Limit theorems for random walks on a strip in subdiffusive regimes

International Nuclear Information System (INIS)

Dolgopyat, D; Goldsheid, I

2013-01-01

We study the asymptotic behaviour of occupation times of a transient random walk (RW) in a quenched random environment (RE) on a strip in a subdiffusive regime. The asymptotic behaviour of hitting times, which is a more traditional object of study, is exactly the same. As a particular case, we solve a long standing problem of describing the asymptotic behaviour of a RW with bounded jumps on a one-dimensional lattice. Our technique results from the development of ideas from our previous work (Dolgopyat and Goldsheid 2012 Commun. Math. Phys. 315 241–77) on the simple RWs in RE and those used in Bolthausen and Goldsheid (2000 Commun. Math. Phys. 214 429–47; 2008 Commun. Math. Phys. 278 253–88) and Goldsheid (2008 Probab. Theory Relat. Fields 141 471–511) for the study of random walks on a strip. (paper)

The fluctuation–dissipation relation in sub-diffusive systems: the case of granular single-file diffusion

International Nuclear Information System (INIS)

Villamaina, D; Puglisi, A; Vulpiani, A

2008-01-01

We study a gas of hard rods on a ring, driven by an external thermostat, with either elastic or inelastic collisions, which exhibits sub-diffusive behavior, 2 > ∼ t 1/2 . We show the validity of the usual fluctuation–dissipation (FD) relation, i.e. the proportionality between the response function and the correlation function, when the gas is elastic or diluted. In contrast, in strongly inelastic or dense cases, when the tracer velocity is no longer independent of the other degrees of freedom, the Einstein formula fails and must be replaced by a more general FD relation. (letter)

Statistical modelling of subdiffusive dynamics in the cytoplasm of living cells: A FARIMA approach

Science.gov (United States)

Burnecki, K.; Muszkieta, M.; Sikora, G.; Weron, A.

2012-04-01

Golding and Cox (Phys. Rev. Lett., 96 (2006) 098102) tracked the motion of individual fluorescently labelled mRNA molecules inside live E. coli cells. They found that in the set of 23 trajectories from 3 different experiments, the automatically recognized motion is subdiffusive and published an intriguing microscopy video. Here, we extract the corresponding time series from this video by image segmentation method and present its detailed statistical analysis. We find that this trajectory was not included in the data set already studied and has different statistical properties. It is best fitted by a fractional autoregressive integrated moving average (FARIMA) process with the normal-inverse Gaussian (NIG) noise and the negative memory. In contrast to earlier studies, this shows that the fractional Brownian motion is not the best model for the dynamics documented in this video.

Noble internal transport barriers and radial subdiffusion of toroidal magnetic lines

Energy Technology Data Exchange (ETDEWEB)

Misguich, J.H.; Reuss, J.D. [Association Euratom-CEA sur la Fusion, CEA/DSM/DRFC, 13 - Saint Paul lez Durance (France); Constantinescu, D.; Steinbrecher, G. [Association Euratom-N.A.S.T.I., Dept. of Physics, University of Craiova (Romania); Vlad, M.; Spineanu, F. [Association Euratom-N.A.S.T.I., National Institute of Laser, Plasma and Radiation Physics, Bucharest (Romania); Weyssow, B.; Balescu, R. [Association Euratom-Etat Belge sur la Fusion, Universite Libre de Bruxelles (Belgium)

2002-02-01

Internal transport barriers (ITB's) observed in tokamaks are described by a purely magnetic approach. Magnetic line motion in toroidal geometry with broken magnetic surfaces is studied from a previously derived Hamiltonian map in situation of incomplete chaos. This appears to reproduce in a realistic way the main features of a tokamak, for a given safety factor profile and in terms of a single parameter L representing the amplitude of the magnetic perturbation. New results are given concerning the Shafranov shift as function of L. For small values of L, closed magnetic surfaces exist (KAM tori) and island chains begin to appear on rational surfaces for higher values of L, with chaotic zones around hyperbolic points, as expected. Single trajectories of magnetic line motion indicate the persistence of a central protected plasma core, surrounded by a chaotic shell enclosed in a double-sided transport barrier. Magnetic lines which succeed to escape across this barrier begin to wander in a wide chaotic sea extending up to a very robust barrier (as long as L{<=}1). For values of L{>=}1, above the escape threshold, most magnetic lines succeed to escape out of the external barrier which has become a permeable Cantorus. Statistical analysis of a large number of trajectories, representing the evolution of a bunch of magnetic lines, indicate that the flux variable {psi} asymptotically grows in a diffuse manner as (L{sup 2}t) with a L{sup 2} scaling as expected, but that the average radial position r{sub m}(t) asymptotically grows as (L{sup 2}t){sup 1/4} while the mean square displacement around this average radius asymptotically grows in a sub-diffusive manner as (L{sup 2}t){sup 1/2}. This result shows the slower dispersion in the present incomplete chaotic regime, which is different from the usual quasilinear diffusion in completely chaotic situations. For physical times t{sub {phi}} of the order of the escape time defined by x{sub m}(t{sub {phi}}) {approx}1, the motion

Noble internal transport barriers and radial subdiffusion of toroidal magnetic lines

International Nuclear Information System (INIS)

Misguich, J.H.; Reuss, J.D.; Constantinescu, D.; Steinbrecher, G.; Vlad, M.; Spineanu, F.; Weyssow, B.; Balescu, R.

2002-02-01

Internal transport barriers (ITB's) observed in tokamaks are described by a purely magnetic approach. Magnetic line motion in toroidal geometry with broken magnetic surfaces is studied from a previously derived Hamiltonian map in situation of incomplete chaos. This appears to reproduce in a realistic way the main features of a tokamak, for a given safety factor profile and in terms of a single parameter L representing the amplitude of the magnetic perturbation. New results are given concerning the Shafranov shift as function of L. For small values of L, closed magnetic surfaces exist (KAM tori) and island chains begin to appear on rational surfaces for higher values of L, with chaotic zones around hyperbolic points, as expected. Single trajectories of magnetic line motion indicate the persistence of a central protected plasma core, surrounded by a chaotic shell enclosed in a double-sided transport barrier. Magnetic lines which succeed to escape across this barrier begin to wander in a wide chaotic sea extending up to a very robust barrier (as long as L≤1). For values of L≥1, above the escape threshold, most magnetic lines succeed to escape out of the external barrier which has become a permeable Cantorus. Statistical analysis of a large number of trajectories, representing the evolution of a bunch of magnetic lines, indicate that the flux variable ψ asymptotically grows in a diffuse manner as (L 2 t) with a L 2 scaling as expected, but that the average radial position r m (t) asymptotically grows as (L 2 t) 1/4 while the mean square displacement around this average radius asymptotically grows in a sub-diffusive manner as (L 2 t) 1/2 . This result shows the slower dispersion in the present incomplete chaotic regime, which is different from the usual quasilinear diffusion in completely chaotic situations. For physical times t φ of the order of the escape time defined by x m (t φ ) ∼1, the motion appears to be super-diffusive, however, but less dangerous than

From stochastic processes to numerical methods: A new scheme for solving reaction subdiffusion fractional partial differential equations

Energy Technology Data Exchange (ETDEWEB)

Angstmann, C.N.; Donnelly, I.C. [School of Mathematics and Statistics, UNSW Australia, Sydney NSW 2052 (Australia); Henry, B.I., E-mail: B.Henry@unsw.edu.au [School of Mathematics and Statistics, UNSW Australia, Sydney NSW 2052 (Australia); Jacobs, B.A. [School of Computer Science and Applied Mathematics, University of the Witwatersrand, Johannesburg, Private Bag 3, Wits 2050 (South Africa); DST–NRF Centre of Excellence in Mathematical and Statistical Sciences (CoE-MaSS) (South Africa); Langlands, T.A.M. [Department of Mathematics and Computing, University of Southern Queensland, Toowoomba QLD 4350 (Australia); Nichols, J.A. [School of Mathematics and Statistics, UNSW Australia, Sydney NSW 2052 (Australia)

2016-02-15

We have introduced a new explicit numerical method, based on a discrete stochastic process, for solving a class of fractional partial differential equations that model reaction subdiffusion. The scheme is derived from the master equations for the evolution of the probability density of a sum of discrete time random walks. We show that the diffusion limit of the master equations recovers the fractional partial differential equation of interest. This limiting procedure guarantees the consistency of the numerical scheme. The positivity of the solution and stability results are simply obtained, provided that the underlying process is well posed. We also show that the method can be applied to standard reaction–diffusion equations. This work highlights the broader applicability of using discrete stochastic processes to provide numerical schemes for partial differential equations, including fractional partial differential equations.

Long-Time Dynamic Response and Stochastic Resonance of Subdiffusive Overdamped Bistable Fractional Fokker-Planck Systems

International Nuclear Information System (INIS)

Yan-Mei, Kang; Yao-Lin, Jiang

2008-01-01

To explore the influence of anomalous diffusion on stochastic resonance (SR) more deeply and effectively, the method of moments is extended to subdiffusive overdamped bistable fractional Fokker-Planck systems for calculating the long-time linear dynamic response. It is found that the method of moments attains high accuracy with the truncation order N = 10, and in normal diffusion such obtained spectral amplification factor (SAF) of the first-order harmonic is also confirmed by stochastic simulation. Observing the SAF of the odd-order harmonics we find some interesting results, i.e. for smaller driving frequency the decrease of sub diffusion exponent inhibits the stochastic resonance (SR), while for larger driving frequency the decrease of sub diffusion exponent enhances the second SR peak, but the first one vanishes and a double SR is induced in the third-order harmonic at the same time. These observations suggest that the anomalous diffusion has important influence on the bistable dynamics

Statistical MOSFET Parameter Extraction with Parameter Selection for Minimal Point Measurement

Directory of Open Access Journals (Sweden)

Marga Alisjahbana

2013-11-01

Full Text Available A method to statistically extract MOSFET model parameters from a minimal number of transistor I(V characteristic curve measurements, taken during fabrication process monitoring. It includes a sensitivity analysis of the model, test/measurement point selection, and a parameter extraction experiment on the process data. The actual extraction is based on a linear error model, the sensitivity of the MOSFET model with respect to the parameters, and Newton-Raphson iterations. Simulated results showed good accuracy of parameter extraction and I(V curve fit for parameter deviations of up 20% from nominal values, including for a process shift of 10% from nominal.

Methods for measurement of durability parameters

DEFF Research Database (Denmark)

Hansen, Ernst Jan De Place

1996-01-01

Present selected methods for measurement of durabilty parameters relating to chlorides, corrosion, moisture and freeze-thaw, primarly on concrete. Advantages and drawbacks of the different methods are included.......Present selected methods for measurement of durabilty parameters relating to chlorides, corrosion, moisture and freeze-thaw, primarly on concrete. Advantages and drawbacks of the different methods are included....

Autocorrelation spectra of an air-fluidized granular system measured by NMR

Science.gov (United States)

Lasic, S.; Stepisnik, J.; Mohoric, A.; Sersa, I.; Planinsic, G.

2006-09-01

A novel insight into the dynamics of a fluidized granular system is given by a nuclear magnetic resonance method that yields the spin-echo attenuation proportional to the spectrum of the grain positional fluctuation. Measurements of the air-fluidized oil-filled spheres and mustard seeds at different degrees of fluidization and grain volume fractions provide the velocity autocorrelation that differs from the commonly anticipated exponential Enskog decay. An empiric formula, which corresponds to the model of grain caging at collisions with adjacent beads, fits well to the experimental data. Its parameters are the characteristic collision time, the free path between collisions and the cage-breaking rate or the diffusion-like constant, which decreases with increasing grain volume fraction. Mean-squared displacements calculated from the correlation spectrum clearly show transitions from ballistic, through sub-diffusion and into diffusion regimes of grain motion.

Precision measurements of electroweak parameters

CERN Document Server

Savin, Alexander

2017-01-01

A set of selected precise measurements of the SM parameters from the LHC experiments is discussed. Results on W-mass measurement and forward-backward asymmetry in production of the Drell--Yan events in both dielectron and dimuon decay channels are presented together with results on the effective mixing angle measurements. Electroweak production of the vector bosons in association with two jets is discussed.

Measuring the chargino parameters

Indian Academy of Sciences (India)

by measuring the cross-sections with polarized beams at e+e- collider ... is given by the fundamental SUSY parameters: the SU(2) gaugino mass Е¾, the higgsino .... two points in the plane which are symmetric under the interchange ¾Д ° ¾К.

Parameter measurement of target

International Nuclear Information System (INIS)

Gao Dangzhong

2001-01-01

The progress of parameter measurement of target (ICF-15) in 1999 are presented, including the design and contract of the microsphere equator profiler, the precise air bearing manufacturing, high-resolution X-ray image of multi-layer shells and the X-ray photos processed with special image and data software, some plastic shells measured in precision of 0.3 μm, the high-resolution observation and photograph system of 'dew-point method', special fixture of target and its temperature distribution measuring, the dew-point temperature and fuel gas pressure of shells measuring with internal pressure of 5 - 15 (x10 5 ) Pa D 2 and wall thickness of 1.5∼3 μm

Footprint parameters as a measure of arch height.

Science.gov (United States)

Hawes, M R; Nachbauer, W; Sovak, D; Nigg, B M

1992-01-01

The human foot has frequently been categorized into arch height groups based upon analysis of footprint parameters. This study investigates the relationship between directly measured arch height and many of the footprint parameters that have been assumed to represent arch height. A total of 115 male subjects were measured and footprint parameters were calculated from digitized outlines. Correlation and regression analyses were used to determine the relationship between footprint measures and arch height. It may be concluded from the results that footprint parameters proposed in the literature (arch angle, footprint index, and arch index) and two further parameters suggested in this study (arch length index and truncated arch index) are invalid as a basis for prediction or categorization of arch height. The categorization of the human foot according to the footprint measures evaluated in this paper represent no more than indices and angles of the plantar surface of the foot itself.

Transmission Electron Microscope Measures Lattice Parameters

Science.gov (United States)

Pike, William T.

1996-01-01

Convergent-beam microdiffraction (CBM) in thermionic-emission transmission electron microscope (TEM) is technique for measuring lattice parameters of nanometer-sized specimens of crystalline materials. Lattice parameters determined by use of CBM accurate to within few parts in thousand. Technique developed especially for use in quantifying lattice parameters, and thus strains, in epitaxial mismatched-crystal-lattice multilayer structures in multiple-quantum-well and other advanced semiconductor electronic devices. Ability to determine strains in indivdual layers contributes to understanding of novel electronic behaviors of devices.

Measurement of drill grinding parameters using laser sensor

Science.gov (United States)

Yanping, Peng; Kumehara, Hiroyuki; Wei, Zhang; Nomura, Takashi

2005-12-01

To measure the grinding parameters and geometry parameters accurately for a drill point is essential to its design and reconditioning. In recent years, a number of non-contact coordinate measuring apparatuses, using CCD camera or laser sensors, are developed. But, a lot work is to be done for further improvement. This paper reports another kind of laser coordinate meter. As an example of its application, the method for geometry inspection of the drill flank surface is detailed. Measured data from laser scanning on the flank surface around some points with several 2-dimensional curves are analyzed with mathematical procedure. If one of these curves turns to be a straight line, it must be the generatrix of the grinding cone. Thus, the grinding parameters are determined by a set of three generatrices. Then, the measurement method and data processing procedure are proposed. Its validity is assessed by measuring a sample with given parameters. The point geometry measured agrees well with the known values. In comparison with other methods in the published literature, it is simpler in computation and more accurate in results.

Measuring the Michel parameter ξ''

International Nuclear Information System (INIS)

Knowles, P.; Deutsch, J.; Egger, J.; Fetscher, W.; Foroughi, F.; Govaerts, J.; Hadri, M.; Kirch, K.; Kistryn, S.; Lang, J.; Morelle, X.; Naviliat, O.; Ninane, A.; Prieels, R.; Severijns, N.; Simons, L.; Sromicki, J.; Vandormael, S.; Hove, P. van

1999-01-01

Unlike the majority of Michel parameters which are consistent with the Standard Model V-A interaction, the experimental value of ξ''(=0.65±0.36) [1] is poorly known. Our experiment will measure the longitudinal polarization, P L , of positrons emitted from the decay of polarized muons. The value of P L , equal to unity in the Standard Model, will decrease for high energy positrons emitted antiparallel to the muon spin if the combination of Michel parameters ξ''/ξξ' - 1 deviates from the Standard Model value of zero

Measurements of thermal parameters of solar modules

International Nuclear Information System (INIS)

Górecki, K; Krac, E

2016-01-01

In the paper the methods of measuring thermal parameters of photovoltaic panels - transient thermal impedance and the absorption factor of light-radiation are presented. The manner of realising these methods is described and the results of measurements of the considered thermal parameters of selected photovoltaic panels are presented. The influence of such selected factors as a type of the investigated panel and its mounting manner on transient thermal impedance of the considered panels is also discussed. (paper)

DAQ system for low density plasma parameters measurement

International Nuclear Information System (INIS)

Joshi, Rashmi S.; Gupta, Suryakant B.

2015-01-01

In various cases where low density plasmas (number density ranges from 1E4 to 1E6 cm -3 ) exist for example, basic plasma studies or LEO space environment measurement of plasma parameters becomes very critical. Conventional tip (cylindrical) Langmuir probes often result into unstable measurements in such lower density plasma. Due to larger surface area, a spherical Langmuir probe is used to measure such lower plasma densities. Applying a sweep voltage signal to the probe and measuring current values corresponding to these voltages gives V-I characteristics of plasma which can be plotted on a digital storage oscilloscope. This plot is analyzed for calculating various plasma parameters. The aim of this paper is to measure plasma parameters using a spherical Langmuir probe and indigenously developed DAQ system. DAQ system consists of Keithley source-meter and a host system connected by a GPIB interface. An online plasma parameter diagnostic system is developed for measuring plasma properties for non-thermal plasma in vacuum. An algorithm is developed using LabVIEW platform. V-I characteristics of plasma are plotted with respect to different filament current values and different locations of Langmuir probe with reference to plasma source. V-I characteristics is also plotted for forward and reverse voltage sweep generated programmatically from the source meter. (author)

Measurement of the Acoustic Nonlinearity Parameter for Biological Media.

Science.gov (United States)

Cobb, Wesley Nelson

In vitro measurements of the acoustic nonlinearity parameter are presented for several biological media. With these measurements it is possible to predict the distortion of a finite amplitude wave in biological tissues of current diagnostic and research interest. The measurement method is based on the finite amplitude distortion of a sine wave that is emmitted by a piston source. The growth of the second harmonic component of this wave is measured by a piston receiver which is coaxial with and has the same size as the source. The experimental measurements and theory are compared in order to determine the nonlinearity parameter. The density, sound speed, and attenuation for the medium are determined in order to make this comparison. The theory developed for this study accounts for the influence of both diffraction and attenuation on the experimental measurements. The effects of dispersion, tissue inhomogeneity and gas bubbles within the excised tissues are studied. To test the measurement method, experimental results are compared with established values for the nonlinearity parameter of distilled water, ethylene glycol and glycerol. The agreement between these values suggests that the measurement uncertainty is (+OR-) 5% for liquids and (+OR-) 10% for solid tissues. Measurements are presented for dog blood and bovine serum albumen as a function of concentration. The nonlinearity parameters for liver, kidney and spleen are reported for both human and canine tissues. The values for the fresh tissues displayed little variation (6.8 to 7.8). Measurements for fixed, normal and cirrhotic tissues indicated that the nonlinearity parameter does not depend strongly on pathology. However, the values for fixed tissues were somewhat higher than those of the fresh tissues.

Influence of measurement errors and estimated parameters on combustion diagnosis

International Nuclear Information System (INIS)

Payri, F.; Molina, S.; Martin, J.; Armas, O.

2006-01-01

Thermodynamic diagnosis models are valuable tools for the study of Diesel combustion. Inputs required by such models comprise measured mean and instantaneous variables, together with suitable values for adjustable parameters used in different submodels. In the case of measured variables, one may estimate the uncertainty associated with measurement errors; however, the influence of errors in model parameter estimation may not be so easily established on an experimental basis. In this paper, a simulated pressure cycle has been used along with known input parameters, so that any uncertainty in the inputs is avoided. Then, the influence of errors in measured variables and geometric and heat transmission parameters on the results of a diagnosis combustion model for direct injection diesel engines have been studied. This procedure allowed to establish the relative importance of these parameters and to set limits to the maximal errors of the model, accounting for both the maximal expected errors in the input parameters and the sensitivity of the model to those errors

Application of a virtual coordinate measuring machine for measurement uncertainty estimation of aspherical lens parameters

International Nuclear Information System (INIS)

Küng, Alain; Meli, Felix; Nicolet, Anaïs; Thalmann, Rudolf

2014-01-01

Tactile ultra-precise coordinate measuring machines (CMMs) are very attractive for accurately measuring optical components with high slopes, such as aspheres. The METAS µ-CMM, which exhibits a single point measurement repeatability of a few nanometres, is routinely used for measurement services of microparts, including optical lenses. However, estimating the measurement uncertainty is very demanding. Because of the many combined influencing factors, an analytic determination of the uncertainty of parameters that are obtained by numerical fitting of the measured surface points is almost impossible. The application of numerical simulation (Monte Carlo methods) using a parametric fitting algorithm coupled with a virtual CMM based on a realistic model of the machine errors offers an ideal solution to this complex problem: to each measurement data point, a simulated measurement variation calculated from the numerical model of the METAS µ-CMM is added. Repeated several hundred times, these virtual measurements deliver the statistical data for calculating the probability density function, and thus the measurement uncertainty for each parameter. Additionally, the eventual cross-correlation between parameters can be analyzed. This method can be applied for the calibration and uncertainty estimation of any parameter of the equation representing a geometric element. In this article, we present the numerical simulation model of the METAS µ-CMM and the application of a Monte Carlo method for the uncertainty estimation of measured asphere parameters. (paper)

Fractional cable equation models for anomalous electrodiffusion in nerve cells: infinite domain solutions.

Science.gov (United States)

Langlands, T A M; Henry, B I; Wearne, S L

2009-12-01

We introduce fractional Nernst-Planck equations and derive fractional cable equations as macroscopic models for electrodiffusion of ions in nerve cells when molecular diffusion is anomalous subdiffusion due to binding, crowding or trapping. The anomalous subdiffusion is modelled by replacing diffusion constants with time dependent operators parameterized by fractional order exponents. Solutions are obtained as functions of the scaling parameters for infinite cables and semi-infinite cables with instantaneous current injections. Voltage attenuation along dendrites in response to alpha function synaptic inputs is computed. Action potential firing rates are also derived based on simple integrate and fire versions of the models. Our results show that electrotonic properties and firing rates of nerve cells are altered by anomalous subdiffusion in these models. We have suggested electrophysiological experiments to calibrate and validate the models.

Activation method for measurement of neutron spectrum parameters

International Nuclear Information System (INIS)

Efimov, B.V.; Demidov, A.M.; Ionov, V.S.; Konjaev, S.I.; Marin, S.V.; Bryzgalov, V.I.

2007-01-01

Experimental researches of spectrum parameters of neutrons at nuclear installations RRC KI are submitted. The installations have different designs of the cores, reflector, parameters and types of fuel elements. Measurements were carried out with use of the technique developed in RRC KI for irradiation resonance detectors UKD. The arrangement of detectors in the cores ensured possibility of measurement of neutron spectra with distinguished values of parameters. The spectrum parameters which are introduced by parametrical representation of a neutrons spectrum in the form corresponding to formalism Westcott. On experimental data were determinate absolute values of density neutron flux (DNF) in thermal and epithermal area of a spectrum (F t , f epi ), empirical dependence of temperature of neutron gas (Tn) on parameter of a rigidity of a spectrum (z), density neutron flux in transitional energy area of the spectrum. Dependences of spectral indexes of nuclides (UDy/UX), included in UKD, from a rigidity z and-or temperatures of neutron gas Tn are obtained.B Tools of mathematical processing of results are used for activation data and estimation of parameters of a spectrum (F t , f epi , z, Tn, UDy/UX). In the paper are presented some results of researches of neutron spectrum parameters of the nuclear installations (Authors)

Equipment for the measurement of non-electrical parameters

International Nuclear Information System (INIS)

Lewin, M.I.; Ewtuchow, A.N.

1977-01-01

The invention concerns equipment for the measurement of non-electrical parameters, which can be used in data processing and control equipment. The transducer converts non-electrical parameters into electrical signals. The process according to the invention is explained using the example of an inductive transducer, which is fed with alternating current. The measured parameter affects the mutual inductance of the transducer, so that the secondary voltage supplied by it is a function of the measured parameter. Amplitude measurement of this voltage by means of rectification and filtering has the disadvantage of long time constants, where the measuring period would amount to 6 to 10 cycles of the supply voltage. According to the invention the secondary voltage of the transducer is connected to an integrator during a half-cycle between two zeros, which charges a capacitor to a voltage proportional to the amplitude. An analogue-digital converter now produces a digital signal corresponding to the capacitor voltage, which is taken to the control equipment. This conversion occurs during a fraction of the second half-cycle, so that there is still time before the end of this half-cycle, so that there is still time before the end of this half-cycle to discharge the capacitor and to reproduce the initial conditions. In the next cycle the whole process is repeated, so that the measuring process only takes one cycle. In order to make the digital signal independent of the amplitude of the current fed in, this also flows through an identical transducer with constant mutual inductance, and affects the analogue-digital converter via a comparative circuit. (ORU) [de

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Effects of measurement noise on modal parameter identification

International Nuclear Information System (INIS)

Dorvash, S; Pakzad, S N

2012-01-01

In the past decade, much research has been conducted on data-driven structural health monitoring (SHM) algorithms with use of sensor measurements. A fundamental step in this SHM application is to identify the dynamic characteristics of structures. Despite the significant efforts devoted to development and enhancement of the modal parameter identification algorithms, there are still substantial uncertainties in the results obtained in real-life deployments. One of the sources of uncertainties in the results is the existence of noise in the measurement data. Depending on the subsequent application of the system identification, the level of uncertainty in the results and, consequently, the level of noise contamination can be very important. As an effort towards understanding the effect of measurement noise on the modal identification, this paper presents parameters that quantify the effects of measurement noise on the modal identification process and determine their influence on the accuracy of results. The performance of these parameters is validated by a numerically simulated example. They are then used to investigate the accuracy of identified modal properties of the Golden Gate Bridge using ambient data collected by wireless sensors. The vibration monitoring tests of the Golden Gate Bridge provided two synchronized data sets collected by two different sensor types. The influence of the sensor noise level on the accuracy of results is investigated throughout this work and it is shown that high quality sensors provide more accurate results as the physical contribution of response in their measured data is significantly higher. Additionally, higher purity and consistency of modal parameters, identified by higher quality sensors, is observed in the results. (paper)

Psychoacoustic parameters and its measuring system; Onshitsu hyoka wo hyokasuru tame no parameter to keisoku system

Energy Technology Data Exchange (ETDEWEB)

Ohashi, M.; Imaizumi, H.; Ono, T. [Ono Sokki Co. Ltd., Tokyo (Japan)

1998-05-01

Human auditory sensation has both extremely excellent performance and general versatility as sound analyzer. At present, it is impossible to make equipment with the same functions as human being, and describe an auditory sensation function as acoustic sensor even by any physical analysis techniques. However, extraction of auditory sensation parameters is becoming possible by using psychoacoustics and binaural signal processing. This paper mainly explains the calculation method of sound quality evaluation parameters derived from psychoacoustic results based on a sound quality evaluation system under development by the authors. This system is based on binaural measurement by dummy head, and calculates psychoacoustic parameters such as loudness, sharpness, roughness, fluctuation strength and tonality through frequency analysis of the measured stereo signals. The system also calculates 2-D parameters such as sensory pleasantness and unbiased annoyance based on the above parameters. 12 refs., 4 figs.

Measurement Error Estimation for Capacitive Voltage Transformer by Insulation Parameters

Directory of Open Access Journals (Sweden)

Bin Chen

2017-03-01

Full Text Available Measurement errors of a capacitive voltage transformer (CVT are relevant to its equivalent parameters for which its capacitive divider contributes the most. In daily operation, dielectric aging, moisture, dielectric breakdown, etc., it will exert mixing effects on a capacitive divider’s insulation characteristics, leading to fluctuation in equivalent parameters which result in the measurement error. This paper proposes an equivalent circuit model to represent a CVT which incorporates insulation characteristics of a capacitive divider. After software simulation and laboratory experiments, the relationship between measurement errors and insulation parameters is obtained. It indicates that variation of insulation parameters in a CVT will cause a reasonable measurement error. From field tests and calculation, equivalent capacitance mainly affects magnitude error, while dielectric loss mainly affects phase error. As capacitance changes 0.2%, magnitude error can reach −0.2%. As dielectric loss factor changes 0.2%, phase error can reach 5′. An increase of equivalent capacitance and dielectric loss factor in the high-voltage capacitor will cause a positive real power measurement error. An increase of equivalent capacitance and dielectric loss factor in the low-voltage capacitor will cause a negative real power measurement error.

Determination of complex microcalorimeter parameters with impedance measurements

International Nuclear Information System (INIS)

Saab, T.; Bandler, S.R.; Chervenak, J.; Figueroa-Feliciano, E.; Finkbeiner, F.; Iyomoto, N.; Kelley, R.L.; Kilbourne, C.A.; Lindeman, M.A.; Porter, F.S.; Sadleir, J.

2006-01-01

The proper understanding and modeling of a microcalorimeter's response requires accurate knowledge of a handful of parameters, such as C, G, α. While a few of these parameters are directly determined from the IV characteristics, some others, notoriously the heat capacity (C) and α, appear in degenerate combinations in most measurable quantities. The consideration of a complex microcalorimeter leads to an added ambiguity in the determination of the parameters. In general, the dependence of the microcalorimeter's complex impedance on these various parameters varies with frequency. This dependence allows us to determine individual parameters by fitting the prediction of the microcalorimeter model to impedance data. In this paper we describe efforts at characterizing the Goddard X-ray microcalorimeters. With the parameters determined by this method, we compare the pulse shape and noise spectra predictions to data taken with the same devices

Measurement of the Stokes parameters of light

International Nuclear Information System (INIS)

Berry, H.G.; Gabrielse, G.; Livingston, A.E.

1977-01-01

We describe a measuring system for determing the state of polarization of a beam of light in terms of its Stokes parameters. The technique which can be fully automated incorporates a monochromator and single photon counting detection and can thus be applied over a large wavelength range for very weak optical signals. Fourier transformation of the data by an on-line minicomputer allows immediate calculation of the Stokes parameters. We discuss special applications to light emitted from excited atomic systems with and without cylindrical symmetry

40 CFR 91.406 - Engine parameters to be measured and recorded.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Engine parameters to be measured and recorded. 91.406 Section 91.406 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Procedures § 91.406 Engine parameters to be measured and recorded. Measure or calculate, then record, the...

40 CFR 90.406 - Engine parameters to be measured and recorded.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Engine parameters to be measured and recorded. 90.406 Section 90.406 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Gaseous Exhaust Test Procedures § 90.406 Engine parameters to be measured and recorded. Measure or...

Estimation of Aerodynamic Parameters in Conditions of Measurement

Directory of Open Access Journals (Sweden)

Htang Om Moung

2017-01-01

Full Text Available The paper discusses the problem of aircraft parameter identification in conditions of measurement noises. It is assumed that all the signals involved into the process of identification are subjects to measurement noises, that is measurement random errors normally distributed. The results of simulation are presented which show the relation between the noises standard deviations and the accuracy of identification.

