vehicle spare-parts for the purpose of investigating its superiority to the p-median model. We found, however, the gravity p-median model to be of limited use for the problem of locating facilities as it either gives solutions similar to the p-median model, or it gives unstable solutions due to a non-concave objective function.

  14. Switching non-local vector median filter

    Science.gov (United States)

    Matsuoka, Jyohei; Koga, Takanori; Suetake, Noriaki; Uchino, Eiji

    2016-04-01

    This paper describes a novel image filtering method that removes random-valued impulse noise superimposed on a natural color image. In impulse noise removal, it is essential to employ a switching-type filtering method, as used in the well-known switching median filter, to preserve the detail of an original image with good quality. In color image filtering, it is generally preferable to deal with the red (R), green (G), and blue (B) components of each pixel of a color image as elements of a vectorized signal, as in the well-known vector median filter, rather than as component-wise signals to prevent a color shift after filtering. By taking these fundamentals into consideration, we propose a switching-type vector median filter with non-local processing that mainly consists of a noise detector and a noise removal filter. Concretely, we propose a noise detector that proactively detects noise-corrupted pixels by focusing attention on the isolation tendencies of pixels of interest not in an input image but in difference images between RGB components. Furthermore, as the noise removal filter, we propose an extended version of the non-local median filter, we proposed previously for grayscale image processing, named the non-local vector median filter, which is designed for color image processing. The proposed method realizes a superior balance between the preservation of detail and impulse noise removal by proactive noise detection and non-local switching vector median filtering, respectively. The effectiveness and validity of the proposed method are verified in a series of experiments using natural color images.

  15. Scotoma analysis of 10-2 visual field testing with a white target in screening for hydroxychloroquine retinopathy

    Directory of Open Access Journals (Sweden)

    Browning DJ

    2015-05-01

    Full Text Available David J Browning, Chong Lee Department of Ophthalmology, Charlotte Eye, Ear, Nose and Throat Associates, Charlotte, NC, USA Objective: To quantify the variability of scotomas detected by 10-2 visual field (VF testing in patients taking hydroxychloroquine without and with retinopathy.Design: Retrospective review of clinical charts and visual fields.Subjects: Twenty-one patients taking hydroxychloroquine without retinopathy, and nine patients taking hydroxychloroquine and one patient taking chloroquine with retinopathy.Methods: Retinopathy was defined by annular scotomas on 10-2 VF testing with corroborative spectral domain optical coherence tomographic outer retinal changes and multifocal electroretinographic changes leading to cessation of hydroxychloroquine or chloroquine. Location and depth of scotoma points on 10-2 VF testing were recorded and their fates followed in serial, reliable 10-2 VFs performed with a white target over time.Main outcome measures: Number of scotoma points and locations, percentage of persistent scotoma points, size of scotomas, location of scotomas, and percentage of scotomas deepening.Results: A median of five, interquartile range (IQR 3–8 scotoma points per VF occurred in patients without retinopathy. A median of 86%, IQR 63%–100% of these points resolve on the subsequent field. For patients with retinopathy, a median of 22%, IQR 10%–59% resolve. The median percentage of scotoma points in the zone 2–8 degrees from fixation in eyes with retinopathy was 79%, IQR 68%–85% compared to 60%, IQR 54%–75% in eyes without retinopathy (P=0.0094. Single-point scotomas were more common in eyes without than with retinopathy. Scotomas consisting of more than four contiguous scotoma points were generally indicative of retinopathy.Conclusion: Point scotomas are common and variable in 10-2 VF testing with a white target for hydroxychloroquine retinopathy in subjects without retinopathy. The annular zone 2 to 8

  16. Betydningen af en række faktorer for døvfødte børn med CI

    DEFF Research Database (Denmark)

    Bengtsson, Steen; Larsen, Lena Bech

    2014-01-01

    Formålet med dette notat er ved hjælp af data fra SFI's undersøgelse af levevilkår for døvfødte børn med CI at belyse spørgsmålet om, hvad forskellige faktorer betyder for deres situation. Spørgsmålet er belyst ved at se på syv forhold, som repræsenterer forskellige sider af det resultat, som...... barnet har fået af CI-behandlingen. Vi belyser resultatet af behandlingen med spørgsmål, der giver vurderinger af: 1) barnets handicap, 2) barnets skolepræstationer, 3) barnets emotionelle forstyrrelser, 4) om barnet er en enspænder, 5) omfang af barnets besøg hos kammerater, 6) forældrenes bekymring...

  17. The mean, the median, and the St. Petersburg paradox

    Directory of Open Access Journals (Sweden)

    Benjamin Y. Hayden

    2009-06-01

    Full Text Available The St.~Petersburg Paradox is a famous economic and philosophical puzzle that has generated numerous conflicting explanations. To shed empirical light on this phenomenon, we examined subjects' bids for one St.~Petersburg gamble with a real monetary payment. We found that bids were typically lower than twice the smallest payoff, and thus much lower than is generally supposed. We also examined bids offered for several hypothetical variants of the St.~Petersburg Paradox. We found that bids were weakly affected by truncating the gamble, were strongly affected by repeats of the gamble, and depended linearly on the initial ``seed'' value of the gamble. One explanation, which we call the extit{median} extit{heuristic}, strongly predicts these data. Subjects following this strategy evaluate a gamble as if they were taking the median rather than the mean of the payoff distribution. Finally, we argue that the distribution of outcomes embodied in the St.~Petersburg paradox is so divergent from the Gaussian form that the statistical mean is a poor estimator of expected value, so that the expected value of the St.~Petersburg gamble is undefined. These results suggest that this classic paradox has a straightforward explanation rooted in the use of a statistical heuristic.

  18. Median Nerve Conduction in Healthy Nigerians: Normative Data

    African Journals Online (AJOL)

    of median nerve disease using multiple studies, and rendering ... Aim: To develop normative values for motor and sensory median nerve ..... Table 5: Comparison of median motor nerve conduction study parameters to studies elsewhere. Study.

  19. Relationships between the Brook Street Terrane and Median Tectonic Zone (Median Batholith) : evidence from Jurassic conglomerates

    International Nuclear Information System (INIS)

    Tulloch, A.J.; Kimbrough, D.L.; Landis, C.A.; Mortimer, N.; Johnston, M.R.

    1999-01-01

    U-Pb zircon ages of 237-180 Ma and c. 280 Ma of seven granitoid clasts from the Rainy River Conglomerate which lies within the eastern Median Tectonic Zone (Median Batholith) in Nelson, and the Barretts Formation of the Brook Street Terrane in Southland, constrain the depositional ages of both units to be no older than c. 180-200 Ma (Early Jurassic). The minimum age of the Rainy River Conglomerate is constrained by the 147 +2 -1 Ma (Latest Jurassic) emplacement age of the One Mile Gabbronorite (new name: previously western Buller Diorite). The ages and chemistry of five of the granitoid clasts are broadly compatible with derivation from rocks that are now represented by Triassic plutons of the Median Tectonic Zone (Median Batholith), although ages as young as 180 Ma are slightly outside the range of the latter as currently exposed in New Zealand. The age (273-290 Ma, 237 +/- 3 Ma) and chemistry of the other two clasts (one each from Rainy River Conglomerate and Barretts Formation) suggest derivation from the Brook Street Terrane. Similarity in stratigraphic age, depositional characteristics, granitoid clast ages and composition between Rainy River Conglomerate and Barretts Formation suggests that they are broadly correlative and collectively overlapped a combined Brook Street Terrane - Median Batholith (MTZ) before the Late Jurassic (147 +2 -1 Ma). Sedimentary overlap may also have continued across to Middle Jurassic conglomeratic strata in the Murihiku Terrane to the east of the Brook Street Terrane. A U-Pb zircon age of 261 +/- 2 Ma is reported for Pourakino Trondhjemite of the Brook Street Terrane. (author). 56 refs., 10 figs., 4 tabs

  20. Median and ulnar neuropathies in university guitarists.

    Science.gov (United States)

    Kennedy, Rachel H; Hutcherson, Kimberly J; Kain, Jennifer B; Phillips, Alicia L; Halle, John S; Greathouse, David G

    2006-02-01

    Descriptive study. To determine the presence of median and ulnar neuropathies in both upper extremities of university guitarists. Peripheral nerve entrapment syndromes of the upper extremities are well documented in musicians. Guitarists and plucked-string musicians are at risk for entrapment neuropathies in the upper extremities and are prone to mild neurologic deficits. Twenty-four volunteer male and female guitarists (age range, 18-26 years) were recruited from the Belmont University School of Music and the Vanderbilt University Blair School of Music. Individuals were excluded if they were pregnant or had a history of recent upper extremity or neck injury. Subjects completed a history form, were interviewed, and underwent a physical examination. Nerve conduction status of the median and ulnar nerves of both upper extremities was obtained by performing motor, sensory, and F-wave (central) nerve conduction studies. Descriptive statistics of the nerve conduction study variables were computed using Microsoft Excel. Six subjects had positive findings on provocative testing of the median and ulnar nerves. Otherwise, these guitarists had normal upper extremity neural and musculoskeletal function based on the history and physical examinations. When comparing the subjects' nerve conduction study values with a chart of normal nerve conduction studies values, 2 subjects had prolonged distal motor latencies (DMLs) of the left median nerve of 4.3 and 4.7 milliseconds (normal, DMLs are compatible with median neuropathy at or distal to the wrist. Otherwise, all electrophysiological variables were within normal limits for motor, sensory, and F-wave (central) values. However, comparison studies of median and ulnar motor latencies in the same hand demonstrated prolonged differences of greater than 1.0 milliseconds that affected the median nerve in 2 additional subjects, and identified contralateral limb involvement in a subject with a prolonged distal latency. The other 20

  1. Scotoma analysis of 10–2 visual field testing with a red target in screening for hydroxychloroquine retinopathy

    Directory of Open Access Journals (Sweden)

    Browning DJ

    2015-08-01

    Full Text Available David J Browning, Chong LeeDepartment of Ophthalmology, Charlotte Eye, Ear, Nose and Throat Associates, Charlotte, NC, USAObjective: To quantify the variability of scotomas detected by 10–2 visual field (VF testing with a red target in patients taking hydroxychloroquine without and with retinopathy.Design: Retrospective review of clinical charts and VFs.Methods: Twenty-four patients taking hydroxychloroquine without retinopathy, and eight patients taking hydroxychloroquine with retinopathy were tested in this study. Retinopathy was defined by annular scotomas on 10–2 VF testing with corroborative spectral domain optical coherence tomographic outer retinal changes and multifocal electroretinographic changes leading to cessation of hydroxychloroquine or chloroquine. Location and depth of scotoma points on 10–2 VF testing were recorded and their fates followed in serial, reliable 10–2 VFs performed with a red target over time. The main outcome measures for this study were the number of scotoma points and locations, percentage of persistent scotoma points, size of scotomas, location of scotomas, and percentage of scotomas deepening. Results: A median of 3, interquartile range (IQR (2, 5, scotoma points per VF occurred in patients without retinopathy. A median of 86%, IQR (77, 100, of these resolved on the subsequent field. For patients with retinopathy, a median of 50%, IQR (46, 79, resolved, a difference compared to patients without retinopathy that was significant (P=0.0158. The median percentage of scotoma points in the zone from 2° to 8° from fixation in eyes with retinopathy was 72%, IQR (54, 100, compared to 49%, IQR (40, 54, in eyes without retinopathy (P=0.0069. The number of persistent scotoma locations at the last visit was higher in eyes with retinopathy: 3, IQR (1, 3, versus 0, IQR (0, 1, in patients without retinopathy, P=0.0156.Conclusion: Point scotomas are common and variable in 10–2 VF testing with a red target for

  2. The Effect of Type and Volume Fraction (Vf) of Steel Fiber on the Mechanical Properties of Self-Compacting Concrete

    DEFF Research Database (Denmark)

    Ghanbarpour, S.; Mazaheripour, H.; Mirmoradi, S. H.

    2010-01-01

    is to investigate the effects of type and volume fraction of steel fiber on the compressive strength, split tensile strength, flexural strength and modulus of elasticity of steel fiber reinforced self-compacting concrete (SFRSCC). Design/methodology/approach – For this purpose, Micro wire and Wave type steel fibers......Purpose – Self-compacting concrete (SCC) offers several economic and technical benefits; the use of steel fibers extends its possibilities. Steel fibers bridge cracks, retard their propagation, and improve several characteristics and properties of the SCC. The purpose of this paper...... – It was found that, inclusion of steel fibers significantly affect the split tensile and flexural strength of SCC accordance with type and vf. Besides, mathematical expressions were developed to estimate the flexural, modulus of elasticity and split tensile strength of SFRSCCs regarding of compressive strength...

  3. MEDIAN: Wireless broadband LAN for multimedia applications

    NARCIS (Netherlands)

    Vliet, P.J. van

    1998-01-01

    MEDIAN is one of the projects in the mobile domain of the Advanced Communications Technologies and Services (ACTS) programme of the European Commission. The main obiective of the MEDIAN project is to evaluate and implement a high speed Wireless Customer Premises / Local Area Network (WCPN/WLAN)

  4. On Preliminary Test Estimator for Median

    OpenAIRE

    Okazaki, Takeo; 岡崎, 威生

    1990-01-01

    The purpose of the present paper is to discuss about estimation of median with a preliminary test. Two procedures are presented, one uses Median test and the other uses Wilcoxon two-sample test for the preliminary test. Sections 3 and 4 give mathematical formulations of such properties, including mean square errors with one specified case. Section 5 discusses their optimal significance levels of the preliminary test and proposes their numerical values by Monte Carlo method. In addition to mea...

  5. Development of Kinematic Graphs of Median Nerve during Active Finger Motion: Implications of Smartphone Use.

    Directory of Open Access Journals (Sweden)

    Hoi-Chi Woo

    Full Text Available Certain hand activities cause deformation and displacement of the median nerve at the carpal tunnel due to the gliding motion of tendons surrounding it. As smartphone usage escalates, this raises the public's concern whether hand activities while using smartphones can lead to median nerve problems.The aims of this study were to 1 develop kinematic graphs and 2 investigate the associated deformation and rotational information of median nerve in the carpal tunnel during hand activities.Dominant wrists of 30 young adults were examined with ultrasonography by placing a transducer transversely on their wrist crease. Ultrasound video clips were recorded when the subject performing 1 thumb opposition with the wrist in neutral position, 2 thumb opposition with the wrist in ulnar deviation and 3 pinch grip with the wrist in neutral position. Six still images that were separated by 0.2-second intervals were then captured from the ultrasound video for the determination of 1 cross-sectional area (CSA, 2 flattening ratio (FR, 3 rotational displacement (RD and 4 translational displacement (TD of median nerve in the carpal tunnel, and these collected information of deformation, rotational and displacement of median nerve were compared between 1 two successive time points during a single hand activity and 2 different hand motions at the same time point. Finally, kinematic graphs were constructed to demonstrate the mobility of median nerve during different hand activities.Performing different hand activities during this study led to a gradual reduction in CSA of the median nerve, with thumb opposition together with the wrist in ulnar deviation causing the greatest extent of deformation of the median nerve. Thumb opposition with the wrist in ulnar deviation also led to the largest extent of TD when compared to the other two hand activities of this study. Kinematic graphs showed that the motion pathways of median nerve during different hand activities were complex

  6. Dual pathology proximal median nerve compression of the forearm.

    LENUS (Irish Health Repository)

    Murphy, Siun M

    2013-12-01

    We report an unusual case of synchronous pathology in the forearm- the coexistence of a large lipoma of the median nerve together with an osteochondroma of the proximal ulna, giving rise to a dual proximal median nerve compression. Proximal median nerve compression neuropathies in the forearm are uncommon compared to the prevalence of distal compression neuropathies (eg Carpal Tunnel Syndrome). Both neural fibrolipomas (Refs. 1,2) and osteochondromas of the proximal ulna (Ref. 3) in isolation are rare but well documented. Unlike that of a distal compression, a proximal compression of the median nerve will often have a definite cause. Neural fibrolipoma, also called fibrolipomatous hamartoma are rare, slow-growing, benign tumours of peripheral nerves, most often occurring in the median nerve of younger patients. To our knowledge, this is the first report of such dual pathology in the same forearm, giving rise to a severe proximal compression of the median nerve. In this case, the nerve was being pushed anteriorly by the osteochondroma, and was being compressed from within by the intraneural lipoma. This unusual case highlights the advantage of preoperative imaging as part of the workup of proximal median nerve compression.

  7. Efficient Scalable Median Filtering Using Histogram-Based Operations.

    Science.gov (United States)

    Green, Oded

    2018-05-01

    Median filtering is a smoothing technique for noise removal in images. While there are various implementations of median filtering for a single-core CPU, there are few implementations for accelerators and multi-core systems. Many parallel implementations of median filtering use a sorting algorithm for rearranging the values within a filtering window and taking the median of the sorted value. While using sorting algorithms allows for simple parallel implementations, the cost of the sorting becomes prohibitive as the filtering windows grow. This makes such algorithms, sequential and parallel alike, inefficient. In this work, we introduce the first software parallel median filtering that is non-sorting-based. The new algorithm uses efficient histogram-based operations. These reduce the computational requirements of the new algorithm while also accessing the image fewer times. We show an implementation of our algorithm for both the CPU and NVIDIA's CUDA supported graphics processing unit (GPU). The new algorithm is compared with several other leading CPU and GPU implementations. The CPU implementation has near perfect linear scaling with a speedup on a quad-core system. The GPU implementation is several orders of magnitude faster than the other GPU implementations for mid-size median filters. For small kernels, and , comparison-based approaches are preferable as fewer operations are required. Lastly, the new algorithm is open-source and can be found in the OpenCV library.

  8. Portfolio optimization using median-variance approach

    Science.gov (United States)

    Wan Mohd, Wan Rosanisah; Mohamad, Daud; Mohamed, Zulkifli

    2013-04-01

    Optimization models have been applied in many decision-making problems particularly in portfolio selection. Since the introduction of Markowitz's theory of portfolio selection, various approaches based on mathematical programming have been introduced such as mean-variance, mean-absolute deviation, mean-variance-skewness and conditional value-at-risk (CVaR) mainly to maximize return and minimize risk. However most of the approaches assume that the distribution of data is normal and this is not generally true. As an alternative, in this paper, we employ the median-variance approach to improve the portfolio optimization. This approach has successfully catered both types of normal and non-normal distribution of data. With this actual representation, we analyze and compare the rate of return and risk between the mean-variance and the median-variance based portfolio which consist of 30 stocks from Bursa Malaysia. The results in this study show that the median-variance approach is capable to produce a lower risk for each return earning as compared to the mean-variance approach.

  9. Papillary carcinoma in median aberrant thyroid (ectopic) - case report.

    Science.gov (United States)

    Hebbar K, Ashwin; K, Shashidhar; Deshmane, Vijaya Laxmi; Kumar, Veerendra; Arjunan, Ravi

    2014-06-01

    Median ectopic thyroid may be encountered anywhere from the foramen caecum to the diaphragm. Non lingual median aberrant thyroid (incomplete descent) usually found in the infrahyoid region and malignant transformation in this ectopic thyroid tissue is very rare. We report an extremely rare case of papillary carcinoma in non lingual median aberrant thyroid in a 25-year-old female. The differentiation between a carcinoma arising in the median ectopic thyroid tissue and a metastatic papillary carcinoma from an occult primary in the main thyroid gland is also discussed.

  10. Robust median estimator in logisitc regression

    Czech Academy of Sciences Publication Activity Database

    Hobza, T.; Pardo, L.; Vajda, Igor

    2008-01-01

    Roč. 138, č. 12 (2008), s. 3822-3840 ISSN 0378-3758 R&D Projects: GA MŠk 1M0572 Grant - others:Instituto Nacional de Estadistica (ES) MPO FI - IM3/136; GA MŠk(CZ) MTM 2006-06872 Institutional research plan: CEZ:AV0Z10750506 Keywords : Logistic regression * Median * Robustness * Consistency and asymptotic normality * Morgenthaler * Bianco and Yohai * Croux and Hasellbroeck Subject RIV: BB - Applied Statistics, Operational Research Impact factor: 0.679, year: 2008 http://library.utia.cas.cz/separaty/2008/SI/vajda-robust%20median%20estimator%20in%20logistic%20regression.pdf

  11. Dual pathology proximal median nerve compression of the forearm.

    Science.gov (United States)

    Murphy, Siun M; Browne, Katherine; Tuite, David J; O'Shaughnessy, Michael

    2013-12-01

    We report an unusual case of synchronous pathology in the forearm- the coexistence of a large lipoma of the median nerve together with an osteochondroma of the proximal ulna, giving rise to a dual proximal median nerve compression. Proximal median nerve compression neuropathies in the forearm are uncommon compared to the prevalence of distal compression neuropathies (eg Carpal Tunnel Syndrome). Both neural fibrolipomas (Refs. 1,2) and osteochondromas of the proximal ulna (Ref. 3) in isolation are rare but well documented. Unlike that of a distal compression, a proximal compression of the median nerve will often have a definite cause. Neural fibrolipoma, also called fibrolipomatous hamartoma are rare, slow-growing, benign tumours of peripheral nerves, most often occurring in the median nerve of younger patients. To our knowledge, this is the first report of such dual pathology in the same forearm, giving rise to a severe proximal compression of the median nerve. In this case, the nerve was being pushed anteriorly by the osteochondroma, and was being compressed from within by the intraneural lipoma. This unusual case highlights the advantage of preoperative imaging as part of the workup of proximal median nerve compression. Copyright © 2013 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

  12. Median nail dystrophy involving the thumb nail

    Directory of Open Access Journals (Sweden)

    Rahulkrishna Kota

    2016-01-01

    Full Text Available Median canaliform dystrophy of Heller is a rare entity characterized by a midline or a paramedian ridge or split and canal formation in nail plate of one or both the thumb nails. It is an acquired condition resulting from a temporary defect in the matrix that interferes with nail formation. Habitual picking of the nail base may be responsible for some cases. Histopathology classically shows parakeratosis, accumulation of melanin within and between the nail bed keratinocytes. Treatment of median nail dystrophy includes injectable triamcinalone acetonide, topical 0.1% tacrolimus, and tazarotene 0.05%, which is many a times challenging for a dermatologist. Psychiatric opinion should be taken when associated with the depressive, obsessive-compulsive, or impulse-control disorder. We report a case of 19-year-old male diagnosed as median nail dystrophy.

  13. Large window median filtering on Clip7

    Energy Technology Data Exchange (ETDEWEB)

    Mathews, K N

    1983-07-01

    Median filtering has been found to be a useful operation to perform on images in order to reduce random noise while preserving edges of objects. However, in some cases, as the resolution of the image increases, so too does the required window size of the filter. For parallel array processors, this leads to problems when dealing with the large amount of data involved. That is to say that there tend to be problems over slow access of data from pixels over a large neighbourhood, lack of available storage of this data during the operation and long computational times for finding the median. An algorithm for finding the median, designed for use on byte wide architecture parallel array processors is presented together with its implementation on Clip7, a scanning array of such processors. 6 references.

  14. Sosiaalisen median markkinoinnin vuosikello Weecos Oy:lle

    OpenAIRE

    Heinämäki, Lotta; Huuskonen, Leena

    2015-01-01

    Opinnäytetyön tarkoitus oli luoda kokonaisvaltainen ja selkeä suunnitelma Weecos Oy:n markkinointitoimenpiteille valituissa sosiaalisen median kanavissa. Weecos on vuonna 2012 perustettu ekologisia yrityksiä yhteen keräävä verkkokauppa-alusta. Pienestä koostaan johtuen se ei ole pystynyt toteuttamaan sosiaalisen median markkinointia toivomallaan tavalla ja markkinoinnin suunnittelu ja toteutus on ollut epäsäännöllistä. Markkinointisuunnitelman tavoitteena oli helpottaa yrityksen markkinoi...

  15. HIV-1 resistance dynamics in patients failing dolutegravir maintenance monotherapy.

    Science.gov (United States)

    Wijting, Ingeborg E A; Lungu, Cynthia; Rijnders, Bart J A; van der Ende, Marchina E; Pham, Hanh T; Mesplede, Thibault; Pas, Suzan D; Voermans, Jolanda J C; Schuurman, Rob; van de Vijver, David A M C; Boers, Patrick H M; Gruters, Rob A; Boucher, Charles A B; van Kampen, Jeroen J A

    2018-03-29

    A high genetic resistance barrier to the integrase-strand-transfer-inhibitor (INSTI) dolutegravir has been reported in vitro and in vivo. We describe the dynamics of INSTI-resistance-associated-mutations (INSTI-RAMs) and mutations in the 3'-polypurine tract (3'-PPT) in relation to virological failure (VF) observed in the randomized dolutegravir maintenance monotherapy study (DOMONO, NCT02401828). From ten patients with VF plasma samples prior to start cART and during VF were used to generate Sanger sequences of integrase, the 5' terminal bases of the 3'- LTR, and the 3'-PPT. Median HIV-RNA (IQR) at VF was 3,490 (1,440-4,990) c/mL. INSTI-RAMs were detected in 4/10 patients (S230R, R263K, N155H, E92Q+N155H) and in 4/10 patients no INSTI-RAMs were detected (2/10 patients integrase sequencing was unsuccessful). The time-to-VF ranged from 4 weeks to 72 weeks. In one patient, mutations developed in the highly conserved 3'-PPT. No changes in the terminal bases of the 3'-LTR were observed. The genetic barrier to resistance is too low to justify dolutegravir maintenance monotherapy as single INSTI-RAMs are sufficient to cause VF. The large variation in time-to-VF suggests that stochastic reactivation of a pre-existing provirus containing a single INSTI-RAM is the mechanism for failure. Changes in the 3'-PPT point to a new dolutegravir resistance mechanism in vivo.

  16. Ventricular fibrillation cardiac arrest produces a chronic striatal hyperdopaminergic state that is worsened by methylphenidate treatment.

    Science.gov (United States)

    Nora, Gerald J; Harun, Rashed; Fine, David F; Hutchison, Daniel; Grobart, Adam C; Stezoski, Jason P; Munoz, Miranda J; Kochanek, Patrick M; Leak, Rehana K; Drabek, Tomas; Wagner, Amy K

    2017-07-01

    Cardiac arrest survival rates have improved with modern resuscitation techniques, but many survivors experience impairments associated with hypoxic-ischemic brain injury (HIBI). Currently, little is understood about chronic changes in striatal dopamine (DA) systems after HIBI. Given the common empiric clinical use of DA enhancing agents in neurorehabilitation, investigation evaluating dopaminergic alterations after cardiac arrest (CA) is necessary to optimize rehabilitation approaches. We hypothesized that striatal DA neurotransmission would be altered chronically after ventricular fibrillation cardiac arrest (VF-CA). Fast-scan cyclic voltammetry was used with median forebrain bundle (MFB) maximal electrical stimulations (60Hz, 10s) in rats to characterize presynaptic components of DA neurotransmission in the dorsal striatum (D-Str) and nucleus accumbens 14 days after a 5-min VF-CA when compared to Sham or Naïve. VF-CA increased D-Str-evoked overflow [DA], total [DA] released, and initial DA release rate versus controls, despite also increasing maximal velocity of DA reuptake (V max ). Methylphenidate (10 mg/kg), a DA transporter inhibitor, was administered to VF-CA and Shams after establishing a baseline, pre-drug 60 Hz, 5 s stimulation response. Methylphenidate increased initial evoked overflow [DA] more-so in VF-CA versus Sham and reduced D-Str V max in VF-CA but not Shams; these findings are consistent with upregulated striatal DA transporter in VF-CA versus Sham. Our work demonstrates that 5-min VF-CA increases electrically stimulated DA release with concomitant upregulation of DA reuptake 2 weeks after brief VF-CA insult. Future work should elucidate how CA insult duration, time after insult, and insult type influence striatal DA neurotransmission and related cognitive and motor functions. © 2017 International Society for Neurochemistry.

  17. Design and evaluation of a campaign to promote the consumption of vegetables and fruits in Mexican school-age children.

    Science.gov (United States)

    Galván, Marcos; Ríos-Pérez, Fernanda; López-Rodríguez, Guadalupe; Guzmán-Saldaña, Rebeca; Fernández-Cortés, Trinidad Lorena; Camacho-Bernal, Gloria; Robles-Acevedo, Manuel

    2016-09-20

    In Mexican school-age children the consumption of vegetables and fruits (V&F) is less than 25% of the amount recommended by the World Health Organization. Evaluate the effectiveness of a promotion campaign about the consumption of V&F in urban school children from Hidalgo, Mexico. A non controlled community trial in 226 school-age children from private and public schools was conducted, we designed and distributed printed material for promoting the consumption of V&F among the school population, access to V&F was provided through planning and sales at school stores, and consumption was supervised by the teachers. At the end of the intervention vegetable consumption increased by 50 g and plain water in 100 mL (T-test, p < 0.05); the proportion of school-age children who identified the health benefits of the consumption of V&F increased significantly (68% initial, 87% final) and greater support from parents (61% initial, 92 final%) was achieved. A promotion campaign and improved access to vegetables, fruits and water in the school environment which is supported by parents and teachers can encourage healthier eating at school.

  18. Regularization of DT-MRI Using 3D Median Filtering Methods

    Directory of Open Access Journals (Sweden)

    Soondong Kwon

    2014-01-01

    Full Text Available DT-MRI (diffusion tensor magnetic resonance imaging tractography is a method to determine the architecture of axonal fibers in the central nervous system by computing the direction of the principal eigenvectors obtained from tensor matrix, which is different from the conventional isotropic MRI. Tractography based on DT-MRI is known to need many computations and is highly sensitive to noise. Hence, adequate regularization methods, such as image processing techniques, are in demand. Among many regularization methods we are interested in the median filtering method. In this paper, we extended two-dimensional median filters already developed to three-dimensional median filters. We compared four median filtering methods which are two-dimensional simple median method (SM2D, two-dimensional successive Fermat method (SF2D, three-dimensional simple median method (SM3D, and three-dimensional successive Fermat method (SF3D. Three kinds of synthetic data with different altitude angles from axial slices and one kind of human data from MR scanner are considered for numerical implementation by the four filtering methods.

  19. Safety performance evaluation of cable median barriers on freeways in Florida.

    Science.gov (United States)

    Alluri, Priyanka; Haleem, Kirolos; Gan, Albert; Mauthner, John

    2016-07-03

    This article aims to evaluate the safety performance of cable median barriers on freeways in Florida. The safety performance evaluation was based on the percentages of barrier and median crossovers by vehicle type, crash severity, and cable median barrier type (Trinity Cable Safety System [CASS] and Gibraltar system). Twenty-three locations with cable median barriers totaling about 101 miles were identified. Police reports of 6,524 crashes from years 2005-2010 at these locations were reviewed to verify and obtain detailed crash information. A total of 549 crashes were determined to be barrier related (i.e., crashes involving vehicles hitting the cable median barrier) and were reviewed in further detail to identify crossover crashes and the manner in which the vehicles crossed the barriers; that is, by either overriding, underriding, or penetrating the barriers. Overall, 2.6% of vehicles that hit the cable median barrier crossed the median and traversed into the opposite travel lane. Overall, 98.1% of cars and 95.5% of light trucks that hit the barrier were prevented from crossing the median. In other words, 1.9% of cars and 4.5% of light trucks that hit the barrier had crossed the median and encroached on the opposite travel lanes. There is no significant difference in the performance of cable median barrier for cars versus light trucks in terms of crossover crashes. In terms of severity, overrides were more severe compared to underrides and penetrations. The statistics showed that the CASS and Gibraltar systems performed similarly in terms of crossover crashes. However, the Gibraltar system experienced a higher proportion of penetrations compared to the CASS system. The CASS system resulted in a slightly higher percentage of moderate and minor injury crashes compared to the Gibraltar system. Cable median barriers are successful in preventing median crossover crashes; 97.4% of the cable median barrier crashes were prevented from crossing over the median. Of all of

  20. Performance evaluation of cable median barrier systems in Texas.

    Science.gov (United States)

    2009-08-01

    Since 2003, the Texas Department of Transportation (TxDOT) has embarked on an aggressive campaign to install : median barriers to prevent cross-median crashes on freeway facilities statewide. In the few years prior to 2003, : virtually all fatalities...

  1. A molecular census of arcuate hypothalamus and median eminence cell types

    DEFF Research Database (Denmark)

    Campbell, John N; Macosko, Evan Z; Fenselau, Henning

    2017-01-01

    The hypothalamic arcuate-median eminence complex (Arc-ME) controls energy balance, fertility and growth through molecularly distinct cell types, many of which remain unknown. To catalog cell types in an unbiased way, we profiled gene expression in 20,921 individual cells in and around the adult...... mouse Arc-ME using Drop-seq. We identify 50 transcriptionally distinct Arc-ME cell populations, including a rare tanycyte population at the Arc-ME diffusion barrier, a new leptin-sensing neuron population, multiple agouti-related peptide (AgRP) and pro-opiomelanocortin (POMC) subtypes, and an orexigenic...... somatostatin neuron population. We extended Drop-seq to detect dynamic expression changes across relevant physiological perturbations, revealing cell type-specific responses to energy status, including distinct responses in AgRP and POMC neuron subtypes. Finally, integrating our data with human genome...

  2. Clinical and electrophysiological evaluation of pediatric Wolff-Parkinson-White patients

    Science.gov (United States)

    Yıldırım, Işıl; Özer, Sema; Karagöz, Tevfik; Şahin, Murat; Özkutlu, Süheyla; Alehan, Dursun; Çeliker, Alpay

    2015-01-01

    Objective: Wolff-Parkinson-White (WPW) syndrome presents with paroxysmal supraventricular tachycardia and is characterized by electrocardiographic (ECG) findings of a short PR interval and a delta wave. The objective of this study was to evaluate the electrophysiological properties of children with WPW syndrome and to develop an algorithm for the management of these patients with limited access to electrophysiological study. Methods: A retrospective review of all pediatric patients who underwent electrophysiological evaluation for WPW syndrome was performed. Results: One hundred nine patients underwent electrophysiological evaluation at a single tertiary center between 1997 and 2011. The median age of the patients was 11 years (0.1-18). Of the 109 patients, 82 presented with tachycardia (median age 11 (0.1-18) years), and 14 presented with syncope (median age 12 (6-16) years); 13 were asymptomatic (median age 10 (2-13) years). Induced AF degenerated to ventricular fibrillation (VF) in 2 patients. Of the 2 patients with VF, 1 was asymptomatic and the other had syncope; the accessory pathway effective refractory period was ≤180 ms in both. An intracardiac electrophysiological study was performed in 92 patients, and ablation was not attempted for risk of atrioventricular block in 8 (8.6%). The success and recurrence rate of ablation were 90.5% and 23.8% respectively. Conclusion: The induction of VF in 2 of 109 patients in our study suggests that the prognosis of WPW in children is not as benign as once thought. All patients with a WPW pattern on the ECG should be assessed electrophysiologically and risk-stratified. Ablation of patients with risk factors can prevent sudden death in this population. PMID:26006136

  3. Test setup for accelerated test of high power IGBT modules with online monitoring of Vce and Vf voltage during converter operation

    DEFF Research Database (Denmark)

    de Vega, Angel Ruiz; Ghimire, Pramod; Pedersen, Kristian Bonderup

    2014-01-01

    Several accelerated test methods exist in order to study the failures mechanisms of the high power IGBT modules like temperature cycling test or power cycles based on DC current pulses. The main drawback is that the test conditions do not represent the real performance and stress conditions...... of the device in real application. The hypothesis is that ageing of power modules closer to real environment including cooling system, full dc-link voltage and continuous PWM operation could lead to more accurate study of failure mechanism. A new type of test setup is proposed, which can create different real...... load conditions like in the field. Furthermore, collector-emitter voltage (Vce) has been used as indicator of the wear-out of the high power IGBT module. The innovative monitoring system implemented in the test setup is capable of measure the Vce and forward voltage of the antiparallel diode (Vf...

  4. Study of recurrent branch of median nerve (Thenar's muscular branch in relation to the flexor retinaculum and median in 64 hands (32 Men

    Directory of Open Access Journals (Sweden)

    Amirsadri R

    1998-07-01

    Full Text Available Variation of recurred branch of median nerve in relation to the median and flexor retinaculum are significant for both hand surgeons and specialists always. In this study, 64 cadaver hands (32 men have been dissected. The median nerve was identified at the proximal edge of the flexor retinaculum, and in order to expose carpal tunnel the ligament was divided, and the above subjects were studied. The results are: 1 The relation of recurrent nerve to the flexor retinaculum was classified into 4 types: A In (53.1% of subjects, this branch arises from the median after the flexor retinaculum. B In (31.3% of subjects, it arises from the median in the carpal tunnel and the moves around the lower edge of flexor retinaculum and enters the thenar region. C In (14.1% of subjects, it arises from the median in the carpal tunnel and pierces the flexor retinaculum. D In (1.56% of subjects it arises, in the carpal tunnel and it divides into two subbranches here. One follows pattern A and the other pattern C. 2 In this step, the relation of the recurrent branch to the median nerve was studied. The results show that inspite of this image even though most often the recurrent branch arises from the lateral side of median, in (68.75% of subjects it arises from it's anterior surface. The MC Nemar test reveals that there is no relation between manifestation of mentioned patterns with right or left hands.

  5. Allegheny County Median Age at Death

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — The median age at death is calculated for each municipality in Allegheny County. Data is based on the decedent's residence at the time of death, not the location...

  6. A theoretical analysis of the median LMF adaptive algorithm

    DEFF Research Database (Denmark)

    Bysted, Tommy Kristensen; Rusu, C.

    1999-01-01

    Higher order adaptive algorithms are sensitive to impulse interference. In the case of the LMF (Least Mean Fourth), an easy and effective way to reduce this is to median filter the instantaneous gradient of the LMF algorithm. Although previous published simulations have indicated that this reduces...... the speed of convergence, no analytical studies have yet been made to prove this. In order to enhance the usability, this paper presents a convergence and steady-state analysis of the median LMF adaptive algorithm. As expected this proves that the median LMF has a slower convergence and a lower steady...

  7. The Investigation of Median Frequency Changes in Paraspinal Muscles Following Fatigue

    Directory of Open Access Journals (Sweden)

    Saeed Talebian

    2009-10-01

    Conclusion: Median frequency shift toward low values following fatigue in global and local paraspinal muscles was seen. However, median frequency values for the local stabilizer muscle were higher than median frequency values for the global muscles.

  8. Intraneural synovial sarcoma of the median nerve

    Directory of Open Access Journals (Sweden)

    Rahul Kasukurthi

    2010-06-01

    Full Text Available Synovial sarcomas are soft-tissue malignancies with a poor prognosis and propensity for distant metastases. Although originally believed to arise from the synovium, these tumors have been found to occur anywhere in the body. We report a rare case of synovial sarcoma arising from the median nerve. To our knowledge, this is the twelfth reported case of intraneural synovial sarcoma, and only the fourth arising from the median nerve. Because the diagnosis may not be apparent until after pathological examination of the surgical speci­men, synovial sarcoma should be kept in mind when dealing with what may seem like a benign nerve tumor.

  9. ABO blood type correlates with survival on prostate cancer vaccine therapy.

    Science.gov (United States)

    Muthana, Saddam M; Gulley, James L; Hodge, James W; Schlom, Jeffrey; Gildersleeve, Jeffrey C

    2015-10-13

    Immunotherapies for cancer are transforming patient care, but clinical responses vary considerably from patient to patient. Simple, inexpensive strategies to target treatment to likely responders could substantially improve efficacy while simultaneously reducing health care costs, but identification of reliable biomarkers has proven challenging. Previously, we found that pre-treatment serum IgM to blood group A (BG-A) correlated with survival for patients treated with PROSTVAC-VF, a therapeutic cancer vaccine in phase III clinical trials for the treatment of prostate cancer. These results suggested that ABO blood type might influence efficacy. Unfortunately, blood types were not available in the clinical records for all but 8 patients and insufficient amounts of sera were left for standard blood typing methods. To test the hypothesis, therefore, we developed a new glycan microarray-based method for determining ABO blood type. The method requires only 4 μL of serum, provides 97% accuracy, and allows simultaneous profiling of many other serum anti-glycan antibodies. After validation with 220 healthy subjects of known blood type, the method was then applied to 74 PROSTVAC-VF patients and 37 control patients from a phase II trial. In this retrospective study, we found that type B and O PROSTVAC-VF patients demonstrated markedly improved clinical outcomes relative to A and AB patients, including longer median survival, longer median survival relative to Halabi predicted survival, and improved overall survival via Kaplan-Meier survival analysis (p = 0.006). Consequently, blood type may provide an inexpensive screen to pre-select patients likely to benefit from PROSTVAC-VF therapy.

  10. Accounting for Pharmacokinetic Variability of Certolizumab Pegol in Patients with Crohn's Disease.

    Science.gov (United States)

    Vande Casteele, Niels; Mould, Diane R; Coarse, Jason; Hasan, Iram; Gils, Ann; Feagan, Brian; Sandborn, William J

    2017-12-01

    Certolizumab pegol is an effective biologic for patients with Crohn's disease (CD). Individual differences in certolizumab pegol apparent clearance (CL/F) affect exposure and possibly efficacy. A previously developed population pharmacokinetic (PK) model did not account for dynamic changes in clinical parameters during therapy. The aim of this study was to refine the existing PK model to capture the time-varying influence of covariates. Data collected from 2157 Crohn's disease patients in nine studies were analyzed using nonlinear mixed-effects modeling software (NONMEM). Certolizumab pegol concentration-time data were described by a one-compartment PK model with first-order absorption, and one-compartment disposition with linear, time-dependent elimination using antidrug antibody (ADAb) concentration as a continuous variable. The final dataset consisted of 12,926 analyzable records. Parameter estimates were absorption rate constant 1.83/day, CL/F 0.527 L/day, and apparent volume of distribution (V/F) 8.33 L. ADAb concentration (2.5-214 units/mL) increased the median CL/F by 142-174%. For a typical patient, body weight (46.8-100.5 kg) increased the median CL/F and V/F from 82 to 120%. Albumin (32-48 g/L) decreased and C-reactive protein (0.5-54.0 mg/L) increased the median CL/F from 123 to 85% and from 83 to 113%, respectively. Between-patient variability of CL/F was 19.6%. By incorporating time-varying covariates, this population PK model reduces between-patient variability on CL/F estimates, and the relative influence of ADAb can now be assessed. As Crohn's disease patient covariates are often time-dependent, this model is more reflective of patient drug exposure with sustained treatment.

  11. Cold intolerance following median and ulnar nerve injuries : prognosis and predictors

    NARCIS (Netherlands)

    Ruijs, A.C.J; Jaquet, J-B.; van Riel, W. G.; Daanen, H. A M; Hovius, S.E.R.

    This study describes the predictors for cold intolerance and the relationship to sensory recovery after median and ulnar nerve injuries. The study population consisted of 107 patients 2 to 10 years after median, ulnar or combined median and ulnar nerve injuries. Patients were asked to fill out the

  12. Cold intolerance following median and ulnar nerve injuries : prognosis and predictors

    NARCIS (Netherlands)

    Ruijs, A.C.J.; Jaquet, J.B.; Riel, W.G. van; Daanen, H.A.M.; Hovius, S.E.R.

    2007-01-01

    This study describes the predictors for cold intolerance and the relationship to sensory recovery after median and ulnar nerve injuries. The study population consisted of 107 patients 2 to 10 years after median, ulnar or combined median and ulnar nerve injuries. Patients were asked to fill out the

  13. Effect of an auditory feedback substitution, tactilo-kinesthetic, or visual feedback on kinematics of pouring water from kettle into cup.

    Science.gov (United States)

    Portnoy, Sigal; Halaby, Orli; Dekel-Chen, Dotan; Dierick, Frédéric

    2015-11-01

    Pouring hot water from a kettle into a cup may prove a hazardous task, especially for the elderly or the visually-impaired. Individuals with deteriorating eyesight may endanger their hands by performing this task with both hands, relaying on tactilo-kinesthetic feedback (TKF). Auditory feedback (AF) may allow them to perform the task singlehandedly, thereby reducing the risk for injury. However since relying on an AF is not intuitive and requires practice, we aimed to determine if AF supplied during the task of pouring water can be used naturally as visual feedback (VF) following practice. For this purpose, we quantified, in young healthy sighted subjects (n = 20), the performance and kinematics of pouring water in the presence of three isolated feedbacks: visual, tactilo-kinesthetic, or auditory. There were no significant differences between the weights of spilled water in the AF condition compared to the TKF condition in the first, fifth or thirteenth trials. The subjectively-reported difficulty levels of using the TKF and the AF were significantly reduced between the first and thirteenth trials for both TKF (p = 0.01) and AF (p = 0.001). Trunk rotation during the first trial using the TKF was significantly lower than the trunk rotation while using VF. Also, shoulder adduction during the first trial using the TKF was significantly higher than the shoulder adduction while using the VF. During the AF trials, the median travel distance of the tip of the kettle was significantly reduced in the first trials so that in the thirtieth trial it did not differ significantly from the median travel distance during the thirtieth trial using TKF and VF. The maximal velocity of the tip of the kettle was constant for each of the feedback conditions but was higher in 10 cm s(-1) using VF than TKF, which was higher in 10 cm s(-1) from using AF. The smoothness of movement of the TKF and AF conditions, expressed by the normalized jerk score (NJSM), was one and two orders

  14. Robust non-local median filter

    Science.gov (United States)

    Matsuoka, Jyohei; Koga, Takanori; Suetake, Noriaki; Uchino, Eiji

    2017-04-01

    This paper describes a novel image filter with superior performance on detail-preserving removal of random-valued impulse noise superimposed on natural gray-scale images. The non-local means filter is in the limelight as a way of Gaussian noise removal with superior performance on detail preservation. By referring the fundamental concept of the non-local means, we had proposed a non-local median filter as a specialized way for random-valued impulse noise removal so far. In the non-local processing, the output of a filter is calculated from pixels in blocks which are similar to the block centered at a pixel of interest. As a result, aggressive noise removal is conducted without destroying the detailed structures in an original image. However, the performance of non-local processing decreases enormously in the case of high noise occurrence probability. A cause of this problem is that the superimposed noise disturbs accurate calculation of the similarity between the blocks. To cope with this problem, we propose an improved non-local median filter which is robust to the high level of corruption by introducing a new similarity measure considering possibility of being the original signal. The effectiveness and validity of the proposed method are verified in a series of experiments using natural gray-scale images.

  15. Usefulness of ultrasound assessment of median nerve mobility in carpal tunnel syndrome.

    Science.gov (United States)

    Park, Gi-Young; Kwon, Dong Rak; Seok, Jung Im; Park, Dong-Soon; Cho, Hee Kyung

    2018-01-01

    Background Carpal tunnel syndrome (CTS) is the most common peripheral compression neuropathy of the upper extremity. Recently, dynamic ultrasound (US) imaging has shown differences in median nerve mobility between the affected and unaffected sides in CTS. Purpose The present study was performed to compare the median nerve mobility between patients with CTS and healthy individuals, and to correlate median nerve mobility with the severity of CTS. Material and Methods A total of 101 patients (128 wrists) with CTS and 43 healthy individuals (70 wrists) were evaluated. Electrodiagnostic studies were initially conducted to determine the neurophysiological grading scale (NGS). The cross-sectional area (CSA) of the median nerve and the grade of median nerve mobility were measured using US. Results The mean grade of median nerve mobility in the CTS group (1.9) was significantly lower than that in the control group (2.6; P mobility and distal motor latency of the median nerve (r = -0.218, P = 0.015), NGS (r = -0.207, P = 0.020) and CSA of the median nerve (r = -0.196, P = 0.028). Conclusion The grade of median nerve mobility was negatively correlated with the severity of CTS. US assessment of median nerve mobility may be useful in diagnosing and determining the severity of CTS.

  16. Sosiaalisen median rooli kunnan viestinnässä

    OpenAIRE

    Selkämaa, Kati

    2016-01-01

    Opinnäytetyön tavoitteena oli selvittää sosiaalisen median roolia kunnan viestinnässä sekä tutkia, miten sosiaalista mediaa hyödynnetään kuntien viestinnässä. Teoriaosuudessa tarkasteltiin sosiaalista mediaa, tutustuttiin sen tunnetuimpiin sovelluksiin sekä perehdyttiin kuntien viestintään yleisesti. Työssä tarkasteltiin myös kuntien viestintään vaikuttavia ja sitä sääteleviä lakeja. Kuntien sosiaalisen median käyttöön tutustuttiin Kuntaliiton tekemän viestintätutkimuksen tulosten pohjalt...

  17. Development of guidelines for cable median barrier systems in Texas.

    Science.gov (United States)

    2009-12-01

    Since 2003, the Texas Department of Transportation (TxDOT) has embarked on an aggressive campaign to install : median barriers to prevent cross-median crashes on freeway facilities statewide. In the few years prior to 2003, : virtually all fatalities...

  18. Detection of progression of glaucomatous visual field damage using the point-wise method with the binomial test.

    Science.gov (United States)

    Karakawa, Ayako; Murata, Hiroshi; Hirasawa, Hiroyo; Mayama, Chihiro; Asaoka, Ryo

    2013-01-01

    To compare the performance of newly proposed point-wise linear regression (PLR) with the binomial test (binomial PLR) against mean deviation (MD) trend analysis and permutation analyses of PLR (PoPLR), in detecting global visual field (VF) progression in glaucoma. 15 VFs (Humphrey Field Analyzer, SITA standard, 24-2) were collected from 96 eyes of 59 open angle glaucoma patients (6.0 ± 1.5 [mean ± standard deviation] years). Using the total deviation of each point on the 2(nd) to 16(th) VFs (VF2-16), linear regression analysis was carried out. The numbers of VF test points with a significant trend at various probability levels (pbinomial test (one-side). A VF series was defined as "significant" if the median p-value from the binomial test was binomial PLR method (0.14 to 0.86) was significantly higher than MD trend analysis (0.04 to 0.89) and PoPLR (0.09 to 0.93). The PIS of the proposed method (0.0 to 0.17) was significantly lower than the MD approach (0.0 to 0.67) and PoPLR (0.07 to 0.33). The PBNS of the three approaches were not significantly different. The binomial BLR method gives more consistent results than MD trend analysis and PoPLR, hence it will be helpful as a tool to 'flag' possible VF deterioration.

  19. MEAN OF MEDIAN ABSOLUTE DERIVATION TECHNIQUE MEAN ...

    African Journals Online (AJOL)

    eobe

    development of mean of median absolute derivation technique based on the based on the based on .... of noise mean to estimate the speckle noise variance. Noise mean property ..... Foraging Optimization,” International Journal of. Advanced ...

  20. Electroacupuncture and Acupuncture Promote the Rat’s Transected Median Nerve Regeneration

    OpenAIRE

    Ho, C. Y.; Yao, C. H.; Chen, W. C.; Shen, W. C.; Bau, D. T.

    2013-01-01

    Background. Acupuncture and electroacupuncture treatments of damaged nerves may aid nerve regeneration related to hindlimb function, but the effects on the forelimb-related median nerve were not known. Methods. A gap was made in the median nerve of each rat by suturing the stumps into silicone rubber tubes. The influences of acupuncture and electroacupuncture treatments on transected median nerve regeneration were evaluated from morphological, electrophysiological, and functional angles. Resu...

  1. Structure-function correlations using scanning laser polarimetry in primary angle-closure glaucoma and primary open-angle glaucoma.

    Science.gov (United States)

    Lee, Pei-Jung; Liu, Catherine Jui-Ling; Wojciechowski, Robert; Bailey-Wilson, Joan E; Cheng, Ching-Yu

    2010-05-01

    To assess the correlations between retinal nerve fiber layer (RNFL) thickness measured with scanning laser polarimetry and visual field (VF) sensitivity in primary open-angle glaucoma (POAG) and primary angle-closure glaucoma (PACG). Prospective, comparative, observational cases series. Fifty patients with POAG and 56 patients with PACG were examined using scanning laser polarimetry with variable corneal compensation (GDx VCC; Laser Diagnostic Technologies, Inc.) and Humphrey VF analyzer (Carl Zeiss Meditec, Inc.) between August 2005 and July 2006 at Taipei Veterans General Hospital. Correlations between RNFL thickness and VF sensitivity, expressed as mean sensitivity in both decibel and 1/Lambert scales, were estimated by the Spearman rank correlation coefficient (r(s)) and multivariate median regression models (pseudo R(2)). The correlations were determined globally and for 6 RNFL sectors and their corresponding VF regions. The correlation between RNFL thickness and mean sensitivity (in decibels) was weaker in the PACG group (r(s) = 0.38; P = .004; pseudo R(2) = 0.17) than in the POAG group (r(s) = 0.51; P polarimetry. Compared with eyes with POAG, fewer RNFL sectors have significant structure-function correlations in eyes with PACG. Copyright 2010 Elsevier Inc. All rights reserved.

  2. Median Filtering Methods for Non-volcanic Tremor Detection

    Science.gov (United States)

    Damiao, L. G.; Nadeau, R. M.; Dreger, D. S.; Luna, B.; Zhang, H.

    2016-12-01

    Various properties of median filtering over time and space are used to address challenges posed by the Non-volcanic tremor detection problem. As part of a "Big-Data" effort to characterize the spatial and temporal distribution of ambient tremor throughout the Northern San Andreas Fault system, continuous seismic data from multiple seismic networks with contrasting operational characteristics and distributed over a variety of regions are being used. Automated median filtering methods that are flexible enough to work consistently with these data are required. Tremor is characterized by a low-amplitude, long-duration signal-train whose shape is coherent at multiple stations distributed over a large area. There are no consistent phase arrivals or mechanisms in a given tremor's signal and even the durations and shapes among different tremors vary considerably. A myriad of masquerading noise, anthropogenic and natural-event signals must also be discriminated in order to obtain accurate tremor detections. We present here results of the median methods applied to data from four regions of the San Andreas Fault system in northern California (Geysers Geothermal Field, Napa, Bitterwater and Parkfield) to illustrate the ability of the methods to detect tremor under diverse conditions.

  3. Lapset median käyttäjinä

    OpenAIRE

    Jalonen, Taru; Suomela, Sonja

    2010-01-01

    Laurea-ammattikorkeakoulu Tiivistelmä Hyvinkää Sosiaali-, terveys- ja liikunta-ala Hoitotyön koulutusohjelma Terveydenhoitaja AMK Sairaanhoitaja AMK Taru Jalonen, Sonja Suomela Lapset median käyttäjinä Vuosi ‎2010‎ Sivumäärä ‎63‎ Tämän opinnäytetyön tarkoituksena oli selvittää lasten tottumuksia ja kokemuksia mediasta sekä ‎niiden herättämiä tunteita. Lisäksi selvitimme lasten käyttämiä mediaympäristöjä sekä median ‎näkymistä lasten leikeissä. Tämä työ on os...

  4. Optimal design of work zone median crossovers.

    Science.gov (United States)

    2010-09-01

    The use of temporary median crossovers in work zones allows for the closure of one side of a multi-lane roadway while : maintaining two-way traffic on the opposite side. This process provides the ability for construction and maintenance crews : to co...

  5. Long-term effectiveness of unboosted atazanavir plus abacavir/lamivudine in subjects with virological suppression

    DEFF Research Database (Denmark)

    Llibre, Josep M; Cozzi-Lepri, Alessandro; Pedersen, Court

    2016-01-01

    Effectiveness data of an unboosted atazanavir (ATV) with abacavir/lamivudine (ABC/3TC) switch strategy in clinical routine are scant.We evaluated treatment outcomes of ATV + ABC/3TC in pretreated subjects in the EuroSIDA cohort when started with undetectable plasma HIV-1 viral load (p......VL), performing a time to loss of virological response (TLOVR analysis at 48, 96, and 144 weeks. Virological failure (VF) was defined as confirmed pVL >50 copies/mL.We included 285 subjects, 67% male, with median baseline CD4 530 cells, and 44 months with pVL ≤50 copies/mL. The third......%/67%/59% (snapshot analysis), respectively. The rates of VF were 8%/8%/6%. Rates of adverse events leading to study discontinuation were 0.4%/1%/2%. The multivariable adjusted analysis showed an association between VF and nadir CD4+ (hazard ratio [HR] 0.63 [95% confidence interval [CI]: 0.42-0.93] per 100 cells...

  6. Association of pol diversity with antiretroviral treatment outcomes among HIV-infected African children.

    Directory of Open Access Journals (Sweden)

    Iris Chen

    Full Text Available In HIV-infected children, viral diversity tends to increase with age in the absence of antiretroviral treatment (ART. We measured HIV diversity in African children (ages 6-36 months enrolled in a randomized clinical trial comparing two ART regimens (Cohort I of the P1060 trial. Children in this cohort were exposed to single dose nevirapine (sdNVP at birth.HIV diversity was measured retrospectively using a high resolution melting (HRM diversity assay. Samples were obtained from 139 children at the enrollment visit prior to ART initiation. Six regions of the HIV genome were analyzed: two in gag, one in pol, and three in env. A single numeric HRM score that reflects HIV diversity was generated for each region; composite HRM scores were also calculated (mean and median for all six regions.In multivariable median regression models using backwards selection that started with demographic and clinical variables, older age was associated with higher HRM scores (higher HIV diversity in pol (P = 0.005 and with higher mean (P = 0.014 and median (P<0.001 HRM scores. In multivariable models adjusted for age, pre-treatment HIV viral load, pre-treatment CD4%, and randomized treatment regimen, higher HRM scores in pol were associated with shorter time to virologic suppression (P = 0.016 and longer time to study endpoints (virologic failure [VF], VF/death, and VF/off study treatment; P<0.001 for all measures.In this cohort of sdNVP-exposed, ART-naïve African children, higher levels of HIV diversity in the HIV pol region prior to ART initiation were associated with better treatment outcomes.

  7. Sosiaalisen median markkinointisuunnitelma uudelle hoitoalan konseptoidulle työvaatemallistolle

    OpenAIRE

    Leppälä, Sanna

    2017-01-01

    Opinnäytetyössä pohdittiin keinoja saada uuden konseptoidun työvaatemalliston näkyvyyttä esille sosiaalisen median keinoin. Toimeksiantaja-yrityksenä toimi suomalainen Virtually Oy ja kohteena oli sen uusi hoitajille suunnattu työvaatemallisto. Malliston ympärille halutaan luoda kestävä brändi ja sosiaalisen median markkinointi on tukemassa brändin tunnettavuutta ja myyntiä. Sosiaalinen media ei yritysten välisessä liiketoiminnassa toimi ainoana markkinoinnin työkaluna, vaan se on tukemas...

  8. Sosiaalisen median rooli mikroyrittäjän ostoprosessissa

    OpenAIRE

    Martikainen, Inkeri

    2014-01-01

    Opinnäytetyön tavoite oli selvittää sosiaalisen median rooli mikroyrittäjän ostoprosessissa; miten mikroyrittäjä hakee tietoa sosiaalisesta mediasta ja millainen vaikutus sieltä löytyvillä käyttäjäarvioilla on ostopäätökseen. Opinnäytetyö tehtiin erään finanssialan yrityksen toimeksiantona. Opinnäytetyön tarkoituksena oli antaa digitaalisen markkinoinnin ammattilaisille tietoa siitä, miten mikroyrittäjiä voidaan tavoittaa sosiaalisen median kautta, ja saada näin uusia asiakkaita. Tutkimus...

  9. Median forehead flap - beyond classic indication

    Directory of Open Access Journals (Sweden)

    Cristian R. Jecan

    2016-11-01

    Full Text Available Introduction. The paramedian forehead flap is one of the best options for reconstruction of the median upper two-thirds of the face due to its vascularity, color, texture match and ability to resurface all or part of the reconstructed area. The forehead flap is the gold standard for nasal soft tissue reconstruction and the flap of choice for larger cutaneous nasal defects having a robust pedicle and large amount of tissue. Materials and Methods. We are reporting a clinical series of cutaneous tumors involving the nose, medial canthus, upper and lower eyelid through a retrospective review of 6 patients who underwent surgical excision of the lesion and primary reconstruction using a paramedian forehead flap. Results. The forehead flap was used for total nose reconstruction, eyelids and medial canthal reconstruction. All flaps survived completely and no tumor recurrence was seen in any of the patients. Cosmetic and functional results were favorable. Conclusions. The forehead flap continues to be one of the best options for nose reconstruction and for closure of surgical defects of the nose larger than 2 cm. Even though is not a gold standard, median forehead flap can be an advantageous technique in periorbital defects reconstruction.

  10. Ultrahigh-frequency ultrasound of fascicles in the median nerve at the wrist.

    Science.gov (United States)

    Cartwright, Michael S; Baute, Vanessa; Caress, James B; Walker, Francis O

    2017-10-01

    An ultrahigh-frequency (70 MHZ) ultrasound device has recently been approved for human use. This study seeks to determine whether this device facilitates counting of fascicles within the median nerve at the wrist. Twenty healthy volunteers underwent imaging of the median nerve at the wrist bilaterally. The number of fascicles in each nerve was counted by two independent raters. The mean fascicle number was 22.68. Correlation was strong between the two raters (r = 0.68, P nerve area did not predict fascicle number. Those with bifid median nerves and persistent median arteries had lower fascicle density than those without anatomic anomalies (1.79 vs. 2.29; P = 0.01). Fascicles within the median nerve at the wrist can be readily imaged. Ultrahigh-frequency ultrasound technology may be informative in a variety of disorders affecting the peripheral nervous system. Muscle Nerve 56: 819-822, 2017. © 2017 Wiley Periodicals, Inc.

  11. Median Robust Extended Local Binary Pattern for Texture Classification.

    Science.gov (United States)

    Liu, Li; Lao, Songyang; Fieguth, Paul W; Guo, Yulan; Wang, Xiaogang; Pietikäinen, Matti

    2016-03-01

    Local binary patterns (LBP) are considered among the most computationally efficient high-performance texture features. However, the LBP method is very sensitive to image noise and is unable to capture macrostructure information. To best address these disadvantages, in this paper, we introduce a novel descriptor for texture classification, the median robust extended LBP (MRELBP). Different from the traditional LBP and many LBP variants, MRELBP compares regional image medians rather than raw image intensities. A multiscale LBP type descriptor is computed by efficiently comparing image medians over a novel sampling scheme, which can capture both microstructure and macrostructure texture information. A comprehensive evaluation on benchmark data sets reveals MRELBP's high performance-robust to gray scale variations, rotation changes and noise-but at a low computational cost. MRELBP produces the best classification scores of 99.82%, 99.38%, and 99.77% on three popular Outex test suites. More importantly, MRELBP is shown to be highly robust to image noise, including Gaussian noise, Gaussian blur, salt-and-pepper noise, and random pixel corruption.

  12. Speckle Reduction and Structure Enhancement by Multichannel Median Boosted Anisotropic Diffusion

    Directory of Open Access Journals (Sweden)

    Yang Zhi

    2004-01-01

    Full Text Available We propose a new approach to reduce speckle noise and enhance structures in speckle-corrupted images. It utilizes a median-anisotropic diffusion compound scheme. The median-filter-based reaction term acts as a guided energy source to boost the structures in the image being processed. In addition, it regularizes the diffusion equation to ensure the existence and uniqueness of a solution. We also introduce a decimation and back reconstruction scheme to further enhance the processing result. Before the iteration of the diffusion process, the image is decimated and a subpixel shifted image set is formed. This allows a multichannel parallel diffusion iteration, and more importantly, the speckle noise is broken into impulsive or salt-pepper noise, which is easy to remove by median filtering. The advantage of the proposed technique is clear when it is compared to other diffusion algorithms and the well-known adaptive weighted median filtering (AWMF scheme in both simulation and real medical ultrasound images.

  13. An investigation on the noise reduction performance of profiled rigid median barriers at highways

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Monazzam

    2012-01-01

    Full Text Available Median barriers as a portion of a divided highway are provided to minimize the cross-median crashes. Moreover, median barriers similar to roadside noise barriers could protect people from transportation noise. Thus, there is a need to investigate various median barrier models to identify changes of insertion loss over a simple rigid barrier. In order to estimate the acoustical influence of median barrier′s profile in the shadow zone, different median barrier models are presented and their insertion losses are calculated over a frequency range from 50 to 4000 Hz using a two-dimensional boundary element method. The present investigation has clearly revealed that among the profiled median barriers, T-shape, Y-shape, and L-shape provide better performance than that of the other shapes. It is also found that among inclined barriers, V-shape barrier significantly presents higher values of attenuation. Based on the calculation of different geometrics, it has been shown that a further 2 dB (A in efficiency could be obtained by a better design of the median barrier which is labeled model "L."

  14. COLOUR IMAGE STEGANOGRAPHY USING MEDIAN MAINTENANCE

    Directory of Open Access Journals (Sweden)

    S. Arivazhagan

    2011-08-01

    Full Text Available Steganographic algorithms in the recent past have been producing stego images with perceptual invisibility, better secrecy and certain robustness against attacks like cropping, filtering etc. Recovering a good quality secret from a good quality stego image may not always be possible. The method proposed in this paper works in transform domain and attempts to extract the secret almost as same as the embedded one maintaining minimal changes to the cover image by using techniques like median maintenance, offset and quantization.

  15. Electromyogram median power frequency in dynamic exercise at medium exercise intensities

    NARCIS (Netherlands)

    Ament, W; Bonga, GJJ; Hof, AL; Verkerke, GJ

    The electromyogram (EMG) median power Frequency of the calf muscles was investigated during an exhausting treadmill exercise and a 20-min recovery period. The exercise was an uphill run at a speed of 5 km . h(-1) and a gradient of 20%. During exercise there was no decrease of EMG median power

  16. Median mental sinus in twins.

    Science.gov (United States)

    Ong, S T; Ngeow, W C

    1999-05-01

    Sinus on the chin can be the result of a chronic apical abscess due to pulp necrosis of a mandibular anterior tooth. The tooth is usually asymptomatic, and a dental cause is therefore not apparent to the patient or the unsuspecting clinician. Not infrequently, the patient may seek treatment from a dermatologist or general surgeon instead of a dentist. Excision and repair of the fistula may be carried out with subsequent breakdown because the dental pathology is not removed. This paper reports the presence of median mental sinus of dental origin in twins. One case healed following root canal therapy while the other required both root canal therapy and surgery to eliminate the infection.