Innovation of Methods for Measurement and Modelling of Twisted Pair Parameters

Directory of Open Access Journals (Sweden)

Lukas Cepa

2011-01-01

Full Text Available The goal of this paper is to optimize a measurement methodology for the most accurate broadband modelling of characteristic impedance and other parameters for twisted pairs. Measured values and theirs comparison is presented in this article. Automated measurement facility was implemented at the Department of telecommunication of Faculty of electrical engineering of Czech technical university in Prague. Measurement facility contains RF switches allowing measurements up to 300 MHz or 1GHz. Measured twisted pair’s parameters can be obtained by measurement but for purposes of fundamental characteristics modelling is useful to define functions that model the properties of the twisted pair. Its primary and secondary parameters depend mostly on the frequency. For twisted pair deployment, we are interested in a frequency band range from 1 MHz to 100 MHz.

Impacts of Different Types of Measurements on Estimating Unsaturatedflow Parameters

Science.gov (United States)

Shi, L.

2015-12-01

This study evaluates the value of different types of measurements for estimating soil hydraulic parameters. A numerical method based on ensemble Kalman filter (EnKF) is presented to solely or jointly assimilate point-scale soil water head data, point-scale soil water content data, surface soil water content data and groundwater level data. This study investigates the performance of EnKF under different types of data, the potential worth contained in these data, and the factors that may affect estimation accuracy. Results show that for all types of data, smaller measurements errors lead to faster convergence to the true values. Higher accuracy measurements are required to improve the parameter estimation if a large number of unknown parameters need to be identified simultaneously. The data worth implied by the surface soil water content data and groundwater level data is prone to corruption by a deviated initial guess. Surface soil moisture data are capable of identifying soil hydraulic parameters for the top layers, but exert less or no influence on deeper layers especially when estimating multiple parameters simultaneously. Groundwater level is one type of valuable information to infer the soil hydraulic parameters. However, based on the approach used in this study, the estimates from groundwater level data may suffer severe degradation if a large number of parameters must be identified. Combined use of two or more types of data is helpful to improve the parameter estimation.

Validity and repeatability of inertial measurement units for measuring gait parameters.

Science.gov (United States)

Washabaugh, Edward P; Kalyanaraman, Tarun; Adamczyk, Peter G; Claflin, Edward S; Krishnan, Chandramouli

2017-06-01

Inertial measurement units (IMUs) are small wearable sensors that have tremendous potential to be applied to clinical gait analysis. They allow objective evaluation of gait and movement disorders outside the clinic and research laboratory, and permit evaluation on large numbers of steps. However, repeatability and validity data of these systems are sparse for gait metrics. The purpose of this study was to determine the validity and between-day repeatability of spatiotemporal metrics (gait speed, stance percent, swing percent, gait cycle time, stride length, cadence, and step duration) as measured with the APDM Opal IMUs and Mobility Lab system. We collected data on 39 healthy subjects. Subjects were tested over two days while walking on a standard treadmill, split-belt treadmill, or overground, with IMUs placed in two locations: both feet and both ankles. The spatiotemporal measurements taken with the IMU system were validated against data from an instrumented treadmill, or using standard clinical procedures. Repeatability and minimally detectable change (MDC) of the system was calculated between days. IMUs displayed high to moderate validity when measuring most of the gait metrics tested. Additionally, these measurements appear to be repeatable when used on the treadmill and overground. The foot configuration of the IMUs appeared to better measure gait parameters; however, both the foot and ankle configurations demonstrated good repeatability. In conclusion, the IMU system in this study appears to be both accurate and repeatable for measuring spatiotemporal gait parameters in healthy young adults. Copyright © 2017 Elsevier B.V. All rights reserved.

Measuring Parameters of Massive Black Hole Binaries with Partially Aligned Spins

Science.gov (United States)

Lang, Ryan N.; Hughes, Scott A.; Cornish, Neil J.

2011-01-01

The future space-based gravitational wave detector LISA will be able to measure parameters of coalescing massive black hole binaries, often to extremely high accuracy. Previous work has demonstrated that the black hole spins can have a strong impact on the accuracy of parameter measurement. Relativistic spin-induced precession modulates the waveform in a manner which can break degeneracies between parameters, in principle significantly improving how well they are measured. Recent studies have indicated, however, that spin precession may be weak for an important subset of astrophysical binary black holes: those in which the spins are aligned due to interactions with gas. In this paper, we examine how well a binary's parameters can be measured when its spins are partially aligned and compare results using waveforms that include higher post-Newtonian harmonics to those that are truncated at leading quadrupole order. We find that the weakened precession can substantially degrade parameter estimation, particularly for the "extrinsic" parameters sky position and distance. Absent higher harmonics, LISA typically localizes the sky position of a nearly aligned binary about an order of magnitude less accurately than one for which the spin orientations are random. Our knowledge of a source's sky position will thus be worst for the gas-rich systems which are most likely to produce electromagnetic counterparts. Fortunately, higher harmonics of the waveform can make up for this degradation. By including harmonics beyond the quadrupole in our waveform model, we find that the accuracy with which most of the binary's parameters are measured can be substantially improved. In some cases, the improvement is such that they are measured almost as well as when the binary spins are randomly aligned.

Measurement-Based Transmission Line Parameter Estimation with Adaptive Data Selection Scheme

DEFF Research Database (Denmark)

Li, Changgang; Zhang, Yaping; Zhang, Hengxu

2017-01-01

Accurate parameters of transmission lines are critical for power system operation and control decision making. Transmission line parameter estimation based on measured data is an effective way to enhance the validity of the parameters. This paper proposes a multi-point transmission line parameter...

Effects of Various Architectural Parameters on Six Room Acoustical Measures in Auditoria.

Science.gov (United States)

Chiang, Wei-Hwa

The effects of architectural parameters on six room acoustical measures were investigated by means of correlation analyses, factor analyses and multiple regression analyses based on data taken in twenty halls. Architectural parameters were used to estimate acoustical measures taken at individual locations within each room as well as the averages and standard deviations of all measured values in the rooms. The six acoustical measures were Early Decay Time (EDT10), Clarity Index (C80), Overall Level (G), Bass Ratio based on Early Decay Time (BR(EDT)), Treble Ratio based on Early Decay Time (TR(EDT)), and Early Inter-aural Cross Correlation (IACC80). A comprehensive method of quantifying various architectural characteristics of rooms was developed to define a large number of architectural parameters that were hypothesized to effect the acoustical measurements made in the rooms. This study quantitatively confirmed many of the principles used in the design of concert halls and auditoria. Three groups of room architectural parameters such as the parameters associated with the depth of diffusing surfaces were significantly correlated with the hall standard deviations of most of the acoustical measures. Significant differences of statistical relations among architectural parameters and receiver specific acoustical measures were found between a group of music halls and a group of lecture halls. For example, architectural parameters such as the relative distance from the receiver to the overhead ceiling increased the percentage of the variance of acoustical measures that was explained by Barron's revised theory from approximately 70% to 80% only when data were taken in the group of music halls. This study revealed the major architectural parameters which have strong relations with individual acoustical measures forming the basis for a more quantitative method for advancing the theoretical design of concert halls and other auditoria. The results of this study provide

Neutron capture measurements and resonance parameters of dysprosium

Energy Technology Data Exchange (ETDEWEB)

Shin, S.G.; Kye, Y.U.; Namkung, W.; Cho, M.H. [Pohang University of Science and Technology, Division of Advanced Nuclear Engineering, Pohang, Gyeongbuk (Korea, Republic of); Kang, Y.R.; Lee, M.W. [Dongnam Inst. of Radiological and Medical Sciences, Research Center, Busan (Korea, Republic of); Kim, G.N. [Kyungpook National University, Department of Physics, Daegu (Korea, Republic of); Ro, T.I. [Dong-A University, Department of Physics, Busan (Korea, Republic of); Danon, Y.; Williams, D. [Rensselaer Polytechnic Institute, Department of Mechanical, Aerospace, and Nuclear Engineering, Troy, NY (United States); Leinweber, G.; Block, R.C.; Barry, D.P.; Rapp, M.J. [Naval Nuclear Laboratory, Knolls Atomic Power Laboratory, Schenectady, NY (United States)

2017-10-15

Neutron capture yields of dysprosium isotopes ({sup 161}Dy, {sup 162}Dy, {sup 163}Dy, and {sup 164}Dy) were measured using the time-of-flight method with a 16 segment sodium iodide multiplicity detector. The measurements were made at the 25m flight station at the Gaerttner LINAC Center at Rensselaer Polytechnic Institute. Resonance parameters were obtained using the multilevel R-matrix Bayesian code SAMMY. The neutron capture data for four enriched dysprosium isotopes and one natural dysprosium sample were sequentially fitted. New resonances not listed in ENDF/B-VII.1 were observed. There were 29 and 17 new resonances from {sup 161}Dy and {sup 163}Dy isotopes, respectively. Six resonances from {sup 161}Dy isotope, two resonances from {sup 163}Dy, and four resonances from {sup 164}Dy were not observed. The capture resonance integrals of each isotope were calculated with the resulting resonance parameters and those of ENDF/B-VII.1 in the energy region from 0.5 eV to 20 MeV and were compared to the capture resonance integrals with the resonance parameters from ENDF/B-VII.1. A resonance integral value of the natural dysprosium calculated with present resonance parameters was 1405 ± 3.5 barn. The value is ∝ 0.3% higher than that obtained with the ENDF/B-VII.1 parameters. The distributions of the present and ENDF/B-VII.1 neutron widths were compared to a Porter-Thomas distribution. Neutron strength functions for {sup 161}Dy and {sup 163}Dy were calculated with the present resonance parameters and both values were in between the values of ''Atlas of Neutron Resonances'' and ENDF/B-VII.1. The present radiation width distributions of {sup 161}Dy and {sup 163}Dy were fitted with the χ{sup 2} distribution by varying the degrees of freedom. (orig.)

Measurement of the Michel Parameters in Leptonic Tau Decays

CERN Document Server

Ackerstaff, K.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Ashby, S.F.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Behnke, T.; Bell, Kenneth Watson; Bella, G.; Bentvelsen, S.; Bethke, S.; Betts, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bobinski, M.; Bock, P.; Bohme, J.; Boutemeur, M.; Braibant, S.; Bright-Thomas, P.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Ciocca, C.; Clarke, P.E.L.; Clay, E.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Couyoumtzelis, C.; Coxe, R.L.; Cuffiani, M.; Dado, S.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; de Roeck, A.; Desch, K.; Dienes, B.; Dixit, M.S.; Doucet, M.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Estabrooks, P.G.; Etzion, E.; Evans, H.G.; Fabbri, F.; Fanfani, A.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fischer, H.M.; Fleck, I.; Folman, R.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Geich-Gimbel, C.; Geralis, T.; Giacomelli, G.; Giacomelli, P.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Hargrove, C.K.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Hocker, James Andrew; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Igo-Kemenes, P.; Imrie, D.C.; Ishii, K.; Jacob, F.R.; Jawahery, A.; Jeremie, H.; Jimack, M.; Joly, A.; Jones, C.R.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kowalewski, Robert V.; Kress, T.; Krieger, P.; von Krogh, J.; Kyberd, P.; Lafferty, G.D.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Lawson, I.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lefebvre, E.; Lellouch, D.; Letts, J.; Levinson, L.; Liebisch, R.; List, B.; Littlewood, C.; Lloyd, A.W.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Lui, D.; Macchiolo, A.; Macpherson, A.; Mannelli, M.; Marcellini, S.; Markopoulos, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Poli, B.; Polok, J.; Przybycien, M.; Rembser, C.; Rick, H.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Roscoe, K.; Rossi, A.M.; Rozen, Y.; Runge, K.; Runolfsson, O.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sang, W.M.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schieck, J.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schorner, T.; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Sproston, M.; Stahl, A.; Stephens, K.; Steuerer, J.; Stoll, K.; Strom, David M.; Strohmer, R.; Tafirout, R.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Torrence, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Van Kooten, Rick J.; Vannerem, P.; Verzocchi, M.; Vikas, P.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilson, G.W.; Wilson, J.A.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.

1999-01-01

The Michel parameters of the leptonic tau decays are measured using the OPAL detector at LEP. The Michel parameters are extracted from the energy spectra of the charged decay leptons and from their energy-energy correlations. A new method involving a global likelihood fit of Monte Carlo generated events with complete detector simulation and background treatment has been applied to the data recorded at center-of-mass energies close to sqrt(s) = M(Z) corresponding to an integrated luminosity of 155 pb-1 during the years 1990 to 1995. If e-mu universality is assumed and inferring the tau polarization from neutral current data, the measured Michel parameters are extracted. Limits on non-standard coupling constants and on the masses of new gauge bosons are obtained. The results are in agreement with the V-A prediction of the Standard Model.

Cloud and Thermodynamic Parameters Retrieved from Satellite Ultraspectral Infrared Measurements

Science.gov (United States)

Zhou, Daniel K.; Smith, William L.; Larar, Allen M.; Liu, Xu; Taylor, Jonathan P.; Schluessel, Peter; Strow, L. Larrabee; Mango, Stephen A.

2008-01-01

Atmospheric-thermodynamic parameters and surface properties are basic meteorological parameters for weather forecasting. A physical geophysical parameter retrieval scheme dealing with cloudy and cloud-free radiance observed with satellite ultraspectral infrared sounders has been developed and applied to the Infrared Atmospheric Sounding Interferometer (IASI) and the Atmospheric InfraRed Sounder (AIRS). The retrieved parameters presented herein are from radiance data gathered during the Joint Airborne IASI Validation Experiment (JAIVEx). JAIVEx provided intensive aircraft observations obtained from airborne Fourier Transform Spectrometer (FTS) systems, in-situ measurements, and dedicated dropsonde and radiosonde measurements for the validation of the IASI products. Here, IASI atmospheric profile retrievals are compared with those obtained from dedicated dropsondes, radiosondes, and the airborne FTS system. The IASI examples presented here demonstrate the ability to retrieve fine-scale horizontal features with high vertical resolution from satellite ultraspectral sounder radiance spectra.

Phase Method of Invariant Measurement of Active-Inductive Measuring Two-Pole Parameters

Directory of Open Access Journals (Sweden)

Boris MAMIKONYAN

2017-04-01

Full Text Available There has been given the solution of the technical problem of separate measurement of parameters of inductance coils and inductive primary converters on alternating current without application of potential-current signals. As a measuring circuit the scheme of voltage divider with active-inductive two-pole is used, and as an output signal there has been used the angle of phase shift between two output voltages of the measuring circuit. For forming the output signal temporal separation of measurement channel is used. The advantages of phase method are mostly due to capacity of using microcontrollers. In the technical solutions under consideration the microcontroller regulates the measuring process and develops the measurement results.

Measurement of agricultural parameters using wireless sensor network (WSN)

Science.gov (United States)

Guaña-Moya, Javier; Sánchez-Almeida, Tarquino; Salgado-Reyes, Nelson

2018-04-01

The technological advances have allowed to create new applications in telecommunications, applying low power and reduced costs in their equipment, thus achieving the evolution of new wireless networks or also denominated Wireless Sensor Network. These technologies allow the generation of measurements and analysis of environmental parameter data and soil. Precision agriculture requires parameters for the improvement of production, obtained through WSN technologies. This research analyzes the climatic requirements and soil parameters in a rose plantation in a greenhouse at an altitude of 3,100 meters above sea level. In the present investigation, maximum parameters were obtained in the production of roses, which are in the optimum range of production, whereas the minimum parameters of temperature, humidity and luminosity, evidenced that these parameters can damage the plants, since temperatures less than 10 °C slow down the growth of the plant and allow the proliferation of diseases and fungi.

Geoelectrical Measurement of Multi-Scale Mass Transfer Parameters

Energy Technology Data Exchange (ETDEWEB)

Day-Lewis, Frederick; Singha, Kamini; Haggerty, Roy; Johnson, Tim; Binley, Andrew; Lane, John

2014-01-16

Mass transfer affects contaminant transport and is thought to control the efficiency of aquifer remediation at a number of sites within the Department of Energy (DOE) complex. An improved understanding of mass transfer is critical to meeting the enormous scientific and engineering challenges currently facing DOE. Informed design of site remedies and long-term stewardship of radionuclide-contaminated sites will require new cost-effective laboratory and field techniques to measure the parameters controlling mass transfer spatially and across a range of scales. In this project, we sought to capitalize on the geophysical signatures of mass transfer. Previous numerical modeling and pilot-scale field experiments suggested that mass transfer produces a geoelectrical signature—a hysteretic relation between sampled (mobile-domain) fluid conductivity and bulk (mobile + immobile) conductivity—over a range of scales relevant to aquifer remediation. In this work, we investigated the geoelectrical signature of mass transfer during tracer transport in a series of controlled experiments to determine the operation of controlling parameters, and also investigated the use of complex-resistivity (CR) as a means of quantifying mass transfer parameters in situ without tracer experiments. In an add-on component to our grant, we additionally considered nuclear magnetic resonance (NMR) to help parse mobile from immobile porosities. Including the NMR component, our revised study objectives were to: 1. Develop and demonstrate geophysical approaches to measure mass-transfer parameters spatially and over a range of scales, including the combination of electrical resistivity monitoring, tracer tests, complex resistivity, nuclear magnetic resonance, and materials characterization; and 2. Provide mass-transfer estimates for improved understanding of contaminant fate and transport at DOE sites, such as uranium transport at the Hanford 300 Area. To achieve our objectives, we implemented a 3

Pose measurement method with six parameters for microassembly based on an optical micrometer

Science.gov (United States)

Ye, Xin; Wang, Qiang; Zhang, Zhi-jing; Sun, Yuan; Zhang, Xiao-feng

2009-07-01

This paper presents a new pose measurement method of microminiature parts that is capable of transforming one dimension (1D) contour size obtained by optical micrometer to three dimension (3D) data with six parameters for microassembly. Pose measurement is one of the most important processes for microminiature parts' alignment and insertion in microassembly. During the past few years, researchers have developed their microassembly systems focusing on visual identification to obtain two or three dimension data with no more than three parameters. Scanning electronic microscope (SEM), optical microscope, and stereomicroscope are applied in their systems. However, as structures of microminiature parts become increasingly complex, six parameters to represent their position and orientation are specifically needed. Firstly, The pose measurement model is established based on the introduction of measuring objects and measuring principle of optical micrometer. The measuring objects are microminiature parts with complex 3D structure. Two groups of two dimension (2D) data are gathered at two different measurement positions. Then part pose with 6 parameters is calculated, including 3 position parameters of feature point of the part and 3 orientation parameters of the part axis. Secondly, pose measurement process for a small shaft, vertical orientation determination, and position parameters obtaining are presented. 2D data is gathered by scanning the generatrix of the part, and valid data is extracted and saved in arrays. A vertical orientation criterion is proposed to determine whether the part is parallel to the Z-axis of the coordinate. If not, 2D data will be fixed into a linear equation using least square algorithm. Then orientation parameters are calculated. Center of Part End (CPE) is selected as feature point of the part, and its position parameters are extracted form two group of 2D data. Finally, a fast pose measurement device is developed and representative

Neutron Capture and Transmission Measurements and Resonance Parameter Analysis of Samarium

International Nuclear Information System (INIS)

Leinweber, G.; Burke, J.A.; Knox, H.D.; Drindak, N.J.; Mesh, D.W.; Haines, W.T.; Ballad, R.V.; Block, R.C.; Slovacek, R.E.; Werner, C.J.; Trbovich, M.J.; Barry, D.P.; Sato, T.

2001-01-01

The purpose of the present work is to accurately measure the neutron cross sections of samarium. The most significant isotope is 149 Sm, which has a large neutron absorption cross section at thermal energies and is a 235 U fission product with a 1% yield. Its cross sections are thus of concern to reactor neutronics. Neutron capture and transmission measurements were performed by the time-of-flight technique at the Rensselaer Polytechnic institute (RPI) LINAC facility using metallic and liquid Sm samples. The capture measurements were made at the 25 meter flight station with a multiplicity-type capture detector, and the transmission total cross-section measurements were performed at 15- and 25-meter flight stations with 6 Li glass scintillation detectors. Resonance parameters were determined by a combined analysis of six experiments (three capture and three transmission) using the multi-level R-matrix Bayesian code SAMMY version M2. The significant features of this work are as follows. Dilute samples of samarium nitrate in deuterated water (D 2 O) were prepared to measure the strong resonances at 0.1 and 8 eV without saturation. Disk-shaped spectroscopic quartz cells were obtained with parallel inner surfaces to provide a uniform thickness of solution. The diluent feature of the SAMMY program was used to analyze these data. The SAMMY program also includes multiple scattering corrections to capture yield data and resolution functions specific to the RPI facility. Resonance parameters for all stable isotopes of samarium were deduced for all resonances up to 30 eV. Thermal capture cross-section and capture resonance integral calculations were made using the resultant resonance parameters and were compared to results obtained using resonance parameters from ENDF/B-VI updated through release 3. Extending the definition of the capture resonance integral to include the strong 0.1 eV resonance in 149 Sm, present measurements agree within estimated uncertainties with En

A nuclear radiation multi-parameter measurement system based on pulse-shape sampling

International Nuclear Information System (INIS)

Qiu Xiaolin; Fang Guoming; Xu Peng; Di Yuming

2007-01-01

In this paper, A nuclear radiation multi-parameter measurement system based on pulse-shape sampling is introduced, including the system's characteristics, composition, operating principle, experiment data and analysis. Compared with conventional nuclear measuring apparatus, it has some remarkable advantages such as the synchronous detection using multi-parameter measurement in the same measurement platform and the general analysis of signal data by user-defined program. (authors)

Definition and measurement of statistical gloss parameters from curved objects

Energy Technology Data Exchange (ETDEWEB)

Kuivalainen, Kalle; Oksman, Antti; Peiponen, Kai-Erik

2010-09-20

Gloss standards are commonly defined for gloss measurement from flat surfaces, and, accordingly, glossmeters are typically developed for flat objects. However, gloss inspection of convex, concave, and small products is also important. In this paper, we define statistical gloss parameters for curved objects and measure gloss data on convex and concave surfaces using two different diffractive-optical-element-based glossmeters. Examples of measurements with the two diffractive-optical-element-based glossmeters are given for convex and concave aluminum pipe samples with and without paint. The defined gloss parameters for curved objects are useful in the characterization of the surface quality of metal pipes and other objects.

Definition and measurement of statistical gloss parameters from curved objects

International Nuclear Information System (INIS)

Kuivalainen, Kalle; Oksman, Antti; Peiponen, Kai-Erik

2010-01-01

Gloss standards are commonly defined for gloss measurement from flat surfaces, and, accordingly, glossmeters are typically developed for flat objects. However, gloss inspection of convex, concave, and small products is also important. In this paper, we define statistical gloss parameters for curved objects and measure gloss data on convex and concave surfaces using two different diffractive-optical-element-based glossmeters. Examples of measurements with the two diffractive-optical-element-based glossmeters are given for convex and concave aluminum pipe samples with and without paint. The defined gloss parameters for curved objects are useful in the characterization of the surface quality of metal pipes and other objects.

Probabilistic teleportation via multi-parameter measurements and partially entangled states

Science.gov (United States)

Wei, Jiahua; Shi, Lei; Han, Chen; Xu, Zhiyan; Zhu, Yu; Wang, Gang; Wu, Hao

2018-04-01

In this paper, a novel scheme for probabilistic teleportation is presented with multi-parameter measurements via a non-maximally entangled state. This is in contrast to the fact that the measurement kinds for quantum teleportation are usually particular in most previous schemes. The detail implementation producers for our proposal are given by using of appropriate local unitary operations. Moreover, the total success probability and classical information of this proposal are calculated. It is demonstrated that the success probability and classical cost would be changed with the multi-measurement parameters and the entanglement factor of quantum channel. Our scheme could enlarge the research range of probabilistic teleportation.

Recommendations for Measuring Tennis Racket Parameters

Directory of Open Access Journals (Sweden)

Tom Allen

2018-02-01

Full Text Available Tennis rackets have advanced significantly since the invention of the game in 1874, including innovations in both shape and materials. Advances in these design parameters have implications for racket performance, especially swing speed. This study tested one hundred rackets, spanning brands and eras, using simple, portable instruments in order to pilot protocols and make recommendations for streamlining testing procedures for tennis rackets. A wide range of properties were measured and documented for each racket. We suggest that since Transverse and Lateral Moment of Inertia are well correlated, measuring both is not necessary when processing a large number of rackets. In addition, it is also possible to predict the Transverse Moment of Inertia well from models that use simple dimension and mass measurements, which may be preferable in larger studies. Exploring the use of more complex modelling will allow us to better understand the impact of tennis racket design on performance in the future.

Anomalous diffusion due to hindering by mobile obstacles undergoing Brownian motion or Orstein-Ulhenbeck processes.

Science.gov (United States)

Berry, Hugues; Chaté, Hugues

2014-02-01

In vivo measurements of the passive movements of biomolecules or vesicles in cells consistently report "anomalous diffusion," where mean-squared displacements scale as a power law of time with exponent αmovement hindrance by obstacles is often invoked. However, our understanding of how hindered diffusion leads to subdiffusion is based on diffusion amidst randomly located immobile obstacles. Here, we have used Monte Carlo simulations to investigate transient subdiffusion due to mobile obstacles with various modes of mobility. Our simulations confirm that the anomalous regimes rapidly disappear when the obstacles move by Brownian motion. By contrast, mobile obstacles with more confined displacements, e.g., Orstein-Ulhenbeck motion, are shown to preserve subdiffusive regimes. The mean-squared displacement of tracked protein displays convincing power laws with anomalous exponent α that varies with the density of Orstein-Ulhenbeck (OU) obstacles or the relaxation time scale of the OU process. In particular, some of the values we observed are significantly below the universal value predicted for immobile obstacles in two dimensions. Therefore, our results show that subdiffusion due to mobile obstacles with OU type of motion may account for the large variation range exhibited by experimental measurements in living cells and may explain that some experimental estimates are below the universal value predicted for immobile obstacles.

Kinetics parameter measurements on RSG-GAS, a low-enriched fuel reactor

International Nuclear Information System (INIS)

Jujuratisbela, U; Arbie, B; Pinem, S.; Tukiran; Suparlina, L.; Singh, O.P.

1995-01-01

Kinetics parameter measurements, such as reactivity worths of control rods and fuel elements, beam tube void reactivity, power reactivity coefficient and xenon poisoning reactivity have been performed on different cores of Reaktor Serba Guna G.A. Siwabessy (RSG-GAS). In parallel, a programme was also initiated to measure the other kinetics parameters like effective delayed neutron life time, prompt neutron decay constant, validation of period reactivity relationship and zero power frequency response function. The paper provides the results of these measurements. (author)

Variances as order parameter and complexity measure for random Boolean networks

International Nuclear Information System (INIS)

Luque, Bartolo; Ballesteros, Fernando J; Fernandez, Manuel

2005-01-01

Several order parameters have been considered to predict and characterize the transition between ordered and disordered phases in random Boolean networks, such as the Hamming distance between replicas or the stable core, which have been successfully used. In this work, we propose a natural and clear new order parameter: the temporal variance. We compute its value analytically and compare it with the results of numerical experiments. Finally, we propose a complexity measure based on the compromise between temporal and spatial variances. This new order parameter and its related complexity measure can be easily applied to other complex systems

Variances as order parameter and complexity measure for random Boolean networks

Energy Technology Data Exchange (ETDEWEB)

Luque, Bartolo [Departamento de Matematica Aplicada y EstadIstica, Escuela Superior de Ingenieros Aeronauticos, Universidad Politecnica de Madrid, Plaza Cardenal Cisneros 3, Madrid 28040 (Spain); Ballesteros, Fernando J [Observatori Astronomic, Universitat de Valencia, Ed. Instituts d' Investigacio, Pol. La Coma s/n, E-46980 Paterna, Valencia (Spain); Fernandez, Manuel [Departamento de Matematica Aplicada y EstadIstica, Escuela Superior de Ingenieros Aeronauticos, Universidad Politecnica de Madrid, Plaza Cardenal Cisneros 3, Madrid 28040 (Spain)

2005-02-04

Several order parameters have been considered to predict and characterize the transition between ordered and disordered phases in random Boolean networks, such as the Hamming distance between replicas or the stable core, which have been successfully used. In this work, we propose a natural and clear new order parameter: the temporal variance. We compute its value analytically and compare it with the results of numerical experiments. Finally, we propose a complexity measure based on the compromise between temporal and spatial variances. This new order parameter and its related complexity measure can be easily applied to other complex systems.

Measured radioecological parameters after the Chernobyl accident

International Nuclear Information System (INIS)

Bonka, H.

1989-01-01

After the Chernobyl accident the radioactivity in the environment in Aachen was measured in detail. The change of the different radionuclies in the eco-system made it possible to obtain radioecological parameters especially for iodine and caesium. The most important data obtained like deposition velocity, washout coefficient, retention factor, removal rate constant, and transfer factor food-milk, food-beef, and soil-grass are reported. (orig.)

Development of Single Optical Sensor Method for the Measurement Droplet Parameters

Energy Technology Data Exchange (ETDEWEB)

Kim, Tae Ho; Ahn, Tae Hwan; Yun, Byong Jo [Pusan National University, Busan (Korea, Republic of); Bae, Byoung Uhn; Kim, Kyoung Doo [KAERI, Daejeon (Korea, Republic of)

2016-05-15

In this study, we tried to develop single optical fiber probe(S-TOP) sensor method to measure droplet parameters such as diameter, droplet fraction, and droplet velocity and so on. To calibrate and confirm the optical fiber sensor for those parameters, we conducted visualization experiments by using a high speed camera with the optical sensor. To evaluate the performance of the S-TOP accurately, we repeated calibration experiments at a given droplet flow condition. Figure. 3 shows the result of the calibration. In this graph, the x axis is the droplet velocity measured by visualization and the y axis is grd, D which is obtained from S-TOP. In this study, we have developed the single tip optical probe sensor to measure the droplet parameters. From the calibration experiments with high speed camera, we get the calibration curve for the droplet velocity. Additionally, the chord length distribution of droplets is measured by the optical probe.

Development of Single Optical Sensor Method for the Measurement Droplet Parameters

International Nuclear Information System (INIS)

Kim, Tae Ho; Ahn, Tae Hwan; Yun, Byong Jo; Bae, Byoung Uhn; Kim, Kyoung Doo

2016-01-01

In this study, we tried to develop single optical fiber probe(S-TOP) sensor method to measure droplet parameters such as diameter, droplet fraction, and droplet velocity and so on. To calibrate and confirm the optical fiber sensor for those parameters, we conducted visualization experiments by using a high speed camera with the optical sensor. To evaluate the performance of the S-TOP accurately, we repeated calibration experiments at a given droplet flow condition. Figure. 3 shows the result of the calibration. In this graph, the x axis is the droplet velocity measured by visualization and the y axis is grd, D which is obtained from S-TOP. In this study, we have developed the single tip optical probe sensor to measure the droplet parameters. From the calibration experiments with high speed camera, we get the calibration curve for the droplet velocity. Additionally, the chord length distribution of droplets is measured by the optical probe.

Sexual dimorphism in visceral adiposity measures, parameters and ...

African Journals Online (AJOL)

Visceral adipose tissue is considered the most important anatomic site of adipose tissue aggregation and is considered the hall mark of metabolic syndrome (MetS) phenotype. The aim of the study was to determine sexual dimorphism in visceral adiposity measures, parameters and biomarkers of metabolic syndrome ...

Dyes assay for measuring physicochemical parameters.

Science.gov (United States)

Moczko, Ewa; Meglinski, Igor V; Bessant, Conrad; Piletsky, Sergey A

2009-03-15

A combination of selective fluorescent dyes has been developed for simultaneous quantitative measurements of several physicochemical parameters. The operating principle of the assay is similar to electronic nose and tongue systems, which combine nonspecific or semispecific elements for the determination of diverse analytes and chemometric techniques for multivariate data analysis. The analytical capability of the proposed mixture is engendered by changes in fluorescence signal in response to changes in environment such as pH, temperature, ionic strength, and presence of oxygen. The signal is detected by a three-dimensional spectrofluorimeter, and the acquired data are processed using an artificial neural network (ANN) for multivariate calibration. The fluorescence spectrum of a solution of selected dyes allows discreet reading of emission maxima of all dyes composing the mixture. The variations in peaks intensities caused by environmental changes provide distinctive fluorescence patterns which can be handled in the same way as the signals collected from nose/tongue electrochemical or piezoelectric devices. This optical system opens possibilities for rapid, inexpensive, real-time detection of a multitude of physicochemical parameters and analytes of complex samples.

Measurements of local two-phase flow parameters in a boiling flow channel

International Nuclear Information System (INIS)

Yun, Byong Jo; Park, Goon-CherI; Chung, Moon Ki; Song, Chul Hwa

1998-01-01

Local two-phase flow parameters were measured lo investigate the internal flow structures of steam-water boiling flow in an annulus channel. Two kinds of measuring methods for local two-phase flow parameters were investigated. These are a two-conductivity probe for local vapor parameters and a Pitot cube for local liquid parameters. Using these probes, the local distribution of phasic velocities, interfacial area concentration (IAC) and void fraction is measured. In this study, the maximum local void fraction in subcooled boiling condition is observed around the heating rod and the local void fraction is smoothly decreased from the surface of a heating rod to the channel center without any wall void peaking, which was observed in air-water experiments. The distributions of local IAC and bubble frequency coincide with those of local void fraction for a given area-averaged void fraction. (author)

Multi-Parameter Measurement in Unseeded Flows using Femtosecond Lasers

Data.gov (United States)

National Aeronautics and Space Administration — Our approach is to use new turn-key femtosecond laser technology along with new high-speed CMOS camera technology to build a multi-parameter measurement system based...

Activation method for measuring the neutron spectra parameters. Computer software

International Nuclear Information System (INIS)

Efimov, B.V.; Ionov, V.S.; Konyaev, S.I.; Marin, S.V.

2005-01-01

The description of mathematical statement of a task for definition the spectral characteristics of neutron fields with use developed in RRC KI unified activation detectors (UKD) is resulted. The method of processing of results offered by authors activation measurements and calculation of the parameters used for an estimation of the neutron spectra characteristics is discussed. Features of processing of the experimental data received at measurements of activation with using UKD are considered. Activation detectors UKD contain a little bit specially the picked up isotopes giving at irradiation peaks scale of activity in the common spectrum scale of activity. Computing processing of results of the measurements is applied on definition of spectrum parameters for nuclear reactor installations with thermal and close to such power spectrum of neutrons. The example of the data processing, the measurements received at carrying out at RRC KI research reactor F-1 is resulted [ru

First Measurements of Higher Order Optics Parameters in the LHC

CERN Document Server

Vanbavinckhove, G; Bartolini, R; Calaga, R; Giovannozzi, M; Maclean, E H; Miyamoto, R; Schmidt, F; Tomas, R

2011-01-01

Higher order effects can play an important role in the performance of the LHC. Lack of knowledge of these pa- rameters can increase the tune footprint and compromise the beam lifetime. First measurements of these parameters at injection and flattop have been conducted. Detailed sim- ulations are compared to the measurements together with discussions on the measurement limitations.

Self-adaptive Green-Ampt infiltration parameters obtained from measured moisture processes

Directory of Open Access Journals (Sweden)

Long Xiang

2016-07-01

Full Text Available The Green-Ampt (G-A infiltration model (i.e., the G-A model is often used to characterize the infiltration process in hydrology. The parameters of the G-A model are critical in applications for the prediction of infiltration and associated rainfall-runoff processes. Previous approaches to determining the G-A parameters have depended on pedotransfer functions (PTFs or estimates from experimental results, usually without providing optimum values. In this study, rainfall simulators with soil moisture measurements were used to generate rainfall in various experimental plots. Observed runoff data and soil moisture dynamic data were jointly used to yield the infiltration processes, and an improved self-adaptive method was used to optimize the G-A parameters for various types of soil under different rainfall conditions. The two G-A parameters, i.e., the effective hydraulic conductivity and the effective capillary drive at the wetting front, were determined simultaneously to describe the relationships between rainfall, runoff, and infiltration processes. Through a designed experiment, the method for determining the G-A parameters was proved to be reliable in reflecting the effects of pedologic background in G-A type infiltration cases and deriving the optimum G-A parameters. Unlike PTF methods, this approach estimates the G-A parameters directly from infiltration curves obtained from rainfall simulation experiments so that it can be used to determine site-specific parameters. This study provides a self-adaptive method of optimizing the G-A parameters through designed field experiments. The parameters derived from field-measured rainfall-infiltration processes are more reliable and applicable to hydrological models.

Measurement of the Z Resonance Parameters at LEP

CERN Document Server

Barate, R; Ghez, P; Goy, C; Lees, J P; Lucotte, A; Merle, E; Minard, M N; Pietrzyk, B; Alemany, R; Casado, M P; Chmeissani, M; Comas, P; Crespo, J M; Fernández, E; Fernández-Bosman, M; Garrido, L; Graugès-Pous, E; Juste, A; Martínez, M; Merino, G; Miquel, R; Mir, L M; Orteu, S; Pacheco, A; Park, I C; Perlas, J A; Riu, I; Sánchez, F; Colaleo, A; Creanza, D; De Palma, M; Iaselli, Giuseppe; Maggi, G; Maggi, M; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Bazarko, A; Becker, U; Boix, G; Bird, F; Blucher, E; Bonvicini, G; Bright-Thomas, P G; Cattaneo, M; Cerutti, F; Ciulli, V; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Greening, T C; Hagelberg, R; Halley, A W; Hansen, J B; Harvey, J; Jacobsen, R; Janot, P; Jost, B; Knobloch, J; Lazeyras, Pierre; Lehraus, Ivan; Maley, P; Mato, P; May, J; Moutoussi, A; Ranjard, F; Rolandi, Luigi; Schlatter, W D; Schmitt, M; Schneider, O; Spagnolo, P; Tejessy, W; Teubert, F; Tomalin, I R; Tournefier, E; Veenhof, R; Wiedenmann, W; Wright, A E; Ajaltouni, Ziad J; Badaud, F; Chazelle, G; Deschamps, O; Falvard, A; Ferdi, C; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Bertelsen, H; Fernley, T; Hansen, F; Hansen, J D; Hansen, J R; Hansen, P H; Lindahl, A; Møllerud, R; Nilsson, B S; Rensch, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Siotis, I; Vayaki, Anna; Blondel, A; Bonneaud, G R; Brient, J C; Rougé, A; Rumpf, M; Swynghedauw, M; Tanaka, R; Verderi, M; Videau, H L; Focardi, E; Parrini, G; Zachariadou, K; Cavanaugh, R J; Corden, M; Georgiopoulos, C H; Antonelli, A; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Chiarella, V; Felici, G; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Picchi, P; Colrain, P; ten Have, I; Hughes, I S; Knowles, I G; Lynch, J G; Morton, W T; Raine, C; Reeves, P; O'Shea, V; Scarr, J M; Smith, K; Thompson, A S; Turnbull, R M; Buchmüller, O L; Dhamotharan, S; Geweniger, C; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Goodsir, S M; Martin, E B; Marinelli, N; Nash, J; Sciabà, A; Sedgbeer, J K; Thomson, E; Williams, M D; Ghete, V M; Girtler, P; Kneringer, E; Kuhn, D; Rudolph, G; Bowdery, C K; Buck, P G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Keemer, N R; Robertson, N A; Sloan, Terence; Snow, S W; Williams, M I; Bauerdick, L A T; Van Gemmeren, P; Giehl, I; Jakobs, K; Kasemann, M; Kleinknecht, K; Quast, G; Renk, B; Rohne, E; Sander, H G; Schmelling, M; Wachsmuth, H W; Wanke, R; Zeitnitz, C; Aubert, Jean-Jacques; Benchouk, C; Bonissent, A; Carr, J; Coyle, P; Etienne, F; Motsch, F; Payre, P; Rousseau, D; Talby, M; Thulasidas, M; Aleppo, M; Antonelli, M; Ragusa, F; Büscher, V; Dietl, H; Ganis, G; Hüttmann, K; Lütjens, G; Mannert, C; Männer, W; Moser, H G; Schael, S; Settles, Ronald; Seywerd, H C J; Stenzel, H; Wolf, G; Azzurri, P; Boucrot, J; Callot, O; Chen, S; Cordier, A; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Jacholkowska, A; Le Diberder, F R; Lefrançois, J; Lutz, A M; Schune, M H; Veillet, J J; Videau, I; Zerwas, D; Bagliesi, G; Bettarini, S; Boccali, T; Bozzi, C; Calderini, G; Dell'Orso, R; Fantechi, R; Ferrante, I; Fidecaro, F; Foà, L; Giassi, A; Gregorio, A; Ligabue, F; Lusiani, A; Marrocchesi, P S; Messineo, A; Palla, Fabrizio; Rizzo, G; Sanguinetti, G; Sguazzoni, G; Steinberger, Jack; Tenchini, Roberto; Vannini, C; Venturi, A; Verdini, P G; Blair, G A; Cowan, G D; Green, M G; Medcalf, T; Strong, J A; Von Wimmersperg-Töller, J H; Botterill, David R; Clifft, R W; Edgecock, T R; Edwards, M; Haywood, S J; Norton, P R; Thompson, J C; Bloch-Devaux, B; Colas, P; Emery, S; Kozanecki, Witold; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Roussarie, A; Schuller, J P; Schwindling, J; Vallage, B; Black, S N; Dann, J H; Kim, H Y; Konstantinidis, N P; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Cartwright, S L; Combley, F; Lehto, M H; Thompson, L F; Affholderbach, K; Barberio, E; Böhrer, A; Brandt, S; Burkhardt, H; Feigl, E; Grupen, Claus; Hess, J; Lutters, G; Meinhard, H; Minguet-Rodríguez, J A; Mirabito, L; Misiejuk, A; Neugebauer, E; Prange, G; Rivera, F; Saraiva, P; Schäfer, U; Sieler, U; Smolik, L; Stephan, F; Trier, H; Apollonio, M; Bosisio, L; Della Marina, R; Giannini, G; Gobbo, B; Musolino, G; Pitis, L; Kim, H; Rothberg, J E; Wasserbaech, S R; Armstrong, S R; Bellantoni, L; Cinabro, D; Conway, J S; Elmer, P; Feng, Z; Ferguson, D P S; Gao, Y; González, S; Grahl, J; Harton, J L; Hayes, O J; Hu, H; Jin, S; Johnson, R P; Kile, J; McNamara, P A; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Sharma, V; Walsh, A M; Walsh, J; Wear, J; Wu Sau Lan; Wu, X; Yamartino, J M; Zobernig, G

2000-01-01

The properties of the Z resonance are measured from the analysis of 4.5 million Z decays into fermion pairs collected with the \\Aleph\\ detector at L EP. The data are consistent with lepton universality. The resonance parameters are measured to be $\\MZ=(91.1885 \\pm 0.0031)~\\Gevcc$, $\\GZ= (2.4951 \\pm 0.0043)~\\GeV$, $\\spol=(41.559 \\pm 0.058)$~nb and, combining the three lepton flavours $\\Rl= 20.725\\pm 0.039$. The corresponding number of light neutrino species is $N_{\

Study of b→e channel and measurement of B0-antiB0 mixing parameter with L3 parameter

International Nuclear Information System (INIS)

Jezequel, S.

1992-04-01

This thesis is based on the analysis of the 1990 and 1991 LEP data taken with the L3 detector. It measures the mixing parameter of the B 0 - anti B 0 system. It consists on the comparison of the relative numbers of dileptons with same signs. After having recalled the theoretical background and previous measurements, it describes precisely the selection of prompt electrons from B hadrons. The muon's one is recalled. Different methods are presented to extract the mixing parameter

Measurement of J/ψ resonance parameters

International Nuclear Information System (INIS)

Bai Jingzhi; Chen Guangpei; Chen Shaomin

1995-01-01

The cross sections of e + e - →hadrons, e + e - , μ + μ - have been measured in the vicinity of J/ψ resonance at BES/BEPC. The fit of the observed cross sections gives the new results of J/ψ resonance parameters: the partial widths to hadrons, electrons and muons are Γ h = 74.1 +- 8.1 keV, Γ e = 5.14 +- 0.39 keV and Γ μ = 5.13 +-0.52 keV respectively; the total width Γ = 84.4 +- 8.9 keV; the branching fractions Γ h /Γ = (87.8 +- 0.5)%, Γ e /Γ (6.09 +- 0.33)%, and Γ μ /Γ = (6.08 +- 0.33)%

Simultaneous measurement of 3 fluctuating plasma parameters

International Nuclear Information System (INIS)

Carlson, A.; Giannone, L.

1991-01-01

Langmuir triple probes can provide simultaneous measurements of n e , T e and V pl with good temporal and spatial resolution, and therefore are especially suited to detailed investigations of plasma turbulence in the scrape-off-layer. Unfortunately, the finite tip separation coupled with the fluctuating gradients prevents a simple interpretation of the results. We have developed a method using, essentially, two or more triple probes, which allows a good estimate of the three plasma parameters and their spatial derivatives at each point of time (assuming tip separation is much less than correlation length and dimensionless fluctuation levels are much less than unity). In particular, we can unambiguously measure the temperature fluctuations and the turbulent particle and heat flux. (author) 1 fig

Simultaneous measurement of 3 fluctuating plasma parameters

International Nuclear Information System (INIS)

Carlson, A.; Giannone, L.

1991-01-01

Langmuir triple probes can provide simultaneous measurements of n e , T e , and V pl with good temporal and spatial resolution, and therefore are especially suited to detailed investigations of plasma turbulence in the scrape-off-layer. Unfortunately, the finite tip separation coupled with the fluctuating gradients prevents a simple interpretation of the results. We have developed a method using, essentially, two or more triple probes, which allows a good estimate of the three plasma parameters and their spatial derivatives at each point of time (assuming tip separation is much less than correlation length and dimensionless fluctuation levels are much less than unity). In particular, we can unambiguously measure the temperature fluctuations and the turbulent particle and heat flux. (orig.)

Simultaneous measurement of 3 fluctuating plasma parameters

Energy Technology Data Exchange (ETDEWEB)

Carlson, A; Giannone, L. (Max-Planck-Institut fuer Plasmaphysik, Garching (Germany))

1991-01-01

Langmuir triple probes can provide simultaneous measurements of n[sub e], T[sub e] and V[sub pl] with good temporal and spatial resolution, and therefore are especially suited to detailed investigations of plasma turbulence in the scrape-off-layer. Unfortunately, the finite tip separation coupled with the fluctuating gradients prevents a simple interpretation of the results. We have developed a method using, essentially, two or more triple probes, which allows a good estimate of the three plasma parameters and their spatial derivatives at each point of time (assuming tip separation is much less than correlation length and dimensionless fluctuation levels are much less than unity). In particular, we can unambiguously measure the temperature fluctuations and the turbulent particle and heat flux. (author) 1 fig.

A principle for the noninvasive measurement of steady-state heat transfer parameters in living tissues

Directory of Open Access Journals (Sweden)

S. Yu. Makarov

2014-01-01

Full Text Available Measuring the parameters of biological tissues (include in vivo is of great importance for medical diagnostics. For example, the value of the blood perfusion parameter is associated with the state of the blood microcirculation system and its functioning affects the state of the tissues of almost all organs. This work describes a previously proposed principle [1] in generalized terms. The principle is intended for noninvasive measuring the parameters of stationary heat transfer in biological tissues. The results of some experiments (natural and numeric are also presented in the research.For noninvasive measurement of thermophysical parameters a number of techniques have been developed using non-stationary thermal process in biological tissue [2][3]. But these techniques require the collecting a lot of data to represent the time-dependent thermal signal. In addition, subsequent processing with specialized algorithms is required for optimal selecting the parameters. The goal of this research is to develop an alternative approach using stationary thermal process for non-invasive measuring the parameters of stationary heat transfer in living tissues.A general principle can be formulated for the measurement methods based on this approach. Namely, the variations (changes of two physical values are measured in the experiment at the transition from one thermal stationary state to another. One of these two physical values unambiguously determines the stationary thermal field into the biological tissue under specified experimental conditions while the other one is unambiguously determined through the thermal field. Then, the parameters can be found from the numerical (or analytical functional dependencies linking the measured variations because the dependencies contain unknown parameters.The dependencies are expressed in terms of the formula:dqi = fi({pj},Ui dUi,Here dqi is a variation of a physical value q which is unambiguously determined from the

Radon decay product in-door behaviour - parameter, measurement method, and model review

International Nuclear Information System (INIS)

Scofield, P.

1988-01-01

This report reviews parameters used to characterize indoor radon daughter behavior and concentrations. Certain parameters that affect indoor radon daughter concentrations are described and the values obtained experimentally or theoretically are summarized. Radon daughter measurement methods are reviewed, such as, PAEC, unattached daughters, particle size distributions, and plateout measurement methods. In addition, certain radon pressure driven/diffusion models and indoor radon daughter models are briefly described. (orig.)

Research On The Measure Method Of Oblique Pinhole Parameters

Directory of Open Access Journals (Sweden)

Ma Yu-Zhen

2016-01-01

Full Text Available There are many special advantages in measuring the diameter of blind and deep holes with a capacitive probe, there are still some challenges for the measurement of a oblique pinhole parameters because the measuring device is inconvenient to stretch into the oblique pinhole exactly. A five-dimensional measurement system was adopted in the paper which included a capacitive sensor probe and a three-coordinate measuring machine to accomplish the measurement for oblique pinholes. With the help of the three-dimensional coordinates measured from the pinhole axis, we put forward a comprehensive method of combining the projection method and the least squares method together for fitting spatial straight line to obtain the optimal equation of the spacial axis. Finally, a reliable and entire measurement system was set up.

Ultrasonic motion analysis system - measurement of temporal and spatial gait parameters

NARCIS (Netherlands)

Huitema, RB; Hof, AL; Postema, K

The duration of stance and swing phase and step and stride length are important parameters in human gait. In this technical note a low-cost ultrasonic motion analysis system is described that is capable of measuring these temporal and spatial parameters while subjects walk on the floor. By using the

Online Measurement of LHC Beam Parameters with the ATLAS High Level Trigger

CERN Document Server

Strauss, E; The ATLAS collaboration

2011-01-01

We present an online measurement of the LHC beam parameters in ATLAS using the High Level Trigger (HLT). When a significant change is detected in the measured beamspot, it is distributed to the HLT. There, trigger algorithms like b-tagging which calculate impact parameters or decay lengths benefit from a precise, up-to-date set of beamspot parameters. Additionally, online feedback is sent to the LHC operators in real time. The measurement is performed by an algorithm running on the Level 2 trigger farm, leveraging the high rate of usable events. Dedicated algorithms perform a full scan of the silicon detector to reconstruct event vertices from registered tracks. The distribution of these vertices is aggregated across the farm and their shape is extracted through fits every 60 seconds to determine the beamspot position, size, and tilt. The reconstructed beam values are corrected for detector resolution effects, measured in situ using the separation of vertices whose tracks have been split into two collections....

Online measurement of LHC beam parameters with the ATLAS High Level Trigger

CERN Document Server

Strauss, E; The ATLAS collaboration

2011-01-01

We present an online measurement of the LHC beam parameters in ATLAS using the High Level Trigger (HLT). When a significant change is detected in the measured beamspot, it is distributed to the HLT. There, trigger algorithms like b-tagging which calculate impact parameters or decay lengths benefit from a precise,up-to-date set of beamspot parameters. Additionally, online feedback is sent to the LHC operators in real time. The measurement is performed by an algorithm running on the Level 2 trigger farm, leveraging the high rate of usable events. Dedicated algorithms perform a full scan of the silicon detector to reconstruct event vertices from registered tracks. The distribution of these vertices is aggregated across the farm and their shape is extracted through fits every 60 seconds to determine the beamspot position, size, and tilt. The reconstructed beam values are corrected for detector resolution effects, measured in situ using the separation of vertices whose tracks have been split into two collections. ...

Analysis of ESR measurement parameters for detecting irradiated spices

International Nuclear Information System (INIS)

Kameya, Hiromi; Hagiwara, Shoji; Todoriki, Setsuko

2015-01-01

The side signals from irradiated cellulose radical are used for detecting irradiated spices with the electron spin resonance (ESR). The side signals are two signals observed on both sides of a singlet signal (g≒2.00) from organic free radicals. Since the intensities of the side signals are weak, if the width of the singlet signal is large, these signals are covered and cannot be observed. In this study, we analyzed ESR measurement parameters of seven kinds spices (oregano, basil, parsley, coriander, cumin, white pepper, and black pepper) that would lead to narrow width of the singlet signal for detecting side signals. The results were as follows: 4 mW microwave power for basil, parsley, oregano, coriander, and cumin, and 8 mW for white pepper and black pepper, while modulation amplitude of 4 G, time constant of 20 ms were determined to be the optimal ESR measurement parameters. (author)

Optimal Design of Measurement Programs for the Parameter Identification of Dynamic Systems

DEFF Research Database (Denmark)

Kirkegaard, Poul Henning; Sørensen, John Dalsgaard; Brincker, Rune

The design of a measured program devoted to parameter identification of structural dynamic systems is considered, the design problem is formulated as an optimization problem due to minimize the total expected cost of the measurement program. All the calculations are based on a priori knowledge...... and engineering judgement. One of the contribution of the approach is that the optimal nmber of sensors can be estimated. This is sown in an numerical example where the proposed approach is demonstrated. The example is concerned with design of a measurement program for estimating the modal damping parameters...

Determination of electromagnetic absorption parameters by reflection measurements

International Nuclear Information System (INIS)

Vittitoe, C.N.

1975-09-01

The method described is for determining the electromagnetic absorption parameters of a material by measuring the optical reflection from a thick sample. With linearly polarized incident light (both perpendicular to and parallel to the plane of incidence), the ratio of the reflected intensities at three or more angles of incidence offers promise for determining the complex index of refraction of a material for a broad range of parameter values. The method may be applicable to molten materials, such as UO 2 , where high temperatures cause corrosion and containment difficulties. A method is given for extending the data to neighboring frequencies. Use of the method was successful for all portions of the complex index of refraction plane except for small values of the extinction coefficient

Measurement of the geometric parameters of power contact wire based on binocular stereovision

Science.gov (United States)

Pan, Xue-Tao; Zhang, Ya-feng; Meng, Fei

2010-10-01

In the electrified railway power supply system, electric locomotive obtains power from the catenary's wire through the pantograph. Under the action of the pantograph, combined with various factors such as vibration, touch current, relative sliding speed, load, etc, the contact wire will produce mechanical wear and electrical wear. Thus, in electrified railway construction and daily operations, the geometric parameters such as line height, pull value, the width of wear surface must be under real-timely and non-contact detection. On the one hand, the safe operation of electric railways will be guaranteed; on the other hand, the wire endurance will be extended, and operating costs reduced. Based on the characteristics of the worn wires' image signal, the binocular stereo vision technology was applied for measurement of contact wire geometry parameters, a mathematical model of measurement of geometric parameters was derived, and the boundaries of the wound wire abrasion-point value were extracted by means of sub-pixel edge detection method based on the LOG operator with the least-squares fitting, thus measurements of the wire geometry parameters were realized. Principles were demonstrated through simulation experiments, and the experimental results show that the detection methods presented in this paper for measuring the accuracy, efficiency and convenience, etc. are close to or superior to the traditional measurements, which has laid a good foundation for the measurement system of geometric parameters for the contact wire of the development of binocular vision.

Measurement of proton-beam parameters by means of digital television diagnostic system

International Nuclear Information System (INIS)

Vazhenin, V.A.; Borovkov, S.D.; Evtikhiev, A.V.

1992-01-01

A method is described for measurement of the parameters of pulse-packet beams by means of a digital television diagnostic system. Results of tests of the system in measurement of the parameters of a proton beam with an energy of 1.35 GeV in the U-70 circular accelerator and results of measurements of the energy spectrum of the 30-MeV proton beam of the LU-30 linear accelerator are given. The possibility is shown of using the system to measure the integrated characteristics of an entire beam-pulse packet as well as the characteristics of individual pulses with a period of 60 msec. 6 refs., 4 figs., 1 tab

COMPREHENSIVE CHECK MEASUREMENT OF KEY PARAMETERS ON MODEL BELT CONVEYOR

Directory of Open Access Journals (Sweden)

Vlastimil MONI

2013-07-01

Full Text Available Complex measurements of characteristic parameters realised on a long distance model belt conveyor are described. The main objective was to complete and combine the regular measurements of electric power on drives of belt conveyors operated in Czech opencast mines with measurements of other physical quantities and to gain by this way an image of their mutual relations and relations of quantities derived from them. The paper includes a short description and results of the measurements on an experimental model conveyor with a closed material transport way.

Geoelectrical Measurement of Multi-Scale Mass Transfer Parameters

Energy Technology Data Exchange (ETDEWEB)

Day-Lewis, Frederick David [US Geological Survey, Storrs, CT (United States); Singha, Kamini [Colorado School of Mines, Golden, CO (United States); Johnson, Timothy C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Haggerty, Roy [Oregon State Univ., Corvallis, OR (United States); Binley, Andrew [Lancaster Univ. (United Kingdom); Lane, John W. [US Geological Survey, Storrs, CT (United States)

2014-11-25

Mass transfer affects contaminant transport and is thought to control the efficiency of aquifer remediation at a number of sites within the Department of Energy (DOE) complex. An improved understanding of mass transfer is critical to meeting the enormous scientific and engineering challenges currently facing DOE. Informed design of site remedies and long-term stewardship of radionuclide-contaminated sites will require new cost-effective laboratory and field techniques to measure the parameters controlling mass transfer spatially and across a range of scales. In this project, we sought to capitalize on the geophysical signatures of mass transfer. Previous numerical modeling and pilot-scale field experiments suggested that mass transfer produces a geoelectrical signature—a hysteretic relation between sampled (mobile-domain) fluid conductivity and bulk (mobile + immobile) conductivity—over a range of scales relevant to aquifer remediation. In this work, we investigated the geoelectrical signature of mass transfer during tracer transport in a series of controlled experiments to determine the operation of controlling parameters, and also investigated the use of complex-resistivity (CR) as a means of quantifying mass transfer parameters in situ without tracer experiments. In an add-on component to our grant, we additionally considered nuclear magnetic resonance (NMR) to help parse mobile from immobile porosities. Including the NMR component, our revised study objectives were to: 1. Develop and demonstrate geophysical approaches to measure mass-transfer parameters spatially and over a range of scales, including the combination of electrical resistivity monitoring, tracer tests, complex resistivity, nuclear magnetic resonance, and materials characterization; and 2. Provide mass-transfer estimates for improved understanding of contaminant fate and transport at DOE sites, such as uranium transport at the Hanford 300 Area. To achieve our objectives, we implemented a 3

On Measurement of Helicity Parameters in Top Quark Decay

OpenAIRE

Nelson, Charles A.; Adler, Jr, L. J.

2000-01-01

To enable an evaluation of future measurements of the helicity parameters for " t --> W b " decay in regard to " T_FS violation", this paper considers the effects of an additional pure-imaginary coupling, (i g/2 Lambda) or (i g), associated with a specific, single additional Lorentz structure, i = S, P, S + P, ... Sizable " T_FS violation" signatures can occur for low-effective mass scales (< 320 GeV), but in most cases can be more simply excluded by 10% precision measurement of the probabili...

Measurement of mixing and CP violation parameters in two-body charm decays

CERN Document Server

Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amhis, Y; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Arrabito, L; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Bailey, D S; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Bernet, R; Bettler, M-O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chiapolini, N; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Constantin, F; Contu, A; Cook, A; Coombes, M; Corti, G; Cowan, G A; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Capua, S; De Cian, M; De Lorenzi, F; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Estève, L; Falabella, A; Fanchini, E; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gauvin, N; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Gracianiv Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Haefeli, G; Haen, C; Haines, S C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Knecht, M; Koppenburg, P; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li Gioi, L; Lieng, M; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Malde, S; Mamunur, R M D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Messi, R; Miglioranzi, S; Milanes, D A; Minard, M-N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Musy, M; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Nedos, M; Needham, M; Neufeld, N; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, K; Palacios, J; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Paterson, S K; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petrella, A; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Plackett, R; Playfer, S; Plo Casasus, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Rinnert, K; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Rosello, M; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, A C; Smith, N A; Smith, E; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Topp-Joergensen, S; Torr, N; Tournefier, E; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urquijo, P; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Viaud, B; Videau, I; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Voss, H; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yushchenko, O; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zverev, E; Zvyagin, A

2012-01-01

A study of mixing and indirect CP violation in $D^0$ mesons through the determination of the parameters $y_{CP}$ and $A_\\Gamma$ is presented. The parameter $y_{CP}$ is the deviation from unity of the ratio of effective lifetimes measured in $D^0$ decays to the CP eigenstate $K^+K^-$ with respect to decays to the Cabibbo favoured mode $K^-\\pi^+$. The result measured using data collected by LHCb in 2010, corresponding to an integrated luminosity of $29~pb^{-1}$, is $$y_{CP} = (5.5\\pm6.3_{\\rm stat}\\pm4.1_{\\rm syst})\\times 10^{-3}.$$ The parameter $A_\\Gamma$ is the asymmetry of effective lifetimes measured in decays of $D^0$ and $\\overline{D}^0$ mesons to $K^+K^-$. The result is $$A_\\Gamma = (-5.9\\pm5.9_{\\rm stat}\\pm2.1_{\\rm syst})\\times 10^{-3}.$$ A data-driven technique is used to correct for lifetime-biasing effects.

Measuring the scale parameter of quantum chromodynamics at CHEER

International Nuclear Information System (INIS)

Krauss, L.M.

1981-01-01

The possibility of measuring the scale parameter of quantum chromodynamics, Λsub(s), at CHEER is discussed. Rationale for the measurement of this quantity are given, along with a discussion of the theoretical difficulties involved. The meaurement of the Q 2 dependence of structure functions and their moments, and methods of measuring αsub(s) and its Q 2 evolution, are discussed, and arguments are given for the advantages and disadvantages of going to high Q 2 values at CHEER. It is concluded that while sensitivity to Λ is lowered at high Q 2 , CHEER will, in principle, be able to provide the first clean measurements of Λ, free from almost all the theoretical confusion involved in interpretations of present data

Investigation of metrological parameters of measuring system for small temperature changes

Directory of Open Access Journals (Sweden)

Samynina M. G.