  17. Separate patient serum sodium medians from males and females provide independent information on analytical bias.

    Science.gov (United States)

    Hansen, Steen Ingemann; Petersen, Per Hyltoft; Lund, Flemming; Fraser, Callum G; Sölétormos, György

    2017-10-26

    During monitoring of monthly medians of results from patients undertaken to assess analytical stability in routine laboratory performance, the medians for serum sodium for male and female patients were found to be significantly related. Daily, weekly and monthly patient medians of serum sodium for both male and female patients were calculated from results obtained on samples from the population >18 years on three analysers in the hospital laboratory. The half-range of medians was applied as an estimate of the maximum bias. Further, the ratios between the two medians were calculated. The medians of both genders demonstrated dispersions over time, but they were closely connected in like patterns, which were confirmed by the half-range of the ratios of medians for males and females that varied from 0.36% for daily, 0.14% for weekly and 0.036% for monthly ratios over all instruments. The tight relationship between the gender medians for serum sodium is only possible when raw laboratory data are used for calculation. The two patient medians can be used to confirm both and are useful as independent estimates of analytical bias during constant calibration periods. In contrast to the gender combined median, the estimate of analytical bias can be confirmed further by calculation of the ratios of medians for males and females.

  18. Voimaa visuaalisuudesta : Narratiivinen kirjallisuuskatsaus visuaalisen sosiaalisen median vaikutuksista nuorten aikuisten hyvinvointiin

    OpenAIRE

    Viita, Shir

    2017-01-01

    Viita, Shir. Voimaa visuaalisuudesta – Narratiivinen kirjallisuuskatsaus visuaalisen sosiaalisen median vaikutuksista nuorten aikuisten hyvinvointiin. Kevät 2016. 52 s., 1 liite. Diakonia ammattikorkeakoulu. Sosiaalialan koulutusohjelma, sosionomin suuntautumisvaihtoehto. Sosionomi (AMK). Opinnäytetyön tavoitteena on tuottaa tietoa sosiaalialan ammattilaisille visuaalisen sosiaalisen median sivustojen Instagramin ja Snapchatin vaikutuksista nuorten aikuisten hyvinvointiin. Opinnäyte...

  19. Application of median-equation approach for outlier detection in geodetic networks

    Directory of Open Access Journals (Sweden)

    Serif Hekimoglu

    Full Text Available In geodetic measurements some outliers may occur sometimes in data sets, depending on different reasons. There are two main approaches to detect outliers as Tests for outliers (Baarda's and Pope's Tests and robust methods (Danish method, Huber method etc.. These methods use the Least Squares Estimation (LSE. The outliers affect the LSE results, especially it smears the effects of the outliers on the good observations and sometimes wrong results may be obtained. To avoid these effects, a method that does not use LSE should be preferred. The median is a high breakdown point estimator and if it is applied for the outlier detection, reliable results can be obtained. In this study, a robust method which uses median with or as a treshould value on median residuals that are obtained from median equations is proposed. If the a priori variance of the observations is known, the reliability of the new approch is greater than the one in the case where the a priori variance is unknown.

  20. Separate patient serum sodium medians from males and females provide independent information on analytical bias

    DEFF Research Database (Denmark)

    Hansen, Steen Ingemann; Petersen, Per Hyltoft; Lund, Flemming

    2017-01-01

    BACKGROUND: During monitoring of monthly medians of results from patients undertaken to assess analytical stability in routine laboratory performance, the medians for serum sodium for male and female patients were found to be significantly related. METHODS: Daily, weekly and monthly patient medians...... all instruments. CONCLUSIONS: The tight relationship between the gender medians for serum sodium is only possible when raw laboratory data are used for calculation. The two patient medians can be used to confirm both and are useful as independent estimates of analytical bias during constant...... calibration periods. In contrast to the gender combined median, the estimate of analytical bias can be confirmed further by calculation of the ratios of medians for males and females....

  1. A GPU-Based Genetic Algorithm for the P-Median Problem

    OpenAIRE

    AlBdaiwi, Bader F.; AboElFotoh, Hosam M. F.

    2016-01-01

    The p-median problem is a well-known NP-hard problem. Many heuristics have been proposed in the literature for this problem. In this paper, we exploit a GPGPU parallel computing platform to present a new genetic algorithm implemented in Cuda and based on a Pseudo Boolean formulation of the p-median problem. We have tested the effectiveness of our algorithm using a Tesla K40 (2880 Cuda cores) on 290 different benchmark instances obtained from OR-Library, discrete location problems benchmark li...

  2. Median nerve fascicular anatomy as a basis for distal neural prostheses.

    Science.gov (United States)

    Planitzer, Uwe; Steinke, Hanno; Meixensberger, Jürgen; Bechmann, Ingo; Hammer, Niels; Winkler, Dirk

    2014-05-01

    Functional electrical stimulation (FES) serves as a possible therapy to restore missing motor functions of peripheral nerves by means of cuff electrodes. FES is established for improving lower limb function. Transferring this method to the upper extremity is complex, due to a lack of anatomical data on the physiological configuration of nerve fascicles. Our study's aim was to provide an anatomical basis for FES of the median nerve in the distal forearm and hand. We investigated 21 distal median nerves from 12 body donors. The peripheral fascicles were traced back by removing the external and interfascicular epineurium and then assigned to 4 quadrants. A distinct motor and sensory distribution was observed. The fascicles innervating the thenar eminence and the first lumbrical muscle originated from the nerves' radial parts in 82%. The fascicle supplying the second lumbrical muscle originated from the ulnar side in 78%. No macroscopically visible plexus formation was observed for the distal median nerve in the forearm. The findings on the distribution of the motor branches of the median nerve and the missing plexus formation may likely serve as an anatomical basis for FES of the distal forearm. However, due to the considerable variability of the motor branches, cuff electrodes will need to be adapted individually in FES. Taking into account the sensory distribution of the median nerve, FES may also possibly be applied in the treatment of regional pain syndromes. Copyright © 2013 Elsevier GmbH. All rights reserved.

  3. Variant palmaris profundus enclosed by an unusual loop of the median nerve

    Science.gov (United States)

    CHOU, HSIU-CHU; JENG, HELLEN; KO, TSUI-LING; PAI, MAN-HUI; CHANG, CHIU-YUN; WU, CHING-HSIANG

    2001-01-01

    According to the usual description in most anatomy texts, the median nerve in the forearm passes between the 2 heads of pronator teres. It continues distally between flexor digitorum superficialis and profundus almost to the retinaculum. Muscular branches leave the nerve near the elbow and supply all superficial muscles of the anterior part of the forearm except flexor carpi ulnaris. Many variations of the median nerve in the forearm have been reported (Urban & Krosman, 1992). The palmaris profundus is also a rare anomaly of the forearm (Dyreby & Engber, 1982). It originates from the radial side of the common flexor tendon in the proximal forearm and inserts into the undersurface of the palmar aponeurosis. The origin of palmaris profundus may be close to the median nerve and its branches, and may be involved in compressive neuropathy of the anterior interosseous nerve. Its tendon crossing through the carpal canal has been implicated in the carpal tunnel syndrome (reviewed by Lahey & Aulicino, 1986). In some cases, palmaris profundus was found enclosed in a common fascial sheath with the median nerve (Stark, 1992; Sahinoglu et al. 1994). To indicate its close association with the median nerve, the palmaris profundus was also named ‘musculus comitans nervi mediani’ (Sahinoglu et al. 1994). This article reports an unusual loop of the median nerve encircling an anomalous palmaris profundus in the forearm, which, to the best of our knowledge, has not been previously described. PMID:11693311

  4. Social Security: a financial appraisal for the median voter.

    Science.gov (United States)

    Galasso, V

    Several explanations have been proposed for why voters continue to support unfunded social security systems. Browning (1975) suggests that the extremely large unfunded pension systems of most democracies depend on the existence of a voting majority composed of middle-aged and older people who fail to fully internalize the cost of financing the system. In fact, when voting, economically rational workers consider only their current and future contributions to the system and their expected pension benefits--not their past contributions, which they regard as sunk costs. If, for a majority of voters, the expected continuation return from social security exceeds the return from alternative assets, an unfunded social security system is politically sustainable. This article explores the validity of Browning's proposition by quantifying the returns that U.S. voters in presidential elections from 1964 to 1996 have obtained, or expect to obtain, from Social Security. Did "investments" in Social Security outperform alternative forms of investment, such as mutual funds or pension funds, for a majority of the voters? What can be expected for the future? The U.S. Social Security system redistributes income within age cohorts on the basis of sex, income, and marital status. To account for some of these features, the median voter is represented by a family unit whose members--a husband who accounts for 70 percent of household earnings and a wife who accounts for 30 percent--make joint economic and voting decisions. Thus, retirement and survival benefits paid out to the spouse of an insured worker can be included in the calculation of Social Security returns. Interval estimates of voters' family incomes from the U.S. Census Bureau were used to obtain the median voter's household earnings. The median voter's age is derived from the ages of those who voted in presidential elections, not from the ages of the entire electorate. The median voter's contributions to Social Security are the

  5. The Median Solution of the Newsvendor Problem and Some Observations

    Directory of Open Access Journals (Sweden)

    Sinha Pritibhushan

    2015-09-01

    Full Text Available We consider the median solution of the Newsvendor Problem. Some properties of such a solution are shown through a theoretical analysis and a numerical experiment. Sometimes, though not often, median solution may be better than solutions maximizing expected profit, or maximizing minimum possible, over distribution with the same average and standard deviation, expected profit, according to some criteria. We discuss the practical suitability of the objective function set and the solution derived, for the Newsvendor Problem, and other such random optimization problems.

  6. Ranking Exponential Trapezoidal Fuzzy Numbers by Median Value

    Directory of Open Access Journals (Sweden)

    S. Rezvani

    2013-12-01

    Full Text Available In this paper, we want represented a method for ranking of two exponential trapezoidal fuzzy numbers. A median value is proposed for the ranking of exponential trapezoidal fuzzy numbers. For the validation the results of the proposed approach are compared with different existing approaches.

  7. Bayesian median regression for temporal gene expression data

    Science.gov (United States)

    Yu, Keming; Vinciotti, Veronica; Liu, Xiaohui; 't Hoen, Peter A. C.

    2007-09-01

    Most of the existing methods for the identification of biologically interesting genes in a temporal expression profiling dataset do not fully exploit the temporal ordering in the dataset and are based on normality assumptions for the gene expression. In this paper, we introduce a Bayesian median regression model to detect genes whose temporal profile is significantly different across a number of biological conditions. The regression model is defined by a polynomial function where both time and condition effects as well as interactions between the two are included. MCMC-based inference returns the posterior distribution of the polynomial coefficients. From this a simple Bayes factor test is proposed to test for significance. The estimation of the median rather than the mean, and within a Bayesian framework, increases the robustness of the method compared to a Hotelling T2-test previously suggested. This is shown on simulated data and on muscular dystrophy gene expression data.

  8. Intraneural hemangioma of the median nerve: A case report

    Directory of Open Access Journals (Sweden)

    Sevinç Teoman

    2008-02-01

    Full Text Available Abstract Hemangiomas of the median nerve are very rare and, so far, only ten cases of intraneural hemangioma of this nerve have been reported in the literature. We present a case of 14-year-old girl who had a soft tissue mass in the region of the left wrist with signs and symptoms of carpal tunnel syndrome. Total removal of the mass was achieved using microsurgical epineural and interfasicular dissection. The symptoms were relieved completely, after this procedure, without any neurologic deficit. On follow-up two years later, no recurrence was observed. Whenever a child or young adult patient presents with CTS the possibility of a hemangioma involving the median nerve should be kept in mind in the differential diagnosis.

  9. Brain malformation in single median maxillary central incisor

    DEFF Research Database (Denmark)

    Kjaer, I; Wagner, Aa; Thomsen, L L

    2009-01-01

    Clinical and radiographic examinations and MR scan of a 12-year-old girl with SMMCI (single median maxillary central incisor) showed impaired growth and a midline defect involving the central incisor, cranium and the midline structures in the brain, falx cerebri and pituitary gland. She had a sev...

  10. Deep structure of Porcupine Basin and nature of the Porcupine Median Ridge from seismic refraction tomography

    Science.gov (United States)

    Watremez, L.; Chen, C.; Prada, M.; Minshull, T. A.; O'Reilly, B.; Reston, T. J.; Wagner, G.; Gaw, V.; Klaeschen, D.; Shannon, P.

    2015-12-01

    The Porcupine Basin is a narrow V-shaped failed rifted basin located offshore SW Ireland. It is of Permo-Triassic to Cenozoic age, with the main rifting phase in the Late Jurassic to Early Cretaceous. Porcupine Basin is a key study area to learn about the processes of continental extension and to understand the thermal history of this rifted basin. Previous studies show increasing stretching factors, from less than 1.5 to the North to more than 6 to the South. A ridge feature, the Porcupine Median Ridge, has been identified in the middle of the southernmost part of the basin. During the last three decades, this ridge has been successively interpreted as a volcanic structure, a diapir of partially serpentinized mantle, or a block of continental crust. Its nature still remains debated today. In this study, we use arrival times from refractions and wide-angle reflections in the sedimentary, crustal and mantle layers to image the crustal structure of the thinnest part of the basin, the geometry of the continental thinning from margin to margin, and the Porcupine Median Ridge. The final velocity model is then compared with coincident seismic reflection data. We show that (1) the basin is asymmetric, (2) P-wave velocities in the uppermost mantle are lower than expected for unaltered peridotites, implying upper-mantle serpentinisation, (3) the nature of Porcupine Median Ridge is probably volcanic, and (4) the amount of thinning is greater than shown in previous studies. We discuss the thermal implications of these results for the evolution of this rift system and the processes leading to the formation of failed rifts. This project is funded by the Irish Shelf Petroleum Studies Group (ISPSG) of the Irish Petroleum Infrastructure Programme Group 4.

  11. PERBANDINGAN TRANSFORMASI BOX-COX DAN REGRESI KUANTIL MEDIAN DALAM MENGATASI HETEROSKEDASTISITAS

    Directory of Open Access Journals (Sweden)

    NI WAYAN YUNI CAHYANI

    2015-01-01

    Full Text Available Ordinary least square (OLS is a method that can be used to estimate the parameter in linear regression analysis. There are some assumption which should be satisfied on OLS, one of this assumption is homoscedasticity, that is the variance of error is constant. If variance of the error is unequal that so-called heteroscedasticity. The presence heteroscedasticity can cause estimation with OLS becomes inefficient. Therefore, heteroscedasticity shall be overcome. There are some method that can used to overcome heteroscedasticity, two among those are Box-Cox power transformation and median quantile regression. This research compared Box-Cox power transformation and median quantile regression to overcome heteroscedasticity. Applied Box-Cox power transformation on OLS result ????2point are greater, smaller RMSE point and confidencen interval more narrow, therefore can be concluded that applied of Box-Cox power transformation on OLS better of median quantile regression to overcome heteroscedasticity.

  12. PERBANDINGAN TRANSFORMASI BOX-COX DAN REGRESI KUANTIL MEDIAN DALAM MENGATASI HETEROSKEDASTISITAS

    Directory of Open Access Journals (Sweden)

    NI WAYAN YUNI CAHYANI

    2015-03-01

    Full Text Available Ordinary least square (OLS is a method that can be used to estimate the parameter in linear regression analysis. There are some assumption which should be satisfied on OLS, one of this assumption is homoscedasticity, that is the variance of error is constant. If variance of the error is unequal that so-called heteroscedasticity. The presence heteroscedasticity can cause estimation with OLS becomes inefficient. Therefore, heteroscedasticity shall be overcome. There are some method that can used to overcome heteroscedasticity, two among those are Box-Cox power transformation and median quantile regression. This research compared Box-Cox power transformation and median quantile regression to overcome heteroscedasticity. Applied Box-Cox power transformation on OLS result ????2point are greater, smaller RMSE point and confidencen interval more narrow, therefore can be concluded that applied of Box-Cox power transformation on OLS better of median quantile regression to overcome heteroscedasticity.

  13. Impact of keyboard typing on the morphological changes of the median nerve.

    Science.gov (United States)

    Yeap Loh, Ping; Liang Yeoh, Wen; Nakashima, Hiroki; Muraki, Satoshi

    2017-09-28

    The primary objective was to investigate the effects of continuous typing on median nerve changes at the carpal tunnel region at two different keyboard slopes (0° and 20°). The secondary objective was to investigate the differences in wrist kinematics and the changes in wrist anthropometric measurements when typing at the two different keyboard slopes. Fifteen healthy right-handed young men were recruited. A randomized sequence of the conditions (control, typing I, and typing II) was assigned to each participant. Wrist anthropometric measurements, wrist kinematics data collection and ultrasound examination to the median nerve was performed at designated time block. Typing activity and time block do not cause significant changes to the wrist anthropometric measurements. The wrist measurements remained similar across all the time blocks in the three conditions. Subsequently, the wrist extensions and ulnar deviations were significantly higher in both the typing I and typing II conditions than in the control condition for both wrists (ptyping I and typing II conditions after the typing task than before the typing task. The MNCSA significantly decreased in the recovery phase after the typing task. This study demonstrated the immediate changes in the median nerve after continuous keyboard typing. Changes in the median nerve were greater during typing using a keyboard tilted at 20° than during typing using a keyboard tilted at 0°. The main findings suggest wrist posture near to neutral position caused lower changes of the median nerve.

  14. Nuorten sosiaalisen median käyttö seurustelusuhteissa : "Onksiul snappii, kikkii tai whatsappii?"

    OpenAIRE

    Pöllänen, Kati

    2016-01-01

    Tässä opinnäytetyössä tutkittiin nuorten sosiaalisen median käyttöä seurustelusuhteissa. Seurustelusuhteella tarkoitetaan kahden toisistaan pitävän ihmisen romanttista suhdetta. Työssä tarkasteltiin keskinuorten ja myöhäisnuorten käyttämiä sosiaalisen median sovelluksia, käyttömääriä ja –tapoja. Lisäksi selvitettiin, millainen rooli sosiaalisella medialla on seurustelusuhteen eri vaiheissa. Työssä tutustuttiin nuorten sosiaalisen median käyttöön kenttätutkimuksella, jossa nu...

  15. Median sternotomy for double lung transplantation with cardiopulmonary bypass in seven consecutive patients

    DEFF Research Database (Denmark)

    Kohno, Mitsutomo; Steinbrüchel, Daniel A

    2012-01-01

    We describe our technique of using median sternotomy to perform double lung transplantations with cardiopulmonary bypass. By sparing the respiratory muscles, median sternotomy is probably less invasive and preserves lung function. Furthermore, it causes less long-term discomfort than intercostal...

  16. A case of fibrolipomatous hamartoma of the median nerve with macrodactyly

    Directory of Open Access Journals (Sweden)

    Sathish Arakeri

    2012-07-01

    Full Text Available Fibrolipomatous hamartoma of nerve is a tumor-like lipomatous process principally involving affecting young persons. The median nerve is most commonly affectedinvolved. The lesion is characterized by a soft slowly growing mass, surrounding and infiltrating major nerves and their branches. It may cause symptoms of compression neuropathy and is associated with macrodactyly in one third of cases. Here, we present a case of Fibrolipomatous hamartoma of nerve in the wrist of a young man arising from median nerve. Debulking of the tumour was performed.

  17. High Rates of Baseline Drug Resistance and Virologic Failure Among ART-naive HIV-infected Children in Mali.

    Science.gov (United States)

    Crowell, Claudia S; Maiga, Almoustapha I; Sylla, Mariam; Taiwo, Babafemi; Kone, Niaboula; Oron, Assaf P; Murphy, Robert L; Marcelin, Anne-Geneviève; Traore, Ban; Fofana, Djeneba B; Peytavin, Gilles; Chadwick, Ellen G

    2017-11-01

    Limited data exist on drug resistance and antiretroviral treatment (ART) outcomes in HIV-1-infected children in West Africa. We determined the prevalence of baseline resistance and correlates of virologic failure (VF) in a cohort of ART-naive HIV-1-infected children baseline (before ART) and at 6 months. Resistance was defined according to the Stanford HIV Genotypic Resistance database. VF was defined as viral load ≥1000 copies/mL after 6 months of ART. Logistic regression was used to evaluate factors associated with VF or death >1 month after enrollment. Post hoc, antiretroviral concentrations were assayed on baseline samples of participants with baseline resistance. One-hundred twenty children with a median age 2.6 years (interquartile range: 1.6-5.0) were included. Eighty-eight percent reported no prevention of mother-to-child transmission exposure. At baseline, 27 (23%), 4 (3%) and none had non-nucleoside reverse transcriptase inhibitor (NNRTI), nucleoside reverse transcriptase inhibitor or protease inhibitor resistance, respectively. Thirty-nine (33%) developed VF and 4 died >1 month post-ART initiation. In multivariable analyses, poor adherence [odds ratio (OR): 6.1, P = 0.001], baseline NNRTI resistance among children receiving NNRTI-based ART (OR: 22.9, P baseline NNRTI resistance (OR: 5.8, P = 0.018) were significantly associated with VF/death. Ten (38%) with baseline resistance had detectable levels of nevirapine or efavirenz at baseline; 7 were currently breastfeeding, but only 2 reported maternal antiretroviral use. Baseline NNRTI resistance was common in children without reported NNRTI exposure and was associated with increased risk of treatment failure. Detectable NNRTI concentrations were present despite few reports of maternal/infant antiretroviral use.

  18. Median Sternotomy or Right Thoracotomy Techniques for Total Artificial Heart Implantation in Calves.

    Science.gov (United States)

    Karimov, Jamshid H; Moazami, Nader; Sunagawa, Gengo; Kobayashi, Mariko; Byram, Nicole; Sale, Shiva; Such, Kimberly A; Horvath, David J; Golding, Leonard A R; Fukamachi, Kiyotaka

    2016-10-01

    The choice of optimal operative access technique for mechanical circulatory support device implantation ensures successful postoperative outcomes. In this study, we retrospectively evaluated the median sternotomy and lateral thoracotomy incisions for placement of the Cleveland Clinic continuous-flow total artificial heart (CFTAH) in a bovine model. The CFTAH was implanted in 17 calves (Jersey calves; weight range, 77.0-93.9 kg) through a median sternotomy (n = 9) or right thoracotomy (n = 8) for elective chronic implantation periods of 14, 30, or 90 days. Similar preoperative preparation, surgical techniques, and postoperative care were employed. Implantation of the CFTAH was successfully performed in all cases. Both methods provided excellent surgical field visualization. After device connection, however, the median sternotomy approach provided better visualization of the anastomoses and surgical lines for hemostasis confirmation and repair due to easier device displacement, which is severely limited following right thoracotomy. All four animals sacrificed after completion of the planned durations (up to 90 days) were operated through full median sternotomy. Our data demonstrate that both approaches provide excellent initial field visualization. Full median sternotomy provides larger viewing angles at the anastomotic suture line after device connection to inflow and outflow ports. Copyright © 2015 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

  19. Effects of smartphone overuse on hand function, pinch strength, and the median nerve.

    Science.gov (United States)

    İnal, Esra Erkol; Demİrcİ, kadİr; Çetİntürk, Azİze; Akgönül, Mehmet; Savaş, Serpİl

    2015-08-01

    In this study we investigated the flexor pollicis longus (FPL) tendon and median nerve in smartphone users by ultrasonography to assess the effects of smartphone addiction on the clinical and functional status of the hands. One hundred two students were divided into 3 groups: non-users, and high or low smartphone users. Smartphone Addiction Scale (SAS) scores and grip and pinch strengths were recorded. Pain in thumb movement and rest and hand function were evaluated on the visual analog scale (VAS) and the Duruöz Hand Index (DHI), respectively. The cross-sectional areas (CSAs) of the median nerve and the FPL tendon were calculated bilaterally using ultrasonography. Significantly higher median nerve CSAs were observed in the dominant hands of the high smartphone users than in the non-dominant hands (PSmartphone overuse enlarges the median nerve, causes pain in the thumb, and decreases pinch strength and hand functions. © 2015 Wiley Periodicals, Inc.

  20. A study of retrograde degeneration of median nerve forearm ...

    African Journals Online (AJOL)

    Mona Mokhtar El Bardawil

    2013-10-22

    Oct 22, 2013 ... tient clinic of the Physical Medicine Rheumatology and Reha- bilitation ... F-wave to calculate axillary F central loop (AFCL) latency of median and ..... amplitude which substantially results from the block of faster ... Postoperative electrophysiological follow up for ... Regional rheumatic pain syndromes. In:.

  1. A novel image inpainting technique based on median diffusion

    Indian Academy of Sciences (India)

    numerical methods such as anisotropic diffusion and multiresolution schemes. Some steps ... Roth & Black (2005) have developed a framework for learning a generic and expressive image priors that ..... This paper presents a new approach for image inpainting by propagating median information .... J. Graphics Tools 9(1):.

  2. Genome and transcriptome studies of the protozoan parasites Trypanosoma cruzi and Giardia intestinalis

    Science.gov (United States)

    Farran, Alexandra J. E.

    Vocal fold (VF) diseases and disorders are difficult to treat surgically or therapeutically. Tissue engineering offers an alternative strategy for the restoration of functional VF. In this work, we have developed tissue engineering methodologies for the functional reconstruction of VF. As a first step, the structure, composition and mechanical properties of native VF tissues have been investigated. In pigs ranging from fetal to 2+ years old, the VF structure and viscoelastic properties were found to be age-dependent. Adult tissues were more organized, displaying a denser lamina propria, and mature elastin fibers compared to fetal tissues, resulting in higher storage moduli. Secondly, biomimetic scaffolds which recaptured the mechanical properties of the native VF were developed. Chemically-defined collagen-hyaluronic acid (HA) composite hydrogels, and elastin-mimetic hybrid polymers (EMHPs) were successfully used as conducive 3D matrices, and 2D elastic scaffolds respectively, to in vitro static culture of fibroblasts. While the collagen-HA hydrogels allowed for in situ cell encapsulation and supported cell attachment and proliferation in 3D, the integrin-binding domain RGDSP was needed for cell proliferation on EMHPs. To emulate in vitro the mechanical environment of the native VF tissue, a dynamic culture system capable of generating vibratory stimulations at human phonation frequencies was successfully created and characterized. Gene expression analysis of fibroblasts subjected to 1 hour vibrations in 2D revealed that the expression of ECM-related genes was altered in response to changes in vibratory frequency and amplitude. Finally, expanding on our previous studies, the dynamic culture system was modified to accommodate for the long-term dynamic culture of cell-laden hydrogels. Human mesenchymal stem cells (hMSCs) encapsulated in a collagen/HA-based hydrogel, cultured in presence of connective tissue growth factor (CTGF), and subjected to high frequency

  3. Clinical Outcomes following median to radial nerve transfers

    Science.gov (United States)

    Ray, Wilson Z.; Mackinnon, Susan E.

    2010-01-01

    Purpose In this study the authors evaluate the clinical outcomes in patients with radial nerve palsy who underwent nerve transfers utilizing redundant fascicles of median nerve (innervating the flexor digitorum superficialis and flexor carpi radialis muscles) to the posterior interosseous nerve and the nerve to the extensor carpi radialis brevis. Methods A retrospective review of the clinical records of 19 patients with radial nerve injuries who underwent nerve transfer procedures using the median nerve as a donor nerve were included. All patients were evaluated using the Medical Research Council (MRC) grading system. Results The mean age of patients was 41 years (range 17 – 78 years). All patients received at least 12 months of follow-up (20.3 ± 5.8 months). Surgery was performed at a mean of 5.7 ± 1.9 months post-injury. Post-operative functional evaluation was graded according to the following scale: grades MRC 0/5 - MRC 2/5 were considered poor outcomes, while MRC of 3/5 was a fair result, MRC grade 4/5 was a good result, and grade 4+/5 was considered an excellent outcome. Seventeen patients (89%) had a complete radial nerve palsy while two patients (11%) had intact wrist extension but no finger or thumb extension. Post-operatively all patients except one had good to excellent recovery of wrist extension. Twelve patients recovered good to excellent finger and thumb extension, two patients had fair recovery, five patients had a poor recovery. Conclusions The radial nerve is a commonly injured nerve, causing significant morbidity in affected patients. The median nerve provides a reliable source of donor nerve fascicles for radial nerve reinnervation. This transfer was first performed in 1999 and evolved over the subsequent decade. The important nuances of both surgical technique and motor re-education critical for to the success of this transfer have been identified and are discussed. PMID:21168979

  4. Bubble CPAP versus CPAP with variable flow in newborns with respiratory distress: a randomized controlled trial.

    Science.gov (United States)

    Yagui, Ana Cristina Zanon; Vale, Luciana Assis Pires Andrade; Haddad, Luciana Branco; Prado, Cristiane; Rossi, Felipe Souza; Deutsch, Alice D Agostini; Rebello, Celso Moura

    2011-01-01

    To evaluate the efficacy and safety of nasal continuous positive airway pressure (NCPAP) using devices with variable flow or bubble continuous positive airway pressure (CPAP) regarding CPAP failure, presence of air leaks, total CPAP and oxygen time, and length of intensive care unit and hospital stay in neonates with moderate respiratory distress (RD) and birth weight (BW) ≥ 1,500 g. Forty newborns requiring NCPAP were randomized into two study groups: variable flow group (VF) and continuous flow group (CF). The study was conducted between October 2008 and April 2010. Demographic data, CPAP failure, presence of air leaks, and total CPAP and oxygen time were recorded. Categorical outcomes were tested using the chi-square test or the Fisher's exact test. Continuous variables were analyzed using the Mann-Whitney test. The level of significance was set at p CPAP failure (21.1 and 20.0% for VF and CF, respectively; p = 1.000), air leak syndrome (10.5 and 5.0%, respectively; p = 0.605), total CPAP time (median: 22.0 h, interquartile range [IQR]: 8.00-31.00 h and median: 22.0 h, IQR: 6.00-32.00 h, respectively; p = 0.822), and total oxygen time (median: 24.00 h, IQR: 7.00-85.00 h and median: 21.00 h, IQR: 9.50-66.75 h, respectively; p = 0.779). In newborns with BW ≥ 1,500 g and moderate RD, the use of continuous flow NCPAP showed the same benefits as the use of variable flow NCPAP.

  5. CT morphology of benign median nerve tumors

    International Nuclear Information System (INIS)

    Feyerabend, T.; Schmitt, R.; Lanz, U.; Warmuth-Metz, M.; Wuerzburg Univ.

    1990-01-01

    Computed tomography (CT) was performed in 3 patients with benign tumors of the median nerve, histologically confirmed as neurilemmoma, fibrolipoma and hemangioma. The neurilemmoma showed a ring-shaped contrast enhancement. The fibrolipoma presented with areas of solid soft tissue and areas of fat. The hemangioma was a solid tumor with a lacunar, vascular contrast enhancement. According to our experience and to the previous literature CT gives useful information regarding the anatomic location, size, and relationship of peripheral nerve sheath tumors to surrounding structures, and may help to differentiate between various tumor types. (orig.)

  6. Prevalence and anatomical pattern of the median artery among ...

    African Journals Online (AJOL)

    Knowledge of the anatomy of median arteries is important in the diagnosis and management of carpal tunnel and pronator teres syndromes, reconstructive surgery in the forearm, minimizing inadvertent vascular injury as well as in limiting operative complications due to unexpected bleeding. The anatomical pattern displays ...

  7. Median nerve cross-sectional area and MRI diffusion characteristics: normative values at the carpal tunnel

    International Nuclear Information System (INIS)

    Yao, Lawrence; Gai, Neville

    2009-01-01

    Enlargement of the median nerve is an objective potential imaging sign of carpal tunnel syndrome. Diffusion tensor MRI (DTI) may provide additional structural information that may prove useful in characterizing median neuropathy. This study further examines normal values for median nerve cross-sectional area (CSA), apparent diffusion coefficient (ADC), and fractional anisotropy (FA). Twenty-three wrists in 17 healthy volunteers underwent MRI of the wrist at 3 T. In 13 subjects, DTI was performed at a B value of 600 mm 2 /s. Median nerve CSA, ADC, and FA were analyzed at standardized anatomic levels. Mean (SD) median nerve CSA within the proximal carpal tunnel was 10.0 (3.4) mm 2 . The mean (SD) FA of the median nerve was 0.71 (0.06) and 0.70 (0.13) proximal to and within the carpal tunnel, respectively. There was a significant difference between nerve CSA and ADC, but not FA, at the distal forearm and proximal carpal tunnel. Nerve CSA, ADC, and FA did not differ between men and women or between dominant and non-dominant wrists. Nerve CSA at the proximal carpal tunnel was positively correlated with subject age and body mass index. Our results suggest a 90% upper confidence limit for normal median nerve CSA of 14.4 mm 2 at the proximal carpal tunnel, higher than normal limits reported by many ultrasound studies. We observed a difference between the CSA and ADC, but not the FA, of the median nerve at the distal forearm and proximal carpal tunnel levels. (orig.)

  8. Median Hetero-Associative Memories Applied to the Categorization of True-Color Patterns

    Science.gov (United States)

    Vázquez, Roberto A.; Sossa, Humberto

    Median associative memories (MED-AMs) are a special type of associative memory based on the median operator. This type of associative model has been applied to the restoration of gray scale images and provides better performance than other models, such as morphological associative memories, when the patterns are altered with mixed noise. Despite of his power, MED-AMs have not been applied in problems involving true-color patterns. In this paper we describe how a median hetero-associative memory (MED-HAM) could be applied in problems that involve true-color patterns. A complete study of the behavior of this associative model in the restoration of true-color images is performed using a benchmark of 14400 images altered by different type of noises. Furthermore, we describe how this model can be applied to an image categorization problem.

  9. A study of retrograde degeneration of median nerve forearm ...

    African Journals Online (AJOL)

    Introduction: Carpal tunnel syndrome (CTS) is a disorder of the hand which results from compression of the median nerve within its fibro-osseous tunnel at the wrist. The slowing in the forearm motor conduction velocity suggests the presence of retrograde degeneration. Existing studies conflict regarding a correlation ...

  10. Quadratic Assignment of Hubs in p-Hub Median Problem

    DEFF Research Database (Denmark)

    Gelareh, Shahin

    We introduce Generalized p-Hub Median Problem (GpHMP) that seeks to locate p hub nodes and install p distinct hub facilities/operators on the hubs while discount factor resulted by consolidation of flow on the hub links depends on the facilities/operators that are installed/operating on both hub...

  11. Regularization of DT-MR images using a successive Fermat median filtering method.

    Science.gov (United States)

    Kwon, Kiwoon; Kim, Dongyoun; Kim, Sunghee; Park, Insung; Jeong, Jaewon; Kim, Taehwan; Hong, Cheolpyo; Han, Bongsoo

    2008-05-21

    Tractography using diffusion tensor magnetic resonance imaging (DT-MRI) is a method to determine the architecture of axonal fibers in the central nervous system by computing the direction of greatest diffusion in the white matter of the brain. To reduce the noise in DT-MRI measurements, a tensor-valued median filter, which is reported to be denoising and structure preserving in the tractography, is applied. In this paper, we proposed the successive Fermat (SF) method, successively using Fermat point theory for a triangle contained in the two-dimensional plane, as a median filtering method. We discussed the error analysis and numerical study about the SF method for phantom and experimental data. By considering the computing time and the image quality aspects of the numerical study simultaneously, we showed that the SF method is much more efficient than the simple median (SM) and gradient descents (GD) methods.

  12. Regularization of DT-MR images using a successive Fermat median filtering method

    International Nuclear Information System (INIS)

    Kwon, Kiwoon; Kim, Dongyoun; Kim, Sunghee; Park, Insung; Jeong, Jaewon; Kim, Taehwan; Hong, Cheolpyo; Han, Bongsoo

    2008-01-01

    Tractography using diffusion tensor magnetic resonance imaging (DT-MRI) is a method to determine the architecture of axonal fibers in the central nervous system by computing the direction of greatest diffusion in the white matter of the brain. To reduce the noise in DT-MRI measurements, a tensor-valued median filter, which is reported to be denoising and structure preserving in the tractography, is applied. In this paper, we proposed the successive Fermat (SF) method, successively using Fermat point theory for a triangle contained in the two-dimensional plane, as a median filtering method. We discussed the error analysis and numerical study about the SF method for phantom and experimental data. By considering the computing time and the image quality aspects of the numerical study simultaneously, we showed that the SF method is much more efficient than the simple median (SM) and gradient descents (GD) methods

  13. Regularization of DT-MR images using a successive Fermat median filtering method

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Kiwoon; Kim, Dongyoun; Kim, Sunghee; Park, Insung; Jeong, Jaewon; Kim, Taehwan [Department of Biomedical Engineering, Yonsei University, Wonju, 220-710 (Korea, Republic of); Hong, Cheolpyo; Han, Bongsoo [Department of Radiological Science, Yonsei University, Wonju, 220-710 (Korea, Republic of)], E-mail: bshan@yonsei.ac.kr

    2008-05-21

    Tractography using diffusion tensor magnetic resonance imaging (DT-MRI) is a method to determine the architecture of axonal fibers in the central nervous system by computing the direction of greatest diffusion in the white matter of the brain. To reduce the noise in DT-MRI measurements, a tensor-valued median filter, which is reported to be denoising and structure preserving in the tractography, is applied. In this paper, we proposed the successive Fermat (SF) method, successively using Fermat point theory for a triangle contained in the two-dimensional plane, as a median filtering method. We discussed the error analysis and numerical study about the SF method for phantom and experimental data. By considering the computing time and the image quality aspects of the numerical study simultaneously, we showed that the SF method is much more efficient than the simple median (SM) and gradient descents (GD) methods.

  14. Influence of median surgeon operative duration on adverse outcomes in bariatric surgery.

    Science.gov (United States)

    Reames, Bradley N; Bacal, Daniel; Krell, Robert W; Birkmeyer, John D; Birkmeyer, Nancy J O; Finks, Jonathan F

    2015-01-01

    Evidence suggests that prolonged operative time adversely affects surgical outcomes. However, whether faster surgeons have better outcomes is unclear, as a surgeon׳s speed could reflect skill and efficiency, but may alternatively reflect haste. This study evaluates whether median surgeon operative time is associated with adverse surgical outcomes after laparoscopic Roux-en-Y gastric bypass. We performed a retrospective cohort study using statewide clinical registry data from the years 2006 to 2012. Surgeons were ranked by their median operative time and grouped into terciles. Multivariable logistic regression with robust standard errors was used to evaluate the influence of median surgeon operative time on 30-day surgical outcomes, adjusting for patient and surgeon characteristics, trainee involvement, concurrent procedures, and the complex interaction between these variables. A total of 16,344 patients underwent surgery during the study period. Compared to surgeons in the fastest tercile, slow surgeons required 53 additional minutes to complete a gastric bypass procedure (median [interquartile range] 139 [133-150] versus 86 [69-91], Ppatient characteristic only, slow surgeons had significantly higher adjusted rates of any complication, prolonged length of stay, emergency department visits or readmissions, and venous thromboembolism (VTE). After further adjustment for surgeon characteristics, resident involvement, and the interaction between these variables, slow surgeons had higher rates of any complication (10.5% versus 7.1%, P=.039), prolonged length of stay (14.0% versus 4.4%, P=.002), and VTE (0.39% versus .22%, P<.001). Median surgeon operative duration is independently associated with adjusted rates of certain adverse outcomes after laparoscopic Roux-en-Y gastric bypass. Improving surgeon efficiency while operating may reduce operative time and improve the safety of bariatric surgery. Copyright © 2015 American Society for Bariatric Surgery. Published by

  15. Variability of pudendal and median nerve sensory perception thresholds in healthy persons.

    Science.gov (United States)

    Quaghebeur, Jörgen; Wyndaele, Jean-Jacques

    2015-04-01

    Normative current perception thresholds (CPTs) are used for the evaluation of sensory function in a variety of diseases. To evaluate the reproducibility of CPT measurements with sinusoidal current in healthy volunteers. Neuroselective CPT evaluations of the median and pudendal nerve in healthy volunteers were repeated with 1 week interval (T1 and T2). In the study group (N = 41) no difference between genders for age (MW-U: P = 0.91) and BMI (t-test: P = 0.18) were found. No significant difference between T1 and T2 was found (Paired t-test: all P-values > 0.05), although the intraclass correlation for each person was low. The variability of measures for the pudendal nerve was: ICC 2 kHz: 0.41; 250 Hz: 0.30; 5 Hz: 0.38, and for the median nerve respectively: 0.58; 0.46; 0.40. Normal CPTs were shown for the pudendal nerve: 2 kHz: 51%; 250 Hz: 76%; 5 Hz: 71%, and median nerve respectively: 78%; 98%; 80%. The pudendal nerve showed more deviating values compared to the median nerve. Both nerves showed deviating values. CPT values with sinusoidal current assessed with 1 week interval, showed a weak intraclass correlation. This finding limits the use of CPT values with this current for longitudinal studies. © 2014 Wiley Periodicals, Inc.

  16. Behavior of visual field index in advanced glaucoma.

    Science.gov (United States)

    Rao, Harsha L; Senthil, Sirisha; Choudhari, Nikhil S; Mandal, Anil K; Garudadri, Chandra S

    2013-01-14

    To evaluate the magnitude of Visual Field Index (VFI) change attributable to change in the estimation algorithm from the pattern deviation probability plot (PDPP) to the total deviation probability plot (TDPP) when the mean deviation (MD) crosses -20 decibels (dB). In a retrospective study, 37 stable glaucoma eyes in which MD of the VFs crossed -20 dB were identified. For each eye, a pair of VFs was selected so that one VF of the pair had a MD better than but close to -20 dB and the other had a MD worse than but again close to -20 dB. The change in VFI in the VF pairs and its associations with the number of points in probability plots with normal threshold sensitivities were evaluated. Similar pairs of VFs from 28 stable glaucoma eyes where the MD crossed -10 dB were chosen as controls. The change in VFI in VF pairs when the MD crossed 20 dB ranged from 3% to 33% (median: 15%), while the change when MD crossed -10 dB ranged from 1% to 8% (median: 4%). Difference in the number of points with normal threshold sensitivities in PDPP when MD was better than -20 dB compared to those in TDPP when MD crossed -20 dB significantly influenced the VFI change (R(2) = 0.65). Considering the eccentricity of these points further explained the VFI change (R(2) = 0.81). The decrease in VFI when MD crosses -20 dB can be highly variable. This has to be considered with the use of VFI in clinical and research settings.

  17. 16 CFR Figure 2 to Part 1203 - ISO Headform-Basic, Reference, and Median Planes

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false ISO Headform-Basic, Reference, and Median Planes 2 Figure 2 to Part 1203 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION CONSUMER PRODUCT... Headform-Basic, Reference, and Median Planes ER10MR98.002 ...

  18. A Rare Variation of the Human Median Nerve Direction

    Directory of Open Access Journals (Sweden)

    Barfi

    2016-04-01

    Full Text Available Introduction The brachial plexus, a complex network of nerves, innervates to the upper limbs. Variation in the course of the nerves in the upper limb is common. Case Presentation This paper describes two cases of upper limb variations in a cadaver dissected at Lorestan University of Medical Sciences. In the first variation, the median nerve in the arm has a different route, so that the median moves deep into the brachialis muscle. In the latter case, after piercing the coracobrachialis muscle a musculocutaneous nerve exists between the brachialis and biceps and goes to the lateral region of the forearm. This is known as the lateral cutaneous nerve of the forearm nerve, and innervates the skin of the lateral part of the forearm and the dorsal part of the hand. Conclusions Because of the possibility of damage to the brachial plexus branches is high in upper limb injuries and surgeries, full knowledge of normal anatomy and variations of these branches is essential for orthopedic specialists, neurosurgeons, radiologists, and anatomists.

  19. Pudendal and median nerve sensory perception threshold: a comparison between normative studies.

    Science.gov (United States)

    Quaghebeur, Jörgen; Wyndaele, Jean Jacques

    2014-12-01

    For the evaluation of sensory innervation, normative data are necessary as a comparison. To compare our current perception thresholds (CPTs) with normative data from other research. Healthy volunteers were assessed for 2000, 250, and 5 Hz CPTs of the median and pudendal nerve and data were compared with other studies. Normative data in the studied group n = 41 (male: 21; female: 20) for the median nerve, 2 kHz, 250 Hz, and 5 Hz were respectively: 241.85 ± 67.72 (140-444); 106.27 ± 39.12 (45-229); 82.05 ± 43.40 (13-271). Pudendal nerve CPTs 250 Hz were: 126.44 ± 69.46 (6-333). For men 2 kHz: 349.95 ± 125.76 (100-588); 5 Hz: 132.67 ± 51.81 (59-249) and women 2 kHz:226.20 ± 119.65 (64-528); 5 Hz: 92.45 ± 44.66 (35-215). For the median nerve no statistical differences for gender were shown. For the pudendal nerve, only 250 Hz showed no difference for gender (t-test: 0.516). Comparison of our data with CPTs of other normative data showed no agreement for the pudendal nerve. For the median nerve only 2 kHz showed agreement in three studies and for 5 Hz with one study. Comparing normative data of multiple studies shows a variety of results and poor agreement. Therefore, referring to normative data of other studies should be handled with caution.

  20. Variability and Reliability of Paired-Pulse Depression and Cortical Oscillation Induced by Median Nerve Stimulation.

    Science.gov (United States)

    Onishi, Hideaki; Otsuru, Naofumi; Kojima, Sho; Miyaguchi, Shota; Saito, Kei; Inukai, Yasuto; Yamashiro, Koya; Sato, Daisuke; Tamaki, Hiroyuki; Shirozu, Hiroshi; Kameyama, Shigeki

    2018-05-08

    Paired-pulse depression (PPD) has been widely used to investigate the functional profiles of somatosensory cortical inhibition. However, PPD induced by somatosensory stimulation is variable, and the reasons for between- and within-subject PPD variability remains unclear. Therefore, the purpose of this study was to clarify the factors influencing PPD variability induced by somatosensory stimulation. The study participants were 19 healthy volunteers. First, we investigated the relationship between the PPD ratio of each component (N20m, P35m, and P60m) of the somatosensory magnetic field, and the alpha, beta, and gamma band changes in power [event-related desynchronization (ERD) and event-related synchronization (ERS)] induced by median nerve stimulation. Second, because brain-derived neurotrophic factor (BDNF) gene polymorphisms reportedly influence the PPD ratio, we assessed whether BDNF genotype influences PPD ratio variability. Finally, we evaluated the test-retest reliability of PPD and the alpha, beta, and gamma ERD/ERS induced by somatosensory stimulation. Significant positive correlations were observed between the P60m_PPD ratio and beta power change, and the P60m_PPD ratio was significantly smaller for the beta ERD group than for the beta ERS group. P35m_PPD was found to be robust and highly reproducible; however, P60m_PPD reproducibility was poor. In addition, the ICC values for alpha, beta, and gamma ERD/ERS were 0.680, 0.760, and 0.552 respectively. These results suggest that the variability of PPD for the P60m deflection may be influenced by the ERD/ERS magnitude, which is induced by median nerve stimulation.

  1. Application of gradient-corrected density functional theory to the structures and thermochemistries of ScF3, TiF4, VF5, and CrF6

    International Nuclear Information System (INIS)

    Russo, T.V.; Martin, R.L.; Jeffrey Hay, P.

    1995-01-01

    Density functional theory (DFT) and Hartree--Fock (HF) calculations are reported for the family of transition metal fluorides ScF 3 , TiF 4 , VF 5 , and CrF 6 . Both HF and the local-density approximation (LDA) yield excellent agreement with experimental bond lengths, while the B-LYP gradient-corrected density functional gives bond lengths 0.04-0.05 A too long. An investigation of various combinations of exchange and correlation functionals shows that, for this series, the origin of this behavior lies in the Becke exchange functional. Much improved bond distances are found using the hybrid HF/DFT functional advocated by Becke. This approximation also leads to much improved thermochemistries. The LDA overestimates average bond energies in this series by 30-40 kcal/mol, whereas the B-LYP functional overbinds by only ∼8-12 kcal/mol, and the hybrid HF/DFT method overbinds by only ∼2 kcal/mol. The hybrid method predicts the octahedral isomer of CrF 6 to be more stable than the trigonal prismatic form by 14 kcal/mol. Comparison of theoretical vibrational frequencies with experiment supports the assignment of an octahedral geometry

  2. In uncertainty we trust: a median voter model with risk aversion

    Directory of Open Access Journals (Sweden)

    Pavel A. Yakovlev

    2011-12-01

    Full Text Available The principal-agent problem and uncertainty are some of the key factors affecting financial and political markets. Fear of the unknown plays an important role in human decision making, including voting. This article describes a theoretical model where voter risk aversion towards uncertainty gives political incumbents a significant advantage over their challengers, exacerbating the principal-agent problem between voters and legislators. The model presented predicts that a rise in voter uncertainty concerning the challenger allows the incumbent to deviate from the median voter’s policy preference without losing the election. This model reconciles the paradoxical coexistence of ideological shirking and high incumbent reelection rates without abandoning the elegant median voter framework.

  3. Sosiaalisen median kehittäminen pk-yrityksissä Töpseli-verkoston avulla

    OpenAIRE

    Palander, Laura

    2010-01-01

    Tämän opinnäytetyön tarkoituksena oli selvittää, minkälaisena mahdollisuutena pk-yrittäjät kokevat sosiaalisen median ja miten he ymmärtävät sen. Läntisellä Uudellamaalla toimivia yrityksiä on osallistunut Laurea-ammattikorkeakoulun Lohjan toimipisteen Töpseli-verkostoon. Verkoston tarkoituksena on vahvistaa länsi Uudellamaalla toimivien pk-yritysten kilpailukykyä, parantamalla yrittäjien ymmärrystä sosiaalisen median tarjoamista mahdollisuuksista. Työtä varten selvitettiin myös ammattikorkea...

  4. [Safety of repeat median sternotomy in the palliative treatment of patients with a univentricular heart].

    Science.gov (United States)

    Díliz-Nava, Héctor; Meléndez-Sagaón, Isis; Tamaríz-Cruz, Orlando; García-Benítez, Luis; Araujo-Martínez, Aric; Palacios-Macedo, Alexis

    To establish the morbidity and mortality of patients with univentricular hearts who underwent a repeat median sternotomy at the Instituto Nacional de Pediatría. A retrospective review was performed on the clinical charts of all patients who underwent a repeat median sternotomy from 2001 to 2016. Sixty-five patients underwent 76 surgeries by repeat median sternotomy. Fifty-nine patients had a first repeat median sternotomy, with a mean age of 36 months (range: 4-176 months) and a mean weight of 12.2 kg (range: 3.2-21.5 kg). Forty patients had a Glenn procedure, and 19 patients had a Fontan procedure. There were 17 patients with a second repeat median sternotomy, with a mean age of 89 months (range 48-156 months), and a mean weight of 22.7 kg (14.4-41 kg). A Fontan procedure was performed on all these 17 patients. A section of the right coronary artery with electrocardiographic changes and a right atrium tear that caused hypotension occurred during first repeat sternotomy. An aortic tear occurred during a second repeat sternotomy with massive bleeding and subsequent death. This represents 3.9% of re-entry injuries. It is concluded that repeat median sternotomy is a safe procedure. Copyright © 2016 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

  5. A Rank Test on Equality of Population Medians

    OpenAIRE

    Pooi Ah Hin

    2012-01-01

    The Kruskal-Wallis test is a non-parametric test for the equality of K population medians. The test statistic involved is a measure of the overall closeness of the K average ranks in the individual samples to the average rank in the combined sample. The resulting acceptance region of the test however may not be the smallest region with the required acceptance probability under the null hypothesis. Presently an alternative acceptance region is constructed such that it has the smallest size, ap...

  6. Tessier Number 30 Median Mandibular Cleft With Congenital Heart Anomalies in Qena, Egypt.

    Science.gov (United States)

    Ali, Ahmed Ali Abdelrahim

    2018-01-01

    Median cleft deformities of the lower lip and mandible are very rare congenital anomalies. Our patient had median cleft of the lower lip, mandible, and the chin with tongue duplication, ankyloglossia, and cleft strap muscles with 2 neck contracture bands. This anomaly was associated with congenital heart disease transposition of great vessels, large ventricular septal defect, and severe pulmonary stenosis. Early repair was done at 6 months to improve feeding.

  7. Evaluation of a non-proprietary, high-tension, four-cable median barrier on level terrain.

    Science.gov (United States)

    2012-11-01

    During the last decade, the use of cable median barriers has risen dramatically. Cable barriers are often utilized in depressed medians : with widths ranging from 30 to 50 ft (9.1 to 15.2 m) and with fill slopes as steep as 4H:1V. A careful review of...

  8. New England observed and predicted median July stream/river temperature points

    Data.gov (United States)

    U.S. Environmental Protection Agency — The shapefile contains points with associated observed and predicted median July stream/river temperatures in New England based on a spatial statistical network...

  9. New England observed and predicted median August stream/river temperature points

    Data.gov (United States)

    U.S. Environmental Protection Agency — The shapefile contains points with associated observed and predicted median August stream/river temperatures in New England based on a spatial statistical network...

  10. Median and ulnar neuropathies in U.S. Army Medical Command Band members.

    Science.gov (United States)

    Shaffer, Scott W; Koreerat, Nicholas R; Gordon, Lindsay B; Santillo, Douglas R; Moore, Josef H; Greathouse, David G

    2013-12-01

    Musicians have been reported as having a high prevalence of upper-extremity musculoskeletal disorders, including carpal tunnel syndrome. The purpose of this study was to determine the presence of median and ulnar neuropathies in U.S. Army Medical Command (MEDCOM) Band members at Fort Sam Houston, Texas. Thirty-five MEDCOM Band members (30 males, 5 females) volunteered to participate. There were 33 right-handed musicians, and the mean length of time in the MEDCOM Band was 12.2 yrs (range, 1-30 yrs). Subjects completed a history form, were interviewed, and underwent a physical examination of the cervical spine and bilateral upper extremities. Nerve conduction studies of the bilateral median and ulnar nerves were performed. Electrophysiological variables served as the reference standard for median and ulnar neuropathy and included distal sensory latencies, distal motor latencies, amplitudes, conduction velocities, and comparison study latencies. Ten of the 35 subjects (29%) presented with abnormal electrophysiologic values suggestive of an upper extremity mononeuropathy. Nine of the subjects had abnormal median nerve electrophysiologic values at or distal to the wrist; 2 had bilateral abnormal values. One had an abnormal ulnar nerve electrophysiologic assessment at the elbow. Nine of these 10 subjects had clinical examination findings consistent with the electrophysiological findings. The prevalence of mononeuropathies in this sample of band members is similar to that found in previous research involving civilian musicians (20-36%) and far exceeds that reported in the general population. Prospective research investigating screening, examination items, and injury prevention measures in musicians appears to be warranted.

  11. PROJECTIONS OF DORSAL AND MEDIAN RAPHE NUCLEI TO DORSAL AND VENTRAL STRIATUM

    Directory of Open Access Journals (Sweden)

    G. R. Hassanzadeh G. Behzadi

    2007-08-01

    Full Text Available The ascending serotonergic projections are derived mainly from mesencephalic raphe nuclei. Topographical projections from mesencephalic raphe nuclei to the striatum were examined in the rat by the retrograde transport technique of HRP (horseradish peroxidase. In 29 rats stereotaxically injection of HRP enzyme were performed in dorsal and ventral parts of striatum separately. The extent of the injection sites and distribution of retrogradely labeled neuronal cell bodies were drawed on representative sections using a projection microscope. Following ipsilateral injection of HRP into the dorsal striatum, numerous labeled neurons were seen in rostral portion of dorsal raphe (DR nucleus. In the same level the cluster of labeled neurons were hevier through caudal parts of DR. A few neurons were also located in lateral wing of DR. More caudally some labeled neurons were found in lateral, medial line of DR. In median raphe nucleus (MnR the labeled neurons were scattered only in median portion of this nucleus. The ipsilateral injection of HRP into the ventral region of striatum resulted on labeling of numerous neurons in rostral, caudal and lateral portions of DR. Through the caudal extension of DR on 4th ventricle level, a large number of labeled neurons were distributed along the ventrocaudal parts of DR. In MnR, labeled neurons were observed only in median part of this nucleus. These findings suggest the mesencephalic raphe nuclei projections to caudo-putamen are topographically organized. In addition dorsal and median raphe nuclei have a stronger projection to the ventral striatum.

  12. Digitaalisen markkinoinnin ja sosiaalisen median hyödyntäminen kampaamoalalla : Pienyritykset

    OpenAIRE

    Myllymäki, Hanna

    2016-01-01

    Tämän opinnäytetyön aiheena oli digitaalisen markkinoinnin ja sosiaalisen median hyödyntäminen kampaamoalalla, erityisesti pienissä yrityksissä. Tavoitteena oli opastaa lukijaa ymmärtämään digitaalisen markkinoinnin ja sosiaalisen median keskeisimmät perusteet ja antaa neuvoja parturi-kampaamoalan yrittäjälle, joka ei ole vielä huomioinut tai osannut hyödyntää niiden työkaluja. Työn teoriaosuudessa käsiteltiin mitä markkinointiviestintä on ja mitä sosiaalisen media on. Tämän lisäksi käsit...

  13. Median effective dose of isoflurane, sevoflurane, and desflurane in green iguanas.

    Science.gov (United States)

    Barter, Linda S; Hawkins, Michelle G; Brosnan, Robert J; Antognini, Joseph F; Pypendop, Bruno H

    2006-03-01

    To determine the median effective dose (ED(50); equivalent to the minimum alveolar concentration [MAC]) of isoflurane, sevoflurane, and desflurane for anesthesia in iguanas. 6 healthy adult green iguanas. In unmedicated iguanas, anesthesia was induced and maintained with each of the 3 volatile drugs administered on separate days according to a Latin square design. Iguanas were endotracheally intubated, mechanically ventilated, and instrumented for cardiovascular and respiratory measurements. During each period of anesthesia, MAC was determined in triplicate. The mean value of 2 consecutive expired anesthetic concentrations, 1 that just permitted and 1 that just prevented gross purposeful movement in response to supramaximal electrical stimulus, and that were not different by more than 15%, was deemed the MAC. Mean +/- SD values for the third MAC determination for isoflurane, sevoflurane, and desflurane were 1.8 +/- 0.3%, 3.1 +/- 1.0%, and 8.9 +/- 2.1% of atmospheric pressure, respectively. The MAC for all inhaled agents was, on average, 22% greater for the first measurement than for the third measurement. Over time, MACs decreased for all 3 agents. Final MAC measurements were similar to values reported for other species. The decrease in MACs over time may be at least partly explained by limitations of anesthetic uptake and distribution imposed by the reptilian cardiorespiratory system. Hence, for a constant end-tidal anesthetic concentration in an iguana, the plane of anesthesia may deepen over time, which could contribute to increased morbidity during prolonged procedures.

  14. Median sep and blink reflex in thyroid diseases.

    Science.gov (United States)

    Oflazoğlu, B; Somay, G; Us, O; Surardamar, A; Tanridağ, T

    2006-11-01

    Pathological disturbances of thyroid hormones is associated with central and peripheral nervous system disturbances. The aim of this study is to evaluate median nerve stimulated somatosensory evoked potential (SEP) and blink reflex of thyroid patients (hypo and hyperthyroidism). Median SEP was performed in 40 patients (21 with hyperthyroidism and 19 with hypothyroidism). We evaluated the latencies of N9, N11, N13, P9, P11, P14, N20 and P25 waves and the N9-N20, N9-N13, N13-N20 and P14-N20 interpeak latencies. We compared the results of patients with the control group (26 persons). We found that the N20 latency was longer in patients with hyperthyroidism than in the control group and the difference was statistically significant. There was not any statistically significant difference regarding the N9, N11, N13, P9, P11, P14, N20 and P25 latencies and the N9-N20, N9-N13, N13-N20 and P14-N20 interpeak latencies between hypothyroid patients and controls. We performed the blink reflex study in 28 of 40 patients (14 patients with hyperthyroidism and 14 patients with hypothyroidism). Comparing the R1, R2, CR2 (contralateral R2) latencies and durations of the patients and controls, we found that R2 and CR2 duration was shorter in patients with hyperthyroidism. This difference was statistically significant.

  15. Effect of finger motion on transverse median nerve movement in the carpal tunnel.

    Science.gov (United States)

    Kang, Hyo Jung; Yoon, Joon Shik

    2016-10-01

    We used ultrasonography (US) to investigate the effects of finger motion on movement of the median nerve in patients with carpal tunnel syndrome (CTS) and the correlation between these US parameters and CTS severity. Ultrasonographic measures were performed in 23 control wrists and 22 CTS wrists in women. During first through third finger flexion and grip motion, median nerve movements were obtained using US and a tracing program. Nerve movements during third finger flexion in the dorsopalmar axis and grip motion in both axes, and during second finger flexion in the radioulnar axis, differed significantly between the control and CTS groups. US parameters correlated negatively with cross-sectional area. This study shows that transverse median nerve movements decreased during grip using US and correlated negatively with CTS severity. Muscle Nerve, 2016 Muscle Nerve 54: -, 2016 Muscle Nerve 54: 738-742, 2016. © 2016 Wiley Periodicals, Inc.

  16. Median Arcuate Ligament Syndrome: A Single-Center Experience with 23 Patients

    Energy Technology Data Exchange (ETDEWEB)

    Nasr, Layla A. [American University of Beirut Medical Center, Division of Interventional Radiology, Department of Radiology (Lebanon); Faraj, Walid G. [American University of Beirut Medical Center, Department of Surgery (Lebanon); Al-Kutoubi, Aghiad [American University of Beirut Medical Center, Division of Interventional Radiology, Department of Radiology (Lebanon); Hamady, Mohamad [Imperial College-London Faculty of Medicine, Division of Interventional Radiology, Department of Radiology (United Kingdom); Khalifeh, Mohamad; Hallal, Ali; Halawani, Hamzeh M. [American University of Beirut Medical Center, Department of Surgery (Lebanon); Wazen, Joelle; Haydar, Ali A., E-mail: ah24@aub.edu.lb [American University of Beirut Medical Center, Division of Interventional Radiology, Department of Radiology (Lebanon)

    2017-05-15

    BackgroundMedian arcuate ligament syndrome (MALS) is a rare entity that occurs when the median arcuate ligament of the diaphragm is low-lying, causing a compression to the underlying celiac trunk. We reviewed the vascular changes associated with MALS in an effort to emphasize the seriousness of this disease and the complications that may result.MethodsThis is a retrospective descriptive analysis of 23 consecutive patients diagnosed with MALS between January 1, 2012 and December 31, 2015 at a tertiary medical center. Computed tomographic (CT) scans, medical records, and patient follow-up were reviewed.ResultsThe number of patients included herein was 23. The median age was 56 years (17–83). Sixteen patients (69.6%) had a significant arterial collateral circulation. Eleven patients (47.8%) were found to have visceral artery aneurysms; 4 patients (36.4%) bled secondary to aneurysm rupture. All ruptured aneurysms were treated with endovascular approach. The severity of the hemodynamic changes appears to be greater with complete occlusion,ConclusionsMALS causes pathological hemodynamic changes within the abdominal vasculature. Follow-up is advised for patients who develop a collateral circulation. Resulting aneurysms should preferably be treated when the size ratio approaches three. Treatment of these aneurysms can be done via an endovascular approach coupled with possible celiac artery decompression to restore physiologic blood flow.

  17. Case Report: A true median facial cleft (crano-facial dysraphia ...

    African Journals Online (AJOL)

    Case Report: A true median facial cleft (crano-facial dysraphia, atessier type O) in Bingham University Teaching Hospital, Jos. ... Patient had a multidisciplinary care by the obstetrician, Neonatologist, anesthesiologist and the plastic surgery team who scheduled a soft tissue repair of the upper lip defect, columella and ...

  18. SOSIAALISEN MEDIAN HYÖDYNTÄMINEN KUNTOKESKUS BALANCEN MARKKINOINNISSA

    OpenAIRE

    Arvola, Timo

    2011-01-01

    Tässä opinnäytetyössä oli kyse kehittämistehtävästä. Kehittämistehtävän tarkoitus oli tarkastella voiko Kuntokes-kus Balance hyödyntää sosiaalista mediaa markkinoinnissaan. Empiirisessä osassa on ohje Facebook-sivun luomi-seen. Teorian alussa tarkastellaan sosiaalista mediaa käsitteenä. Sosiaalisesta mediasta käsitteenä siirrytään sosiaalisen median sovelluksiin ja niiden ominaisuuksiin. Sovelluksista käsitellään Facebook, Youtube, Twitter, Wikipedia, blogit, Movescount ja HeiaHeia. ...

  19. Nuorten sosiaalisen median käyttö tiedonhankinnassa

    OpenAIRE

    Simolin, Annina

    2017-01-01

    Opinnäytetyön toimeksiantajana on Hämeen ammattikorkeakoulun strateginen viestintä, joka vastaa muun muassa opiskelijahankinnasta. HAMKilla on tällä hetkellä käytössään useita sosiaalisen median kanavia, ja työllä haluttiin selvittää mistä kanavista ja mitä tietoa nuoret erityisesti hakevat jatko-opintoja suunnitellessaan. Lisäksi haluttiin selvittää miten nuoret haluavat itse olla yhteydessä oppilaitoksiin hakuaikana. Teoriaosiossa on käsitelty nuorten mediakäyttäytymistä sekä useita sosiaal...

  20. The relationship between better-eye and integrated visual field mean deviation and visual disability.

    Science.gov (United States)

    Arora, Karun S; Boland, Michael V; Friedman, David S; Jefferys, Joan L; West, Sheila K; Ramulu, Pradeep Y

    2013-12-01

    To determine the extent of difference between better-eye visual field (VF) mean deviation (MD) and integrated VF (IVF) MD among Salisbury Eye Evaluation (SEE) subjects and a larger group of glaucoma clinic subjects and to assess how those measures relate to objective and subjective measures of ability/performance in SEE subjects. Retrospective analysis of population- and clinic-based samples of adults. A total of 490 SEE and 7053 glaucoma clinic subjects with VF loss (MD ≤-3 decibels [dB] in at least 1 eye). Visual field testing was performed in each eye, and IVF MD was calculated. Differences between better-eye and IVF MD were calculated for SEE and clinic-based subjects. In SEE subjects with VF loss, models were constructed to compare the relative impact of better-eye and IVF MD on driving habits, mobility, self-reported vision-related function, and reading speed. Difference between better-eye and IVF MD and relationship of better-eye and IVF MD with performance measures. The median difference between better-eye and IVF MD was 0.41 dB (interquartile range [IQR], -0.21 to 1.04 dB) and 0.72 dB (IQR, 0.04-1.45 dB) for SEE subjects and clinic-based patients with glaucoma, respectively, with differences of ≥ 2 dB between the 2 MDs observed in 9% and 18% of the groups, respectively. Among SEE subjects with VF loss, both MDs demonstrated similar associations with multiple ability and performance metrics as judged by the presence/absence of a statistically significant association between the MD and the metric, the magnitude of observed associations (odds ratios, rate ratios, or regression coefficients associated with 5-dB decrements in MD), and the extent of variability in the metric explained by the model (R(2)). Similar associations of similar magnitude also were noted for the subgroup of subjects with glaucoma and subjects in whom better-eye and IVF MD differed by ≥ 2 dB. The IVF MD rarely differs from better-eye MD, and similar associations between VF loss and

  1. Relationship between consecutive deterioration of mean deviation value and progression of visual field defect in open-angle glaucoma.