2014-02-01

Full Text Available Metrological parameters of the non-standard contact device were investigated to characterize its performance in temperature change measurements in the specified temperature range. Several series thermistors with a negative temperature coefficient of resistance connected into a linearization circuit were used as the sensing element of the semiconductor device. Increasing the number of thermistors leads to improved circuitry resolving power and reduced dispersion of this parameter. However, there is the question of optimal ratio of the number of thermistors and implemented temperature resolution, due to the nonlinear resolution dependence of the number of series-connected thermoelements. An example of scheme of four similar thermistors as the primary sensor and of a standard measuring instrument, which is working in ohmmeter mode, shows the ability to measure temperature changes at the level of hundredth of a Celsius degree. In this case, a quantization error, which is determined by a resolution of the measuring system, and the ohmmeter accuracy make the main contribution to the overall accuracy of measuring small temperature changes.

Ion source plasma parameters measurement based on Langmuir probe with commercial frequency sweep

International Nuclear Information System (INIS)

Xie, Y.H.; Hu, C.D.; Liu, S.; Shong, S.H.; Jiang, C.C.; Liu, Z.M.

2010-01-01

Langmuir probe is one of the main diagnostic tools to measure the plasma parameters in the ion source. In this article, the commercial frequency power, which is sine wave of 50 Hz, was supplied on the Langmuir probe to measure the plasma parameters. The best feature of this probe sweep voltage is that it does not need extra design. The probe I-V characteristic curve can be got in less than 5 ms and the plasma parameters, the electron temperature and the electron density, varying with the time can be got in one plasma discharge of 400 ms.

Measuring neutrino oscillation parameters using $\

Energy Technology Data Exchange (ETDEWEB)

Backhouse, Christopher James [Oriel College, Oxford (United Kingdom)

2011-01-01

MINOS is a long-baseline neutrino oscillation experiment. It consists of two large steel-scintillator tracking calorimeters. The near detector is situated at Fermilab, close to the production point of the NuMI muon-neutrino beam. The far detector is 735 km away, 716m underground in the Soudan mine, Northern Minnesota. The primary purpose of the MINOS experiment is to make precise measurements of the 'atmospheric' neutrino oscillation parameters (Δm_atm² and sin² 2θ_atm). The oscillation signal consists of an energy-dependent deficit of v_μ interactions in the far detector. The near detector is used to characterize the properties of the beam before oscillations develop. The two-detector design allows many potential sources of systematic error in the far detector to be mitigated by the near detector observations. This thesis describes the details of the v_μ-disappearance analysis, and presents a new technique to estimate the hadronic energy of neutrino interactions. This estimator achieves a significant improvement in the energy resolution of the neutrino spectrum, and in the sensitivity of the neutrino oscillation fit. The systematic uncertainty on the hadronic energy scale was re-evaluated and found to be comparable to that of the energy estimator previously in use. The best-fit oscillation parameters of the v_μ-disappearance analysis, incorporating this new estimator were: Δm² = 2.32_-0.08^+0.12 x 10^-3 eV², sin ² 2θ > 0.90 (90% C.L.). A similar analysis, using data from a period of running where the NuMI beam was operated in a configuration producing a predominantly $\\bar{v}$_μ beam, yielded somewhat different best-fit parameters Δ$\\bar{m}${sup 2} = (3.36_-0.40^+0.46(stat.) ± 0.06(syst.)) x 10^-3eV², sin² 2$\\bar{θ}$ = 0.86_-0.12^_0

Measurement of some biophysical parameters in skin lesions of leprosy

Directory of Open Access Journals (Sweden)

A B Gupta

1990-01-01

Full Text Available Transepidermal water loss (TEWL, high frequency electrical conductance (HFC and the hydration state index (HSI were measured in sldn lesions of 30 paucibacillary leprosy patients and compared with the contralateral uninvolved skin. While the TEWL, HFC and HSI all showed lower values in the lesion site, as compared to the contralateral skin sites, the differences between the two sets of values significant in HFC and. HSI only at 2% and 1% level respectively. A significant positive correlation (r = 0.69 was found to eidst between these two parameters. The parameters correlate well with the known reduced sweating in skin lesions of TT and BT leprosy and may therefore be considered as good objective parameters to confirm hypohydrosis in suspected skin lesions ofleprosy.

Express method for contactless measurement of parameters of thermoelectric materials

Directory of Open Access Journals (Sweden)

Ashcheulov A. A.

2015-08-01

Full Text Available The paper presents an original method for contactless express measurement of parameters of thermoelectric materials. The presence of a combination of AC and DC magnetic fields in the gap of the oscillating circuit, where the monitored sample of the thermoelectric material is located, leads — due to Ampere force — to delamination of geometric regions of the occurrence of half-cycles of Foucault current. This in turn causes the appearance of additional heat losses in the oscillating circuit caused by Peltier effect. Computer modeling of these processes with the use of the software package ComsolFenlab 3.3 allowed determining the nature and magnitude of the electric currents in oscillating circuit, the range of operating frequencies, and the ratio of amplitudes of the variable and fixed components of the magnetic field. These components eventually cause a certain temperature difference along the controlled sample, which difference is proportional to the thermoelectric figure of merit Z of the material. The basic expressions are obtained for determining the value of the Seebeck coefficient a, thermal conductivity ?, electrical conductivity ? and thermoelectric figure of merit Z. A description is given to the design of the device for contactless express measurement of parameters of thermoelectric materials based on Bi—Te—Se—Sb solid solutions. Its distinctive feature is the ability to determine the symmetric and asymmetric components of the electric conductivity of the material values. The actual error in parameter measurement in this case is 2%.

Perioperative versus postoperative measurement of Taylor Spatial Frame mounting parameters.

Science.gov (United States)

Sökücü, Sami; Demir, Bilal; Lapçin, Osman; Yavuz, Umut; Kabukçuoğlu, Yavuz S

2014-01-01

The aim of this study was to determine the differences, if any, between application parameters for the Taylor Spatial Frame (TSF) system obtained during surgery under fluoroscopy and after surgery from digital radiography. This retrospective study included 17 extremities of 15 patients (8 male, 7 female; mean age: 21.9 years, range: 10 to 55 years) who underwent TSF after deformity and fracture. Application parameters measured by fluoroscopy at the end of surgery after mounting the fixator were compared with parameters obtained from anteroposterior and lateral digital radiographs taken 1 day after surgery. Fixator was applied to the femur in 8 patients, tibia in 6 and radius in 3. Mean time to removal of the frame was 3.5 (range: 3 to 7) months. Mean perioperative anteroposterior, lateral and axial frame offsets of patients were 9.1 (range: 3 to 20) mm, 18.1 (range: 5 to 37) mm and 95.3 (range: 25 to 155) mm, respectively. Mean postoperative anteroposterior, lateral and axial frame offset radiographs were 11.8 (range: 2 to 30) mm, 18 (range: 6 to 47) mm and 109.5 (range: 28 to 195) mm, respectively. There was no statistically significant difference between the groups (p>0.05). While measurements taken during operation may lengthen the duration in the operation room, fluoroscopy may provide better images and is easier to perform than digital radiography. On the other hand, there is no difference between measurements taken during perioperative fluoroscopy and postoperative digital radiography.

Measurement of the cp violation parameter sin 2 beta

International Nuclear Information System (INIS)

K.F. Kelley

1999-01-01

This thesis presents a measurement of the time-dependent asymmetry in the rate of (anti B) d 0 versus B d 0 decays to J/ψK s 0 . In the context of the Standard Model this is interpreted as a measurement of the CP violation parameter sin(2β). A total of 198±17 B d 0 /(anti B) d 0 decays were observed in p(anti p) collisions at √s=1.8 TeV by the CDF detector at the Fermilab Tevatron. The initial B flavor (whether B 0 or (anti B) 0 ) is determined by a same-side flavor tagging technique. The analysis results in sin(2β)=1.8±1.1(stat.)±0.3(syst.). This analysis demonstrates the feasibility of studying CP violation in the B 0 -(anti B) 0 system at a hadron collider. By applying the methods used in this analysis, future, higher-statistics experiments should be able to tightly constrain the parameters of the Standard Model

Investigation on influence parameters in measurements of the optomechanical hole plate using an optical coordinate measuring machine

DEFF Research Database (Denmark)

Morace, Renate Erica; Hansen, Hans Nørgaard; De Chiffre, Leonardo

2003-01-01

This paper describes the results of an experimental investigation on influence parameters in optical coordinate measurements of the optomechanical hole plate. Special attention was paid to the background of the object, which strongly influences the measurement result. Furthermore, it is seen that...... influences, the measurements were all performed with no movements of the axes of the CMM....

A Measurement of the Michel Parameters in Leptonic Decays of the Tau

Energy Technology Data Exchange (ETDEWEB)

Ammar, R.; Baringer, P.; Bean, A.; Besson, D.; Coppage, D.; Darling, C.; Davis, R.; Hancock, N.; Kotov, S.; Kravchenko, I.; Kwak, N. [University of Kansas, Lawrence, Kansas 66045 (United States); Anderson, S.; Kubota, Y.; Lattery, M.; ONeill, J.J.; Patton, S.; Poling, R.; Riehle, T.; Savinov, V.; Smith, A. [University of Minnesota, Minneapolis, Minnesota 55455 (United States); Alam, M.S.; Athar, S.B.; Ling, Z.; Mahmood, A.H.; Severini, H.; Timm, S.; Wappler, F. [State University of New York at Albany, Albany, New York 12222 (United States); Anastassov, A.; Blinov, S.; Duboscq, J.E.; Fujino, D.; Fulton, R.; Gan, K.K.; Hart, T.; Honscheid, K.; Kagan, H.; Kass, R.; Lee, J.; Spencer, M.B.; Sung, M.; Undrus, A.; Wanke, R.; Wolf, A.; Zoeller, M. [Ohio State University, Columbus, Ohio 43210 (United States); Nemati, B.; Richichi, S.J.; Ross, W.R.; Skubic, P.; Wood, M. [University of Oklahoma, Norman, Oklahoma 73019 (United States); Bishai, M.; Fast, J.; Gerndt, E.; Hinson, J.W.; Menon, N.; Miller, D.H.; Shibata, E.I.; Shipsey, I.P. [Purdue University, West Lafayette, Indiana 47907 (United States); Yurko, M.; Gibbons, L.; Johnson, S.D.; Kwon, Y.; Roberts, S.; Thorndike, E.H. [University of Rochester, Rochester, New York 14627 (United States); Jessop, C.P.; Lingel, K.; Marsiske, H.; Perl, M.L.; Schaffner, S.F.; Ugolini, D.; Wang, R.; Zhou, X. [Stanford Linear Accelerator Center, Stanford University, Stanford, California 94309 (United States); Coan, T.E.; Fadeyev, V.; Korolkov, I.; Maravin, Y.; Narsky, I.; Shelkov, V.; Staeck, J.; Stroynowski, R.; Volobouev, I.; Ye, J. [Southern Methodist University, Dallas, Texas 75275 (United States); Artuso, M.; Efimov, A.; Frasconi, F.; Gao, M.; Goldberg, M.; He, D.; Kopp, S.; Moneti, G.C.; Mountain, R.; Mukhin, Y.; Schuh, S.; Skwarnicki, T.; Stone, S.; Viehhauser, G.; Xing, X. [Syracuse University, Syracuse, New York 13244 (United States); Bartelt, J.; Csorna, S.E.; Jain, V.; and others

1997-06-01

We have measured the spectral shape Michel parameters {rho} and {eta} using leptonic decays of the {tau} , recorded by the CLEO II detector. Assuming e-{mu} universality in the vectorlike couplings, we find {rho}{sub e{mu}}=0.735{plus_minus}0.013{plus_minus}0.008 and {eta}{sub e{mu}}=-0.015{plus_minus}0.061{plus_minus}0.062 , where the first error is statistical and the second systematic. We also present measurements for the parameters for e and {mu} final states separately. {copyright} {ital 1997} {ital The American Physical Society}

Parameters affecting level measurement interpretation of nuclear fuel solutions

International Nuclear Information System (INIS)

Hunt, B.A.; Landat, D.A.

1999-01-01

This paper describes a level measurement technique commonly used in the measurement of radioactive liquids and equipment utilised by the inspectors for safeguards purposes. Some of the influencing parameters affecting the measurement results by this technique are characterised. An essential requisite for successful process operations in chemical facilities involving liquids generally require some physical measurements to be made in-line for both process and quality control in order to achieve the necessary final product specifications . In nuclear fuel reprocessing facilities, the same objectives apply coupled however with an additional requirement of achieving nuclear material accountancy and control. In view of the strategic importance of some of the process vessels in nuclear facilities, accountancy has to be supported by volume and density measurements of low uncertainty. Inspectors therefore require instruments which are at the very least as good as or better than operator's equipment. The classical measurement technique and most widely applied for process liquids in nuclear installations is the bubbler probe or dip-tube technique. Here a regulated flow of air passes through tubes inserted to various depths into the vessel and pressure readings are measured which are a function of the presence of liquid height and density of solution in the tank. These readings, taken together with a pre-determined calibration curve are sufficient for the volume and amount of liquor in a tank to be quantified. All measurement equipment and instrumentation are long distances from the tank environment. The key physical parameter to measure at this location is therefore pressure. Equipment designed developed, commissioned and tested in the tank measurement facilities at Ispra and in nuclear installations in Europe, Japan and the USA, house digital pressure transducer modules with manufacture's declared features of better than 0.01% accuracy and long term stability of 0.01% full

Online measurement of LHC beam parameters with the ATLAS High Level Trigger

International Nuclear Information System (INIS)

Strauss, E

2012-01-01

We present an online measurement of the LHC beamspot parameters in ATLAS using the High Level Trigger (HLT). When a significant change is detected in the measured beamspot, it is distributed to the HLT. There, trigger algorithms like b-tagging which calculate impact parameters or decay lengths benefit from a precise, up-to-date set of beamspot parameters. Additionally, online feedback is sent to the LHC operators in real time. The measurement is performed by an algorithm running on the Level 2 trigger farm, leveraging the high rate of usable events. Dedicated algorithms perform a full scan of the silicon detector to reconstruct event vertices from registered tracks. The distribution of these vertices is aggregated across the farm and their shape is extracted through fits every 60 seconds to determine the beamspot position, size, and tilt. The reconstructed beamspot values are corrected for detector resolution effects, measured in situ using the separation of vertices whose tracks have been split into two collections. Furthermore, measurements for individual bunch crossings have allowed for studies of single-bunch distributions as well as the behavior of bunch trains. This talk will cover the constraints imposed by the online environment and describe how these measurements are accomplished with the given resources. The algorithm tasks must be completed within the time constraints of the Level 2 trigger, with limited CPU and bandwidth allocations. This places an emphasis on efficient algorithm design and the minimization of data requests.

Real-Time Aerodynamic Parameter Estimation without Air Flow Angle Measurements

Science.gov (United States)

Morelli, Eugene A.

2010-01-01

A technique for estimating aerodynamic parameters in real time from flight data without air flow angle measurements is described and demonstrated. The method is applied to simulated F-16 data, and to flight data from a subscale jet transport aircraft. Modeling results obtained with the new approach using flight data without air flow angle measurements were compared to modeling results computed conventionally using flight data that included air flow angle measurements. Comparisons demonstrated that the new technique can provide accurate aerodynamic modeling results without air flow angle measurements, which are often difficult and expensive to obtain. Implications for efficient flight testing and flight safety are discussed.

Measuring, calculating and estimating PEP's parasitic mode loss parameters

International Nuclear Information System (INIS)

Weaver, J.N.

1981-01-01

This note discusses various ways the parasitic mode losses from a bunched beam to a vacuum chamber can be measured, calculated or estimated. A listing of the parameter, k, for the various PEP ring components is included. A number of formulas for calculating multiple and single pass losses are discussed and evaluated for several cases. 25 refs., 1 fig., 1 tab

Experimental Characterization of Ultra-Wideband Channel Parameter Measurements in an Underground Mine

Directory of Open Access Journals (Sweden)

B. Nkakanou

2011-01-01

Full Text Available Experimental results for an ultra-wideband (UWB channel parameters in an underground mining environment over a frequency range of 3 GHz to 10 GHz are reported. The measurements were taken both in LOS and NLOS cases in two different size mine galleries. In the NLOS case, results were acquired for different corridor obstruction angles. The results were obtained during an extensive measurement campaign in the UWB frequency, and the measurement procedure allows both the large- and small-scale parameters such as the path loss exponent, coherence bandwidth, and so forth, to be quantified. The capacity of the UWB channel as a function of the physical depth of the mine gallery has also been recorded for comparison purposes.

Precision measurements of thermodynamic parameters of heavy alkali metals

Science.gov (United States)

Blagonravov, L. A.; Modenov, A. A.

2017-11-01

On the temperature dependences of a number of one-component liquids, regions of anomalous behavior in the form of kinks and also in the form of limited areas of forced growth have been previously observed (LA Blagonravov, LA Orlov, et al., TVT 2000, vol. 38, No. 4, p.566-572). However, the interpretation of these anomalies is complicated by the small magnitude of the effects themselves (the magnitude of the observed effect was 5%, a random error of 2-3%). An increase in the accuracy of measurements is required for a more confident determination of the detailed shape of the anomalies. In the proposed work, thermodynamic parameters are studied using a technique that uses the elastic-thermal effect. The adiabatic thermal coefficient of pressure (a.t.p.c.) is measured: χ = (1/T)(∂T/∂p)S. An installation in which the pressure change is carried out in a periodic mode is used for measurements. The software allows simultaneous averaging of the values of the amplitude of pressure oscillations and the amplitude of temperature response oscillations with the subsequent determination of their ratio. The facility uses an advanced pressure modulator, which allows creating pressure oscillations of the shape close to sinusoidal (the value of the second harmonic is not more than 10%) and a precision SR-810 nanovoltmeter with a synchronous digital detector. The currently used technique provides an acceptable measurement accuracy (error in the region of 0.5-1%). However, to further increase the accuracy, it was decided to make changes in the measuring path. Namely, by developing and applying a scheme of a precision low-noise preamplifier based on the instrument amplifier INA333, a circuit allowing simultaneous measurement of not only the two above parameters but also the current temperature of the sample (to exclude the effect of temperature drift.) Preliminary results of measurements of the temperature dependence of the a.t.p.c. of liquid cesium in the temperature range up to

Pre-Analytical Parameters Affecting Vascular Endothelial Growth Factor Measurement in Plasma: Identifying Confounders.

Science.gov (United States)

Walz, Johanna M; Boehringer, Daniel; Deissler, Heidrun L; Faerber, Lothar; Goepfert, Jens C; Heiduschka, Peter; Kleeberger, Susannah M; Klettner, Alexa; Krohne, Tim U; Schneiderhan-Marra, Nicole; Ziemssen, Focke; Stahl, Andreas

2016-01-01

Vascular endothelial growth factor-A (VEGF-A) is intensively investigated in various medical fields. However, comparing VEGF-A measurements is difficult because sample acquisition and pre-analytic procedures differ between studies. We therefore investigated which variables act as confounders of VEGF-A measurements. Following a standardized protocol, blood was taken at three clinical sites from six healthy participants (one male and one female participant at each center) twice one week apart. The following pre-analytical parameters were varied in order to analyze their impact on VEGF-A measurements: analyzing center, anticoagulant (EDTA vs. PECT / CTAD), cannula (butterfly vs. neonatal), type of centrifuge (swing-out vs. fixed-angle), time before and after centrifugation, filling level (completely filled vs. half-filled tubes) and analyzing method (ELISA vs. multiplex bead array). Additionally, intrapersonal variations over time and sex differences were explored. Statistical analysis was performed using a linear regression model. The following parameters were identified as statistically significant independent confounders of VEGF-A measurements: analyzing center, anticoagulant, centrifuge, analyzing method and sex of the proband. The following parameters were no significant confounders in our data set: intrapersonal variation over one week, cannula, time before and after centrifugation and filling level of collection tubes. VEGF-A measurement results can be affected significantly by the identified pre-analytical parameters. We recommend the use of CTAD anticoagulant, a standardized type of centrifuge and one central laboratory using the same analyzing method for all samples.

Pre-Analytical Parameters Affecting Vascular Endothelial Growth Factor Measurement in Plasma: Identifying Confounders.

Directory of Open Access Journals (Sweden)

Johanna M Walz

Full Text Available Vascular endothelial growth factor-A (VEGF-A is intensively investigated in various medical fields. However, comparing VEGF-A measurements is difficult because sample acquisition and pre-analytic procedures differ between studies. We therefore investigated which variables act as confounders of VEGF-A measurements.Following a standardized protocol, blood was taken at three clinical sites from six healthy participants (one male and one female participant at each center twice one week apart. The following pre-analytical parameters were varied in order to analyze their impact on VEGF-A measurements: analyzing center, anticoagulant (EDTA vs. PECT / CTAD, cannula (butterfly vs. neonatal, type of centrifuge (swing-out vs. fixed-angle, time before and after centrifugation, filling level (completely filled vs. half-filled tubes and analyzing method (ELISA vs. multiplex bead array. Additionally, intrapersonal variations over time and sex differences were explored. Statistical analysis was performed using a linear regression model.The following parameters were identified as statistically significant independent confounders of VEGF-A measurements: analyzing center, anticoagulant, centrifuge, analyzing method and sex of the proband. The following parameters were no significant confounders in our data set: intrapersonal variation over one week, cannula, time before and after centrifugation and filling level of collection tubes.VEGF-A measurement results can be affected significantly by the identified pre-analytical parameters. We recommend the use of CTAD anticoagulant, a standardized type of centrifuge and one central laboratory using the same analyzing method for all samples.

Fractional Brownian motion and motion governed by the fractional Langevin equation in confined geometries.

Science.gov (United States)

Jeon, Jae-Hyung; Metzler, Ralf

2010-02-01

Motivated by subdiffusive motion of biomolecules observed in living cells, we study the stochastic properties of a non-Brownian particle whose motion is governed by either fractional Brownian motion or the fractional Langevin equation and restricted to a finite domain. We investigate by analytic calculations and simulations how time-averaged observables (e.g., the time-averaged mean-squared displacement and displacement correlation) are affected by spatial confinement and dimensionality. In particular, we study the degree of weak ergodicity breaking and scatter between different single trajectories for this confined motion in the subdiffusive domain. The general trend is that deviations from ergodicity are decreased with decreasing size of the movement volume and with increasing dimensionality. We define the displacement correlation function and find that this quantity shows distinct features for fractional Brownian motion, fractional Langevin equation, and continuous time subdiffusion, such that it appears an efficient measure to distinguish these different processes based on single-particle trajectory data.

Measuring the electron-ion ring parameters by bremsstrahlung

International Nuclear Information System (INIS)

Inkin, V.D.; Mozelev, A.A.; Sarantsev, V.P.

1982-01-01

A system is described for measuring the number of electrons and ions in the electron-ion rings of a collective heavy ion accelerator. The system operation is based on detecting gamma quanta of bremsstrahlung following the ring electron interaction with the nuclei of neutral atoms and ions at different stages of filling the ring with ions. The radiation detector is a scintillation block - a photomultiplier operating for counting with NaI(Tl) crystal sized 30x30 mm and ensuring the detection efficiency close to unity. The system apparatus is made in the CAMAC standard and rems on-line with the TRA/i miniature computer. The block-diagrams of the system and algorithm of data processing are presented. A conclusion is drawn that the results of measuring the ring parameters with the use of the diagnostics system described are in good agreement within the range of measuring errors with those obtained by means of the diagnostics system employing synchrotron radiation and induction sensors

Resonance parameters for measured keV neutron capture cross sections

Energy Technology Data Exchange (ETDEWEB)

Musgrove, A.R. de L

1969-05-01

All available neutron capture cross sections in the keV region ({approx} to 100 keV) have been fitted with resonance parameters. Capture cross sections for nuclides with reasonably well known average s-wave parameters, but no measured cross section, have been calculated and tabulated using p-and d- wave strength functions interpolated between fitted values. Several of these nuclides are of interest in the theory of slow nucleosynthesis of heavy elements in stars, and the product of cosmic abundance (due to the s-process) and capture cross section at 30 keV has been plotted versus mass number. (author)

Parameters-adjustable front-end controller in digital nuclear measurement system

International Nuclear Information System (INIS)

Hao Dejian; Zhang Ruanyu; Yan Yangyang; Wang Peng; Tang Changjian

2013-01-01

Background: One digitizer is used to implement a digital nuclear measurement for the acquisition of nuclear information. Purpose: A principle and method of a parameter-adjustable front-end controller is presented for the sake of reducing the quantitative errors while getting the maximum ENOB (effective number of bits) of ADC (analog-to-digital converter) during waveform digitizing, as well as reducing the losing counts. Methods: First of all, the quantitative relationship among the radiation count rate (n), the amplitude of input signal (V in ), the conversion scale of ADC (±V) and the amplification factor (A) was derived. Secondly, the hardware and software of the front-end controller were designed to fulfill matching the output of different detectors, adjusting the amplification linearly through the control of channel switching, and setting of digital potentiometer by CPLD (Complex Programmable Logic Device). Results: (1) Through the measurement of γ-ray of Am-241 under our digital nuclear measurement set-up with CZT detector, it was validated that the amplitude of output signal of detectors of RC feedback type could be amplified linearly with adjustable amplification by the front-end controller. (2) Through the measurement of X-ray spectrum of Fe-5.5 under our digital nuclear measurement set-up with Si-PIN detector, it was validated that the front-end controller was suitable for the switch resetting type detectors, by which high precision measurement under various count rates could be fulfilled. Conclusion: The principle and method of the parameter-adjustable front-end controller presented in this paper is correct and feasible. (authors)

Measurement of speech parameters in casual speech of dementia patients

NARCIS (Netherlands)

Ossewaarde, Roelant; Jonkers, Roel; Jalvingh, Fedor; Bastiaanse, Yvonne

Measurement of speech parameters in casual speech of dementia patients Roelant Adriaan Ossewaarde1,2, Roel Jonkers1, Fedor Jalvingh1,3, Roelien Bastiaanse1 1CLCG, University of Groningen (NL); 2HU University of Applied Sciences Utrecht (NL); 33St. Marienhospital - Vechta, Geriatric Clinic Vechta

Local measurement of transport parameters for laser injected trace impurities

Energy Technology Data Exchange (ETDEWEB)

Giannella, R; Lauro-Taroni, L [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking

1994-07-01

A procedure has been developed that determines local measurements of transport parameters`s profiles for injected impurities. The measured profiles extend from the plasma centre up to a certain radial position (usually {rho} = 0.6-0.7). In the outer region of the plasma the procedure supplies ``most suitable extensions`` up to the plasma edge of the measured transport profiles. The procedure intrinsically assures consistency and excellent agreement between the simulated and experimental data of local broad band soft X-ray emissivity and intensities of individual emission lines from different ion states of the injected impurities. 4 refs., 3 figs.

The Association between Parameters of Malnutrition and Diagnostic Measures of Sarcopenia in Geriatric Outpatients

Science.gov (United States)

Reijnierse, Esmee M.; Trappenburg, Marijke C.; Leter, Morena J.; Blauw, Gerard Jan; de van der Schueren, Marian A. E.; Meskers, Carel G. M.; Maier, Andrea B.

2015-01-01

Objectives Diagnostic criteria for sarcopenia include measures of muscle mass, muscle strength and physical performance. Consensus on the definition of sarcopenia has not been reached yet. To improve insight into the most clinically valid definition of sarcopenia, this study aimed to compare the association between parameters of malnutrition, as a risk factor in sarcopenia, and diagnostic measures of sarcopenia in geriatric outpatients. Material and Methods This study is based on data from a cross-sectional study conducted in a geriatric outpatient clinic including 185 geriatric outpatients (mean age 82 years). Parameters of malnutrition included risk of malnutrition (assessed by the Short Nutritional Assessment Questionnaire), loss of appetite, unintentional weight loss and underweight (body mass index malnutrition (independent variables) and diagnostic measures of sarcopenia (dependent variables) were analysed using multivariate linear regression models adjusted for age, body mass, fat mass and height in separate models. Results None of the parameters of malnutrition was consistently associated with diagnostic measures of sarcopenia. The strongest associations were found for both relative and absolute muscle mass; less stronger associations were found for muscle strength and physical performance. Underweight (p = malnutrition relate differently to diagnostic measures of sarcopenia in geriatric outpatients. The association between parameters of malnutrition and diagnostic measures of sarcopenia was strongest for both relative and absolute muscle mass, while less strong associations were found with muscle strength and physical performance. PMID:26284368

Using Indirect Turbulence Measurements for Real-Time Parameter Estimation in Turbulent Air

Science.gov (United States)

Martos, Borja; Morelli, Eugene A.

2012-01-01

The use of indirect turbulence measurements for real-time estimation of parameters in a linear longitudinal dynamics model in atmospheric turbulence was studied. It is shown that measuring the atmospheric turbulence makes it possible to treat the turbulence as a measured explanatory variable in the parameter estimation problem. Commercial off-the-shelf sensors were researched and evaluated, then compared to air data booms. Sources of colored noise in the explanatory variables resulting from typical turbulence measurement techniques were identified and studied. A major source of colored noise in the explanatory variables was identified as frequency dependent upwash and time delay. The resulting upwash and time delay corrections were analyzed and compared to previous time shift dynamic modeling research. Simulation data as well as flight test data in atmospheric turbulence were used to verify the time delay behavior. Recommendations are given for follow on flight research and instrumentation.

Correlation and agreement of a digital and conventional method to measure arch parameters.

Science.gov (United States)

Nawi, Nes; Mohamed, Alizae Marny; Marizan Nor, Murshida; Ashar, Nor Atika

2018-01-01

The aim of the present study was to determine the overall reliability and validity of arch parameters measured digitally compared to conventional measurement. A sample of 111 plaster study models of Down syndrome (DS) patients were digitized using a blue light three-dimensional (3D) scanner. Digital and manual measurements of defined parameters were performed using Geomagic analysis software (Geomagic Studio 2014 software, 3D Systems, Rock Hill, SC, USA) on digital models and with a digital calliper (Tuten, Germany) on plaster study models. Both measurements were repeated twice to validate the intraexaminer reliability based on intraclass correlation coefficients (ICCs) using the independent t test and Pearson's correlation, respectively. The Bland-Altman method of analysis was used to evaluate the agreement of the measurement between the digital and plaster models. No statistically significant differences (p > 0.05) were found between the manual and digital methods when measuring the arch width, arch length, and space analysis. In addition, all parameters showed a significant correlation coefficient (r ≥ 0.972; p digital and manual measurements. Furthermore, a positive agreement between digital and manual measurements of the arch width (90-96%), arch length and space analysis (95-99%) were also distinguished using the Bland-Altman method. These results demonstrate that 3D blue light scanning and measurement software are able to precisely produce 3D digital model and measure arch width, arch length, and space analysis. The 3D digital model is valid to be used in various clinical applications.

The Research of Screw Thread Parameter Measurement Based on Position Sensitive Detector and Laser

International Nuclear Information System (INIS)

Tong, Q B; Ding, Z L; Chen, J C; Ai, L L; Yuan, F

2006-01-01

A technique and system of measuring screw thread parameter based on the theory of laser measurement is presented in this paper, which can be carried out the automated measurement of screw thread parameter. An inspection instrument was designed and produced, which included exterior imaging system of optical path, transverse displacement measurement system, axial displacement measurement system, and a module to deal with, control and assess the data in the upper system. The inspection and estimate of the screw thread contour curve were completed by using position sensitive device (PSD) as photoelectric detector to measure the coordinate data of the screw thread contour curve in the transverse section, and using precise raster to measure the axial displacement of the precision worktable under the screw thread test criterion., computer can gives a measured result according to coordinate data of the screw thread obtained by PSD. The relation between measured spot and image is established, and optimum design of the system organization are introduced, including the image length of receiving lens focal length optical system and the choice of PSD , and some main factor affected measuring precision are analyzed. The experimental results show that the measurement uncertainty of screw thread minor diameter can reach 0. 5μm, which can meet most requests for the measurement of screw thread parameter

Hydrological model parameter dimensionality is a weak measure of prediction uncertainty

Science.gov (United States)

Pande, S.; Arkesteijn, L.; Savenije, H.; Bastidas, L. A.

2015-04-01

This paper shows that instability of hydrological system representation in response to different pieces of information and associated prediction uncertainty is a function of model complexity. After demonstrating the connection between unstable model representation and model complexity, complexity is analyzed in a step by step manner. This is done measuring differences between simulations of a model under different realizations of input forcings. Algorithms are then suggested to estimate model complexity. Model complexities of the two model structures, SAC-SMA (Sacramento Soil Moisture Accounting) and its simplified version SIXPAR (Six Parameter Model), are computed on resampled input data sets from basins that span across the continental US. The model complexities for SIXPAR are estimated for various parameter ranges. It is shown that complexity of SIXPAR increases with lower storage capacity and/or higher recession coefficients. Thus it is argued that a conceptually simple model structure, such as SIXPAR, can be more complex than an intuitively more complex model structure, such as SAC-SMA for certain parameter ranges. We therefore contend that magnitudes of feasible model parameters influence the complexity of the model selection problem just as parameter dimensionality (number of parameters) does and that parameter dimensionality is an incomplete indicator of stability of hydrological model selection and prediction problems.

Measurements of gas parameters in plasma-assisted supersonic combustion processes using diode laser spectroscopy

International Nuclear Information System (INIS)

Bolshov, Mikhail A; Kuritsyn, Yu A; Liger, V V; Mironenko, V R; Leonov, S B; Yarantsev, D A

2009-01-01

We report a procedure for temperature and water vapour concentration measurements in an unsteady-state combustion zone using diode laser absorption spectroscopy. The procedure involves measurements of the absorption spectrum of water molecules around 1.39 μm. It has been used to determine hydrogen combustion parameters in M = 2 gas flows in the test section of a supersonic wind tunnel. The relatively high intensities of the absorption lines used have enabled direct absorption measurements. We describe a differential technique for measurements of transient absorption spectra, the procedure we used for primary data processing and approaches for determining the gas temperature and H 2 O concentration in the probed zone. The measured absorption spectra are fitted with spectra simulated using parameters from spectroscopic databases. The combustion-time-averaged (∼50 ms) gas temperature and water vapour partial pressure in the hot wake region are determined to be 1050 K and 21 Torr, respectively. The large signal-to-noise ratio in our measurements allowed us to assess the temporal behaviour of these parameters. The accuracy in our temperature measurements in the probed zone is ∼40 K. (laser applications and other topics in quantum electronics)

Rocket measurements within a polar cap arc - Plasma, particle, and electric circuit parameters

Science.gov (United States)

Weber, E. J.; Ballenthin, J. O.; Basu, S.; Carlson, H. C.; Hardy, D. A.; Maynard, N. C.; Kelley, M. C.; Fleischman, J. R.; Pfaff, R. F.

1989-01-01

Results are presented from the Polar Ionospheric Irregularities Experiment (PIIE), conducted from Sondrestrom, Greenland, on March 15, 1985, designed for an investigation of processes which lead to the generation of small-scale (less than 1 km) ionospheric irregularities within polar-cap F-layer auroras. An instrumented rocket was launched into a polar cap F layer aurora to measure energetic electron flux, plasma, and electric circuit parameters of a sun-aligned arc, coordinated with simultaneous measurements from the Sondrestrom incoherent scatter radar and the AFGL Airborne Ionospheric Observatory. Results indicated the existence of two different generation mechanisms on the dawnside and duskside of the arc. On the duskside, parameters are suggestive of an interchange process, while on the dawnside, fluctuation parameters are consistent with a velocity shear instability.

Validity of a smartphone protractor to measure sagittal parameters in adult spinal deformity.

Science.gov (United States)

Kunkle, William Aaron; Madden, Michael; Potts, Shannon; Fogelson, Jeremy; Hershman, Stuart

2017-10-01

Smartphones have become an integral tool in the daily life of health-care professionals (Franko 2011). Their ease of use and wide availability often make smartphones the first tool surgeons use to perform measurements. This technique has been validated for certain orthopedic pathologies (Shaw 2012; Quek 2014; Milanese 2014; Milani 2014), but never to assess sagittal parameters in adult spinal deformity (ASD). This study was designed to assess the validity, reproducibility, precision, and efficiency of using a smartphone protractor application to measure sagittal parameters commonly measured in ASD assessment and surgical planning. This study aimed to (1) determine the validity of smartphone protractor applications, (2) determine the intra- and interobserver reliability of smartphone protractor applications when used to measure sagittal parameters in ASD, (3) determine the efficiency of using a smartphone protractor application to measure sagittal parameters, and (4) elucidate whether a physician's level of experience impacts the reliability or validity of using a smartphone protractor application to measure sagittal parameters in ASD. An experimental validation study was carried out. Thirty standard 36″ standing lateral radiographs were examined. Three separate measurements were performed using a marker and protractor; then at a separate time point, three separate measurements were performed using a smartphone protractor application for all 30 radiographs. The first 10 radiographs were then re-measured two more times, for a total of three measurements from both the smartphone protractor and marker and protractor. The parameters included lumbar lordosis, pelvic incidence, and pelvic tilt. Three raters performed all measurements-a junior level orthopedic resident, a senior level orthopedic resident, and a fellowship-trained spinal deformity surgeon. All data, including the time to perform the measurements, were recorded, and statistical analysis was performed to

Two-detector cross-correlation noise technique and its application in measuring reactor kinetic parameters

International Nuclear Information System (INIS)

Lu Guiping; Peng Feng; Yi Jieyi

1988-01-01

The two-detector cross-correlation noise technique is a new method of measuring reactor kinetic parameters developed in the sixties. It has the advantages of non-perturbation in core, high signal to noise ratio, low space dependent effect, and simple and reliable in measurement. A special set of cross-correlation analyzer has been prepared for measuring kinetic parameters of several reactor assemblies, such as the High Flux Engineering Test Reactor, its zero power mock up facility and a low enriched uranium light water lattice zero power facility

Using linear time-invariant system theory to estimate kinetic parameters directly from projection measurements

International Nuclear Information System (INIS)

Zeng, G.L.; Gullberg, G.T.

1995-01-01

It is common practice to estimate kinetic parameters from dynamically acquired tomographic data by first reconstructing a dynamic sequence of three-dimensional reconstructions and then fitting the parameters to time activity curves generated from the time-varying reconstructed images. However, in SPECT, the pharmaceutical distribution can change during the acquisition of a complete tomographic data set, which can bias the estimated kinetic parameters. It is hypothesized that more accurate estimates of the kinetic parameters can be obtained by fitting to the projection measurements instead of the reconstructed time sequence. Estimation from projections requires the knowledge of their relationship between the tissue regions of interest or voxels with particular kinetic parameters and the project measurements, which results in a complicated nonlinear estimation problem with a series of exponential factors with multiplicative coefficients. A technique is presented in this paper where the exponential decay parameters are estimated separately using linear time-invariant system theory. Once the exponential factors are known, the coefficients of the exponentials can be estimated using linear estimation techniques. Computer simulations demonstrate that estimation of the kinetic parameters directly from the projections is more accurate than the estimation from the reconstructed images

Measuring Cosmological Parameters with Photometrically Classified Pan-STARRS Supernovae

Science.gov (United States)

Jones, David; Scolnic, Daniel; Riess, Adam; Rest, Armin; Kirshner, Robert; Berger, Edo; Kessler, Rick; Pan, Yen-Chen; Foley, Ryan; Chornock, Ryan; Ortega, Carolyn; Challis, Peter; Burgett, William; Chambers, Kenneth; Draper, Peter; Flewelling, Heather; Huber, Mark; Kaiser, Nick; Kudritzki, Rolf; Metcalfe, Nigel; Tonry, John; Wainscoat, Richard J.; Waters, Chris; Gall, E. E. E.; Kotak, Rubina; McCrum, Matt; Smartt, Stephen; Smith, Ken

2018-01-01

We use nearly 1,200 supernovae (SNe) from Pan-STARRS and ~200 low-z (z energy equation of state parameter w to be -0.986±0.058 (stat+sys). If we allow w to evolve with redshift as w(a) = w0 + wa(1-a), we find w0 = -0.923±0.148 and wa = -0.404±0.797. These results are consistent with measurements of cosmological parameters from the JLA and from a new analysis of 1049 spectroscopically confirmed SNe Ia (Scolnic et al. 2017). We try four different photometric classification priors for Pan-STARRS SNe and two alternate ways of modeling the CC SN contamination, finding that none of these variants gives a w that differs by more than 1% from the baseline measurement. The systematic uncertainty on w due to marginalizing over the CC SN contamination, σwCC = 0.019, is approximately equal to the photometric calibration uncertainty and is lower than the systematic uncertainty in the SN\\,Ia dispersion model (σwdisp = 0.024). Our data provide one of the best current constraints on w, demonstrating that samples with ~5% CC SN contamination can give competitive cosmological constraints when the contaminating distribution is marginalized over in a Bayesian framework.

A double parameters measurement of steam-water two-phase flow with single orifice

International Nuclear Information System (INIS)

Zhong Shuoping; Tong Yunxian; Yu Meiying

1992-08-01

A double parameters measurement of steam-water two-phase flow with single orifice is described. An on-line measurement device based on micro-computer has been developed. The measured r.m.s error of steam quality is less than 6.5% and the measured relative r.m.s. error of mass flow rate is less than 9%

Measurement and simulation of the TRR BNCT beam parameters

Energy Technology Data Exchange (ETDEWEB)

Bavarnegin, Elham [Nuclear Science and Technology Research Institute (NSTRI), Tehran (Iran, Islamic Republic of); Department of Physics, University of Guilan, Rasht (Iran, Islamic Republic of); Sadremomtaz, Alireza [Department of Physics, University of Guilan, Rasht (Iran, Islamic Republic of); Khalafi, Hossein [Nuclear Science and Technology Research Institute (NSTRI), Tehran (Iran, Islamic Republic of); Kasesaz, Yaser, E-mail: ykasesaz@aeoi.org.ir [Nuclear Science and Technology Research Institute (NSTRI), Tehran (Iran, Islamic Republic of); Golshanian, Mohadeseh; Ghods, Hossein; Ezzati, Arsalan; Keyvani, Mehdi; Haddadi, Mohammad [Nuclear Science and Technology Research Institute (NSTRI), Tehran (Iran, Islamic Republic of)

2016-09-11

Recently, the configuration of the Tehran Research Reactor (TRR) thermal column has been modified and a proper thermal neutron beam for preclinical Boron Neutron Capture Therapy (BNCT) has been obtained. In this study, simulations and experimental measurements have been carried out to identify the BNCT beam parameters including the beam uniformity, the distribution of the thermal neutron dose, boron dose, gamma dose in a phantom and also the Therapeutic Gain (TG). To do this, the entire TRR structure including the reactor core, pool, the thermal column and beam tubes have been modeled using MCNPX Monte Carlo code. To measure in-phantom dose distribution a special head phantom has been constructed and foil activation techniques and TLD700 dosimeter have been used. The results show that there is enough uniformity in TRR thermal BNCT beam. TG parameter has the maximum value of 5.7 at the depth of 1 cm from the surface of the phantom, confirming that TRR thermal neutron beam has potential for being used in treatment of superficial brain tumors. For the purpose of a clinical trial, more modifications need to be done at the reactor, as, for example design, and construction of a treatment room at the beam exit which is our plan for future. To date, this beam is usable for biological studies and animal trials. There is a relatively good agreement between simulation and measurement especially within a diameter of 10 cm which is the dimension of usual BNCT beam ports. This relatively good agreement enables a more precise prediction of the irradiation conditions needed for future experiments.

Measurements of Dune Parameters on Titan Suggest Differences in Sand Availability

Science.gov (United States)

Stewart, Brigitte W.; Radebaugh, Jani

2014-11-01

The equatorial region of Saturn’s moon Titan has five large sand seas with dunes similar to large linear dunes on Earth. Cassini Radar SAR swaths have high enough resolution (300 m) to measure dune parameters such as width and spacing, which helps inform us about formation conditions and long-term evolution of the sand dunes. Previous measurements in locations scattered across Titan have revealed an average width of 1.3 km and spacing of 2.7 km, with variations by location. We have taken over 1200 new measurements of dune width and spacing in the T8 swath, a region on the leading hemisphere of Titan in the Belet Sand Sea, between -5 and -9 degrees latitude. We have also taken over 500 measurements in the T44 swath, located on the anti-Saturn hemisphere in the Shangri-La Sand Sea, between 0 and 20 degrees latitude. We correlated each group of 50 measurements with the average distance from the edge of the dune field to obtain an estimate of how position within a dune field affects dune parameters. We found that in general, the width and spacing of dunes decreases with distance from the edge of the dune field, consistent with similar measurements in sand seas on Earth. We suggest that this correlation is due to the lesser availability of sand at the edges of dune fields. These measurements and correlations could be helpful in determining differences in sand availability across different dune fields, and along the entire equatorial region of Titan.

Prediction of betavoltaic battery output parameters based on SEM measurements and Monte Carlo simulation

International Nuclear Information System (INIS)

Yakimov, Eugene B.

2016-01-01

An approach for a prediction of "6"3Ni-based betavoltaic battery output parameters is described. It consists of multilayer Monte Carlo simulation to obtain the depth dependence of excess carrier generation rate inside the semiconductor converter, a determination of collection probability based on the electron beam induced current measurements, a calculation of current induced in the semiconductor converter by beta-radiation, and SEM measurements of output parameters using the calculated induced current value. Such approach allows to predict the betavoltaic battery parameters and optimize the converter design for any real semiconductor structure and any thickness and specific activity of beta-radiation source. - Highlights: • New procedure for betavoltaic battery output parameters prediction is described. • A depth dependence of beta particle energy deposition for Si and SiC is calculated. • Electron trajectories are assumed isotropic and uniformly started under simulation.

Measurements for kinetic parameters estimation in the RA-0 research reactor

International Nuclear Information System (INIS)

Gomez, A; Bellino, P A

2012-01-01

In the present work, measurements based on the neutron noise technique and the inverse kinetic method were performed to estimate the different kinetic parameters of the reactor in its critical state. By means of the neutron noise technique, we obtained the current calibration factor of the ionization chamber M6 belonging to the power range channels of the reactor instrumentation. The maximum current allowed compatible with the maximum power authorized by the operation license was also obtained. Using the neutron noise technique, the reduced mean reproduction time (Λ*) was estimated. This parameter plays a fundamental role in the deterministic analysis of criticality accidents. Comparison with previous values justified performing new measurements to study systematic trends in the value of Λ*. Using the inverse kinetics method, the reactivity worth of the control rods was estimated, confirming the existence of spatial effects and trends previously observed (author)

Measurement of key pool boiling parameters in nanofluids for nuclear applications

International Nuclear Information System (INIS)

Bang, In Cheol; Buongiorno, Jacopo; Hu, Lin-Wen; Wang, Hsin

2008-01-01

Nanofluids, colloidal dispersions of nanoparticles in a base fluid such as water, can afford very significant Critical Heat Flux (CHF) enhancement. Such engineered fluids potentially could be employed in reactors as advanced coolants in safety systems with significant safety and economic advantages. However, a satisfactory explanation of the CHF enhancement mechanism in nanofluids is lacking. To close this gap, we have identified the important boiling parameters to be measured. These are the properties (e.g., density, viscosity, thermal conductivity, specific heat, vaporization enthalpy, surface tension), hydrodynamic parameters (i.e., bubble size, bubble velocity, departure frequency, hot/dry spot dynamics) and surface conditions (i.e., contact angle, nucleation site density). We have also deployed a pool boiling facility in which many such parameters can be measured. The facility is equipped with a thin indium-tin-oxide heater deposited over a sapphire substrate. An infra-red high-speed camera and an optical probe are used to measure the temperature distribution on the heater and the hydrodynamics above the heater, respectively. The first data generated with this facility already provide some clue on the CHF enhancement mechanism in nanofluids. Specifically, the progression to burnout in a pure fluid (ethanol in this case) is characterized by a smoothly-shaped and steadily-expanding hot spot. By contrast, in the ethanol-based nanofluid the hot spot pulsates and the progression to burnout lasts longer, although the nanofluid CHF is higher than the pure fluid CHF. The presence of a nanoparticle deposition layer on the heater surface seems to enhance wettability and aid hot spot dissipation, thus delaying burnout. (author)

Self-Trapping Self-Repelling Random Walks

Science.gov (United States)

Grassberger, Peter

2017-10-01

Although the title seems self-contradictory, it does not contain a misprint. The model we study is a seemingly minor modification of the "true self-avoiding walk" model of Amit, Parisi, and Peliti in two dimensions. The walks in it are self-repelling up to a characteristic time T* (which depends on various parameters), but spontaneously (i.e., without changing any control parameter) become self-trapping after that. For free walks, T* is astronomically large, but on finite lattices the transition is easily observable. In the self-trapped regime, walks are subdiffusive and intermittent, spending longer and longer times in small areas until they escape and move rapidly to a new area. In spite of this, these walks are extremely efficient in covering finite lattices, as measured by average cover times.

Ultra-Weak Fiber Bragg Grating Sensing Network Coated with Sensitive Material for Multi-Parameter Measurements

Directory of Open Access Journals (Sweden)

Wei Bai

2017-06-01

Full Text Available A multi-parameter measurement system based on ultra-weak fiber Bragg grating (UFBG array with sensitive material was proposed and experimentally demonstrated. The UFBG array interrogation principle is time division multiplex technology with two semiconductor optical amplifiers as timing units. Experimental results showed that the performance of the proposed UFBG system is almost equal to that of traditional FBG, while the UFBG array system has obvious superiority with potential multiplexing ability for multi-point and multi-parameter measurement. The system experimented on a 144 UFBG array with the reflectivity of UFBG ~0.04% for the four target parameters: hydrogen, humidity, temperature and salinity. Moreover, a uniform solution was customized to divide the cross-sensitivity between temperature and other target parameters. It is expected that this scheme will be capable of handling thousands of multi-parameter sensors in a single fiber.

Ultra-Weak Fiber Bragg Grating Sensing Network Coated with Sensitive Material for Multi-Parameter Measurements.

Science.gov (United States)

Bai, Wei; Yang, Minghong; Hu, Chenyuan; Dai, Jixiang; Zhong, Xuexiang; Huang, Shuai; Wang, Gaopeng

2017-06-26

A multi-parameter measurement system based on ultra-weak fiber Bragg grating (UFBG) array with sensitive material was proposed and experimentally demonstrated. The UFBG array interrogation principle is time division multiplex technology with two semiconductor optical amplifiers as timing units. Experimental results showed that the performance of the proposed UFBG system is almost equal to that of traditional FBG, while the UFBG array system has obvious superiority with potential multiplexing ability for multi-point and multi-parameter measurement. The system experimented on a 144 UFBG array with the reflectivity of UFBG ~0.04% for the four target parameters: hydrogen, humidity, temperature and salinity. Moreover, a uniform solution was customized to divide the cross-sensitivity between temperature and other target parameters. It is expected that this scheme will be capable of handling thousands of multi-parameter sensors in a single fiber.

Measurements of the Z boson resonance parameters at SLC [SLAC Linear Collider

International Nuclear Information System (INIS)

Hearty, C.

1989-07-01

This paper presents the measurement by the Mark II experiment at the SLAC Linear Collider of the parameters of the Z boson resonance. The results are updated from those presented at the SLAC Summer Institute to include all data presented in the most recent Mark II publication, consisting of 19 nb -1 of data at ten different center-of-mass energies between 89.2 and 93.0 GeV. The resonance parameters are extracted by measuring the Z production cross section at a series of center-of-mass energies (scan points) near the Z peak, then fitting these data with the theoretical cross section. The four major aspects of the analysis are the determination at each scan point of the center-of-mass energy (E), the integrated luminosity, the number of Z decays and the expected cross section as a function of the resonance parameters, such as mass and width. I will discuss each of these steps in turn, after a brief description of the Mark II detector, then conclude with the results of the analysis. 7 refs., 9 figs., 3 tabs

Software measurement standards for areal surface texture parameters: part 2—comparison of software

International Nuclear Information System (INIS)

Harris, P M; Smith, I M; Giusca, C; Leach, R K; Wang, C

2012-01-01

A companion paper in this issue describes reference software for the evaluation of areal surface texture parameters, focusing on the definitions of the parameters and giving details of the numerical algorithms employed in the software to implement those definitions. The reference software is used as a benchmark against which software in a measuring instrument can be compared. A data set is used as input to both the software under test and the reference software, and the results delivered by the software under test are compared with those provided by the reference software. This paper presents a comparison of the results returned by the reference software with those reported by proprietary software for surface texture measurement. Differences between the results can be used to identify where algorithms and software for evaluating the parameters differ. They might also be helpful in identifying where parameters are not sufficiently well-defined in standards. (paper)

Space dependence of reactivity parameters on reactor dynamic perturbation measurements

International Nuclear Information System (INIS)

Maletti, R.; Ziegenbein, D.

1985-01-01

Practical application of reactor-dynamic perturbation measurements for on-power determination of differential reactivity weight of control rods and power coefficients of reactivity has shown a significant dependence of parameters on the position of outcore detectors. The space dependence of neutron flux signal in the core of a VVER-440-type reactor was measured by means of 60 self-powered neutron detectors. The greatest neutron flux alterations are located close to moved control rods and in height of the perturbation position. By means of computations, detector positions can be found in the core in which the one-point model is almost valid. (author)

Headphone-To-Ear Transfer Function Estimation Using Measured Acoustic Parameters

Directory of Open Access Journals (Sweden)

Jinlin Liu

2018-06-01

Full Text Available This paper proposes to use an optimal five-microphone array method to measure the headphone acoustic reflectance and equivalent sound sources needed in the estimation of headphone-to-ear transfer functions (HpTFs. The performance of this method is theoretically analyzed and experimentally investigated. With the measured acoustic parameters HpTFs for different headphones and ear canal area functions are estimated based on a computational acoustic model. The estimation results show that HpTFs vary considerably with headphones and ear canals, which suggests that individualized compensations for HpTFs are necessary for headphones to reproduce desired sounds for different listeners.

Beam parameter measurements for the SLAC linear collider

International Nuclear Information System (INIS)

Clendenin, J.E.; Blocker, C.; Breidenbach, M.

1982-01-01

A stable, closely-controlled, high-intensity, single-bunch beam will be required for the SLAC Linear Collider. The characteristics of short-pulse, low-intensity beams in the SLAC linac have been studied. A new, high-intensity thermionic gun, subharmonic buncher and S-band buncher/accelerator section were installed recently at SLAC. With these components, up to 10 11 electrons in a single S-band bunch are available for injection into the linac. the first 100-m accelerator sector has been modified to allow control of short-pulse beams by a model-driven computer program. Additional instrumentation, including a computerized energy analyzer and emittance monitor have been added at the end of the 100-m sector. The beam intensity, energy spectrum, emittance, charge distribution and the effect of wake fields in the first accelerator sector have been measured. The new source and beam control system will be described and the most recent results of the beam parameter measurements will be discussed

Measuring Accurate Body Parameters of Dressed Humans with Large-Scale Motion Using a Kinect Sensor

Directory of Open Access Journals (Sweden)

Sidan Du

2013-08-01

Full Text Available Non-contact human body measurement plays an important role in surveillance, physical healthcare, on-line business and virtual fitting. Current methods for measuring the human body without physical contact usually cannot handle humans wearing clothes, which limits their applicability in public environments. In this paper, we propose an effective solution that can measure accurate parameters of the human body with large-scale motion from a Kinect sensor, assuming that the people are wearing clothes. Because motion can drive clothes attached to the human body loosely or tightly, we adopt a space-time analysis to mine the information across the posture variations. Using this information, we recover the human body, regardless of the effect of clothes, and measure the human body parameters accurately. Experimental results show that our system can perform more accurate parameter estimation on the human body than state-of-the-art methods.

Evaluation of Perfusion and Thermal Parameters of Skin Tissue Using Cold Provocation and Thermographic Measurements

Directory of Open Access Journals (Sweden)

Strąkowska Maria

2016-09-01

Full Text Available Measurement of the perfusion coefficient and thermal parameters of skin tissue using dynamic thermography is presented in this paper. A novel approach based on cold provocation and thermal modelling of skin tissue is presented. The measurement was performed on a person’s forearm using a special cooling device equipped with the Peltier module. The proposed method first cools the skin, and then measures the changes of its temperature matching the measurement results with a heat transfer model to estimate the skin perfusion and other thermal parameters. In order to assess correctness of the proposed approach, the uncertainty analysis was performed.

Probing the type of anomalous diffusion with single-particle tracking.

Science.gov (United States)

Ernst, Dominique; Köhler, Jürgen; Weiss, Matthias

2014-05-07

Many reactions in complex fluids, e.g. signaling cascades in the cytoplasm of living cells, are governed by a diffusion-driven encounter of reactants. Yet, diffusion in complex fluids often exhibits an anomalous characteristic ('subdiffusion'). Since different types of subdiffusion have distinct effects on timing and equilibria of chemical reactions, a thorough determination of the reactants' type of random walk is key to a quantitative understanding of reactions in complex fluids. Here we introduce a straightforward and simple approach for determining the type of subdiffusion from single-particle tracking data. Unlike previous approaches, our method also is sensitive to transient subdiffusion phenomena, e.g. obstructed diffusion below the percolation threshold. We validate our strategy with data from experiment and simulation.

Transport of oxygen ions in Er doped La2Mo2O9 oxide ion conductors: Correlation with microscopic length scales

Science.gov (United States)

Paul, T.; Ghosh, A.

2018-01-01

We report oxygen ion transport in La2-xErxMo2O9 (0.05 ≤ x ≤ 0.25) oxide ion conductors. We have measured conductivity and dielectric spectra at different temperatures in a wide frequency range. The mean square displacement and spatial extent of non-random sub-diffusive regions are estimated from the conductivity spectra and dielectric spectra, respectively, using linear response theory. The composition dependence of the conductivity is observed to be similar to that of the spatial extent of non-random sub-diffusive regions. The behavior of the composition dependence of the mean square displacement of oxygen ions is opposite to that of the conductivity. The attempt frequency estimated from the analysis of the electric modulus agrees well with that obtained from the Raman spectra analysis. The full Rietveld refinement of X-ray diffraction data of the samples is performed to estimate the distance between different oxygen lattice sites. The results obtained from such analysis confirm the ion hopping within the spatial extent of non-random sub-diffusive regions.

Measuring Parameters of Massive Black Hole Binaries with Partially-Aligned Spins

Science.gov (United States)

Lang, Ryan N.; Hughes, Scott A.; Cornish, Neil J.

2010-01-01

It is important to understand how well the gravitational-wave observatory LISA can measure parameters of massive black hole binaries. It has been shown that including spin precession in the waveform breaks degeneracies and produces smaller expected parameter errors than a simpler, precession-free analysis. However, recent work has shown that gas in binaries can partially align the spins with the orbital angular momentum, thus reducing the precession effect. We show how this degrades the earlier results, producing more pessimistic errors in gaseous mergers. However, we then add higher harmonics to the signal model; these also break degeneracies, but they are not affected by the presence of gas. The harmonics often restore the errors in partially-aligned binaries to the same as, or better than/ those that are obtained for fully precessing binaries with no harmonics. Finally, we investigate what LISA measurements of spin alignment can tell us about the nature of gas around a binary,

Experimental investigation on local parameter measurement using optical probes in two-phase flow under rolling condition

International Nuclear Information System (INIS)

Tian Daogui; Sun Licheng; Yan Changqi; Liu Guoqiang

2013-01-01

In order to get more local interfacial information as well as to further comprehend the intrinsic mechanism of two-phase flow under rolling condition, a method was proposed to measure the local parameters by using optical probes under rolling condition in this paper. An experimental investigation of two-phase flow under rolling condition was conducted using the probe fabricated by the authors. It is verified that the probe method is feasible to measure the local parameters in two'-phase flow under rolling condition. The results show that the interfacial parameters distribution near wall region has a distinct periodicity due to the rolling motion. The averaged deviation of the void fraction measured by the probe from that obtained from measured pressure drop is about 8%. (authors)

Muon decay: Measurement of the integral asymmetry parameter

International Nuclear Information System (INIS)

Beltrami, I.; Burkard, H.; Dincklage, R.D. von; Fetscher, W.; Gerber, H.J.; Johnson, K.F.

1987-01-01

The positron directional distribution following muon decay is measured. The polarized muons are derived from pion decay in flight and are brought to rest in Be metal. Using the μSR-technique P μ ξ = 1.0027 ± 0.0084 is deduced. The integral asymmetry parameters ξ bears on the mass of the W tilde (wino, the supersymmetrical partner of the gauge boson W), mediating such decay as μ → eν tilde ν tilde. Assuming very light scalar neutrini msub(n tilde) μ a new lower limit on the wino mass msub(w tilde) > 270 GeV/c 2 (90% CL) is inferred. (orig.)

Grain boundary diffusion in terms of the tempered fractional calculus

International Nuclear Information System (INIS)

Sibatov, R.T.; Svetukhin, V.V.

2017-01-01

Mathematical treatment of grain-boundary diffusion based on the model first proposed by Fisher is usually formulated in terms of normal diffusion equations in a two-component nonhomogeneous medium. On the other hand, fractional equations of anomalous diffusion proved themselves to be useful in description of grain-boundary diffusion phenomena. Moreover, the most important propagation regime predicted by Fisher's model demonstrates subdiffusive behavior. However, the direct link between fractional approach and the Fisher model and its modifications has not found yet. Here, we fill this gap and show that solution of fractional subdiffusion equation offers general properties of classical solutions obtained by Whipple and Suzuoka. The tempered fractional approach is a convenient tool for studying precipitation in granular materials as the tempered subdiffusion limited process. - Highlights: • The link connected fractional diffusion approach and Fisher's model of grain-boundary diffusion is derived. • The subdiffusion exponent of grain-boundary diffusion can differ from 1/2. • Nucleation in granular materials is modeled by the process limited by tempered subdiffusion.

Grain boundary diffusion in terms of the tempered fractional calculus

Energy Technology Data Exchange (ETDEWEB)

Sibatov, R.T., E-mail: ren_sib@bk.ru [Ulyanovsk State University, 432017, 42 Leo Tolstoy str., Ulyanovsk (Russian Federation); Svetukhin, V.V. [Ulyanovsk State University, 432017, 42 Leo Tolstoy str., Ulyanovsk (Russian Federation); Institute of Nanotechnology and Microelectronics of the Russian Academy of Sciences, 115487, 18 Nagatinskaya str., Moscow (Russian Federation)

2017-06-28

Mathematical treatment of grain-boundary diffusion based on the model first proposed by Fisher is usually formulated in terms of normal diffusion equations in a two-component nonhomogeneous medium. On the other hand, fractional equations of anomalous diffusion proved themselves to be useful in description of grain-boundary diffusion phenomena. Moreover, the most important propagation regime predicted by Fisher's model demonstrates subdiffusive behavior. However, the direct link between fractional approach and the Fisher model and its modifications has not found yet. Here, we fill this gap and show that solution of fractional subdiffusion equation offers general properties of classical solutions obtained by Whipple and Suzuoka. The tempered fractional approach is a convenient tool for studying precipitation in granular materials as the tempered subdiffusion limited process. - Highlights: • The link connected fractional diffusion approach and Fisher's model of grain-boundary diffusion is derived. • The subdiffusion exponent of grain-boundary diffusion can differ from 1/2. • Nucleation in granular materials is modeled by the process limited by tempered subdiffusion.