    Science.gov (United States)

    Naito, Tomoko; Yoshikawa, Keiji; Mizoue, Shiro; Nanno, Mami; Kimura, Tairo; Suzumura, Hirotaka; Takeda, Ryuji; Shiraga, Fumio

    2015-01-01

    To analyze the relationship between consecutive deterioration of mean deviation (MD) value and glaucomatous visual field (VF) progression in open-angle glaucoma (OAG), including primary OAG and normal tension glaucoma. The subjects of the study were patients undergoing treatment for OAG who had performed VF tests at least 10 times with a Humphrey field analyzer (SITA standard, C30-2 program). The VF progression was defined by a significantly negative MD slope (MD slope worsening) at the final VF test during the follow-up period. The relationship between the MD slope worsening and the consecutive deterioration of MD value were retrospectively analyzed. A total of 165 eyes of 165 patients were included in the analysis. Significant progression of VF defects was observed in 72 eyes of 72 patients (43.6%), while no significant progression was evident in 93 eyes of 93 patients (56.4%). There was significant relationship between the frequency of consecutive deterioration of MD value and MD slope worsening (P<0.0001, Cochran-Armitage trend test). A significant association was observed for MD slope worsening in the eyes with three (odds ratio: 2.1, P=0.0224) and four (odds ratio: 3.6, P=0.0008) consecutive deterioration of MD value in multiple logistic regression analysis, but no significant association in the eyes with two consecutive deterioration (odds ratio: 1.1, P=0.8282). The eyes with VF progression had significantly lower intraocular pressure reduction rate (P<0.01). This retrospective study has shown that three or more consecutive deterioration of MD value might be a predictor to future significant MD slope worsening in OAG.

  2. Presentation and management of keloid scarring following median sternotomy: a case study

    Directory of Open Access Journals (Sweden)

    Javangula Kalyana C

    2010-12-01

    Full Text Available Abstract Introduction Keloid scars following median sternotomy are rare and occur more frequently in pigmented skin. Different management strategies have been described with variable success. We present a case of keloid scar formation following cardiac surgery including our management and the final aesthetic result. Case description A 64 year old female of fair complexion underwent mitral valve replacement. The procedure and postoperative recovery were uncomplicated, however, during the following year, thick keloid scars formed over the incision sites. Initial non surgical measures failed to relieve pain and did not offer any tangible aesthetic benefit. Eventually surgical excision was attempted. She presented to our clinic for nine months follow up with significant improvement in pain and aesthetic result. Discussion and Evaluation Several theories have attempted to explore the pathophysiology of keloid scar formation. A number of predisposing factors have been documented however none existed in this case. A variety of invasive and non invasive approaches have been described but significant differences in success rates and methodology of investigations still precludes a standardized management protocol. Conclusions In this case study a rare presentation of keloid scar has been presented. The variety of methods used to improve pain and aesthetic result demonstrates the propensity of keloid scars to recur and the therapeutic challenges that surgeons have to face in their quest for a satisfactory patient outcome.

  3. Median survival time of patients after transcatheter chemo-embolization for hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Haider, Z.; Haq, T.; Munir, K.; Usman, M.U.; Azeemuddin, M.

    2006-01-01

    Objective: To determine the effect on survival after trans arterial chemo embolization (TACE) in patients with unresectable hepatocellular carcinoma (HCC). Design: Longitudinal cohort study. Place and Duration of Study: Radiology Department, The Aga Khan University Hospital, Stadium Road, Karachi, from December 1997 to September 2005. Patients and Methods: Patients undergoing TACE procedure for HCC were prospectively followed. Forty three patients were enrolled from December 1997 to March 2003 in the study and subjected to chemo embolization therapy. Eight out of 43 patients were excluded from the study, who lost to follow-up. All the patients were followed till their death. Median and mean survival were calculated. Results: The median survival of these 35 patients was 410 days (13.6 months), with 95% confidence interval (236 days lower bound and 536 days upper bound). Mean survival time was 603 days (20.1 months) with 95% confidence interval (394 days lower bound and 812 days upper bound). There was significant difference in mean survival time (in days) by Child's Pugh class (X2 = 12.384; df=2, p-value=0.002). Conclusion: The study showed that TACE is an effective palliative treatment. TACE increases the median survival time. (author)

  4. Clinical and Virologic Outcomes After Changes in First Antiretroviral Regimen at 7 Sites in the Caribbean, Central and South America Network.

    Science.gov (United States)

    Wolff, Marcelo; Shepherd, Bryan E; Cortés, Claudia; Rebeiro, Peter; Cesar, Carina; Wagner Cardoso, Sandra; Pape, Jean W; Padgett, Denis; Sierra-Madero, Juan; Echevarria, Juan; McGowan, Catherine C

    2016-01-01

    HIV-infected persons in resource-limited settings may experience high rates of antiretroviral therapy (ART) change, particularly because of toxicity or other nonfailure reasons. Few reports address patient outcomes after these modifications. HIV-infected adults from the 7 Caribbean, Central and South America network clinical cohorts who modified >1 drug from the first ART regimen (ART-1) for any reason thereby starting a second regimen (ART-2) were included. We assessed cumulative incidence of, and factors associated with, death, virologic failure (VF), and regimen change after starting ART-2. Five thousand five hundred sixty-five ART-naive highly active ART initiators started ART-2 after a median of 9.8 months on ART-1; 39% changed to ART-2 because of toxicity and 11% because of failure. Median follow-up after starting ART-2 was 2.9 years; 45% subsequently modified ART-2. Cumulative incidences of death at 1, 3, and 5 years after starting ART-2 were 5.1%, 8.4%, and 10.5%, respectively. In adjusted analyses, death was associated with older age, clinical AIDS, lower CD4 at ART-2 start, earlier calendar year, and starting ART-2 because of toxicity (adjusted hazard ratio = 1.5 vs. failure, 95% confidence interval: 1.0 to 2.1). Cumulative incidences of VF after 1, 3, and 5 years were 9%, 19%, and 25%. In adjusted analyses, VF was associated with younger age, earlier calendar year, lower CD4 at the start of ART-2, and starting ART-2 because of failure (adjusted hazard ratio = 2.1 vs. toxicity, 95% confidence interval: 1.5 to 2.8). Among patients modifying the first ART regimen, risks of subsequent modifications, mortality, and virologic failure were high. Access to improved antiretrovirals in the region is needed to improve initial treatment success.

  5. European Organization for Research and Treatment of Cancer and Groupe d'Etude des Lymphomes de l'Adulte very favorable and favorable, lymphocyte-predominant Hodgkin disease.

    Science.gov (United States)

    Wilder, Richard B; Schlembach, Pamela J; Jones, Dan; Chronowski, Gregory M; Ha, Chul S; Younes, Anas; Hagemeister, Fredrick B; Barista, Ibrahim; Cabanillas, Fernando; Cox, James D

    2002-03-15

    Lymphocyte-predominant Hodgkin disease (LPHD) is rare and has a natural history different from that of classic Hodgkin disease. There is little information in the literature regarding the role of chemotherapy in patients with early-stage LPHD. The objective of this study was to examine recurrence free survival (RFS), overall survival (OS), and patterns of first recurrence in patients with LPHD who were treated with radiotherapy alone or with chemotherapy followed by radiotherapy. From 1963 to 1996, 48 consecutive patients ages 16-49 years (median, 28 years) with Ann Arbor Stage I (n = 30 patients) or Stage II (n = 18 patients), very favorable (VF; n = 5 patients) or favorable (F; n = 43 patients) LPHD, according to the European Organization for Research and Treatment of Cancer and Groupe d'Etude des Lymphomes de l'Adulte (EORTC-GELA) criteria, received radiotherapy alone (n = 37 patients) or received chemotherapy followed by radiotherapy (n = 11 patients). The percentages of patients with VF disease (11% vs. 9% in the radiotherapy group vs. the chemotherapy plus radiotherapy group, respectively) or F disease (89% vs. 91%, respectively) within the two treatment groups were similar (P = 1.00). A median of three cycles of chemotherapy with mechlorethamine, vincristine, procarbazine, and prednisone (MOPP) or with mitoxantrone, vincristine, vinblastine, and prednisone (NOVP) was given initially to six patients and five patients, respectively. A median total radiotherapy dose of 40 grays (Gy) given in daily fractions of 2.0 Gy was delivered to both treatment groups. The median follow-up was 9.3 years, and 98% of patients were observed for > or = 3.0 years. RFS was similar for patients who were treated with radiotherapy alone and patients who were treated with chemotherapy followed by radiotherapy (10-year survival rates: 77% and 68%, respectively; P = 0.89). The OS rate also was similar for the two groups (10-year survival rates: 90% and 100%, respectively; P = 0

  6. Sosiaalisen median merkitys mikroyrityksille - Case: TallFits Oy

    OpenAIRE

    Nousiainen, Ari; Koskivuori, Timo

    2011-01-01

    Tämän opinnäytetyön aiheena on sosiaalinen media mikroyritysten näkökulmasta. Työssä käsi-tellään sosiaalista mediaa ja markkinoinnissa tapahtunutta muutosta sekä niitä toimintatapoja, joita interaktiivinen mediaympäristö yrityksille ja sen asiakkaille tarjoaa. Työn tavoitteena on tuottaa tietoa sosiaalisen median hyödyistä ja haasteista mikroyrityksille ja lisätä koh-deyrityksemme TallFits Oy:n myyntiä ja löydettävyyttä. Tavoitteiden saavuttamiseksi opinnäytetyömme tarkoituksena oli tehd...

  7. Median Filter Noise Reduction of Image and Backpropagation Neural Network Model for Cervical Cancer Classification

    Science.gov (United States)

    Wutsqa, D. U.; Marwah, M.

    2017-06-01

    In this paper, we consider spatial operation median filter to reduce the noise in the cervical images yielded by colposcopy tool. The backpropagation neural network (BPNN) model is applied to the colposcopy images to classify cervical cancer. The classification process requires an image extraction by using a gray level co-occurrence matrix (GLCM) method to obtain image features that are used as inputs of BPNN model. The advantage of noise reduction is evaluated by comparing the performances of BPNN models with and without spatial operation median filter. The experimental result shows that the spatial operation median filter can improve the accuracy of the BPNN model for cervical cancer classification.

  8. Median and Morphological Specialized Processors for a Real-Time Image Data Processing

    Directory of Open Access Journals (Sweden)

    Kazimierz Wiatr

    2002-01-01

    Full Text Available This paper presents the considerations on selecting a multiprocessor MISD architecture for fast implementation of the vision image processing. Using the author′s earlier experience with real-time systems, implementing of specialized hardware processors based on the programmable FPGA systems has been proposed in the pipeline architecture. In particular, the following processors are presented: median filter and morphological processor. The structure of a universal reconfigurable processor developed has been proposed as well. Experimental results are presented as delays on LCA level implementation for median filter, morphological processor, convolution processor, look-up-table processor, logic processor and histogram processor. These times compare with delays in general purpose processor and DSP processor.

  9. AN AMELIORATED DETECTION STATISTICS FOR ADAPTIVE MASK MEDIAN FILTRATION OF HEAVILY NOISED DIGITAL IMAGES

    Directory of Open Access Journals (Sweden)

    Geeta Hanji

    2016-11-01

    Full Text Available Noise reduction is an important area of research in image processing applications. The performance of the digital image noise filtering method primarily depends upon the accuracy of noise detection scheme. This paper presents an effective detector based, adaptive mask, median filtration of heavily noised digital images affected with fixed value (or salt and pepper impulse noise. The proposed filter presents a novel approach; an ameliorated Rank Ordered Absolute Deviation (ROAD statistics to judge whether the input pixel is noised or noise free. If a pixel is detected as corrupted, it is subjected to adaptive mask median filtration; otherwise, it is kept unchanged. Extensive experimental results and comparative performance evaluations demonstrate that the proposed filter outperforms the existing decision type, median based filters with powerful noise detectors in terms of objective performance measures and visual retrieviation accuracy.

  10. Gender-partitioned patient medians of serum albumin requested by general practitioners for the assessment of analytical stability.

    Science.gov (United States)

    Hansen, Steen Ingemann; Petersen, Per Hyltoft; Lund, Flemming; Fraser, Callum G; Sölétormos, György

    2018-04-25

    Recently, the use of separate gender-partitioned patient medians of serum sodium has revealed potential for monitoring analytical stability within the optimum analytical performance specifications for laboratory medicine. The serum albumin concentration depends on whether a patient is sitting or recumbent during phlebotomy. We therefore investigated only examinations requested by general practitioners (GPs) to provide data from sitting patients. Weekly and monthly patient medians of serum albumin requested by GP for both male and female patients were calculated from the raw data obtained from three analysers in the hospital laboratory on examination of samples from those >18 years. The half-range of medians were applied as an estimate of the maximum bias. Further, the ratios between the two medians were calculated (females/males). The medians for male and female patients were closely related despite considerable variation due to the current analytical variation. This relationship was confirmed by the calculated half-range for the monthly ratio between the genders of 0.44%, which surpasses the optimum analytical performance specification for bias of serum albumin (0.72%). The weekly ratio had a half-range of 1.83%, which surpasses the minimum analytical performance specifications of 2.15%. Monthly gender-partitioned patient medians of serum albumin are useful for monitoring of long-term analytical stability, where the gender medians are two independent estimates of changes in (delta) bias: only results requested by GP are of value in this application to ensure that all patients are sitting during phlebotomy.

  11. Platelet-rich plasma limits the nerve injury caused by 10% dextrose in the rabbit median nerve.

    Science.gov (United States)

    Park, Gi-Young; Kwon, Dong Rak

    2014-01-01

    We evaluated the effect of platelet-rich plasma (PRP) injection in a rabbit model of dextrose-induced median nerve injury. New Zealand white rabbits (n = 15) were divided randomly into 3 groups. Three different regimens (group 1: 0.1 ml saline; group 2: 10% dextrose with PRP; group 3: 10% dextrose with saline) were injected within the carpal tunnel. Electrophysiological and histological findings were evaluated 12 weeks after the injection. The mean median motor latency in group 3 was significantly longer than that in groups 1 and 2. The cross-sectional area of the median nerve and subsynovial connective tissue thickness in group 3 were significantly larger than those in groups 1 and 2. PRP injection may be effective in controlling median nerve injury, as demonstrated by improvement in electrophysiological and histological findings 12 weeks after dextrose injection. Copyright © 2013 Wiley Periodicals, Inc.

  12. Radiographic signs of open median sternotomy in neonates and infants

    Energy Technology Data Exchange (ETDEWEB)

    Wu, George [Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); Geisinger Medical Center, Danville, PA (United States); Jaimes, Camilo; Markowitz, Richard I. [Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); Gaynor, J.W. [The Children' s Hospital of Philadelphia, Department of Surgery, Philadelphia, PA (United States)

    2012-06-15

    Leaving the median sternotomy wound open following cardiac surgery is employed to avoid cardiovascular compression. Horizontal struts can be used. Radiologists interpreting portable radiographs might be unaware of the open median sternotomy (OMS). To describe the frequency of radiographic signs of OMS and to increase awareness among radiologists to prevent misdiagnosis of pneumothorax and pneumomediastinum. Radiographs of 41 infants (17 girls/24 boys) with OMS were studied (age range 2 days to 8 months, mean 33 days). Central lucency and sternal edges were noted. Interclavicular distances before and after sternotomy were compared. Central lucency was seen in 25/41 (61%) children. Sternal struts were apparent in 27 (66%). In 14 without struts, central lucency was present in 8 (57%). In 27 children with struts, central lucency was present in 17 (63%) and absent in 10 (37%). Split sternal centers were identified in 6/41 (15%). The mean interclavicular distance was 23.5 mm (SD = 4.39) before sternotomy and 38.2 mm (SD = 7.0 mm) after sternotomy (P < 0.001). OMS has characteristic signs in the majority of cases. Recognition of these findings is useful and can prevent misinterpretation. (orig.)

  13. Robust K-Median and K-Means Clustering Algorithms for Incomplete Data

    Directory of Open Access Journals (Sweden)

    Jinhua Li

    2016-01-01

    Full Text Available Incomplete data with missing feature values are prevalent in clustering problems. Traditional clustering methods first estimate the missing values by imputation and then apply the classical clustering algorithms for complete data, such as K-median and K-means. However, in practice, it is often hard to obtain accurate estimation of the missing values, which deteriorates the performance of clustering. To enhance the robustness of clustering algorithms, this paper represents the missing values by interval data and introduces the concept of robust cluster objective function. A minimax robust optimization (RO formulation is presented to provide clustering results, which are insensitive to estimation errors. To solve the proposed RO problem, we propose robust K-median and K-means clustering algorithms with low time and space complexity. Comparisons and analysis of experimental results on both artificially generated and real-world incomplete data sets validate the robustness and effectiveness of the proposed algorithms.

  14. Calculation of statistic estimates of kinetic parameters from substrate uncompetitive inhibition equation using the median method

    Directory of Open Access Journals (Sweden)

    Pedro L. Valencia

    2017-04-01

    Full Text Available We provide initial rate data from enzymatic reaction experiments and tis processing to estimate the kinetic parameters from the substrate uncompetitive inhibition equation using the median method published by Eisenthal and Cornish-Bowden (Cornish-Bowden and Eisenthal, 1974; Eisenthal and Cornish-Bowden, 1974. The method was denominated the direct linear plot and consists in the calculation of the median from a dataset of kinetic parameters Vmax and Km from the Michaelis–Menten equation. In this opportunity we present the procedure to applicate the direct linear plot to the substrate uncompetitive inhibition equation; a three-parameter equation. The median method is characterized for its robustness and its insensibility to outlier. The calculations are presented in an Excel datasheet and a computational algorithm was developed in the free software Python. The kinetic parameters of the substrate uncompetitive inhibition equation Vmax, Km and Ks were calculated using three experimental points from the dataset formed by 13 experimental points. All the 286 combinations were calculated. The dataset of kinetic parameters resulting from this combinatorial was used to calculate the median which corresponds to the statistic estimator of the real kinetic parameters. A comparative statistical analyses between the median method and the least squares was published in Valencia et al. [3].

  15. Median artery of the forearm in human fetuses in northeastern Brazil: anatomical study and review of the literature.

    Science.gov (United States)

    Aragão, José Aderval; da Silva, Ana Caroline Ferreira; Anunciação, Caio Barretto; Reis, Francisco Prado

    2017-01-01

    A persistent median artery is a rare anomaly. It accompanies the median nerve along its course in the forearm and is of variable origin. It is associated with other local anatomical variations and may contribute significantly towards formation of the superficial palmar arch. In embryos, it is responsible mainly for the blood supply to the hand. The objective of this study was to research the frequency, type (forearm or palmar) and origin of the median artery in fetuses, correlating its presence with sex and body side. Red-colored latex was injected into 32 brachial arteries of human fetuses until its arrival in the hand could be seen. Twenty-four hours after the injection, the median arteries were dissected without the aid of optical instruments. Among the 32 forearms dissected, the median artery was present in 81.25 % (26) of the cases, and it was found more frequently in females and on the left side. Regarding origin, most of the median arteries originated in the common interosseous artery (38.5 %) and anterior interosseous artery (34.6 %). The mean length of the median arteries was 21.1 mm for the palmar type and 19.8 mm for the forearm type. The median artery has a high rate of persistence. It is important to be aware of this anatomical variation, since its presence may give rise to difficulties during routine surgical procedures on the wrist. Its presence may cause serious functional complications in the carpal tunnel, anterior interosseous nerve, round pronator syndromes, and ischemia of the hand.

  16. Property Mix Heterogeneity and Market Cycles: How Much Can We Rely on Median-Price Indices?

    Directory of Open Access Journals (Sweden)

    Odilon Ricardo da Hora Gonçalves Fernandes Costa

    2017-05-01

    Full Text Available Objective. Understand in which types of location median-price indices could provide reasonable estimates of rent growth. As far as our research allows, the market-based measures developed througout this study are the first to emphasize office properties in Brazil using an hedonic framework.Methodology. Create appraisal-based indices of rent growth using median-price and hedonic-based techniques for two regions with different degrees of property mix heterogeneity and compare their behavior overtime.Findings. Volatility in median-price measures is larger than hedonic-based measures in market peaks and throughs due to different weighting of high and low-tier properties overtime. This result is stronger in the location with higher property mix heterogeneity and, consequently, exacerbates market cycles in this region.  Limitations. We do not find statistically significant differences between the measures considered. Nevertheless, we do not consider whether this similarity would hold when using transactional-based data.    Value. Our results suggest that researchers, policy makers and investors need to take into account the “undesired fluctuation” of median-price measures when interpreting such indices.  

  17. Some haltuun : Murrosikäisen sosiaalisen median käytön ohjaus terveydenhoitajan työssä

    OpenAIRE

    Paavola, Pinja; Haapala, Lotta

    2016-01-01

    Opinnäytetyön tavoitteena oli lisätä terveydenhoitajien tietämystä sosiaalisesta mediasta, jotta he osaavat ohjata murrosikäisiä sosiaalisen median turvallisessa käytössä ja, että murrosikäinen voi käyttää sosiaalista mediaa turvallisesti. Tarkoituksena oli selvittää, miten murrosikäinen käyttää sosiaalisen median sovelluksia ja miten terveydenhoitaja voisi ohjata sosiaalisen median turvalliseen käyttöön. Tutkimuskysymyksinä oli selvittää; mitä murrosikäinen tietää sosiaalisen median turvalli...

  18. The "p"-Median Model as a Tool for Clustering Psychological Data

    Science.gov (United States)

    Kohn, Hans-Friedrich; Steinley, Douglas; Brusco, Michael J.

    2010-01-01

    The "p"-median clustering model represents a combinatorial approach to partition data sets into disjoint, nonhierarchical groups. Object classes are constructed around "exemplars", that is, manifest objects in the data set, with the remaining instances assigned to their closest cluster centers. Effective, state-of-the-art implementations of…

  19. Resuscitation therapy for traumatic brain injury-induced coma in rats: mechanisms of median nerve electrical stimulation

    Directory of Open Access Journals (Sweden)

    Zhen Feng

    2015-01-01

    Full Text Available In this study, rats were put into traumatic brain injury-induced coma and treated with median nerve electrical stimulation. We explored the wake-promoting effect, and possible mechanisms, of median nerve electrical stimulation. Electrical stimulation upregulated the expression levels of orexin-A and its receptor OX1R in the rat prefrontal cortex. Orexin-A expression gradually increased with increasing stimulation, while OX1R expression reached a peak at 12 hours and then decreased. In addition, after the OX1R antagonist, SB334867, was injected into the brain of rats after traumatic brain injury, fewer rats were restored to consciousness, and orexin-A and OXIR expression in the prefrontal cortex was downregulated. Our findings indicate that median nerve electrical stimulation induced an up-regulation of orexin-A and OX1R expression in the prefrontal cortex of traumatic brain injury-induced coma rats, which may be a potential mechanism involved in the wake-promoting effects of median nerve electrical stimulation.

  20. PENERAPAN METODE LEAST MEDIAN SQUARE-MINIMUM COVARIANCE DETERMINANT (LMS-MCD DALAM REGRESI KOMPONEN UTAMA

    Directory of Open Access Journals (Sweden)

    I PUTU EKA IRAWAN

    2013-11-01

    Full Text Available Principal Component Regression is a method to overcome multicollinearity techniques by combining principal component analysis with regression analysis. The calculation of classical principal component analysis is based on the regular covariance matrix. The covariance matrix is optimal if the data originated from a multivariate normal distribution, but is very sensitive to the presence of outliers. Alternatives are used to overcome this problem the method of Least Median Square-Minimum Covariance Determinant (LMS-MCD. The purpose of this research is to conduct a comparison between Principal Component Regression (RKU and Method of Least Median Square - Minimum Covariance Determinant (LMS-MCD in dealing with outliers. In this study, Method of Least Median Square - Minimum Covariance Determinant (LMS-MCD has a bias and mean square error (MSE is smaller than the parameter RKU. Based on the difference of parameter estimators, still have a test that has a difference of parameter estimators method LMS-MCD greater than RKU method.

  1. Usability testing of wireless broadband LAN in the MEDIAN user trials

    NARCIS (Netherlands)

    Dam, C. van; Vliet, P.J. van; Schuurman, K.; Maltha, S.R.; Leyten, A.J.M.; Dirks, M.W.S.

    1999-01-01

    The main objective of the ACTS MEDIAN project is to build a high speed WCPN/LAN demonstrator system for multimedia applications and demonstrate it in user trials. The demonstrator system, consisting of one base station and two portable stations, is capable of handling high speed (up to 150 Mbit/s)

  2. Robust Mediation Analysis Based on Median Regression

    Science.gov (United States)

    Yuan, Ying; MacKinnon, David P.

    2014-01-01

    Mediation analysis has many applications in psychology and the social sciences. The most prevalent methods typically assume that the error distribution is normal and homoscedastic. However, this assumption may rarely be met in practice, which can affect the validity of the mediation analysis. To address this problem, we propose robust mediation analysis based on median regression. Our approach is robust to various departures from the assumption of homoscedasticity and normality, including heavy-tailed, skewed, contaminated, and heteroscedastic distributions. Simulation studies show that under these circumstances, the proposed method is more efficient and powerful than standard mediation analysis. We further extend the proposed robust method to multilevel mediation analysis, and demonstrate through simulation studies that the new approach outperforms the standard multilevel mediation analysis. We illustrate the proposed method using data from a program designed to increase reemployment and enhance mental health of job seekers. PMID:24079925

  3. Angiotensin converting enzyme 1 in the median preoptic nucleus contributes to chronic intermittent hypoxia hypertension.

    Science.gov (United States)

    Faulk, Katelynn E; Nedungadi, T Prashant; Cunningham, J Thomas

    2017-05-01

    Obstructive sleep apnea is associated with hypertension and cardiovascular disease. Chronic intermittent hypoxia is used to model the arterial hypoxemia seen in sleep apnea patients and is associated with increased sympathetic nerve activity and a sustained diurnal increase in blood pressure. The renin angiotensin system has been associated with hypertension seen in chronic intermittent hypoxia. Angiotensin converting enzyme 1, which cleaves angiotensin I to the active counterpart angiotensin II, is present within the central nervous system and has been shown to be regulated by AP-1 transcription factors, such as ΔFosB. Our previous study suggested that this transcriptional regulation in the median preoptic nucleus contributes to the sustained blood pressure seen following chronic intermittent hypoxia. Viral mediated delivery of a short hairpin RNA against angiotensin converting enzyme 1 in the median preoptic nucleus was used along with radio-telemetry measurements of blood pressure to test this hypothesis. FosB immunohistochemistry was utilized in order to assess the effects of angiotensin converting enzyme 1 knockdown on the activity of nuclei downstream from median preoptic nucleus. Angiotensin converting enzyme 1 knockdown within median preoptic nucleus significantly attenuated the sustained hypertension seen in chronic intermittent hypoxia. Angiotensin converting enzyme 1 seems to be partly responsible for regulating downstream regions involved in sympathetic and blood pressure control, such as the paraventricular nucleus and the rostral ventrolateral medulla. The data suggest that angiotensin converting enzyme 1 within median preoptic nucleus plays a critical role in the sustained hypertension seen in chronic intermittent hypoxia. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  4. Experience of thymectomy by median sternotomy in patients with myasthenia gravis

    International Nuclear Information System (INIS)

    Hussain, N.; Ahmed, S.W.; Ahmed, T.; Hafeez, A.B.; Baloch, R.; Ali, S.

    2010-01-01

    Objective: To determine the outcome of thymectomy in patients with myasthenia gravis and safety of median sternotomy approach. Methodology: An observational descriptive study was conducted in the department of thoracic surgery JPMC from February 2005 to January 2009. Twenty two patients having persistent generalized or ocular myasthenia gravis referred to our department by neurologists and general physicians, partially or not responding to medical treatment with or without thymoma, were included in the study. Those who were not fit for anaesthesia were excluded. Preoperatively 2 to 3 sessions of plasmaphaeresis were done and each patient was given anti myasthenia gravis treatment. Clinical staging was done by Modified Osserman classification. Median sternotomy approach was used. Outcome was assessed on the basis of remission of disease in different Osserman groups. All patients were followed for a minimum of 6 months. Results: Out of 22 patients, 16 (72.7%) were females and 6 (27.2%) males. Mean age at presentation was 35.2 +- 14.5 years. Mean duration of symptoms was 1.5 +- 1.2 years. A total of 4 (18.1%) patients with myasthenia gravis had thymoma and histopathology of 18 (81.9%) patients showed thymic hyperplasia. Remission was seen in most grades of Osserman. The best response was seen in Grade I where all patients achieved remission. Most patients in Grade II A and II B were benefited. The only patient in Grade III had no improvement of symptoms. No patient in Grade IV underwent thymectomy. Overall 86.3 % had a positive outcome on basis of remission and improvement. Conclusion: Thymectomy by median sternotomy is safe and effective with more favourable outcomes for patients of myasthenia gravis not responding to medical treatment. (author)

  5. On Recording the Unipolar ECG Limb Leads via the Wilson's vs the Goldberger's Terminals: aVR, aVL, and aVF Revisited

    Directory of Open Access Journals (Sweden)

    John E. Madias

    2008-11-01

    Full Text Available The augmented unipolar limb leads aVR, aVL, and aVF, introduced by Goldberger in 1942, are an integral part of the 12-lead ECG.1,2 Leads I, II, and III have 2 dedicated electrodes, but the other 9 leads have a single dedicated electrode, and another one constructed from the averaged inputs of multiple electrodes. This Viewpoint discusses whether an indifferent pole for the recording of unipolar limb leads is best provided by the Wilson's central terminal (WCT, or by inputs from 2 limb electrodes (Goldberger's central terminal (GCT, as done currently, and whether the latter have any advantages over the former. The term "unipolar", popularized by Wilson, is a misnomer, since no leads can be truly "unipolar", all requiring positive and negative poles. Thus the term unipolar is used herein in the quasi-unipolar sense, as when first introduced by Wilson and Goldberger, who also realized that such leads were not truly unipolar. The popularity of the unipolar leads reflected the quest of recording the ECG from various vantage points of the body, considering the limitations of the 3 bipolar leads, introduced by Einthoven,3 which register the difference of 2 ECG curves recorded at the 2 poles of these leads, and no variation in potential at each of these poles.4 In contrast the unipolar leads were thought to register such variation of absolute potential, something not really true. Initially the WCT was used to record the unipolar limb leads,5 but the amplitude was low, and the inscribed ECGs, then, and for many decades later,6 were thick-lined (≥2 mm (Figure 1.

  6. Median nerve trauma in a rat model of work-related musculoskeletal disorder.

    Science.gov (United States)

    Clark, Brian D; Barr, Ann E; Safadi, Fayez F; Beitman, Lisa; Al-Shatti, Talal; Amin, Mamta; Gaughan, John P; Barbe, Mary F

    2003-07-01

    Anatomical and physiological changes were evaluated in the median nerves of rats trained to perform repetitive reaching. Motor degradation was evident after 4 weeks. ED1-immunoreactive macrophages were seen in the transcarpal region of the median nerve of both forelimbs by 5-6 weeks. Fibrosis, characterized by increased immunoexpression of collagen type I by 8 weeks and connective tissue growth factor by 12 weeks, was evident. The conduction velocity (NCV) within the carpal tunnel showed a modest but significant decline after 9-12 weeks. The lowest NCV values were found in animals that refused to participate in the task for the full time available. Thus, both anatomical and physiological signs of progressive tissue damage were present in this model. These results, together with other recent findings indicate that work-related carpal tunnel syndrome develops through mechanisms that include injury, inflammation, fibrosis and subsequent nerve compression.

  7. Estudio del comportamiento de zapatas de medianería con viga centradora mediante modelos de elementos finitos

    OpenAIRE

    Galletero Montero, Pablo; Fernandez Gomez, Jaime Antonio; Perepérez Ventura, Bernardo

    2014-01-01

    Investigación sobre el cálculo de zapatas de medianería utilizando métodos no convencionales. Las dos soluciones más empleadas en edificación para el problema de las cimentaciones de medianería son la utilización de una viga centradora que conecta la zapata de medianería con la zapata del pilar interior más próximo y la colaboración de la viga de la primera planta trabajando como tirante. Los modelos convencionales existentes para el cálculo de este tipo de cimentaciones presentan una serie d...

  8. Median prior constrained TV algorithm for sparse view low-dose CT reconstruction.

    Science.gov (United States)

    Liu, Yi; Shangguan, Hong; Zhang, Quan; Zhu, Hongqing; Shu, Huazhong; Gui, Zhiguo

    2015-05-01

    It is known that lowering the X-ray tube current (mAs) or tube voltage (kVp) and simultaneously reducing the total number of X-ray views (sparse view) is an effective means to achieve low-dose in computed tomography (CT) scan. However, the associated image quality by the conventional filtered back-projection (FBP) usually degrades due to the excessive quantum noise. Although sparse-view CT reconstruction algorithm via total variation (TV), in the scanning protocol of reducing X-ray tube current, has been demonstrated to be able to result in significant radiation dose reduction while maintain image quality, noticeable patchy artifacts still exist in reconstructed images. In this study, to address the problem of patchy artifacts, we proposed a median prior constrained TV regularization to retain the image quality by introducing an auxiliary vector m in register with the object. Specifically, the approximate action of m is to draw, in each iteration, an object voxel toward its own local median, aiming to improve low-dose image quality with sparse-view projection measurements. Subsequently, an alternating optimization algorithm is adopted to optimize the associative objective function. We refer to the median prior constrained TV regularization as "TV_MP" for simplicity. Experimental results on digital phantoms and clinical phantom demonstrated that the proposed TV_MP with appropriate control parameters can not only ensure a higher signal to noise ratio (SNR) of the reconstructed image, but also its resolution compared with the original TV method. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Alternation in F-wave parameters of median nerve from unaffected extremity in stroke patients with hemiplegia under dynamic state

    Institute of Scientific and Technical Information of China (English)

    Hang Zhao; Yong Lin; Wenhua Qi; Shuping Yin; Jiachun Feng

    2006-01-01

    state were detected in order. The amplitude and appearance percentage of F wave were recorded.MAIN OUTCOME MEASURES: Comparison of F-wave parameters of median nerve between the unaffected extremity of stroke patients with hemiplegia and the extremity of control subjects under different status.RESULTS: All the patients accomplished the detection, and all of them participated in the final analysis. ①Under dynamic status, the amplitude and appearance percentage of F wave of unaffected extremity of patients in BRSS Ⅲ-Ⅳ group were significantly higher than those in the normal control group, respectively [(0.803 9±0.157 3) mV vs. (0.406 7±0.170 3) mV; (0.856 1±0.266 8)% vs. (0.650 0±0.197 6)%, P< 0.05]. Under static status, there were no significant differences in F-wave parameters of median nerve in the unaffected extremity of patients between BRSS Ⅰ -Ⅱ group and BRSS Ⅴ-Ⅵ group (P> 0.05). ②F-wave parameters of median nerve of unaffected extremity of patients in BRSS Ⅰ - Ⅱ group and BRSS Ⅴ -Ⅵ group under dynamic statewere higher than those under static status, without significant difference (P>0.05),while the amplitude and appearance percentage of F wave of median nerve of unaffected extremity of patients in BRSS Ⅲ- Ⅳ group under dynamic statewere significantly higher than those under static state [(0.803 9±0.157 3) mV vs.(0.391 7±0.131 6) mV; (0.856 1±0.266 8 )% vs.(0.639 1 ±0.259 4)%,P< 0.05]. ③ There was no significant difference in F wave parameters among groups under static state(P>0.05). However, under dynamic status,the amplitude and appearance percentage of F wave parameters of median nerve of unaffected extremity of patients in BRSS Ⅲ-Ⅳ group [(0.803 9±0.157 3) mV, (0.856 1±0.266 8)%] were significantly lower than those in the other two groups [(0.395 1±0.1488),(0.437 1±0.157 6) mV;(0.612 5±0.232 8)%,(0.657 1±0.232 5)%,P< 0.05].CONCLUSION: With the development of disease condition and the increase of

  10. A median filter approach for correcting errors in a vector field

    Science.gov (United States)

    Schultz, H.

    1985-01-01

    Techniques are presented for detecting and correcting errors in a vector field. These methods employ median filters which are frequently used in image processing to enhance edges and remove noise. A detailed example is given for wind field maps produced by a spaceborne scatterometer. The error detection and replacement algorithm was tested with simulation data from the NASA Scatterometer (NSCAT) project.

  11. Structure-Function Correlations using Scanning Laser Polarimetry in Primary Angle-Closure Glaucoma and Primary Open Angle Glaucoma

    Science.gov (United States)

    Lee, Pei-Jung; Liu, Catherine Jui-Ling.; Wojciechowski, Robert; Bailey-Wilson, Joan E.; Cheng, Ching-Yu

    2010-01-01

    Purpose To assess the correlations between retinal nerve fiber layer (RNFL) thickness measured with scanning laser polarimetry (SLP) and visual field (VF) sensitivity in primary open angle glaucoma (POAG) and primary angle-closure glaucoma (PACG). Design Prospective, comparative, observational cases series Methods Fifty patients with POAG and 56 with PACG were examined using SLP with variable corneal compensation (GDx VCC) and Humphrey VF analyzer between August 2005 and July 2006 at Taipei Veterans General Hospital. Correlations between RNFL thickness and VF sensitivity, expressed as mean sensitivity (MS) in both decibel (dB) and 1/Lambert (L) scales, were estimated by Spearman's rank correlation coefficient (rs) and multivariate median regression models (pseudo R2). The correlations were determined globally and for six RNFL sectors and their corresponding VF regions. Results The correlation between RNFL thickness and MS (in dB) was weaker in the PACG group (rs = 0.38, P = 0.004, pseudo R2 = 0.17) than in the POAG group (rs = 0.51, P <0.001, pseudo R2 = 0.31), but the difference in the magnitude of correlation was not significant (P = 0.42).With Bonferroni correction, the structure-function correlation was significant in the superotemporal (rs = 0.62), superonasal (rs = 0.56), inferonasal (rs = 0.53), and inferotemporal (rs = 0.50) sectors in the POAG group (all P <0.001), while it was significant only in the superotemporal (rs = 0.53) and inferotemporal (rs = 0.48) sectors in the PACG group (both P <0.001). The results were similar when MS was expressed as 1/L scale. Conclusions Both POAG and PACG eyes had moderate structure-function correlations using SLP. Compared to eyes with POAG, fewer RNFL sectors have significant structure-function correlations in eyes with PACG. PMID:20202618

  12. Wound infection after median sternotomy during the war in Croatia.

    Science.gov (United States)

    Jelić, I; Anić, D; Alfirević, I; Kalinić, S; Ugljen, R; Letica, D; Ante Korda, Z; Vucemilo, I; Bulat, C; Predrijevac, M; Corić, V; Husar, J; Jelic, M; Hulina, D; Depina, I; Dadić, D

    1996-12-01

    From 1990 to 1994 at Clinical Hospital Center, Zagreb, 1904 median sternotomies were performed for cardiac operations. Patients shared the same intensive care unit (ICU) with the wounded persons, admitted to the hospital from battlefield. Infection developed in 124 patients, an incidence of 6.51%. Methicillin resistant Staphylococcus aureus (MRSA) was isolated from 90, methicillin resistant Staphylococcus epidermidis (MRSE) from 19, and gram negative bacilli (GNB) from 56 patients, Pseudomonas aeruginosa in 2, and Clostridium pneumoniae in 1 case. Ninety-six patients (5.04%) developed superficial localized infection of subcutaneous tissues and they were treated with frequent dressing changes with antibiotic-soaked gauze in combination with systemic antibiotics. Twenty-eight patients (1.47%) developed mediastinitis and sternal dehiscence. They were treated by operative debridement followed by reclosure of the sternum with continuous antibiotic irrigation. We obtained satisfactory results with our method of closure of sternum which is a modification of Robicsek's technique. Nine of them required further operation. In seven cases we performed muscle flaps and in two omentoplasty. One hundred and twenty patients were discharged in satisfactory condition. The uncontrolled mediastinal sepsis caused death in 4 patients. Higher infection rate after median sternotomy during 1991 and 1992 could be possibly explained with the war circumstances in Croatia, and especially with MRSA strain becoming endemic in surgical ICU.

  13. The development of a cisgenic apple plant.

    Science.gov (United States)

    Vanblaere, Thalia; Szankowski, Iris; Schaart, Jan; Schouten, Henk; Flachowsky, Henryk; Broggini, Giovanni A L; Gessler, Cesare

    2011-07-20

    Cisgenesis represents a step toward a new generation of GM crops. The lack of selectable genes (e.g. antibiotic or herbicide resistance) in the final product and the fact that the inserted gene(s) derive from organisms sexually compatible with the target crop should rise less environmental concerns and increase consumer's acceptance. Here we report the generation of a cisgenic apple plant by inserting the endogenous apple scab resistance gene HcrVf2 under the control of its own regulatory sequences into the scab susceptible apple cultivar Gala. A previously developed method based on Agrobacterium-mediated transformation combined with a positive and negative selection system and a chemically inducible recombination machinery allowed the generation of apple cv. Gala carrying the scab resistance gene HcrVf2 under its native regulatory sequences and no foreign genes. Three cisgenic lines were chosen for detailed investigation and were shown to carry a single T-DNA insertion and express the target gene HcrVf2. This is the first report of the generation of a true cisgenic plant. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Prevalence of ulnar-to-median nerve motor fiber anastomosis (Riché-Cannieu communicating branch) in hand: An electrophysiological study

    Science.gov (United States)

    Ahadi, Tannaz; Raissi, Gholam Reza; Yavari, Masood; Majidi, Lobat

    2016-01-01

    Background: Two main muscles studied in the hand for evaluation of median nerve injuries are opponens pollicis (OP) and abductor pollicis brevis (APB). However, Riché-Cannieu communicating branch (RCCB) may limit the use of these muscles in electrodiagnosis. This condition is confusing in the case of median nerve injuries. This study was conducted to evaluate the prevalence of RCCB. Methods: Twenty-three consecutive cases of complete median nerve injury were studied. Evoked responses via stimulation of median and ulnar nerves in the wrist and recording with needle in the thenar area were studied. Results: Of the patients, 82.6% exhibited RCCB. In 14 (60.8%) cases the OP and in 19(82.6%) cases APB was supplied by the ulnar nerve. Conclusion: RCCB was detected to be 60.8% in OP and 82.6% in APB, so OP is preferable to APB in the study of median nerve. PMID:27390694

  15. The prevalence of median neuropathy at wrist in systemic sclerosis patients at Srinagarind Hospital

    Directory of Open Access Journals (Sweden)

    Thanaporn Nimitbancha

    2015-01-01

    Full Text Available Objectives: To determine the prevalence and factor related with median neuropathy at wrist (MNW in systemic sclerosis patients. Study Design: Cross-sectional study. Setting: Srinagarind Hospital, Khon Kaen, Thailand. Participants: Systemic sclerosis patients who attended the Scleroderma Clinic, Srinagarind Hospital. Materials and Methods: Seventyfive systemic sclerosis patients were prospectively evaluated by questionnaire, physical examination, and electrodiagnostic study. The questionnaire consisted of the symptoms, duration, and type of systemic sclerosis. The physical examination revealed skin score of systemic sclerosis, pinprick sensation of median nerve distribution of both hands, and weakness of both abductor pollicis brevis muscles. The provocative test which were Tinel′s sign and Phalen′s maneuver were also examined. Moreover, electrodiagnostic study of the bilateral median and ulnar nerves was conducted. Results: The prevalence of MNW in systemic sclerosis patients was 44% - percentage of mild, moderate, and severe were 28%, 9.3%, and 6.7%, respectively. The prevalence of asymptomatic MNW was 88%. There were no association between the presence of MNW and related factors of systemic sclerosis. Conclusions: MNW is one of the most common entrapment neuropathies in systemic sclerosis patients. Systemic sclerosis patients should be screened for early signs of MNW.

  16. Hotellin ravitsemispalveluiden markkinointiviestinnän kehittäminen sosiaalisen median keinoin, esimerkkinä case: Digihotelli

    OpenAIRE

    Ruokolainen, Anita

    2014-01-01

    Opinnäytetyössä kehitetään hotellin ravitsemispalveluiden markkinointiviestintää sosiaalisen median tarjoamin keinoin. Työn toimeksiantaja on majoitus- ja ravitsemispalveluita tarjoava yritys. Työn tavoitteena on laatia konkreettisia kehitysideoita markkinointiviestintää varten. Lisäksi tavoitteena on kehittää uusia tapoja hyödyntää sosiaalista mediaa yrityksen markkinointiviestinnässä. Työssä perehdytään myös sosiaalisen median uusiin trendeihin ja kehityssuuntiin. Työn teoreettinen vii...

  17. Data Visualization of Item-Total Correlation by Median Smoothing

    Directory of Open Access Journals (Sweden)

    Chong Ho Yu

    2016-02-01

    Full Text Available This paper aims to illustrate how data visualization could be utilized to identify errors prior to modeling, using an example with multi-dimensional item response theory (MIRT. MIRT combines item response theory and factor analysis to identify a psychometric model that investigates two or more latent traits. While it may seem convenient to accomplish two tasks by employing one procedure, users should be cautious of problematic items that affect both factor analysis and IRT. When sample sizes are extremely large, reliability analyses can misidentify even random numbers as meaningful patterns. Data visualization, such as median smoothing, can be used to identify problematic items in preliminary data cleaning.

  18. Relationship between abdominal fat area measured by screening abdominal fat CT and metabolic syndrome in asymptomatic Korean individuals

    Energy Technology Data Exchange (ETDEWEB)

    Park, Dae Woong; Park, Noh Hyuck; Park, Ji Yeon; Kim, Seon Jeong [Dept. of Radiology, MyoungJi Hospital, Seonam University College of Medicine, Goyang (Korea, Republic of)

    2017-07-15

    The purpose of this study was to investigate the relationship between abdominal fat as assessed by abdominal fat CT and metabolic syndrome (MS), especially in asymptomatic Korean individuals. Retrospectively, a medical record analysis was performed in a total of 111 patients with screening abdominal fat CT. The data such as visceral fat (VF), subcutaneous fat (SF) and VF/SF were elicited by abdominal fat CT, and we analyzed the relationship of VF, SF, and VF/SF with MS and cardiovascular risk factors. In males, VF and SF had a positive correlation with many cardiovascular risk factors and MS, but VF was superior to SF. In females, VF, but not SF, had a positive correlation with some cardiovascular risk factors and MS. The cut-off values of VF and SF to predict MS, which were calculated by drawing receiver operating characteristic curves, were as follows: the cut-off value of VF in men: 136.50 cm{sup 2}, the cut-off value of SF in men: 159.50 cm{sup 2}, and the cut-off value of VF in women: 134.50 cm{sup 2}. In conclusion, VF accumulation was the best predictor of MS and it had a positive correlation with cardiovascular risk factors in both sexes. SF also had a significant association with MS, especially in men, although it was not superior to VF.

  19. Relationship between abdominal fat area measured by screening abdominal fat CT and metabolic syndrome in asymptomatic Korean individuals

    International Nuclear Information System (INIS)

    Park, Dae Woong; Park, Noh Hyuck; Park, Ji Yeon; Kim, Seon Jeong

    2017-01-01

    The purpose of this study was to investigate the relationship between abdominal fat as assessed by abdominal fat CT and metabolic syndrome (MS), especially in asymptomatic Korean individuals. Retrospectively, a medical record analysis was performed in a total of 111 patients with screening abdominal fat CT. The data such as visceral fat (VF), subcutaneous fat (SF) and VF/SF were elicited by abdominal fat CT, and we analyzed the relationship of VF, SF, and VF/SF with MS and cardiovascular risk factors. In males, VF and SF had a positive correlation with many cardiovascular risk factors and MS, but VF was superior to SF. In females, VF, but not SF, had a positive correlation with some cardiovascular risk factors and MS. The cut-off values of VF and SF to predict MS, which were calculated by drawing receiver operating characteristic curves, were as follows: the cut-off value of VF in men: 136.50 cm"2, the cut-off value of SF in men: 159.50 cm"2, and the cut-off value of VF in women: 134.50 cm"2. In conclusion, VF accumulation was the best predictor of MS and it had a positive correlation with cardiovascular risk factors in both sexes. SF also had a significant association with MS, especially in men, although it was not superior to VF

  20. Identification and Expression Profiles of Six Transcripts Encoding Carboxylesterase Protein in Vitis flexuosa Infected with Pathogens

    Directory of Open Access Journals (Sweden)

    Md. Zaherul Islam

    2016-08-01

    Full Text Available Plants protect themselves from pathogen attacks via several mechanisms, including hypersensitive cell death. Recognition of pathogen attack by the plant resistance gene triggers expression of carboxylesterase genes associated with hypersensitive response. We identified six transcripts of carboxylesterase genes, Vitis flexuosa carboxylesterase 5585 (VfCXE5585, VfCXE12827, VfCXE13132, VfCXE17159, VfCXE18231, and VfCXE47674, which showed different expression patterns upon transcriptome analysis of V. flexuosa inoculated with Elsinoe ampelina. The lengths of genes ranged from 1,098 to 1,629 bp, and their encoded proteins consisted of 309 to 335 amino acids. The predicted amino acid sequences showed hydrolase like domains in all six transcripts and contained two conserved motifs, GXSXG of serine hydrolase characteristics and HGGGF related to the carboxylesterase family. The deduced amino acid sequence also contained a potential catalytic triad consisted of serine, aspartic acid and histidine. Of the six transcripts, VfCXE12827 showed upregulated expression against E. ampelina at all time points. Three genes (VfCXE5585, VfCXE12827, and VfCXE13132 showed upregulation, while others (VfCXE17159, VfCXE18231, and VfCXE47674 were down regulated in grapevines infected with Botrytis cinerea. All transcripts showed upregulated expression against Rhizobium vitis at early and later time points except VfCXE12827, and were downregulated for up to 48 hours post inoculation (hpi after upregulation at 1 hpi in response to R. vitis infection. All tested genes showed high and differential expression in response to pathogens, indicating that they all may play a role in defense pathways during pathogen infection in grapevines.

  1. Ciliated median raphe cyst of perineum presenting as perianal polyp: a case report with immunohistochemical study, review of literature, and pathogenesis.

    Science.gov (United States)

    Sagar, Jayesh; Sagar, Bethani; Patel, Adam F; Shak, D K

    2006-03-05

    Median raphe cyst is a very rare, benign congenital lesion occurring mainly on the ventral aspect of the penis, but can develop anywhere in the midline between the external urethral meatus and anus. We report a case of median raphe cyst in the perineum presenting as a perianal polyp in a 65-year-old, English white male with exceptionally rare ciliated epithelium. According to our knowledge, this is the third such case of ciliated median raphe cyst in the English literature. This case, also the first case of ciliated median raphe cyst in the perineum location, focuses on pathogenesis of median raphe cyst.

  2. 40 CFR 799.1700 - Fluoroalkenes.

    Science.gov (United States)

    2010-07-01

    ... sacrificed and necropsied. The order of sacrifice for mice at all pathological evaluations will be random... order of sacrifice for rats at all pathological evaluations will be random among all exposure groups... final results submitted to the Agency by March 23, 1992. The oncogenicity testing for VF shall be...

  3. A Comparison among Worker Types Using a Composites Approach and Median Splits

    Science.gov (United States)

    Aziz, Shahnaz; Wuensch, Karl L.; Brandon, Howard R.

    2010-01-01

    The current study examined Spence and Robbins' (1992) worker types in terms of correlates of workaholism (e.g., work-life imbalance, obsessive-compulsive behavior). A survey was administered to professionals, who were then classified into different worker types following the traditional median-split technique. The data were also analyzed with…

  4. Epithelioid Sarcoma of the Forearm Arising from Perineural Sheath of Median Nerve Mimicking Carpal Tunnel Syndrome

    Directory of Open Access Journals (Sweden)

    Hiromasa Fujii

    2009-01-01

    Full Text Available We report here a case of epithelioid sarcoma in the forearm of a 33-year-old male presenting with symptoms and signs of carpal tunnel syndrome originating from the direct involvement of the median nerve. Due to the slow growing of the tumor, the patient noticed the presence of tumor mass in his forearm after several months from the initial onset of the symptoms. Magnetic resonance imaging showed an 8×4 cm mass involving the median nerve in the middle part of the forearm, and histological analysis of the biopsy specimen revealed the diagnosis of epithelioid sarcoma. Radical surgical resection was performed in conjunction with adjuvant chemotherapy. The function of the flexors were restored by the multiple tendon transfers (EIP→FDS; ECRL→FDP; BrR→FPL; EDM→opponens with superficial cutaneous branch of radial nerve transfer to the resected median nerve. The function of the affected hand showed excellent with the DASH disability/symptom score of 22.5, and both the grasp power and sensory of the median nerve area has recovered up to 50% of the normal side. The patient returned to his original vocation and alive with continuous disease free at 3.5-year follow-up since initial treatment.

  5. CTL escape mediated by proteasomal destruction of an HIV-1 cryptic epitope.

    Directory of Open Access Journals (Sweden)

    Sylvain Cardinaud

    2011-05-01

    Full Text Available Cytotoxic CD8+ T cells (CTLs play a critical role in controlling viral infections. HIV-infected individuals develop CTL responses against epitopes derived from viral proteins, but also against cryptic epitopes encoded by viral alternative reading frames (ARF. We studied here the mechanisms of HIV-1 escape from CTLs targeting one such cryptic epitope, Q9VF, encoded by an HIVgag ARF and presented by HLA-B*07. Using PBMCs of HIV-infected patients, we first cloned and sequenced proviral DNA encoding for Q9VF. We identified several polymorphisms with a minority of proviruses encoding at position 5 an aspartic acid (Q9VF/5D and a majority encoding an asparagine (Q9VF/5N. We compared the prevalence of each variant in PBMCs of HLA-B*07+ and HLA-B*07- patients. Proviruses encoding Q9VF/5D were significantly less represented in HLA-B*07+ than in HLA-B*07- patients, suggesting that Q9FV/5D encoding viruses might be under selective pressure in HLA-B*07+ individuals. We thus analyzed ex vivo CTL responses directed against Q9VF/5D and Q9VF/5N. Around 16% of HLA-B*07+ patients exhibited CTL responses targeting Q9VF epitopes. The frequency and the magnitude of CTL responses induced with Q9VF/5D or Q9VF/5N peptides were almost equal indicating a possible cross-reactivity of the same CTLs on the two peptides. We then dissected the cellular mechanisms involved in the presentation of Q9VF variants. As expected, cells infected with HIV strains encoding for Q9VF/5D were recognized by Q9VF/5D-specific CTLs. In contrast, Q9VF/5N-encoding strains were neither recognized by Q9VF/5N- nor by Q9VF/5D-specific CTLs. Using in vitro proteasomal digestions and MS/MS analysis, we demonstrate that the 5N variation introduces a strong proteasomal cleavage site within the epitope, leading to a dramatic reduction of Q9VF epitope production. Our results strongly suggest that HIV-1 escapes CTL surveillance by introducing mutations leading to HIV ARF-epitope destruction by proteasomes.

  6. Ciliated Median Raphe Cyst of Perineum Presenting as Perianal Polyp: A Case Report with Immunohistochemical Study, Review of Literature, and Pathogenesis

    Directory of Open Access Journals (Sweden)

    Jayesh Sagar

    2006-01-01

    Full Text Available Median raphe cyst is a very rare, benign congenital lesion occurring mainly on the ventral aspect of the penis, but can develop anywhere in the midline between the external urethral meatus and anus. We report a case of median raphe cyst in the perineum presenting as a perianal polyp in a 65-year-old, English white male with exceptionally rare ciliated epithelium. According to our knowledge, this is the third such case of ciliated median raphe cyst in the English literature. This case, also the first case of ciliated median raphe cyst in the perineum location, focuses on pathogenesis of median raphe cyst.

  7. Clinical Correlates of Computationally Derived Visual Field Defect Archetypes in Patients from a Glaucoma Clinic.

    Science.gov (United States)

    Cai, Sophie; Elze, Tobias; Bex, Peter J; Wiggs, Janey L; Pasquale, Louis R; Shen, Lucy Q

    2017-04-01

    To assess the clinical validity of visual field (VF) archetypal analysis, a previously developed machine learning method for decomposing any Humphrey VF (24-2) into a weighted sum of clinically recognizable VF loss patterns. For each of 16 previously identified VF loss patterns ("archetypes," denoted AT1 through AT16), we screened 30,995 reliable VFs to select 10-20 representative patients whose VFs had the highest decomposition coefficients for each archetype. VF global indices and patient ocular and demographic features were extracted retrospectively. Based on resemblances between VF archetypes and clinically observed VF patterns, hypotheses were generated for associations between certain VF archetypes and clinical features, such as an association between AT6 (central island, representing severe VF loss) and large cup-to-disk ratio (CDR). Distributions of the selected clinical features were compared between representative eyes of certain archetypes and all other eyes using the two-tailed t-test or Fisher exact test. 243 eyes from 243 patients were included, representative of AT1 through AT16. CDR was more often ≥ 0.7 among eyes representative of AT6 (central island; p = 0.002), AT10 (inferior arcuate defect; p = 0.048), AT14 (superior paracentral defect; p = 0.016), and AT16 (inferior paracentral defect; p = 0.016) than other eyes. CDR was more often 6D (p = 0.069). Shared clinical features between computationally derived VF archetypes and clinically observed VF patterns support the clinical validity of VF archetypal analysis.

  8. A comparison of latent class, K-means, and K-median methods for clustering dichotomous data.

    Science.gov (United States)

    Brusco, Michael J; Shireman, Emilie; Steinley, Douglas

    2017-09-01

    The problem of partitioning a collection of objects based on their measurements on a set of dichotomous variables is a well-established problem in psychological research, with applications including clinical diagnosis, educational testing, cognitive categorization, and choice analysis. Latent class analysis and K-means clustering are popular methods for partitioning objects based on dichotomous measures in the psychological literature. The K-median clustering method has recently been touted as a potentially useful tool for psychological data and might be preferable to its close neighbor, K-means, when the variable measures are dichotomous. We conducted simulation-based comparisons of the latent class, K-means, and K-median approaches for partitioning dichotomous data. Although all 3 methods proved capable of recovering cluster structure, K-median clustering yielded the best average performance, followed closely by latent class analysis. We also report results for the 3 methods within the context of an application to transitive reasoning data, in which it was found that the 3 approaches can exhibit profound differences when applied to real data. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  9. Prognosis of late versus early ventricular fibrillation in acute myocardial infarction

    DEFF Research Database (Denmark)

    Jensen, G V; Torp-Pedersen, C; Køber, L

    1990-01-01

    VF was not associated with heart failure. When VF was associated with heart failure (secondary VF) early VF had a greater mortality than late VF after 2 and 5 years. Logistic regression analysis showed that heart failure (relative risk 1.9 [1.1 to 3.1]) and cardiogenic shock (relative risk 3.9 [1.......8 to 8.5]) were significant risk factors for in-hospital death. Late VF compared to early VF had no prognostic implication (relative risk 1.0 [0.6 to 1.6]). For patients discharged from the hospital, risk factors were heart failure (1.8 [1.1 to 2.8]) and previous AMI (1.6 [1.3 to 2.1]).(ABSTRACT...... TRUNCATED AT 250 WORDS)...

  10. Virological failure and HIV-1 drug resistance mutations among naive and antiretroviral pre-treated patients entering the ESTHER program of Calmette Hospital in Cambodia.

    Directory of Open Access Journals (Sweden)

    Hubert Barennes

    Full Text Available INTRODUCTION: In resource limited settings, patients entering an antiretroviral therapy (ART program comprise ART naive and ART pre-treated patients who may show differential virological outcomes. METHODS: This retrospective study, conducted in 2010-2012 in the HIV clinic of Calmette Hospital located in Phnom Penh (Cambodia assessed virological failure (VF rates and patterns of drug resistance of naive and pre-treated patients. Naive and ART pre-treated patients were included when a Viral Load (VL was performed during the first year of ART for naive subjects or at the first consultation for pre-treated individuals. Patients showing Virological failure (VF (>1,000 copies/ml underwent HIV DR genotyping testing. Interpretation of drug resistance mutations was done according to 2013 version 23 ANRS algorithms. RESULTS: On a total of 209 patients, 164 (78.4% were naive and 45 (21.5% were ART pre-treated. Their median initial CD4 counts were 74 cells/mm3 (IQR: 30-194 and 279 cells/mm3 (IQR: 103-455 (p<0.001, respectively. Twenty seven patients (12.9% exhibited VF (95% CI: 8.6-18.2%, including 10 naive (10/164, 6.0% and 17 pre-treated (17/45, 37.8% patients (p<0.001. Among these viremic patients, twenty-two (81.4% were sequenced in reverse transcriptase and protease coding regions. Overall, 19 (86.3% harbored ≥1 drug resistance mutations (DRMs whereas 3 (all belonging to pre-treated patients harbored wild-types viruses. The most frequent DRMs were M184V (86.3%, K103N (45.5% and thymidine analog mutations (TAMs (40.9%. Two (13.3% pre-treated patients harbored viruses that showed a multi-nucleos(tide resistance including Q151M, K65R, E33A/D, E44A/D mutations. CONCLUSION: In Cambodia, VF rates were low for naive patients but the emergence of DRMs to NNRTI and 3TC occurred relatively quickly in this subgroup. In pre-treated patients, VF rates were much higher and TAMs were relatively common. HIV genotypic assays before ART initiation and for ART pre

  11. Median and common peroneal neuropathy in coir workers of Alappuzha district, Kerala.

    Science.gov (United States)

    Chandra, Sadanandavalli Retnaswami; Anand, Biji; Issac, Thomas Gregor

    2017-01-01

    Coir work, in a large number of people involves mechanically rolling the coconut fibers into coir which is later subjected to various processes. The primary work is done as a cottage industry specially by women in the sitting posture for several hours. This study reports evidence of median and common peroneal neuropathy electrophysiologically in people who had been engaged in this job for several years. This study was initiated to establish the possible relationship between coir work and symptomatic neuropathies which was seen in that region with all investigations " for other causes not " contributing to the etiological diagnosis. One hundred and forty-two upper limbs and 142 lower limbs in patients engaged in long years of coir work but having no symptoms were evaluated electrophysiologically with informed consent and financial compensation, appropriate inclusion and exclusion criteria were followed as described in the text. There is electrophysiological evidence for median and common peroneal neuropathy in persons engaged in long years of coir work. Coir workers neuropathy appears to be a new occupational neuropathy which can be prevented by following simple preventive measures.

  12. Correlation between the median particle size of chewed frankfurter sausage and almonds during masticatory performance test.

    Science.gov (United States)

    Sumonsiri, P; Thongudomporn, U; Paphangkorakit, J

    2018-04-27

    The correlation between chewing and gastric function is best reflected when the same food type is used during both tests. We proposed frankfurter sausage as test food for masticatory performance as it can also be used in gastric emptying test. The suitability of frankfurter sausage to determine masticatory performance, however, has never been examined. To examine the correlations between the median particle size of frankfurter sausage and almonds (as standard test food) after different numbers of chewing cycles. Twenty-seven subjects performed masticatory performance tests by chewing 2 types of test foods, that is, a piece of almond or 5-g frankfurter sausage cubes placed in a sealed latex bag, for 5 and 15 chewing cycles. For each individual, right and left sides were tested separately. Chewed samples obtained from both sides were pooled. Median particle sizes were determined using a multiple sieving method. Spearman's rank correlation was used to examine any correlation between median particle sizes of the 2 test foods after 5 and 15 cycles. Median particle sizes after 5 and 15 cycles were 2.04 ± 0.87 and 0.95 ± 0.58 mm for almonds and 4.16 ± 0.19 and 3.73 ± 0.25 mm for frankfurter sausage, respectively. Significant correlations were observed between the median particle size of chewed frankfurter sausage after 15 cycles and that of chewed almonds after 5 and 15 cycles (r = .76, P < .01 and r = .52, P = .01, respectively). Frankfurter sausage chewed for 15 cycles may be suitable for the determination of masticatory performance in conjunction with gastric emptying test. © 2018 John Wiley & Sons Ltd.

  13. A Comparison of Ultrasound and MRI Measurements of the Cross-Sectional Area of the Median Nerve at the Wrist.

    Science.gov (United States)

    Hersh, Beverly; D'Auria, Jennifer; Scott, Michael; Fowler, John R

    2018-05-01

    Ultrasound (US) measurement of cross-sectional area (CSA) of the median nerve has emerged as a viable alternative to electromyography/nerve conduction studies (EMG/NCS) for diagnosis of carpal tunnel syndrome (CTS). The purpose of this study is to compare CSA of the median nerve between US and MRI using current MRI and US technology. The null hypothesis is there is no difference between US and MRI CSA measurements. The study design was an observational cohort, enrolling patients presenting to clinic with MRI of the wrist. Participants with clinical signs and symptoms of CTS were excluded. The CSA measurements of the median nerve on MRI T1-weighted axial images were performed by a hand fellow blinded to results of US measurements, and US measurement of median nerve CSA was performed by a hand fellowship trained surgeon blinded to results of the MRI measurements. Results were analyzed via percent error, Pearson correlation, and t tests. Twenty participants were enrolled with mean age of 29.4 years. Four left wrists and 16 right wrists were measured. The US mean CSA of the median nerve was 6.8 mm 2 (±2.330 mm 2 ). The MRI mean CSA of the median nerve was 6.8 mm 2 (±2.153 mm 2 ), P = .442. Pearson correlation between modalities was 0.93, suggesting near-perfect correlation. Mean percent error was 8.8%. Results of this study suggest that US is an accurate method to measure CSA of the median nerve at the carpal tunnel inlet. The mean difference between US and MRI was unlikely to be clinically significant.

  14. The effect of symptoms of carpal tunnel syndrome on ultrasonographic median nerve measures before and after wheelchair propulsion.