Ultrasonic measurements and other allied parameters of yttrium soaps in mixed organic solvents

International Nuclear Information System (INIS)

Mehrotra, K.N.; Tandon, K.

1990-01-01

The ultrasonic measurements of yttrium soaps were made in a mixture of 70 % benzene and 30 % dimethylsulfoxide (ν/ν) to determine the critical micelle concentration, soap-solvent interaction and various acoustic and thermodynamic parameters. The values of the CMC decrease with increasing chainlength of fatty acid constituent of the soap molecule and are in agreement with the values obtained from other micellar properties. The various acoustic parameters (intermolecular freelength, adiabatic compressibility, apparent molar compressibility, specific acoustic impedance, apparent molar volume, molar sound velocity, solvation number, available volume and relative association) for yttrium soaps (myristate, palmitate, stearate and oleate) have been evaluated by ultrasonic velocity measurements. (Authors)

Effects of X-ray tube parameters on thickness measure precision in X-ray profile gauge

International Nuclear Information System (INIS)

Miao Jichen; Wu Zhifang; Xing Guilai

2011-01-01

Instantaneous profile gauge technology has been widely used in metallurgy industry because it can on-line get the profile of steel strip. It has characters of high measure precision and wide measure range, but the X-ray tube parameters only can be set few different values during measurement. The relations of thickness measure precision and X-ray tube current, X-ray tube voltage were analyzed. The results show that the X-ray tube current affects the thickness measure precision and the X-ray tube voltage determines the thickness measure range. The method of estimating the X-ray current by thickness measure precision was provided in the end. This method is the base of X-ray source selection and X-ray source parameter's setting in the instantaneous profile gauge. (authors)

Reconstruction of constitutive parameters in isotropic linear elasticity from noisy full-field measurements

International Nuclear Information System (INIS)

Bal, Guillaume; Bellis, Cédric; Imperiale, Sébastien; Monard, François

2014-01-01

Within the framework of linear elasticity we assume the availability of internal full-field measurements of the continuum deformations of a non-homogeneous isotropic solid. The aim is the quantitative reconstruction of the associated moduli. A simple gradient system for the sought constitutive parameters is derived algebraically from the momentum equation, whose coefficients are expressed in terms of the measured displacement fields and their spatial derivatives. Direct integration of this system is discussed to finally demonstrate the inexpediency of such an approach when dealing with noisy data. Upon using polluted measurements, an alternative variational formulation is deployed to invert for the physical parameters. Analysis of this latter inversion procedure provides existence and uniqueness results while the reconstruction stability with respect to the measurements is investigated. As the inversion procedure requires differentiating the measurements twice, a numerical differentiation scheme based on an ad hoc regularization then allows an optimally stable reconstruction of the sought moduli. Numerical results are included to illustrate and assess the performance of the overall approach. (paper)

Evaluation of Hydraulic Parameters Obtained by Different Measurement Methods for Heterogeneous Gravel Soil

Directory of Open Access Journals (Sweden)

Chen Zeng

2012-01-01

Full Text Available Knowledge of soil hydraulic parameters for the van Genuchten function is important to characterize soil water movement for watershed management. Accurate and rapid prediction of soil water flow in heterogeneous gravel soil has become a hot topic in recent years. However, it is difficult to precisely estimate hydraulic parameters in a heterogeneous soil with rock fragments. In this study, the HYDRUS-2D numerical model was used to evaluate hydraulic parameters for heterogeneous gravel soil that was irregularly embedded with rock fragments in a grape production base. The centrifugal method (CM, tensiometer method (TM and inverse solution method (ISM were compared for various parameters in the van Genuchten function. The soil core method (SCM, disc infiltration method (DIM and inverse solution method (ISM were also investigated for measuring saturated hydraulic conductivity. Simulation with the DIM approach revealed a problem of overestimating soil water infiltration whereas simulation with the SCM approach revealed a problem of underestimating water movement as compared to actual field observation. The ISM approach produced the best simulation result even though this approach slightly overestimated soil moisture by ignoring the impact of rock fragments. This study provides useful information on the overall evaluation of soil hydraulic parameters attained with different measurement methods for simulating soil water movement and distribution in heterogeneous gravel soil.

A measurement of the resonance parameters of the neutral intermediate vector boson

International Nuclear Information System (INIS)

Nash, J.A.

1990-01-01

This thesis presents a measurement of the Z 0 Boson resonance parameters. The measurement was performed at the Stanford Linear Collider using the Mark II detector. Based on a sample of 480 Hadronic and Leptonic decays, the mass is found to be 91.14 ± 0.12 GeV/c 2 , the total width is 2.42 -0.35 +0.45 GeV, and the peak cross section for all Hadronic events, and for Muon and Tau events with cosθ Thrust < 0. 65 is 45 ± 4 nb. By constraining the visible width to the Standard Model value for 5 quarks and 3 charged leptons, and allowing the invisible width to be a parameter, the width to invisible decay modes is found to be 0.46 ± 0.10 GeV. Assuming this width comes from massless neutrinos, this measurement corresponds to 2.8 ± 0.6 neutrino species. This measurement sets an upper limit of 3.9 neutrino generations at the 95% confidence level, ruling out a fourth generation of Standard Model neutrinos at this level. 54 refs., 65 figs., 11 tabs

A method for external measurement of toroidal equilibrium parameters

International Nuclear Information System (INIS)

Brunsell, P.; Hellblom, G.; Brynolf, J.

1992-01-01

A method has been developed for determining from external magnetic field measurements the horizontal shift, the vertical shift and the poloidal field asymmetry parameter (Λ) of a toroidal plasma in force equilibrium. The magnetic measurements consist of two toroidal differential flux loops, giving the average vertical magnetic field and the average radial magnetic field respectively, together with cosine-coils for obtaining the m=1 cosine harmonic of the external poloidal magnetic field component. The method is used to analyse the evolution of the toroidal equilibrium during reversed-field pinch discharges in the Extrap T1-U device. We find that good equilibrium control is needed for long plasma pulses. For non-optimized externally applied vertical fields, the diagnostic clearly shows a horizontal drift motion of the pinch resulting in earlier discharge termination. (au)

Secchi depth analysis using bio-optical parameters measured in the Arabian Sea

Digital Repository Service at National Institute of Oceanography (India)

Suresh, T.; Naik, P.; Bandishte, M.; Desa, E.; Mascarenhas, A.A.M.Q.; Matondkar, S.G.P.

spatial and temporal variability of Secchi depth and their dependence on the optical properties beam attenuation and diffuse attenuation the biological parameter of Chlorophyll. The in-situ measured inherent and apparent optical properties have been used...

Measurement-based perturbation theory and differential equation parameter estimation with applications to satellite gravimetry

Science.gov (United States)

Xu, Peiliang

2018-06-01

The numerical integration method has been routinely used by major institutions worldwide, for example, NASA Goddard Space Flight Center and German Research Center for Geosciences (GFZ), to produce global gravitational models from satellite tracking measurements of CHAMP and/or GRACE types. Such Earth's gravitational products have found widest possible multidisciplinary applications in Earth Sciences. The method is essentially implemented by solving the differential equations of the partial derivatives of the orbit of a satellite with respect to the unknown harmonic coefficients under the conditions of zero initial values. From the mathematical and statistical point of view, satellite gravimetry from satellite tracking is essentially the problem of estimating unknown parameters in the Newton's nonlinear differential equations from satellite tracking measurements. We prove that zero initial values for the partial derivatives are incorrect mathematically and not permitted physically. The numerical integration method, as currently implemented and used in mathematics and statistics, chemistry and physics, and satellite gravimetry, is groundless, mathematically and physically. Given the Newton's nonlinear governing differential equations of satellite motion with unknown equation parameters and unknown initial conditions, we develop three methods to derive new local solutions around a nominal reference orbit, which are linked to measurements to estimate the unknown corrections to approximate values of the unknown parameters and the unknown initial conditions. Bearing in mind that satellite orbits can now be tracked almost continuously at unprecedented accuracy, we propose the measurement-based perturbation theory and derive global uniformly convergent solutions to the Newton's nonlinear governing differential equations of satellite motion for the next generation of global gravitational models. Since the solutions are global uniformly convergent, theoretically speaking

Measurement of the CP-violation parameter Re(var-epsilon '/var-epsilon)

International Nuclear Information System (INIS)

Gibbons, L.K.; Barker, A.R.; Briere, R.A.; Makoff, G.; Papadimitriou, V.; Patterson, J.R.; Schwingenheuer, B.; Somalwar, S.V.; Wah, Y.W.; Winstein, B.; Winston, R.; Woods, M.; Yamamoto, H.; Swallow, E.C.; Bock, G.J.; Coleman, R.; Enagonio, J.; Hsiung, Y.B.; Ramberg, E.; Stanfield, K.; Tschirhart, R.; Yamanaka, T.; Gollin, G.D.; Karlsson, M.; Okamitsu, J.K.; Debu, P.; Peyaud, B.; Turlay, R.; Vallage, B.

1993-01-01

A measurement of the CP-violation parameter Re(var-epsilon '/var-epsilon) has been made using the full E731 data set. We find Re(var-epsilon '/var-epsilon)=(7.4±5.2±2.9)x10 -4 where the first error is statistical and the second systematic

The Virtual Fields Method Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements

CERN Document Server

Pierron, Fabrice

2012-01-01

The Virtual Fields Method: Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements is the first book on the Virtual Fields Method (VFM), a technique to identify materials mechanical properties from full-field measurements. Firmly rooted with extensive theoretical description of the method, the book presents numerous examples of application to a wide range of materials (composites, metals, welds, biomaterials) and situations (static, vibration, high strain rate). The authors give a detailed training section with examples of progressive difficulty to lead the reader to program the VFM and include a set of commented Matlab programs as well as GUI Matlab-based software for more general situations. The Virtual Fields Method: Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements is an ideal book for researchers, engineers, and students interested in applying the VFM to new situations motivated by their research.  

Neutron Capture and Transmission Measurements and Resonance Parameter Analysis of Niobium

International Nuclear Information System (INIS)

NJ Drindak; JA Burke; G Leinweber; JA Helm; JG Hoole; RC Block; Y Danon; RE Slovacek; BE Moretti; CJ Werner; ME Overberg; SA Kolda; MJ Trbovich; DP Barry

2005-01-01

Epithermal neutron capture and transmission measurements were performed using the time-of-flight method at the RPI linac using metallic Nb samples. The capture measurements were made at the 25-meter flight station with a 16-section sodium iodide multiplicity detector and the transmission measurements at the 25-meter flight station with a Li-6 glass scintillation detector. Resonance parameters were determined for all resonances up to 500eV with a combined analysis of capture and transmission data using the multi-level R-matrix Bayesian code SAMMY. The present results are compared to those presented in ENDF/B-VI, updated through Release 3

Pneumophonic coordination impairments in parkinsonian dysarthria: importance of aerodynamic parameters measurements.

Science.gov (United States)

Moustapha, S M; Alain, G; Robert, E; Bernard, T; Mourtalla, Kâ M; Lamine, G; François, V

2012-01-01

Among Parkinsonian axial signs, dysarthria represents an important disabling symptom able to lead towards a significant reduction of oral communication. Several methods of dysarthria assessment have been used but aerodynamic evaluation is rare in the literature. To highlight the importance of aerodynamic parameters measurements in assessment of parkinsonian dysarthria. Using a dedicated system (EVA2), 24 parkinsonian patients were recorded after withdrawal of L-dopa for at least 12 h (condition called OFF DOPA) in order to evaluate intra-oral pressure (IOP), mean oral air flow (MOAF) and laryngeal resistance (LR) on six /p/ during realization of the sentence "Papa ne m'a pas parle' de beau-papa" ("Daddy did not speak to me about daddy-in-law") which corresponds to a breath group. 50 control subjects were recorded in parallel in order to define reference measurements. It appeared that there is in Parkinson's disease aerodynamic impairments which were evidenced by the fall in IOP and that of MOAF in patients compared with control subjects. The difference between the two groups was statistically significant. In addition a greater instability of LR in patients compared with control subjects was also noted. Our results show that measurements of aerodynamics parameters, by reflecting the dysfunction induced by disease, may well be relevant factors in parkinsonian dysarthria evaluation.

Final Report: Geoelectrical Measurement of Multi-Scale Mass Transfer Parameters

Energy Technology Data Exchange (ETDEWEB)

Haggerty, Roy [Oregon State Univ., Corvallis, OR (United States); Day-Lewis, Fred [U.S. Geological Survey, Storrs, CT (United States); Singha, Kamini [Colorado School of Mines, Golden, CO (United States); Johnson, Timothy [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Binley, Andrew [Lancaster Univ. (United Kingdom); Lane, John [U.S. Geological Survey, Storrs, CT (United States)

2014-03-20

Mass transfer affects contaminant transport and is thought to control the efficiency of aquifer remediation at a number of sites within the Department of Energy (DOE) complex. An improved understanding of mass transfer is critical to meeting the enormous scientific and engineering challenges currently facing DOE. Informed design of site remedies and long-term stewardship of radionuclide-contaminated sites will require new cost-effective laboratory and field techniques to measure the parameters controlling mass transfer spatially and across a range of scales. In this project, we sought to capitalize on the geophysical signatures of mass transfer. Previous numerical modeling and pilot-scale field experiments suggested that mass transfer produces a geoelectrical signature—a hysteretic relation between sampled (mobile-domain) fluid conductivity and bulk (mobile + immobile) conductivity—over a range of scales relevant to aquifer remediation. In this work, we investigated the geoelectrical signature of mass transfer during tracer transport in a series of controlled experiments to determine the operation of controlling parameters, and also investigated the use of complex-resistivity (CR) as a means of quantifying mass transfer parameters in situ without tracer experiments. In an add-on component to our grant, we additionally considered nuclear magnetic resonance (NMR) to help parse mobile from immobile porosities. Including the NMR component, our revised study objectives were to: 1. Develop and demonstrate geophysical approaches to measure mass-transfer parameters spatially and over a range of scales, including the combination of electrical resistivity monitoring, tracer tests, complex resistivity, nuclear magnetic resonance, and materials characterization; and 2. Provide mass-transfer estimates for improved understanding of contaminant fate and transport at DOE sites, such as uranium transport at the Hanford 300 Area. To achieve our objectives, we implemented a 3

MR flow velocity measurement using 2D phase contrast, assessment of imaging parameters

International Nuclear Information System (INIS)

Akata, Soichi; Fukushima, Akihiro; Abe, Kimihiko; Darkanzanli, A.; Gmitro, A.F.; Unger, E.C.; Capp, M.P.

1999-01-01

The two-dimensional (2D) phase contrast technique using balanced gradient pulses is utilized to measure flow velocities of cerebrospinal fluid and blood. Various imaging parameters affect the accuracy of flow velocity measurements to varying degrees. Assessment of the errors introduced by changing the imaging parameters are presented and discussed in this paper. A constant flow phantom consisting of a pump, a polyethylene tube and a flow meter was assembled. A clinical 1.5 Tesla MR imager was used to perform flow velocity measurements. The phase contrast technique was used to estimate the flow velocity of saline through the phantom. The effects of changes in matrix size, flip angle, flow compensation, and velocity encoding (VENC) value were tested in the pulse sequence. Gd-DTPA doped saline was used to study the effect of changing T1 on the accuracy of flow velocity measurement. Matrix size (within practical values), flip angle, and flow compensation had minimum impact on flow velocity measurements. T1 of the solution also had no effect on the accuracy of measuring the flow velocity. On the other hand, it was concluded that errors as high as 20% can be expected in the flow velocity measurements if the VENC value is not properly chosen. (author)

MR flow velocity measurement using 2D phase contrast, assessment of imaging parameters

Energy Technology Data Exchange (ETDEWEB)

Akata, Soichi; Fukushima, Akihiro; Abe, Kimihiko [Tokyo Medical Coll. (Japan); Darkanzanli, A.; Gmitro, A.F.; Unger, E.C.; Capp, M.P.

1999-11-01

The two-dimensional (2D) phase contrast technique using balanced gradient pulses is utilized to measure flow velocities of cerebrospinal fluid and blood. Various imaging parameters affect the accuracy of flow velocity measurements to varying degrees. Assessment of the errors introduced by changing the imaging parameters are presented and discussed in this paper. A constant flow phantom consisting of a pump, a polyethylene tube and a flow meter was assembled. A clinical 1.5 Tesla MR imager was used to perform flow velocity measurements. The phase contrast technique was used to estimate the flow velocity of saline through the phantom. The effects of changes in matrix size, flip angle, flow compensation, and velocity encoding (VENC) value were tested in the pulse sequence. Gd-DTPA doped saline was used to study the effect of changing T1 on the accuracy of flow velocity measurement. Matrix size (within practical values), flip angle, and flow compensation had minimum impact on flow velocity measurements. T1 of the solution also had no effect on the accuracy of measuring the flow velocity. On the other hand, it was concluded that errors as high as 20% can be expected in the flow velocity measurements if the VENC value is not properly chosen. (author)

The final measurements of the muon decay parameters from the TWIST experiment

International Nuclear Information System (INIS)

Bayes, R

2013-01-01

The TWIST (TRIUMF Weak Interaction Symmetry Test) experiment probes the Lorentz structure of the weak interaction using muon decay. This structure has a very well defined form under the Standard Model (SM) which makes precise predictions for the shape of the decay positron spectrum with respect to momentum and angle. The shape of the spectrum may be described under some rather general assumptions using a set of decay parameters whose values according to the SM are ρ = δ = 3/4, η = 0, and ξ = 1. TWIST uses a large sample of muon decays in a large acceptance spectrometer to measure the decay parameters to an order of magnitude greater precision than previous measurements. This experiment saw its last year of data collection in 2007. As TWIST is a systematics dominated experiment, much effort has been spent on refinements of the estimates of the systematic uncertainties over previous TWIST results. These proceedings will discuss the measures taken to achieve the precision goal of parts in 10 4 , and the physics implications of the experiment.

Evaluation of moving-coil loudspeaker and passive radiator parameters using normal-incidence sound transmission measurements: theoretical developments.

Science.gov (United States)

Leishman, Timothy W; Anderson, Brian E

2013-07-01

The parameters of moving-coil loudspeaker drivers are typically determined using direct electrical excitation and measurement. However, as electro-mechano-acoustical devices, their parameters should also follow from suitable mechanical or acoustical evaluations. This paper presents the theory of an acoustical method of excitation and measurement using normal-incidence sound transmission through a baffled driver as a plane-wave tube partition. Analogous circuits enable key parameters to be extracted from measurement results in terms of open and closed-circuit driver conditions. Associated tools are presented that facilitate adjacent field decompositions and derivations of sound transmission coefficients (in terms of driver parameters) directly from the circuits. The paper also clarifies the impact of nonanechoic receiving tube terminations and the specific benefits of downstream field decompositions.

The Positioning Accuracy of BAUV Using Fusion of Data from USBL System and Movement Parameters Measurements

Directory of Open Access Journals (Sweden)

Naus Krzysztof

2016-08-01

Full Text Available The article presents a study of the accuracy of estimating the position coordinates of BAUV (Biomimetic Autonomous Underwater Vehicle by the extended Kalman filter (EKF method. The fusion of movement parameters measurements and position coordinates fixes was applied. The movement parameters measurements are carried out by on-board navigation devices, while the position coordinates fixes are done by the USBL (Ultra Short Base Line system. The problem of underwater positioning and the conceptual design of the BAUV navigation system constructed at the Naval Academy (Polish Naval Academy—PNA are presented in the first part of the paper. The second part consists of description of the evaluation results of positioning accuracy, the genesis of the problem of selecting method for underwater positioning, and the mathematical description of the method of estimating the position coordinates using the EKF method by the fusion of measurements with on-board navigation and measurements obtained with the USBL system. The main part contains a description of experimental research. It consists of a simulation program of navigational parameter measurements carried out during the BAUV passage along the test section. Next, the article covers the determination of position coordinates on the basis of simulated parameters, using EKF and DR methods and the USBL system, which are then subjected to a comparative analysis of accuracy. The final part contains systemic conclusions justifying the desirability of applying the proposed fusion method of navigation parameters for the BAUV positioning.

The Positioning Accuracy of BAUV Using Fusion of Data from USBL System and Movement Parameters Measurements.

Science.gov (United States)

Krzysztof, Naus; Aleksander, Nowak

2016-08-15

The article presents a study of the accuracy of estimating the position coordinates of BAUV (Biomimetic Autonomous Underwater Vehicle) by the extended Kalman filter (EKF) method. The fusion of movement parameters measurements and position coordinates fixes was applied. The movement parameters measurements are carried out by on-board navigation devices, while the position coordinates fixes are done by the USBL (Ultra Short Base Line) system. The problem of underwater positioning and the conceptual design of the BAUV navigation system constructed at the Naval Academy (Polish Naval Academy-PNA) are presented in the first part of the paper. The second part consists of description of the evaluation results of positioning accuracy, the genesis of the problem of selecting method for underwater positioning, and the mathematical description of the method of estimating the position coordinates using the EKF method by the fusion of measurements with on-board navigation and measurements obtained with the USBL system. The main part contains a description of experimental research. It consists of a simulation program of navigational parameter measurements carried out during the BAUV passage along the test section. Next, the article covers the determination of position coordinates on the basis of simulated parameters, using EKF and DR methods and the USBL system, which are then subjected to a comparative analysis of accuracy. The final part contains systemic conclusions justifying the desirability of applying the proposed fusion method of navigation parameters for the BAUV positioning.

Measurements of integrated components' parameters versus irradiation doses gamma radiation (60Co) dosimetry-methodology-tests

International Nuclear Information System (INIS)

Fuan, J.

1991-01-01

This paper describes the methodology used for the irradiation of the integrated components and the measurements of their parameters, using Quality Insurance of dosimetry: - Measurement of the integrated dose using the competences of the Laboratoire Central des Industries Electriques (LCIE): - Measurement of irradiation dose versus source/component distance, using a calibrated equipment. - Use of ALANINE dosimeters, placed on the support of the irradiated components. - Assembly and polarization of components during the irradiations. Selection of the irradiator. - Measurement of the irradiated components's parameters, using the competences of the societies: - GenRad: GR130 tests equipement placed in the DEIN/SIR-CEN SACLAY. - Laboratoire Central des Industries Electriques (LCIE): GR125 tests equipment and this associated programmes test [fr

Rocket measurements within a polar cap arc: Plasma, particle, and electric circuit parameters

International Nuclear Information System (INIS)

Weber, E.J.; Ballenthin, J.O.; Basu, S.; Carlson, H.C.; Hardy, D.A.; Maynard, N.C.; Smiddy, M.; Kelley, M.C.; Fleischman, J.R.; Sheehan, R.E.; Pfaff, R.F.; Rodriguez, P.

1989-01-01

An instrumented rocket payload was launched into a polar cap F layer aurora to investigate the energetic particle, plasma, and electric circuit parameters of a Sun-aligned arc. On-board instruments measured energetic electron flux, ion composition and density fluctuations, electron density and temperature, electron density fluctuations, and ac and dc electric fields. Real-time all-sky imaging photometer measurements of the location and motion of the aurora, were used to determine the proper geophysical situation for launch. Comparison of the in situ measurements with remote optical measurements shows that the arc was produced by fluxes of low-energy (< 1 keV) electrons. Field-aligned potentials in the arc inferred from the electron spectra had a maximum value of approximately 300 V, and from the spectral shape a parent population of preaccelerated electrons characteristic of the boundary plasma sheet or magnetosheath was inferred. Electric field components along and across the arc show sunward flow within the arc and duskward drift of the arc consistent with the drift direction and speed determined from optical imaging. Thus this arc is drifting duskward under the influence of the convection electric field. Three possible explanations for this (field-aligned currents, chemistry, and transport) are considered. Finally, ionospheric irregularity and electric field fluctuations indicate two different generation mechanisms on the dawnside and duskside of the arc. On the duskside, parameters are suggestive of an interchange process, while on the dawnside, fluctuation parameters are consistent with a velocity shear instability

Four-Parameter white blood cell differential counting based on light scattering measurements

NARCIS (Netherlands)

Terstappen, Leonardus Wendelinus Mathias Marie; de Grooth, B.G.; Visscher, K.; Kouterik, F.A.; Greve, Jan

1988-01-01

Measurement of the depolarized orthogonal light scattering in flow cytometry enables one to discriminate human eosinephilic granulocytes from neutrophilic granulocytes. We use this method to perform a four-parameter differential white blood cell analysis. A simple flow cytometer was built equipped

A measurement of the tau Michel parameters at SLD

International Nuclear Information System (INIS)

Quigley, J.

1997-05-01

This thesis presents a measurement of the tau Michel parameters. This measurement utilizes the highly polarized SLC electron beam to extract these quantities directly from the measured tau decay spectra using the 1993--95 SLD sample of 4,528 tau pair events. The results are ρ e = 0.71 ± 0.14 ± 0.05, ξ e = 1.16 ± 0.52 ± 0.06, and (ξδ) e = 0.85 ± 0.43 ± 0.08 for tau decays to electrons and ρ μ = 0.54 ± 0.28 - 0.14, η μ = -0.59 ± 0.82 ± 0.45, ξ μ = 0.75 ± 0.50 ± 0.14, and (ξδ) μ = 0.82 ± 0.32 ± 0.07 for tau decays to muons. Combining all leptonic tau decays gives ρ = 0.72 ± 0.09 ± 0.03, ξ = 1.05 ± 0.35 ± 0.04, and Ξδ = 0.88 ± 0.27 ± 0.04. These results agree well with the current world average and the Standard Model

Low-field NMR logging sensor for measuring hydraulic parameters of model soils

Science.gov (United States)

Sucre, Oscar; Pohlmeier, Andreas; Minière, Adrien; Blümich, Bernhard

2011-08-01

SummaryKnowing the exact hydraulic parameters of soils is very important for improving water management in agriculture and for the refinement of climate models. Up to now, however, the investigation of such parameters has required applying two techniques simultaneously which is time-consuming and invasive. Thus, the objective of this current study is to present only one technique, i.e., a new non-invasive method to measure hydraulic parameters of model soils by using low-field nuclear magnetic resonance (NMR). Hereby, two model clay or sandy soils were respectively filled in a 2 m-long acetate column having an integrated PVC tube. After the soils were completely saturated with water, a low-field NMR sensor was moved up and down in the PVC tube to quantitatively measure along the whole column the initial water content of each soil sample. Thereafter, both columns were allowed to drain. Meanwhile, the NMR sensor was set at a certain depth to measure the water content of that soil slice. Once the hydraulic equilibrium was reached in each of the two columns, a final moisture profile was taken along the whole column. Three curves were subsequently generated accordingly: (1) the initial moisture profile, (2) the evolution curve of the moisture depletion at that particular depth, and (3) the final moisture profile. All three curves were then inverse analyzed using a MATLAB code over numerical data produced with the van Genuchten-Mualem model. Hereby, a set of values ( α, n, θr and θs) was found for the hydraulic parameters for the soils under research. Additionally, the complete decaying NMR signal could be analyzed through Inverse Laplace Transformation and averaged on the 1/ T2 space. Through measurement of the decay in pure water, the effect on the relaxation caused by the sample could be estimated from the obtained spectra. The migration of the sample-related average with decreasing saturation speaks for a enhancement of the surface relaxation as the soil dries, in

Effect of window function for measurement of ultrasonic nonlinear parameter using fast fourier transform of tone-burst signal

Energy Technology Data Exchange (ETDEWEB)

Lee, Kyoung Jun; Kim, Jong Beom; Song, Dong Gil; Jhang, Kyung Young [Dept. of Mechanical Engineering, Hanyang University, Seoul (Korea, Republic of)

2015-08-15

In ultrasonic nonlinear parameter measurement using the fast Fourier transform(FFT) of tone-burst signals, the side lobe and leakage on spectrum because of finite time and non-periodicity of signals makes it difficult to measure the harmonic magnitudes accurately. The window function made it possible to resolve this problem. In this study, the effect of the Hanning and Turkey window functions on the experimental measurement of nonlinear parameters was analyzed. In addition, the effect of changes in tone burst signal number with changes in the window function on the experimental measurement was analyzed. The result for both window functions were similar and showed that they enabled reliable nonlinear parameter measurement. However, in order to restore original signal amplitude, the amplitude compensation coefficient should be considered for each window function. On a separate note, the larger number of tone bursts was advantageous for stable nonlinear parameter measurement, but this effect was more advantageous in the case of the Hanning window than the Tukey window.

Optimal Design of Measurement Programs for the Parameter Identification of Dynamic Systems

DEFF Research Database (Denmark)

Kirkegaard, Poul Henning; Sørensen, John Dalsgaard; Brincker, Rune

The design of measurement programs devoted to parameter identification of structural dynamic systems is considered. The design problem is formulated as an optimization problem to minimize the total expected cost that is the cost of failure and the cost of the measurement program. All...... the calculations are based on a priori knowledge and engineering judgement. One of the contribution of the approach is that the optimal number of sensors can be estimated. This is shown in a numerical example where the proposed approach is demonstrated. The example is concerned with design of a measurement program...

Optimal Design of Measurement Programs for the Parameter Identification of Dynamic Systems

DEFF Research Database (Denmark)

Kirkegaard, Poul Henning; Sørensen, John Dalsgaard; Brincker, Rune

1993-01-01

The design of a measurement program devoted to parameter identification of structural dynamic systems is considered. The design problem is formulated as an optimization problem to minimize the total expected cost that is the cost of failure and the cost of the measurement program. All...... the calculations are based on a priori knowledge and engineering judgement. One of the contribution of the approach is that the optimal number of sensory can be estimated. This is shown in an numerical example where the proposed approach is demonstrated. The example is concerned with design of a measurement...

Optimal Design of Measurement Programs for the Parameter Identification of Dynamic Systems

DEFF Research Database (Denmark)

Kirkegaard, Poul Henning; Sørensen, John Dalsgaard; Brincker, Rune

1991-01-01

The design of a measurement program devoted to parameter identification of structural dynamic systems is considered. The design problem is formulated as an optimization problem to minimize the total expected cost, i.e. the cost of failure and the cost of the measurement program. All...... the calculations are based on a priori knowledge and engineering judgement. One of the contributions of the approach is that the optimal number of sensors can be estimated. This is shown in a numerical example where the proposed approach is demonstrated. The example is concerned with design of a measurement...