    Science.gov (United States)

    Impink, Bradley G; Collinger, Jennifer L; Boninger, Michael L

    2011-09-01

    To quantify median nerve characteristics before and after strenuous wheelchair propulsion and relate them to symptoms of carpal tunnel syndrome (CTS). We hypothesized that persons with and without symptoms of CTS would have significantly different nerve characteristics at baseline and after propulsion. A repeated-measures design was used to obtain ultrasound images of the median nerve at 3 levels of the wrist (radius, pisiform, and hamate) before and after wheelchair propulsion. Investigators were blinded to subject history related to CTS. The 2007 and 2008 National Veterans Wheelchair Games and the Human Engineering Research Laboratories. Fifty-four participants between the ages of 18 and 65 years with a nonprogressive disability who used a manual wheelchair as their primary means of mobility completed this study. Participants completed questionnaires regarding demographics and the presence and severity of symptoms of CTS. Ultrasound images of the median nerve were obtained before and after a 15-minute strenuous wheelchair-propulsion task. Baseline values and post-propulsion changes were determined for median nerve cross-sectional area, flattening ratio, and swelling ratio. Differences in median nerve variables between symptomatic and asymptomatic groups were assessed. No significant differences between symptom groups were identified at baseline; however, persons with symptoms of CTS showed a significantly different percent change from baseline compared with the asymptomatic participants for cross-sectional area at pisiform (P = .014) and flattening ratio at hamate (P = .022), and they showed a strong trend toward a difference in swelling ratio (P = .0502). For each of these variables, the change in the symptomatic group was in the opposite direction of the change in the asymptomatic group. We found several median nerve responses to wheelchair propulsion associated with symptoms of CTS. These responses occurred even though no baseline ultrasound difference was

  15. Experimental concrete coating application on the median barrier of I 65 in Louisville.

    Science.gov (United States)

    2008-06-01

    The objectives of this research were to evaluate the experimental protective coating that was applied to approximately 1,200 linear feet of concrete median barrier along the paving project on a section of I 65 between mile points 131.289 and 136.421 ...

  16. Cost per median overall survival month associated with abiraterone acetate and enzalutamide for treatment of patients with metastatic castration-resistant prostate cancer.

    Science.gov (United States)

    Pilon, Dominic; Queener, Marykay; Lefebvre, Patrick; Ellis, Lorie A

    2016-08-01

    To calculate costs per median overall survival (OS) month in chemotherapy-naïve patients with metastatic castration-resistant prostate cancer (mCRPC) treated with abiraterone acetate plus prednisone (AA + P) or enzalutamide. Median treatment duration and median OS data from published Phase 3 clinical trials and prescribing information were used to calculate costs per median OS month based on wholesale acquisition costs (WACs) for patients with mCRPC treated with AA + P or enzalutamide. Sensitivity analyses were performed to understand how variations in treatment duration and treatment-related monitoring recommendations influenced cost per median OS month. Cost-effectiveness estimates of other Phase 3 trial outcomes were also explored: cost per month of chemotherapy avoided and per median radiographic progression-free survival (rPFS) month. The results demonstrated that AA + P has a lower cost per median OS month than enzalutamide ($3231 vs 4512; 28% reduction), based on the following assumptions: median treatment duration of 14 months for AA + P and 18 months for enzalutamide, median OS of 34.7 months for AA + P and 35.3 months for enzalutamide, and WAC per 30-day supply of $8007.17 for AA + P vs $8847.98 for enzalutamide. Sensitivity analyses showed that accounting for recommended treatment-related monitoring costs or assuming identical treatment durations for AA + P and enzalutamide (18 months) resulted in costs per median OS month 8-27% lower for AA + P than for enzalutamide. Costs per month of chemotherapy avoided were $4448 for AA + P and $5688 for enzalutamide, while costs per month to achieve median rPFS were $6794 for AA + P and $7963 for enzalutamide. This cost-effectiveness analysis demonstrated that costs per median OS month, along with costs of other Phase 3 trial outcomes, were lower for AA + P than for enzalutamide. The findings were robust to sensitivity analyses. These results have important implications

  17. Anomalous Innervation of the Median Nerve in the Arm in the Absence of the Musculocutaneous Nerve

    Directory of Open Access Journals (Sweden)

    Khursheed Raza

    2017-03-01

    Full Text Available The brachial plexus innervates the upper extremities. While variations in the formation of the brachial plexus and its terminal branches are quite common, it is uncommon for the median nerve to innervate the muscles of the arm. During the dissection of an elderly male cadaver at the Department of Anatomy, All India Institute of Medical Sciences, New Delhi, India, in 2016, the coracobrachialis muscle was found to be supplied by a direct branch from the lateral root of the median nerve and the musculocutaneous nerve was absent. The branches of the median nerve supplied the biceps brachii and brachialis muscles and the last branch continued as the lateral cutaneous nerve of the forearm. These variations may present atypically in cases of arm flexor paralysis or sensory loss on the lateral forearm. Knowledge of these variations is important in surgeries and during the administration of regional anaesthesia near the shoulder joint and upper arm.

  18. Normative weight-adjusted models for the median levels of first trimester serum biomarkers for trisomy 21 screening in a specific ethnicity.

    Directory of Open Access Journals (Sweden)

    Ounjai Kor-Anantakul

    Full Text Available To establish normative weight-adjusted models for the median levels of first trimester serum biomarkers for trisomy 21 screening in southern Thai women, and to compare these reference levels with Caucasian-specific and northern Thai models.A cross-sectional study was conducted in 1,150 normal singleton pregnancy women to determine serum pregnancy-associated plasma protein-A (PAPP-A and free β-human chorionic gonadotropin (β-hCG concentrations in women from southern Thailand. The predicted median values were compared with published equations for Caucasians and northern Thai women.The best-fitting regression equations for the expected median serum levels of PAPP-A (mIU/L and free β- hCG (ng/mL according to maternal weight (Wt in kg and gestational age (GA in days were: [Formula: see text] and [Formula: see text] Both equations were selected with a statistically significant contribution (p< 0.05. Compared with the Caucasian model, the median values of PAPP-A were higher and the median values of free β-hCG were lower in the southern Thai women. And compared with the northern Thai models, the median values of both biomarkers were lower in southern Thai women.The study has successfully developed maternal-weight- and gestational-age-adjusted median normative models to convert the PAPP-A and free β-hCG levels into their Multiple of Median equivalents in southern Thai women. These models confirmed ethnic differences.

  19. Current concepts on ventricular fibrillation: A Vicious Circle of Cardiomyocyte Calcium Overload in the Initiation, Maintenance, and Termination of Ventricular Fibrillation

    Directory of Open Access Journals (Sweden)

    Christian E. Zaugg

    2004-04-01

    Full Text Available Based on recent experimental studies, this review article introduces the novel concept that cardiomyocyte Ca2+ and ventricular fibrillation (VF are mutually related, forming a self-maintaining vicious circle in the initiation, maintenance, and termination of VF. On the one hand, elevated myocyte Ca2+ can cause delayed afterdepolarizations, triggered activity, and consequently life-threatening ventricular tachyarrhythmias in various pathological conditions such as digitalis toxicity, myocardial ischemia, or heart failure. On the other hand, VF itself directly and rapidly causes progressive myocyte Ca2+ overload that maintains VF and renders termination of VF increasingly difficult. Accordingly, energy levels for successful electrical defibrillation (defibrillation thresholds increase as both VF and Ca2+ overload progress. Furthermore, VF-induced myocyte Ca2+ overload can promote re-induction of VF after defibrillation and/or postfibrillatory myocardial dysfunction (postresuscitation stunning due to reduced myofilament Ca2+ responsiveness. The probability of these adverse events is best reduced by early detection and rapid termination of VF to prevent or limit Ca2+ overload. Early additional therapy targeting transsarcolemmal Ca2+ entry, particularly during the first 2 min of VF, may partially prevent myocyte Ca2+ overload and thus, increase the likelihood of successful defibrillation as well as prevent postfibrillatory myocardial dysfunction.

  20. Gender-partitioned patient medians of serum albumin requested by general practitioners for the assessment of analytical stability

    DEFF Research Database (Denmark)

    Hansen, Steen Ingemann; Petersen, Per Hyltoft; Lund, Flemming

    2017-01-01

    BACKGROUND: Recently, the use of separate gender-partitioned patient medians of serum sodium has revealed potential for monitoring analytical stability within the optimum analytical performance specifications for laboratory medicine. The serum albumin concentration depends on whether a patient...... patients were closely related despite considerable variation due to the current analytical variation. This relationship was confirmed by the calculated half-range for the monthly ratio between the genders of 0.44%, which surpasses the optimum analytical performance specification for bias of serum albumin...... (0.72%). The weekly ratio had a half-range of 1.83%, which surpasses the minimum analytical performance specifications of 2.15%. CONCLUSIONS: Monthly gender-partitioned patient medians of serum albumin are useful for monitoring of long-term analytical stability, where the gender medians are two...

  1. Percentiles of the run-length distribution of the Exponentially Weighted Moving Average (EWMA) median chart

    Science.gov (United States)

    Tan, K. L.; Chong, Z. L.; Khoo, M. B. C.; Teoh, W. L.; Teh, S. Y.

    2017-09-01

    Quality control is crucial in a wide variety of fields, as it can help to satisfy customers’ needs and requirements by enhancing and improving the products and services to a superior quality level. The EWMA median chart was proposed as a useful alternative to the EWMA \\bar{X} chart because the median-type chart is robust against contamination, outliers or small deviation from the normality assumption compared to the traditional \\bar{X}-type chart. To provide a complete understanding of the run-length distribution, the percentiles of the run-length distribution should be investigated rather than depending solely on the average run length (ARL) performance measure. This is because interpretation depending on the ARL alone can be misleading, as the process mean shifts change according to the skewness and shape of the run-length distribution, varying from almost symmetric when the magnitude of the mean shift is large, to highly right-skewed when the process is in-control (IC) or slightly out-of-control (OOC). Before computing the percentiles of the run-length distribution, optimal parameters of the EWMA median chart will be obtained by minimizing the OOC ARL, while retaining the IC ARL at a desired value.

  2. Prevalence and evolution of low frequency HIV drug resistance mutations detected by ultra deep sequencing in patients experiencing first line antiretroviral therapy failure.

    Science.gov (United States)

    Vandenhende, Marie-Anne; Bellecave, Pantxika; Recordon-Pinson, Patricia; Reigadas, Sandrine; Bidet, Yannick; Bruyand, Mathias; Bonnet, Fabrice; Lazaro, Estibaliz; Neau, Didier; Fleury, Hervé; Dabis, François; Morlat, Philippe; Masquelier, Bernard

    2014-01-01

    Clinical relevance of low-frequency HIV-1 variants carrying drug resistance associated mutations (DRMs) is still unclear. We aimed to study the prevalence of low-frequency DRMs, detected by Ultra-Deep Sequencing (UDS) before antiretroviral therapy (ART) and at virological failure (VF), in HIV-1 infected patients experiencing VF on first-line ART. Twenty-nine ART-naive patients followed up in the ANRS-CO3 Aquitaine Cohort, having initiated ART between 2000 and 2009 and experiencing VF (2 plasma viral loads (VL) >500 copies/ml or one VL >1000 copies/ml) were included. Reverse transcriptase and protease DRMs were identified using Sanger sequencing (SS) and UDS at baseline (before ART initiation) and VF. Additional low-frequency variants with PI-, NNRTI- and NRTI-DRMs were found by UDS at baseline and VF, significantly increasing the number of detected DRMs by 1.35 fold (plow-frequency DRMs modified ARV susceptibility predictions to the prescribed treatment for 1 patient at baseline, in whom low-frequency DRM was found at high frequency at VF, and 6 patients at VF. DRMs found at VF were rarely detected as low-frequency DRMs prior to treatment. The rare low-frequency NNRTI- and NRTI-DRMs detected at baseline that correlated with the prescribed treatment were most often found at high-frequency at VF. Low frequency DRMs detected before ART initiation and at VF in patients experiencing VF on first-line ART can increase the overall burden of resistance to PI, NRTI and NNRTI.

  3. Estimation of brachial artery volume flow by duplex ultrasound imaging predicts dialysis access maturation.

    Science.gov (United States)

    Ko, Sae Hee; Bandyk, Dennis F; Hodgkiss-Harlow, Kelley D; Barleben, Andrew; Lane, John

    2015-06-01

    This study validated duplex ultrasound measurement of brachial artery volume flow (VF) as predictor of dialysis access flow maturation and successful hemodialysis. Duplex ultrasound was used to image upper extremity dialysis access anatomy and estimate access VF within 1 to 2 weeks of the procedure. Correlation of brachial artery VF with dialysis access conduit VF was performed using a standardized duplex testing protocol in 75 patients. The hemodynamic data were used to develop brachial artery flow velocity criteria (peak systolic velocity and end-diastolic velocity) predictive of three VF categories: low (800 mL/min). Brachial artery VF was then measured in 148 patients after a primary (n = 86) or revised (n = 62) upper extremity dialysis access procedure, and the VF category correlated with access maturation or need for revision before hemodialysis usage. Access maturation was conferred when brachial artery VF was >600 mL/min and conduit imaging indicated successful cannulation based on anatomic criteria of conduit diameter >5 mm and skin depth 800 mL/min was predicted when the brachial artery lumen diameter was >4.5 mm, peak systolic velocity was >150 cm/s, and the diastolic-to-systolic velocity ratio was >0.4. Brachial artery velocity spectra indicating VF 800 mL/min. Duplex testing to estimate brachial artery VF and assess the conduit for ease of cannulation can be performed in 5 minutes during the initial postoperative vascular clinic evaluation. Estimation of brachial artery VF using the duplex ultrasound, termed the "Fast, 5-min Dialysis Duplex Scan," facilitates patient evaluation after new or revised upper extremity dialysis access procedures. Brachial artery VF correlates with access VF measurements and has the advantage of being easier to perform and applicable for forearm and also arm dialysis access. When brachial artery velocity spectra criteria confirm a VF >800 mL/min, flow maturation and successful hemodialysis are predicted if anatomic criteria

  4. Rotasi Varimax dan Median Hirarki Cluster Pada Program Raskin di Kabupaten Lombok Barat

    Directory of Open Access Journals (Sweden)

    Desy Komalasari

    2015-11-01

    Full Text Available The granting rice program for poor households (Raskin is one of the West Lombok regency government programs for village poverty. The effectiveness of the program relating to 14 criteria for the poor households Raskin recipients (RTS-PM. The 14 criteria have been grouped into several factors using varimax rotation factor analysis, while the RTS-PM have been grouped using hierarchical median cluster analysis. Four factors obtained based on the analysis. First factor was the house existence, the second factor was the financial ability, the third factor was the house existing facilities, and the four factor was the education of the household head and the purchasing power of clothing. The clustering results using hierarchical median cluster analysis formed 3 clusters. The first cluster contains the RTS-PM which have been grouped into first factor; the second cluster contains the RTS-PM which have been grouped into second and third factor; and the third cluster contains the RTS-PM which have been grouped into fourth factor.

  5. Rotasi Varimax dan Median Hirarki Cluster Pada Program Raskin di Kabupaten Lombok Barat

    Directory of Open Access Journals (Sweden)

    Desy Komalasari

    2015-06-01

    Full Text Available The granting rice program for poor households (Raskin is one of the West Lombok regency government programs for village poverty. The effectiveness of the program relating to 14 criteria for the poor households Raskin recipients (RTS-PM. The 14 criteria have been grouped into several factors using varimax rotation factor analysis, while the RTS-PM have been grouped using hierarchical median cluster analysis. Four factors obtained based on the analysis. First factor was the house existence, the second factor was the financial ability, the third factor was the house existing facilities, and the four factor was the education of the household head and the purchasing power of clothing. The clustering results using hierarchical median cluster analysis formed 3 clusters. The first cluster contains the RTS-PM which have been grouped into first factor; the second cluster contains the RTS-PM which have been grouped into second and third factor; and the third cluster contains the RTS-PM which have been grouped into fourth factor.

  6. Ultrasound in the diagnosis of a median neuropathy in the forearm: case report

    Directory of Open Access Journals (Sweden)

    Yoon Joon-Shik

    2007-12-01

    Full Text Available Abstract Background Electrodiagnostic studies are traditionally used in the diagnosis of focal neuropathies, however they lack anatomical information regarding the nerve and its surrounding structures. The purpose of this case is to show that high-resolution ultrasound used as an adjunct to electrodiagnostic studies may complement this lack of information and give insight to the cause. Case presentation A 60-year-old male patient sustained a forearm traction injury resulting in progressive weakness and functional loss in the first three digits of the right hand. High-resolution ultrasound showed the presence of an enlarged nerve and a homogenous soft-tissue structure appearing to engulf the nerve. The contralateral side was normal. Surgery revealed fibrotic bands emanating from the flexor digitorum profundus muscle compressing the median nerve thus confirming the ultrasound findings. Conclusion A diagnostically challenging case of median neuropathy in the forearm is presented in which high-resolution ultrasound was valuable in establishing an anatomic etiology and directing appropriate management.

  7. Median of patient results as a tool for assessment of analytical stability.

    Science.gov (United States)

    Jørgensen, Lars Mønster; Hansen, Steen Ingemann; Petersen, Per Hyltoft; Sölétormos, György

    2015-06-15

    In spite of the well-established external quality assessment and proficiency testing surveys of analytical quality performance in laboratory medicine, a simple tool to monitor the long-term analytical stability as a supplement to the internal control procedures is often needed. Patient data from daily internal control schemes was used for monthly appraisal of the analytical stability. This was accomplished by using the monthly medians of patient results to disclose deviations from analytical stability, and by comparing divergences with the quality specifications for allowable analytical bias based on biological variation. Seventy five percent of the twenty analytes achieved on two COBASs INTEGRA 800 instruments performed in accordance with the optimum and with the desirable specifications for bias. Patient results applied in analytical quality performance control procedures are the most reliable sources of material as they represent the genuine substance of the measurements and therefore circumvent the problems associated with non-commutable materials in external assessment. Patient medians in the monthly monitoring of analytical stability in laboratory medicine are an inexpensive, simple and reliable tool to monitor the steadiness of the analytical practice. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Vision Health-Related Quality of Life in Chinese Glaucoma Patients

    Directory of Open Access Journals (Sweden)

    Lei Zuo

    2015-01-01

    Full Text Available This cross-sectional study evaluated VRQOL in Chinese glaucoma patients and the potential factors influencing VRQOL. The VRQOL was assessed using the Chinese-version low vision quality of life questionnaire. Visual field loss was classified by the Hodapp-Parrish-Anderson method. The correlations of VRQOL to the best corrected visual acuity and the VF loss were investigated. The potential impact factors to VRQOL of glaucoma patients were screened by single factor analysis and were further analyzed by multiple regression analysis. There were significant differences in VRQOL scores between mild VF loss group and moderate VF loss group, moderate VF loss group and severe VF loss group, and mild VF loss group and severe VF loss group according to the better eye. In multiple linear regression, the binocular weighted average BCVA significantly affected the VRQOL scores. Binocular MD was the second influencing factor. In logistic regression, binocular severe VF loss and stroke were significantly associated with abnormal VRQOL. Education was the next influencing factor. This study showed that visual acuity correlated linearly with VRQOL, and VF loss might reach a certain level, correlating with abnormal VRQOL scores. Stroke was significantly associated with abnormal VRQOL.

  9. Elevers oppfatning av lærers tilbakemeldingspraksis: om sammenheng mellom graden av VfL-praksis og elevenes opplevde nytte av lærers skriftlige tilbakemeldinger i skriftlig norsk

    Directory of Open Access Journals (Sweden)

    Harald Eriksen

    2017-11-01

    Full Text Available Formålet med denne studien var å undersøke elevers oppfatninger av norsklærerens tilbakemeldingspraksis i skriftlig norsk. På bakgrunn av omfattende internasjonal forskning innen feltet ‘Vurdering for læring’ (VfL er det i denne studien utviklet teoridrevne hypoteser som testes ved å analysere et datasett fra to videregående skoler. Hypotesene er at elevene oppfatter lærers tilbakemelding som mer nyttig hvis den 1 retter seg mot målet med opplæringen, 2 gir elevene informasjon via en forklaring eller instruks om hvordan de skal komme nærmere målet og 3 at lærer legger til rette for bruk av tilbakemeldingen. Strukturell likningsmodellering (SEM av resultater fra en spørreundersøkelse blant elever (N = 213 er brukt som metode til å estimere forholdet mellom de fire latente variablene kriterier, forklaring, bruk og nytte (avhengig variabel. SEM er brukt fordi metoden egner seg til å undersøke sammenhenger i komplekse datasett. Funn er at elevene oppfatter at hvis lærer forklarer hvordan de kan forbedre seg, er dette positivt statistisk assosiert med opplevd nytte. Et mer overraskende funn er at lærerens tilrettelegging for bruk av tilbakemeldinger ikke er signifikant assosiert med opplevd nytte. Resultatene blir diskutert i artikkelen.

  10. Alternative approach for management of an electrical storm in Brugada syndrome:Importance of primary ablation within a narrow time window

    Directory of Open Access Journals (Sweden)

    Ahmed Karim Talib, MD, PhD

    2016-06-01

    Full Text Available Placement of an implantable cardioverter–defibrillator (ICD is the only powerful treatment modality for Brugada syndrome in patients presenting with ventricular fibrillation (VF. For those whose first presentation is an electrical storm, pharmacologic therapy is typically used to control VF followed by ICD implantation. We report an alternative approach whereby, before ICD implantation, emergency catheter ablation of the VF-triggering premature ventricular contraction (PVC resulted in long-term VF-free survival. The results suggest that, because VF triggers appear in a narrow time window, ablation of the culprit PVCs that initiate VF before the index PVCs subside is a reasonable alternative approach.

  11. An adaptive sampling method for variable-fidelity surrogate models using improved hierarchical kriging

    Science.gov (United States)

    Hu, Jiexiang; Zhou, Qi; Jiang, Ping; Shao, Xinyu; Xie, Tingli

    2018-01-01

    Variable-fidelity (VF) modelling methods have been widely used in complex engineering system design to mitigate the computational burden. Building a VF model generally includes two parts: design of experiments and metamodel construction. In this article, an adaptive sampling method based on improved hierarchical kriging (ASM-IHK) is proposed to refine the improved VF model. First, an improved hierarchical kriging model is developed as the metamodel, in which the low-fidelity model is varied through a polynomial response surface function to capture the characteristics of a high-fidelity model. Secondly, to reduce local approximation errors, an active learning strategy based on a sequential sampling method is introduced to make full use of the already required information on the current sampling points and to guide the sampling process of the high-fidelity model. Finally, two numerical examples and the modelling of the aerodynamic coefficient for an aircraft are provided to demonstrate the approximation capability of the proposed approach, as well as three other metamodelling methods and two sequential sampling methods. The results show that ASM-IHK provides a more accurate metamodel at the same simulation cost, which is very important in metamodel-based engineering design problems.

  12. Years Versus Days Between Successive Surgeries, After an Initial Outpatient Procedure, for the Median Patient Versus the Median Surgeon in the State of Iowa.

    Science.gov (United States)

    Dexter, Franklin; Jarvie, Craig; Epstein, Richard H

    2018-03-01

    Previously, we studied the relative importance of different institutional interventions that the largest hospital in Iowa could take to grow the anesthesia department's outpatient surgical care. Most (>50%) patients having elective surgery had not previously had surgery at the hospital. Patient perioperative experience was unimportant for influencing total anesthesia workload and numbers of patients. More important was the availability of surgical clinic appointments within several days. These results would be generalizable if the median time from surgery to a patient's next surgical procedure was large (eg, >2 years), among all hospitals in Iowa with outpatient surgery, and without regard to the hospital where the next procedure was performed. There were 37,172 surgical cases at hospital outpatient departments of any of the 117 hospitals in Iowa from July 1, 2013, to September 30, 2013. Data extracted about each case included its intraoperative work relative value units. The 37,172 cases were matched to all inpatient and outpatient records for the next 2 years statewide using patient linkage identifiers; from these were determined whether the patient had surgery again within 2 years. Furthermore, the cases' 1820 surgeons were matched to the surgeon's next outpatient or inpatient case, both including and excluding other cases performed on the date of the original case. By patient, the median time to their next surgical case, either outpatient or inpatient, exceeded 2 years, tested with weighting by intraoperative relative value units and repeated when unweighted (both P 2 years for patients versus 1 day for surgeons. Thus, although patients' experiences are an important attribute of quality of care, surgeons' experiences are orders of magnitude more important from the vantage point of marketing and growth of an anesthesia practice.

  13. Ant colony optimization techniques for the hamiltonian p-median problem

    Directory of Open Access Journals (Sweden)

    M. Zohrehbandian

    2010-12-01

    Full Text Available Location-Routing problems involve locating a number of facilitiesamong candidate sites and establishing delivery routes to a set of users in such a way that the total system cost is minimized. A special case of these problems is Hamiltonian p-Median problem (HpMP. This research applies the metaheuristic method of ant colony optimization (ACO to solve the HpMP. Modifications are made to the ACO algorithm used to solve the traditional vehicle routing problem (VRP in order to allow the search of the optimal solution of the HpMP. Regarding this metaheuristic algorithm a computational experiment is reported as well.

  14. Sudden cardiac arrest in people with epilepsy in the community

    Science.gov (United States)

    Lamberts, Robert J.; Blom, Marieke T.; Wassenaar, Merel; Bardai, Abdennasser; Leijten, Frans S.; de Haan, Gerrit-Jan; Sander, Josemir W.; Thijs, Roland D.

    2015-01-01

    Objective: To ascertain whether characteristics of ventricular tachycardia/fibrillation (VT/VF) differed between people with epilepsy and those without and which individuals with epilepsy were at highest risk. Methods: We ascertained 18 people with active epilepsy identified in a community-based registry of sudden cardiac arrest (SCA) with ECG-confirmed VT/VF (cases). We compared them with 470 individuals with VT/VF without epilepsy (VT/VF controls) and 54 individuals with epilepsy without VT/VF (epilepsy controls). Data on comorbidity, epilepsy severity, and medication use were collected and entered into (conditional) logistic regression models to identify determinants of VT/VF in epilepsy. Results: In most cases, there was an obvious (10/18) or presumed cardiovascular cause (5/18) in view of preexisting heart disease. In 2 of the 3 remaining events, near–sudden unexpected death in epilepsy (SUDEP) was established after successful resuscitation. Cases had a higher prevalence of congenital/inherited heart disease (17% vs 1%, p = 0.002), and experienced VT/VF at younger age (57 vs 64 years, p = 0.023) than VT/VF controls. VT/VF in cases occurred more frequently at/near home (89% vs 58%, p = 0.009), and was less frequently witnessed (72% vs 89%, p = 0.048) than in VT/VF controls. Cases more frequently had clinically relevant heart disease (50% vs 15%, p = 0.005) and intellectual disability (28% vs 1%, p epilepsy controls. Conclusion: Cardiovascular disease rather than epilepsy characteristics is the main determinant of VT/VF in people with epilepsy in the community. SCA and SUDEP are partially overlapping disease entities. PMID:26092917

  15. Akıllı telefon kullanımının median sinir üzerine etkisi

    OpenAIRE

    İlik, Faik; Büyükgöl, Huseyin; Eren, Fatma A.; İlik, Mustafa K.; Kayhan, Fatih; Köse, Hatice

    2018-01-01

    Purpose: The aim of this study was to examine the effects of smartphone use on the median nerve. Materials and Methods: Participants were classified into three groups according to their smartphone use frequencies; high smartphone users (with Smartphone addiction scale (SAS) score of higher than 71), low smartphone users (SAS score less than 71) and classical type mobile phones users. The Visual analogue scale (VAS), quick-disabilities of arm, shoulder, hand (qDASH) and median nerve conduction...

  16. Anatomic Variation of the Median Nerve Associated with an Anomalous Muscle of the Forearm.

    Science.gov (United States)

    Atoni, Atoni Dogood; Oyinbo, Charles Aidemise

    2017-03-01

    Documented anatomical variations are important not only for the study of the subject of anatomy, but also in clinical situation. This knowledge would aid surgeons in planning a preoperative strategy for surgical procedures and reconstructive surgery. The right forearm of a 35-year-old embalmed male cadaver present a splitting of the median nerve in the proximal 1/3 of the forearm to form medial and lateral divisions that accommodate an anomalous muscle. The split median nerve reunites at the distal 1/3 and continues as a single nerve. The anomalous muscle arises by muscle fibers from flexor digitorum superficialis and inserted by tendon into flexor digitorum profundus. There was no such variation in the left forearm. The knowledge of such anatomical variations is important to clinicians and surgeons in interpreting atypical clinical presentations and avoiding unusual injury during surgery.

  17. Anatomic Variation of the Median Nerve Associated with an Anomalous Muscle of the Forearm

    Directory of Open Access Journals (Sweden)

    Atoni Atoni Dogood

    2017-03-01

    Full Text Available Documented anatomical variations are important not only for the study of the subject of anatomy, but also in clinical situation. This knowledge would aid surgeons in planning a preoperative strategy for surgical procedures and reconstructive surgery. The right forearm of a 35-year-old embalmed male cadaver present a splitting of the median nerve in the proximal 1/3 of the forearm to form medial and lateral divisions that accommodate an anomalous muscle. The split median nerve reunites at the distal 1/3 and continues as a single nerve. The anomalous muscle arises by muscle fibers from flexor digitorum superficialis and inserted by tendon into flexor digitorum profundus. There was no such variation in the left forearm. The knowledge of such anatomical variations is important to clinicians and surgeons in interpreting atypical clinical presentations and avoiding unusual injury during surgery.

  18. Relationship between consecutive deterioration of mean deviation value and progression of visual field defect in open-angle glaucoma

    Directory of Open Access Journals (Sweden)

    Naito T

    2015-11-01

    Full Text Available Tomoko Naito,1 Keiji Yoshikawa,2 Shiro Mizoue,3 Mami Nanno,4 Tairo Kimura,5 Hirotaka Suzumura,6 Ryuji Takeda,7 Fumio Shiraga1 1Department of Ophthalmology, Okayama University Graduate School of Medicine, Okayama, 2Yoshikawa Eye Clinic, Tokyo, 3Department of Ophthalmology, Ehime University Graduate School of Medicine, Ehime, 4Kagurazaka Minamino Eye Clinic, 5Ueno Eye Clinic, 6Suzumura Eye Clinic, Tokyo, 7Department of Agriculture, Kinki University, Nara, Japan Purpose: To analyze the relationship between consecutive deterioration of mean deviation (MD value and glaucomatous visual field (VF progression in open-angle glaucoma (OAG, including primary OAG and normal tension glaucoma.Patients and methods: The subjects of the study were patients undergoing treatment for OAG who had performed VF tests at least 10 times with a Humphrey field analyzer (SITA standard, C30-2 program. The VF progression was defined by a significantly negative MD slope (MD slope worsening at the final VF test during the follow-up period. The relationship between the MD slope worsening and the consecutive deterioration of MD value were retrospectively analyzed.Results: A total of 165 eyes of 165 patients were included in the analysis. Significant progression of VF defects was observed in 72 eyes of 72 patients (43.6%, while no significant progression was evident in 93 eyes of 93 patients (56.4%. There was significant relationship between the frequency of consecutive deterioration of MD value and MD slope worsening (P<0.0001, Cochran–Armitage trend test. A significant association was observed for MD slope worsening in the eyes with three (odds ratio: 2.1, P=0.0224 and four (odds ratio: 3.6, P=0.0008 consecutive deterioration of MD value in multiple logistic regression analysis, but no significant association in the eyes with two consecutive deterioration (odds ratio: 1.1, P=0.8282. The eyes with VF progression had significantly lower intraocular pressure reduction rate (P<0

  19. Relationship between visual field progression and baseline refraction in primary open-angle glaucoma.

    Science.gov (United States)

    Naito, Tomoko; Yoshikawa, Keiji; Mizoue, Shiro; Nanno, Mami; Kimura, Tairo; Suzumura, Hirotaka; Umeda, Yuzo; Shiraga, Fumio

    2016-01-01

    To analyze the relationship between visual field (VF) progression and baseline refraction in Japanese patients with primary open-angle glaucoma (POAG) including normal-tension glaucoma. In this retrospective study, the subjects were patients with POAG who had undergone VF tests at least ten times with a Humphrey Field Analyzer (Swedish interactive thresholding algorithm standard, Central 30-2 program). VF progression was defined as a significantly negative value of mean deviation (MD) slope at the final VF test. Multivariate logistic regression models were applied to detect an association between MD slope deterioration and baseline refraction. A total of 156 eyes of 156 patients were included in this analysis. Significant deterioration of MD slope was observed in 70 eyes of 70 patients (44.9%), whereas no significant deterioration was evident in 86 eyes of 86 patients (55.1%). The eyes with VF progression had significantly higher baseline refraction compared to those without apparent VF progression (-1.9±3.8 diopter [D] vs -3.5±3.4 D, P=0.0048) (mean ± standard deviation). When subject eyes were classified into four groups by the level of baseline refraction applying spherical equivalent (SE): no myopia (SE > -1D), mild myopia (-1D ≥ SE > -3D), moderate myopia (-3D ≥ SE > -6D), and severe myopia (-6D ≥ SE), the Cochran-Armitage trend analysis showed a decreasing trend in the proportion of MD slope deterioration with increasing severity of myopia (P=0.0002). The multivariate analysis revealed that baseline refraction (P=0.0108, odds ratio [OR]: 1.13, 95% confidence interval [CI]: 1.03-1.25) and intraocular pressure reduction rate (P=0.0150, OR: 0.97, 95% CI: 0.94-0.99) had a significant association with MD slope deterioration. In the current analysis of Japanese patients with POAG, baseline refraction was a factor significantly associated with MD slope deterioration as well as intraocular pressure reduction rate. When baseline refraction was classified into

  20. Feasibility of vocal fold abduction and adduction assessment using cine-MRI.

    Science.gov (United States)

    Baki, Marina Mat; Menys, Alex; Atkinson, David; Bassett, Paul; Morley, Simon; Beale, Timothy; Sandhu, Guri; Naduvilethil, Georgekutty; Stevenson, Nicola; Birchall, Martin A; Punwani, Shonit

    2017-02-01

    Determine feasibility of vocal fold (VF) abduction and adduction assessment by cine magnetic resonance imaging (cine-MRI) METHODS: Cine-MRI of the VF was performed on five healthy and nine unilateral VF paralysis (UVFP) participants using an axial gradient echo acquisition with temporal resolution of 0.7 s. VFs were continuously imaged with cine-MRI during a 10-s period of quiet respiration and phonation. Scanning was repeated twice within an individual session and then once again at a 1-week interval. Asymmetry of VF position during phonation (VF phonation asymmetry, VFPa) and respiration (VF respiration asymmetry, VFRa) was determined. Percentage reduction in total glottal area between respiration and phonation (VF abduction potential, VFAP) was derived to measure overall mobility. An un-paired t-test was used to compare differences between groups. Intra-session, inter-session and inter-reader repeatability of the quantitative metrics was evaluated using intraclass correlation coefficient (ICC). VF position asymmetry (VFPa and VFRa) was greater (p=0.012; p=0.001) and overall mobility (VFAP) was lower (p=0.008) in UVFP patients compared with healthy participants. ICC of repeatability of all metrics was good, ranged from 0.82 to 0.95 except for the inter-session VFPa (0.44). Cine-MRI is feasible for assessing VF abduction and adduction. Derived quantitative metrics have good repeatability. • Cine-MRI is used to assess vocal folds (VFs) mobility: abduction and adduction. • New quantitative metrics are derived from VF position and abduction potential. • Cine-MRI able to depict the difference between normal and abnormal VF mobility. • Cine-MRI derived quantitative metrics have good repeatability.

  1. Mapping glaucoma patients' 30-2 and 10-2 visual fields reveals clusters of test points damaged in the 10-2 grid that are not sampled in the sparse 30-2 grid.

    Directory of Open Access Journals (Sweden)

    Ryo Asaoka

    Full Text Available PURPOSE: To cluster test points in glaucoma patients' 30-2 and 10-2 visual field (VF (Humphrey Field Analyzer: HFA, Carl Zeiss Meditec, Dublin, CA in order to map the different regions damaged by the disease. METHOD: This retrospective study included 128 eyes from 128 patients. 142 total deviation (TD values (74 from the 30-2 VF and 68 from the 10-2 VF were clustered using the 'Hierarchical Ordered Partitioning And Collapsing Hybrid-Partitioning Around Medoids' algorithm. The stability of the identified clusters was evaluated using bootstrapping. RESULTS: 65 sectors were identified in total: 38 sectors were located outside the 10-2 VF whereas 29 sectors were located inside the 10-2 VF (two sectors overlap in both grids. The mapping of many sectors appeared to follow the distribution of retinal nerve fiber bundles. The results of bootstrapping suggested clusters were stable whether they were outside or inside the 10-2 VF. CONCLUSION: A considerable number of sectors were identified in the 10-2 VF area, despite the fact that clustering was carried out on all points in both the 30-2 VF and 10-2 VF simultaneously. These findings suggest that glaucomatous central VF deterioration cannot be picked up by the 30-2 test grid alone, because of poor spatial sampling; denser estimation of the central ten degrees, than offered by the 30-2 test grid alone, is needed. It may be beneficial to develop a new VF test grid that combines test points from 30-2 and 10-2 VFs--the results of this study could help to devise this test grid.

  2. Median Growth Percentiles (MGPs): Assessment of Intertemporal Stability and Correlations with Observational Scores

    Science.gov (United States)

    Pivovarova, Margarita; Amrein-Beardsley, Audrey

    2018-01-01

    While states are no longer required to set up teacher evaluation systems based in significant part on student test scores, quite a few continue to use value-added (VAMs) or student growth percentile (SGP) models for that purpose. In this study, we analyzed three years of teacher data to illustrate the performance of teachers' median growth…

  3. Comparison of circadian, weekly, and seasonal variations of electrical storms and single events of ventricular fibrillation in patients with Brugada syndrome

    Directory of Open Access Journals (Sweden)

    Yoshiyasu Aizawa

    2016-06-01

    Full Text Available In patients with Brugada syndrome (BS, VF occurred predominantly during the nocturnal period. Some patients also developed ESs. In addition to the circadian rhythm, patients showed weekly and seasonal patterns. The patients with ESs had peak episodes of VF on Saturday and in the winter and spring, while episodes of VF in patients with single VF events occurred most often on Monday with smaller seasonal variation. Except for age, there was no difference in the clinical or ECG characteristics between the patients with ESs and those with single VF episodes.

  4. Evaluation of median nerve T2 signal changes in patients with surgically treated carpal tunnel syndrome.

    Science.gov (United States)

    Samanci, Yavuz; Karagöz, Yeşim; Yaman, Mehmet; Atçı, İbrahim Burak; Emre, Ufuk; Kılıçkesmez, Nuri Özgür; Çelik, Suat Erol

    2016-11-01

    To determine the accuracy of median nerve T2 evaluation and its relation with Boston Questionnaire (BQ) and nerve conduction studies (NCSs) in pre-operative and post-operative carpal tunnel syndrome (CTS) patients in comparison with healthy volunteers. Twenty-three CTS patients and 24 healthy volunteers underwent NCSs, median nerve T2 evaluation and self-administered BQ. Pre-operative and 1st year post-operative median nerve T2 values and cross-sectional areas (CSAs) were compared both within pre-operative and post-operative CTS groups, and with healthy volunteers. The relationship between MRI findings and BQ and NCSs was analyzed. The ROC curve analysis was used for determining the accuracy. The comparison of pre-operative and post-operative T2 values and CSAs revealed statistically significant improvements in the post-operative patient group (pT2 values at all levels and BQ values, and positive and negative correlations were also found regarding T2 values and NCS findings in CTS patients. The receiver operating characteristic curve analysis for defined cut-off levels of median nerve T2 values in hands with severe CTS yielded excellent accuracy at all levels. However, this accuracy could not be demonstrated in hands with mild CTS. This study is the first to analyze T2 values in both pre-operative and post-operative CTS patients. The presence of increased T2 values in CTS patients compared to controls and excellent accuracy in hands with severe CTS indicates T2 signal changes related to CTS pathophysiology and possible utilization of T2 signal evaluation in hands with severe CTS. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Endocrine and anatomical findings in a case of Solitary Median Maxillary Central Incisor Syndrome

    NARCIS (Netherlands)

    Szakszon, Katalin; Felszeghy, Enikő; Csízy, István; Józsa, Tamás; Káposzta, Rita; Balogh, Erzsébet; Oláh, Eva; Balogh, István; Berényi, Ervin; Knegt, Alida C.; Ilyés, István

    2012-01-01

    Solitary Median Maxillary Central Incisor Syndrome (SMMCI) is a rare malformation syndrome consisting of multiple, mainly midline defects. Some authors suggest that it is a mild manifestation of the wide spectrum of holoprosencephaly, others classify it rather as a distinct entity. Authors report a

  6. A Phase 1 Randomized, Open Label, Rectal Safety, Acceptability, Pharmacokinetic, and Pharmacodynamic Study of Three Formulations of Tenofovir 1% Gel (the CHARM-01 Study.

    Directory of Open Access Journals (Sweden)

    Ian Mcgowan

    Full Text Available The CHARM-01 study characterized the safety, acceptability, pharmacokinetics (PK, and pharmacodynamics (PD of three tenofovir (TFV gels for rectal application. The vaginal formulation (VF gel was previously used in the CAPRISA 004 and VOICE vaginal microbicide Phase 2B trials and the RMP-02/MTN-006 Phase 1 rectal safety study. The reduced glycerin VF (RGVF gel was used in the MTN-007 Phase 1 rectal microbicide trial and is currently being evaluated in the MTN-017 Phase 2 rectal microbicide trial. A third rectal specific formulation (RF gel was also evaluated in the CHARM-01 study.Participants received 4 mL of the three TFV gels in a blinded, crossover design: seven daily doses of RGVF, seven daily doses of RF, and six daily doses of placebo followed by one dose of VF, in a randomized sequence. Safety, acceptability, compartmental PK, and explant PD were monitored throughout the trial.All three gels were found to be safe and acceptable. RF and RGVF PK were not significantly different. Median mucosal mononuclear cell (MMC TFV-DP trended toward higher values for RF compared to RGVF (1136 and 320 fmol/106 cells respectively. Use of each gel in vivo was associated with significant inhibition of ex vivo colorectal tissue HIV infection. There was also a significant negative correlation between the tissue levels of TFV, tissue TFV-DP, MMC TFV-DP, rectal fluid TFV, and explant HIV-1 infection.All three formulations were found to be safe and acceptable. However, the safety profile of the VF gel was only based on exposure to one dose whereas participants received seven doses of the RGVF and RF gels. There was a trend towards higher tissue MMC levels of TFV-DP associated with use of the RF gel. Use of all gels was associated with significant inhibition of ex vivo tissue HIV infection.ClinicalTrials.gov NCT01575405.

  7. Clinical and radiologic review of uncommon cause of profound iron deficiency anemia: Median arcuate ligament syndrome

    International Nuclear Information System (INIS)

    Gunduz, Yasemin; Asil, Kiyasrttin; Aksoy, Yakup Ersel; Ayhan, Lacin Tatli

    2014-01-01

    Median arcuate ligament syndrome is an anatomic and clinical entity characterized by dynamic compression of the proximal celiac artery by the median arcuate ligament, which leads to postprandial epigastric pain, vomiting, and weight loss. These symptoms are usually nonspecific and are easily misdiagnosed as functional dyspepsia, peptic ulcer disease, or gastropathy. In this report, we presented a 72-year-old male patient with celiac artery compression syndrome causing recurrent abdominal pain associated with gastric ulcer and iron deficiency anemia. This association is relatively uncommon and therefore not well determined. In addition, we reported the CT angiography findings and three-dimensional reconstructions of this rare case.

  8. Clinical and radiologic review of uncommon cause of profound iron deficiency anemia: Median arcuate ligament syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Gunduz, Yasemin; Asil, Kiyasrttin; Aksoy, Yakup Ersel; Ayhan, Lacin Tatli [Dept. of Radiology, Sakarya University Medical Faculty, Sakarya (Turkmenistan)

    2014-08-15

    Median arcuate ligament syndrome is an anatomic and clinical entity characterized by dynamic compression of the proximal celiac artery by the median arcuate ligament, which leads to postprandial epigastric pain, vomiting, and weight loss. These symptoms are usually nonspecific and are easily misdiagnosed as functional dyspepsia, peptic ulcer disease, or gastropathy. In this report, we presented a 72-year-old male patient with celiac artery compression syndrome causing recurrent abdominal pain associated with gastric ulcer and iron deficiency anemia. This association is relatively uncommon and therefore not well determined. In addition, we reported the CT angiography findings and three-dimensional reconstructions of this rare case.

  9. Green and sustainable median on a divided multilane highway

    Science.gov (United States)

    Ambak, K.; Bajuri, F. A. A.; Yusoff, N. A.; Madun, A.; Prasetijo, J.

    2017-11-01

    The road system in Malaysia showed good growth with increasing number of vehicles on the road. However, statistic of road accident is still at an alarming rate. There are many factor can contribute to the occurrence of an accident. If the accident was caused by road facilities such as street furniture, it is shown that the street furniture was failed to improve the safety of the road users. In this study, a new concept of materials for the construction of road dividers was purpose. The sustainable materials such as laterite soil, Cow Grass, tires and PVC pipes was used to replace the cement and iron guardrails in road divider construction. The main objectives of this study is to design characteristics of a road divider using natural material such as laterite soil, sand, grass and recycle material like used a tyre. A series of experiments such as test liquid limit, plastic limit test, standard proctor test and observations of root growth in 30 days were conducted. The result shows that the plastic index value of 35% was obtained. From the proctor compaction test, the optimum water content was 23% and maximum dry density at 15.3 kN/m3. This value was used to build a prototype of green and sustainable raised road median. The suitability of sand used as the medium in irrigation system was approved. Permeability of sand is 10-2 mm/s to 10 mm/s which is having a high rate of flow. The growth of Cow Grass roots was increased by 4.9 cm in 30 days. This shows that, the grass is suitable to grow in laterite soil and can be used as vegetation material. Through the impact test conducted on a model with a scale of 1:7.5, indicate the initial damage occurred when a force reaches 10N. However, the condition of the model is still stable. From the impact test conducted, the prototype of green and sustainable raised road median has a good potential to be used as existing road divider as it can absorb the impact of an accident.

  10. Separation of simultaneous sources using a structural-oriented median filter in the flattened dimension

    Science.gov (United States)

    Gan, Shuwei; Wang, Shoudong; Chen, Yangkang; Chen, Xiaohong; Xiang, Kui

    2016-01-01

    Simultaneous-source shooting can help tremendously shorten the acquisition period and improve the quality of seismic data for better subsalt seismic imaging, but at the expense of introducing strong interference (blending noise) to the acquired seismic data. We propose to use a structural-oriented median filter to attenuate the blending noise along the structural direction of seismic profiles. The principle of the proposed approach is to first flatten the seismic record in local spatial windows and then to apply a traditional median filter (MF) to the third flattened dimension. The key component of the proposed approach is the estimation of the local slope, which can be calculated by first scanning the NMO velocity and then transferring the velocity to the local slope. Both synthetic and field data examples show that the proposed approach can successfully separate the simultaneous-source data into individual sources. We provide an open-source toy example to better demonstratethe proposed methodology.

  11. Comparison of Macular Integrity Assessment (MAIA ™, MP-3, and the Humphrey Field Analyzer in the Evaluation of the Relationship between the Structure and Function of the Macula.

    Directory of Open Access Journals (Sweden)

    Kazuyuki Hirooka

    Full Text Available This study was conducted in order to compare relationships between the macular visual field (VF mean sensitivity measured by MAIATM (Macular Integrity Assessment, MP-3, or Humphry field analyzer (HFA and the ganglion cell and inner plexiform layer (GCA thicknesses.This cross-sectional study examined 73 glaucoma patients and 19 normal subjects. All subjects underwent measurements for GCA thickness by Cirrus HD-OCT and static threshold perimetry using MAIATM, MP-3, or HFA. VF and OCT in the retinal view were used to examine both the global relationship between the VF sensitivity and GCA thickness, and the superior hemiretina and inferior hemiretina. The relationship between the GCA thickness and macular sensitivity was examined by Spearman correlation analysis.For each instrument, statistically significant macular VF sensitivity (dB and GCA thickness relationships were observed using the decibel scale (R = 0.547-0.687, all P < 0.001. The highest correlation for the global (R = 0.682 and the superior hemiretina (R = 0.594 GCA thickness-VF mean sensitivity was observed by the HFA. The highest correlation for the inferior hemiretina (R = 0.687 GCA thickness-VF mean sensitivity was observed by the MP-3. Among the three VF measurement instruments, however, no significant differences were found for the structure-function relationships.All three VF measurement instruments found similar structure-function relationships in the central VF.

  12. Feasibility of vocal fold abduction and adduction assessment using cine-MRI

    Energy Technology Data Exchange (ETDEWEB)

    Baki, Marina Mat [National University of Malaysia, Faculty of Medicine, Kuala Lumpur (Malaysia); Menys, Alex; Morley, Simon; Beale, Timothy [University College London, Centre for Medical Imaging, London (United Kingdom); Atkinson, David; Punwani, Shonit [University College London, Centre for Medical Imaging, London (United Kingdom); Royal National Throat Nose Ear Hospital, University College London Hospital NHS Trust, London (United Kingdom); Bassett, Paul [University College London, London (United Kingdom); Sandhu, Guri [Charing Cross Hospital, Imperial College Healthcare NHS Trust, London (United Kingdom); Naduvilethil, Georgekutty; Stevenson, Nicola [Royal National Throat Nose Ear Hospital, University College London Hospital NHS Trust, London (United Kingdom); Birchall, Martin A. [Royal National Throat Nose Ear Hospital, University College London Hospital NHS Trust, London (United Kingdom); University of California, Davis, Department of Otolaryngology, Davis, CA (United States); University College London, Ear Institute, London (United Kingdom)

    2017-02-15

    Determine feasibility of vocal fold (VF) abduction and adduction assessment by cine magnetic resonance imaging (cine-MRI) Cine-MRI of the VF was performed on five healthy and nine unilateral VF paralysis (UVFP) participants using an axial gradient echo acquisition with temporal resolution of 0.7 s. VFs were continuously imaged with cine-MRI during a 10-s period of quiet respiration and phonation. Scanning was repeated twice within an individual session and then once again at a 1-week interval. Asymmetry of VF position during phonation (VF phonation asymmetry, VFPa) and respiration (VF respiration asymmetry, VFRa) was determined. Percentage reduction in total glottal area between respiration and phonation (VF abduction potential, VFAP) was derived to measure overall mobility. An un-paired t-test was used to compare differences between groups. Intra-session, inter-session and inter-reader repeatability of the quantitative metrics was evaluated using intraclass correlation coefficient (ICC). VF position asymmetry (VFPa and VFRa) was greater (p=0.012; p=0.001) and overall mobility (VFAP) was lower (p=0.008) in UVFP patients compared with healthy participants. ICC of repeatability of all metrics was good, ranged from 0.82 to 0.95 except for the inter-session VFPa (0.44). Cine-MRI is feasible for assessing VF abduction and adduction. Derived quantitative metrics have good repeatability. (orig.)

  13. Feasibility of vocal fold abduction and adduction assessment using cine-MRI

    International Nuclear Information System (INIS)

    Baki, Marina Mat; Menys, Alex; Morley, Simon; Beale, Timothy; Atkinson, David; Punwani, Shonit; Bassett, Paul; Sandhu, Guri; Naduvilethil, Georgekutty; Stevenson, Nicola; Birchall, Martin A.

    2017-01-01

    Determine feasibility of vocal fold (VF) abduction and adduction assessment by cine magnetic resonance imaging (cine-MRI) Cine-MRI of the VF was performed on five healthy and nine unilateral VF paralysis (UVFP) participants using an axial gradient echo acquisition with temporal resolution of 0.7 s. VFs were continuously imaged with cine-MRI during a 10-s period of quiet respiration and phonation. Scanning was repeated twice within an individual session and then once again at a 1-week interval. Asymmetry of VF position during phonation (VF phonation asymmetry, VFPa) and respiration (VF respiration asymmetry, VFRa) was determined. Percentage reduction in total glottal area between respiration and phonation (VF abduction potential, VFAP) was derived to measure overall mobility. An un-paired t-test was used to compare differences between groups. Intra-session, inter-session and inter-reader repeatability of the quantitative metrics was evaluated using intraclass correlation coefficient (ICC). VF position asymmetry (VFPa and VFRa) was greater (p=0.012; p=0.001) and overall mobility (VFAP) was lower (p=0.008) in UVFP patients compared with healthy participants. ICC of repeatability of all metrics was good, ranged from 0.82 to 0.95 except for the inter-session VFPa (0.44). Cine-MRI is feasible for assessing VF abduction and adduction. Derived quantitative metrics have good repeatability. (orig.)

  14. Can Probability Maps of Swept-Source Optical Coherence Tomography Predict Visual Field Changes in Preperimetric Glaucoma?

    Science.gov (United States)

    Lee, Won June; Kim, Young Kook; Jeoung, Jin Wook; Park, Ki Ho

    2017-12-01

    To determine the usefulness of swept-source optical coherence tomography (SS-OCT) probability maps in detecting locations with significant reduction in visual field (VF) sensitivity or predicting future VF changes, in patients with classically defined preperimetric glaucoma (PPG). Of 43 PPG patients, 43 eyes were followed-up on every 6 months for at least 2 years were analyzed in this longitudinal study. The patients underwent wide-field SS-OCT scanning and standard automated perimetry (SAP) at the time of enrollment. With this wide-scan protocol, probability maps originating from the corresponding thickness map and overlapped with SAP VF test points could be generated. We evaluated the vulnerable VF points with SS-OCT probability maps as well as the prevalence of locations with significant VF reduction or subsequent VF changes observed in the corresponding damaged areas of the probability maps. The vulnerable VF points were shown in superior and inferior arcuate patterns near the central fixation. In 19 of 43 PPG eyes (44.2%), significant reduction in baseline VF was detected within the areas of structural change on the SS-OCT probability maps. In 16 of 43 PPG eyes (37.2%), subsequent VF changes within the areas of SS-OCT probability map change were observed over the course of the follow-up. Structural changes on SS-OCT probability maps could detect or predict VF changes using SAP, in a considerable number of PPG eyes. Careful comparison of probability maps with SAP results could be useful in diagnosing and monitoring PPG patients in the clinical setting.

  15. Plasmids of Raw Milk Cheese Isolate Lactococcus lactis subsp. lactis Biovar diacetylactis DPC3901 Suggest a Plant-Based Origin for the Strain ▿ †

    Science.gov (United States)

    Fallico, Vincenzo; McAuliffe, Olivia; Fitzgerald, Gerald F.; Ross, R. Paul

    2011-01-01

    The four-plasmid complement of the raw milk cheese isolate Lactococcus lactis subsp. lactis biovar diacetylactis DPC3901 was sequenced, and some genetic features were functionally analyzed. The complete sequences of pVF18 (18,977 bp), pVF21 (21,739 bp), pVF22 (22,166 bp), and pVF50 (53,876 bp) were obtained. Each plasmid contained genes not previously described for Lactococcus, in addition to genes associated with plant-derived lactococcal strains. Most of the novel genes were found on pVF18 and encoded functions typical of bacteria associated with plants, such as activities of plant cell wall modification (orf11 and orf25). In addition, a predicted high-affinity regulated system for the uptake of cobalt was identified (orf19 to orf21 [orf19-21]), which has a single database homolog on a plant-derived Leuconostoc plasmid and whose functionality was demonstrated following curing of pVF18. pVF21 and pVF22 encode additional metal transporters, which, along with orf19-21 of pVF18, could enhance host ability to uptake growth-limiting amounts of biologically essential ions within the soil. In addition, vast regions from pVF50 and pVF21 share significant homology with the plant-derived lactococcal plasmid pGdh442, which is indicative of extensive horizontal gene transfer and recombination between these plasmids and suggests a common plant niche for their hosts. Phenotypes associated with these regions include glutamate dehydrogenase activity and Na+ and K+ transport. The presence of numerous plant-associated markers in L. lactis DPC3901 suggests a plant origin for the raw milk cheese isolate and provides for the first time the genetic basis to support the concept of the plant-milk transition for Lactococcus strains. PMID:21803914

  16. Sosiaalisen median negatiiviset vaikutukset käyttäjälle

    OpenAIRE

    Vidgren, Lilli

    2018-01-01

    Tutkielma on kirjallisuuskatsauksena toteutettu kandidaatintutkielma, jonka tutkimusaihe ja -otsikko on sosiaalisen median negatiiviset vaikutukset käyttä- jälle. Negatiivisia vaikutuksia tutkittiin vapaa-ajan käytön näkökulmasta. Sosiaalinen media on tullut nopeasti tärkeäksi ja välttämättömäksi osaksi ihmisten jokapäiväistä elämää, ja sen jatkuva läsnäolo vaikuttaa sen käyttäjiin negatiivisella tavalla. Negatiivisten vaikutusten tutkimisella ihmiset tulisivat enemmän tieto...

  17. Implementation and evaluation of an ordered subsets reconstruction algorithm for transmission PET studies using median root prior and inter-update median filtering

    International Nuclear Information System (INIS)

    Bettinardi, V.; Gilardi, M.C.; Fazio, F.; Alenius, S.; Ruotsalainen, U.; Numminen, P.; Teraes, M.

    2003-01-01

    An ordered subsets (OS) reconstruction algorithm based on the median root prior (MRP) and inter-update median filtering was implemented for the reconstruction of low count statistics transmission (TR) scans. The OS-MRP-TR algorithm was evaluated using an experimental phantom, simulating positron emission tomography (PET) whole-body (WB) studies, as well as patient data. Various experimental conditions, in terms of TR scan time (from 1 h to 1 min), covering a wide range of TR count statistics were evaluated. The performance of the algorithm was assessed by comparing the mean value of the attenuation coefficient (MVAC) of known tissue types and the coefficient of variation (CV) for low-count TR images, reconstructed with the OS-MRP-TR algorithm, with reference values obtained from high-count TR images reconstructed with a filtered back-projection (FBP) algorithm. The reconstructed OS-MRP-TR images were then used for attenuation correction of the corresponding emission (EM) data. EM images reconstructed with attenuation correction generated by OS-MRP-TR images, of low count statistics, were compared with the EM images corrected for attenuation using reference (high statistics) TR data. In all the experimental situations considered, the OS-MRP-TR algorithm showed: (1) a tendency towards a stable solution in terms of MVAC; (2) a difference in the MVAC of within 5% for a TR scan of 1 min reconstructed with the OS-MRP-TR and a TR scan of 1 h reconstructed with the FBP algorithm; (3) effectiveness in noise reduction, particularly for low count statistics data [using a specific parameter configuration the TR images reconstructed with OS-MRP-TR(1 min) had a lower CV than the corresponding TR images of a 1-h scan reconstructed with the FBP algorithm]; (4) a difference of within 3% between the mean counts in the EM images attenuation corrected using the OS-MRP-TR images of 1 min and the mean counts in the EM images attenuation corrected using the OS-MRP-TR images of 1 h; (5

  18. Vitex rotundifolia Fruit Suppresses the Proliferation of Human Colorectal Cancer Cells through Down-regulation of Cyclin D1 and CDK4 via Proteasomal-Dependent Degradation and Transcriptional Inhibition.

    Science.gov (United States)

    Song, Hun Min; Park, Gwang Hun; Park, Su Bin; Kim, Hyun-Seok; Son, Ho-Jun; Um, Yurry; Jeong, Jin Boo

    2018-01-01

    Viticis Fructus (VF) as the dried fruit from Vitex rotundifolia L. used as a traditional medicine for treating inflammation, headache, migraine, chronic bronchitis, eye pain, and gastrointestinal infections has been reported to have antiproliferative effects against various cancer cells, including breast, lung and colorectal cancer cells. However, the molecular mechanisms by which VF mediates the inhibitory effect of the proliferation of cancer cells have not been elucidated in detail. In this study, we investigated the molecular mechanism of VF on the down-regulation of cyclin D1 and CDK4 level associated with cancer cell proliferation. VF suppressed the proliferation of human colorectal cancer cell lines such as HCT116 and SW480. VF induced decrease in cyclin D1 and CDK4 in both protein and mRNA levels. However, the protein levels of cyclin D1 and CDK4 were decreased by VF at an earlier time than the change of mRNA levels; rather it suppressed the expression of cyclin D1 and CDK4 via the proteasomal degradation. In cyclin D1 and CDK4 degradation, we found that Thr286 phosphorylation of cyclin D1 plays a pivotal role in VF-mediated cyclin D1 degradation. Subsequent experiments with several kinase inhibitors suggest that VF-mediated degradation of cyclin D1 may be dependent on GSK3[Formula: see text] and VF-mediated degradation of CDK4 is dependent on ERK1/2, p38 and GSK3[Formula: see text]. In the transcriptional regulation of cyclin D1 and CDK4, we found that VF inhibited Wnt activation associated with cyclin D1 transcriptional regulation through TCF4 down-regulation. In addition, VF treatment down-regulated c-myc expression associated CDK4 transcriptional regulation. Our results suggest that VF has potential to be a candidate for the development of chemoprevention or therapeutic agents for human colorectal cancer.

  19. Inferior J waves in patients with vasospastic angina might be a risk factor for ventricular fibrillation.

    Science.gov (United States)

    Fumimoto, Tomoko; Ueyama, Takeshi; Shimizu, Akihiko; Yoshiga, Yasuhiro; Ono, Makoto; Kato, Takayoshi; Ishiguchi, Hironori; Okamura, Takayuki; Yamada, Jutaro; Yano, Masafumi

    2017-09-01

    There is little information about the relationship between J waves and the occurrence of ventricular fibrillation (VF) in patients with vasospastic angina (VSA). The present study aimed to assess the incidence of J waves and the occurrence of VF in patients with VSA. The subjects consisted of 62 patients with VSA diagnosed by acetylcholine provocation tests in our institution from 2002 to 2014. We investigated the VF events, prevalence of J waves, and relationship between the VF events and J waves. J waves were observed in 16 patients (26%) and VF events were documented in 11 (18%). The incidence of VF in the patients with J waves was significantly higher than that in those without J waves (38% vs 11%, p=0.026). J waves were observed in the inferior leads in 14 patients, lateral leads in 5, and anterior leads in 3. A univariate analysis indicated that the incidence of VF in the inferior leads of J wave positive patients (46%=6/14) was significantly (p=0.01) higher than that in the inferior leads of J wave negative patients (10%=5/48). The J waves in the anterior and/or lateral leads were not related to the incidence of VF. Notched type and slurred type J waves were not associated with VF. A multivariate analysis revealed that J waves in VSA patients were associated with VF [odds ratio (OR) 6.41, 95% confidence interval (CI) 1.37-29.93, p=0.02] and organic stenosis (OR 6.98, 95% CI 1.39-35.08, p=0.02). Further, J waves in the inferior leads were strongly correlated with VF (OR 11.85, 95% CI 2.05-68.42, p=0.006). The results suggest that the existence of J waves, especially in the inferior leads, might be a risk factor for VF in VSA patients. Copyright © 2016 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

  20. Hardware design of the median filter based on window structure and batcher′s oddeven sort network

    Directory of Open Access Journals (Sweden)

    SUN Kaimin

    2013-06-01

    Full Text Available Area and speed are two important factors to be considered in designing Median Filter with digital circuits.Area consideration requires the use of logical resources as little as possible,while speed consideration requires the system capable of working on higher clock frequencies,with as few clock cycles as possible to complete a frame filtering or real time filtering.This paper gives a new design of Median Filter,the hardware structure of which is a 3×3 window structure with two buffers.The filter function module is based on Batcher′s Odd-Even Sort network theory.Structural design is implemented in FPGA,verified by ModelSim software and realizes video image filtering.The experimental analysis shows that this new structure of Median Filter effectively decreases logical resources (merely using 741 Logic Elements,and accelerates the pixel processing speed up to 27MHz.This filter achieves realtime processing of video images of 30 frames/s.This design not only has a certain practicality,but also provides a reference for the hardware structure design ideas in digital image processing.

  1. Diffusion tensor imaging of the median nerve: intra-, inter-reader agreement, and agreement between two software packages

    International Nuclear Information System (INIS)

    Guggenberger, Roman; Nanz, Daniel; Puippe, Gilbert; Andreisek, Gustav; Rufibach, Kaspar; White, Lawrence M.; Sussman, Marshall S.

    2012-01-01

    To assess intra-, inter-reader agreement, and the agreement between two software packages for magnetic resonance diffusion tensor imaging (DTI) measurements of the median nerve. Fifteen healthy volunteers (seven men, eight women; mean age, 31.2 years) underwent DTI of both wrists at 1.5 T. Fractional anisotropy (FA) and apparent diffusion coefficient (ADC) of the median nerve were measured by three readers using two commonly used software packages. Measurements were repeated by two readers after 6 weeks. Intraclass correlation coefficients (ICC) and Bland-Altman analysis were used for statistical analysis. ICCs for intra-reader agreement ranged from 0.87 to 0.99, for inter-reader agreement from 0.62 to 0.83, and between the two software packages from 0.63 to 0.82. Bland-Altman analysis showed no differences for intra- and inter-reader agreement and agreement between software packages. The intra-, inter-reader, and agreement between software packages for DTI measurements of the median nerve were moderate to substantial suggesting that user- and software-dependent factors contribute little to variance in DTI measurements. (orig.)

  2. Growth, immune and viral responses in HIV infected African children receiving highly active antiretroviral therapy: a prospective cohort study

    Directory of Open Access Journals (Sweden)

    Bagenda Danstan

    2010-08-01

    Full Text Available Abstract Background Scale up of paediatric antiretroviral therapy in resource limited settings continues despite limited access to routine laboratory monitoring. We documented the weight and height responses in HIV infected Ugandan children on highly active antiretroviral therapy and determined clinical factors associated with successful treatment outcomes. Methods A prospective cohort of HIV infected children were initiated on HAART and followed for 48 weeks. Body mass index for age z scores(BAZ, weight and height-for-age z scores (WAZ & HAZ were calculated: CD4 cell % and HIV-1 RNA were measured at baseline and every 12 weeks. Treatment outcomes were classified according to; both virological and immunological success (VS/IS, virological failure and immunological success (VF/IS. virological success and immunological failure (VS/IF and both virological and immunological failure (VF/IF. Results From March 2004 until May 2006, 124 HIV infected children were initiated on HAART. The median age (IQR was 5.0 years (2.1 - 7.0 and 49% (61/124 were female. The median [95% confidence interval (CI] BAZ, WAZ and HAZ at baseline were 0.29 (-2.9, -1.2, -1.2 (-2.1, -0.5 and -2.06 (-2.9, -1.2 respectively. Baseline median CD4 cell % and log10 HIV-1 RNA were; 11.8% (7.5-18.0 and 5.6 (5.2-5.8 copies/ml. By 48 weeks, mean WAZ and HAZ in the VF/IS group, which was younger, increased from - 0.98 (SD 1.7 to + 1.22 (SD 1.2 and from -1.99 (1.7 to + 0.76 (2.4 respectively. Mean increase in WAZ and HAZ in the VS/IF group, an older group was modest, from -1.84 (1.3 to - 0.41 (1.2 and -2.25 (1.2 to -1.16 (1.3 respectively. Baseline CD4 cell % [OR 6.97 95% CI (2.6 -18.6], age [OR 4.6 95% CI (1.14 -19.1] and WHO clinical stage [OR 3.5 95%CI (1.05 -12.7] were associated with successful treatment outcome. Conclusions HIV infected Ugandan children demonstrated a robust increase in height and weight z scores during the first 48 weeks of HAART, including those who failed to

  3. Wolff-Parkinson-White syndrome in the era of catheter ablation: insights from a registry study of 2169 patients.

    Science.gov (United States)

    Pappone, Carlo; Vicedomini, Gabriele; Manguso, Francesco; Saviano, Massimo; Baldi, Mario; Pappone, Alessia; Ciaccio, Cristiano; Giannelli, Luigi; Ionescu, Bogdan; Petretta, Andrea; Vitale, Raffaele; Cuko, Amarild; Calovic, Zarko; Fundaliotis, Angelica; Moscatiello, Mario; Tavazzi, Luigi; Santinelli, Vincenzo

    2014-09-02

    The management of Wolff-Parkinson-White is based on the distinction between asymptomatic and symptomatic presentations, but evidence is limited in the asymptomatic population. The Wolff-Parkinson-White registry was an 8-year prospective study of either symptomatic or asymptomatic Wolff-Parkinson-White patients referred to our Arrhythmology Department for evaluation or ablation. Inclusion criteria were a baseline electrophysiological testing with or without radiofrequency catheter ablation (RFA). Primary end points were the percentage of patients who experienced ventricular fibrillation (VF) or potentially malignant arrhythmias and risk factors. Among 2169 enrolled patients, 1001 (550 asymptomatic) did not undergo RFA (no-RFA group) and 1168 (206 asymptomatic) underwent ablation (RFA group). There were no differences in clinical and electrophysiological characteristics between the 2 groups except for symptoms. In the no-RFA group, VF occurred in 1.5% of patients, virtually exclusively (13 of 15) in children (median age, 11 years), and was associated with a short accessory pathway antegrade refractory period (PParkinson-White syndrome essentially depends on intrinsic electrophysiological properties of AP rather than on symptoms. RFA performed during the same procedure after electrophysiological testing is of benefit in improving the long-term outcomes. © 2014 American Heart Association, Inc.

  4. Long-term results of radiotherapy in the treatment of pituitary adenomas in children and adolescents

    International Nuclear Information System (INIS)

    Grigsby, P.W.; Thomas, P.R.; Simpson, J.R.; Fineberg, B.B.

    1988-01-01

    A retrospective review was performed of 11 children and adolescents (less than 19 years of age) with diagnosed pituitary adenomas. The patients were treated with subtotal resection and postoperative irradiation (S + R) or with irradiation alone (RT) at the Radiation Oncology Center, Mallinckrodt Institute of Radiology, Washington University Medical Center, from January 1958 through December 1982. Patient conditions at diagnosis were acromegaly in one, Nelson's syndrome in one, prolactinoma in three, chromophobe adenoma in three, and Cushing's disease in three. Median follow-up was 15.6 years (range 6.3-29.5 years). Only two patients have had failure: one at 8.6 years and the other at 20.7 years following treatment. All four patients with visual field (VF) defects at diagnosis underwent S + R, with only one developing recurrent disease. The remaining seven patients, who did not have VF defects, received RT only, and there has been one failure in this group. None have suffered long-term visual complications. All have been able to continue school and/or work. Three of eight females have borne children. Hypopituitarism requiring medication occurred in all who received S + R and in four of seven who received RT only

  5. Estimation of in vitro activity of tuberoinfundibular dopaminergic neurons by measurement of DOPA synthesis in the median eminence of hypothalamic slices.

    Science.gov (United States)

    Arita, J; Kimura, F

    1984-12-01

    A new method for estimation of in vitro neurosecretory activity of tuberoinfundibular dopaminergic (TIDA) neurons was developed by measuring the rate of synthesis of dihydroxyphenylalanine (DOPA) in the median eminence of hypothalamic slices. Sagittal hypothalamic slices of ovariectomized rats were incubated in a medium containing 3-hydroxybenzylhydrazine (NSD 1015), an inhibitor of DOPA decarboxylase. DOPA accumulated in the median eminence following incubation with NSD 1015 was determined by high-performance liquid chromatography with electro-chemical detection. The amount of DOPA accumulated in vitro in the median eminence was maximal in a medium containing 10 mM NSD 1015 and linear up to 120 min at 37 degrees C. Increasing the concentration of tyrosine in medium stimulated the synthesis of DOPA in the median eminence. The synthesis of DOPA was blocked by 1 mM alpha-methyltyrosine, an inhibitor of tyrosine hydroxylase. The rate of in vitro synthesis of DOPA in the median eminence was 33% of that of in vivo synthesis. Incubation in a medium containing 50 mM K+ to depolarize neurons caused a 2.4-fold increase in DOPA synthesis in the median eminence. The high K+-induced increase in DOPA synthesis was blocked by omission of Ca2+ and addition of 1 mM EGTA into the medium, suggesting Ca2+ dependency of depolarization-activated DOPA synthesis. These results indicate that this in vitro assay is a useful means to study the regulatory mechanisms of TIDA neurons.

  6. Statistical properties of the deviations of f 0 F 2 from monthly medians

    Directory of Open Access Journals (Sweden)

    Y. Tulunay

    2002-06-01

    Full Text Available The deviations of hourly f 0 F 2 from monthly medians for 20 stations in Europe during the period 1958-1998 are studied. Spectral analysis is used to show that, both for original data (for each hour and for the deviations from monthly medians, the deterministic components are the harmonics of 11 years (solar cycle, 1 year and its harmonics, 27 days and 12 h 50.49 m (2nd harmonic of lunar rotation period L 2 periodicities. Using histograms for one year samples, it is shown that the deviations from monthly medians are nearly zero mean (mean < 0.5 and approximately Gaussian (relative difference range between %10 to %20 and their standard deviations are larger for daylight hours (in the range 5-7. It is shown that the amplitude distribution of the positive and negative deviations is nearly symmetrical at night hours, but asymmetrical for day hours. The positive and negative deviations are then studied separately and it is observed that the positive deviations are nearly independent of R12 except for high latitudes, but negative deviations are modulated by R12 . The 90% confidence interval for negative deviations for each station and each hour is computed as a linear model in terms of R12. After correction for local time, it is shown that for all hours the confidence intervals increase with latitude but decrease above 60N. Long-term trend analysis showed that there is an increase in the amplitude of positive deviations from monthly means irrespective of the solar conditions. Using spectral analysis it is also shown that the seasonal dependency of negative deviations is more accentuated than the seasonal dependency of positive deviations especially at low latitudes. In certain stations, it is also observed that the 4th harmonic of 1 year corresponding to a periodicity of 3 months, which is missing in f 0 F 2 data, appears in the spectra of negative variations.

  7. Verkkosivujen ja sosiaalisen median käyttäminen ennakoivan turvallisuusviestinnän välineenä

    OpenAIRE

    Virta, Esa-Pekka

    2016-01-01

    Tämän opinnäytetyön tavoitteena oli laatia selvitys eräälle ammattikorkeakoululle verkkosivujen sekä sosiaalisen median käyttämisestä ennakoivan turvallisuusviestinnän välineenä. Ennakoivaa turvallisuusviestintää on Suomessa tutkittu melko vähän kun sitä verrataan turvallisuusjohtamista koskeviin tutkimuksiin. Verkkosivujen sekä sosiaalisen median käyttämistä ennakoivan turvallisuusviestinnän välineenä ei ole tutkittu juuri ollenkaan ja tästä syntyi idea tuottaa tämä selvitys. Opinnäytetyön t...

  8. Risk factors for predicting visual field progression in Chinese patients with primary open-angle glaucoma: A retrospective study.

    Science.gov (United States)

    Hung, Kuo-Hsuan; Cheng, Ching-Yu; Liu, Catherine Jui-Ling

    2015-07-01

    Glaucoma is a leading cause of irreversible blindness worldwide. It is characterized by progressive deterioration of the visual field (VF) that results in a complete loss of vision. This study aimed to determine the risk factors associated with VF progression in Chinese patients with primary open-angle glaucoma (POAG). We reviewed the charts of POAG patients who visited our clinic between July 2009 and June 2010. We included patients with five or more reliable VF tests using the Humphrey Field Analyzer (Humphrey Instruments, San Leandro, CA, USA) during a period of at least 2 years. The scoring system of the Collaborative Initial Glaucoma Treatment Study (CIGTS) was used to code the VF. Progression was defined as an increasing score ≥3, compared to the averaged baseline data. Univariate and multivariate logistic regression analyses were performed to identify the risk factors of VF progression. There were 92 patients (representing 92 eyes) with an average of 8.9 reliable VFs over a mean follow up of 5.4 years. Multivariate logistic regression showed that eyes with more VF tests [odds ratio (OR) = 1.500, p < 0.010] and either increased peak intraocular pressure (IOP) (OR = 1.235, p = 0.044) or a wide IOP range (OR = 1.165, p = 0.041) favored VF progression. High myopia (less than -6.0 D) was not a risk factor (OR = 1.289, p = 0.698) for VF progression in this study. In addition to a greater number of VF tests, Chinese patients with treated POAG who experienced a high peak IOP or a wide range of IOP during follow up were more likely to have VF deterioration. Copyright © 2015. Published by Elsevier Taiwan.

  9. Activation patterns of Purkinje fibers during long-duration ventricular fibrillation in an isolated canine heart model.

    Science.gov (United States)

    Tabereaux, Paul B; Walcott, Greg P; Rogers, Jack M; Kim, Jong; Dosdall, Derek J; Robertson, Peter G; Killingsworth, Cheryl R; Smith, William M; Ideker, Raymond E

    2007-09-04

    The roles of Purkinje fibers (PFs) and focal wave fronts, if any, in the maintenance of ventricular fibrillation (VF) are unknown. If PFs are involved in VF maintenance, it should be possible to map wave fronts propagating from PFs into the working ventricular myocardium during VF. If wave fronts ever arise focally during VF, it should be possible to map them appearing de novo. Six canine hearts were isolated, and the left main coronary artery was cannulated and perfused. The left ventricular cavity was exposed, which allowed direct endocardial mapping of the anterior papillary muscle insertion. Nonperfused VF was induced, and 6 segments of data, each 5 seconds long, were analyzed during 10 minutes of VF. During 36 segments of data that were analyzed, 1018 PF or focal wave fronts of activation were identified. In 534 wave fronts, activation was mapped propagating from working ventricular myocardium to PF. In 142 wave fronts, activation was mapped propagating from PF to working ventricular myocardium. In 342 wave fronts, activation was mapped arising focally. More than 1 of these 3 patterns could occur in the same wave front. PFs are highly active throughout the first 10 minutes of VF. In addition to retrograde propagation from the working ventricular myocardium to PFs, antegrade propagation occurs from PFs to working ventricular myocardium, which suggests PFs are important in VF maintenance. Prior plunge needle recordings in dogs indicate activation propagates from the endocardium toward the epicardium after 1 minute of VF, which suggests that focal sites on the endocardium may represent foci and not breakthrough. If so, in addition to reentry, abnormal automaticity or triggered activity may also occur during VF.

  10. The Impact of School Gardening on Cree Children's Knowledge and Attitudes toward Vegetables and Fruit.

    Science.gov (United States)

    Hanbazaza, Mahitab A; Triador, Lucila; Ball, Geoff D C; Farmer, Anna; Maximova, Katerina; Alexander First Nation; Willows, Noreen D

    2015-09-01

    School-based interventions may increase children's preferences for vegetables and fruit (V&F). This Canadian study measured changes in Indigenous First Nations schoolchildren's V&F knowledge, preferences, and home consumption following the implementation of a gardening and V&F snack program. At baseline, 7 months, and 18 months, children in grades 1-6 (i) listed at least 5 V&F they knew, (ii) tasted and indicated their preferences towards 9 vegetables and 8 fruit using a 6-point Likert scale, and (iii) indicated their home consumption of 17 V&F. At all 3 time points, 56.8% (n = 66/116) of children provided data. Children listed a greater number of V&F at 18 months (4.9 ± 0.1) than at baseline (4.5 ± 1.0) or 7 months (4.7 ± .07) (F(1.6,105.6) = 6.225, P < 0.05). Vegetable preferences became more positive between baseline (37.9 ± 9.3) and 7 months (39.9 ± 9.2), but returned to baseline levels at 18 months (37.3 ± 8.7) (F(1.6,105.8) = 4.581, P < 0.05). Fruit preferences at 18 months (42.7 ± 3.0) were greater than at baseline (41.1 ± 4.3) and at 7 months (41.9 ± 5.1) (F(1.7,113.3) = 3.409, P < 0.05). No change in V&F consumption occurred at home. Despite improvements in V&F knowledge and preferences, home consumption of V&F did not occur. Complementing school-based programs with home-based components may be needed to influence V&F intake of children.

  11. Polyphenol content and glycemic load of pasta enriched with Faba bean flour

    Directory of Open Access Journals (Sweden)

    Imma Turco

    2016-05-01

    Full Text Available Background: Legumes contain elevated levels of health functional components. The objective of the present paper was to evaluate the nutritional properties and the post-prandial glycaemic responses of pasta obtained using 35% Vicia Faba (VF bean flour, which is an important source of fiber and phytochemical compounds. Results: Protein and fiber content were higher in VF pasta compared with durum wheat semolina (DWS pasta. The total phenol content in VF pasta was about two fold higher compared to that of DWS pasta. A higher total flavonoid content, higher antioxidant activity against peroxyl radicals evaluated by oxygen radical absorbance capacity (ORAC assay was also observed in VF pasta. The comparison of post-prandial increase of glucose after VF intake or DWS demonstrated significant differences and VF pasta exhibited a lower glycemic index value, a lower glycemic load and higher glycemic profile compared with DWS pasta. Conclusion: The results suggest that enrichment with 35% Vicia faba bean has potential health benefits and that VF flour can be used as an ingredient to prepare added-value products.

  12. Addressing the role of earthworms in treating domestic wastewater by analyzing biofilm modification through chemical and spectroscopic methods.

    Science.gov (United States)

    Wang, Yin; Xing, Mei-Yan; Yang, Jian; Lu, Biao

    2016-03-01

    Vermifiltration eco-friendly system is an alternative and low-cost artificial ecosystem for decentralized wastewater treatment and excess sludge reduction. The biofilm characteristics of a vermifilter (VF) with earthworms, Eisenia fetida, for domestic wastewater treatment were studied. A conventional biofilter (BF) without earthworms served as the control. Pore number in VF biofilm was significantly more than BF biofilm, and VF biofilm showed a better level-administrative structure through scanning electron microscope. VF biofilms had lower levels of protein and polysaccharide, but phosphoric acids and humic acid showed the opposite results. Furthermore, in the presence of earthworms, VF biofilms contained higher total organic carbon (TOC) percentage composition in the condition of less volatile suspended substances (VSS) contents. Dehydrogenase activity (DHA) and adenosine triphosphate (ATP) contents along VF showed better results than BF by increment of 12.84 ∼ 16.46 %. Overall findings indicated that the earthworms' presence remarkably decreases biofilm contests but increases enzyme activity and improves the community structure of VF biofilms, which is beneficial for the wastewater disposal.

  13. Epidemiology and genetics of ventricular fibrillation during acute myocardial infarction

    DEFF Research Database (Denmark)

    Glinge, Charlotte; Sattler, Stefan; Jabbari, Reza

    2016-01-01

    of a family member is a risk factor for SCD and VF during acute myocardial infarction (MI), independent of traditional risk factors including family history of MI, suggesting a genetic component in the susceptibility to VF. To prevent SCD and VF due to MI, we need a better understanding of the genetic...... and molecular mechanisms causing VF in this apparently healthy population. Even though new insights and technologies have become available, the genetic predisposition to VF during MI remains poorly understood. Findings from a variety of different genetic studies have failed to reach reproducibility, although...... several genetic variants, both common and rare variants, have been associated to either VF or SCD. For this review, we searched PubMed for potentially relevant articles, using the following MeSH-terms: "sudden cardiac death", "ventricular fibrillation", "out-of-hospital cardiac arrest", "myocardial...

  14. Lightweight MAC-Spoof Detection Exploiting Received Signal Power and Median Filtering

    DEFF Research Database (Denmark)

    Papini, Davide

    2011-01-01

    this kind of attack based on signal power monitoring. The main contribution of our work is the introduction of a median l- ter that enables the detection of the attack by looking at the variance of the signal power. We take into account two types of references for the samples, time and number of frames......IEEE 802.11 networks are subject to MAC-spoof attacks. An attacker can easily steal the identity of a legitimate station, even Access Points, thus enabling him to take full control over network basic mech- anisms or even access restricted resources. In this paper we propose a method to detect...

  15. A biological inspired fuzzy adaptive window median filter (FAWMF) for enhancing DNA signal processing.

    Science.gov (United States)

    Ahmad, Muneer; Jung, Low Tan; Bhuiyan, Al-Amin

    2017-10-01

    Digital signal processing techniques commonly employ fixed length window filters to process the signal contents. DNA signals differ in characteristics from common digital signals since they carry nucleotides as contents. The nucleotides own genetic code context and fuzzy behaviors due to their special structure and order in DNA strand. Employing conventional fixed length window filters for DNA signal processing produce spectral leakage and hence results in signal noise. A biological context aware adaptive window filter is required to process the DNA signals. This paper introduces a biological inspired fuzzy adaptive window median filter (FAWMF) which computes the fuzzy membership strength of nucleotides in each slide of window and filters nucleotides based on median filtering with a combination of s-shaped and z-shaped filters. Since coding regions cause 3-base periodicity by an unbalanced nucleotides' distribution producing a relatively high bias for nucleotides' usage, such fundamental characteristic of nucleotides has been exploited in FAWMF to suppress the signal noise. Along with adaptive response of FAWMF, a strong correlation between median nucleotides and the Π shaped filter was observed which produced enhanced discrimination between coding and non-coding regions contrary to fixed length conventional window filters. The proposed FAWMF attains a significant enhancement in coding regions identification i.e. 40% to 125% as compared to other conventional window filters tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. This study proves that conventional fixed length window filters applied to DNA signals do not achieve significant results since the nucleotides carry genetic code context. The proposed FAWMF algorithm is adaptive and outperforms significantly to process DNA signal contents. The algorithm applied to variety of DNA datasets produced noteworthy discrimination between coding and non-coding regions contrary

  16. How Much Volume of Local Anesthesia and How Long Should You Wait After Injection for an Effective Wrist Median Nerve Block?

    Science.gov (United States)

    Lovely, Lyndsay M; Chishti, Yasmin Z; Woodland, Jennifer L; Lalonde, Donald H

    2018-05-01

    Many surgeons and emergentologists use non-ultrasound-guided wrist nerve blocks. There is little evidence to guide the ideal volume of local anesthesia or how long we should wait after injection before performing pain-free procedures. This pilot study examined time to maximal anesthesia to painful needle stick in 14 volunteer participants receiving bilateral wrist blocks of 6 versus 11 mL of local. One surgeon performed all 14 bilateral wrist median nerve blocks in participants who remained blinded until after bandages were applied to their wrist. No one could see which wrist received the larger 11-mL volume injection versus the 6-mL block. Blinded sensory assessors then measured perceived maximal numbness time and numbness to needle stick pain in the fingertips of the median nerve distribution. Failure to get a complete median nerve block occurred in seven of fourteen 6-mL wrist blocks versus failure in only one of fourteen 11-mL blocks. Perceived maximal numbness occurred at roughly 40 minutes after injection, but actual numbness to painful needle stick took around 100 minutes. Incomplete median nerve numbness occurred with both 6- and 11-mL non-ultrasound-guided blocks at the wrist. In those with complete blocks, it took a surprisingly long time of 100 minutes for maximal anesthesia to occur to painful needle stick stimuli to the fingertips of the median nerve distribution. Non-ultrasound-guided median nerve blocks at the wrist as described in this article lack reliability and take too long to work.

  17. Use of the temporal median and trimmed mean mitigates effects of respiratory motion in multiple-acquisition abdominal diffusion imaging

    International Nuclear Information System (INIS)

    Jerome, N P; Orton, M R; D’Arcy, J A; Leach, M O; Collins, D J; Feiweier, T; Tunariu, N; Koh, D-M

    2015-01-01

    Respiratory motion commonly confounds abdominal diffusion-weighted magnetic resonance imaging, where averaging of successive samples at different parts of the respiratory cycle, performed in the scanner, manifests the motion as blurring of tissue boundaries and structural features and can introduce bias into calculated diffusion metrics. Storing multiple averages separately allows processing using metrics other than the mean; in this prospective volunteer study, median and trimmed mean values of signal intensity for each voxel over repeated averages and diffusion-weighting directions are shown to give images with sharper tissue boundaries and structural features for moving tissues, while not compromising non-moving structures. Expert visual scoring of derived diffusion maps is significantly higher for the median than for the mean, with modest improvement from the trimmed mean. Diffusion metrics derived from mono- and bi-exponential diffusion models are comparable for non-moving structures, demonstrating a lack of introduced bias from using the median. The use of the median is a simple and computationally inexpensive alternative to complex and expensive registration algorithms, requiring only additional data storage (and no additional scanning time) while returning visually superior images that will facilitate the appropriate placement of regions-of-interest when analysing abdominal diffusion-weighted magnetic resonance images, for assessment of disease characteristics and treatment response. (note)

  18. Characterization of the Small and Median Companies in the Textile Sector of the Ecuadorian Economy

    Directory of Open Access Journals (Sweden)

    Jenny Lilián Basantes–Avalos

    2015-12-01

    Full Text Available The small and median companies perform a fundamental role in the economy of latinoamerican countries, and Ecuador is not the exception, because of its incidence in the generation of employment and economic development. Historically, Ecuador has been a textile country by excellence, and with the years has been consolidated like one of the manufactured industries most importants of the country. However, the sector has to deal with adverse condition in the last decade. For such reason, the manufacturers have the challenge of improve the production techniques to promote a better quality offer and recognition, capable of competing with foreign products of similar characteristics. In this context, this paper has the intent to characterize the small and median companies of Ecuador in general and the textile sector as a particularity, its current situation, the importance of the Ecuadorian economy, such as their problems and opportunities. 

  19. Asymmetric Bilateral Variations in the Musculocutaneous and Median Nerves with High Branching of Brachial Artery

    Directory of Open Access Journals (Sweden)

    Vandana Tomar

    2012-01-01

    Full Text Available Brachial Plexus is formed by the union of the anterior rami of cervical 5, 6, 7, 8 and thoracic 1 nerves. These nerves unite and divide to form the key nerves innervating the upper limb. Variations in the course of these nerves are clinically important to anesthetists, neurologists and orthopedicians. We report bilateral variations in the arterial and neural structures in the upper limb of a 65 year old cadaver. The muscles of the arm on one side were innervated by the median nerve with absence of musculocutaneous. While on the other side the musculocutaneous nerve contributed to the formation of the median nerve. There was a presence of high bifurcation of brachial artery on both sides. Knowledge of such variations in the innervations of muscles and the arterial supply of the limbs are important to remember before performing any reconstructive procedures or interventions on the limb.

  20. Duration of symptomatology and median segmental sensory latency in 993 carpal tunnel syndrome hands (668 cases

    Directory of Open Access Journals (Sweden)

    KOUYOUMDJIAN JOAO ARIS

    1999-01-01

    Full Text Available According to median sensory nerve action potential onset-latency to index finger in a 140 mm fixed distance, 993 carpal tunnel syndrome (CTS hands from 668 patients were grouped into MIld (3.0 to 3.5 ms, 384 hands, MOderate (3.6 to 4.4 ms, 332 hands, SEvere (> 4.4 ms, 135 hands and UNrecordable (142 hands and correlated with CTS symptomatology duration. All patients have sensory antidromic median-radial latency difference (MRD e > or = 1.0 ms without any doubt about CTS diagnosis. Patients with systemic disease, trauma or previous surgery were excluded. There is a remarkable cumulative percentage increase from 1 to 12 months in group UN (3.5% to 38.7%, 11 folds, much less than the group MI (13.8% to 54.6%, 3.9 folds. There is also a remarkable non-cumulative percentage increase in group UN, from 1 to 4-12 months; the group MI had a relatively uniform distribution in all symptomatic duration groups from 1 to > 60 months. The conclusion is that median nerve compression at carpal tunnel can lead to unrecordable potentials in a relatively short period from 1 to 12 months of evolution, suggesting acute/subacute deterioration. Electrophysiological evaluation must be done periodically in patients that underwent clinical treatment, since cumulative 38.7% of group UN was found in 12 months period.

  1. Speckle noise reduction in breast ultrasound images: SMU (srad median unsharp) approch

    International Nuclear Information System (INIS)

    Njeh, I.; Sassi, O. B.; Ben Hamida, A.; Chtourou, K.

    2011-01-01

    Image denoising has become a very essential for better information extraction from the image and mainly from so noised ones, such as ultrasound images. In certain cases, for instance in ultrasound images, the noise can restrain information which is valuable for the general practitioner. Consequently medical images are very inconsistent, and it is crucial to operate case to case. This paper presents a novel algorithm SMU (Srad Median Unsharp) for noise suppression in ultrasound breast images in order to realize a computer aided diagnosis (CAD) for breast cancer.

  2. The role of the accessory pathway radiofrequency catheter ablation in the secondary prevention of the malignant tachyarrhythmias in patients with Wolff-Parkinson-White syndrome

    Directory of Open Access Journals (Sweden)

    Mujović Nebojša

    2010-01-01

    Full Text Available Background/Aim. The occurrence of atrial fibrillation (AF in the presence of an accessory pathway (AP that conducts rapidly is potentially lethal because the rapid ventricular response may lead to ventricular fibrillation (VF. The aim of the study was to determine long-term efficacy of AP catheter-ablation using radiofrequency (RF current in secondary prevention of VF in WPW patients. Methods. Study included a total of 192 symptomatic WPW patients who underwent RF catheter-ablation of AP in our institution from 1994 to 2007 and were available for clinical follow-up for more than 3 months after procedure. Results. Before ablation, VF was recorded in total of 27 patients (14.1%. In 14 of patients (51.9% VF was the first clinical manifestation of WPW syndrome. A total of 35 VF episodes were identified in 27 patients. The occurrence of VF was preceded by physical activity or emotional stress in 17.1% of cases, by alcohol abuse in 2.9% and by inappropriate intravenous drug administration in 28.6%. In addition, no clear precipitating factor was identified in 40% of VF cases, while informations about activities preceding 11.4% of VF episodes were not available. The follow-up of 5.7 ± 3.3 years was obtained in all of 27 VF patients. Of the 20 patients who underwent successful AP ablation, all were alive, without syncope or ventricular tachyarrhythmias during long-term follow-up. In 4 of 7 unsuccessfully treated patients, recurrence of supraventricular tachycardia and/or preexcited atrial fibrillation were recorded; one of these patients suddenly died of VF, 6 years after procedure. Conclusion. In significant proportion of WPW patients, VF was the first clinical manifestation of WPW syndrome, often precipitated by physical activity, emotional stress or inappropriate drug administration. Successful elimination of AP by percutaneous RF catheter-ablation is highly effective in secondary prevention of life-threatening tachyarrhythmias in patients with

  3. Functional visual fields: a cross-sectional UK study to determine which visual field paradigms best reflect difficulty with mobility function.

    Science.gov (United States)

    Subhi, Hikmat; Latham, Keziah; Myint, Joy; Crossland, Michael

    2017-11-20

    To develop an appropriate method of assessing visual field (VF) loss which reflects its functional consequences, this study aims to determine which method(s) of assessing VF best reflect mobility difficulty. This cross-sectional observational study took place within a single primary care setting. Participants attended a single session at a University Eye Clinic, Cambridge, UK, with data collected by a single researcher (HS), a qualified optometrist. 50 adult participants with peripheral field impairment were recruited for this study. Individuals with conditions not primarily affecting peripheral visual function, such as macular degeneration, were excluded from the study. Participants undertook three custom and one standard binocular VF tests assessing VF to 60°, and also integrated monocular threshold 24-2 visual fields (IVF). Primary VF outcomes were average mean threshold, percentage of stimuli seen and VF area. VF outcomes were compared with self-reported mobility function assessed with the Independent Mobility Questionnaire, and time taken and patient acceptability were also considered. Receiver operating characteristic (ROC) curves determined which tests best predicted difficulty with mobility tasks. Greater VF loss was associated with greater self-reported mobility difficulty with all field paradigms (R 2 0.38-0.48, all Pmobility tasks in ROC analysis. Mean duration of the tests ranged from 1 min 26 s (±9 s) for kinetic assessment to 9 min 23 s (±24 s) for IVF. The binocular VF tests extending to 60° eccentricity all relate similarly to self-reported mobility function, and slightly better than integrated monocular VFs. A kinetic assessment of VF area is quicker than and as effective at predicting mobility function as static threshold assessment. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  4. Effects of tung oilseed FAD2 and DGAT2 genes on unsaturated fatty acid accumulation in Rhodotorula glutinis and Arabidopsis thaliana.

    Science.gov (United States)

    Chen, Yicun; Cui, Qinqin; Xu, Yongjie; Yang, Susu; Gao, Ming; Wang, Yangdong

    2015-08-01

    Genetic engineering to produce valuable lipids containing unsaturated fatty acids (UFAs) holds great promise for food and industrial applications. Efforts to genetically modify plants to produce desirable UFAs with single enzymes, however, have had modest success. The key enzymes fatty acid desaturase (FAD) and diacylglycerol acyltransferase (DGAT) are responsible for UFA biosynthesis (a push process) and assembling fatty acids into lipids (a pull process) in plants, respectively. To examine their roles in UFA accumulation, VfFAD2 and VfDGAT2 genes cloned from Vernicia fordii (tung tree) oilseeds were conjugated and transformed into Rhodotorula glutinis and Arabidopsis thaliana via Agrobacterium tumefaciens. Real-time quantitative PCR revealed variable gene expression levels in the transformants, with a much higher level of VfDGAT2 than VfFAD2. The relationship between VfFAD2 expression and linoleic acid (C18:2) increases in R. glutinis (R (2) = 0.98) and A. thaliana (R (2) = 0.857) transformants was statistically linear. The VfDGAT2 expression level was statistically correlated with increased total fatty acid content in R. glutinis (R (2) = 0.962) and A. thaliana (R (2) = 0.8157) transformants. With a similar expression level between single- and two-gene transformants, VfFAD2-VfDGAT2 co-transformants showed a higher linolenic acid (C18:3) yield in R. glutinis (174.36 % increase) and A. thaliana (14.61 % increase), and eicosatrienoic acid (C20:3) was enriched (17.10 % increase) in A. thaliana. Our data suggest that VfFAD2-VfDGAT2 had a synergistic effect on UFA metabolism in R. glutinis, and to a lesser extent, A. thaliana. These results show promise for further genetic engineering of plant lipids to produce desirable UFAs.

  5. Patient-centric blood pressure-targeted cardiopulmonary resuscitation improves survival from cardiac arrest.

    Science.gov (United States)

    Sutton, Robert M; Friess, Stuart H; Naim, Maryam Y; Lampe, Joshua W; Bratinov, George; Weiland, Theodore R; Garuccio, Mia; Nadkarni, Vinay M; Becker, Lance B; Berg, Robert A

    2014-12-01

    Although current resuscitation guidelines are rescuer focused, the opportunity exists to develop patient-centered resuscitation strategies that optimize the hemodynamic response of the individual in the hopes to improve survival. To determine if titrating cardiopulmonary resuscitation (CPR) to blood pressure would improve 24-hour survival compared with traditional CPR in a porcine model of asphyxia-associated ventricular fibrillation (VF). After 7 minutes of asphyxia, followed by VF, 20 female 3-month-old swine randomly received either blood pressure-targeted care consisting of titration of compression depth to a systolic blood pressure of 100 mm Hg and vasopressors to a coronary perfusion pressure greater than 20 mm Hg (BP care); or optimal American Heart Association Guideline care consisting of depth of 51 mm with standard advanced cardiac life support epinephrine dosing (Guideline care). All animals received manual CPR for 10 minutes before first shock. Primary outcome was 24-hour survival. The 24-hour survival was higher in the BP care group (8 of 10) compared with Guideline care (0 of 10); P = 0.001. Coronary perfusion pressure was higher in the BP care group (point estimate +8.5 mm Hg; 95% confidence interval, 3.9-13.0 mm Hg; P < 0.01); however, depth was higher in Guideline care (point estimate +9.3 mm; 95% confidence interval, 6.0-12.5 mm; P < 0.01). Number of vasopressor doses before first shock was higher in the BP care group versus Guideline care (median, 3 [range, 0-3] vs. 2 [range, 2-2]; P = 0.003). Blood pressure-targeted CPR improves 24-hour survival compared with optimal American Heart Association care in a porcine model of asphyxia-associated VF cardiac arrest.

  6. Wound infections after median sternotomy treated by VAC therapy, summary of results, and risk factor analysis.

    Science.gov (United States)

    Hulman, M; Bezak, B; Artemiou, P; Cikrai, R

    2017-01-01

    The aim of this study is to summarize results and analyze risk factors for the development of wound infection in heart surgery patients after median sternotomy. In this retrospective analysis with assessment of multiple risk factors, we examined 143 patients with infection after median sternotomy treated with VAC therapy from total of 4,650 patients operated in our department from 2012 to 2015. Total of 143 patients developed significant SSI treated by VAC therapy following cardiac surgery. Of these, only 14 patients developed DSWI and one patient was diagnosed with suspected osteomyelitis. BMI, female gender, and use of BIMA proved to be statistically significant risk factors in our study (p infection (p infection proved to be a significant prognostic factor for patients' outcome (p infection (Tab. 3, Ref. 30).

  7. Mesopontine median raphe regulates hippocampal ripple oscillation and memory consolidation.

    Science.gov (United States)

    Wang, Dong V; Yau, Hau-Jie; Broker, Carl J; Tsou, Jen-Hui; Bonci, Antonello; Ikemoto, Satoshi

    2015-05-01

    Sharp wave-associated field oscillations (∼200 Hz) of the hippocampus, referred to as ripples, are believed to be important for consolidation of explicit memory. Little is known about how ripples are regulated by other brain regions. We found that the median raphe region (MnR) is important for regulating hippocampal ripple activity and memory consolidation. We performed in vivo simultaneous recording in the MnR and hippocampus of mice and found that, when a group of MnR neurons was active, ripples were absent. Consistently, optogenetic stimulation of MnR neurons suppressed ripple activity and inhibition of these neurons increased ripple activity. Notably, using a fear conditioning procedure, we found that photostimulation of MnR neurons interfered with memory consolidation. Our results demonstrate a critical role of the MnR in regulating ripples and memory consolidation.

  8. Dicty_cDB: VFK250 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFK250 (Link to dictyBase) - - - Contig-U13825-1 VFK250P (Link to Original site) VFK2...50F 647 VFK250Z 679 VFK250P 1306 - - Show VFK250 Library VF (Link to library) Clone ID VFK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFK2-C/VFK250Q.Seq.d/ Representative seq. ID VFK2...50P (Link to Original site) Representative DNA sequence >VFK250 (VFK250Q) /CSM/VF/VFK2-C/VFK2...re E Sequences producing significant alignments: (bits) Value VFK250 (VFK250Q) /CSM/VF/VFK2-C/VFK250Q.Seq.d/

  9. Early Ventricular Tachycardia or Fibrillation in Patients With ST Elevation Myocardial Infarction Undergoing Primary Percutaneous Coronary Intervention and Impact on Mortality and Stent Thrombosis (from the Harmonizing Outcomes with Revascularization and Stents in Acute Myocardial Infarction Trial).

    Science.gov (United States)

    Kosmidou, Ioanna; Embacher, Monica; McAndrew, Thomas; Dizon, José M; Mehran, Roxana; Ben-Yehuda, Ori; Mintz, Gary S; Stone, Gregg W

    2017-11-15

    The prevalence and impact of early ventricular arrhythmias (ventricular tachycardia [VT]/ventricular fibrillation [VF]) occurring before mechanical revascularization for acute ST segment elevation myocardial infarction (STEMI) treated with percutaneous coronary intervention are poorly understood. We sought to investigate the association between early VT/VF and long-term clinical outcomes using data from the Harmonizing Outcomes with Revascularization and Stents in Acute Myocardial Infarction trial. Among 3,602 patients with STEMI, 108 patients (3.0%) had early VT/VF. Baseline clinical characteristics were similar in patients with versus without early VT/VF. Patients with early VT/VF had shorter symptom-to-balloon times and lower left ventricular ejection fraction and underwent more frequent thrombectomy compared with patients without early VT/VF. Adjusted 3-year rates of all-cause death (15.7% vs 6.5%; adjusted hazard ratio 2.62, 95% confidence interval 1.48 to 4.61, p stent thrombosis (13.7% vs 5.7%; adjusted hazard ratio 2.74, 95% confidence interval 1.52 to 4.93, p Stents in Acute Myocardial Infarction trial, VT/VF occurring before coronary angiography and revascularization in patients with STEMI was strongly associated with increased 3-year rates of death and stent thrombosis. Further investigation into the mechanisms underlying the increased risk of early stent thrombosis in patients with early VT/VF is required. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Additional Muscle Slip of Bicipital Aponeurosis and its Anomalous Relationship with the Median Cubital Vein

    Directory of Open Access Journals (Sweden)

    Nandini Bhat

    2017-03-01

    Full Text Available The cubital region of the arm is a common site for recording blood pressure, taking blood for analysis and administering intravenous therapy and blood transfusions. During the routine dissection of a 70-year-old male cadaver at the Kasturba Medical College, Manipal, Karnataka, India, in 2015, it was observed that the aponeurotic insertion of the biceps brachii muscle divided into two slips. The medial slip fused normally with the deep fascia of the forearm, while flexor carpi radialis muscle fibres originated from the lateral slip. There was also a single vein in the forearm, the cephalic vein, which bifurcated to form the median cubital vein and the cephalic vein proper. The median cubital vein, further reinforced by the radial vein, passed deep to the two slips of the bicipital aponeurosis and then continued as the basilic vein. During venepuncture, medical practitioners should be aware of potential cubital fossa variations which could lead to nerve entrapment syndromes.

  11. Sample size calculations based on a difference in medians for positively skewed outcomes in health care studies

    Directory of Open Access Journals (Sweden)

    Aidan G. O’Keeffe

    2017-12-01

    Full Text Available Abstract Background In healthcare research, outcomes with skewed probability distributions are common. Sample size calculations for such outcomes are typically based on estimates on a transformed scale (e.g. log which may sometimes be difficult to obtain. In contrast, estimates of median and variance on the untransformed scale are generally easier to pre-specify. The aim of this paper is to describe how to calculate a sample size for a two group comparison of interest based on median and untransformed variance estimates for log-normal outcome data. Methods A log-normal distribution for outcome data is assumed and a sample size calculation approach for a two-sample t-test that compares log-transformed outcome data is demonstrated where the change of interest is specified as difference in median values on the untransformed scale. A simulation study is used to compare the method with a non-parametric alternative (Mann-Whitney U test in a variety of scenarios and the method is applied to a real example in neurosurgery. Results The method attained a nominal power value in simulation studies and was favourable in comparison to a Mann-Whitney U test and a two-sample t-test of untransformed outcomes. In addition, the method can be adjusted and used in some situations where the outcome distribution is not strictly log-normal. Conclusions We recommend the use of this sample size calculation approach for outcome data that are expected to be positively skewed and where a two group comparison on a log-transformed scale is planned. An advantage of this method over usual calculations based on estimates on the log-transformed scale is that it allows clinical efficacy to be specified as a difference in medians and requires a variance estimate on the untransformed scale. Such estimates are often easier to obtain and more interpretable than those for log-transformed outcomes.

  12. Influence of a vegetable fat blend on the texture, microstructure and sensory properties of kashar cheese

    Directory of Open Access Journals (Sweden)

    Dinkçi, N.

    2011-09-01

    Full Text Available The possibility of using a commercial vegetable fat blend in Kashar cheese was investigated. Kashar cheeses were manufactured by replacing the milk fat (MF with a vegetable fat (VF blend. Kashar cheeses from whole milk were also manufactured to compare textural, microstructural, meltability, color and sensory characteristics during a ripening period of 90 days. The use of vegetable fat decreased the meltability, hardness, cohesiveness, gumminess and chewiness of the cheese; while increasing adhesiveness where springiness was not affected. Differences became less notable toward the end of ripening. Scanning electron micrographs displayed VF cheese with a compact network with small and uniform fat globules embedded in the protein matrix. The MF cheese exhibited an open protein matrix containing milk fat globules of various sizes and forms. The color analysis demonstrated significant differences between cheeses. Finally, all sensory characteristics of the cheese were affecte d by the vegetable fat blend.

    La posibilidad de usar una mezcla de grasas vegetales comerciales en queso Kashar fue investigada. Los quesos Kashar fueron elaborados con una mezcla de grasas vegetales (VF en lugar de grasa de leche (MF. Quesos Kashar con leche entera fueron también elaborados para comparar las características sensoriales, de color, de fusión, microestructurales y de textura durante el periodo de maduración de 90 días. El uso de grasas vegetales decreció la dureza y las propiedades de fusión, de cohesión, de gomosidad y de masticación e incremento la adhesividad mientras que la elasticidad no fue afectada. Las diferencias se hicieron menos notables hacia el final de la maduración. La micrografía electrónica de barrido de quesos VF mostro una red compacta con pequeños y uniformes glóbulos de grasa embebidos en la matriz de proteínas. Los quesos MF exhibieron una matriz de proteínas abierta conteniendo glóbulos de grasa de leche de varios

  13. Visual field examination in children with brain disorders

    NARCIS (Netherlands)

    Koenraads, Y

    2016-01-01

    The aim of this thesis is to gain more insight in the diagnostic and prognostic implications of visual field (VF) examination in children with brain disorders. Several aspects of VF examination in children with brain disorders were evaluated: All VF examinations that were performed with the

  14. Altered brain morphometry in carpal tunnel syndrome is associated with median nerve pathology☆☆☆

    Science.gov (United States)

    Maeda, Yumi; Kettner, Norman; Sheehan, James; Kim, Jieun; Cina, Stephen; Malatesta, Cristina; Gerber, Jessica; McManus, Claire; Mezzacappa, Pia; Morse, Leslie R.; Audette, Joseph; Napadow, Vitaly

    2013-01-01

    Objective Carpal tunnel syndrome (CTS) is a common median nerve entrapment neuropathy characterized by pain, paresthesias, diminished peripheral nerve conduction velocity (NCV) and maladaptive functional brain neuroplasticity. We evaluated structural reorganization in brain gray matter (GM) and white matter (WM) and whether such plasticity is linked to altered median nerve function in CTS. Methods We performed NCV testing, T1-weighted structural MRI, and diffusion tensor imaging (DTI) in 28 CTS and 28 age-matched healthy controls (HC). Voxel-based morphometry (VBM) contrasted regional GM volume for CTS versus HC. Significant clusters were correlated with clinical metrics and served as seeds to define associated WM tracts using DTI data and probabilistic tractography. Within these WM tracts, fractional anisotropy (FA), axial (AD) and radial (RD) diffusivity were evaluated for group differences and correlations with clinical metrics. Results For CTS subjects, GM volume was significantly reduced in contralesional S1 (hand-area), pulvinar and frontal pole. GM volume in contralesional S1 correlated with median NCV. NCV was also correlated with RD and was negatively correlated with FA within U-fiber cortico-cortical association tracts identified from the contralesional S1 VBM seed. Conclusions Our study identified clear morphometric changes in the CTS brain. This central morphometric change is likely secondary to peripheral nerve pathology and altered somatosensory afference. Enhanced axonal coherence and myelination within cortico-cortical tracts connecting primary somatosensory and motor areas may accompany peripheral nerve deafferentation. As structural plasticity was correlated with NCV and not symptomatology, the former may be a better determinant of appropriate clinical intervention for CTS, including surgery. PMID:23799199

  15. Retrospective review of Prothrombinex use by SAAS MedSTAR.

    Science.gov (United States)

    Fischer, Roy; Brettig, Simon; Pearce, Andrew

    2017-04-01

    The aim of this study was to review and describe the use of Prothrombinex by a physician-led retrieval service based remote from a hospital blood bank. This is a retrospective observational study. Patients to whom Prothrombinex was administered by the retrieval team were identified from the retrieval service patient database. The paper case cards of the identified patients were then manually reviewed and the data matched to patients in the state-wide electronic laboratory record. Between 1 January 2010 and 30 November 2013 38 cases were identified. For 28 the indication was warfarinisation associated with life-threatening bleeding (most commonly intracranial or gastrointestinal tract). In the remaining 10 cases, Prothrombinex was used to treat coagulopathy associated with liver disease or massive haemorrhage. The median time saved by the retrieval team administering PTX-VF, rather than waiting to the receiving centre, was 120 min (interquartile range: 85-195 min). The median dose of PTX-VF administered was 23.25 IU/kg (interquartile range: 20-33 IU/kg). Paired international normalised ratios (INRs) were available for 33 of the 38 patients. In the warfarin group, all patients had an improvement in their INR and 21 of 25 had correction of their INR. In the non-warfarin group, the effect on INR was more variable. Prothrombinex is a clinically useful product that can be relatively easily stored and used by retrieval services, even if they are based in isolation from a hospital blood bank. More research is required to look at the utility of Prothrombinex for non-warfarin-related bleeding in the pre-hospital and retrieval environment. © 2016 Australasian College for Emergency Medicine and Australasian Society for Emergency Medicine.

  16. Manometric findings in relation to functional outcomes in different types of anorectal malformations.

    Science.gov (United States)

    Kyrklund, Kristiina; Pakarinen, Mikko P; Rintala, Risto J

    2017-04-01

    To compare anorectal manometry (AM) in patients with different types of anorectal malformations (ARMs) in relation to functional outcomes. A single-institution, cross-sectional study. After ethical approval, all patients ≥7years old treated for anterior anus (AA), perineal fistula (PF), vestibular fistula (VF), or rectourethral fistula (RUF) from 1983 onwards were invited to answer the Rintala bowel function score (BFS) questionnaire and to attend anorectal manometry (AM). Patients with mild ARMs (AA females and PF males) had been treated with minimally invasive perineal procedures. Females with VF/PF and males with RUF had undergone internal-sphincter saving sagittal repairs. 55 of 132 respondents (42%; median age 12 (7-29) years; 42% male) underwent AM. Patients with mild ARMs displayed good anorectal function after minimally invasive treatments. The median anal resting and squeeze pressures among patients with mild ARMs (60 cm H2O and 116 cm H2O respectively) were significantly higher than among patients with more severe ARMs (50 cm H2O, and 80cm H2O respectively; p≤0.002). The rectoanal inhibitory reflex was preserved in 100% of mild ARMs and 83% of patients with more severe malformations after IAS-saving sagittal repair. The functional outcome was poor in 4/5 patients with an absent RAIR (BFS≤11 or antegrade continence enema-dependence). Rectal sensation correlated significantly with the BFS. Our findings support the appropriateness of our minimally invasive approaches to the management of mild ARMs, and IAS-saving anatomical repairs for patients with more severe malformations. III. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Relationship between median nerve somatosensory evoked potentials and spinal cord injury levels in patients with quadriplegia.

    Science.gov (United States)

    de Arruda Serra Gaspar, M I F; Cliquet, A; Fernandes Lima, V M; de Abreu, D C C

    2009-05-01

    Cross-sectional study. To observe if there is a relationship between the level of injury by the American Spinal Cord Injury Association (ASIA) and cortical somatosensory evoked potential (SSEP) recordings of the median nerve in patients with quadriplegia. Rehabilitation Outpatient Clinic at the university hospital in Brazil. Fourteen individuals with quadriplegia and 8 healthy individuals were evaluated. Electrophysiological assessment of the median nerve was performed by evoked potential equipment. The injury level was obtained by ASIA. N(9), N(13) and N(20) were analyzed based on the presence or absence of responses. The parameters used for analyzing these responses were the latency and the amplitude. Data were analyzed using mixed-effect models. N(9) responses were found in all patients with quadriplegia with a similar latency and amplitude observed in healthy individuals; N(13) responses were not found in any patients with quadriplegia. N(20) responses were not found in C5 patients with quadriplegia but it was present in C6 and C7 patients. Their latencies were similar to healthy individuals (P>0.05) but the amplitudes were decreased (P<0.05). This study suggests that the SSEP responses depend on the injury level, considering that the individuals with C6 and C7 injury levels, both complete and incomplete, presented SSEP recordings in the cortical area. It also showed a relationship between the level of spinal cord injury assessed by ASIA and the median nerve SSEP responses, through the latency and amplitude recordings.

  18. Characterization of insulin-like growth factor I receptors in the median eminence of the brain and their modulation by food restriction

    International Nuclear Information System (INIS)

    Bohannon, N.J.; Corp, E.S.; Wilcox, B.J.; Figlewicz, D.P.; Dorsa, D.M.; Baskin, D.G.

    1988-01-01

    High affinity binding sites for 125I-labeled [Thr59]insulin-like growth factor I (IGF-I) were measured in rat median eminence by in vitro autoradiography with slide-mounted sections of frozen rat brain. Specific binding of 0.1 nM iodo-[Thr59]IGF-I to brain slices reached maximum by 12 h at 4 C and was unchanged at 24 h. Densitometry by computer digital image analysis of autoradiographic images indicated that specific binding of iodo-[Thr59]IGF-I to the median eminence was reversible. The specificity of binding was evaluated with competition of iodo-[Thr59]IGF-I with unlabeled [Thr59]IGF-I, rat IGF-II (multiplication-stimulating activity), and porcine insulin. All were recognized by the binding site, but the rank order of potency was [Thr59]IGF-I greater than IGF-II greater than insulin. Somatostatin was completely ineffective. Further, an antibody against the rat IGF-II receptor did not block binding of iodo-[Thr59]IGF-I to the median eminence. Fourteen days of food restriction (75% of food intake of controls) resulted in significant weight loss and reduction of plasma immunoreactive IGF-I in six food-restricted rats (0.9 +/- 0.1 U/ml) compared with values in six controls (2.6 +/- 0.5 U/ml; P less than 0.001). Binding of 125I-labeled [Thr59]IGF-I in the median eminence was significantly increased in the food-restricted rats, primarily due to an increase in the concentration of iodo-[Thr59]IGF-I-binding sites in the median eminence; the affinity (Kd) of binding was unchanged. The results indicate that the median eminence has type I IGF-I receptors, which become more numerous under metabolic conditions associated with decreased caloric intake and lowered plasma IGF-I levels

  19. Idiopathic Intracranial Hypertension-A Comparison of Clinical Characteristics Between 4 Medical Centers in Different Geographic Regions of the World.

    Science.gov (United States)

    Rosenblatt, Amir; Klein, Ainat; Roemer, Ségolène; Borruat, François-Xavier; Meira, Dália; Silva, Marta; Gökçay, Figen; Çelebisoy, Neşe; Kesler, Anat

    2016-09-01

    Idiopathic intracranial hypertension (IIH) is a well-characterized syndrome, most commonly affecting obese women of childbearing age. Differences in its prevalence have been reported in various populations. The aim of this article was to determine whether differences in clinical presentation and management exist for patients with IIH between different regions the world. Retrospective database analysis of adult patients with IIH from 4 different neuro-ophthalmology clinics. The data collected included gender, age of onset, body mass index (BMI), lumbar puncture opening pressure, initial visual acuity (VA), initial visual field (VF) mean deviation (MD), pharmacological or surgical treatment, length of follow-up, final VA, and final VF MD. The study population consisted of 244 patients, with significant regional variations of female to male ratio. Overall, there was no significant difference regarding the age of diagnosis or the BMI. Acetazolamide was the first line of treatment in all groups but there was a difference between countries regarding second-line treatment, including the use of surgical interventions. Mean initial VA differed between groups but the final change in VA was the same among all the study groups. There are differences in IIH presentation, treatment, and response to therapy among different countries. International prospective studies involving multiple centers are needed to determine the potential influence of environmental and genetic factors on the development of IIH and to improve the management of this potentially blinding disorder.

  20. Validity of F-wave minimal latency of median and ulnar nerves for diagnosis and severity assessment of carpal tunnel syndrome in type II diabetes mellitus

    International Nuclear Information System (INIS)

    Hussain, A.; Habib, S.S.; Omar, S.A.; Drees, M.A.

    2011-01-01

    Type II diabetes mellitus is a common problem and is sometimes associated with Carpal Tunnel Syndrome (CTS) due to compression of median nerve at wrist. Electrophysiological tests are frequently used for its diagnosis. In this work, F-wave minimal latency (FWML) difference between median and ulnar nerve and F-ratio is used to facilitate the diagnosis and severity of CTS in type II diabetes mellitus (T2DM). Methods: Thirty control cases were selected who were physically fit for normal electrophysiological values. Thirty-two patients with a long history of type II diabetes mellitus were studied for electro-diagnostic tests. All patients had clinical evidence of CTS. Among all diabetics about 20 cases had poor glycaemic control (HbA1c>7.5). F-wave minimal latency (FWML) were measured in median and ulnar nerves and F-ratio of median nerve were also noted. The mean values in different groups were compared using t-test and p greater or equal to 0.05 was considered significant. Results: In control group, the ulnar FWML was either equal or slightly longer that the median FWML value. In CTS group with type II diabetes mellitus the FWML value of median nerve were significantly longer than FWML of the ulnar nerve. Moreover, in uncontrolled diabetic patients the FWML values was very much longer than controlled group. Similarly the F-ratio of median nerve was significantly low. Conclusion: In addition to the specific criteria for CTS diagnosis, the parameters like FWML difference in median and ulnar nerve with reduced F-ratio of median nerve can be useful in establishing the diagnosis and severity of CTS in type II diabetes mellitus. (author)

  1. Population pharmacokinetics of proguanil in patients with acute P. falciparum malaria after combined therapy with atovaquone.

    Science.gov (United States)

    Hussein, Z; Eaves, C J; Hutchinson, D B; Canfield, C J

    1996-11-01

    1. The pharmacokinetics of proguanil were evaluated in patients with acute P. falciparum malaria receiving concomitantly proguanil hydrochloride and atovaquone. The population consisted of 203 Blacks, 112 Orientals and 55 Malays; 274 males and 96 females. Of the 370 patients, 114 and 256 patients were classified as 'poor' and 'extensive' metabolizers of proguanil, respectively. Body weight and age ranged between 11-110 kg and 3-65 years, respectively. 2. A one compartment model with first-order absorption and elimination was fitted to proguanil plasma concentration-time profiles, using non-linear mixed effect modelling (NONMEM). 3. Oral clearance (CLo) showed a 0.785 power relationship with body weight and was 13% higher in Orientals than Blacks and Malays and 17% lower in 'poor' than 'extensive' metabolizers. According to the mean weight of each population, the final population estimates of CLo in Blacks, Orientals and Malays who are 'extensive' metabolizers were 54.0, 61.5 and 64.3 l h-1, respectively. Age, gender and dose had no significant effects on CLo. 4. Apparent volume of distribution (V/F) showed a 0.88 power relationship with body weight. The final population estimates were 562 and 1629 l in children ( 15 years, respectively, who had a mean body weight of 22.6 and 54.8 kg, respectively. The effect of other covariates on V/F was not examined. 5. The final magnitudes of interpatient variability in CLo and V/F were relatively low at 22.5 and 17.0%, respectively. 6. Population pharmacokinetic parameter estimates in Black, Oriental and Malay patients with acute P. falciparum malaria are in good agreement with results of pharmacokinetic studies in healthy Caucasian volunteers. In view of the 30-50% residual variability in proguanil plasma concentrations, the slight effects of Orientals and 'poor' metabolizers on CLo are unlikely to be clinically significant. Hence, dose recommendation will be solely based on body weight.

  2. Median and common peroneal neuropathy in coir workers of Alappuzha district, Kerala

    Directory of Open Access Journals (Sweden)

    Sadanandavalli Retnaswami Chandra

    2017-01-01

    for other causes not” contributing to the etiological diagnosis. Subjects and Methods: One hundred and forty-two upper limbs and 142 lower limbs in patients engaged in long years of coir work but having no symptoms were evaluated electrophysiologically with informed consent and financial compensation, appropriate inclusion and exclusion criteria were followed as described in the text. Results: There is electrophysiological evidence for median and common peroneal neuropathy in persons engaged in long years of coir work. Conclusions: Coir workers neuropathy appears to be a new occupational neuropathy which can be prevented by following simple preventive measures.

  3. Entrapment of the Martin-Gruber branch of median nerve in the forearm

    Directory of Open Access Journals (Sweden)

    Anu Vinod Ranade

    2016-07-01

    Full Text Available We report a rare case of a dual neuro-vascular variation, which was observed in the right extremity of male cadaver. About an inch inferior to the elbow joint, three branches arose from the median nerve. These were the anterior interosseous branch, a Martin-Gruber branch (MGB and a muscular branch. The MGB coursed infero-medially to join with the ulnar nerve by running posterior to the ulnar artery. It was surprising to observe that the MGB passed between the ulnar artery and its venae comitantes. There was an acute angulation of the MGB here, suggesting entrapment at this site.

  4. Influence of a vegetable fat blend on the texture, microstructure and sensory properties of kashar cheese

    Energy Technology Data Exchange (ETDEWEB)

    Dinkci, N.; Kesenkas, H.; Seckin, A. K.; Kinik, O.; Gonc, S.

    2011-07-01

    The possibility of using a commercial vegetable fat blend in Kashar cheese was investigated. Kashar cheeses were manufactured by replacing the milk fat (MF) with a vegetable fat (VF) blend. Kashar cheeses from whole milk were also manufactured to compare textural, microstructural, meltability, color and sensory characteristics during a ripening period of 90 days. The use of vegetable fat decreased the meltability, hardness, cohesiveness, gumminess and chewiness of the cheese; while increasing adhesiveness where springiness was not affected. Differences became less notable toward the end of ripening. Scanning electron micrographs displayed VF cheese with a compact network with small and uniform fat globules embedded in the protein matrix. The MF cheese exhibited an open protein matrix containing milk fat globules of various sizes and forms. The color analysis demonstrated significant differences between cheeses. Finally, all sensory characteristics of the cheese were affected by the vegetable fat blend. (Author) 36 refs.

  5. Glaucoma progression detection by retinal nerve fiber layer measurement using scanning laser polarimetry: event and trend analysis.

    Science.gov (United States)

    Moon, Byung Gil; Sung, Kyung Rim; Cho, Jung Woo; Kang, Sung Yong; Yun, Sung-Cheol; Na, Jung Hwa; Lee, Youngrok; Kook, Michael S

    2012-06-01

    To evaluate the use of scanning laser polarimetry (SLP, GDx VCC) to measure the retinal nerve fiber layer (RNFL) thickness in order to evaluate the progression of glaucoma. Test-retest measurement variability was determined in 47 glaucomatous eyes. One eye each from 152 glaucomatous patients with at least 4 years of follow-up was enrolled. Visual field (VF) loss progression was determined by both event analysis (EA, Humphrey guided progression analysis) and trend analysis (TA, linear regression analysis of the visual field index). SLP progression was defined as a reduction of RNFL exceeding the predetermined repeatability coefficient in three consecutive exams, as compared to the baseline measure (EA). The slope of RNFL thickness change over time was determined by linear regression analysis (TA). Twenty-two eyes (14.5%) progressed according to the VF EA, 16 (10.5%) by VF TA, 37 (24.3%) by SLP EA and 19 (12.5%) by SLP TA. Agreement between VF and SLP progression was poor in both EA and TA (VF EA vs. SLP EA, k = 0.110; VF TA vs. SLP TA, k = 0.129). The mean (±standard deviation) progression rate of RNFL thickness as measured by SLP TA did not significantly differ between VF EA progressors and non-progressors (-0.224 ± 0.148 µm/yr vs. -0.218 ± 0.151 µm/yr, p = 0.874). SLP TA and EA showed similar levels of sensitivity when VF progression was considered as the reference standard. RNFL thickness as measurement by SLP was shown to be capable of detecting glaucoma progression. Both EA and TA of SLP showed poor agreement with VF outcomes in detecting glaucoma progression.

  6. Transverse plane tendon and median nerve motion in the carpal tunnel: ultrasound comparison of carpal tunnel syndrome patients and healthy volunteers.

    Directory of Open Access Journals (Sweden)

    Margriet H M van Doesburg

    Full Text Available The median nerve and flexor tendons are known to translate transversely in the carpal tunnel. The purpose of this study was to investigate these motions in differential finger motion using ultrasound, and to compare them in healthy people and carpal tunnel syndrome patients.Transverse ultrasounds clips were taken during fist, index finger, middle finger and thumb flexion in 29 healthy normal subjects and 29 CTS patients. Displacement in palmar-dorsal and radial-ulnar direction was calculated using Analyze software. Additionally, the distance between the median nerve and the tendons was calculated.We found a changed motion pattern of the median nerve in middle finger, index finger and thumb motion between normal subjects and CTS patients (p<0.05. Also, we found a changed motion direction in CTS patients of the FDS III tendon in fist and middle finger motion, and of the FDS II and flexor pollicis longus tendon in index finger and thumb motion, respectively (p<0.05. The distance between the median nerve and the FDS II or FPL tendon is significantly greater in patients than in healthy volunteers for index finger and thumb motion, respectively (p<0.05.Our results suggest a changed motion pattern of the median nerve and several tendons in carpal tunnel syndrome patients compared to normal subjects. Such motion patterns may be useful in distinguishing affected from unaffected individuals, and in studies of the pathomechanics of carpal tunnel syndrome.

  7. Anatomical study of the motor branches of the median nerve to the forearm and guidelines for selective neurectomy.

    Science.gov (United States)

    Parot, Catalina; Leclercq, Caroline

    2016-07-01

    The median nerve is responsible for the motor innervation of most of the muscles usually involved in upper limb spasticity. Selective neurectomy is one of the treatments utilized to reduce spasticity. The purpose of this study was to describe the variations of the motor branches of the median nerve in the forearm and draw recommendations for an appropriate planning of selective neurectomy. The median nerve was dissected in the forearm of 20 fresh cadaver upper limbs. Measurements included number, origin, division, and entry point of each motor branch into the muscles. One branch for the pronator teres was the most common pattern. In 9/20 cases, it arose as a common trunk with other branches. A single trunk innervated the flexor carpi radialis with a common origin with other branches in 17/20 cases. Two, three or four branches innervated the flexor digitorum superficialis, the first one frequently through a common trunk with other branches. They were very difficult to identify unless insertions of pronator teres and flexor digitorum superficialis were detached. The flexor digitorum profundus received one to five branches and flexor pollicis longus one to two branches from the anterior interosseous nerve. There is no regular pattern of the motor branches of the median nerve in the forearm. Our findings differ in many points from the classical literature. Because of the frequency of common trunks for different muscles, we recommend the use of peroperative electrical stimulation. Selective neurotomy of flexor digitorum superficialis is technically difficult, because the entry point of some of their terminal branches occurs just below the arch and deep to the muscle belly.

  8. Echinococcus multilocularis vesicular fluid inhibits activation and proliferation of natural killer cells.

    Science.gov (United States)

    Bellanger, Anne-Pauline; Mougey, Valentine; Pallandre, Jean-Rene; Gbaguidi-Haore, Houssein; Godet, Yann; Millon, Laurence

    2017-08-25

    Alveolar echinococcosis is a severe chronic helminthic disease that mimics slow-growing liver cancer. The immune evasion strategy of Echinococcus multilocularis Leuckart, 1863 remains poorly understood. The aim of this study was to investigate in vitro the impact of E. multilocularis vesicular fluid (Em-VF) on peripheral blood mononuclear cells (PBMC) and on natural killer (NK) cells. PBMC and NK cells were exposed to Em-VF (1 µg/ml) during six days. The effect of Em-VF was assessed on CD69, viability and proliferation, and on and transforming growth factor β (TGF-β), interferon γ (IFN-γ), interleukin 17 (IL-17) and interleukin 10, using flow cytometry and ELISA, respectively. Exposure to Em-VF had no bearing on PBMC's viability, proliferation and expression of CD69. In contrast, higher levels of IL-17 at day three and of TGF-β at day six were observed in PBMC supernatant after exposure to Em-VF (p Wilcoxon signed-rank test). Exposure to Em-VF induced a significant decrease of CD69 expression of NK cells at day three and a significant decrease of proliferation of NK cells at day six (p Wilcoxon signed-rank test). In contrast, NK cells viability and levels of cytokines did not vary significantly over Em-VF stimulation. Exposure to Em-VF had a significant bearing on activation and proliferation of NK cells. NK cells may play an important role in the immune response of the host against E. multilocularis.

  9. A Valepotriate Fraction of Valeriana glechomifolia Shows Sedative and Anxiolytic Properties and Impairs Recognition But Not Aversive Memory in Mice

    Directory of Open Access Journals (Sweden)

    Natasha Maurmann

    2011-01-01

    Full Text Available Plants of the genus Valeriana (Valerianaceae are used in traditional medicine as a mild sedative, antispasmodic and tranquilizer in many countries. This study was undertaken to explore the neurobehavioral effects of systemic administration of a valepotriate extract fraction of known quantitative composition of Valeriana glechomifolia (endemic of southern Brazil in mice. Adult animals were treated with a single intraperitoneal injection of valepotriate fraction (VF in the concentrations of 1, 3 or 10 mg kg-1, or with vehicle in the pre-training period before each behavioral test. During the exploration of an open field, mice treated with 10 mg kg-1 of VF showed reduced locomotion and exploratory behavior. Although overall habituation sessions for locomotion and exploratory behavior among vehicle control and doses of VF were not affected, comparison between open-field and habituation sessions within each treatment showed that VF administration at 1 and 10 mg kg-1 impaired habituation. In the elevated plus-maze test, mice treated with VF (10 mg kg-1 showed a significant increase in the percentage of time spent in the open arms without significant effects in the number of total arm entries. VF at 3 mg kg-1 produced an impairment of novel-object recognition memory. In contrast, VF did not affect fear-related memory assessed in an inhibitory avoidance task. The results indicate that VF can have sedative effects and affect behavioral parameters related to recognition memory.