Airborne-Measured Spatially-Averaged Temperature and Moisture Turbulent Structure Parameters Over a Heterogeneous Surface

Science.gov (United States)

Platis, Andreas; Martinez, Daniel; Bange, Jens

2014-05-01

Turbulent structure parameters of temperature and humidity can be derived from scintillometer measurements along horizontal paths of several 100 m to several 10 km. These parameters can be very useful to estimate the vertical turbulent heat fluxes at the surface (applying MOST). However, there are many assumptions required by this method which can be checked using in situ data, e.g. 1) Were CT2 and CQ2 correctly derived from the initial CN2 scintillometer data (structure parameter of density fluctuations or refraction index, respectively)? 2) What is the influence of the surround hetereogeneous surface regarding its footprint and the weighted averaging effect of the scintillometer method 3) Does MOST provide the correct turbulent fluxes from scintillometer data. To check these issues, in situ data from low-level flight measurements are well suited, since research aircraft cover horizontal distances in very short time (Taylor's hypothesis of a frozen turbulence structure can be applyed very likely). From airborne-measured time series the spatial series are calculated and then their structure functions that finally provide the structure parameters. The influence of the heterogeneous surface can be controlled by the definition of certain moving-average window sizes. A very useful instrument for this task are UAVs since they can fly very low and maintain altitude very precisely. However, the data base of such unmanned operations is still quite thin. So in this contribution we want to present turbulence data obtained with the Helipod, a turbulence probe hanging below a manned helicopter. The structure parameters of temperature and moisture, CT2 and CQ2, in the lower convective boundary layer were derived from data measured using the Helipod in 2003. The measurements were carried out during the LITFASS03 campaign over a heterogeneous land surface around the boundary-layer field site of the Lindenberg Meteorological Observatory-Richard-Aßmann-Observatory (MOL) of the

Windowing UWB microwave, mm-wave multi-port S-parameter measurements using open-ended excess electrical length

Directory of Open Access Journals (Sweden)

Gholamreza Askari

2017-05-01

Full Text Available Multi-port measurements are a big challenge in circuits' verification, especially when the frequency increases. This study presents a new technique for measuring S-parameters of multi-port ultra-wideband (UWB microwave and mm-wave circuits. The concepts are based on direct or indirect applying modulated UWB impulse radio in desired bandwidth to the one port of the modified multi-port circuit and gathering the reflected signal in the same port and the output signal in the second port in time domain, and the other ports are left opened with a special designed added electrical length. Then by applying intelligent windowing in time domain to the gathering data, and using fast Fourier transform, the desired S-parameters are extracted. Validation of this technique is verified by design and fabrication of a three-port UWB Wilkinson power divider in 22–30 GHz. The simulation and measurement results of the reflection and transmission S-parameters by using this new technique are very close to those are extracted with the conventional vector network analysers S-parameters measurements and show the ability and the accuracy of this technique.

Fractional calculus and morphogen gradient formation

Science.gov (United States)

Yuste, Santos Bravo; Abad, Enrique; Lindenberg, Katja

2012-12-01

Some microscopic models for reactive systems where the reaction kinetics is limited by subdiffusion are described by means of reaction-subdiffusion equations where fractional derivatives play a key role. In particular, we consider subdiffusive particles described by means of a Continuous Time Random Walk (CTRW) model subject to a linear (first-order) death process. The resulting fractional equation is employed to study the developmental biology key problem of morphogen gradient formation for the case in which the morphogens are subdiffusive. If the morphogen degradation rate (reactivity) is constant, we find exponentially decreasing stationary concentration profiles, which are similar to the profiles found when the morphogens diffuse normally. However, for the case in which the degradation rate decays exponentially with the distance to the morphogen source, we find that the morphogen profiles are qualitatively different from the profiles obtained when the morphogens diffuse normally.

High-speed infrared thermography for the measurement of microscopic boiling parameters on micro- and nano-structured surfaces

International Nuclear Information System (INIS)

Park, Youngjae; Kim, Hyungdae; Kim, Hyungmo; Kim, Joonwon

2014-01-01

Micro- and nano-scale structures on boiling surfaces can enhance nucleate boiling heat transfer coefficient (HTC) and critical heat flux (CHF). A few studies were conducted to explain the enhancements of HTC and CHF using the microscopic boiling parameters. Quantitative measurements of microscopic boiling parameters are needed to understand the physical mechanism of the boiling heat transfer augmentation on structured surfaces. However, there is no existing experimental techniques to conveniently measure the boiling parameters on the structured surfaces because of the small (parameters. Finally, quantitative microscopic boiling parameters are used to interpret the enhancement of HTC and CHF. In this study, liquid-vapor phase distributions of each surface were clearly visualized by IR thermography during the nucleate boiling phenomena. From the visualization results, following microscopic boiling parameters were quantitatively measured by image processing. - Number density of dry patch, NDP IR thermography technique was demonstrated by nucleate pool boiling experiments with M- and N surfaces. The enhancement of HTC and CHF could be explained by microscopic boiling parameters

Measurement methods and accuracy analysis of Chang'E-5 Panoramic Camera installation parameters

Science.gov (United States)

Yan, Wei; Ren, Xin; Liu, Jianjun; Tan, Xu; Wang, Wenrui; Chen, Wangli; Zhang, Xiaoxia; Li, Chunlai

2016-04-01

Chang'E-5 (CE-5) is a lunar probe for the third phase of China Lunar Exploration Project (CLEP), whose main scientific objectives are to implement lunar surface sampling and to return the samples back to the Earth. To achieve these goals, investigation of lunar surface topography and geological structure within sampling area seems to be extremely important. The Panoramic Camera (PCAM) is one of the payloads mounted on CE-5 lander. It consists of two optical systems which installed on a camera rotating platform. Optical images of sampling area can be obtained by PCAM in the form of a two-dimensional image and a stereo images pair can be formed by left and right PCAM images. Then lunar terrain can be reconstructed based on photogrammetry. Installation parameters of PCAM with respect to CE-5 lander are critical for the calculation of exterior orientation elements (EO) of PCAM images, which is used for lunar terrain reconstruction. In this paper, types of PCAM installation parameters and coordinate systems involved are defined. Measurement methods combining camera images and optical coordinate observations are studied for this work. Then research contents such as observation program and specific solution methods of installation parameters are introduced. Parametric solution accuracy is analyzed according to observations obtained by PCAM scientifically validated experiment, which is used to test the authenticity of PCAM detection process, ground data processing methods, product quality and so on. Analysis results show that the accuracy of the installation parameters affects the positional accuracy of corresponding image points of PCAM stereo images within 1 pixel. So the measurement methods and parameter accuracy studied in this paper meet the needs of engineering and scientific applications. Keywords: Chang'E-5 Mission; Panoramic Camera; Installation Parameters; Total Station; Coordinate Conversion

Measurement of the main and critical parameters for optimal laser treatment of heart disease

Science.gov (United States)

Kabeya, FB; Abrahamse, H.; Karsten, AE

2017-10-01

Laser light is frequently used in the diagnosis and treatment of patients. As in traditional treatments such as medication, bypass surgery, and minimally invasive ways, laser treatment can also fail and present serious side effects. The true reason for laser treatment failure or the side effects thereof, remains unknown. From the literature review conducted, and experimental results generated we conclude that an optimal laser treatment for coronary artery disease (named heart disease) can be obtained if certain critical parameters are correctly measured and understood. These parameters include the laser power, the laser beam profile, the fluence rate, the treatment time, as well as the absorption and scattering coefficients of the target treatment tissue. Therefore, this paper proposes different, accurate methods for the measurement of these critical parameters to determine the optimal laser treatment of heart disease with a minimal risk of side effects. The results from the measurement of absorption and scattering properties can be used in a computer simulation package to predict the fluence rate. The computing technique is a program based on the random number (Monte Carlo) process and probability statistics to track the propagation of photons through a biological tissue.

Development of time-resolved optical measurement and diagnostic system for parameters of high current and pulsed electron beam

International Nuclear Information System (INIS)

Jiang Xiaoguo; Wang Yuan; Yang Guojun; Xia Liansheng; Li Hong; Zhang Zhuo; Liao Shuqing; Shi Jinshui

2013-01-01

The beam parameters measurement is the most important work for the study of linear induction accelerator(LIA). The beam parameters are important to evaluate the character of the beam. The demands of beam parameters measurement are improving while the development of accelerator is improving. The measurement difficulty feature higher time-resolved ability, higher spatial resolution, larger dynamic range and higher intuitionistic view data. The measurement technology of beam spot, beam emittance, beam energy have been developed for the past several years. Some high performance equipment such as high speed framing camera are developed recently. Under this condition, the relative integrated optical measurement and diagnostic system for the beam parameters is developed based on several principles. The system features time-resolved ability of up to 2 ns, high sensitivity and large dynamic range. The processing program is compiled for the data process and the local real-time process is reached. The measurement and diagnostic system has provided full and accurate data for the debug work and has been put into applications. (authors)

Fast RF-CV characterization through high-speed 1-port S-parameter measurements

NARCIS (Netherlands)

Herfst, R.W.; Steeneken, P.G.; Tiggelman, M.P.J.; Stulemeijer, J.; Schmitz, Jurriaan

2010-01-01

We present a novel method to measure the capacitance-voltage relation of an electronic device. The approach is accurate, very fast, and cost-effective compared to the existing off-the-shelf solutions. Capacitances are determined using a single-frequency 1-port S-parameter setup constructed from

Kinetic parameter estimation from attenuated SPECT projection measurements

International Nuclear Information System (INIS)

Reutter, B.W.; Gullberg, G.T.

1998-01-01

Conventional analysis of dynamically acquired nuclear medicine data involves fitting kinetic models to time-activity curves generated from regions of interest defined on a temporal sequence of reconstructed images. However, images reconstructed from the inconsistent projections of a time-varying distribution of radiopharmaceutical acquired by a rotating SPECT system can contain artifacts that lead to biases in the estimated kinetic parameters. To overcome this problem the authors investigated the estimation of kinetic parameters directly from projection data by modeling the data acquisition process. To accomplish this it was necessary to parametrize the spatial and temporal distribution of the radiopharmaceutical within the SPECT field of view. In a simulated transverse slice, kinetic parameters were estimated for simple one compartment models for three myocardial regions of interest, as well as for the liver. Myocardial uptake and washout parameters estimated by conventional analysis of noiseless simulated data had biases ranging between 1--63%. Parameters estimated directly from the noiseless projection data were unbiased as expected, since the model used for fitting was faithful to the simulation. Predicted uncertainties (standard deviations) of the parameters obtained for 500,000 detected events ranged between 2--31% for the myocardial uptake parameters and 2--23% for the myocardial washout parameters

Measurement of kinetic parameters in the fast subcritical core MASURCA

International Nuclear Information System (INIS)

Baeten, Peter; Abderrahim, Hamid Aiet

2004-01-01

In the MUSE shared cost action of the European Fifth Framework Program measurements have been performed to investigate the neutronic behavior of the fast subcritical core MASURCA coupled with the GENEPI accelerator. The aim is to examine the applicability of different measurement techniques for the determination of the main kinetic parameters. The measurement of Rossi-alpha distributions, recorded with the accelerator turned off, showed that the analysis of the obtained distributions is feasible for deep subcritical levels, but with strongly deteriorated statistics. From Rossi-alpha distributions, recorded with the pulsed neutron source in operation, the alpha decay constant was easily derived due to good statistics on the correlated signal resulting from the strong intensity of the neutron pulse. When applying the pulsed neutron source analysis, the reactivity (in dollars) together with the ratio of the mean neutron lifetime l and the effective delayed neutron fraction β eff is immediately derived. Although these first results are very promising, further measurements are needed to qualify the method at larger subcritical levels which are representative for future ADS

A Test-Bench for Measurement of Electrical Static Parameters of Strip Silicon Detectors

CERN Document Server

Golutvin, I A; Danilevich, V G; Dmitriev, A Yu; Elsha, V V; Zamiatin, Y I; Zubarev, E V; Ziaziulia, F E; Kozus, V I; Lomako, V M; Stepankov, D V; Khomich, A P; Shumeiko, N M; Cheremuhin, A E

2003-01-01

An automated test-bench for electrical parameters input control of the strip silicon detectors, used in the End-Cap Preshower detector of the CMS experiment, is described. The test-bench application allows one to solve a problem of silicon detectors input control in conditions of mass production - 1800 detectors over 2 years. The test-bench software is realized in Delphi environment and contains a user-friendly operator interface for measurement data processing and visualization as well as up-to-date facilities for MS-Windows used for the network database. High operating characteristics and reliability of the test-bench were confirmed while more than 800 detectors were tested. Some technical solutions applied to the test-bench could be useful for design and construction of automated facilities for electrical parameters measurements of the microstrip detectors input control.

Measurements of relevant parameters in the formation of clathrate hydrates by a novel experimental apparatus

Energy Technology Data Exchange (ETDEWEB)

Arca, S.; Di Profio, P.; Germani, R.; Savelli, G. [Perugia Univ., CEMIN, Perugia (Italy). Dept. of Chemistry

2008-07-01

There is a growing interest in understanding the thermodynamics and kinetics of clathrate hydrate formation. This paper presented a study that involved the design, construction, calibration, and testing of a new apparatus that could obtain as many parameters as possible in a single formation batch and that could measure unexplored clathrate hydrate parameters. The apparatus was capable of measuring equilibrium phases involving gaseous components. The paper described the conceptual design as well as the chamber, pressure line, temperature control, liquid addition line, and conductometric probe. The paper also discussed data acquisition, stirring, measurement examples, and internal illumination and video monitoring. It was concluded that refining measurements, particularly those concerning kinetic characterizations, is important in order to clarify several uncertain kinetic behaviors of clathrate hydrates. 6 refs., 16 figs.

Measurements, in vivo, of parameters of the dopamine system

International Nuclear Information System (INIS)

Friedman, A.M.; DeJesus, O.T.; Dinerstein, R.; Revenaugh, J.

1983-01-01

This paper discusses methods of measuring important parameters of the dopamine system in the living animal by use of PET techniques. One primary concern is the density and binding affinity of post-synaptic neuroreceptors. A second concern is the activity of neurons. In vivo, this is generally related to the turnover of neurotransmitter and can also be related to the uptake of precursor compounds by the neurons. If the transmitter and neuroleptic compound compete for the same binding sites (on the receptor molecule) these two effects are interwoven and are not easily isolated. It appears that the movement of neuroleptic drugs from the brain is slow enough to allow equilibrium to be maintained between ligand and receptor, especially after some time for the initial washout and translocation in the brain. To test the consequences of equilibrium binding and the possible use of the model for measurement of receptor densities by emission tomography we have modified Clark's equilibrium model of ligand binding. In this note we will describe the solutions of the equations and some comparisons of the predictions of the model with data, as well as its application to tomographic measurements

Classical vs. evolved quenching parameters and procedures in scintillation measurements: The importance of ionization quenching

International Nuclear Information System (INIS)

Bagan, H.; Tarancon, A.; Rauret, G.; Garcia, J.F.

2008-01-01

The quenching parameters used to model detection efficiency variations in scintillation measurements have not evolved since the decade of 1970s. Meanwhile, computer capabilities have increased enormously and ionization quenching has appeared in practical measurements using plastic scintillation. This study compares the results obtained in activity quantification by plastic scintillation of 14 C samples that contain colour and ionization quenchers, using classical (SIS, SCR-limited, SCR-non-limited, SIS(ext), SQP(E)) and evolved (MWA-SCR and WDW) parameters and following three calibration approaches: single step, which does not take into account the quenching mechanism; two steps, which takes into account the quenching phenomena; and multivariate calibration. Two-step calibration (ionization followed by colour) yielded the lowest relative errors, which means that each quenching phenomenon must be specifically modelled. In addition, the sample activity was quantified more accurately when the evolved parameters were used. Multivariate calibration-PLS also yielded better results than those obtained using classical parameters, which confirms that the quenching phenomena must be taken into account. The detection limits for each calibration method and each parameter were close to those obtained theoretically using the Currie approach

The Vocal Extent Measure: Development of a Novel Parameter in Voice Diagnostics and Initial Clinical Experience

Directory of Open Access Journals (Sweden)

Philipp P. Caffier

2018-01-01

Full Text Available Voice range profile (VRP and evaluation using the dysphonia severity index (DSI represent essentials of instrument-based objective voice diagnostics and are implemented in different standardized registration programs. The respective measurement results, however, show differences. The aim of the study was to prove these differences statistically and to develop a new parameter, the Vocal Extent Measure (VEM, which is not influenced by the measurement program. VRPs of 97 subjects were recorded by two examiners using the established registration programs DiVAS (XION medical and LingWAVES (WEVOSYS simultaneously. The VEM was developed on the basis of VRP area and perimeter. All 194 VRP files were analyzed for various parameters and gender independence. The registration programs exhibited significant differences in several vocal parameters. A significant gender influence for DSI was found with DiVAS (p<0.01, but not with LingWAVES. The VEM quantified the dynamic performance and frequency range by a unidimensional, interval-scaled value without unit, mostly between 0 and 120. This novel parameter represents an intelligible and user-friendly positive measure of vocal function, allows simple and stable VRP description, and seems to be suitable for quantification of vocal capacity. In contrast to DSI, the VEM proved to be less susceptible to registration program and gender.

Stability Analysis for Li-Ion Battery Model Parameters and State of Charge Estimation by Measurement Uncertainty Consideration

Directory of Open Access Journals (Sweden)

Shifei Yuan

2015-07-01

Full Text Available Accurate estimation of model parameters and state of charge (SoC is crucial for the lithium-ion battery management system (BMS. In this paper, the stability of the model parameters and SoC estimation under measurement uncertainty is evaluated by three different factors: (i sampling periods of 1/0.5/0.1 s; (ii current sensor precisions of ±5/±50/±500 mA; and (iii voltage sensor precisions of ±1/±2.5/±5 mV. Firstly, the numerical model stability analysis and parametric sensitivity analysis for battery model parameters are conducted under sampling frequency of 1–50 Hz. The perturbation analysis is theoretically performed of current/voltage measurement uncertainty on model parameter variation. Secondly, the impact of three different factors on the model parameters and SoC estimation was evaluated with the federal urban driving sequence (FUDS profile. The bias correction recursive least square (CRLS and adaptive extended Kalman filter (AEKF algorithm were adopted to estimate the model parameters and SoC jointly. Finally, the simulation results were compared and some insightful findings were concluded. For the given battery model and parameter estimation algorithm, the sampling period, and current/voltage sampling accuracy presented a non-negligible effect on the estimation results of model parameters. This research revealed the influence of the measurement uncertainty on the model parameter estimation, which will provide the guidelines to select a reasonable sampling period and the current/voltage sensor sampling precisions in engineering applications.

UPTF test instrumentation. Measurement system identification, engineering units and computed parameters

International Nuclear Information System (INIS)

Sarkar, J.; Liebert, J.; Laeufer, R.

1992-11-01

This updated version of the previous report /1/ contains, besides additional instrumentation needed for 2D/3D Programme, the supplementary instrumentation in the inlet plenum of SG simulator and hot and cold leg of broken loop, the cold leg of intact loops and the upper plenum to meet the requirements (Test Phase A) of the UPTF Programme, TRAM, sponsored by the Federal Minister of Research and Technology (BMFT) of the Federal Republic of Germany. For understanding, the derivation and the description of the identification codes for the entire conventional and advanced measurement systems classifying the function, and the equipment unit, key, as adopted in the conventional power plants, have been included. Amendments have also been made to the appendices. In particular, the list of measurement systems covering the measurement identification code, instrument, measured quantity, measuring range, band width, uncertainty and sensor location has been updated and extended to include the supplementary instrumentation. Beyond these amendments, the uncertainties of measurements have been precisely specified. The measurement identification codes which also stand for the identification of the corresponding measured quantities in engineering units and the identification codes derived therefrom for the computed parameters have been adequately detailed. (orig.)

Selection of entropy-measure parameters for knowledge discovery in heart rate variability data.

Science.gov (United States)

Mayer, Christopher C; Bachler, Martin; Hörtenhuber, Matthias; Stocker, Christof; Holzinger, Andreas; Wassertheurer, Siegfried

2014-01-01

Heart rate variability is the variation of the time interval between consecutive heartbeats. Entropy is a commonly used tool to describe the regularity of data sets. Entropy functions are defined using multiple parameters, the selection of which is controversial and depends on the intended purpose. This study describes the results of tests conducted to support parameter selection, towards the goal of enabling further biomarker discovery. This study deals with approximate, sample, fuzzy, and fuzzy measure entropies. All data were obtained from PhysioNet, a free-access, on-line archive of physiological signals, and represent various medical conditions. Five tests were defined and conducted to examine the influence of: varying the threshold value r (as multiples of the sample standard deviation σ, or the entropy-maximizing rChon), the data length N, the weighting factors n for fuzzy and fuzzy measure entropies, and the thresholds rF and rL for fuzzy measure entropy. The results were tested for normality using Lilliefors' composite goodness-of-fit test. Consequently, the p-value was calculated with either a two sample t-test or a Wilcoxon rank sum test. The first test shows a cross-over of entropy values with regard to a change of r. Thus, a clear statement that a higher entropy corresponds to a high irregularity is not possible, but is rather an indicator of differences in regularity. N should be at least 200 data points for r = 0.2 σ and should even exceed a length of 1000 for r = rChon. The results for the weighting parameters n for the fuzzy membership function show different behavior when coupled with different r values, therefore the weighting parameters have been chosen independently for the different threshold values. The tests concerning rF and rL showed that there is no optimal choice, but r = rF = rL is reasonable with r = rChon or r = 0.2σ. Some of the tests showed a dependency of the test significance on the data at hand. Nevertheless, as the medical

Production of Single W Bosons at LEP and Measurement of $WW\\gamma$ Gauge Coupling Parameters

CERN Document Server

Achard, P; Aguilar-Benítez, M; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alviggi, M G; Anderhub, H; Andreev, V P; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Bajo, A; Baksay, G; Baksay, L; Baldew, S V; Banerjee, S; Banerjee, Sw; Barczyk, A; Barillère, R; Bartalini, P; Basile, M; Batalova, N; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Bellucci, L; Berbeco, R; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Biasini, M; Biglietti, M; Biland, A; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böhm, A; Boldizsar, L; Borgia, B; Bottai, S; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brochu, F; Burger, J D; Burger, W J; Cai, X D; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada, M; Chamizo-Llatas, M; Chang, Y H; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chiefari, G; Cifarelli, Luisa; Cindolo, F; Clare, I; Clare, R; Coignet, G; Colino, N; Costantini, S; de la Cruz, B; Cucciarelli, S; van Dalen, J A; De Asmundis, R; Déglon, P L; Debreczeni, J; Degré, A; Dehmelt, K; Deiters, K; Della Volpe, D; Delmeire, E; Denes, P; De Notaristefani, F; De Salvo, A; Diemoz, M; Dierckxsens, M; Dionisi, C; Dittmar, Michael; Doria, A; Dova, M T; Duchesneau, D; Echenard, B; Eline, A; El-Mamouni, H; Engler, A; Eppling, F J; Ewers, A; Extermann, Pierre; Falagán, M A; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, Marta; Ferguson, T; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisher, W; Fisk, I; Forconi, G; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gataullin, M; Gentile, S; Giagu, S; Gong, Z F; Grenier, G; Grimm, O; Grünewald, M W; Guida, M; van Gulik, R; Gupta, V K; Gurtu, A; Gutay, L J; Haas, D; Hakobyan, R S; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Hirschfelder, J; Hofer, H; Hohlmann, M; Holzner, G; Hou, S R; Hu, Y; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Käfer, D; Kaur, M; Kienzle-Focacci, M N; Kim, J K; Kirkby, Jasper; Kittel, E W; Klimentov, A; König, A C; Kopal, M; Koutsenko, V F; Kräber, M H; Krämer, R W; Krenz, W; Krüger, A; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Levtchenko, M; Levchenko, P M; Li, C; Likhoded, S A; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lü, Y S; Lübelsmeyer, K; Luci, C; Luminari, L; Lustermann, W; Ma Wen Gan; Malgeri, L; Malinin, A; Maña, C; Mangeol, D J J; Mans, J; Martin, J P; Marzano, F; Mazumdar, K; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Mihul, A; Milcent, H; Mirabelli, G; Mnich, J; Mohanty, G B; Muanza, G S; Muijs, A J M; Musicar, B; Musy, M; Nagy, S; Natale, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Niessen, T; Nisati, A; Nowak, H; Ofierzynski, R A; Organtini, G; Palomares, C; Pandoulas, D; Paolucci, P; Paramatti, R; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Pedace, M; Pensotti, S; Perret-Gallix, D; Petersen, B; Piccolo, D; Pierella, F; Pioppi, M; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Pothier, J; Prokofiev, D O; Prokofev, D; Quartieri, J; Rahal-Callot, G; Rahaman, M A; Raics, P; Raja, N; Ramelli, R; Rancoita, P G; Ranieri, R; Raspereza, A V; Razis, P A; Ren, D; Rescigno, M; Reucroft, S; Riemann, S; Riles, K; Roe, B P; Romero, L; Rosca, A; Rosier-Lees, S; Roth, S; Rosenbleck, C; Roux, B; Rubio, Juan Antonio; Ruggiero, G; Rykaczewski, H; Sakharov, A; Saremi, S; Sarkar, S; Salicio, J; Sánchez, E; Sanders, M P; Schäfer, C; Shchegelskii, V; Schmidt-Kärst, S; Schmitz, D; Schopper, Herwig Franz; Schotanus, D J; Schwering, G; Sciacca, C; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shumilov, E; Shvorob, A V; Siedenburg, T; Son, D; Souga, C; Spillantini, P; Steuer, M; Stickland, D P; Stoyanov, B; Strässner, A; Sudhakar, K; Sultanov, G G; Sun, L Z; Sushkov, S V; Suter, H; Swain, J D; Szillási, Z; Tang, X W; Tarjan, P; Tauscher, Ludwig; Taylor, L; Tellili, B; Teyssier, D; Timmermans, C; Ting, Samuel C C; Ting, S M; Tonwar, S C; Tóth, J; Tully, C; Tung, K L; Ulbricht, J; Valente, E; Van de Walle, R T; Vásquez, R P; Veszpremi, V; Vesztergombi, G; Vetlitskii, I; Vicinanza, D; Viertel, Gert M; Villa, S; Vivargent, M; Vlachos, S; Vodopyanov, I; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Wadhwa, M; Wallraff, W; Wang, X L; Wang, Z M; Weber, M; Wienemann, P; Wilkens, H; Wynhoff, S; Xia, L; Xu, Z Z; Yamamoto, J; Yang, B Z; Yang, C G; Yang, H J; Yang, M; Yeh, S C; Zalite, A; Zalite, Yu; Zhang, Z P; Zhao, J; Zhu, G Y; Zhu, R Y; Zhuang, H L; Zichichi, A; Zimmermann, B; Zöller, M

2002-01-01

\\documentclass[12pt,a4paper,dvips]{article} \\begin{document} \\begin{center} {Production of Single W Bosons at LEP and \\\\ Measurement of \\boldmath$\\rm W W \\gamma$ Gauge Coupling Parameters} \\end{center} \\begin{abstract} Single W boson production in electron-positron collisions is studied with the L3 detector at centre-of-mass energies between $192\\mathrm{\\ Ge\\kern -0.1em V}$ and $209\\mathrm{\\ Ge\\kern -0.1em V}$. Events with two acoplanar hadronic jets or a single energetic lepton are selected, and the single W cross section is measured. Combining the results with measurements at lower centre-of-mass energies, the ratio of the measured cross section to the Standard Model expectation is found to be $1.12^{+0.11}_{-0.10}\\pm0.03$. From all single W data, the WW$\\gamma$ gauge coupling parameter $\\kappa_\\gamma$ is measured to be $1.116^{+0.082}_{-0.086}\\pm0.068$. \\end{abstract} \\end{document}

Neutron Transmission and Capture Measurements and Resonance Parameter Analysis of Neodymium from 1eV to 500 eV

International Nuclear Information System (INIS)

DP Barry; MJ Trbovich; Y Danon; RC Block; RE Slovacek

2005-01-01

Neodymium is a 235 U fission product and is important for reactor neutronic calculations. The aim of the present work is to improve upon the existing neutron cross section data of neodymium. Neutron capture and transmission measurements were performed by the time-off-light technique at the Rensselaer Polytechnic Institute LINAC laboratory using metallic neodymium samples. The capture measurements were made at the 25-m flight station with a 16-segment NaI multiplicity detector, and the transmission measurements were performed at 15-m and 25-m flight stations, respectively, with 6 Li glass scintillation detectors. After the data were collected and reduced, resonance parameters were determined by combined fitting of the transmission and capture data with the multilevel R-matrix Bayesian code SAMMY. The resonance parameters for all naturally occurring neodymium isotopes were deduced within the energy range of 1 eV to 500 eV. The resulting resonance parameters were used to calculate the capture resonance integrals from this energy. The RPI parameters gave a resonance integral value of 32 ± 1 barns that is approximately 7% lower than that obtained with the ENDF-B/VI parameters. The current measurements significantly reduce the uncertainties on the resonance parameters when compared with previously published parameters

A Study of Transmission Control Method for Distributed Parameters Measurement in Large Factories and Storehouses

Directory of Open Access Journals (Sweden)

Shujing Su

2015-01-01

Full Text Available For the characteristics of parameters dispersion in large factories, storehouses, and other applications, a distributed parameter measurement system is designed that is based on the ring network. The structure of the system and the circuit design of the master-slave node are described briefly. The basic protocol architecture about transmission communication is introduced, and then this paper comes up with two kinds of distributed transmission control methods. Finally, the reliability, extendibility, and control characteristic of these two methods are tested through a series of experiments. Moreover, the measurement results are compared and discussed.

Identification of grid model parameters using synchrophasor measurements

Energy Technology Data Exchange (ETDEWEB)

Boicea, Valentin; Albu, Mihaela [Politehnica University of Bucharest (Romania)

2012-07-01

Presently a critical element of the energy networks is represented by the active distribution grids, where generation intermittency and controllable loads contribute to a stochastic varability of the quantities characterizing the grid operation. The capability of controlling the electrical energy transfer is also limited by the incomplete knowledge of the detailed electrical model of each of the grid components. Asset management in distribution grids has to consider dynamic loads, while high loading of network sections might already have degraded some of the assets. Moreover, in case of functional microgrids, all elements need to be modelled accurately and an appropriate measurement layer enabling online control needs to be deployed. In this paper a method for online identification of the actual parameter values in grid electrical models is proposed. Laboratory results validating the proposed method are presented. (orig.)

Measurement of specific parameters for dose calculation after inhalation of aerols containing transuranium elements

International Nuclear Information System (INIS)

Ramounet-le Gall, B.; Fritsch, P.; Abram, M.C.; Rateau, G.; Grillon, G.; Guillet, K.; Baude, S.; Berard, P.; Ansoborlo, E.; Delforge, J.

2002-01-01

A review on specific parameter measurements to calculate doses per unit of incorporation according to recommendations of the International Commission of Radiological Protection has been performed for inhaled actinide oxides. Alpha activity distribution of the particles can be obtained by autoradiography analysis using aerosol sampling filters at the work places. This allows us to characterize granulometric parameters of 'pure' actinide oxides, but complementary analysis by scanning electron microscopy is needed for complex aerosols. Dissolution parameters with their standard deviation are obtained after rat inhalation exposure, taking into account both mechanical lung clearance and actinide transfer to the blood estimated from bone retention. In vitro experiments suggest that the slow dissolution rate might decrease as a function of time following exposure. Dose calculation software packages have been developed to take into account granulometry and dissolution parameters as well as specific physiological parameters of exposed individuals. In the case of poorly soluble actinide oxides, granulometry and physiology appear as the main parameters controlling dose value, whereas dissolution only alters dose distribution. Validation of these software packages are in progress. (author)

The Numerical Calculation and Experimental Measurement of the Inductance Parameters for Permanent Magnet Synchronous Motor in Electric Vehicle

Science.gov (United States)

Jiang, Chao; Qiao, Mingzhong; Zhu, Peng

2017-12-01

A permanent magnet synchronous motor with radial magnetic circuit and built-in permanent magnet is designed for the electric vehicle. Finite element numerical calculation and experimental measurement are adopted to obtain the direct axis and quadrature axis inductance parameters of the motor which are vital important for the motor control. The calculation method is simple, the measuring principle is clear, the results of numerical calculation and experimental measurement are mutual confirmation. A quick and effective method is provided to obtain the direct axis and quadrature axis inductance parameters of the motor, and then improve the design of motor or adjust the control parameters of the motor controller.