  10. Vellozia flavicans Mart. ex Schult. hydroalcoholic extract inhibits the neuromuscular blockade induced by Bothrops jararacussu venom.

    Science.gov (United States)

    Tribuiani, Natália; da Silva, Alexandro Mateus; Ferraz, Miriéle Cristina; Silva, Magali Glauzer; Bentes, Ana Paula Guerreiro; Graziano, Talita Signoreti; dos Santos, Marcio Galdino; Cogo, José Carlos; Varanda, Eliana Aparecida; Groppo, Francisco Carlos; Cogo, Karina; Oshima-Franco, Yoko

    2014-02-08

    Snakebite is a significant public health issue in tropical countries. In Brazil, some of the most common snake envenomations are from Bothrops. Bothrops bites trigger local and systemic effects including edema, pain, erythema, cyanosis, infections, and necrosis. Vellozia flavicans is a plant from the Brazilian "cerrado" (savanna) that is popularly used as an anti-inflammatory medicine. Since inflammation develops quickly after Bothrops bites, which can lead to infection, the aim of the present study was to observe possible anti-snake venom and antimicrobial activities of V. flavicans (Vf). The chromatographic profile of the main constituents from the Vf leaf hydroalcoholic extract was obtained by thin-layer chromatography (TLC). The anti-snake venom activity was measured by Vf's ability to neutralize the in vitro neuromuscular blockade caused by Bothrops jararacussu venom (Bjssu) in a mouse phrenic nerve-diaphragm model (PND). After a 20 min incubation, preparations of PND were added to Tyrode's solution (control); Vf (0.2, 0.5, 1, and 2 mg/mL); 40 μg/mL Bjssu; pre-incubation for 30 min with Bjssu and 1 mg/mL Vf; and a Bjssu pretreated preparation (for 10 min) followed by 1 mg/mL Vf. Myographic recording was performed, and the contractile responses were recorded. The antimicrobial activity (minimum inhibitory concentration [MIC] and minimum bactericidal concentration [MBC]) was obtained for Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Enterococcus faecalis, using gentamicin and vancomycin as positive controls. TLC analysis yielded several compounds from Vf, such as flavonoids (quercetin) and phenolic acids (chlorogenic acid). Bjssu completely blocked the contractile responses of PND preparations, while Vf preserved 97% (±10%) of the contractile responses when incubated with Bjssu. In the PND pretreated with Bjssu, Vf was able to inhibit the neuromuscular blockade progress. MIC and MBC of Vf ranged from 2.5 to 5.0 mg/mL for P. aeruginosa

  11. MRI shows thickening and altered diffusion in the median and ulnar nerves in multifocal motor neuropathy

    DEFF Research Database (Denmark)

    Haakma, Wieke; Jongbloed, Bas A.; Froeling, Martijn

    2017-01-01

    Objectives To study disease mechanisms in multifocal motor neuropathy (MMN) with magnetic resonance imaging (MRI) and diffusion tensor imaging (DTI) of the median and ulnar nerves. Methods We enrolled ten MMN patients, ten patients with amyotrophic lateral sclerosis (ALS) and ten healthy controls...

  12. Risk factors for vaginal fistula symptoms in Sub-Saharan Africa

    DEFF Research Database (Denmark)

    Maheu-Giroux, Mathieu; Filippi, Véronique; Maulet, Nathalie

    2016-01-01

    Background Vaginal fistula (VF) is one of the most severe maternal morbidities with the immediate consequence of chronic urinary and/or fecal incontinence. The epidemiological evidence regarding risk factors for VF is dominated by facility-based studies. Our aim is to estimate the effect size...... of selected risk factors for VF using population-based survey data.  Methods We pooled all available Demographic and Health Surveys and Multiple Indicators Cluster Surveys carried out in sub-Saharan Africa that collected information on VF symptoms. Bayesian matched logistic regression models that accounted...

  13. Application of subinterval area median contrast filtering method in the recognizing of geochemical anomalies

    International Nuclear Information System (INIS)

    Zhao Ningbo; Fu Jin; Zhang Chuan; Liu Huan

    2012-01-01

    Traditional geochemical processing method sometimes maybe loses some weak anomalies related to mineralization, the authors can avoid the influence of geology background and can solve the problem of recognizing weak anomalies in the low-background and high-background area with the subinterval area median contrast filtering method. In an area of Jiangxi Province, several new anomalies are identified by this method and uranium mineralized prospects are found among them. (authors)

  14. Identifying areas of high risk of human exposure to coccidioidomycosis in Texas using serology data from dogs.

    Science.gov (United States)

    Gautam, R; Srinath, I; Clavijo, A; Szonyi, B; Bani-Yaghoub, M; Park, S; Ivanek, R

    2013-03-01

    Coccidioidomycosis or Valley Fever (VF) is an emerging soil-borne fungal zoonosis affecting humans and animals. Most non-human cases of VF are found in dogs, which we hypothesize may serve as sentinels for estimating the human exposure risk. The objective of this study is to use the spatial and temporal distribution and clusters of dogs seropositive for VF to define the geographic area in Texas where VF is endemic, and thus presents a higher risk of exposure to humans. The included specimens were seropositive dogs tested at a major diagnostic laboratory between 1999 and 2009. Data were aggregated by zip code and smoothed by empirical Bayesian estimation to develop an isopleth map of VF seropositive rates using kriging. Clusters of seropositive dogs were identified using the spatial scan test. Both the isopleth map and the scan test identified an area with a high rate of VF-seropositive dogs in the western and southwestern parts of Texas (relative risk = 31). This location overlapped an area that was previously identified as a potential endemic region based on human surveys. Together, these data suggest that dogs may serve as sentinels for estimating the risk of human exposure to VF. © 2012 Blackwell Verlag GmbH.

  15. The Value of Median Nerve Sonography as a Predictor for Short- and Long-Term Clinical Outcomes in Patients with Carpal Tunnel Syndrome: A Prospective Long-Term Follow-Up Study.

    Directory of Open Access Journals (Sweden)

    Alexander Marschall

    Full Text Available To investigate the prognostic value of B-mode and Power Doppler (PD ultrasound of the median nerve for the short- and long-term clinical outcomes of patients with carpal tunnel syndrome (CTS.Prospective study of 135 patients with suspected CTS seen 3 times: at baseline, then at short-term (3 months and long-term (15-36 months follow-up. At baseline, the cross-sectional area (CSA of the median nerve was measured with ultrasound at 4 levels on the forearm and wrist. PD signals were graded semi-quantitatively (0-3. Clinical outcomes were evaluated at each visit with the Boston Questionnaire (BQ and the DASH Questionnaire, as well as visual analogue scales for the patient's assessment of pain (painVAS and physician's global assessment (physVAS. The predictive values of baseline CSA and PD for clinical outcomes were determined with multivariate logistic regression models.Short-term and long-term follow-up data were available for 111 (82.2% and 105 (77.8% patients, respectively. There was a final diagnosis of CTS in 84 patients (125 wrists. Regression analysis revealed that the CSA, measured at the carpal tunnel inlet, predicted short-term clinical improvement according to BQ in CTS patients undergoing carpal tunnel surgery (OR 1.8, p = 0.05, but not in patients treated conservatively. Neither CSA nor PD assessments predicted short-term improvement of painVAS, physVAS or DASH, nor was any of the ultrasound parameters useful for the prediction of long-term clinical outcomes.Ultrasound assessment of the median nerve at the carpal tunnel inlet may predict short-term clinical improvement in CTS patients undergoing carpal tunnel release, but long-term outcomes are unrelated to ultrasound findings.

  16. Incidence and risk factors of ventricular fibrillation before primary angioplasty in patients with first ST-elevation myocardial infarction: a nationwide study in Denmark.

    Science.gov (United States)

    Jabbari, Reza; Engstrøm, Thomas; Glinge, Charlotte; Risgaard, Bjarke; Jabbari, Javad; Winkel, Bo Gregers; Terkelsen, Christian Juhl; Tilsted, Hans-Henrik; Jensen, Lisette Okkels; Hougaard, Mikkel; Chiuve, Stephanie E; Pedersen, Frants; Svendsen, Jesper Hastrup; Haunsø, Stig; Albert, Christine M; Tfelt-Hansen, Jacob

    2015-01-05

    We aimed to investigate the incidence and risk factors for ventricular fibrillation (VF) before primary percutaneous coronary intervention (PPCI) among patients with ST-segment elevation myocardial infarction (STEMI) in a prospective nationwide setting. In this case-control study, patients presenting within the first 12 hours of first STEMI who survived to undergo angiography and subsequent PPCI were enrolled. Over 2 years, 219 cases presenting with VF before PPCI and 441 controls without preceding VF were enrolled. Of the 219 case patients, 182 (83%) had STEMI with out-of-hospital cardiac arrest due to VF, and 37 (17%) had cardiac arrest upon arrival to the emergency room. Medical history was collected by standardized interviews and by linkage to national electronic health records. The incidence of VF before PPCI among STEMI patients was 11.6%. Multivariable logistic regression analysis identified novel associations between atrial fibrillation and alcohol consumption with VF. Patients with a history of atrial fibrillation had a 2.80-fold odds of experiencing VF before PPCI (95% CI 1.10 to 7.30). Compared with nondrinkers, patients who consumed 1 to 7 units, 8 to 14 units, or >15 units of alcohol per week had an odds ratio (OR) of 1.30 (95% CI, 0.80 to 2.20), 2.30 (95% CI, 1.20 to 4.20), or 3.30 (95% CI, 1.80 to 5.90), respectively, for VF. Previously reported associations for preinfarction angina (OR 0.46; 95% CI 0.32 to 0.67), age of history of sudden death (OR 1.60; 95% CI 1.10 to 2.40) were all associated with VF. Several easily assessed risk factors were associated with VF occurring out-of-hospital or on arrival at the emergency room before PPCI in STEMI patients, thus providing potential avenues for investigation regarding improved identification and prevention of life-threatening ventricular arrhythmias. © 2015 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

  17. The use of hybrid constructed wetlands for wastewater treatment with special attention to nitrogen removal: a review of a recent development.

    Science.gov (United States)

    Vymazal, Jan

    2013-09-15

    The hybrid systems were developed in the 1960s but their use increased only during the late 1990 s and in the 2000s mostly because of more stringent discharge limits for nitrogen and also more complex wastewaters treated in constructed wetlands (CWs). The early hybrid CWs consisted of several stages of vertical flow (VF) followed by several stages of horizontal flow (HF) beds. During the 1990 s, HF-VF and VF-HF hybrid systems were introduced. However, to achieve higher removal of total nitrogen or to treat more complex industrial and agricultural wastewaters other types of hybrid constructed wetlands including free water surface (FWS) CWs and multistage CWs have recently been used as well. The survey of 60 hybrid constructed wetlands from 24 countries reported after 2003 revealed that hybrid constructed wetlands are primarily used on Europe and in Asia while in other continents their use is limited. The most commonly used hybrid system is a VF-HF constructed wetland which has been used for treatment of both sewage and industrial wastewaters. On the other hand, the use of a HF-VF system has been reported only for treatment of municipal sewage. Out of 60 surveyed hybrid systems, 38 have been designed to treat municipal sewage while 22 hybrid systems were designed to treat various industrial and agricultural wastewaters. The more detailed analysis revealed that VF-HF hybrid constructed wetlands are slightly more efficient in ammonia removal than hybrid systems with FWS CWs, HF-VF systems or multistage VF and HF hybrid CWs. All types of hybrid CWs are comparable with single VF CWs in terms of NH4-N removal rates. On the other hand, CWs with FWS units remove substantially more total nitrogen as compared to other types of hybrid constructed wetlands. However, all types of hybrid constructed wetlands are more efficient in total nitrogen removal than single HF or VF constructed wetlands. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Vitrification Facility integrated system performance testing report

    International Nuclear Information System (INIS)

    Elliott, D.

    1997-01-01

    This report provides a summary of component and system performance testing associated with the Vitrification Facility (VF) following construction turnover. The VF at the West Valley Demonstration Project (WVDP) was designed to convert stored radioactive waste into a stable glass form for eventual disposal in a federal repository. Following an initial Functional and Checkout Testing of Systems (FACTS) Program and subsequent conversion of test stand equipment into the final VF, a testing program was executed to demonstrate successful performance of the components, subsystems, and systems that make up the vitrification process. Systems were started up and brought on line as construction was completed, until integrated system operation could be demonstrated to produce borosilicate glass using nonradioactive waste simulant. Integrated system testing and operation culminated with a successful Operational Readiness Review (ORR) and Department of Energy (DOE) approval to initiate vitrification of high-level waste (HLW) on June 19, 1996. Performance and integrated operational test runs conducted during the test program provided a means for critical examination, observation, and evaluation of the vitrification system. Test data taken for each Test Instruction Procedure (TIP) was used to evaluate component performance against system design and acceptance criteria, while test observations were used to correct, modify, or improve system operation. This process was critical in establishing operating conditions for the entire vitrification process

  19. Interfascicular suture with nerve autografts for median, ulnar and radial nerve lesions.

    Science.gov (United States)

    Pluchino, F; Luccarelli, G

    1981-05-01

    Interfascicular nerve suture with autografts is the operation of choice for repairing peripheral nerve injuries because it ensures more precise alignment of the fasciculi and so better chances of reinnervation of the sectioned nerve. The procedure as described by Millesi et al has been used at the Istituto Neurologico di Milano in 30 patients with traumatic lesions of the median, ulnar and radial nerves. All have been followed up for 2 to 7 years since operation. The results obtained are compared with those of other series obtained with interfascicular suture and with epineural suture. Microsurgery is essential. The best time to operate is discussed.

  20. Impulse Noise Cancellation of Medical Images Using Wavelet Networks and Median Filters

    Science.gov (United States)

    Sadri, Amir Reza; Zekri, Maryam; Sadri, Saeid; Gheissari, Niloofar

    2012-01-01

    This paper presents a new two-stage approach to impulse noise removal for medical images based on wavelet network (WN). The first step is noise detection, in which the so-called gray-level difference and average background difference are considered as the inputs of a WN. Wavelet Network is used as a preprocessing for the second stage. The second step is removing impulse noise with a median filter. The wavelet network presented here is a fixed one without learning. Experimental results show that our method acts on impulse noise effectively, and at the same time preserves chromaticity and image details very well. PMID:23493998

  1. Contemporary management of median arcuate ligament syndrome provides early symptom improvement

    Science.gov (United States)

    Columbo, Jesse A.; Trus, Thadeus; Nolan, Brian; Goodney, Philip; Rzucidlo, Eva; Powell, Richard; Walsh, Daniel; Stone, David

    2017-01-01

    Objective Optimal diagnosis and management of median arcuate ligament (MAL) syndrome (MALS) remains unclear in contemporary practice. The advent and evolution of laparoscopic and endovascular techniques has redirected management toward a less invasive therapeutic algorithm. This study examined our contemporary outcomes of patients treated for MALS. Methods All patients treated for MALS at Dartmouth-Hitchcock Medical Center from 2000 to 2013 were retrospectively reviewed. Demographics and comorbidities were recorded. Freedom from symptoms and freedom from reintervention were the primary end points. Return to work or school was assessed. Follow-up by clinic visits and telephone allowed quantitative comparisons among the patients. Results During the study interval, 21 patients (24% male), with a median age of 42 years, were treated for MALS. All patients complained of abdominal pain in the presence of a celiac stenosis, 16 (76%) also reported weight loss at the time of presentation, and 57% had a concomitant psychiatric history. Diagnostic imaging most commonly used included duplex ultrasound (81%), computed tomography angiography (66%), angiography (57%), and magnetic resonance angiography (5%). Fourteen patients (67%) underwent multiple diagnostic studies. All patients underwent initial laparoscopic MAL release. Seven patients (33%) underwent subsequent celiac stent placement in the setting of recurrent or unresolved symptoms with persistent celiac stenosis at a mean interval of 49 days. Two patients required surgical bypass after an endovascular intervention failed. The 6-month freedom from symptoms was 75% and freedom from reintervention was 64%. Eighteen patients (81%) reported early symptom improvement and weight gain, and 66% were able to return to work. Conclusions A multidisciplinary treatment approach using initial laparoscopic release and subsequent stent placement and bypass surgery provides symptom improvement in most patients treated for MALS. The

  2. Understanding Fish Linear Acceleration Using an Undulatory Biorobotic Model with Soft Fluidic Elastomer Actuated Morphing Median Fins.

    Science.gov (United States)

    Wen, Li; Ren, Ziyu; Di Santo, Valentina; Hu, Kainan; Yuan, Tao; Wang, Tianmiao; Lauder, George V

    2018-04-10

    Although linear accelerations are an important common component of the diversity of fish locomotor behaviors, acceleration is one of the least-understood aspects of propulsion. Analysis of acceleration behavior in fishes with both spiny and soft-rayed median fins demonstrates that fin area is actively modulated when fish accelerate. We implemented an undulatory biomimetic robotic fish model with median fins manufactured using multimaterial three-dimensional printing-a spiny-rayed dorsal fin, soft-rayed dorsal/anal fins, and a caudal fin-whose stiffnesses span three orders of magnitude. We used an array of fluidic elastomeric soft actuators to mimic the dorsal/anal inclinator and erector/depressor muscles of fish, which allowed the soft fins to be erected or folded within 0.3 s. We experimentally show that the biomimetic soft dorsal/anal fin can withstand external loading. We found that erecting the soft dorsal/anal fins significantly enhanced the linear acceleration rate, up to 32.5% over the folded fin state. Surprisingly, even though the projected area of the body (in the lateral plane) increased 16.9% when the median fins were erected, the magnitude of the side force oscillation decreased by 24.8%, which may have led to significantly less side-to-side sway in the robotic swimmer. Visualization of fluid flow in the wake of median fins reveals that during linear acceleration, the soft dorsal fin generates a wake flow opposite in direction to that of the caudal fin, which creates propulsive jets with time-variant circulations and jet angles. Erectable/foldable fins provide a new design space for bioinspired underwater robots with structures that morph to adapt to different locomotor behaviors. This biorobotic fish model is also a potentially promising system for studying the dynamics of complex multifin fish swimming behaviors, including linear acceleration, steady swimming, and burst and coast, which are difficult to analyze in freely swimming fishes.

  3. Effect of Dietary Omega-3 Polyunsaturated Fatty Acids on Heart Rate and Heart Rate Variability in Animals Susceptible or Resistant to Ventricular Fibrillation

    Directory of Open Access Journals (Sweden)

    George E Billman

    2012-03-01

    Full Text Available The consumption of omega-3 polyunsaturated fatty acids (n-3 PUFAs has been reported to reduce cardiac mortality following myocardial infarction as well as to decrease resting heart rate (HR and increase heart rate variability (HRV. However, it has not been established whether n-3 PUFAs exhibit the same actions on HR and HRV in individuals known to be either susceptible or resistant to ventricular fibrillation (VF. Therefore, HR and HRV (high frequency and total R-R interval variability were evaluated before and 3 months after n-3 PUFA treatment in dogs with healed myocardial infarction that were either susceptible (VF+, n = 31 or resistant (VF-, n = 31 to ventricular tachyarrhythmias induced by a 2 min coronary artery occlusion during the last minute of a submaximal exercise test. HR and HRV were evaluated at rest, during submaximal exercise and in response to acute myocardial ischemia at rest before and after either placebo (1 g/day, corn oil, VF+, n = 9; VF- n = 8 or n-3 PUFA (docosahexaenoic acid + eicosapentaenoic acid ethyl esters, 1-4g/day, VF+, n = 22; VF-, n = 23 treatment for 3 months. The n-3 PUFA treatment elicited similar increases in red blood cell membrane, right atrial, and left ventricular n-3 PUFA levels in both the VF+ and VF- dogs. The n-3 PUFA treatment also provoked similar reductions in baseline HR and increases in baseline HRV in both groups that resulted in parallel shifts in the response to either exercise or acute myocardial ischemia (that is, the change in these variables induced by physiological challenges was not altered after n-3 PUFA treatment. These data demonstrate that dietary n-3 PUFA decreased HR and increased HRV to a similar extent in animals known to be prone to or resistant to malignant cardiac tachyarrhythmias.

  4. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  5. Functional connectivity of the dorsal and median raphe nuclei at rest

    DEFF Research Database (Denmark)

    Beliveau, Vincent; Svarer, Claus; Frokjaer, Vibe G

    2015-01-01

    Serotonin (5-HT) is a neurotransmitter critically involved in a broad range of brain functions and implicated in the pathophysiology of neuropsychiatric illnesses including major depression, anxiety and sleep disorders. Despite being widely distributed throughout the brain, there is limited...... knowledge on the contribution of 5-HT to intrinsic brain activity. The dorsal raphe (DR) and median raphe (MR) nuclei are the source of most serotonergic neurons projecting throughout the brain and thus provide a compelling target for a seed-based probe of resting-state activity related to 5-HT. Here we...... implemented a novel multimodal neuroimaging approach for investigating resting-state functional connectivity (FC) between DR and MR and cortical, subcortical and cerebellar target areas. Using [(11)C]DASB positron emission tomography (PET) images of the brain serotonin transporter (5-HTT) combined...

  6. Predictors of having a resistance test following confirmed virological failure of combination antiretroviral therapy: data from EuroSIDA

    DEFF Research Database (Denmark)

    Fox, Zoe V; Cozzi-Lepri, Alessandro; D'Arminio Monforte, Antonella

    2011-01-01

    these recommendations. Methods: In EuroSIDA, virological failure (VF) was defined as confirmed VL>1,000 copies/ml after =4 months continuous use of any antiretroviral in a =3-drug regimen started during or after 2002. We assessed whether a resistance test was performed around VF (from 4 months before to 1 year after VF...

  7. Dose dependency of the frequency of micronucleated binucleated clone cells and of division related median clone sizes difference. Pt. 2

    International Nuclear Information System (INIS)

    Hagemann, G,; Kreczik, A.; Treichel, M.

    1996-01-01

    Following irradiation of the progenitor cells the clone growth of CHO cells decreases as a result of cell losses. Lethally acting expressions of micronuclei are produced by heritable lethal mutations. The dependency of the frequency of micronucleated binucleated clone cells and of the median clone sizes difference on the radiation dose was measured and compared to non-irradiated controls. Using the cytokinesis-block-micronucleus-method binucleated cells with micronuclei were counted as ratio of all binucleated cells within a clone size distribution. This ratio (shortened: micronucleus yield) was determined for all clone size distributions, which had been exposed to different irradiation doses and incubation times. The micronucleus yields were compared to the corresponding median clone sizes differences. The micronucleus yield is linearly dependent on the dose and is independent of the incubation time. The same holds true for the division related median clone sizes difference, which as a result is also linearly dependent on the micronucleus yield. Due to the inevitably errors of the cell count of micronucleated binucleated cells, an automatic measurement of the median clone sizes differences is the preferred method for evaluation of cellular radiation sensitivity for heritable lethal mutations. This value should always be determined in addition, if clone survival fractions are used as predictive test because it allows for an estimation of the remission probability of surviving cells. (orig.) [de

  8. The Effectiveness of A School-Based Nutrition Intervention on Children's Fruit, Vegetables, and Dairy Product Intake.

    Science.gov (United States)

    Drapeau, Vicky; Savard, Mathieu; Gallant, Annette; Nadeau, Luc; Gagnon, Jocelyn

    2016-05-01

    Most Canadian children do not meet daily recommendations for consumption of vegetables and fruits (V/F) and dairy products (DP). The aim of this study was to evaluate the impact of Team Nutriathlon on V/F and DP consumption of children. Participants were 404 children from grades 5 and 6 (intervention group [IG] N = 242, control group [CG] N = 162). Teams of children were guided to increase their consumption and variety of V/F and DP over an 8-week period. Daily servings of V/F and DP were compared between groups at 4 time points: baseline (week 0), during (week 6), immediately after (week 9 or 10), and a follow-up 10 weeks after (week 20) the intervention. During and after the program and at follow-up, children in the IG consumed more servings of V/F and DP compared to the CG (group × time, p .05). Team Nutriathlon is an innovative school-based nutrition program that can help to increase the V/F and DP consumption of children. © 2016, American School Health Association.

  9. Improvement of Screening Accuracy of Mini-Mental State Examination for Mild Cognitive Impairment and Non-Alzheimer's Disease Dementia by Supplementation of Verbal Fluency Performance.

    Science.gov (United States)

    Kim, Jee Wook; Lee, Dong Young; Seo, Eun Hyun; Sohn, Bo Kyung; Choe, Young Min; Kim, Shin Gyeom; Park, Shin Young; Choo, Il Han; Youn, Jong Chul; Jhoo, Jin Hyeong; Kim, Ki Woong; Woo, Jong Inn

    2014-01-01

    THIS STUDY AIMED TO INVESTIGATE WHETHER THE SUPPLEMENTATION OF VERBAL FLUENCY: Animal category test (VF) performance can improve the screening ability of Mini-Mental State Examination (MMSE) for mild cognitive impairment (MCI), dementia and their major subtypes. Six hundred fifty-five cognitively normal (CN), 366 MCI [282 amnestic MCI (aMCI); 84 non-amnestic MCI (naMCI)] and 494 dementia [346 Alzheimer's disease (AD); and 148 non-Alzheimer's disease dementia (NAD)] individuals living in the community were included (all aged 50 years and older) in the study. The VF-supplemented MMSE (MMSE+VF) score had a significantly better screening ability for MCI, dementia and overall cognitive impairment (MCI plus dementia) than the MMSE raw score alone. MMSE+VF showed a significantly better ability than MMSE for both MCI subtypes, i.e., aMCI and naMCI. In the case of dementia subtypes, MMSE+VF was better than the MMSE alone for NAD screening, but not for AD screening. The results support the usefulness of VF-supplementation to improve the screening performance of MMSE for MCI and NAD.

  10. Detection of Life Threatening Ventricular Arrhythmia Using Digital Taylor Fourier Transform.

    Science.gov (United States)

    Tripathy, Rajesh K; Zamora-Mendez, Alejandro; de la O Serna, José A; Paternina, Mario R Arrieta; Arrieta, Juan G; Naik, Ganesh R

    2018-01-01

    Accurate detection and classification of life-threatening ventricular arrhythmia episodes such as ventricular fibrillation (VF) and rapid ventricular tachycardia (VT) from electrocardiogram (ECG) is a challenging problem for patient monitoring and defibrillation therapy. This paper introduces a novel method for detection and classification of life-threatening ventricular arrhythmia episodes. The ECG signal is decomposed into various oscillatory modes using digital Taylor-Fourier transform (DTFT). The magnitude feature and a novel phase feature namely the phase difference (PD) are evaluated from the mode Taylor-Fourier coefficients of ECG signal. The least square support vector machine (LS-SVM) classifier with linear and radial basis function (RBF) kernels is employed for detection and classification of VT vs. VF, non-shock vs. shock and VF vs. non-VF arrhythmia episodes. The accuracy, sensitivity, and specificity values obtained using the proposed method are 89.81, 86.38, and 93.97%, respectively for the classification of Non-VF and VF episodes. Comparison with the performance of the state-of-the-art features demonstrate the advantages of the proposition.

  11. The Effect of Combination of Video Feedback and Audience Feedback on Social Anxiety: Preliminary Findings.

    Science.gov (United States)

    Chen, Junwen; Mak, Rebecca; Fujita, Satoko

    2015-09-01

    Although video feedback (VF) is shown to improve appraisals of social performance in socially anxious individuals, its impact on state anxiety during a social situation is mixed. The current study investigated the effect of combined video feedback and audience feedback (AF) on self-perceptions of performance and bodily sensations as well as state anxiety pertaining to a speech task. Forty-one socially anxious students were randomly allocated to combined video feedback with audience feedback (VF + AF), video feedback only (VF), audience feedback only (AF), or a control condition. Following a 3-min speech, participants in the VF + AF, VF, and AF conditions watched the videotape of their speech with cognitive preparation in the presence of three confederates who served as audience, and/or received feedback from the confederates, while the control group watched their videotaped speech without cognitive preparation. Both VF + AF and AF conditions improved distorted appraisal of performance and bodily sensations as well as state anxiety. The clinical implications of these findings are discussed. © The Author(s) 2015.

  12. Long-term results of radiotherapy in the treatment of pituitary adenomas in children and adolescents

    Energy Technology Data Exchange (ETDEWEB)

    Grigsby, P.W.; Thomas, P.R.; Simpson, J.R.; Fineberg, B.B.

    1988-12-01

    A retrospective review was performed of 11 children and adolescents (less than 19 years of age) with diagnosed pituitary adenomas. The patients were treated with subtotal resection and postoperative irradiation (S + R) or with irradiation alone (RT) at the Radiation Oncology Center, Mallinckrodt Institute of Radiology, Washington University Medical Center, from January 1958 through December 1982. Patient conditions at diagnosis were acromegaly in one, Nelson's syndrome in one, prolactinoma in three, chromophobe adenoma in three, and Cushing's disease in three. Median follow-up was 15.6 years (range 6.3-29.5 years). Only two patients have had failure: one at 8.6 years and the other at 20.7 years following treatment. All four patients with visual field (VF) defects at diagnosis underwent S + R, with only one developing recurrent disease. The remaining seven patients, who did not have VF defects, received RT only, and there has been one failure in this group. None have suffered long-term visual complications. All have been able to continue school and/or work. Three of eight females have borne children. Hypopituitarism requiring medication occurred in all who received S + R and in four of seven who received RT only.

  13. Enhancement of Visual Field Predictions with Pointwise Exponential Regression (PER) and Pointwise Linear Regression (PLR).

    Science.gov (United States)

    Morales, Esteban; de Leon, John Mark S; Abdollahi, Niloufar; Yu, Fei; Nouri-Mahdavi, Kouros; Caprioli, Joseph

    2016-03-01

    The study was conducted to evaluate threshold smoothing algorithms to enhance prediction of the rates of visual field (VF) worsening in glaucoma. We studied 798 patients with primary open-angle glaucoma and 6 or more years of follow-up who underwent 8 or more VF examinations. Thresholds at each VF location for the first 4 years or first half of the follow-up time (whichever was greater) were smoothed with clusters defined by the nearest neighbor (NN), Garway-Heath, Glaucoma Hemifield Test (GHT), and weighting by the correlation of rates at all other VF locations. Thresholds were regressed with a pointwise exponential regression (PER) model and a pointwise linear regression (PLR) model. Smaller root mean square error (RMSE) values of the differences between the observed and the predicted thresholds at last two follow-ups indicated better model predictions. The mean (SD) follow-up times for the smoothing and prediction phase were 5.3 (1.5) and 10.5 (3.9) years. The mean RMSE values for the PER and PLR models were unsmoothed data, 6.09 and 6.55; NN, 3.40 and 3.42; Garway-Heath, 3.47 and 3.48; GHT, 3.57 and 3.74; and correlation of rates, 3.59 and 3.64. Smoothed VF data predicted better than unsmoothed data. Nearest neighbor provided the best predictions; PER also predicted consistently more accurately than PLR. Smoothing algorithms should be used when forecasting VF results with PER or PLR. The application of smoothing algorithms on VF data can improve forecasting in VF points to assist in treatment decisions.

  14. MR neurography of the median nerve at 3.0 T: Optimization of diffusion tensor imaging and fiber tractography

    International Nuclear Information System (INIS)

    Guggenberger, Roman; Eppenberger, Patrick; Markovic, Daniel; Nanz, Daniel; Chhabra, Avneesh; Pruessmann, Klaas P.; Andreisek, Gustav

    2012-01-01

    Objectives: The purpose of this study was to systematically assess the optimal b-value and reconstruction parameters for DTI and fiber tractography of the median nerve at 3.0 T. Methods: Local ethical board approved study with 45 healthy volunteers (15 men, 30 women; mean age, 41 ± 3.4 years) who underwent DTI of the right wrist at 3.0 T. A single-shot echo-planar-imaging sequence (TR/TE 10123/40 ms) was acquired at four different b-values (800, 1000, 1200, and 1400 s/mm 2 ). Two independent readers performed post processing and fiber-tractography. Fractional anisotropy (FA) maps were calculated. Fiber tracts of the median nerve were generated using four different algorithms containing different FA thresholds and different angulation tolerances. Data were evaluated quantitatively and qualitatively. Results: Tracking algorithms using a minimum FA threshold of 0.2 and a maximum angulation of 10° were significantly better than other algorithms. Fiber tractography generated significantly longer fibers in DTI acquisitions with higher b-values (1200 and 1400 s/mm 2 versus 800 s/mm 2 ; p 2 (p 2 for DTI of the median nerve at 3.0 T. Optimal reconstruction parameters for fiber tractography should encompass a minimum FA threshold of 0.2 and a maximum angulation tolerance of 10.

  15. Drift wave stabilized by an additional streaming ion or plasma population

    Science.gov (United States)

    Bashir, M. F.; Vranjes, J.

    2015-03-01

    It is shown that the universally unstable kinetic drift wave in an electron-ion plasma can very effectively be suppressed by adding an extra flowing ion (or plasma) population. The effect of the flow of the added ions is essential, their response is of the type (vp h-vf 0) exp[-(vph-vf 0) 2] , where vf 0 is the flow speed and vp h is the phase speed parallel to the magnetic field vector. The damping is strong and it is mainly due to this ion exponential term, and this remains so for vf 0

  16. Patient-centric Blood Pressure–targeted Cardiopulmonary Resuscitation Improves Survival from Cardiac Arrest

    Science.gov (United States)

    Friess, Stuart H.; Naim, Maryam Y.; Lampe, Joshua W.; Bratinov, George; Weiland, Theodore R.; Garuccio, Mia; Nadkarni, Vinay M.; Becker, Lance B.; Berg, Robert A.

    2014-01-01

    Rationale: Although current resuscitation guidelines are rescuer focused, the opportunity exists to develop patient-centered resuscitation strategies that optimize the hemodynamic response of the individual in the hopes to improve survival. Objectives: To determine if titrating cardiopulmonary resuscitation (CPR) to blood pressure would improve 24-hour survival compared with traditional CPR in a porcine model of asphyxia-associated ventricular fibrillation (VF). Methods: After 7 minutes of asphyxia, followed by VF, 20 female 3-month-old swine randomly received either blood pressure–targeted care consisting of titration of compression depth to a systolic blood pressure of 100 mm Hg and vasopressors to a coronary perfusion pressure greater than 20 mm Hg (BP care); or optimal American Heart Association Guideline care consisting of depth of 51 mm with standard advanced cardiac life support epinephrine dosing (Guideline care). All animals received manual CPR for 10 minutes before first shock. Primary outcome was 24-hour survival. Measurements and Main Results: The 24-hour survival was higher in the BP care group (8 of 10) compared with Guideline care (0 of 10); P = 0.001. Coronary perfusion pressure was higher in the BP care group (point estimate +8.5 mm Hg; 95% confidence interval, 3.9–13.0 mm Hg; P < 0.01); however, depth was higher in Guideline care (point estimate +9.3 mm; 95% confidence interval, 6.0–12.5 mm; P < 0.01). Number of vasopressor doses before first shock was higher in the BP care group versus Guideline care (median, 3 [range, 0–3] vs. 2 [range, 2–2]; P = 0.003). Conclusions: Blood pressure–targeted CPR improves 24-hour survival compared with optimal American Heart Association care in a porcine model of asphyxia-associated VF cardiac arrest. PMID:25321490

  17. The Significance of HIV ‘Blips’ in Resource-Limited Settings: Is It the Same? Analysis of the Treat Asia HIV Observational Database (TAHOD) and the Australian HIV Observational Database (AHOD)

    Science.gov (United States)

    Kanapathipillai, Rupa; McManus, Hamish; Kamarulzaman, Adeeba; Lim, Poh Lian; Templeton, David J.; Law, Matthew; Woolley, Ian

    2014-01-01

    Introduction Magnitude and frequency of HIV viral load blips in resource-limited settings, has not previously been assessed. This study was undertaken in a cohort from a high income country (Australia) known as AHOD (Australian HIV Observational Database) and another cohort from a mixture of Asian countries of varying national income per capita, TAHOD (TREAT Asia HIV Observational Database). Methods Blips were defined as detectable VL (≥ 50 copies/mL) preceded and followed by undetectable VL (failure (VF) was defined as two consecutive VL ≥50 copies/ml. Cox proportional hazard models of time to first VF after entry, were developed. Results 5040 patients (AHOD n = 2597 and TAHOD n = 2521) were included; 910 (18%) of patients experienced blips. 744 (21%) and 166 (11%) of high- and middle/low-income participants, respectively, experienced blips ever. 711 (14%) experienced blips prior to virological failure. 559 (16%) and 152 (10%) of high- and middle/low-income participants, respectively, experienced blips prior to virological failure. VL testing occurred at a median frequency of 175 and 91 days in middle/low- and high-income sites, respectively. Longer time to VF occurred in middle/low income sites, compared with high-income sites (adjusted hazards ratio (AHR) 0.41; pfailure (p = 0.360 for blip 50–≤1000, p = 0.309 for blip 50–≤400 and p = 0.300 for blip 50–≤200). 209 of 866 (24%) patients were switched to an alternate regimen in the setting of a blip. Conclusion Despite a lower proportion of blips occurring in low/middle-income settings, no significant difference was found between settings. Nonetheless, a substantial number of participants were switched to alternative regimens in the setting of blips. PMID:24516527

  18. Callosal involvement in a lateralized stroop task in alcoholic and healthy subjects.

    Science.gov (United States)

    Schulte, T; Müller-Oehring, E M; Salo, R; Pfefferbaum, A; Sullivan, E V

    2006-11-01

    To investigate the role of interhemispheric attentional processes, 25 alcoholic and 28 control subjects were tested with a Stroop match-to-sample task and callosal areas were measured with magnetic resonance imaging. Stroop color-word stimuli were presented to the left or right visual field (VF) and were preceded by a color cue that did or did not match the word's color. For matching colors, both groups showed a right VF advantage; for nonmatching colors, controls showed a left VF advantage, whereas alcoholic subjects showed no VF advantage. For nonmatch trials, VF advantage correlated with callosal splenium area in controls but not alcoholic subjects, supporting the position that information presented to the nonpreferred hemisphere is transmitted via the splenium to the hemisphere specialized for efficient processing. The authors speculate that alcoholism-associated callosal thinning disrupts this processing route.

  19. Sosiaalisen median strategian jalkauttaminen : Facebook Merikeskus Vellamon markkinointiviestinnän välineenä

    OpenAIRE

    Okulov, Jaana

    2013-01-01

    Tämä opinnäytetyö käsittelee museokeskus Merikeskus Vellamon sosiaalisen median strategian jalkauttamista ja Facebook-yhteisösovelluksen hyödyntämistä markkinointiviestinnässä. Facebook-yrityssivun perustaminen ja houkuttelevan kohderyhmäkohtaisen sisällöntuotannon oppiminen oli toimeksiantajan toiveesta operatiivisen suunnittelun pohjana tälle toiminnalliselle opinnäytetyölle. Teoriaosuudessa tutkittiin sosiaalista mediaa ilmiönä ja vuorovaikutteisena viestintäkanavana sekä Facebook-yh...

  20. Efficient Architecture and Implementation of Vector Median Filter in Co-Design Context

    Directory of Open Access Journals (Sweden)

    N. Masmoudi

    2007-09-01

    Full Text Available This work presents an efficient fast parallel architecture of the Vector Median Filter (VMF using combined hardware/software (HW/SW implementation. The hardware part of the system is implemented using VHDL language, whereas the software part is developed using C/C++ language. The software part of the embedded system uses the NIOS-II softcore processor and the operating system used is μClinux. The comparison between the software and HW/SW solutions shows that adding a hardware part in the design attempts to speed up the filtering process compared to the software solution. This efficient embedded system implementation can perform well in several image processing applications.

  1. Long-term follow-up for efficacy and safety of treatment of retinitis pigmentosa with valproic acid.

    Science.gov (United States)

    Bhalla, Sheena; Joshi, Deval; Bhullar, Shaminder; Kasuga, Daniel; Park, Yeonhee; Kay, Christine N

    2013-07-01

    The purpose of this study was to determine the long-term efficacy and safety of valproic acid (VPA) treatment in patients with pigmentary retinal dystrophies. A retrospective chart review was conducted on 31 patients with a diagnosis of pigmentary retinal dystrophy prescribed VPA at a single centre. Visual field (VF), visual acuity (VA), length of treatment, liver enzymes and side effects were analysed. VF areas were defined using Goldmann VF (GVF) tracings recorded before, during and after VPA treatment using the V4e isopter for each eye. Using custom software, planimetric areas of VF were calculated. Five of the patients (10 eyes) had two Goldmann VF tracings, allowing comparison between baseline and follow-up VF. After 9.8 months of VPA, VF decreased by 0.145 cm(2) (26.478%) (p=0.432). For 22 of the patients (41 eyes), VA data was available, and logarithm of the minimum angle of resolution (logMAR) score changed by 0.056 log units (representing a decline in VA) after 14.9 months on VPA (p=0.002). Twelve patients (38.7%) reported negative side effects related to VPA use. VPA plays a complex role in patients with pigmentary retinal dystrophies and may be associated with VA and field decline as well as adverse side effects. Physicians should use caution with using VPA for pigmentary retinal dystrophies.

  2. A Divergence Median-based Geometric Detector with A Weighted Averaging Filter

    Science.gov (United States)

    Hua, Xiaoqiang; Cheng, Yongqiang; Li, Yubo; Wang, Hongqiang; Qin, Yuliang

    2018-01-01

    To overcome the performance degradation of the classical fast Fourier transform (FFT)-based constant false alarm rate detector with the limited sample data, a divergence median-based geometric detector on the Riemannian manifold of Heimitian positive definite matrices is proposed in this paper. In particular, an autocorrelation matrix is used to model the correlation of sample data. This method of the modeling can avoid the poor Doppler resolution as well as the energy spread of the Doppler filter banks result from the FFT. Moreover, a weighted averaging filter, conceived from the philosophy of the bilateral filtering in image denoising, is proposed and combined within the geometric detection framework. As the weighted averaging filter acts as the clutter suppression, the performance of the geometric detector is improved. Numerical experiments are given to validate the effectiveness of our proposed method.

  3. Least median of squares filtering of locally optimal point matches for compressible flow image registration

    International Nuclear Information System (INIS)

    Castillo, Edward; Guerrero, Thomas; Castillo, Richard; White, Benjamin; Rojo, Javier

    2012-01-01

    Compressible flow based image registration operates under the assumption that the mass of the imaged material is conserved from one image to the next. Depending on how the mass conservation assumption is modeled, the performance of existing compressible flow methods is limited by factors such as image quality, noise, large magnitude voxel displacements, and computational requirements. The Least Median of Squares Filtered Compressible Flow (LFC) method introduced here is based on a localized, nonlinear least squares, compressible flow model that describes the displacement of a single voxel that lends itself to a simple grid search (block matching) optimization strategy. Spatially inaccurate grid search point matches, corresponding to erroneous local minimizers of the nonlinear compressible flow model, are removed by a novel filtering approach based on least median of squares fitting and the forward search outlier detection method. The spatial accuracy of the method is measured using ten thoracic CT image sets and large samples of expert determined landmarks (available at www.dir-lab.com). The LFC method produces an average error within the intra-observer error on eight of the ten cases, indicating that the method is capable of achieving a high spatial accuracy for thoracic CT registration. (paper)

  4. SMART_PV: A SOFTWARE APPLICATION FOR MANAGING ENGLISH PHRASAL VERBS SMART_PV: UNA APLICACIÓN DE SOFTWARE PARA LA GESTIÓN DE VERBOS FRASALES EN INGLÉS

    Directory of Open Access Journals (Sweden)

    Bell Manrique Losada

    2012-12-01

    Full Text Available Phrasal verbs (PVs are lexical units consisting of a verb and one or two particles. In this paper we present a characterization of English PVs. This characterization serves as the backbone for our web application called Smart_PV. The purpose of Smart_PV is twofold: i to allow the input of PVs and ii to detect PVs in texts. We designed web interfaces to register the PVs with their features and to detect PVs in the texts as follows: the user enters the text and starts the PVs detection process by splitting the text into words. Smart_PV was validated inserting 80 PVs (including the 25 most common PVs in documents of the European Union and detecting PVs in texts from different domains. Our results show the expediency of this kind of applications for teachers, students, translators, and common users, as a tool to support translation and text mining tasks. Although a database with more PVs and the analysis of more documents are required, our results demonstrate the feasibility and usefulness of our application.Los verbos frasales (VF son unidades léxicas conformadas por un verbo y una o dos partículas. En este artículo se presenta una caracterización para los VF en inglés, la cual es usada como eje principal de una aplicación web para VF llamada Smart_PV. El objetivo de Smart_PV es doble: i permitir el ingreso de VF, y ii detectar VF en textos. Se diseñaron interfaces web para ingresar los VF con sus características y para detectarlos en textos así: el usuario ingresa un texto y comienza el proceso de detección de VF dividiendo el texto en palabras. Smart_PV fue validada insertando 80 VF (incluyendo los 25 VF más comunes en documentos de la Unión Europea, y detectando VF en textos de diferentes dominios. Los resultados muestran la conveniencia de este tipo de aplicaciones para profesores, estudiantes, traductores y usuarios comunes como apoyo en tareas de traducción y minería de textos. Aunque es deseable una base de datos con más VF y

  5. The Impact of Change in Visual Field on Health-Related Quality of Life: The Los Angeles Latino Eye Study

    Science.gov (United States)

    Patino, Cecilia M.; Varma, Rohit; Azen, Stanley P.; Conti, David V.; Nichol, Michael B.; McKean-Cowdin, Roberta

    2010-01-01

    Purpose To assess the impact of change in visual field (VF) on change in health related quality of life (HRQoL) at the population level. Design Prospective cohort study Participants 3,175 Los Angles Latino Eye Study (LALES) participants Methods Objective measures of VF and visual acuity and self-reported HRQoL were collected at baseline and 4-year follow-up. Analysis of covariance was used to evaluate mean differences in change of HRQoL across severity levels of change in VF and to test for effect modification by covariates. Main outcome measures General and vision-specific HRQoL. Results Of 3,175 participants, 1430 (46%) showed a change in VF (≥1 decibel [dB]) and 1651, 1715 (54%) reported a clinically important change (≥5 points) in vision-specific HRQoL. Progressive worsening and improvement in the VF were associated with increasing losses and gains in vision-specific HRQoL for the composite score and 10 of its 11 subscales (all Ptrends 5 dB and gains > 3 dB were associated with clinically meaningful losses and gains in vision-specific HRQoL, respectively. Areas of vision-specific HRQoL most affected by greater losses in VF were driving, dependency, role-functioning, and mental health. The effect of change in VF (loss or gain) on mean change in vision-specific HRQoL varied by level of baseline vision loss (in visual field and/or visual acuity) and by change in visual acuity (all P-interactions 5 dB loss in visual field during the study period had a mean loss of vision-specific HRQoL of 11.3 points, while those with no VF loss at baseline had a mean loss of 0.97 points Similarly, with a > 5 dB loss in VF and baseline visual acuity impairment (mild/severe) there was a loss in vision-specific HRQoL of 10.5 points, whereas with no visual acuity impairment at baseline there was a loss of vision-specific HRQoL of 3.7 points. Conclusion Both losses and gains in VF produce clinically meaningful changes in vision-specific HRQoL. In the presence of pre-existing vision

  6. Evaluation of a novel median power spectrogram for seizure detection by non-neurophysiologists.

    Science.gov (United States)

    Yan, Peter; Melman, Tamar; Yan, Sherry; Otgonsuren, Munkhzul; Grinspan, Zachary

    2017-08-01

    (1) To evaluate how well resident physicians use a novel EEG spectral analysis tool (the median power spectrogram; MPS) to detect seizures. (2) To assess the capability of the MPS to identify different seizure types. 120 EEG records from children with intractable seizures were converted to MPS by taking the median power across leads and using multi-taper spectral estimation. Twelve blinded neurology residents were trained to interpret the spectrogram with a five-minute video tutorial and post-test. Two residents independently assessed each set for presence of seizures. Their performance was compared to seizures identified using conventional EEG. Two blinded neurologists separately reviewed the EEGs and spectrograms to independently categorize the seizures. Their results were used to determine the spectrogram's capability to reveal seizures and visualize different seizure types for the user. Three key MPS features distinguished seizures from inter-ictal background: power difference relative to background, down-sloping resonance bands, and power in high frequencies. Using these features, residents identified seizures with 77% sensitivity and 72% specificity. 86% (51/59) of focal seizures and 81% (22/27) of generalized seizures were detected by at least one resident. Missed seizures included brief (seizures, tonic seizures, seizures with predominant delta (0-4Hz) activity, and seizures evident primarily in supplementary low temporal leads. The MPS is a novel qEEG modality that requires minimal training to interpret. It enables physicians without extensive neurophysiology training to identify seizures with sensitivity and specificity comparable to more complex multi-modal qEEG displays. Copyright © 2017 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  7. Manual therapy intervention in the treatment of patients with carpal tunnel syndrome: median nerve mobilization versus medical treatment

    Directory of Open Access Journals (Sweden)

    Faten I Mohamed

    2016-01-01

    Conclusion CTS improves after median nerve mobilization, which is better than conventional medical treatment. It provides support for the use of manual therapy in conservative management of CTS with satisfactory Results .

  8. Income Inequality, the Median Voter, and the Support for Public Education. NBER Working Paper No. 16097

    Science.gov (United States)

    Corcoran, Sean; Evans, William N.

    2010-01-01

    Using a panel of U.S. school districts spanning 1970-2000, we examine the relationship between income inequality and fiscal support for public education. In contrast with recent theoretical and empirical work suggesting a negative relationship between inequality and public spending, we find results consistent with a median voter model, in which…

  9. KEHONKUVA JA MEDIA : 9.-luokkalaisten tyttöjen kehonkuva ja median vaikutus siihen

    OpenAIRE

    Vainionpää, Charlotta; Koski, Riikka

    2016-01-01

    Tämän tutkimuksen aiheena oli kehonkuva ja media: 9.-luokkalaisten tyttöjen kehonkuva ja median vaikutus siihen. Tutkimuksen tarkoituksena oli selvittää minkälaisena tytöt kokevat oman kehonkuvansa, minkälaisia ulkonäköpaineita tytöillä on ja miten media vaikuttaa heidän kehonkuvaansa. Työn teoreettisessa viitekehyksessä pääkäsitteet olivat nuoruus, kehonkuva ja media. Nuoruus-osiossa käsiteltiin nuoruuden määrittelyn lisäksi murrosikää ja murrosiän fyysisiä sekä psyykkisiä muutoksia. Keh...

  10. Vape Factor Fast Find-Adult (VF3-A): a prototype survey method for recording brand-specific vaping factors in adult populations.

    Science.gov (United States)

    Ross, Craig S; Zhang, Tancy C; DeJong, William; Siegel, Michael

    2018-03-23

    In population studies, vaping is often treated as a dichotomous exposure (present/absent) without consideration of specific vaping devices and materials being used. A survey instrument is needed to record specific vaping devices and materials. We developed a database of 613 vaping device models and 3196 vaping liquid products, indexed by device brand, device type, liquid brand, liquid name and liquid flavour type. We developed a survey instrument to allow participants to report their vaping device and liquid from the indexed lists. The survey was pilot tested with a convenience sample of 208 adults (≥age 21). We validated the vaping device and liquid responses with a recontact survey. We report the proportion of respondents finding their products, characteristics of people finding their products and survey response times. Devices used most frequently in the past 30 days were electronic cigarettes (33% of respondents), vaping pens (28%) and vaping mods (16%). Fifty-seven per cent used liquids containing nicotine most frequently in the past 30 days, followed by liquids without nicotine (20%) and marijuana or hashish (10%). Most (85%) participants found their vaping device successfully (median 19.7 s) and 74% found their vaping liquid (median 19.8 s). Females and older adults were less likely to find their devices and liquids. Responses were validated for 91% and 76% of devices and e-liquids, respectively. This study demonstrated the feasibility of an internet-based survey instrument to record specific vaping factors for use in studies of vaping and health. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  11. Accelerated magnetic resonance diffusion tensor imaging of the median nerve using simultaneous multi-slice echo planar imaging with blipped CAIPIRINHA.

    Science.gov (United States)

    Filli, Lukas; Piccirelli, Marco; Kenkel, David; Boss, Andreas; Manoliu, Andrei; Andreisek, Gustav; Bhat, Himanshu; Runge, Val M; Guggenberger, Roman

    2016-06-01

    To investigate the feasibility of MR diffusion tensor imaging (DTI) of the median nerve using simultaneous multi-slice echo planar imaging (EPI) with blipped CAIPIRINHA. After federal ethics board approval, MR imaging of the median nerves of eight healthy volunteers (mean age, 29.4 years; range, 25-32) was performed at 3 T using a 16-channel hand/wrist coil. An EPI sequence (b-value, 1,000 s/mm(2); 20 gradient directions) was acquired without acceleration as well as with twofold and threefold slice acceleration. Fractional anisotropy (FA), mean diffusivity (MD) and quality of nerve tractography (number of tracks, average track length, track homogeneity, anatomical accuracy) were compared between the acquisitions using multivariate ANOVA and the Kruskal-Wallis test. Acquisition time was 6:08 min for standard DTI, 3:38 min for twofold and 2:31 min for threefold acceleration. No differences were found regarding FA (standard DTI: 0.620 ± 0.058; twofold acceleration: 0.642 ± 0.058; threefold acceleration: 0.644 ± 0.061; p ≥ 0.217) and MD (standard DTI: 1.076 ± 0.080 mm(2)/s; twofold acceleration: 1.016 ± 0.123 mm(2)/s; threefold acceleration: 0.979 ± 0.153 mm(2)/s; p ≥ 0.074). Twofold acceleration yielded similar tractography quality compared to standard DTI (p > 0.05). With threefold acceleration, however, average track length and track homogeneity decreased (p = 0.004-0.021). Accelerated DTI of the median nerve is feasible. Twofold acceleration yields similar results to standard DTI. • Standard DTI of the median nerve is limited by its long acquisition time. • Simultaneous multi-slice acquisition is a new technique for accelerated DTI. • Accelerated DTI of the median nerve yields similar results to standard DTI.

  12. Evaluation of Visual Field Test Parameters after Artificial Tear Administration in Patients with Glaucoma and Dry Eye.

    Science.gov (United States)

    Özyol, Pelin; Özyol, Erhan; Karalezli, Aylin

    2018-01-01

    To examine the effect of a single dose of artificial tear administration on automated visual field (VF) testing in patients with glaucoma and dry eye syndrome. A total of 35 patients with primary open-angle glaucoma experienced in VF testing with symptoms of dry eye were enrolled in this study. At the first visit, standard VF testing was performed. At the second and third visits with an interval of one week, while the left eyes served as control, one drop of artificial tear was administered to each patient's right eye, and then VF testing was performed again. The reliability parameters, VF indices, number of depressed points at probability levels of pattern deviation plots, and test times were compared between visits. No significant difference was observed in any VF testing parameters of control eyes (P>0.05). In artificial tear administered eyes, significant improvement was observed in test duration, mean deviation, and the number of depressed points at probability levels (P˂0.5%, P˂1%, P˂2) of pattern deviation plots (P˂0.05). The post-hoc test revealed that artificial tear administration elicited an improvement in test duration, mean deviation, and the number of depressed points at probability levels (P˂0.5%, P˂1%, P˂2%) of pattern deviation plots from first visit to second and third visits (P˂0.01, for all comparisons). The intraclass correlation coefficient for the three VF test indices was found to be between 0.735 and 0.85 (P<0.001, for all). A single dose of artificial tear administration immediately before VF testing seems to improve test results and decrease test time.

  13. THE VELOCITY FUNCTION IN THE LOCAL ENVIRONMENT FROM ΛCDM AND ΛWDM CONSTRAINED SIMULATIONS

    International Nuclear Information System (INIS)

    Zavala, J.; Jing, Y. P.; Faltenbacher, A.; Yepes, G.; Hoffman, Y.; Gottloeber, S.; Catinella, B.

    2009-01-01

    Using constrained simulations of the local universe for generic cold dark matter (CDM) and for 1 keV warm dark matter (WDM), we investigate the difference in the abundance of dark matter halos in the local environment. We find that the mass function (MF) within 20 h -1 Mpc of the Local Group is ∼2 times larger than the universal MF in the 10 9 -10 13 h -1 M sun mass range. Imposing the field of view of the ongoing H I blind survey Arecibo Legacy Fast ALFA (ALFALFA) in our simulations, we predict that the velocity function (VF) in the Virgo-direction region (VdR) exceeds the universal VF by a factor of 3. Furthermore, employing a scheme to translate the halo VF into a galaxy VF, we compare the simulation results with a sample of galaxies from the early catalog release of ALFALFA. We find that our simulations are able to reproduce the VF in the 80-300 km s -1 velocity range, having a value ∼10 times larger than the universal VF in the VdR. In the low-velocity regime, 35-80 km s -1 , the WDM simulation reproduces the observed flattening of the VF. In contrast, the simulation with CDM predicts a steep rise in the VF toward lower velocities; for V max = 35 km s -1 , it forecasts ∼10 times more sources than the ones observed. If confirmed by the complete ALFALFA survey, our results indicate a potential problem for the CDM paradigm or for the conventional assumptions about energetic feedback in dwarf galaxies.

  14. Symptomatic ventricular tachyarrhythmia is associated with delayed gadolinium enhancement in cardiac magnetic resonance imaging and with elevated plasma brain natriuretic peptide level in hypertrophic cardiomyopathy

    International Nuclear Information System (INIS)

    Oka, Katsumi; Tsujino, Takeshi; Nakao, Shinji; Lee-Kawabata, Masaaki; Ezumi, Akira; Masai, Miho; Ohyanagi, Mitsumasa; Masuyama, Tohru

    2008-01-01

    Delayed gadolinium enhancement (DGE) in cardiac magnetic resonance (CMR) imaging indicates the areas with myocardial fibrosis, which are suggested to be arrhythmogenic substrate in hypertrophic cardiomyopathy (HCM). Elevated brain natriuretic peptide (BNP) is associated with cardiovascular events in HCM. We investigated the grade of DGE in CMR and plasma BNP levels in HCM patients with or without symptomatic ventricular tachycardia (VT) or ventricular fibrillation (VF). We recruited 26 consecutive untreated HCM patients without any symptoms of heart failure. They were divided into 2 groups: patients with symptomatic VT/VF [VT/VF (+) group, n=6]; patients without symptomatic VT/VF [VT/VF (-) group, n=20]. CMR was performed to evaluate left ventricular geometry and the grade of DGE. Plasma BNP levels, left ventricular mass index, and the number of segments with positive DGE were greater in the VT/VF (+) group than in the VT/VF (-) group (698.1±387.6 vs. 226.9±256.8 pg/ml, p=0.006; 152.3±49.5 vs. 89.5±24.1 g/m 2 , p=0.003; 9.7±5.7 vs. 3.5±3.3, p=0.013). On logistic regression, adjusted odds ratio for symptomatic VT/VF was 214 for log BNP (95% confidence interval [CI] 1.2-37,043, p=0.04) and 1.54 for DGE score (95% CI 1.01-2.34, p=0.04). High plasma BNP levels and the enlarged area of DGE in CMR were associated with symptomatic ventricular tachyarrhythmia. These factors may be useful markers for detecting high-risk patients of sudden cardiac death in HCM. (author)

  15. Bibliometric analysis of anaesthesia journal editorial board members: correlation between journal impact factor and the median h-index of its board members.

    Science.gov (United States)

    Pagel, P S; Hudetz, J A

    2011-09-01

    h-index is useful for quantifying scholarly activity in medicine, but this statistic has not been extensively applied as a measure of productivity in anaesthesia. We conducted a bibliometric analysis of h-index in editorial board members and tested the hypothesis that editorial board members of anaesthesia journals with higher impact factors (IFs) have higher h-indices. Ten of 19 journals with 2009 IF>1 were randomly chosen from Journal Citation Reports(®). Board members were identified using each journal's website. Publications, citations, citations per publication, and h-index for each member were obtained using Scopus(®). Four hundred and twenty-three individuals filled 481 anaesthesia editorial board positions. The median h-index of all editorial board members was 14. Board members published 75 papers (median) with 1006 citations and 13 citations per publication. Members serving on journals with IF greater than median had significantly (Pcitations, and citations per publication than those at journals with IF less than median. A significant correlation between the median h-index of a journal's editorial board members and its IF (h-index=3.01×IF+6.85; r( 2)=0.452; P=0.033) was observed for the 10 journals examined. Board members of subspeciality-specific journals had bibliometric indices that were less than those at general journals. The h-index was greater in individuals serving more than one journal. European editorial board members had higher h-index values than their American colleagues. The results suggest that editorial board members of anaesthesia journals with higher IFs have higher h-indices.

  16. Clinical and virologic outcomes after changes in first antiretroviral regimen at 7 sites in the Caribbean, Central and South America Network (CCASAnet)

    Science.gov (United States)

    Wolff, Marcelo; Shepherd, Bryan E.; Cortés, Claudia; Rebeiro, Peter; Cesar, Carina; Cardoso, Sandra Wagner; Pape, Jean W.; Padgett, Denis; Sierra-Madero, Juan; Echevarria, Juan; McGowan, Catherine C.

    2015-01-01

    Background HIV-infected persons in lower income countries may experience high rates of antiretroviral therapy (ART) change, particularly due to toxicity or other non-failure reasons. Few reports address patient outcomes after these modifications. Methods HIV-infected adults from 7 Caribbean, Central and South America network (CCASAnet) clinical cohorts who modified > or = 1 drug from first ART regimen (ART-1) for any reason thereby starting a second regimen (ART-2) were included. Results 5,565 ART-naïve HAART initiators started ART-2 after a median of 9.8 months on ART-1; 39% changed to ART-2 due to toxicity and 11% due to failure. Median follow-up after starting ART-2 was 2.9 years; 45% subsequently modified ART-2. Cumulative incidences of death at 1, 3, and 5 years after starting ART-2 were 5.1%, 8.4% and 10.5%, respectively. In adjusted analyses, death was associated with older age, clinical AIDS, lower CD4 at ART-2 start, earlier calendar year, and starting ART-2 because of toxicity (adjusted hazard ratio[aHR]=1.5 vs. failure, 95% confidence interval[CI]=1.0–2.1). Cumulative incidences of VF after 1, 3, and 5 years were 9%, 19%, and 25%. In adjusted analyses, VF was associated with younger age, earlier calendar year, lower CD4 at start of ART-2, and starting ART-2 because of failure (aHR=2.1 vs. toxicity, 95% CI=1.5–2.8). Conclusions Among patients modifying first ART regimen, risks of subsequent modifications, mortality, and virologic failure were high. Access to improved antiretrovirals in the region is needed to improve initial treatment success. PMID:26761273

  17. Haemodynamic effects of adrenaline (epinephrine) depend on chest compression quality during cardiopulmonary resuscitation in pigs.

    Science.gov (United States)

    Pytte, Morten; Kramer-Johansen, Jo; Eilevstjønn, Joar; Eriksen, Morten; Strømme, Taevje A; Godang, Kristin; Wik, Lars; Steen, Petter Andreas; Sunde, Kjetil

    2006-12-01

    Adrenaline (epinephrine) is used during cardiopulmonary resuscitation (CPR) based on animal experiments without supportive clinical data. Clinically CPR was reported recently to have much poorer quality than expected from international guidelines and what is generally done in laboratory experiments. We have studied the haemodynamic effects of adrenaline during CPR with good laboratory quality and with quality simulating clinical findings and the feasibility of monitoring these effects through VF waveform analysis. After 4 min of cardiac arrest, followed by 4 min of basic life support, 14 pigs were randomised to ClinicalCPR (intermittent manual chest compressions, compression-to-ventilation ratio 15:2, compression depth 30-38 mm) or LabCPR (continuous mechanical chest compressions, 12 ventilations/min, compression depth 45 mm). Adrenaline 0.02 mg/kg was administered 30 s thereafter. Plasma adrenaline concentration peaked earlier with LabCPR than with ClinicalCPR, median (range), 90 (30, 150) versus 150 (90, 270) s (p = 0.007), respectively. Coronary perfusion pressure (CPP) and cortical cerebral blood flow (CCBF) increased and femoral blood flow (FBF) decreased after adrenaline during LabCPR (mean differences (95% CI) CPP 17 (6, 29) mmHg (p = 0.01), FBF -5.0 (-8.8, -1.2) ml min(-1) (p = 0.02) and median difference CCBF 12% of baseline (p = 0.04)). There were no significant effects during ClinicalCPR (mean differences (95% CI) CPP 4.7 (-3.2, 13) mmHg (p = 0.2), FBF -0.2 (-4.6, 4.2) ml min(-1)(p = 0.9) and CCBF 3.6 (-1.8, 9.0)% of baseline (p = 0.15)). Slope VF waveform analysis reflected changes in CPP. Adrenaline improved haemodynamics during laboratory quality CPR in pigs, but not with quality simulating clinically reported CPR performance.

  18. Stochastic dynamics of phase singularities under ventricular fibrillation in 2D Beeler-Reuter model

    Directory of Open Access Journals (Sweden)

    Akio Suzuki

    2011-09-01

    Full Text Available The dynamics of ventricular fibrillation (VF has been studied extensively, and the initiation mechanism of VF has been elucidated to some extent. However, the stochastic dynamical nature of sustained VF remains unclear so far due to the complexity of high dimensional chaos in a heterogeneous system. In this paper, various statistical mechanical properties of sustained VF are studied numerically in 2D Beeler-Reuter-Drouhard-Roberge (BRDR model with normal and modified ionic current conductance. The nature of sustained VF is analyzed by measuring various fluctuations of spatial phase singularity (PS such as velocity, lifetime, the rates of birth and death. It is found that the probability density function (pdf for lifetime of PSs is independent of system size. It is also found that the hyper-Gamma distribution serves as a universal pdf for the counting number of PSs for various system sizes and various parameters of our model tissue under VF. Further, it is demonstrated that the nonlinear Langevin equation associated with a hyper-Gamma process can mimic the pdf and temporal variation of the number of PSs in the 2D BRDR model.

  19. Estimating the probability that the Taser directly causes human ventricular fibrillation.

    Science.gov (United States)

    Sun, H; Haemmerich, D; Rahko, P S; Webster, J G

    2010-04-01

    This paper describes the first methodology and results for estimating the order of probability for Tasers directly causing human ventricular fibrillation (VF). The probability of an X26 Taser causing human VF was estimated using: (1) current density near the human heart estimated by using 3D finite-element (FE) models; (2) prior data of the maximum dart-to-heart distances that caused VF in pigs; (3) minimum skin-to-heart distances measured in erect humans by echocardiography; and (4) dart landing distribution estimated from police reports. The estimated mean probability of human VF was 0.001 for data from a pig having a chest wall resected to the ribs and 0.000006 for data from a pig with no resection when inserting a blunt probe. The VF probability for a given dart location decreased with the dart-to-heart horizontal distance (radius) on the skin surface.

  20. Dicty_cDB: VFK273 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFK273 (Link to dictyBase) - - - Contig-U16028-1 | Contig-U16311-1 VFK2...73P (Link to Original site) VFK273F 633 VFK273Z 575 VFK273P 1188 - - Show VFK273 Library VF (Link to library) Clone ID VFK2...028-1 | Contig-U16311-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFK2-D/VFK2...73Q.Seq.d/ Representative seq. ID VFK273P (Link to Original site) Representative DNA sequence >VFK273 (VFK2...73Q) /CSM/VF/VFK2-D/VFK273Q.Seq.d/ AAATCTTTATTAATATTTTTCAAAATAAATAAATAAATAAATTAAAAATGAAAGTTTTAT

  1. Investigation of survival time and disability characteristics in 5 subjects with bilateral thalamus infarction near median line%双侧中线旁丘脑梗死5例致残特点及生存期调查

    Institute of Scientific and Technical Information of China (English)

    翟明; 刘江; 钟静玫; 林岚

    2002-01-01

    @@ Background:Bilateral thalamus infarction near median line is uncommon in clinic.Reports concerned with this conditions were more less.It is characterized by conscious disorder and Korsakoff syndrome.The main caused may be the injury of intralaminar nuclei,dorsomedial nuclei,and injury of cortical matter,mammalillary bodies,fasciculus thalamicus around cerebral chamer III.Comprehensing the disability characteristics in pateints with bilateral thalamus infarction near median line is important for direction of rehabilitation.While study of survival time will improve evaluation of prognosis. Design:Patients recruited from June 1997~ October 2000 were analyzed. Unit:Intraneural Department of First People's Hospital of Yunnan Province. Subjects:55 subjects with MRI proved bilateral thalamus infarction near median line entered study.These patients included 3 women,2 men(age ranging from 50 to 77 years old,mean age:68.6 years).The period from onset to admission ranged from 5 hours to 2 days.All subejcts experienced acute bilateral thalamus infarction near median line.All had hypertension previously,1 had diabetes,2 had auricular fibrillation. Intervention:All patients received management which was conducted according to protocol for treatment of ischemic cerebrovascular diseases. Patients clinical characteristics were summari-zed and analyzed.Follow up was conducted to determine the survival period. Main evaluation indexes:Survival time and conscious disorder were evaluated. Result:All patients showed different level of conscious disorder.3 cases developed thalamic dementia,2 developed vision numb,In 1 case,condition progressively deteriorated manifesting as moderate coma progressed to deep coma,and bilateral mydriasis.Finally,this patients died of central respiratory and circulatory failure after 8 days.4 cases with favorable prognosis discharged,3 out of them died within 1 year after discharge.Survival subject suffered from reduced memory was followed up till now

  2. Final analysis of survival outcomes in the phase 3 FIRST trial of up-front treatment for multiple myeloma.

    Science.gov (United States)

    Facon, Thierry; Dimopoulos, Meletios A; Dispenzieri, Angela; Catalano, John V; Belch, Andrew; Cavo, Michele; Pinto, Antonello; Weisel, Katja; Ludwig, Heinz; Bahlis, Nizar J; Banos, Anne; Tiab, Mourad; Delforge, Michel; Cavenagh, Jamie D; Geraldes, Catarina; Lee, Je-Jung; Chen, Christine; Oriol, Albert; De La Rubia, Javier; White, Darrell; Binder, Daniel; Lu, Jin; Anderson, Kenneth C; Moreau, Philippe; Attal, Michel; Perrot, Aurore; Arnulf, Bertrand; Qiu, Lugui; Roussel, Murielle; Boyle, Eileen; Manier, Salomon; Mohty, Mohamad; Avet-Loiseau, Herve; Leleu, Xavier; Ervin-Haynes, Annette; Chen, Guang; Houck, Vanessa; Benboubker, Lotfi; Hulin, Cyrille

    2018-01-18

    This FIRST trial final analysis examined survival outcomes in patients with transplant-ineligible newly diagnosed multiple myeloma (NDMM) treated with lenalidomide and low-dose dexamethasone until disease progression (Rd continuous), Rd for 72 weeks (18 cycles; Rd18), or melphalan, prednisone, and thalidomide (MPT; 72 weeks). The primary endpoint was progression-free survival (PFS; primary comparison: Rd continuous vs MPT). Overall survival (OS) was a key secondary endpoint (final analysis prespecified ≥60 months' follow-up). Patients were randomized to Rd continuous (n = 535), Rd18 (n = 541), or MPT (n = 547). At a median follow-up of 67 months, PFS was significantly longer with Rd continuous vs MPT (hazard ratio [HR], 0.69; 95% confidence interval [CI], 0.59-0.79; P < .00001) and was similarly extended vs Rd18. Median OS was 10 months longer with Rd continuous vs MPT (59.1 vs 49.1 months; HR, 0.78; 95% CI, 0.67-0.92; P = .0023), and similar with Rd18 (62.3 months). In patients achieving complete or very good partial responses, Rd continuous had an ≈30-month longer median time to next treatment vs Rd18 (69.5 vs 39.9 months). Over half of all patients who received second-line treatment were given a bortezomib-based therapy. Second-line outcomes were improved in patients receiving bortezomib after Rd continuous and Rd18 vs after MPT. No new safety concerns, including risk for secondary malignancies, were observed. Treatment with Rd continuous significantly improved survival outcomes vs MPT, supporting Rd continuous as a standard of care for patients with transplant-ineligible NDMM. This trial was registered at www.clinicaltrials.gov as #NCT00689936 and EudraCT as 2007-004823-39. © 2018 by The American Society of Hematology.

  3. Seasonal variability in nitrate and phosphate uptake kinetics in a forested headwater stream using pulse nutrient additions

    Science.gov (United States)

    Griffiths, N. A.; Mulholland, P. J.

    2011-12-01

    We used the Tracer Additions for Spiraling Curve Characterization (TASCC) approach to quantify seasonal variability in ambient nutrient spiraling metrics and nutrient uptake kinetics in the West Fork of Walker Branch, a forested headwater stream in eastern Tennessee, USA. We performed instantaneous additions of nitrate (NO3-) and phosphate (PO4-3) separately with a conservative tracer (chloride, Cl-) during the following biologically-important time periods: autumn (during leaf fall, high organic matter [OM] standing stocks), winter (low OM standing stocks), spring (prior to canopy closure), and summer (closed canopy). We predicted that nutrient demand would be highest during autumn and spring, as OM inputs fuel heterotrophic respiration and high light availability stimulates autotrophic production, respectively. The measured ambient PO4-3 uptake rates (Vf-amb) followed our predictions, with the highest Vf-amb rates in autumn (Vf-amb = 2.8 mm/min) and spring (Vf-amb = 2.9 mm/min), and undetectable uptake in winter. Further, maximum areal PO4-3 uptake rates (Umax) were higher in autumn (Umax = 297 μg/m2/min) than spring (Umax = 106 μg/m2/min), possibly due to greater nutrient demand of heterotrophs on leaf litter accumulations. Contrary to our predictions, ambient NO3- uptake rates were highest in autumn and winter (autumn: Vf-amb = 2.8 mm/min, winter: Vf-amb = 2.4 mm/min), and lowest in spring (Vf-amb = 1.0 mm/min). The higher than expected Vf-amb rate in winter may be due to higher stream metabolism rates and thus greater nitrogen demand; the lower than expected Vf-amb rate in spring may reflect an alleviation of nitrogen demand due to high ammonium concentrations during this time. As the demand for both nitrogen and phosphorus in Walker Branch is greatest in autumn, future work will characterize how nutrient metrics change during this dynamic time period (i.e., before, during, and after leaf fall).

  4. Clinical evaluation of a novel population-based regression analysis for detecting glaucomatous visual field progression.

    Science.gov (United States)

    Kovalska, M P; Bürki, E; Schoetzau, A; Orguel, S F; Orguel, S; Grieshaber, M C

    2011-04-01

    The distinction of real progression from test variability in visual field (VF) series may be based on clinical judgment, on trend analysis based on follow-up of test parameters over time, or on identification of a significant change related to the mean of baseline exams (event analysis). The aim of this study was to compare a new population-based method (Octopus field analysis, OFA) with classic regression analyses and clinical judgment for detecting glaucomatous VF changes. 240 VF series of 240 patients with at least 9 consecutive examinations available were included into this study. They were independently classified by two experienced investigators. The results of such a classification served as a reference for comparison for the following statistical tests: (a) t-test global, (b) r-test global, (c) regression analysis of 10 VF clusters and (d) point-wise linear regression analysis. 32.5 % of the VF series were classified as progressive by the investigators. The sensitivity and specificity were 89.7 % and 92.0 % for r-test, and 73.1 % and 93.8 % for the t-test, respectively. In the point-wise linear regression analysis, the specificity was comparable (89.5 % versus 92 %), but the sensitivity was clearly lower than in the r-test (22.4 % versus 89.7 %) at a significance level of p = 0.01. A regression analysis for the 10 VF clusters showed a markedly higher sensitivity for the r-test (37.7 %) than the t-test (14.1 %) at a similar specificity (88.3 % versus 93.8 %) for a significant trend (p = 0.005). In regard to the cluster distribution, the paracentral clusters and the superior nasal hemifield progressed most frequently. The population-based regression analysis seems to be superior to the trend analysis in detecting VF progression in glaucoma, and may eliminate the drawbacks of the event analysis. Further, it may assist the clinician in the evaluation of VF series and may allow better visualization of the correlation between function and structure owing to VF

  5. Sensorimotor Learning of Acupuncture Needle Manipulation Using Visual Feedback.

    Directory of Open Access Journals (Sweden)

    Won-Mo Jung

    Full Text Available Humans can acquire a wide variety of motor skills using sensory feedback pertaining to discrepancies between intended and actual movements. Acupuncture needle manipulation involves sophisticated hand movements and represents a fundamental skill for acupuncturists. We investigated whether untrained students could improve their motor performance during acupuncture needle manipulation using visual feedback (VF.Twenty-one untrained medical students were included, randomly divided into concurrent (n = 10 and post-trial (n = 11 VF groups. Both groups were trained in simple lift/thrusting techniques during session 1, and in complicated lift/thrusting techniques in session 2 (eight training trials per session. We compared the motion patterns and error magnitudes of pre- and post-training tests.During motion pattern analysis, both the concurrent and post-trial VF groups exhibited greater improvements in motion patterns during the complicated lifting/thrusting session. In the magnitude error analysis, both groups also exhibited reduced error magnitudes during the simple lifting/thrusting session. For the training period, the concurrent VF group exhibited reduced error magnitudes across all training trials, whereas the post-trial VF group was characterized by greater error magnitudes during initial trials, which gradually reduced during later trials.Our findings suggest that novices can improve the sophisticated hand movements required for acupuncture needle manipulation using sensorimotor learning with VF. Use of two types of VF can be beneficial for untrained students in terms of learning how to manipulate acupuncture needles, using either automatic or cognitive processes.

  6. Relationship between optical coherence tomography, pattern electroretinogram and automated perimetry in eyes with temporal hemianopia from chiasmal compression.

    Science.gov (United States)

    Monteiro, Mário L R; Cunha, Leonardo P; Costa-Cunha, Luciana V F; Maia, Otacílio O; Oyamada, Maria K

    2009-08-01

    To evaluate the relationship between pattern electroretinogram (PERG) amplitude, macular and retinal nerve fiber layer (RNFL) thickness by optical coherence tomography (OCT), and visual field (VF) loss on standard automated perimetry (SAP) in eyes with temporal hemianopia from chiasmal compression. Forty-one eyes from 41 patients with permanent temporal VF defects from chiasmal compression and 41 healthy subjects underwent transient full-field and hemifield (temporal or nasal) stimulation PERG, SAP and time domain-OCT macular and RNFL thickness measurements. Comparisons were made using Student's t-test. Deviation from normal VF sensitivity for the central 18 degrees of VF was expressed in 1/Lambert units. Correlations between measurements were verified by linear regression analysis. PERG and OCT measurements were significantly lower in eyes with temporal hemianopia than in normal eyes. A significant correlation was found between VF sensitivity loss and full-field or nasal, but not temporal, hemifield PERG amplitude. Likewise a significant correlation was found between VF sensitivity loss and most OCT parameters. No significant correlation was observed between OCT and PERG parameters, except for nasal hemifield amplitude. A significant correlation was observed between several macular and RNFL thickness parameters. In patients with chiasmal compression, PERG amplitude and OCT thickness measurements were significant related to VF loss, but not to each other. OCT and PERG quantify neuronal loss differently, but both technologies are useful in understanding structure-function relationship in patients with chiasmal compression. (ClinicalTrials.gov number, NCT00553761).

  7. Earthworm eco-physiological characteristics and quantification of earthworm feeding in vermifiltration system for sewage sludge stabilization using stable isotopic natural abundance

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiaowei; Xing, Meiyan, E-mail: lixiaowei419@163.com; Yang, Jian; Dai, Xiaohu

    2014-07-15

    Highlights: • Earthworm growth biomass and activity decreased with the VF depth. • Earthworm gut microbial communities were dominated by Gammaproteobacteria. • δ{sup 15}N and δ{sup 13}C in earthworms decreased with time, and increased with the VF depth. • Effect of earthworm feeding in enhanced VSS reduction was analyzed quantitatively. • Earthworm feeding had low contribution to the enhanced VSS reduction. - Abstract: Previous studies showed that the presence of earthworm improves treatment performance of vermifilter (VF) for sewage sludge stabilization, but earthworm eco-physiological characteristics and effects in VF were not fully investigated. In this study, earthworm population, enzymatic activity, gut microbial community and stable isotopic abundance were investigated in the VF. Results showed that biomass, average weight, number and alkaline phosphatase activity of the earthworms tended to decrease, while protein content and activities of peroxidase and catalase had an increasing tendency as the VF depth. Earthworm gut microbial communities were dominated by Gammaproteobacteria, and the percentages arrived to 76–92% of the microbial species detected. {sup 15}N and {sup 13}C natural abundance of the earthworms decreased with operation time, and increased as the VF depth. Quantitative analysis using δ{sup 15}N showed that earthworm feeding and earthworm–microorganism interaction were responsible for approximately 21% and 79%, respectively, of the enhanced volatile suspended solid reduction due to the presence of earthworm. The finding provides a quantitative insight into how earthworms influence on sewage sludge stabilization in vermifiltration system.

  8. Baseline mean deviation and rates of visual field change in treated glaucoma patients.

    Science.gov (United States)

    Forchheimer, I; de Moraes, C G; Teng, C C; Folgar, F; Tello, C; Ritch, R; Liebmann, J M

    2011-05-01

    To evaluate the relationships between baseline visual field (VF) mean deviation (MD) and subsequent progression in treated glaucoma. Records of patients seen in a glaucoma practice between 1999 and 2009 were reviewed. Patients with glaucomatous optic neuropathy, baseline VF damage, and ≥8 SITA-standard 24-2 VF were included. Patients were divided into tertiles based upon baseline MD. Automated pointwise linear regression determined global and localized rates (decibels (dB) per year) of change. Progression was defined when two or more adjacent test locations in the same hemifield showed a sensitivity decline at a rate of >1.0  dB per year, P0.50) and global rates of VF change of progressing eyes were -1.3±1.2, -1.01±0.7, and -0.9±0.5 dB/year (P=0.09, analysis of variance). Within these groups, intraocular pressure (IOP) in stable vs progressing eyes were 15.5±3.3 vs 17.0±3.1 (P0.50) and multivariate (P=0.26) analyses adjusting for differences in follow-up IOP. After correcting for differences in IOP in treated glaucoma patients, we did not find a relationship between the rate of VF change (dB per year) and the severity of the baseline VF MD. This finding may have been due to more aggressive IOP lowering in eyes with more severe disease. Eyes with lower IOP progressed less frequently across the spectrum of VF loss.

  9. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    International Nuclear Information System (INIS)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.; Goberna, R.; Guerrero, J.M.

    1991-01-01

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using [ 125 I]melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37 degree C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of [ 125 I]melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8 fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of [ 125 I]melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the [ 125 I]melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland

  10. Minimally invasive repair of pectus excavatum in an adolescent with a history of a median sternotomy as an infant

    Directory of Open Access Journals (Sweden)

    Lauren Huckaby

    2014-10-01

    Full Text Available The report by Nuss et al., in 1998 of their 10-year experience with minimally invasive repair of pectus excavatum introduced the possibility of a less invasive approach for the correction of chest wall abnormalities. This procedure is now well-accepted around the world, although serious complications such as intraoperative cardiac perforation and postoperative bar displacement have been reported. The Nuss procedure has been performed concurrently with sternotomy for cardiac operations. However, there have been no reports of minimally invasive pectus excavatum correction in a child with a remote history of a median sternotomy. With IRB approval (Protocol #1308002283 we report the successful completion of a Nuss procedure in an adolescent with a history of a median sternotomy in infancy. During the procedure, thoracoscopy on the right side revealed significant adhesions of the lung and pericardium to the posterior sternum. Additional trocars were placed bilaterally to facilitate visualization and to allow for lysis of the adhesions with bipolar cautery. Passage of the bar was accomplished uneventfully and the patient has an excellent cosmetic outcome 28 months following the operation. We believe that a previous median sternotomy should not be viewed as a contraindication to the minimally invasive repair of pectus excavatum.

  11. The dlx5a/dlx6a genes play essential roles in the early development of zebrafish median fin and pectoral structures.

    Directory of Open Access Journals (Sweden)

    Eglantine Heude

    Full Text Available The Dlx5 and Dlx6 genes encode homeodomain transcription factors essential for the proper development of limbs in mammalian species. However, the role of their teleost counterparts in fin development has received little attention. Here, we show that dlx5a is an early marker of apical ectodermal cells of the pectoral fin buds and of the median fin fold, but also of cleithrum precursor cells during pectoral girdle development. We propose that early median fin fold establishment results from the medial convergence of dlx5a-expressing cells at the lateral edges of the neural keel. Expression analysis also shows involvement of dlx5a during appendage skeletogenesis. Using morpholino-mediated knock down, we demonstrate that disrupted dlx5a/6a function results in pectoral fin agenesis associated with misexpression of bmp4, fgf8a, and1 and msx genes. In contrast, the median fin fold presents defects in mesenchymal cell migration and actinotrichia formation, whereas the initial specification seems to occur normally. Our results demonstrate that the dlx5a/6a genes are essential for the induction of pectoral fin outgrowth, but are not required during median fin fold specification. The dlx5a/6a knock down also causes a failure of cleithrum formation associated with a drastic loss of runx2b and col10a1 expression. The data indicate distinct requirements for dlx5a/6a during median and pectoral fin development suggesting that initiation of unpaired and paired fin formation are not directed through the same molecular mechanisms. Our results refocus arguments on the mechanistic basis of paired appendage genesis during vertebrate evolution.

  12. The dlx5a/dlx6a Genes Play Essential Roles in the Early Development of Zebrafish Median Fin and Pectoral Structures

    Science.gov (United States)

    Heude, Églantine; Shaikho, Sarah; Ekker, Marc

    2014-01-01

    The Dlx5 and Dlx6 genes encode homeodomain transcription factors essential for the proper development of limbs in mammalian species. However, the role of their teleost counterparts in fin development has received little attention. Here, we show that dlx5a is an early marker of apical ectodermal cells of the pectoral fin buds and of the median fin fold, but also of cleithrum precursor cells during pectoral girdle development. We propose that early median fin fold establishment results from the medial convergence of dlx5a-expressing cells at the lateral edges of the neural keel. Expression analysis also shows involvement of dlx5a during appendage skeletogenesis. Using morpholino-mediated knock down, we demonstrate that disrupted dlx5a/6a function results in pectoral fin agenesis associated with misexpression of bmp4, fgf8a, and1 and msx genes. In contrast, the median fin fold presents defects in mesenchymal cell migration and actinotrichia formation, whereas the initial specification seems to occur normally. Our results demonstrate that the dlx5a/6a genes are essential for the induction of pectoral fin outgrowth, but are not required during median fin fold specification. The dlx5a/6a knock down also causes a failure of cleithrum formation associated with a drastic loss of runx2b and col10a1 expression. The data indicate distinct requirements for dlx5a/6a during median and pectoral fin development suggesting that initiation of unpaired and paired fin formation are not directed through the same molecular mechanisms. Our results refocus arguments on the mechanistic basis of paired appendage genesis during vertebrate evolution. PMID:24858471

  13. Median and Ulnar Neuropathy Assessment in Parkinson’s Disease regarding Symptom Severity and Asymmetry

    Directory of Open Access Journals (Sweden)

    Nilgul Yardimci

    2016-01-01

    Full Text Available Background. While increasing evidence suggests comorbidity of peripheral neuropathy (PNP and Parkinson’s disease (PD, the pathogenesis of PNP in PD is still a debate. The aim of this article is to search the core PD symptoms such as rigidity and tremor as contributing factors to mononeuropathy development while emphasizing each individual patient’s asymmetric symptom severity. Methods. We studied 62 wrists and 62 elbows of 31 patients (mean age 66.48±10.67 and 64 wrists and 64 elbows of 32 age-gender matched healthy controls (mean age 62.03±10.40, p=0.145. The Hoehn and Yahr disability scale and Unified Parkinson’s Disease Rated Scale were used to determine the severity of the disease. Results. According to electrodiagnostic criteria, we confirmed median neuropathy in 16.12% (bilateral in two-thirds of the patients and ulnar neuropathy in 3.22% of the PD group. While mean age (p=0.003, age at PD onset (p=0.019, and H&Y scores (p=0.016 were significant, tremor and rigidity scores were not. The comparison of the mean indices of electrophysiologic parameters indicated subclinical median and ulnar nerve demyelination both at the wrist and at the elbow in the patient groups where a longer disease duration and mild tremor and rigidity scores are prominent, remarkably. Conclusion. A disease related peripheral neurodegeneration beyond symptom severity occurs in PD.

  14. Median Modified Wiener Filter for nonlinear adaptive spatial denoising of protein NMR multidimensional spectra

    KAUST Repository

    Cannistraci, Carlo Vittorio

    2015-01-26

    Denoising multidimensional NMR-spectra is a fundamental step in NMR protein structure determination. The state-of-the-art method uses wavelet-denoising, which may suffer when applied to non-stationary signals affected by Gaussian-white-noise mixed with strong impulsive artifacts, like those in multi-dimensional NMR-spectra. Regrettably, Wavelet\\'s performance depends on a combinatorial search of wavelet shapes and parameters; and multi-dimensional extension of wavelet-denoising is highly non-trivial, which hampers its application to multidimensional NMR-spectra. Here, we endorse a diverse philosophy of denoising NMR-spectra: less is more! We consider spatial filters that have only one parameter to tune: the window-size. We propose, for the first time, the 3D extension of the median-modified-Wiener-filter (MMWF), an adaptive variant of the median-filter, and also its novel variation named MMWF*. We test the proposed filters and the Wiener-filter, an adaptive variant of the mean-filter, on a benchmark set that contains 16 two-dimensional and three-dimensional NMR-spectra extracted from eight proteins. Our results demonstrate that the adaptive spatial filters significantly outperform their non-adaptive versions. The performance of the new MMWF* on 2D/3D-spectra is even better than wavelet-denoising. Noticeably, MMWF* produces stable high performance almost invariant for diverse window-size settings: this signifies a consistent advantage in the implementation of automatic pipelines for protein NMR-spectra analysis.

  15. Median Modified Wiener Filter for nonlinear adaptive spatial denoising of protein NMR multidimensional spectra

    KAUST Repository

    Cannistraci, Carlo Vittorio; Abbas, Ahmed; Gao, Xin

    2015-01-01

    Denoising multidimensional NMR-spectra is a fundamental step in NMR protein structure determination. The state-of-the-art method uses wavelet-denoising, which may suffer when applied to non-stationary signals affected by Gaussian-white-noise mixed with strong impulsive artifacts, like those in multi-dimensional NMR-spectra. Regrettably, Wavelet's performance depends on a combinatorial search of wavelet shapes and parameters; and multi-dimensional extension of wavelet-denoising is highly non-trivial, which hampers its application to multidimensional NMR-spectra. Here, we endorse a diverse philosophy of denoising NMR-spectra: less is more! We consider spatial filters that have only one parameter to tune: the window-size. We propose, for the first time, the 3D extension of the median-modified-Wiener-filter (MMWF), an adaptive variant of the median-filter, and also its novel variation named MMWF*. We test the proposed filters and the Wiener-filter, an adaptive variant of the mean-filter, on a benchmark set that contains 16 two-dimensional and three-dimensional NMR-spectra extracted from eight proteins. Our results demonstrate that the adaptive spatial filters significantly outperform their non-adaptive versions. The performance of the new MMWF* on 2D/3D-spectra is even better than wavelet-denoising. Noticeably, MMWF* produces stable high performance almost invariant for diverse window-size settings: this signifies a consistent advantage in the implementation of automatic pipelines for protein NMR-spectra analysis.

  16. Ventricular fibrillation occurring after atrioventricular node ablation despite minimal difference between pre- and post-ablation heart rates.

    Science.gov (United States)

    Squara, F; Theodore, G; Scarlatti, D; Ferrari, E

    2017-02-01

    We report the case of an 82-year-old man presenting with ventricular fibrillation (VF) occurring acutely after atrioventricular node (AVN) ablation. This patient had severe valvular cardiomyopathy, chronic atrial fibrillation (AF), and underwent prior to the AVN ablation a biventricular implantable cardiac defibrillator positioning. The VF was successfully cardioverted with one external electrical shock. What makes this presentation original is that the pre-ablation spontaneous heart rate in AF was slow (84 bpm), and that VF occurred after ablation despite a minimal heart rate drop of only 14 bpm. VF is the most feared complication of AVN ablation, but it had previously only been described in case of acute heart rate drop after ablation of at least 30 bpm (and more frequently>50 bpm). This case report highlights the fact that VF may occur after AVN ablation regardless of the heart rate drop, rendering temporary fast ventricular pacing mandatory whatever the pre-ablation heart rate. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  17. Time course and predictors of median nerve conduction after carpal tunnel release.

    Science.gov (United States)

    Rotman, Mitchell B; Enkvetchakul, Bobby V; Megerian, J Thomas; Gozani, Shai N

    2004-05-01

    To identify predictors of outcome and of electrophysiologic recovery in patients with carpal tunnel syndrome (CTS) treated by endoscopic carpal tunnel release using a nerve conduction testing system (NC-Stat; NEUROMetrix, Inc, Waltham, MA). Validity of the automated nerve conduction testing system was shown by comparing presurgical distal motor latencies (DMLs) against a reference obtained by referral to an electromyography laboratory. The DML was evaluated in 48 patients with CTS. Measurements were obtained within 1 hour of surgery and at 2 weeks, 6 weeks, 3 months, and 6 months after carpal tunnel release. Presurgical and postsurgical DMLs were then compared and correlated with variables and possible predictors of outcome including age, body mass index, gender, and presurgical DMLs. The automated nerve conduction testing system DMLs matched those of reference electromyography/nerve conduction study values with high correlation. Sensitivity of the automated nerve conduction testing system when compared with a standardized CTS case definition was 89%, with a specificity of 95%. A significant correlation was found between the DML before release and the DML 1 hour after release. Moreover, maximal postsurgical DML improvement was highly dependent on the presurgical DML, with no improvement shown for the 6-ms group. Among the clinical variables of age, gender, and body mass index only age was mildly predictive of postrelease DML changes at 6 months. No other correlations between clinical variables and postsurgical DMLs were significant. In addition the predictive value of age was lost when combined with the presurgical DML in a multivariate analysis. Postsurgical changes in the median nerve DML were highly dependent on the prerelease latency. The sensitivity and specificity of a nerve conduction monitoring system in detecting and aiding in the diagnosis of CTS is useful in the long-term management of patients with CTS and can aid in determining the level of improvement

  18. CT morphology of benign median nerve tumors; Report of three cases and a review

    Energy Technology Data Exchange (ETDEWEB)

    Feyerabend, T; Schmitt, R; Lanz, U; Warmuth-Metz, M [Wuerzburg Univ. (Germany, F.R.). Abt. fuer Roentgendiagnostik Wuerzburg Univ. (Germany, F.R.). Abt. fuer Hand- und Mikrochirurgie

    1990-01-01

    Computed tomography (CT) was performed in 3 patients with benign tumors of the median nerve, histologically confirmed as neurilemmoma, fibrolipoma and hemangioma. The neurilemmoma showed a ring-shaped contrast enhancement. The fibrolipoma presented with areas of solid soft tissue and areas of fat. The hemangioma was a solid tumor with a lacunar, vascular contrast enhancement. According to our experience and to the previous literature CT gives useful information regarding the anatomic location, size, and relationship of peripheral nerve sheath tumors to surrounding structures, and may help to differentiate between various tumor types. (orig.).

  19. The influence of al-madinah al-munawwara treated and untreated domestic wastewater on growth and physiology of three tomato (lycopersicon esculentum mill.) genotypes

    International Nuclear Information System (INIS)

    Akhkha, A.; Boutraa, T.; Shoaibi, A.K.

    2017-01-01

    The impact of irrigation with Al-Madinah Al-Munawwara domestic wastewater on three tomato genotypes (AL, P and VF) was investigated. Five treatments including Tap water, untreated (TN), primary (T1), secondary (T2) and tertiary (T3) treated wastewaters were used for irrigation. The physico-chemical characteristics of wastewater were determined. Leaves were analysed for N, P, K and heavy metals (Copper, Cadmium, Lead and Nickel). The growth parameters assessed were % germination, plant height, shoot and root dry weights, and total leaf dry weight. Some physiological parameters such as photosynthetic light response curve, maximum gross photosynthesis (Amax), dark respiration (DR), chlorophyll fluorescence parameters (Fo, Fm and Fv / Fm), chlorophyll content index and stomatal conductance were detected. % germination was decreased in both A1 and P genotype, with no effect on VF genotype. Most growth parameters were increased in genotype A1, followed by VF then P genotype which had a sensitive leaf dry weight to T2 and T3. Photosynthesis was mainly increased in A1 genotype with a decrease in VF genotype. DR was negatively affected in VF genotype with no response of A1 genotype. Chlorophyll fluorescence showed an increase in Fo in VF genotype but a decrease in Fv / Fm in both A1 and VF genotypes. Chlorophyll content index was decreased but only in A1 and VF genotypes under TN. Treatment with TN and / or T1 decreased stomatal conductance in all genotypes. The levels of heavy metals in wastewaters used were lower than the standard limits; however, plant chemical analysis showed that the leaves of the three tomato genotypes accumulated heavy metals but differently with higher levels at TN and lower levels at T3. (author)

  20. Pinhole single-photon emission tomography reconstruction based on median root prior

    International Nuclear Information System (INIS)

    Sohlberg, Antti; Kuikka, Jyrki T.; Ruotsalainen, Ulla

    2003-01-01

    The maximum likelihood expectation maximisation (ML-EM) algorithm can be used to reduce reconstruction artefacts produced by filtered backprojection (FBP) methods in pinhole single-photon emission tomography (SPET). However, ML-EM suffers from noise propagation along iterations, which leads to quantitatively unpleasant reconstruction results. To avoid this increase in noise, the median root prior (MRP) algorithm for pinhole SPET was implemented. Projection data of a line source and Picker's thyroid phantom were collected using a single-head gamma camera with a pinhole collimator. MRP was added to existing pinhole ML-EM reconstruction algorithm and the phantom studies were reconstructed using MRP, ML-EM and FBP for comparison. Coefficients of variation, contrasts and full-widths at half-maximum were calculated and showed a clear reduction in noise without significant loss of resolution or decrease in contrast when MRP was applied. MRP also produced visually pleasing images even with high iteration numbers, free of the checkerboard-type noise patterns which are typical of ML-EM images. (orig.)

  1. Comparison between minimal right vertical infra-axillary thoracotomy and standard median sternotomy for repair of atrial septal defects

    Directory of Open Access Journals (Sweden)

    Hafize Yaliniz

    2015-10-01

    Conclusion: Minimal right vertical infra-axillary thoracotomy can be performed with favorable cosmetic and clinical results for atrial septal defects closure. Infra-axillary thoracotomy provides a good alternative to standard median sternotomy for patients with atrial septal defects.

  2. Median nerve neuropathy in the forearm due to recurrence of anterior wrist ganglion that originates from the scaphotrapezial joint: Case Report

    Directory of Open Access Journals (Sweden)

    Okada Kiyoshi

    2012-01-01

    Full Text Available Abstract Background Median nerve neuropathy caused by compression from a tumor in the forearm is rare. Cases with anterior wrist ganglion have high recurrence rates despite surgical treatment. Here, we report the recurrence of an anterior wrist ganglion that originated from the Scaphotrapezial joint due to incomplete resection and that caused median nerve neuropathy in the distal forearm. Case presentation A 47-year-old right-handed housewife noted the appearance of soft swelling on the volar aspect of her left distal forearm, and local resection surgery was performed twice at another hospital. One year after the last surgery, the swelling reappeared and was associated with numbness and pain in the radial volar aspect of the hand. Magnetic resonance imaging revealed that the multicystic lesion originated from the Scaphotrapezial joint and had expanded beyond the wrist. Exploration of the left median nerve showed that it was compressed by a large ovoid cystic lesion at the distal forearm near the proximal end of the carpal tunnel. We resected the cystic lesion to the Scaphotrapezial joint. Her symptoms disappeared 1 week after surgery, and complications or recurrent symptoms were absent 13 months after surgery. Conclusions A typical median nerve compression was caused by incomplete resection of an anterior wrist ganglion, which may have induced widening of the cyst. Cases with anterior wrist ganglion have high recurrence rates and require extra attention in their treatment.

  3. The median hazard ratio: a useful measure of variance and general contextual effects in multilevel survival analysis.

    Science.gov (United States)

    Austin, Peter C; Wagner, Philippe; Merlo, Juan

    2017-03-15

    Multilevel data occurs frequently in many research areas like health services research and epidemiology. A suitable way to analyze such data is through the use of multilevel regression models (MLRM). MLRM incorporate cluster-specific random effects which allow one to partition the total individual variance into between-cluster variation and between-individual variation. Statistically, MLRM account for the dependency of the data within clusters and provide correct estimates of uncertainty around regression coefficients. Substantively, the magnitude of the effect of clustering provides a measure of the General Contextual Effect (GCE). When outcomes are binary, the GCE can also be quantified by measures of heterogeneity like the Median Odds Ratio (MOR) calculated from a multilevel logistic regression model. Time-to-event outcomes within a multilevel structure occur commonly in epidemiological and medical research. However, the Median Hazard Ratio (MHR) that corresponds to the MOR in multilevel (i.e., 'frailty') Cox proportional hazards regression is rarely used. Analogously to the MOR, the MHR is the median relative change in the hazard of the occurrence of the outcome when comparing identical subjects from two randomly selected different clusters that are ordered by risk. We illustrate the application and interpretation of the MHR in a case study analyzing the hazard of mortality in patients hospitalized for acute myocardial infarction at hospitals in Ontario, Canada. We provide R code for computing the MHR. The MHR is a useful and intuitive measure for expressing cluster heterogeneity in the outcome and, thereby, estimating general contextual effects in multilevel survival analysis. © 2016 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd. © 2016 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd.

  4. Median of patient results as a tool for assessment of analytical stability

    DEFF Research Database (Denmark)

    Jørgensen, Lars Mønster; Hansen, Steen Ingemann; Petersen, Per Hyltoft

    2015-01-01

    BACKGROUND: In spite of the well-established external quality assessment and proficiency testing surveys of analytical quality performance in laboratory medicine, a simple tool to monitor the long-term analytical stability as a supplement to the internal control procedures is often needed. METHOD......: Patient data from daily internal control schemes was used for monthly appraisal of the analytical stability. This was accomplished by using the monthly medians of patient results to disclose deviations from analytical stability, and by comparing divergences with the quality specifications for allowable...... analytical bias based on biological variation. RESULTS: Seventy five percent of the twenty analytes achieved on two COBASs INTEGRA 800 instruments performed in accordance with the optimum and with the desirable specifications for bias. DISCUSSION: Patient results applied in analytical quality performance...

  5. Dicty_cDB: VFD492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFD492 (Link to dictyBase) - - - Contig-U16603-1 VFD492P (Link to Original site) VFD492...F 516 VFD492Z 653 VFD492P 1169 - - Show VFD492 Library VF (Link to library) Clone ID VFD492...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFD4-D/VFD492Q.Seq.d/ Representative seq. ID VFD492...P (Link to Original site) Representative DNA sequence >VFD492 (VFD492Q) /CSM/VF/VFD4-D/VFD492...al 8.0 %: nuclear >> prediction for VFD492 is exc 5' end seq. ID VFD492F 5' end seq. >VFD492

  6. Dicty_cDB: VFK244 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFK244 (Link to dictyBase) - - - Contig-U16513-1 VFK244E (Link to Original site) VFK2...44F 710 VFK244Z 703 VFK244P 1393 VFK244E 1166 Show VFK244 Library VF (Link to library) Clone ID VFK2...ginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFK2-B/VFK244Q.Seq.d/ Re...presentative seq. ID VFK244E (Link to Original site) Representative DNA sequence >VFK244 (VFK244Q) /CSM/VF/VFK2-B/VFK2...nsif*nlsnqnklnlfrk*k*ikkkn Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VFK244 (VFK2

  7. Dicty_cDB: VFK242 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFK242 (Link to dictyBase) - - - Contig-U16260-1 VFK242P (Link to Original site) VFK2...42F 606 VFK242Z 292 VFK242P 878 - - Show VFK242 Library VF (Link to library) Clone ID VFK2... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFK2-B/VFK242Q.Seq.d/ Representative seq. ID VFK2...42P (Link to Original site) Representative DNA sequence >VFK242 (VFK242Q) /CSM/VF/VFK2-B/VFK2...eum cDNA clone:ddv63n23, 5' ... 1142 0.0 1 ( BJ427875 ) Dictyostelium discoideum cDNA clone:ddv63k24, 5' ...

  8. Is it necessary to use the entire root as a donor when transferring contralateral C7 nerve to repair median nerve?

    Science.gov (United States)

    Gao, Kai-Ming; Lao, Jie; Guan, Wen-Jie; Hu, Jing-Jing

    2018-01-01

    If a partial contralateral C 7 nerve is transferred to a recipient injured nerve, results are not satisfactory. However, if an entire contralateral C 7 nerve is used to repair two nerves, both recipient nerves show good recovery. These findings seem contradictory, as the above two methods use the same donor nerve, only the cutting method of the contralateral C 7 nerve is different. To verify whether this can actually result in different repair effects, we divided rats with right total brachial plexus injury into three groups. In the entire root group, the entire contralateral C 7 root was transected and transferred to the median nerve of the affected limb. In the posterior division group, only the posterior division of the contralateral C 7 root was transected and transferred to the median nerve. In the entire root + posterior division group, the entire contralateral C 7 root was transected but only the posterior division was transferred to the median nerve. After neurectomy, the median nerve was repaired on the affected side in the three groups. At 8, 12, and 16 weeks postoperatively, electrophysiological examination showed that maximum amplitude, latency, muscle tetanic contraction force, and muscle fiber cross-sectional area of the flexor digitorum superficialis muscle were significantly better in the entire root and entire root + posterior division groups than in the posterior division group. No significant difference was found between the entire root and entire root + posterior division groups. Counts of myelinated axons in the median nerve were greater in the entire root group than in the entire root + posterior division group, which were greater than the posterior division group. We conclude that for the same recipient nerve, harvesting of the entire contralateral C 7 root achieved significantly better recovery than partial harvesting, even if only part of the entire root was used for transfer. This result indicates that the entire root should be used as a

  9. Bioelectrical impedance and visceral fat: a comparison with computed tomography in adults and elderly

    International Nuclear Information System (INIS)

    Eickemberg, Michaela; Roriz, Anna Karla Carneiro; Fontes, Gardenia Abreu Vieira; Sampaio, Lilian Ramos

    2013-01-01

    Objective: To evaluate the association between electrical bioimpedance analysis (BIA) and visceral fat (VF) in adult and elderly patients. Subjects and methods: This was a cross-sectional study, with a sample of 191 subjects (52% women, 49% elderly) stratified by sex, age and body mass. Computerized tomography (VF area) and BIA (percentage of total body fat (%TBF-BIA), phase angle, reactance and resistance) data were generated. Statistical analysis was based on Pearson's Correlation Coefficient, Anova, Pearson's Chi-square, and ROC curves. Results: VF areas ≥ 130 cm 2 were more prevalent among the elderly and among men. Adult females showed a stronger correlation between GV and %TBF-BIA. The other groups showed similar results and statistically significant correlations. Correlations between GV and phase angle were weak and not statistically significant. ROC Curves analyzes showed the following %TBF-BIA, which identified excess VF: for male subjects: 21.5% (adults) and 24.25% (elderly); for female subjects: 35.05% (adults) and 38.45% (elderly) with sensitivity of 78.6%, 82.1%, 83.3%, and 66.7%, and specificity of 70.6%, 62.5%, 79.1%, and 69%, respectively. Conclusion: BIA was found to have satisfactory sensitivity and specificity to predict VF; however, other devices and other techniques should be investigated to improve VF prediction. (author)

  10. An immediate effect of axial neck rotation training with real time visual feedback using a smartphone inclinometer on improvement in axial neck rotation function.

    Science.gov (United States)

    Park, Kyue-Nam; Kwon, Oh-Yun; Kim, Si-Hyun; Jeon, In-Cheol

    2017-03-01

    The purpose of this study was to compare the immediate effects of axial neck rotation training (Axi-NRT) with and without real-time visual feedback (VF) using a smartphone inclinometer on the range of motion (ROM) for axial neck rotation and the onset of compensatory neck lateral bending and extension during active neck rotation. Twenty participants with restricted ROM for neck rotation but no neck pain (21.1 ± 1.6 years and 8 males, 12 females) were recruited for Axi-NRT with VF, and twenty age- and gender-matched participants with restricted ROM for neck rotation were recruited for Axi-NRT without VF. Changes in ROM for neck rotation and the onset time of compensatory neck movement during active neck rotation were measured using an electromagnetic tracking system. Axi-NRT with VF was more effective in increasing ROM for neck rotation and decreasing and delaying the onset of compensatory neck movements during active neck rotation compared with Axi-NRT without VF. Repeated Axi-NRT using VF is useful to educate participants in maintaining the axis of the cervical spine and to increase ROM for axial neck rotation with less compensatory neck motion in participants with a restricted range of neck rotations.

  11. Mediating effects of group cohesion on physical activity and diet in women of color: health is power.

    Science.gov (United States)

    Lee, Rebecca E; O'Connor, Daniel P; Smith-Ray, Renae; Mama, Scherezade K; Medina, Ashley V; Reese-Smith, Jacqueline Y; Banda, Jorge A; Layne, Charles S; Brosnan, Marcella; Cubbin, Catherine; McMillan, Tracy; Estabrooks, Paul A

    2012-01-01

    To determine the effects and mediating factors of a physical activity (PA) or vegetable and fruit (VF) group cohesion intervention. Longitudinal design. Harris County and Travis County, Texas. Community-dwelling African-American and Hispanic or Latina women. Three hundred ten women were randomized to a PA (n  =  204) or VF (n  =  106) intervention group. Women met in groups six times over the course of 6 months and were exposed to a group cohesion intervention to promote walking or to increase VF consumption. Women completed the International PA Questionnaire, National Cancer Institute VF and fat screeners, PA Group Environment Questionnaire, and 7-day accelerometer protocol at baseline and post-intervention. The direct and mediated effects of the intervention on outcomes were evaluated using a mediational chain model, controlling for baseline values and covariates using path analysis. Women were middle aged (mean  =  44.4 years) and overweight or obese (mean body mass index  =  34.0 kg/m(2)). PA increased and fat consumption decreased for both groups, whereas VF consumption increased for women in VF group only (all p psychological and physical health benefits for African-American and Hispanic or Latina women, but refinement of measures and intervention delivery is needed to determine whether hypothesized mediational pathways are valid.

  12. Bioelectrical impedance and visceral fat: a comparison with computed tomography in adults and elderly; Bioimpedancia eletrica e gordura visceral: uma comparacao com a tomografia computadorizada em adultos e idosos

    Energy Technology Data Exchange (ETDEWEB)

    Eickemberg, Michaela [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Roriz, Anna Karla Carneiro [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Fontes, Gardenia Abreu Vieira [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Sampaio, Lilian Ramos [Universidade Federal de Sao Paulo (Unifesp), Sao Paulo, SP (Brazil)

    2013-05-01

    Objective: To evaluate the association between electrical bioimpedance analysis (BIA) and visceral fat (VF) in adult and elderly patients. Subjects and methods: This was a cross-sectional study, with a sample of 191 subjects (52% women, 49% elderly) stratified by sex, age and body mass. Computerized tomography (VF area) and BIA (percentage of total body fat (%TBF-BIA), phase angle, reactance and resistance) data were generated. Statistical analysis was based on Pearson's Correlation Coefficient, Anova, Pearson's Chi-square, and ROC curves. Results: VF areas {>=} 130 cm{sup 2} were more prevalent among the elderly and among men. Adult females showed a stronger correlation between GV and %TBF-BIA. The other groups showed similar results and statistically significant correlations. Correlations between GV and phase angle were weak and not statistically significant. ROC Curves analyzes showed the following %TBF-BIA, which identified excess VF: for male subjects: 21.5% (adults) and 24.25% (elderly); for female subjects: 35.05% (adults) and 38.45% (elderly) with sensitivity of 78.6%, 82.1%, 83.3%, and 66.7%, and specificity of 70.6%, 62.5%, 79.1%, and 69%, respectively. Conclusion: BIA was found to have satisfactory sensitivity and specificity to predict VF; however, other devices and other techniques should be investigated to improve VF prediction. (author)

  13. Characterizing the continuously acquired cardiovascular time series during hemodialysis, using median hybrid filter preprocessing noise reduction.

    Science.gov (United States)

    Wilson, Scott; Bowyer, Andrea; Harrap, Stephen B

    2015-01-01

    The clinical characterization of cardiovascular dynamics during hemodialysis (HD) has important pathophysiological implications in terms of diagnostic, cardiovascular risk assessment, and treatment efficacy perspectives. Currently the diagnosis of significant intradialytic systolic blood pressure (SBP) changes among HD patients is imprecise and opportunistic, reliant upon the presence of hypotensive symptoms in conjunction with coincident but isolated noninvasive brachial cuff blood pressure (NIBP) readings. Considering hemodynamic variables as a time series makes a continuous recording approach more desirable than intermittent measures; however, in the clinical environment, the data signal is susceptible to corruption due to both impulsive and Gaussian-type noise. Signal preprocessing is an attractive solution to this problem. Prospectively collected continuous noninvasive SBP data over the short-break intradialytic period in ten patients was preprocessed using a novel median hybrid filter (MHF) algorithm and compared with 50 time-coincident pairs of intradialytic NIBP measures from routine HD practice. The median hybrid preprocessing technique for continuously acquired cardiovascular data yielded a dynamic regression without significant noise and artifact, suitable for high-level profiling of time-dependent SBP behavior. Signal accuracy is highly comparable with standard NIBP measurement, with the added clinical benefit of dynamic real-time hemodynamic information.

  14. Does Full Wound Rupture following Median Pilonidal Closure Alter Long-Term Recurrence Rate?

    Science.gov (United States)

    Doll, Dietrich; Matevossian, Edouard; Luedi, Markus M; Schneider, Ralf; van Zypen, Dominic; Novotny, Alexander

    2015-01-01

    The purpose of this study was to examine the recurrence rate of wound rupture in primary pilonidal sinus disease (PSD) after median closure. A total of 583 patients from the German military cohort were interviewed. We compared the choice of surgical therapy, wound dehiscence (if present) and long-term recurrence-free survival for patients with primary open treatment, marsupialization and primary median treatment (closed vs. secondary open, respectively). Actuarial recurrence rate was determined using the Kaplan-Meier calculation with a follow-up of up to 20 years after primary PSD surgery. Patients with excision followed by primary open wound treatment showed a significantly lower 5- than 10-year recurrence rate (8.3 vs. 11.2%) compared to the patients with primary midline closure (17.4 vs. 20.5%, p = 0.03). The 20-year recurrence rate was 28% in primary open wound treatment versus 44% in primary midline closure without wound rupture. In contrast to these findings, long-term recurrence rates following secondary open wound treatment (12.2% at 5 years vs. 17.1% at 10 years) tended to be higher (although not significantly, p = 0.57) compared to primary open treatment (8.3% at 5 years vs. 11.2% at 10 years). There was no statistical difference in long-term recurrence rates between secondary open and primary midline closure (p = 0.7). Hence, despite only a short wound closure time experienced before wound rupture, the patient does not fully benefit from an open wound treatment in terms of recurrence rate. The postoperative pilonidal sinus wound rupture of primary midline closures did not significantly increase the 5- and 10-year long-term recurrence rates compared to uneventfully healing primary midline closures. © 2015 S. Karger AG, Basel.

  15. Risk of Local Failure in Breast Cancer Patients With Lobular Carcinoma In Situ at the Final Surgical Margins: Is Re-excision Necessary?

    Energy Technology Data Exchange (ETDEWEB)

    Sadek, Betro T.; Shenouda, Mina N.; Abi Raad, Rita F. [Department of Radiation Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States); Niemierko, Andrzej [Department of Radiation Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States); Statistics Section, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States); Keruakous, Amany R. [Department of Radiation Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States); Goldberg, Saveli I. [Department of Radiation Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States); Statistics Section, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States); Taghian, Alphonse G., E-mail: ataghian@partners.org [Department of Radiation Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States)

    2013-11-15

    Purpose: To compare the outcome of patients with invasive breast cancer both with and without lobular carcinoma in situ (LCIS)-positive/close surgical margins after breast-conserving treatment. Methods and Materials: We retrospectively studied 2358 patients with T1-T2 invasive breast cancer treated with lumpectomy and radiation therapy from January 1980 to December 2009. Median age was 57 years (range, 24-91 years). There were 82 patients (3.5%) with positive/close LCIS margins (<0.2 cm) and 2232 patients (95.7%) with negative margins. A total of 1789 patients (76%) had negative lymph nodes. Patients who received neoadjuvant chemotherapy were excluded. A total of 1783 patients (76%) received adjuvant systemic therapy. Multivariable analysis (MVA) was performed using Cox's proportional hazards model. Results: The 5-year cumulative incidence of locoregional recurrence (LRR) was 3.2% (95% confidence interval [CI] 2.5%-4.1%) for the 2232 patients with LCIS-negative surgical margins (median follow-up 104 months) and 2.8% (95% CI 0.7%-10.8%) for the 82 patients with LCIS-positive/close surgical margins (median follow-up 90 months). This was not statistically significant (P=.5). On MVA, LCIS-positive margins after the final surgery were not associated with increased risk of LRR (hazard ratio [HR] 3.4, 95% CI 0.5-24.5, P=.2). Statistically significant prognostic variables on Cox's MVA for risk of LRR included systemic therapy (HR 0.5, 95% CI 0.33-0.75, P=.001), number of positive lymph nodes (HR 1.11, 95% CI 1.05-1.18, P=.001), menopausal status (HR 0.96, 95% CI 0.95-0.98, P=.001), and histopathologic grade (grade 3 vs grade 1/2) (HR 2.6, 95% CI 1.4-4.7, P=.003). Conclusion: Our results suggest that the presence of LCIS at the surgical margin after lumpectomy does not increase the risk of LRR or the final outcome. These findings suggest that re-excision or mastectomy in patients with LCIS-positive/close final surgical margins is unnecessary.

  16. Median Urinary Iodine Concentrations Are Indicative of Adequate Iodine Status among Women of Reproductive Age in Prey Veng, Cambodia.

    Science.gov (United States)

    Karakochuk, Crystal D; Michaux, Kristina D; Chai, Tze L; Chan, Benny B; Whitfield, Kyly C; Barr, Susan I; McLean, Judy; Talukder, Aminuzzaman; Hou, Kroeun; Ly, Sokhoing; Green, Tim J

    2016-03-03

    Iodine deficiency disorders are estimated to affect over 1.9 million people worldwide. Iodine deficiency is especially serious for women during pregnancy and lactation because of the negative consequences for both mother and infant. The aim of this cross-sectional study was to determine the median urinary iodine concentration (UIC) as a population-level indicator of iodine status among rural women farmers of reproductive age (18-45 years) in the province of Prey Veng, Cambodia. A total of 450 women provided a spot morning urine sample in 2012. Of those women, 93% (n = 420) were non-pregnant and 7% (n = 30) were pregnant at the time of collection. UIC was quantified using the Sandell-Kolthoff reaction with modifications. The median UIC of non-pregnant (139 μg/L) and pregnant women (157 μg/L) were indicative of adequate iodine status using the WHO/UNICEF/ICCIDD epidemiological criteria for both groups (median UIC between 100-199 and 150-249 μg/L, respectively). We conclude that non-pregnant and pregnant women in rural Prey Veng, Cambodia had adequate iodine status based on single spot morning urine samples collected in 2012. More research is warranted to investigate iodine status among larger and more representative populations of women in Cambodia, especially in light of recent policy changes to the national program for universal salt iodization.

  17. Combined laryngeal inflammation and trauma mediate long-lasting immunoreactivity response in the brainstem sensory nuclei in the rat

    Directory of Open Access Journals (Sweden)

    Kristina eSimonyan

    2012-11-01

    Full Text Available Somatosensory feedback from the larynx plays a critical role in regulation of normal upper airway functions, such as breathing, deglutition and voice production, while altered laryngeal sensory feedback is known to elicit a variety of pathological reflex responses, including persistent coughing, dysphonia and laryngospasm. Despite its clinical impact, the central mechanisms underlying the development of pathological laryngeal responses remain poorly understood. We examined the effects of persistent vocal fold (VF inflammation and trauma, as frequent causes of long-lasting modulation of laryngeal sensory feedback, on brainstem immunoreactivity in the rat. Combined VF inflammation and trauma were induced by injection of lipopolysaccharide (LPS solution and compared to VF trauma alone from injection of vehicle solution and to controls without any VF manipulations. Using a c-fos marker, we found significantly increased Fos-like immunoreactivity (FLI in the bilateral intermediate/parvicellular reticular formation (IRF/PCRF with a trend in the left solitary tract nucleus (NTS only in animals with LPS-induced VF inflammation and trauma. Further, FLI in the right NTS was significantly correlated with the severity of LPS-induced VF changes. However, increased brainstem FLI response was not associated with FLI changes in the first-order neurons of the laryngeal afferents located in the nodose and jugular ganglia in either group. Our data indicate that complex VF alterations (i.e., inflammation/trauma vs. trauma alone may cause prolonged excitability of the brainstem nuclei receiving a direct sensory input from the larynx, which, in turn, may lead to (malplastic changes within the laryngeal central sensory control.

  18. [Associations of obesity and physical activity with cognition in people aged 50 and above in Shanghai].

    Science.gov (United States)

    Huang, Z Z; Zhang, Y C; Zheng, Y; Guo, Y F; Ruan, Y; Sun, S Y; Shi, Y; Gao, S N; Ye, J H; Yan, Y J; Wu, K; Xu, R F; Wu, F

    2018-03-10

    Objective: To investigate the associations of obesity and physical activity with cognition in the elderly. Methods: A cross-sectional survey was conducted from October 2009 to June 2010 among people aged ≥50 years selected through multistage random cluster sampling in Shanghai. The subjects' body weight, body height, waist circumference and hip circumference were measured to calculate body mass index (BMI) and waist-hip ratio (WHR), and the data on self-reported physical activity level were collected through questionnaire survey. A comprehensive battery of cognitive tests was conducted to assess subjects' cognitive functions, including verbal recall, forward digit span (FDS), backward digit span (BDS), and verbal fluency (VF). General linear model was used to examine the associations of BMI, WHR and physical activity with cognition. Results: A total of 7 913 participants were included, with a median age of 60 years. Age, sex, education level, income level, BMI, WHR and physical activity level were significantly associated with cognitive scores in univariate analysis. After adjusted for age, sex, education level and income level, BMI was no longer significantly associated with cognitive scores in all cognitive functions (all P >0.01). WHR was significantly associated with VF score ( P cognitive functions ( P cognitive functions ( P cognition level in the elderly, suggesting that waist circumference control and physical activity might help maintain cognition in the elderly.

  19. Factors Associated with Low-Level Viraemia and Virological Failure: Results from the Austrian HIV Cohort Study.

    Directory of Open Access Journals (Sweden)

    Gisela Leierer

    Full Text Available In human immunodeficiency virus treatment adequate virological suppression is warranted, nevertheless for some patients it remains a challenge. We investigated factors associated with low-level viraemia (LLV and virological failure (VF under combined antiretroviral therapy (cART.We analysed patients receiving standard regimens between 1st July 2012 and 1st July 2013 with at least one viral load (VL measurement below the quantification limit (BLQ in their treatment history. After a minimum of 6 months of unmodified cART, the next single VL measurement within 6 months was analysed. VF was defined as HIV RNA levels ≥ 200 copies/mL and all other quantifiable measurements were classified as LLV. Factors associated with LLV and VF compared to BLQ were identified by logistic regression models.Of 2276 participants, 1972 (86.6% were BLQ, 222 (9.8% showed LLV and 82 (3.6% had VF. A higher risk for LLV and VF was shown in patients with cART interruptions and in patients with boosted PI therapy. The risk for LLV and VF was lower in patients from centres using the Abbott compared to the Roche assay to measure VL. A higher risk for LLV but not for VF was found in patients with a higher VL before cART [for >99.999 copies/mL: aOR (95% CI: 4.19 (2.07-8.49; for 10.000-99.999 copies/mL: aOR (95% CI: 2.52 (1.23-5.19] and shorter cART duration [for <9 months: aOR (95% CI: 2.59 (1.38-4.86]. A higher risk for VF but not for LLV was found in younger patients [for <30 years: aOR (95% CI: 2.76 (1.03-7.35; for 30-50 years: aOR (95% CI: 2.70 (1.26-5.79], people originating from high prevalence countries [aOR (95% CI: 2.20 (1.09-4.42] and in male injecting drug users [aOR (95% CI: 2.72 (1.38-5.34].For both VF and LLV, factors associated with adherence play a prominent role. Furthermore, performance characteristics of the diagnostic assay used for VL quantification should also be taken into consideration.

  20. Median sternotomy and ventral stabilisation using pins and polymethylmethacrylate for a comminuted T5 vertebral fracture in a Miniature Schnauzer.

    Science.gov (United States)

    Guiot, L P; Allman, D A

    2011-01-01

    A 2.9 kg Miniature Schnauzer was referred to our clinic, the Emergency & Critical Care Medicine Service at the Michigan State University Veterinary Teaching Hospital, following a dog fight. Physical examination findings upon admission included multiple thoracic wounds, absence of hindlimb deep pain, and marked Schiff-Sherrington syndrome. Computed tomography imaging revealed thoracic wall penetration and a comminuted T5 vertebral fracture. Thoracic exploration and thoracic wall repair were performed through a median sternotomy. The vertebral fracture was exposed and stabilised intra-thoracically through the same approach using pins and polymethylmethacrylate. The pins were placed percutaneously into the vertebral bodies of the adjacent vertebrae. Recovery was uncomplicated and fracture healing was documented eight weeks postoperatively. Spinal trauma secondary to dog fights is relatively common. The presence of concurrent penetrating thoracic injury negatively affects prognosis and necessitates thoracic exploration as soon as feasible. The approach should allow complete thoracic exploration to repair parietal and visceral damage, thus indicating the need for median sternotomy rather than an intercostal approach. The present case report suggested that median sternotomy can be used to safely apply stabilisation devices for the treatment of concurrent spinal trauma. Direct visualisation of the vertebral bodies permitted optimal implant anchorage as compared to potentially more hazardous techniques such as dorsal pinning.

  1. 77 FR 20354 - Meetings; Sunshine Act

    Science.gov (United States)

    2012-04-04

    ... storage tank containing flammable vinyl fluoride (VF). The VF vapor from interconnected, in-service... record of this incident. The Board will also consider whether to approve the CSB's draft 2012-2016...

  2. Approximate median regression for complex survey data with skewed response.

    Science.gov (United States)

    Fraser, Raphael André; Lipsitz, Stuart R; Sinha, Debajyoti; Fitzmaurice, Garrett M; Pan, Yi

    2016-12-01

    The ready availability of public-use data from various large national complex surveys has immense potential for the assessment of population characteristics using regression models. Complex surveys can be used to identify risk factors for important diseases such as cancer. Existing statistical methods based on estimating equations and/or utilizing resampling methods are often not valid with survey data due to complex survey design features. That is, stratification, multistage sampling, and weighting. In this article, we accommodate these design features in the analysis of highly skewed response variables arising from large complex surveys. Specifically, we propose a double-transform-both-sides (DTBS)'based estimating equations approach to estimate the median regression parameters of the highly skewed response; the DTBS approach applies the same Box-Cox type transformation twice to both the outcome and regression function. The usual sandwich variance estimate can be used in our approach, whereas a resampling approach would be needed for a pseudo-likelihood based on minimizing absolute deviations (MAD). Furthermore, the approach is relatively robust to the true underlying distribution, and has much smaller mean square error than a MAD approach. The method is motivated by an analysis of laboratory data on urinary iodine (UI) concentration from the National Health and Nutrition Examination Survey. © 2016, The International Biometric Society.

  3. Low Median Nerve Palsy as Initial Manifestation of Churg-Strauss Syndrome.

    Science.gov (United States)

    Roh, Young Hak; Koh, Young Do; Noh, Jung Ho; Gong, Hyun Sik; Baek, Goo Hyun

    2017-06-01

    Anterior interosseous nerve (AIN) syndrome is typically characterized by forearm pain and partial or complete dysfunction of the AIN-innervated muscles. Although the exact etiology and pathophysiology of the disorder remain unclear, AIN syndrome is increasingly thought to be an inflammatory condition of the nerve rather than a compressive neuropathy because the symptoms often resolve spontaneously following prolonged observation. However, peripheral neuropathy can be 1 of the first symptoms of systemic vasculitis that needs early systemic immunotherapy to prevent extensive nerve damage. Churg-Strauss syndrome (CSS; eosinophilic granulomatosis with polyangiitis) is 1 type of primary systemic vasculitis that frequently damages the peripheral nervous system. CSS-associated neuropathy usually involves nerves of the lower limb, and few studies have reported on the involvement of the upper limb alone. We report on a rare case of low median nerve palsy as the initial manifestation of CSS. The patient recovered well with early steroid treatment for primary systemic vasculitis. Copyright © 2017 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

  4. Clinical importance of median mandibular flexure in oral rehabilitation: a review.

    Science.gov (United States)

    Sivaraman, K; Chopra, A; Venkatesh, S B

    2016-03-01

    The mandible has a property to flex inwards around the mandibular symphysis with change in shape and decrease in mandibular arch width during opening and protrusion of the mandible. The mandibular deformation may range from a few micrometres to more than 1 mm. The movement occurs because of the contraction of lateral pterygoid muscles that pulls mandibular condyles medially and causes a sagittal movement of the posterior segments. This movement of mandible can have a profound influence on prognosis and treatment outcome for various restorative, endodontics, fixed, removable and implant-related prosthesis. The review unfolds the causes, importance and clinical implications of median mandibular flexure in oral rehabilitation. This review also highlights the appropriate preventive measures and techniques that should be adopted by clinicians to minimise the effect of flexural movement of the jaw during oral rehabilitation. This would not only help clinicians to achieve a good prosthesis with accurate fit and longevity but also maintain the health of the surrounding periodontal or periimplant gingival tissues and bone. © 2015 John Wiley & Sons Ltd.

  5. Planning the City Logistics Terminal Location by Applying the Green p-Median Model and Type-2 Neurofuzzy Network.

    Science.gov (United States)

    Pamučar, Dragan; Vasin, Ljubislav; Atanasković, Predrag; Miličić, Milica

    2016-01-01

    The paper herein presents green p-median problem (GMP) which uses the adaptive type-2 neural network for the processing of environmental and sociological parameters including costs of logistics operators and demonstrates the influence of these parameters on planning the location for the city logistics terminal (CLT) within the discrete network. CLT shows direct effects on increment of traffic volume especially in urban areas, which further results in negative environmental effects such as air pollution and noise as well as increased number of urban populations suffering from bronchitis, asthma, and similar respiratory infections. By applying the green p-median model (GMM), negative effects on environment and health in urban areas caused by delivery vehicles may be reduced to minimum. This model creates real possibilities for making the proper investment decisions so as profitable investments may be realized in the field of transport infrastructure. The paper herein also includes testing of GMM in real conditions on four CLT locations in Belgrade City zone.

  6. Planning the City Logistics Terminal Location by Applying the Green p-Median Model and Type-2 Neurofuzzy Network

    Directory of Open Access Journals (Sweden)

    Dragan Pamučar

    2016-01-01

    Full Text Available The paper herein presents green p-median problem (GMP which uses the adaptive type-2 neural network for the processing of environmental and sociological parameters including costs of logistics operators and demonstrates the influence of these parameters on planning the location for the city logistics terminal (CLT within the discrete network. CLT shows direct effects on increment of traffic volume especially in urban areas, which further results in negative environmental effects such as air pollution and noise as well as increased number of urban populations suffering from bronchitis, asthma, and similar respiratory infections. By applying the green p-median model (GMM, negative effects on environment and health in urban areas caused by delivery vehicles may be reduced to minimum. This model creates real possibilities for making the proper investment decisions so as profitable investments may be realized in the field of transport infrastructure. The paper herein also includes testing of GMM in real conditions on four CLT locations in Belgrade City zone.

  7. Solidification microstructures in a short fiber reinforced alloy composite containing different fiber fractions

    Directory of Open Access Journals (Sweden)

    JING Qing-xiu

    2006-02-01

    Full Text Available The solidification microstructures and micro-segregation of a fiber reinforced Al-9 Cu alloy, containing different volume fractions of Al2O3 short fibers about 6 μm diameter and made by squeeze casting have been studied. The results indicate that as volume fraction of fiber Vf increases, the size of final grains becomes finer in the matrix. If λf /λ>1, the fibers have almost no influence on the solidification behavior of the matrix, so the final grains grow coarse, where λf is the average inter-fiber spacing and λ is the secondary dendrite arm spacing. While if λf /λ<1, the growth of crystals in the matrix is affected significantly by the fibers and the grain size is reduced to the value of the inter-fiber spacing. The fibers influence the average length of a solidification volume element L of the matrix and also influence the solidification time θt of the matrix. As a result of fibers influencing L and θt, the micro-segregation in the matrix is improved when the composite contains more fibers, although the level of the improvement is slight. The Clyne-Kurz model can be used to semi-quantitatively analyze the relationship between Vf and the volume fraction fe of the micro-segregation eutectic structure.

  8. Median Survival Time of Endometrial Cancer Patients with Lymphovascular Invasion at the Hospital Universiti Sains Malaysia.

    Science.gov (United States)

    Asyikeen, Wan Adnan Wan Nor; Siti-Azrin, Ab Hamid; Jalil, Nur Asyilla Che; Zin, Anani Aila Mat; Othman, Nor Hayati

    2016-11-01

    Endometrial cancer is the most common gynaecologic malignancy among females worldwide. The purpose of this study was to determine the median survival time of endometrial cancer patients at the Hospital Universiti Sains Malaysia (USM). A list of 121 endometrial cancer cases registered at Hospital USM between 2000 until 2011 was retrospectively reviewed. The survival time of the endometrial cancer patients was estimated by Kaplan-Meier survival analysis. Log-rank tests were performed to compare the survival of the patients based on socio-demographics and clinical presentation. Only 108 patients, 87.0%, were included who were of Malay ethnicity. Previous history included menopause in 67.6% of patients and diabetes mellitus in 39.8% of patients; additionally, 63.4% of patients were nulliparous. Tumour staging was as follows: 24.5% stage I, 10.8% stage II, 26.5% stage III and 38.2% stage IV. The overall median survival time of the endometrial cancer patients was 70.20 months (95% confidence interval (CI): 51.79, 88.61). The significant factors were age, the presence of lymphovascular invasion and treatment received. The overall survival of endometrial cancer was low. A prospective study needs to be carried out to discover more effective and accurate tests for the early detection of endometrial cancer.

  9. Difference in the Clinical Characteristics of Ventricular Fibrillation Occurrence in the Early Phase of an Acute Myocardial Infarction Between Patients With and Without J Waves.

    Science.gov (United States)

    Naruse, Yoshihisa; Nogami, Akihiko; Harimura, Yoshie; Ishibashi, Mayu; Noguchi, Yuichi; Sekiguchi, Yukio; Sato, Akira; Aonuma, Kazutaka

    2015-08-01

    We recently showed that the presence of J waves increases the risk of ventricular fibrillation (VF) occurrence in the early phase of an acute myocardial infarction (AMI). This study aimed to evaluate the clinical characteristics of VF occurrences in the early phase of an AMI between patients with and without J waves. This retrospective, observational study included 281 consecutive patients with an AMI (69 ± 12 years; 207 men) in whom 12-lead ECGs before AMI onset could be evaluated. The patients were classified based on a VF occurrence J waves. J waves were electrocardiographically defined as an elevation of the terminal portion of the QRS complex of >0.1 mV from baseline in at least 2 contiguous inferior or lateral leads. VF occurred in 24 patients, and J waves were present in 37. VF occurrence was more prevalent in the patients with than without J waves (27% vs. 6%; P J waves, peak creatine kinase level (P J waves, there was no significant difference in these variables. There was no association between the location of J waves and the infarct area. In patients with AMI, those with J waves were more likely to develop VF and less likely to have high-risk clinical characteristics than those without J waves. © 2015 Wiley Periodicals, Inc.

  10. Does early verbal fluency decline after STN implantation predict long-term cognitive outcome after STN-DBS in Parkinson's disease?

    Science.gov (United States)

    Borden, Alaina; Wallon, David; Lefaucheur, Romain; Derrey, Stéphane; Fetter, Damien; Verin, Marc; Maltête, David

    2014-11-15

    An early and transient verbal fluency (VF) decline and impairment in frontal executive function, suggesting a cognitive microlesion effect may influence the cognitive repercussions related to subthalamic nucleus deep brain stimulation (STN-DBS). Neuropsychological tests including semantic and phonemic verbal fluency were administered both before surgery (baseline), the third day after surgery (T3), at six months (T180), and at an endpoint multiple years after surgery (Tyears). Twenty-four patients (mean age, 63.5 ± 9.5 years; mean disease duration, 12 ± 5.8 years) were included. Both semantic and phonemic VF decreased significantly in the acute post-operative period (44.4 ± 28.2% and 34.3 ± 33.4%, respectively) and remained low at 6 months compared to pre-operative levels (decrease of 3.4 ± 47.8% and 10.8 ± 32.1%) (P < 0.05). Regression analysis showed phonemic VF to be an independent factor of decreased phonemic VF at six months. Age was the only independent predictive factor for incident Parkinson's disease dementia (PDD) (F (4,19)=3.4, P<0.03). An acute post-operative decline in phonemic VF can be predictive of a long-term phonemic VF deficit. The severity of this cognitive lesion effect does not predict the development of dementia which appears to be disease-related. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Decline in verbal fluency after subthalamic nucleus deep brain stimulation in Parkinson's disease: a microlesion effect of the electrode trajectory?

    Science.gov (United States)

    Le Goff, Floriane; Derrey, Stéphane; Lefaucheur, Romain; Borden, Alaina; Fetter, Damien; Jan, Maryvonne; Wallon, David; Maltête, David

    2015-01-01

    Decline in verbal fluency (VF) is frequently reported after chronic deep brain stimulation (DBS) of the subthalamic nucleus (STN) in Parkinson disease (PD). We investigated whether the trajectory of the implanted electrode correlate with the VF decline 6 months after surgery. We retrospectively analysed 59 PD patients (mean age, 61.9 ± 7; mean disease duration, 13 ± 4.6) who underwent bilateral STN-DBS. The percentage of VF decline 6 months after STN-DBS in the on-drug/on-stimulation condition was determined in respect of the preoperative on-drug condition. The patients were categorised into two groups (decline and stable) for each VF. Cortical entry angles, intersection with deep grey nuclei (caudate, thalamic or pallidum), and anatomical extent of the STN affected by the electrode pathway, were compared between groups. A significant decline of both semantic and phonemic VF was found after surgery, respectively 14.9% ± 22.1 (P < 0.05) and 14.2% ± 30.3 (P < 0.05). Patients who declined in semantic VF (n = 44) had a left trajectory with a more anterior cortical entry point (56 ± 53 versus 60 ± 55 degree, P = 0.01) passing less frequently trough the thalamus (P = 0.03). Microlesion of left brain regions may contribute to subtle cognitive impairment following STN-DBS in PD.

  12. Prevalence of vertebral fractures and quality of life in a sample of postmenopausal Brazilian women with osteoporosis.

    Science.gov (United States)

    de Oliveira Ferreira, Néville; da Silva, Raimunda Beserra; Arthuso, Michael; Pinto-Neto, Aarão Mendes; Caserta, Nelson; Costa-Paiva, Lúcia

    2012-01-01

    The prevalence of vertebral fracture was high in postmenopausal Brazilian osteoporotic women; quality of life was impaired regardless of vertebral fractures, despite a direct correlation between the number of vertebral fractures and a worse quality of life score. The purpose of this study is to evaluate the prevalence of vertebral fractures (VF), quality of life (QOL), association between number of VF and QOL scores, and correlate the factors associated with QOL in a sample of postmenopausal Brazilian women with osteoporosis. A cross-sectional study of 126 postmenopausal osteoporotic women aged 55-80 years was conducted. Women were interviewed about sociodemographic and clinical data, responded to QUALEFFO-41 questionnaire, and underwent vertebral radiography to measure the anterior, mean, and posterior height at each vertebra (T4 to L5). VF were classified as anterior wedge, posterior wedge, central collapse, and crush. Data was expressed as means (±SD) and frequencies, Mann-Whitney or Student's T tests were used to compare means, and odds ratio and 95 % confidence interval were used for multiple regression analysis. Values were significant when P value obesity, unemployment, sedentary lifestyle, low level of school education, and non-use of osteoporosis drugs. There was a high prevalence of VF in Brazilian postmenopausal women with osteoporosis. QOL was impaired regardless of VF, despite a direct correlation between number of VF and a worse QOL score.

  13. Characteristics associated with virologic failure in high-risk HIV-positive participants with prior failure: a post hoc analysis of ACTG 5251.

    Science.gov (United States)

    Robbins, Gregory K; Cohn, Susan E; Harrison, Linda J; Smeaton, Laura; Moran, Laura; Rusin, David; Dehlinger, Marjorie; Flynn, Theresa; Lammert, Sara; Wu, Albert W; Safren, Steven A; Reynolds, Nancy R

    2016-07-01

    Patients with prior virologic failure (VF) are at an increased risk of subsequent failure, emergence of resistance, and death. This analysis identifies outcomes and correlates of VF in a high-risk population. A5251 was designed to evaluate an enhanced adherence counseling intervention delivered by nurses from a central call site on virologic suppression. Due to slow enrollment, the study was closed prematurely and revised study endpoints were evaluated (week 24 VF (HIV-1 RNA ≥200 copies/ml) and non-perfect adherence (antiretroviral regimen changes were three and the co-morbidity in this population was higher than typical for HIV clinical trials. At week 24 (n = 41), 24 (59%) failed to reach virologic suppression (HIV-1 RNA perceptions (IPQ-B) were associated with week 24 non-adherence. Early clinical assessments (week 12 HIV-RNA ≥200 copies/mL and non-perfect adherence) as well as higher depression and adverse illness perceptions were associated with week 24 VF. In this high-risk population, the proportion of participants with suboptimal adherence and VF was unacceptably high. Interventions to address this treatment gap are clearly needed. Depression and a higher illness perception score, failure to achieve virologic suppression by week 12, and less than perfect adherence could be used to target individuals for early interventions in treatment-experienced, high-risk individuals at high risk for VF.

  14. Bioelectrical impedance and visceral fat: a comparison with computed tomography in adults and elderly; Bioimpedancia eletrica e gordura visceral: uma comparacao com a tomografia computadorizada em adultos e idosos

    Energy Technology Data Exchange (ETDEWEB)

    Eickemberg, Michaela [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Roriz, Anna Karla Carneiro [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Fontes, Gardenia Abreu Vieira [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Sampaio, Lilian Ramos [Universidade Federal de Sao Paulo (Unifesp), Sao Paulo, SP (Brazil)

    2013-05-01

    Objective: To evaluate the association between electrical bioimpedance analysis (BIA) and visceral fat (VF) in adult and elderly patients. Subjects and methods: This was a cross-sectional study, with a sample of 191 subjects (52% women, 49% elderly) stratified by sex, age and body mass. Computerized tomography (VF area) and BIA (percentage of total body fat (%TBF-BIA), phase angle, reactance and resistance) data were generated. Statistical analysis was based on Pearson's Correlation Coefficient, Anova, Pearson's Chi-square, and ROC curves. Results: VF areas {>=} 130 cm{sup 2} were more prevalent among the elderly and among men. Adult females showed a stronger correlation between GV and %TBF-BIA. The other groups showed similar results and statistically significant correlations. Correlations between GV and phase angle were weak and not statistically significant. ROC Curves analyzes showed the following %TBF-BIA, which identified excess VF: for male subjects: 21.5% (adults) and 24.25% (elderly); for female subjects: 35.05% (adults) and 38.45% (elderly) with sensitivity of 78.6%, 82.1%, 83.3%, and 66.7%, and specificity of 70.6%, 62.5%, 79.1%, and 69%, respectively. Conclusion: BIA was found to have satisfactory sensitivity and specificity to predict VF; however, other devices and other techniques should be investigated to improve VF prediction. (author)

  15. Evaluation of Visual Field and Imaging Outcomes for Glaucoma Clinical Trials (An American Ophthalomological Society Thesis).

    Science.gov (United States)

    Garway-Heath, David F; Quartilho, Ana; Prah, Philip; Crabb, David P; Cheng, Qian; Zhu, Haogang

    2017-08-01

    To evaluate the ability of various visual field (VF) analysis methods to discriminate treatment groups in glaucoma clinical trials and establish the value of time-domain optical coherence tomography (TD OCT) imaging as an additional outcome. VFs and retinal nerve fibre layer thickness (RNFLT) measurements (acquired by TD OCT) from 373 glaucoma patients in the UK Glaucoma Treatment Study (UKGTS) at up to 11 scheduled visits over a 2 year interval formed the cohort to assess the sensitivity of progression analysis methods. Specificity was assessed in 78 glaucoma patients with up to 11 repeated VF and OCT RNFLT measurements over a 3 month interval. Growth curve models assessed the difference in VF and RNFLT rate of change between treatment groups. Incident progression was identified by 3 VF-based methods: Guided Progression Analysis (GPA), 'ANSWERS' and 'PoPLR', and one based on VFs and RNFLT: 'sANSWERS'. Sensitivity, specificity and discrimination between treatment groups were evaluated. The rate of VF change was significantly faster in the placebo, compared to active treatment, group (-0.29 vs +0.03 dB/year, P <.001); the rate of RNFLT change was not different (-1.7 vs -1.1 dB/year, P =.14). After 18 months and at 95% specificity, the sensitivity of ANSWERS and PoPLR was similar (35%); sANSWERS achieved a sensitivity of 70%. GPA, ANSWERS and PoPLR discriminated treatment groups with similar statistical significance; sANSWERS did not discriminate treatment groups. Although the VF progression-detection method including VF and RNFLT measurements is more sensitive, it does not improve discrimination between treatment arms.

  16. SCN5A mutations and polymorphisms in patients with ventricular fibrillation during acute myocardial infarction.

    Science.gov (United States)

    Boehringer, Tim; Bugert, Peter; Borggrefe, Martin; Elmas, Elif

    2014-10-01

    Mutations in the SCN5A gene encoding the Nav1.5 channel α-subunit are known to be risk factors of arrhythmia, including Brugada Syndrome and Long QT syndrome subtype 3. The present study focused on the role of SCN5A variants in the development of ventricular fibrillation (VF) during acute myocardial infarction (AMI). Since VF during AMI is the major cause of sudden death in the Western world, SCN5A mutations represent genetic risk factors for sudden death. By exon re-sequencing, the entire coding region and flanking intron regions were sequenced in 46 AMI/VF+ patients. In total, nine single nucleotide variants were identified of which four represented common single nucleotide polymorphisms (SNPs; 87G>A, 1673A>G, IVS16‑6C>T and 5457T>A). Only five rare variants were identified, each in only one patient. Only two of the rare variants represented missense mutations (3578G>A and 4786T>A). The common SNPs and the missense mutations were also genotyped using polymerase chain reaction methods in 79 AMI/VF‑ patients and 480 healthy controls. The SNPs did not demonstrate significant differences in allele and genotype frequencies between the study groups. The 3578G>A mutation was identified in one out of the 480 controls, whereas the 4786T>A mutation was not present in AMI/VF- patients and controls. In conclusion, the majority of AMI/VF+ patients demonstrated a wild type sequence or common SNPs in SCN5A. Only two out of 46 (4.3%) AMI/VF+ patients revealed mutations that may be involved in Nav1.5 dysfunction and VF. However, this requires further functional validation.

  17. Dicty_cDB: [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFB603 (Link to dictyBase) - - - Contig-U16505-1 VFB603Z (Link... to Original site) - - VFB603Z 496 - - - - Show VFB603 Library VF (Link to library) Clone ID VFB603 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16505-1 Original site URL http://dict...al 4.0 %: cytoskeletal 4.0 %: vesicles of secretory system 4.0 %: endoplasmic reticulum >> prediction for VF

  18. Results of ENHANCED Implantable Cardioverter Defibrillator Programming to Reduce Therapies and Improve Quality of Life (from the ENHANCED-ICD Study)

    DEFF Research Database (Denmark)

    Mastenbroek, Mirjam H.; Pedersen, Susanne S.; van der Tweel, Ingeborg

    2016-01-01

    -reported outcomes. The "ENHANCED Implantable Cardioverter Defibrillator programming to reduce therapies and improve quality of life" study (ENHANCED-ICD study) was a prospective, safety-monitoring study enrolling 60 primary and secondary prevention patients at the University Medical Center Utrecht. Patients...... programming strategy, unnecessary ICD therapy was prevented in 10% of ENHANCED-ICD patients during a median follow-up period of 1.3 years. With respect to patient-reported outcomes, levels of distress were highest and perceived health status lowest at the time of implantation, which both gradually improved...... during follow-up. In conclusion, the ENHANCED-ICD study demonstrates that programming a NID 60/80 for VT/VF detection is safe for ICD patients and does not negatively impact their quality of life....

  19. Dynamic plastic buckling of shells: a reconsideration of the Vaughan--Florence analysis

    International Nuclear Information System (INIS)

    Horvay, G.; Veluswami, M.A.; Stockton, F.D.

    1979-01-01

    A study aimed at extending the VF analysis to encompass axial variation of the impulse load revealed that the Ω 2 term may not be neglected, because it constitutes the only restraint on the motion that is caused by the departure from axial uniformity. This suggested reconsidering also the original VF analysis, for axial uniformity, with the Ω 2 term retained. It is found that the maximum amplification is drastically reduced by retention of the Ω 2 term, by a factor close to 3 in VF's example, and is reached in a time about 25% below that given by VF. Their critical mode number is only slightly shifted: from n = 16 to n = 17. Various ramifications of the numerical integration scheme are also explored. It is found that about N = 20000 integration steps is optimal

  20. Induced Monoculture in Axelrod Model with Clever Mass Media

    Science.gov (United States)

    Rodríguez, Arezky H.; Del Castillo-Mussot, M.; Vázquez, G. J.

    A new model is proposed, in the context of Axelrod's model for the study of cultural dissemination, to include an external vector field (VF) which describes the effects of mass media on social systems. The VF acts over the whole system and it is characterized by two parameters: a nonnull overlap with each agent in the society and a confidence value of its information. Beyond a threshold value of the confidence, there is induced monocultural globalization of the system lined up with the VF. Below this value, the multicultural states are unstable and certain homogenization of the system is obtained in opposite line up according to that we have called negative publicity effect. Three regimes of behavior for the spread process of the VF information as a function of time are reported.

  1. The impact of serum potassium-influencing antihypertensive drugs on the risk of out-of-hospital cardiac arrest: A case-control study

    NARCIS (Netherlands)

    Alharbi, Fawaz F.; Souverein, Patrick C.; de Groot, Mark C. H.; Blom, Marieke T.; de Boer, Anthonius; Klungel, Olaf H.; Tan, Hanno L.

    2017-01-01

    AimsSudden cardiac arrest (SCA) is a complex multifactorial event and most commonly caused by ventricular tachycardia/ fibrillation (VT/ VF). Some antihypertensive drugs could induce hypokalaemia or hyperkalaemia, which may increase susceptibility to VT/VF and SCA. ObjectiveTo assess the association

  2. Effectiveness of pollutants removal in hybrid constructed wetlands – different configurations case study

    Directory of Open Access Journals (Sweden)

    Gajewska Magdalena

    2017-01-01

    Full Text Available In recent years, an increase in interest in hybrid constructed wetland systems (HCWs has been observed. The aim of the paper is to compare different HCW configurations in terms of mass removal rates and efficiency of pollutants removal. Analysed data have been collected at multistage constructed wetlands in Poland, which are composed by at least two beds: horizontal subsurface flow (SSHF and vertical subsurface flow (SSVF. The evaluation was focused on hybrid constructed wetlands performance with HF+VF vs. VF+HF configuration, where influent wastewater of the same composition was treated. In analysed HCWs, the effective removal of organic matter from 75.2 to 91.6% COD was confirmed. Efficiency of total nitrogen removal varied from 47.3 to 91.7%. The most effective removal of TN (8.3 g m−2 d−1 occurred in the system with VF+VF+HF configuration.

  3. Final disposition and quality auditing of the rehabilitation process in wild raptors admitted to a Wildlife Rehabilitation Centre in Catalonia, Spain, during a twelve year period (1995-2007.

    Directory of Open Access Journals (Sweden)

    Rafael A Molina-López

    Full Text Available BACKGROUND: Variability in reporting and classification methods in previous published data of the final dispositions in the rehabilitation of wild raptors makes use of this data limited in trying to audit the quality of the rehabilitation process. Crude as well as stratified disposition rates are needed if quality auditing of the rehabilitation process is to be adequately performed. METHODOLOGY: Final dispositions of 6221 hospitalized wild raptors admitted at a wildlife rehabilitation centre (WRC of Catalonia during 1995-2007 were analyzed. These dispositions were calculated as the euthanasia (Er, unassisted mortality (Mr, release (Rr and captivity rates (Cr., time to death (Td for dead and euthanized raptors, and length of stay for released (Tr raptors was estimated. Stratified analyses by main causes of admission and clinical signs were performed. RESULTS: THE DISPOSITION FOR THE TOTAL POPULATION WERE: Er = 30.6%, Mr = 19.1%, Rr = 47.2%, and Cr = 3%. By main causes of admission, Er was higher in the trauma category (34.2%, whereas Mr was found similar between trauma (37.4% and non-trauma categories (34.8%. The highest Rr was observed for the orphaned group (77.9%. Furthermore, Cr was low in all the categories (<4%. By clinical signs, the highest Er was found in animals suffering musculoskeletal (37.9% or skin (32.3% lesions; Mr was high in infectious/parasitic diseases (66.7% and in case of neurological symptoms (64.5%. The euthanized birds had a median Td = 1 day (P10 = 0-P90 = 59 for both trauma and non-trauma categories, and Td = 36 days for the orphaned young group (P10 = 0; P90 = 596. The median Td in the unassisted dead birds was 2 days for all the categories (P10 = 0-P90 = 31. Finally, the median Tr in the centre was variable among categories. CONCLUSIONS/SIGNIFICANCE: Reporting of final dispositions in wildlife rehabilitation should include the crude and stratified rates (Er, Mr, Rr, and Cr, by causes and clinical presentation, as well

  4. Clinical observed performance evaluation: a prospective study in final year students of surgery.

    LENUS (Irish Health Repository)

    Markey, G C

    2010-06-24

    We report a prospective study of clinical observed performance evaluation (COPE) for 197 medical students in the pre-qualification year of clinical education. Psychometric quality was the main endpoint. Students were assessed in groups of 5 in 40-min patient encounters, with each student the focus of evaluation for 8 min. Each student had a series of assessments in a 25-week teaching programme. Over time, several clinicians from a pool of 16 surgical consultants and registrars evaluated each student by direct observation. A structured rating form was used for assessment data. Variance component analysis (VCA), internal consistency and inter-rater agreement were used to estimate reliability. The predictive and convergent validity of COPE in relation to summative OSCE, long case, and overall final examination was estimated. Median number of COPE assessments per student was 7. Generalisability of a mean score over 7 COPE assessments was 0.66, equal to that of an 8 x 7.5 min station final OSCE. Internal consistency was 0.88-0.97 and inter-rater agreement 0.82. Significant correlations were observed with OSCE performance (R = 0.55 disattenuated) and long case (R = 0.47 disattenuated). Convergent validity was 0.81 by VCA. Overall final examination performance was linearly related to mean COPE score with standard error 3.7%. COPE permitted efficient serial assessment of a large cohort of final year students in a real world setting. Its psychometric quality compared well with conventional assessments and with other direct observation instruments as reported in the literature. Effect on learning, and translation to clinical care, are directions for future research.

  5. Accretion of visceral fat and hepatic insulin resistance in pregnant rats.

    Science.gov (United States)

    Einstein, Francine H; Fishman, Sigal; Muzumdar, Radhika H; Yang, Xiao Man; Atzmon, Gil; Barzilai, Nir

    2008-02-01

    Insulin resistance (IR) is a hallmark of pregnancy. Because increased visceral fat (VF) is associated with IR in nonpregnant states, we reasoned that fat accretion might be important in the development of IR during pregnancy. To determine whether VF depots increase in pregnancy and whether VF contributes to IR, we studied three groups of 6-mo-old female Sprague-Dawley rats: 1) nonpregnant sham-operated rats (Nonpreg; n = 6), 2) pregnant sham-operated rats (Preg; n = 6), and 3) pregnant rats in which VF was surgically removed 1 mo before mating (PVF-; n = 6). VF doubled by day 19 of pregnancy (Nonpreg 5.1 +/- 0.3, Preg 10.0 +/- 1.0 g, P Insulin sensitivity was measured by hyperinsulinemic-euglycemic clamp in late gestation in chronically catheterized unstressed rats. Glucose IR (mg.kg(-1).min(-1)) was highest in Nonpreg (19.4 +/- 2.0), lowest in Preg (11.1 +/- 1.4), and intermediate in PVF- (14.7 +/- 0.6; P insulin sensitivity than Preg [hepatic glucose production (HGP): Nonpreg 4.5 +/- 1.3, Preg 9.3 +/- 0.5 mg.kg(-1).min(-1); P insulin sensitivity was similar to nonpregnant levels in PVF- (HGP 4.9 +/- 0.8 mg.kg(-1).min(-1)). Both pregnant groups had lower peripheral glucose uptake compared with Nonpreg. In parallel with hepatic insulin sensitivity, hepatic triglyceride content was increased in pregnancy (Nonpreg 1.9 +/- 0.4 vs. Preg 3.2 +/- 0.3 mg/g) and decreased with removal of VF (PVF- 1.3 +/- 0.4 mg/g; P insulin action in pregnancy.

  6. Contrasting growth properties of Nocardioides JS614 on threedifferent vinyl halides.

    Science.gov (United States)

    Taylor, Anne E; Bottomley, Peter J; Semprini, Lewis

    2018-02-01

    Ethene (ETH)-grown inocula of Nocardioides JS614 grow on vinyl chloride (VC), vinyl fluoride (VF), or vinyl bromide (VB) as the sole carbon and energy source, with faster growth rates and higher cell yields on VC and VF than on VB. However, whereas acetate-grown inocula of JS614 grow on VC and VF after a lag period, growth on VB did not occur unless supplemental ethene oxide (EtO) was present in the medium. Despite inferior growth on VB, the maximum rate of VB consumption by ETH-grown cells was ~ 50% greater than the rates of VC and VF consumption, but Br - release during VB consumption was non-stoichiometric with VB consumption (~ 66%) compared to 100% release of Cl - and F - during VC and VF consumption. Evidence was obtained for VB turnover-dependent toxicity of cell metabolism in JS614 with both acetate-dependent respiration and growth being significantly reduced by VB turnover, but no VC or VF turnover-dependent toxicity of growth was detected. Reduced growth rate and cell yield of JS614 on VB probably resulted from a combination of inefficient metabolic processing of the highly unstable VB epoxide (t 0.5  = 45 s), accompanied by growth inhibitory effects of VB metabolites on acetate-dependent metabolism. The exact role(s) of EtO in promoting growth of alkene repressed JS614 on VB remains unresolved, with evidence of EtO inducing epoxide consuming activity prior to an increase in alkene oxidizing activity and supplementing reductant supply when VB is the growth substrate.

  7. Accelerated magnetic resonance diffusion tensor imaging of the median nerve using simultaneous multi-slice echo planar imaging with blipped CAIPIRINHA

    Energy Technology Data Exchange (ETDEWEB)

    Filli, Lukas; Kenkel, David; Boss, Andreas; Manoliu, Andrei; Andreisek, Gustav; Runge, Val M.; Guggenberger, Roman [University Hospital of Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Piccirelli, Marco [University Hospital of Zurich, Department of Neuroradiology, Zurich (Switzerland); Bhat, Himanshu [Siemens Medical Solutions USA Inc, Charlestown, MA (United States)

    2016-06-15

    To investigate the feasibility of MR diffusion tensor imaging (DTI) of the median nerve using simultaneous multi-slice echo planar imaging (EPI) with blipped CAIPIRINHA. After federal ethics board approval, MR imaging of the median nerves of eight healthy volunteers (mean age, 29.4 years; range, 25-32) was performed at 3 T using a 16-channel hand/wrist coil. An EPI sequence (b-value, 1,000 s/mm{sup 2}; 20 gradient directions) was acquired without acceleration as well as with twofold and threefold slice acceleration. Fractional anisotropy (FA), mean diffusivity (MD) and quality of nerve tractography (number of tracks, average track length, track homogeneity, anatomical accuracy) were compared between the acquisitions using multivariate ANOVA and the Kruskal-Wallis test. Acquisition time was 6:08 min for standard DTI, 3:38 min for twofold and 2:31 min for threefold acceleration. No differences were found regarding FA (standard DTI: 0.620 ± 0.058; twofold acceleration: 0.642 ± 0.058; threefold acceleration: 0.644 ± 0.061; p ≥ 0.217) and MD (standard DTI: 1.076 ± 0.080 mm{sup 2}/s; twofold acceleration: 1.016 ± 0.123 mm{sup 2}/s; threefold acceleration: 0.979 ± 0.153 mm{sup 2}/s; p ≥ 0.074). Twofold acceleration yielded similar tractography quality compared to standard DTI (p > 0.05). With threefold acceleration, however, average track length and track homogeneity decreased (p = 0.004-0.021). Accelerated DTI of the median nerve is feasible. Twofold acceleration yields similar results to standard DTI. (orig.)

  8. Ethical aspects of final disposal. Final report

    International Nuclear Information System (INIS)

    Baltes, B.; Leder, W.; Achenbach, G.B.; Spaemann, R.; Gerhardt, V.

    2003-01-01

    In fulfilment of this task the Federal Environmental Ministry has commissioned GRS to summarise the current national and international status of ethical aspects of the final disposal of radioactive wastes as part of the project titled ''Final disposal of radioactive wastes as seen from the viewpoint of ethical objectives''. The questions arising from the opinions, positions and publications presented in the report by GRS were to serve as a basis for an expert discussion or an interdisciplinary discussion forum for all concerned with the ethical aspects of an answerable approach to the final disposal of radioactive wastes. In April 2001 GRS held a one-day seminar at which leading ethicists and philosophers offered statements on the questions referred to above and joined in a discussion with experts on issues of final disposal. This report documents the questions that arose ahead of the workshop, the specialist lectures held there and a summary of the discussion results [de

  9. Síndrome do Ligamento Arqueado Mediano - Relato de Caso/ Median Arcuate Ligament Syndrome – Case Report

    Directory of Open Access Journals (Sweden)

    Leandro Urquiza Marques Alves da Silva

    2013-03-01

    Full Text Available Introdução: A Síndrome do Ligamento Arqueado Mediano, também denominada Síndrome da Compressão do Tronco Celíaco decorre da compressão do Tronco Celíaco pelo ligamento Arqueado Mediano, comprometendo o fluxo sanguíneo e causando sintomas. O grau de compressão varia com as fases do ciclo respiratório, devido a mobilidade das estruturas, sendo maior na expiração. Casuística: O trabalho relata o caso de uma paciente com quadro de dor abdominal crônica, mal definida, há cerca de 25 anos. Os sintomas eram desencadeados pela ingestão de alimentos. Foram realizados exames de imagem para investigação diagnóstica que demonstraram alterações típicas da compressão do Tronco Celíaco pelo Ligamento Arqueado Mediano, como o aspecto em “gancho” na angiotomografia multislice do abdome e aumento das velocidades sistólica e diastólica, no estudo ultrassonográfico com Doppler. Discussão: Diante do quadro clínico apresentado pela paciente, estabeleceu-se o diagnóstico da Síndrome do Ligamento Arqueado Mediano, caracterizada pelos achados imagenológicos citados, associados aos sintomas de dor abdominal crônica, mal definida, geralmente desencadeada pela alimentação. Os estudos de imagem também permitiram a exclusão de outras patologias que poderiam ser a causa das dores da paciente. Conclusão: Os achados de imagem são fundamentais para o diagnóstico da síndrome, pois quando presentes têm alta especificidade e ainda podem excluir outras condições que poderiam causar dor abdominal crônica. O tratamento consiste na secção do ligamento, sua indicação ainda permanece controversa na literatura. Introduction: The Median Arcuate Ligament Syndrome, also called Syndrome Compression of the results from of Celiac Trunk compression by the ligament Arched Median, compromising blood flow and causing symptoms. The degree of compression varies with the phases of the respiratory cycle, because of the mobility of the structures

  10. The Impact of Cataract Surgery on Subjective Visual Functions and ...

    African Journals Online (AJOL)

    2016-12-13

    Dec 13, 2016 ... The second eye surgery confers additional gains in terms of VF and QoL in ... subjective visual function (VF) and QoL of our patients.[10-12]. Most similar ... For reprints contact: reprints@medknow.com. How to cite this article: ...

  11. Export of detritus and invertebrate from headwater streams: linking mountaintop removal and valley fill coal mining to downstream receiving waters

    Science.gov (United States)

    Mountaintop removal and valley fill (MTR/VF) coal mining has resulted in large scale alteration of the topography, reduced forest productivity, and burial of headwater streams in the U.S. Central Appalachians. Although MTR/VF coal mining has occurred for several decades and the ...

  12. Median filters as a tool to determine dark noise thresholds in high resolution smartphone image sensors for scientific imaging

    Science.gov (United States)

    Igoe, Damien P.; Parisi, Alfio V.; Amar, Abdurazaq; Rummenie, Katherine J.

    2018-01-01

    An evaluation of the use of median filters in the reduction of dark noise in smartphone high resolution image sensors is presented. The Sony Xperia Z1 employed has a maximum image sensor resolution of 20.7 Mpixels, with each pixel having a side length of just over 1 μm. Due to the large number of photosites, this provides an image sensor with very high sensitivity but also makes them prone to noise effects such as hot-pixels. Similar to earlier research with older models of smartphone, no appreciable temperature effects were observed in the overall average pixel values for images taken in ambient temperatures between 5 °C and 25 °C. In this research, hot-pixels are defined as pixels with intensities above a specific threshold. The threshold is determined using the distribution of pixel values of a set of images with uniform statistical properties associated with the application of median-filters of increasing size. An image with uniform statistics was employed as a training set from 124 dark images, and the threshold was determined to be 9 digital numbers (DN). The threshold remained constant for multiple resolutions and did not appreciably change even after a year of extensive field use and exposure to solar ultraviolet radiation. Although the temperature effects' uniformity masked an increase in hot-pixel occurrences, the total number of occurrences represented less than 0.1% of the total image. Hot-pixels were removed by applying a median filter, with an optimum filter size of 7 × 7; similar trends were observed for four additional smartphone image sensors used for validation. Hot-pixels were also reduced by decreasing image resolution. The method outlined in this research provides a methodology to characterise the dark noise behavior of high resolution image sensors for use in scientific investigations, especially as pixel sizes decrease.

  13. Dicty_cDB: [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFB830 (Link to dictyBase) - - - Contig-U13825-1 VFB830P (Link... to Original site) VFB830F 566 VFB830Z 634 VFB830P 1200 - - Show VFB830 Library VF (Link to library) Clone ID VFB830 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U13825-1 Original site URL http://dict...m3a: 0.00 m3b: 0.00 m_ : 1.00 56.0 %: mitochondrial 28.0 %: cytoplasmic 16.0 %: nuclear >> prediction for VF

  14. Remote Estimation of Vegetation Fraction and Yield in Oilseed Rape with Unmanned Aerial Vehicle Data

    Science.gov (United States)

    Peng, Y.; Fang, S.; Liu, K.; Gong, Y.

    2017-12-01

    This study developed an approach for remote estimation of Vegetation Fraction (VF) and yield in oilseed rape, which is a crop species with conspicuous flowers during reproduction. Canopy reflectance in green, red, red edge and NIR bands was obtained by a camera system mounted on an unmanned aerial vehicle (UAV) when oilseed rape was in the vegetative growth and flowering stage. The relationship of several widely-used Vegetation Indices (VI) vs. VF was tested and found to be different in different phenology stages. At the same VF when oilseed rape was flowering, canopy reflectance increased in all bands, and the tested VI decreased. Therefore, two algorithms to estimate VF were calibrated respectively, one for samples during vegetative growth and the other for samples during flowering stage. During the flowering season, we also explored the potential of using canopy reflectance or VIs to estimate Flower Fraction (FF) in oilseed rape. Based on FF estimates, rape yield can be estimated using canopy reflectance data. Our model was validated in oilseed rape planted under different nitrogen fertilization applications and in different phenology stages. The results showed that it was able to predict VF and FF accurately in oilseed rape with estimation error below 6% and predict yield with estimation error below 20%.

  15. Mountaintop Removal Mining and Catchment Hydrology

    Directory of Open Access Journals (Sweden)

    Andrew J. Miller

    2014-03-01

    Full Text Available Mountaintop mining and valley fill (MTM/VF coal extraction, practiced in the Central Appalachian region, represents a dramatic landscape-scale disturbance. MTM operations remove as much as 300 m of rock, soil, and vegetation from ridge tops to access deep coal seams and much of this material is placed in adjacent headwater streams altering landcover, drainage network, and topography. In spite of its scale, extent, and potential for continued use, the effects MTM/VF on catchment hydrology is poorly understood. Previous reviews focus on water quality and ecosystem health impacts, but little is known about how MTM/VF affects hydrology, particularly the movement and storage of water, hence the hydrologic processes that ultimately control flood generation, water chemistry, and biology. This paper aggregates the existing knowledge about the hydrologic impacts of MTM/VF to identify areas where further scientific investigation is needed. While contemporary surface mining generally increases peak and total runoff, the limited MTM/VF studies reveal significant variability in hydrologic response. Significant knowledge gaps relate to limited understanding of hydrologic processes in these systems. Until the hydrologic impact of this practice is better understood, efforts to reduce water quantity and quality problems and ecosystem degradation will be difficult to achieve.

  16. Behaviour of reinforced concrete slabs with steel fibers

    Science.gov (United States)

    Baarimah, A. O.; Syed Mohsin, S. M.

    2017-11-01

    This paper investigates the potential effect of steel fiber added into reinforced concrete slabs. Four-point bending test is conducted on six slabs to investigate the structural behaviour of the slabs by considering two different parameters; (i) thickness of slab (ii) volume fraction of steel fiber. The experimental work consists of six slabs, in which three slabs are designed in accordance to Eurocode 2 to fulfil shear capacity characteristic, whereas, the other three slabs are designed with 17% less thickness, intended to fail in shear. Both series of slabs are added with steel fiber with a volume fraction of Vf = 0%, Vf = 1% and Vf = 2% in order to study the effect and potential of fiber to compensate the loss in shear capacity. The slab with Vf = 0% steel fiber and no reduction in thickness is taken as the control slab. The experimental result suggests promising improvement of the load carrying capacity (up to 32%) and ductility (up to 87%) as well as delayed in crack propagation for the slabs with Vf = 2%. In addition, it is observed that addition of fibers compensates the reduction in the slab thickness as well as changes the failure mode of the slab from brittle to a more ductile manner.

  17. Everolimus plus exemestane in postmenopausal patients with HR(+) breast cancer: BOLERO-2 final progression-free survival analysis.

    Science.gov (United States)

    Yardley, Denise A; Noguchi, Shinzaburo; Pritchard, Kathleen I; Burris, Howard A; Baselga, José; Gnant, Michael; Hortobagyi, Gabriel N; Campone, Mario; Pistilli, Barbara; Piccart, Martine; Melichar, Bohuslav; Petrakova, Katarina; Arena, Francis P; Erdkamp, Frans; Harb, Wael A; Feng, Wentao; Cahana, Ayelet; Taran, Tetiana; Lebwohl, David; Rugo, Hope S

    2013-10-01

    Effective treatments for hormone-receptor-positive (HR(+)) breast cancer (BC) following relapse/progression on nonsteroidal aromatase inhibitor (NSAI) therapy are needed. Initial Breast Cancer Trials of OraL EveROlimus-2 (BOLERO-2) trial data demonstrated that everolimus and exemestane significantly prolonged progression-free survival (PFS) versus placebo plus exemestane alone in this patient population. BOLERO-2 is a phase 3, double-blind, randomized, international trial comparing everolimus (10 mg/day) plus exemestane (25 mg/day) versus placebo plus exemestane in postmenopausal women with HR(+) advanced BC with recurrence/progression during or after NSAIs. The primary endpoint was PFS by local investigator review, and was confirmed by independent central radiology review. Overall survival, response rate, and clinical benefit rate were secondary endpoints. Final study results with median 18-month follow-up show that median PFS remained significantly longer with everolimus plus exemestane versus placebo plus exemestane [investigator review: 7.8 versus 3.2 months, respectively; hazard ratio = 0.45 (95% confidence interval 0.38-0.54); log-rank P NSAIs. These results further support the use of everolimus plus exemestane in this patient population. ClinicalTrials.gov #NCT00863655.

  18. Whole-head analysis of cortical spatial organization from unilateral stimulation of median nerve in both hands: No complete hemisphere homology

    NARCIS (Netherlands)

    Theuvenet, Peter J.; van Dijk, Bob W.; Peters, M.J.; van Ree, Jan M.; Lopes da Silva, Fernando L.; Chen, Andrew C.N.

    2005-01-01

    We examined the contralateral hemispheric cortical activity in MEG (151 ch) after unilateral median nerve stimulation of the right and left hand in twenty healthy right-handed subjects. The goal was to establish parameters to describe cortical activity of the hemispheric responses and to study the

  19. Final Disposition and Quality Auditing of the Rehabilitation Process in Wild Raptors Admitted to a Wildlife Rehabilitation Centre in Catalonia, Spain, during a Twelve Year Period (1995–2007)

    Science.gov (United States)

    Molina-López, Rafael A.; Casal, Jordi; Darwich, Laila

    2013-01-01

    Background Variability in reporting and classification methods in previous published data of the final dispositions in the rehabilitation of wild raptors makes use of this data limited in trying to audit the quality of the rehabilitation process. Crude as well as stratified disposition rates are needed if quality auditing of the rehabilitation process is to be adequately performed. Methodology Final dispositions of 6221 hospitalized wild raptors admitted at a wildlife rehabilitation centre (WRC) of Catalonia during 1995–2007 were analyzed. These dispositions were calculated as the euthanasia (Er), unassisted mortality (Mr), release (Rr) and captivity rates (Cr)., time to death (Td) for dead and euthanized raptors, and length of stay for released (Tr) raptors was estimated. Stratified analyses by main causes of admission and clinical signs were performed. Results The disposition for the total population were: Er  = 30.6%, Mr = 19.1%, Rr  = 47.2%, and Cr  = 3%. By main causes of admission, Er was higher in the trauma category (34.2%), whereas Mr was found similar between trauma (37.4%) and non-trauma categories (34.8%). The highest Rr was observed for the orphaned group (77.9%). Furthermore, Cr was low in all the categories (<4%). By clinical signs, the highest Er was found in animals suffering musculoskeletal (37.9%) or skin (32.3%) lesions; Mr was high in infectious/parasitic diseases (66.7%) and in case of neurological symptoms (64.5%). The euthanized birds had a median Td  = 1 day (P10 = 0-P90 = 59) for both trauma and non-trauma categories, and Td  = 36 days for the orphaned young group (P10 = 0; P90 = 596). The median Td in the unassisted dead birds was 2 days for all the categories (P10 = 0-P90 = 31). Finally, the median Tr in the centre was variable among categories. Conclusions/Significance Reporting of final dispositions in wildlife rehabilitation should include the crude and stratified rates (Er, Mr, Rr

  20. Median nitrate concentrations in groundwater in the New Jersey Highlands Region estimated using regression models and land-surface characteristics

    Science.gov (United States)

    Baker, Ronald J.; Chepiga, Mary M.; Cauller, Stephen J.

    2015-01-01

    Nitrate-concentration data are used in conjunction with land-use and land-cover data to estimate median nitrate concentrations in groundwater underlying the New Jersey (NJ) Highlands Region. Sources of data on nitrate in 19,670 groundwater samples are from the U.S. Geological Survey (USGS) National Water Information System (NWIS) and the NJ Private Well Testing Act (PWTA).

  1. Estimating the sample mean and standard deviation from the sample size, median, range and/or interquartile range

    OpenAIRE

    Wan, Xiang; Wang, Wenqian; Liu, Jiming; Tong, Tiejun

    2014-01-01

    Background In systematic reviews and meta-analysis, researchers often pool the results of the sample mean and standard deviation from a set of similar clinical trials. A number of the trials, however, reported the study using the median, the minimum and maximum values, and/or the first and third quartiles. Hence, in order to combine results, one may have to estimate the sample mean and standard deviation for such trials. Methods In this paper, we propose to improve the existing literature in ...

  2. Structural and functional characteristics of natural and constructed channels draining a reclaimed mountaintop removal and valley fill coal mine

    Science.gov (United States)

    Mountaintop removal and valley fill (MTR/VF) coal mining has altered the landscape of the Central Appalachian region in the United States. The goals of this study were to 1) compare the structure and function of natural and constructed stream channels in forested and MTR/VF catch...

  3. Hybrid (laparoscopy + stent treatment of celiac trunk compression syndrome (Dunbar syndrome, median arcuate ligament syndrome (MALS

    Directory of Open Access Journals (Sweden)

    Maciej Michalik

    2016-12-01

    Full Text Available Introduction : Celiac trunk (CT compression syndrome caused by the median arcuate ligament (MAL is a rarely diagnosed disease because of its nonspecific symptoms, which cause a delay in the correct diagnosis. Intestinal ischemia occurs, which causes symptoms of abdominal angina. One method of treatment for this disease is surgical release of the CT – the intersection of the MAL. Laparoscopy is the first step of the hybrid technique combined with percutaneous angioplasty and stenting of the CT. Aim: To demonstrate the usefulness and advantages of the laparoscopic approach in the treatment of Dunbar syndrome. Material and methods : Between 2013 and 2016 in the General and Minimally Invasive Surgery Department of the Medical Sciences Faculty of the University of Warmia and Mazury in Olsztyn, 6 laparoscopic procedures were performed because of median arcuate ligament syndrome. During the laparoscopy the MAL was cut with a harmonic scalpel. One month after laparoscopy 5 patients had Doppler percutaneous angioplasty of the CT with stent implantation in the Vascular Surgery Department in Pomeranian Medical University in Szczecin. Results : In one case, there was a conversion of laparoscopic surgery to open due to unmanageable intraoperative bleeding. In one case, postoperative ultrasound examination of the abdominal cavity demonstrated the presence of a large hematoma in the retroperitoneal space. All patients reported relief of symptoms in the first days after the operation. Conclusions : The hybrid method, combining laparoscopy and angioplasty, seems to be a long-term solution, which increases the comfort of the patient, brings the opportunity for normal functioning and minimizes the risk of restenosis.

  4. Hybrid (laparoscopy + stent) treatment of celiac trunk compression syndrome (Dunbar syndrome, median arcuate ligament syndrome (MALS)).

    Science.gov (United States)

    Michalik, Maciej; Dowgiałło-Wnukiewicz, Natalia; Lech, Paweł; Majda, Kaja; Gutowski, Piotr

    2016-01-01

    Celiac trunk (CT) compression syndrome caused by the median arcuate ligament (MAL) is a rarely diagnosed disease because of its nonspecific symptoms, which cause a delay in the correct diagnosis. Intestinal ischemia occurs, which causes symptoms of abdominal angina. One method of treatment for this disease is surgical release of the CT - the intersection of the MAL. Laparoscopy is the first step of the hybrid technique combined with percutaneous angioplasty and stenting of the CT. To demonstrate the usefulness and advantages of the laparoscopic approach in the treatment of Dunbar syndrome. Between 2013 and 2016 in the General and Minimally Invasive Surgery Department of the Medical Sciences Faculty of the University of Warmia and Mazury in Olsztyn, 6 laparoscopic procedures were performed because of median arcuate ligament syndrome. During the laparoscopy the MAL was cut with a harmonic scalpel. One month after laparoscopy 5 patients had Doppler percutaneous angioplasty of the CT with stent implantation in the Vascular Surgery Department in Pomeranian Medical University in Szczecin. In one case, there was a conversion of laparoscopic surgery to open due to unmanageable intraoperative bleeding. In one case, postoperative ultrasound examination of the abdominal cavity demonstrated the presence of a large hematoma in the retroperitoneal space. All patients reported relief of symptoms in the first days after the operation. The hybrid method, combining laparoscopy and angioplasty, seems to be a long-term solution, which increases the comfort of the patient, brings the opportunity for normal functioning and minimizes the risk of restenosis.

  5. Laser Welding Process Parameters Optimization Using Variable-Fidelity Metamodel and NSGA-II

    Directory of Open Access Journals (Sweden)

    Wang Chaochao

    2017-01-01

    Full Text Available An optimization methodology based on variable-fidelity (VF metamodels and nondominated sorting genetic algorithm II (NSGA-II for laser bead-on-plate welding of stainless steel 316L is presented. The relationships between input process parameters (laser power, welding speed and laser focal position and output responses (weld width and weld depth are constructed by VF metamodels. In VF metamodels, the information from two levels fidelity models are integrated, in which the low-fidelity model (LF is finite element simulation model that is used to capture the general trend of the metamodels, and high-fidelity (HF model which from physical experiments is used to ensure the accuracy of metamodels. The accuracy of the VF metamodel is verified by actual experiments. To slove the optimization problem, NSGA-II is used to search for multi-objective Pareto optimal solutions. The results of verification experiments show that the obtained optimal parameters are effective and reliable.

  6. ST-segment elevation and ventricular fibrillation shortly after transseptal puncture for left atrial catheter ablation

    Directory of Open Access Journals (Sweden)

    Daisuke Ishigaki, MD

    2013-10-01

    Full Text Available A 47-year-old man with drug-resistant paroxysmal atrial fibrillation underwent left atrial (LA catheter ablation. After sheaths were inserted into the LA using the Brockenbrough method, he complained of angina and developed ST-segment elevation in the II, III, aVF, V5, and V6 leads. Ventricular fibrillation (VF occurred followed by ventricular tachycardia. The VF was successfully treated with direct current shock. Coronary angiography with isosorbide dinitrate showed neither spasm nor embolism in the coronary artery. The chest pain disappeared after 6 min with resolution of the ST-segment elevation. A summarized review of ST-segment elevation associated with transseptal puncture disclosed that ST-segment elevation is often found in inferior leads (87.5%, while concomitant bradyarrhythmia has been reported in 43.8% of patients. Our patient is the first recorded case with potentially lethal tachyarrhythmia. Although ST-segment elevation and VF is a rare complication associated with transseptal puncture, awareness of this complication is important.

  7. Effectiveness of Ritonavir-Boosted Protease Inhibitor Monotherapy in Clinical Practice Even with Previous Virological Failures to Protease Inhibitor-Based Regimens.

    Directory of Open Access Journals (Sweden)

    Luis F López-Cortés

    Full Text Available Significant controversy still exists about ritonavir-boosted protease inhibitor monotherapy (mtPI/rtv as a simplification strategy that is used up to now to treat patients that have not experienced previous virological failure (VF while on protease inhibitor (PI -based regimens. We have evaluated the effectiveness of two mtPI/rtv regimens in an actual clinical practice setting, including patients that had experienced previous VF with PI-based regimens.This retrospective study analyzed 1060 HIV-infected patients with undetectable viremia that were switched to lopinavir/ritonavir or darunavir/ritonavir monotherapy. In cases in which the patient had previously experienced VF while on a PI-based regimen, the lack of major HIV protease resistance mutations to lopinavir or darunavir, respectively, was mandatory. The primary endpoint of this study was the percentage of participants with virological suppression after 96 weeks according to intention-to-treat analysis (non-complete/missing = failure.A total of 1060 patients were analyzed, including 205 with previous VF while on PI-based regimens, 90 of whom were on complex therapies due to extensive resistance. The rates of treatment effectiveness (intention-to-treat analysis and virological efficacy (on-treatment analysis at week 96 were 79.3% (CI95, 76.8-81.8 and 91.5% (CI95, 89.6-93.4, respectively. No relationships were found between VF and earlier VF while on PI-based regimens, the presence of major or minor protease resistance mutations, the previous time on viral suppression, CD4+ T-cell nadir, and HCV-coinfection. Genotypic resistance tests were available in 49 out of the 74 patients with VFs and only four patients presented new major protease resistance mutations.Switching to mtPI/rtv achieves sustained virological control in most patients, even in those with previous VF on PI-based regimens as long as no major resistance mutations are present for the administered drug.

  8. Visceral fat dominant distribution in male type 2 diabetic patients is closely related to hepatic insulin resistance, irrespective of body type

    Directory of Open Access Journals (Sweden)

    Miyazaki Yoshinori

    2009-08-01

    Full Text Available Abstract Background All previous studies that investigated the association between abdominal fat distribution and insulin resistance evaluated subcutaneous and visceral fat area and/or volume, but these values were not related to the body type of each subject. In the present study we have examined the association between abdominal fat distribution and peripheral (muscle/hepatic sensitivity to insulin using the visceral to abdominal subcutaneous fat area ratio (VF/SF ratio in male patients with type 2 diabetes mellitus. This ratio defines the predominancy of visceral or subcutaneous abdominal adiposity, independent of the body type of each individual. Methods Thirty-six type 2 diabetic male patients underwent a euglycemic insulin clamp (insulin infusion rate = 40 mU/m2·min with 3-3H-glucose to measure insulin-mediated total body (primarily reflects muscle glucose disposal (TGD and suppression of endogenous (primarily reflects liver glucose production (EGP in response to a physiologic increase in plasma insulin concentration. Abdominal subcutaneous (SF and intraabdominal visceral fat (VF areas were quantitated with magnetic resonance imaging (MRI at the level of L4–5. Results TGD and TGD divided by steady state plasma insulin concentration during the insulin clamp (TGD/SSPI correlated inversely with body mass index (BMI, total fat mass (FM measured by 3H2O, SF and VF areas, while VF/SF ratio displayed no significant relationship with TGD or TGD/SSPI. In contrast, EGP and the product of EGP and SSPI during the insulin clamp (an index hepatic insulin resistance correlated positively with VF/SF ratio, but not with BMI, FM, VF or SF. Conclusion We conclude that, independent of the individual's body type, visceral fat dominant accumulation as opposed to subcutaneous fat accumulation is associated with hepatic insulin resistance, whereas peripheral (muscle insulin resistance is more closely related to general obesity (i.e. higher BMI and total FM

  9. Effect of carbon nanofibre addition on the mechanical properties of ...

    Indian Academy of Sciences (India)

    Owing to the good mechanical properties of the carbon nanofibres (CNFs), they ... 8H Satin, T-300 carbon fabric (C-fabric) was used as rein- forcement. ... below. Absolute strength (S) in MPa at a given Vf: S = a + bVf + cV 2 f , where 'a' is the ...

  10. The Effect of Dynamic Geometry Software on the Vocational High School Students' Succes for Teaching Bisector and the Median Concepts

    Directory of Open Access Journals (Sweden)

    Mihriban HACISALİHOĞLU KARADENİZ

    2014-12-01

    Full Text Available The aim of this study is to examine the effect on the success of the students “Bisector and Median correspond at a point in a triangle” findings stated within Geometry course curriculum by using computer assisted teaching program Dynamic Geometer’s Sketchpad. During this study quasi experimental design was used on preliminary and posttest groups. This research was conducted on twenty five 10th grade students studying Computer Information Systems (CIS at Technical and Vocational High School. “A Success Test” consisting of 12 questions which had been previously formed through the observations of specialized teachers was used as preliminary and posttests. Each group was chosen without any meaningful difference between preliminary test results gathered. Two groups were formed due to preliminary test results: an experiment group T-10 class (13 students and a control group A-10A (12 students. It was targeted to access findings developed by Dynamic Geometer’s Sketchpad programmed in the experiment group but the control group wasn’t intervened. An independent sample t-test on pair comparison was used among different groups paired samples t-test was used on pair comparison among same groups. Findings achieved during the study revealed that Dynamic Geometer’s Sketchpad was more effective on students’ success than traditional teaching methods. A meaningful difference on behalf of the experiment group was determined within the independent sample t-test conducted on final test results. [t(23=3.176, p< .05]. These findings indicate that Dynamic Geometer’s Sketchpad software used in the experiment group is more effective on students’ success compared to traditional teaching methods used in control group.

  11. Vein visualization: patient characteristic factors and efficacy of a new infrared vein finder technology.

    Science.gov (United States)

    Chiao, F B; Resta-Flarer, F; Lesser, J; Ng, J; Ganz, A; Pino-Luey, D; Bennett, H; Perkins, C; Witek, B

    2013-06-01

    We investigated the patient characteristic factors that correlate with identification of i.v. cannulation sites with normal eyesight. We evaluated a new infrared vein finding (VF) technology device in identifying i.v. cannulation sites. Each subject underwent two observations: one using the conventional method (CM) of normal, unassisted eyesight and the other with the infrared VF device, VueTek's Veinsite™ (VF). A power analysis for moderate effect size (β=0.95) required 54 samples for within-subject differences. Patient characteristic profiles were obtained from 384 subjects (768 observations). Our sample population exhibited an overall average of 5.8 [95% confidence interval (CI) 5.4-6.2] veins using CM. As a whole, CM vein visualization were less effective among obese [4.5 (95% CI 3.8-5.3)], African-American [4.6 (95% CI 3.6-5.5 veins)], and Asian [5.1 (95% CI 4.1-6.0)] subjects. Next, the VF technology identified an average of 9.1 (95% CI 8.6-9.5) possible cannulation sites compared with CM [average of 5.8 (95% CI 5.4-6.2)]. Seventy-six obese subjects had an average of 4.5 (95% CI 3.8-5.3) and 8.2 (95% CI 7.4-9.1) veins viewable by CM and VF, respectively. In dark skin subjects, 9.1 (95% CI 8.3-9.9) veins were visible by VF compared with 5.4 (95% CI 4.8-6.0) with CM. African-American or Asian ethnicity, and obesity were associated with decreased vein visibility. The visibility of veins eligible for cannulation increased for all subgroups using a new infrared device.

  12. Cognitive component of psychomotor retardation in unipolar and bipolar depression: Is verbal fluency a relevant marker? Impact of repetitive transcranial stimulation.

    Science.gov (United States)

    Thomas-Ollivier, Véronique; Foyer, Emmanuelle; Bulteau, Samuel; Pichot, Anne; Valriviere, Pierre; Sauvaget, Anne; Deschamps, Thibault

    2017-09-01

    In the literature, psychomotor retardation (PMR) is increasingly highlighted as a relevant marker for depression. Currently, we chose to focus on the fluency capacities as an evaluation of the frontal lobes functioning to reach a better understanding of cognitive and neurobiological mechanisms involved in PMR in depression. The aims of this study were: (i) to explore the cognitive component of PMR through the analysis of verbal fluency (VF) performance in unipolar and bipolar depression; and (ii) to examine whether a repetitive transcranial magnetic stimulation treatment could improve concomitantly the PMR and VF capacities, as a relevant marker characteristic of the cognitive component of PMR. Fifteen unipolar and 15 bipolar patients were compared to 15 healthy adults. Before treatment, the results showed VF deficits, particularly marked in the bipolar group. The investigation of the interplay between PMR, VF performance, Montgomery-Åsberg Depression Rating Scale scores, and Montreal Cognitive Assessment scores showed that the deficits in these various dimensions were not homogeneous. The absence of correlation between the psychomotor retardation scale (the French Retardation Rating Scale for Depression) and VF, and the correlation with MoCA raise the hypothesis of a more global cognitive impairment associated with PMR in the BD group. The repetitive transcranial magnetic stimulation treatment had a positive impact on depression, PMR, and fluency scores. Correlations between the Retardation Rating Scale for Depression and VF performances appeared after treatment, showing the cognitive role of psychomotor functioning in depression. Further analyses, including other cognitive measures in an objective evaluation of PMR, are required for a better understanding of these complex relationships. © 2017 The Authors. Psychiatry and Clinical Neurosciences © 2017 Japanese Society of Psychiatry and Neurology.

  13. Thin minimal rim width at Bruch’s membrane opening is associated with glaucomatous paracentral visual field loss

    Directory of Open Access Journals (Sweden)

    Taniguchi EV

    2017-12-01

    Full Text Available Elise V Taniguchi,1–3 Eleftherios I Paschalis,1,2 Dejiao Li,1,4 Kouros Nouri-Mahdavi,5 Stacey C Brauner,1 Scott H Greenstein,1 Angela V Turalba,1 Janey L Wiggs,1 Louis R Pasquale,1,6 Lucy Q Shen1 1Department of Ophthalmology, Harvard Medical School, Massachusetts Eye and Ear, Boston, MA, 2Boston Keratoprosthesis Laboratory, Massachusetts Eye and Ear – Schepens Eye Research Institute, Harvard Medical School, Boston, MA, USA; 3Department of Ophthalmology, Universidade Federal de São Paulo, São Paulo, Brazil; 4Department of Ophthalmology, Beijing China-Japan Friendship Hospital, Beijing, People’s Republic of China; 5Department of Ophthalmology, David Geffen School of Medicine and Stein Eye Institute, Los Angeles, CA, USA; 6Channing Division of Network Medicine, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA Purpose: To compare optic nerve head (ONH measurements in glaucomatous eyes with paracentral visual field (VF loss to eyes with peripheral VF loss and controls.Methods: Open-angle glaucoma (OAG patients with early paracentral VF loss or isolated peripheral VF loss as well as control subjects underwent ONH imaging with swept-source optical coherence tomography (OCT and retinal nerve fiber layer (RNFL imaging with spectral-domain OCT. Minimum rim width at Bruch’s membrane opening (BMO-MRW, lamina cribrosa depth (LCD, and RNFL thickness were compared among the glaucoma and control groups with one-way analysis of variance, Kruskal–Wallis test, and multiple regression analysis.Results: Twenty-nine eyes from 29 OAG patients (15 early paracentral and 14 isolated peripheral VF loss and 20 eyes of 20 control subjects were included. The early paracentral and isolated peripheral VF loss groups had similar VF mean deviation (MD (–5.3±2.7 dB and –3.7±3.0 dB, p=0.15, respectively. Global BMO-MRW was lower in OAG eyes than in controls (193.8±40.0 vs 322.7±62.2 µm, p<0.001, but similar

  14. The NO Regular Defibrillation testing In Cardioverter Defibrillator Implantation (NORDIC ICD) trial

    DEFF Research Database (Denmark)

    Bänsch, Dietmar; Bonnemeier, Hendrik; Brandt, Johan

    2015-01-01

    was standardized across all participating centres. After inducing a fast ventricular tachycardia (VT) with a heart rate ≥240 b.p.m. or ventricular fibrillation (VF) with a low-energy T-wave shock, DF was attempted with an initial 15 J shock. If the shock reversed the VT or VF, DF testing was considered successful...... and terminated. If unsuccessful, two effective 24 J shocks were administered. If DF was unsuccessful, the system was reconfigured and another DF testing was performed. An ICD shock energy of 40 J had to be programmed in all patients for treatment of spontaneous VT/VF episodes. The primary endpoint...

  15. The varying distribution of intra- and inter-vertebral height ratios determines the prevalence of vertebral fractures.

    Science.gov (United States)

    Zebaze, Roger Martin Djoumessi; Djoumessi, Roger Martin Zebaze; Maalouf, Ghassan; Wehbe, Joseph; Nehme, Alexandre; Maalouf, Naim; Seeman, Ego

    2004-08-01

    Credible inferences regarding the burden of vertebral fractures (VFs) cannot be made without a globally accepted quantitative definition of 'fracture'. Currently, differences in anterior, middle, or posterior vertebral heights (VHs) within a vertebra, or between adjacent vertebrae, are used to define 'fracture'. However, VH differences are essential for the construction of thoracolumbar curves, evolutionary adaptations that provide stability in bipedal stance and gait. As there is no reference standard to distinguish anatomical variation from fracture, approaches to defining a VF use a reference range of VH ratios derived in premenopausal women or derived by trimming, a method that iteratively removes the tails of a distribution of VH ratios to produce a normal distribution. From this, reference ranges of VH ratio means and standard deviations (SDs) are obtained and a nominal deviation of 15% or more, or 3 SD or more is regarded as a 'fracture'. We measured VHs by quantitative vertebral morphometry (QVM) and bone mineral density (BMD) by dual energy X-ray absorptiometry in 697 Lebanese women (age 20-89 years) to compare the prevalence of VF ascertained by published methods and a new method that uses the premenopausal range (without trimming) and requires two VH abnormalities. VF prevalence using published methods reached 60% to 70% in pre- and post-menopausal women, and in women with normal or high BMD because VH ratios were not normally distributed and cut-offs used to define VF fracture fell within the observed distribution of the data. The new method resulted in a VF prevalence of 3.3% in younger and 14% in older women, 7% (high), 10% (middle), and 20% (low) BMD tertiles consistent with the notion that the method detected VF due to bone fragility. We suggest that using a fixed trimming method to define reference range and cut-offs or applying fixed cut-offs to identify VFs in populations, where these ratios are not normally distributed, may result in the capture

  16. Geographically Weighted Regression Models in Estimating Median Home Prices in Towns of Massachusetts Based on an Urban Sustainability Framework

    Directory of Open Access Journals (Sweden)

    Yaxiong Ma

    2018-03-01

    Full Text Available Housing is a key component of urban sustainability. The objective of this study was to assess the significance of key spatial determinants of median home price in towns in Massachusetts that impact sustainable growth. Our analysis investigates the presence or absence of spatial non-stationarity in the relationship between sustainable growth, measured in terms of the relationship between home values and various parameters including the amount of unprotected forest land, residential land, unemployment, education, vehicle ownership, accessibility to commuter rail stations, school district performance, and senior population. We use the standard geographically weighted regression (GWR and Mixed GWR models to analyze the effects of spatial non-stationarity. Mixed GWR performed better than GWR in terms of Akaike Information Criterion (AIC values. Our findings highlight the nature and spatial extent of the non-stationary vs. stationary qualities of key environmental and social determinants of median home price. Understanding the key determinants of housing values, such as valuation of green spaces, public school performance metrics, and proximity to public transport, enable towns to use different strategies of sustainable urban planning, while understanding urban housing determinants—such as unemployment and senior population—can help modify urban sustainable housing policies.

  17. Comparing Learning from Productive Failure and Vicarious Failure

    Science.gov (United States)

    Kapur, Manu

    2014-01-01

    A total of 136 eighth-grade math students from 2 Singapore schools learned from either productive failure (PF) or vicarious failure (VF). PF students "generated" solutions to a complex problem targeting the concept of variance that they had not learned yet before receiving instruction on the targeted concept. VF students…

  18. Management of sternal precautions following median sternotomy by physical therapists in Australia: a web-based survey.

    Science.gov (United States)

    Tuyl, Lara J; Mackney, Jennifer