Measurement of resonance parameters of orbitally excited narrow B0 mesons.

Science.gov (United States)

Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; González, B Alvarez; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Almenar, C Cuenca; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; da Costa, J Guimaraes; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kusakabe, Y; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlok, J; Fernandez, P Movilla; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Griso, S Pagan; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Peiffer, T; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Pueschel, E; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Rekovic, V; Renton, P; Renz, M; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Saltó, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schmidt, M A; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sforza, F; Sfyrla, A; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shiraishi, S; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spreitzer, T; Squillacioti, P; Stanitzki, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Stuart, D; Suh, J S; Sukhanov, A; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thompson, G A; Thomson, E; Tipton, P; Ttito-Guzmán, P; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Tourneur, S; Trovato, M; Tsai, S-Y; Tu, Y; Turini, N; Ukegawa, F; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Veszpremi, V; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Volobouev, I; Volpi, G; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wagner-Kuhr, J; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Weinelt, J; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Würthwein, F; Wynne, S M; Xie, S; Yagil, A; Yamamoto, K; Yamaoka, J; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zhang, X; Zheng, Y; Zucchelli, S

2009-03-13

We report a measurement of resonance parameters of the orbitally excited (L=1) narrow B0 mesons in decays to B;{(*)+}pi;{-} using 1.7 fb;{-1} of data collected by the CDF II detector at the Fermilab Tevatron. The mass and width of the B_{2};{*0} state are measured to be m(B_{2};{*0})=5740.2_{-1.8};{+1.7}(stat)-0.8+0.9(syst) MeV/c;{2} and Gamma(B_{2};{*0})=22.7_{-3.2};{+3.8}(stat)-10.2+3.2(syst) MeV/c;{2}. The mass difference between the B_{2};{*0} and B10 states is measured to be 14.9_{-2.5};{+2.2}(stat)-1.4+1.2(syst) MeV/c;{2}, resulting in a B10 mass of 5725.3_{-2.2};{+1.6}(stat)-1.5+1.4(syst) MeV/c;{2}. This is currently the most precise measurement of the masses of these states and the first measurement of the B_{2};{*0} width.

A real-time measurement system for parameters of live biology metabolism process with fiber optics

Science.gov (United States)

Tao, Wei; Zhao, Hui; Liu, Zemin; Cheng, Jinke; Cai, Rong

2010-08-01

Energy metabolism is one of the basic life activities of cellular in which lactate, O2 and CO2 will be released into the extracellular environment. By monitoring the quantity of these parameters, the mitochondrial performance will be got. A continuous measurement system for the concentration of O2, CO2 and PH value is introduced in this paper. The system is made up of several small-sized fiber optics biosensors corresponding to the container. The setup of the system and the principle of measurement of several parameters are explained. The setup of the fiber PH sensor based on principle of light absorption is also introduced in detail and some experimental results are given. From the results we can see that the system can measure the PH value precisely suitable for cell cultivation. The linear and repeatable accuracies are 3.6% and 6.7% respectively, which can fulfill the measurement task.

The estimation of effective doses using measurement of several relevant physical parameters from radon exposures

International Nuclear Information System (INIS)

Ridzikova, A; Fronka, A.; Maly, B.; Moucka, L.

2003-01-01

In the present investigation, we will be study the dose relevant factors from continual monitoring in real homes into account getting more accurate estimation of 222 Rn the effective dose. The dose relevant parameters include the radon concentration, the equilibrium factor (f), the fraction (fp) of unattached radon decay products and real time occupancy people in home. The result of the measurement are the time courses of radon concentration that are based on estimation effective doses together with assessment of the real time occupancy people indoor. We found out by analysis that year effective dose is lower than effective dose estimated by ICRP recommendation from the integral measurement that included only average radon concentration. Our analysis of estimation effective doses using measurement of several physical parameters was made only in one case and for the better specification is important to measure in different real occupancy houses. (authors)

Measurement of key pool boiling parameters in nanofluids for nuclear applications

International Nuclear Information System (INIS)

Bang, In Cheol; Buongiorno, Jacopo; Hu, Lin-Wen; Wang, Hsin

2007-01-01

Nanofluids, colloidal dispersions of nanoparticles in a base fluid such as water, can afford very significant Critical Heat Flux (CHF) enhancement. Such engineered fluids potentially could be employed in reactors as advanced coolants in safety systems with significant safety and economic advantages. However, a satisfactory explanation of the CHF enhancement mechanism in nanofluids is lacking. To close this gap, we have identified the important boiling parameters to be measured and have deployed a pool boiling facility to measure them. The facility is equipped with a thin indium-tin-oxide heater deposited over a sapphire substrate. An intra-red high-speed camera and an optical probe are used to measure the temperature distribution on the heater and the hydrodynamics above the heater, respectively. The first data generated with this facility already provide some clue on the CHF enhancement mechanism in nanofluids. (author)

Pressure drop and arterial compliance - Two arterial parameters in one measurement.

Science.gov (United States)

Rotman, Oren M; Zaretsky, Uri; Shitzer, Avraham; Einav, Shmuel

2017-01-04

Coronary artery pressure-drop and distensibility (compliance) are two major, seemingly unrelated, parameters in the cardiovascular clinical setting, which are indicative of coronary arteries patency and atherosclerosis severity. While pressure drop is related to flow, and therefore serves as a functional indicator of a stenosis severity, the arterial distensibility is indicative of the arterial stiffness, and hence the arterial wall composition. In the present study, we hypothesized that local pressure drops are dependent on the arterial distensibility, and hence can provide information on both indices. The clinical significance is that a single measurement of pressure drop could potentially provide both functional and bio-mechanical metrics of lesions, and thus assist in real-time decision making prior to stenting. The goal of the current study was to set the basis for understanding this relationship, and define the accuracy and sensitivity required from the pressure measurement system. The investigation was performed using numerical fluid-structure interaction (FSI) simulations, validated experimentally using our high accuracy differential pressure measurement system. Simplified silicone mock coronary arteries with zero to intermediate size stenoses were used, and various combinations of arterial distensibility, diameter, and flow rate were simulated. Results of hyperemic flow cases were also compared to fractional flow reserve (FFR). The results indicate the potential clinical superiority of a high accuracy pressure drop-based parameter over FFR, by: (i) being more lesion-specific, (ii) the possibility to circumvent the FFR dependency on pharmacologically-induced hyperemia, and, (iii) by providing both functional and biomechanical lesion-specific information. Copyright © 2016 Elsevier Ltd. All rights reserved.

Covariance-Based Estimation from Multisensor Delayed Measurements with Random Parameter Matrices and Correlated Noises

Directory of Open Access Journals (Sweden)

R. Caballero-Águila

2014-01-01

Full Text Available The optimal least-squares linear estimation problem is addressed for a class of discrete-time multisensor linear stochastic systems subject to randomly delayed measurements with different delay rates. For each sensor, a different binary sequence is used to model the delay process. The measured outputs are perturbed by both random parameter matrices and one-step autocorrelated and cross correlated noises. Using an innovation approach, computationally simple recursive algorithms are obtained for the prediction, filtering, and smoothing problems, without requiring full knowledge of the state-space model generating the signal process, but only the information provided by the delay probabilities and the mean and covariance functions of the processes (signal, random parameter matrices, and noises involved in the observation model. The accuracy of the estimators is measured by their error covariance matrices, which allow us to analyze the estimator performance in a numerical simulation example that illustrates the feasibility of the proposed algorithms.

Intra-observer reproducibility and interobserver reliability of the radiographic parameters in the Spinal Deformity Study Group's AIS Radiographic Measurement Manual.

Science.gov (United States)

Dang, Natasha Radhika; Moreau, Marc J; Hill, Douglas L; Mahood, James K; Raso, James

2005-05-01

Retrospective cross-sectional assessment of the reproducibility and reliability of radiographic parameters. To measure the intra-examiner and interexaminer reproducibility and reliability of salient radiographic features. The management and treatment of adolescent idiopathic scoliosis (AIS) depends on accurate and reproducible radiographic measurements of the deformity. Ten sets of radiographs were randomly selected from a sample of patients with AIS, with initial curves between 20 degrees and 45 degrees. Fourteen measures of the deformity were measured from posteroanterior and lateral radiographs by 2 examiners, and were repeated 5 times at intervals of 3-5 days. Intra-examiner and interexaminer differences were examined. The parameters include measures of curve size, spinal imbalance, sagittal kyphosis and alignment, maximum apical vertebral rotation, T1 tilt, spondylolysis/spondylolisthesis, and skeletal age. Intra-examiner reproducibility was generally excellent for parameters measured from the posteroanterior radiographs but only fair to good for parameters from the lateral radiographs, in which some landmarks were not clearly visible. Of the 13 parameters observed, 7 had excellent interobserver reliability. The measurements from the lateral radiograph were less reproducible and reliable and, thus, may not add value to the assessment of AIS. Taking additional measures encourages a systematic and comprehensive assessment of spinal radiographs.

Preliminary Measurement of Neutrino Oscillation Parameters By NuMI/MINOS and Calibration Studies for Improving this Measurement

International Nuclear Information System (INIS)

Symes, Philip Andrew; Sussex U.

2005-01-01

This thesis explains the origins of neutrinos and their interactions, and the phenomenon of neutrino oscillations. Experiments for measuring neutrino oscillations are mentioned and the experiment investigated in this thesis, the ''Main Injector Neutrino Oscillation Search'', and its neutrino beam, the Fermi National Accelerator Laboratory's ''Neutrinos At The Main Injector'', are described. MINOS is a long baseline (735 km) neutrino oscillation experiment with a near and a far detector, intended to make precision measurements of the atmospheric sector neutrino oscillation parameters. A measurement is made of the ''atmospheric'' neutrino oscillation parameters, Δm 23 2 and sin 2 (2θ 23 ), using neutrinos from the NuMI beam. The results of this analysis are compared to measurements at MINOS using neutrinos from the atmosphere and with other experiments. A more detailed method of beam neutrino analysis is discussed, and the extra calibrations needed to perform that analysis properly are described, with special attention paid to two aspects of the calibration, which comprise the bulk of work for this thesis. The light injection calibration system uses LEDs to illuminate the detector readout and provides a normalization of the stability of the detector over time. The hardware and different modi operandi of the system are described. There is a description of installation and commissioning of the system at one of the MINOS detectors. The response normalization of each detector with cosmic ray muons is described. Special attention is paid to the explanation of necessary corrections that must be made to the muon sample in order for the sample to be used to calibrate each detector to the specified accuracy. The performance of the calibration is shown

Evaluation of nuclear parameters measurements realized during the Angra-1 reactor start-up tests and the theoretical previsions of these parameters

International Nuclear Information System (INIS)

Fernandes, V.B.; Ponzoni Filho, P.; Perrotta, J.A.; Silva Ipojuca, T. da

1982-01-01

A summary of measuring techniques and the results of the follow nuclear parameters, are presented: a) reactivity of various control bank; b) capacity of reactor shutdown; c) critical concentrations of soluble boron for various core configurations; d) reactivity isothermal coefficients; e) power mapping; f) power reactivity coefficients. (E.G.) [pt

Determining tumor blood flow parameters from dynamic image measurements

Science.gov (United States)

Libertini, Jessica M.

2008-11-01

Many recent cancer treatments focus on preventing angiogenesis, the process by which a tumor promotes the growth of large and efficient capillary beds for the increased nourishment required to support the tumor's rapid growth[l]. To measure the efficacy of these treatments in a timely fashion, there is an interest in using data from dynamic sequences of contrast-enhanced medical imaging, such as MRI and CT, to measure blood flow parameters such as perfusion, permeability-surface-area product, and the relative volumes of the plasma and extracellular-extravascular space. Starting with a two compartment model presented by the radiology community[2], this work challenges the application of a simplification to this problem, which was originally developed to model capillary reuptake[3]. While the primary result of this work is the demonstration of the inaccuracy of this simplification, the remainder of the paper is dedicated to presenting alternative methods for calculating the perfusion and plasma volume coefficients. These methods are applied to model data sets based on real patient data, and preliminary results are presented.

Focusing on a Probability Element: Parameter Selection of Message Importance Measure in Big Data

OpenAIRE

She, Rui; Liu, Shanyun; Dong, Yunquan; Fan, Pingyi

2017-01-01

Message importance measure (MIM) is applicable to characterize the importance of information in the scenario of big data, similar to entropy in information theory. In fact, MIM with a variable parameter can make an effect on the characterization of distribution. Furthermore, by choosing an appropriate parameter of MIM,it is possible to emphasize the message importance of a certain probability element in a distribution. Therefore, parametric MIM can play a vital role in anomaly detection of bi...

Automated egg grading system using computer vision: Investigation on weight measure versus shape parameters

Science.gov (United States)

Nasir, Ahmad Fakhri Ab; Suhaila Sabarudin, Siti; Majeed, Anwar P. P. Abdul; Ghani, Ahmad Shahrizan Abdul

2018-04-01

Chicken egg is a source of food of high demand by humans. Human operators cannot work perfectly and continuously when conducting egg grading. Instead of an egg grading system using weight measure, an automatic system for egg grading using computer vision (using egg shape parameter) can be used to improve the productivity of egg grading. However, early hypothesis has indicated that more number of egg classes will change when using egg shape parameter compared with using weight measure. This paper presents the comparison of egg classification by the two above-mentioned methods. Firstly, 120 images of chicken eggs of various grades (A–D) produced in Malaysia are captured. Then, the egg images are processed using image pre-processing techniques, such as image cropping, smoothing and segmentation. Thereafter, eight egg shape features, including area, major axis length, minor axis length, volume, diameter and perimeter, are extracted. Lastly, feature selection (information gain ratio) and feature extraction (principal component analysis) are performed using k-nearest neighbour classifier in the classification process. Two methods, namely, supervised learning (using weight measure as graded by egg supplier) and unsupervised learning (using egg shape parameters as graded by ourselves), are conducted to execute the experiment. Clustering results reveal many changes in egg classes after performing shape-based grading. On average, the best recognition results using shape-based grading label is 94.16% while using weight-based label is 44.17%. As conclusion, automated egg grading system using computer vision is better by implementing shape-based features since it uses image meanwhile the weight parameter is more suitable by using weight grading system.

Measurement of Michel Parameters ($\\bar\\eta$, $\\xi\\kappa$) in the radiative leptonic decay of tau at Belle

CERN Document Server

Abdesselam, A.

2017-06-22

We present the first measurement of the Michel parameters $\\bar{\\eta}$ and $\\xi\\kappa$ in the radiative leptonic decay of the $\\tau$ lepton using 703 f$\\mathrm{b}^{-1}$ of data collected with the Belle detector at the KEKB $e^+e^-$ collider. The Michel parameters are measured by an unbinned maximum likelihood fit to the kinematic information of $e^+e^-\\rightarrow\\tau^+\\tau^-\\rightarrow (\\pi^+\\pi^0 \\bar{\

Measurements of diffusion parameters of methanol on gamma-irradiated polycarbonate

International Nuclear Information System (INIS)

Silva, Pietro P.J.C.G.P.O.; Araujo, Elmo S.

2013-01-01

Polycarbonate (PC) is an engineering polymer which presents interesting properties such as toughness, light weight and transparency. This material has been used for several important applications including in the medical field. In this particular application, polycarbonate has been exposed frequently to gamma irradiation and to chemical environment that can be able to product significant changes in polymer structure that may lead to future catastrophic fail and rupture. Polymer structural damages induced by gamma irradiation or chemical attack (environment stress cracking) have been studied by several research groups for many years and for many solvent-polymer systems, but few reporters present informations about the simultaneous occurrence of these effects. This present work has the goal to understand the diffusion process of methanol in polycarbonate and to determinate the diffusion parameters on polymer system under 100 kGy of gamma irradiation. Swelling experiments were performed at the samples of polycarbonate divided in two groups: PC-0 (without dose) and PC-100 (with 100 kGy of dose). Diffusion parameters (D) may be measured by slope of the sorption curve for polymers with Fickian behavior. A comparison of the D parameters was made for each set of sample. There were no significant differences on D values of sample groups observed due to the radiation effects. However, stress strain curves obtained show that methanol has great influence on mechanical behavior of PC but the radiation dose don't have significant influence on this mechanical behavior. (author)

Integration of neural networks with fuzzy reasoning for measuring operational parameters in a nuclear reactor

International Nuclear Information System (INIS)

Ikonomopoulos, A.; Tsoukalas, L.H.

1993-01-01

A novel approach is described for measuring variables with operational significance in a complex system such as a nuclear reactor. The methodology is based on the integration of artificial neural networks with fuzzy reasoning. Neural networks are used to map dynamic time series to a set of user-defined linguistic labels called fuzzy values. The process takes place in a manner analogous to that of measurement. Hence, the entire procedure is referred to as virtual measurement and its software implementation as a virtual measuring device. An optimization algorithm based on information criteria and fuzzy algebra augments the process and assists in the identification of different states of the monitored parameter. The proposed technique is applied for monitoring parameters such as performance, valve position, transient type, and reactivity. The results obtained from the application of the neural network-fuzzy reasoning integration in a high power research reactor clearly demonstrate the excellent tolerance of the virtual measuring device to faulty signals as well as its ability to accommodate noisy inputs

Measurement of plasma parameters

International Nuclear Information System (INIS)

1999-01-01

The physics issues of the measurements of the plasma properties necessary to provide both the control and science data for achieving the goals of the ITER device are discussed. The assessment of the requirements for these measurements is first discussed, together with priorities that relate to the experimental program. Subsequently, some of the proposed measurement techniques, the plasma diagnostics, are described with particular emphasis on their implementation on ITER and their capability to meet the requirements. A judgement on the present status of the diagnostic program on ITER is provided with some indication of the research and development program necessary to demonstrate viability of techniques or their implementation. (author)

Keratoconus diagnosis using Corvis ST measured biomechanical parameters

Directory of Open Access Journals (Sweden)

Roghiyeh Elham

2017-09-01

Conclusions: The A1T seems a valuable parameter in the diagnosis of keratoconic eyes. It showed excellent diagnostic ability even when controlled for CCT. None of the parameters were reliable index for keratoconus staging.

Markov chain beam randomization: a study of the impact of PLANCK beam measurement errors on cosmological parameter estimation

Science.gov (United States)

Rocha, G.; Pagano, L.; Górski, K. M.; Huffenberger, K. M.; Lawrence, C. R.; Lange, A. E.

2010-04-01

We introduce a new method to propagate uncertainties in the beam shapes used to measure the cosmic microwave background to cosmological parameters determined from those measurements. The method, called markov chain beam randomization (MCBR), randomly samples from a set of templates or functions that describe the beam uncertainties. The method is much faster than direct numerical integration over systematic “nuisance” parameters, and is not restricted to simple, idealized cases as is analytic marginalization. It does not assume the data are normally distributed, and does not require Gaussian priors on the specific systematic uncertainties. We show that MCBR properly accounts for and provides the marginalized errors of the parameters. The method can be generalized and used to propagate any systematic uncertainties for which a set of templates is available. We apply the method to the Planck satellite, and consider future experiments. Beam measurement errors should have a small effect on cosmological parameters as long as the beam fitting is performed after removal of 1/f noise.

Parameter degeneracies in neutrino oscillation measurement of leptonic CP and T violation

International Nuclear Information System (INIS)

Minakata, Hisakazu; Nunokawa, Hiroshi; Parke, Stephen

2002-01-01

The measurement of the mixing angle θ 13 , sign of Δm 13 2 , and the CP or T violating phase δ is fraught with ambiguities in neutrino oscillation. In this paper we give an analytic treatment of the parameter degeneracies associated with measuring the ν μ →ν e probability and its CP and/or T conjugates. For CP violation, we give explicit solutions to allow us to obtain the regions where there exist twofold and fourfold degeneracies. We calculate the fractional differences, (Δθ/θ-bar), between the allowed solutions which may be used to compare with the expected sensitivities of the experiments. For T violation we show that there is always a complete degeneracy between solutions with positive and negative Δm 13 2 which arises due to a symmetry and cannot be removed by observing one neutrino oscillation probability and its T conjugate. Thus there is always a fourfold parameter degeneracy apart from exceptional points. Explicit solutions are also given and the fractional differences are computed. The biprobability CP/T trajectory diagrams are extensively used to illuminate the nature of the degeneracies

Preliminary Measurement of Neutrino Oscillation Parameters By NuMI/MINOS and Calibration Studies for Improving this Measurement

Energy Technology Data Exchange (ETDEWEB)

Symes, Philip Andrew [Univ. of Sussex, Brighton (United Kingdom)

2005-11-01

This thesis explains the origins of neutrinos and their interactions, and the phenomenon of neutrino oscillations. Experiments for measuring neutrino oscillations are mentioned and the experiment investigated in this thesis, the ''Main Injector Neutrino Oscillation Search'', and its neutrino beam, the Fermi National Accelerator Laboratory's ''Neutrinos At The Main Injector'', are described. MINOS is a long baseline (735 km) neutrino oscillation experiment with a near and a far detector, intended to make precision measurements of the atmospheric sector neutrino oscillation parameters. A measurement is made of the ''atmospheric'' neutrino oscillation parameters, Δm$2\\atop{23}$ and sin²(2θ₂₃), using neutrinos from the NuMI beam. The results of this analysis are compared to measurements at MINOS using neutrinos from the atmosphere and with other experiments. A more detailed method of beam neutrino analysis is discussed, and the extra calibrations needed to perform that analysis properly are described, with special attention paid to two aspects of the calibration, which comprise the bulk of work for this thesis. The light injection calibration system uses LEDs to illuminate the detector readout and provides a normalization of the stability of the detector over time. The hardware and different modi operandi of the system are described. There is a description of installation and commissioning of the system at one of the MINOS detectors. The response normalization of each detector with cosmic ray muons is described. Special attention is paid to the explanation of necessary corrections that must be made to the muon sample in order for the sample to be used to calibrate each detector to the specified accuracy. The performance of the calibration is shown.

Measurement of np elastic scattering spin-spin correlation parameters at 484, 634, and 788 MeV

International Nuclear Information System (INIS)

Garnett, R.W.

1989-03-01

The spin-spin correlation parameters C/sub LL/ and C/sub SL/ were measured for np elastic scattering at the incident neutron kinetic energy of 634 MeV. Good agreement was obtained with previously measured data. Additionally, the first measurement of the correlation parameter C/sub SS/ was made at the three energies, 484, 634, and 788 MeV. It was found that the new values, in general, do not agree well with phase shift predictions. A study was carried out to determine which of the isospin-0 partial waves will be affected by this new data. It was found that the 1 P 1 partial wave will be affected significantly at all three measurement energies. At 634 and 788 MeV, the 3 S 1 phase shifts will also change. 29 refs., 21 figs., 16 tabs

Implications of the top quark mass measurement for the CKM parameters x$_{s}$ and CP asymmetries

CERN Document Server

Ali, A

1995-01-01

Motivated by the recent determination of the top quark mass by the CDF collaboration, \\mt =174 \\pm 10 ^{+13}_{-12} GeV, we review and update constraints on the parameters of the quark flavour mixing matrix V_{CKM} in the standard model. In performing these fits, we use inputs from the measurements of \\abseps, the CP-violating parameter in K decays, \\xd = (\\delm)/\\Gamma, the mixing parameter in \\bdbdbar\\ mixing, the present measurements of the matrix elements \\absvcb and \\absvub, and the B-hadron lifetimes. The CDF value for \\mt considerably reduces the CKM-parameter space previously allowed. An interesting result of our analysis is that the present data can be used to restrict the coupling constant product ratio f_{B_d}\\sqrt{B_{B_d}} to the range 110-270 MeV -- in comfortable agreement with existing theoretical estimates of this quantity. We use the updated CKM matrix to predict the \\bsbsbar\\ mixing ratio \\xs, as well as the quantities \\sin 2\\alpha, \\sin 2\\beta and \\sin^2\\gamma, which characterize CP-violatin...

Precision Beam Parameter Monitoring in a Measurement of the Weak Mixing Angle in Moeller Scattering

Energy Technology Data Exchange (ETDEWEB)

Cooke, M.S.

2005-04-11

A precision measurement of the parity nonconserving left-right asymmetry, A{sub LR}, in Moeller scattering (e{sup -}e{sup -} {yields} e{sup -}e{sup -}) is currently in progress at the Stanford Linear Accelerator Center (SLAC). This experiment, labeled SLAC-E158, scatters longitudinally polarized electrons off atomic electrons in an unpolarized hydrogen target at a Q{sup 2} of 0.03 (GeV/c){sup 2}. The asymmetry, which is the fractional difference in the scattering cross-sections, measures the effective pseudo-scalar weak neutral current coupling, g{sub ee}, governing Moeller scattering. This quantity is in turn proportional to (1/4 - sin{sup 2} {theta}{sub w}), where {theta}{sub w} is the electroweak mixing angle. The goal is to measure the asymmetry to a precision of 1 x 10{sup -8} which corresponds to {delta}(sin{sup 2} {theta}{sub w}) {approx} 0.0007. Since A{sub LR} is a function of the cross-sections, and the cross-sections depend on the beam parameters, the desired precision of A{sub LR} places stringent requirements on the beam parameters. This paper investigates the requirements on the beam parameters and discusses the means by which they are monitored and accounted for.

Retrieval of cloud droplet size distribution parameters from polarized reflectance measurements

Directory of Open Access Journals (Sweden)

M. Alexandrov

2011-09-01

Full Text Available We present an algorithm for retrieval of cloud droplet size distribution parameters (effective radius and variance from the Research Scanning Polarimeter (RSP measurements. The RSP is an airborne prototype for the Aerosol Polarimetery Sensor (APS, which is due to be launched as part of the NASA Glory Project. This instrument measures both polarized and total reflectances in 9 spectral channels with center wavelengths ranging from 410 to 2250 nm. For cloud droplet size retrievals we utilize the polarized reflectances in the scattering angle range between 140 and 170 degrees where they exhibit rainbow. The shape of the rainbow is determined mainly by single-scattering properties of the cloud particles, that simplifies the inversions and reduces retrieval uncertainties. The retrieval algorithm was tested using realistically simulated cloud radiation fields. Our retrievals of cloud droplet sizes from actual RSP measurements made during two recent field campaigns were compared with the correlative in situ observations.

Temporal correlation functions of concentration fluctuations: an anomalous case.

Science.gov (United States)

Lubelski, Ariel; Klafter, Joseph

2008-10-09

We calculate, within the framework of the continuous time random walk (CTRW) model, multiparticle temporal correlation functions of concentration fluctuations (CCF) in systems that display anomalous subdiffusion. The subdiffusion stems from the nonstationary nature of the CTRW waiting times, which also lead to aging and ergodicity breaking. Due to aging, a system of diffusing particles tends to slow down as time progresses, and therefore, the temporal correlation functions strongly depend on the initial time of measurement. As a consequence, time averages of the CCF differ from ensemble averages, displaying therefore ergodicity breaking. We provide a simple example that demonstrates the difference between these two averages, a difference that might be amenable to experimental tests. We focus on the case of ensemble averaging and assume that the preparation time of the system coincides with the starting time of the measurement. Our analytical calculations are supported by computer simulations based on the CTRW model.

Modal parameter determination of a lightweight aerospace panel using laser Doppler vibrometer measurements

Science.gov (United States)

de Sousa, Kleverson C.; Domingues, Allan C.; Pereira, Pedro P. de S.; Carneiro, Sergio H.; de Morais, Marcus V. G.; Fabro, Adriano T.

2016-06-01

The experimental determination of modal parameters, i.e. natural frequencies, mode shapes and damping ratio, are key in characterizing the dynamic behaviour of structures. Typically, such parameters are obtained from dynamic measurements using one or a set of accelerometers, for response measurements, along with force transducers from an impact hammer or an electrodynamic actuator, i.e. a shaker. However, lightweight structures, commonly applied in the aerospace industry, can be significantly affected by the added mass from accelerometers. Therefore, non-contact measurement techniques, like Laser Doppler Vibrometer (LDV), are a more suitable approach in determining the dynamic characteristics of such structures. In this article, the procedures and results of a modal test for a honeycomb sandwich panel for aerospace applications are presented and discussed. The main objectives of the test are the identification of natural frequencies and mode shapes in order to validate a numerical model, as well as the identification of the damping characteristics of the panel. A validated numerical model will be necessary for future detailed response analysis of the satellite, including vibroacoustic investigations to account for acoustic excitations encountered during launching. The numerical model using homogenised material properties is updated to fit the experimental results and very good agreement between experimental and numerically obtained natural frequencies and mode shapes.

Kinetic parameter estimation from SPECT cone-beam projection measurements

International Nuclear Information System (INIS)

Huesman, Ronald H.; Reutter, Bryan W.; Zeng, G. Larry; Gullberg, Grant T.

1998-01-01

Kinetic parameters are commonly estimated from dynamically acquired nuclear medicine data by first reconstructing a dynamic sequence of images and subsequently fitting the parameters to time-activity curves generated from regions of interest overlaid upon the image sequence. Biased estimates can result from images reconstructed using inconsistent projections of a time-varying distribution of radiopharmaceutical acquired by a rotating SPECT system. If the SPECT data are acquired using cone-beam collimators wherein the gantry rotates so that the focal point of the collimators always remains in a plane, additional biases can arise from images reconstructed using insufficient, as well as truncated, projection samples. To overcome these problems we have investigated the estimation of kinetic parameters directly from SPECT cone-beam projection data by modelling the data acquisition process. To accomplish this it was necessary to parametrize the spatial and temporal distribution of the radiopharmaceutical within the SPECT field of view. In a simulated chest image volume, kinetic parameters were estimated for simple one-compartment models for four myocardial regions of interest. Myocardial uptake and washout parameters estimated by conventional analysis of noiseless simulated cone-beam data had biases ranging between 3-26% and 0-28%, respectively. Parameters estimated directly from the noiseless projection data were unbiased as expected, since the model used for fitting was faithful to the simulation. Statistical uncertainties of parameter estimates for 10 000 000 events ranged between 0.2-9% for the uptake parameters and between 0.3-6% for the washout parameters. (author)

Island based radar and microwave radiometer measurements of stratus cloud parameters during the Atlantic Stratocumulus Transition Experiment (ASTEX)

Energy Technology Data Exchange (ETDEWEB)

Frisch, A.S. [Colorado State Univ., Fort Collins, CO (United States); Fairall, C.W.; Snider, J.B. [NOAA Environmental Technology Lab., Boulder, CO (United States); Lenshow, D.H.; Mayer, S.D. [National Center for Atmospheric Research, Boulder, CO (United States)

1996-04-01

During the Atlantic Stratocumulus Transition Experiment (ASTEX) in June 1992, simultaneous measurements were made with a vertically pointing cloud sensing radar and a microwave radiometer. The radar measurements are used to estimate stratus cloud drizzle and turbulence parameters. In addition, with the microwave radiometer measurements of reflectivity, we estimated the profiles of cloud liquid water and effective radius. We used radar data for computation of vertical profiles of various drizzle parameters such as droplet concentration, modal radius, and spread. A sample of these results is shown in Figure 1. In addition, in non-drizzle clouds, with the radar and radiometer we can estimate the verticle profiles of stratus cloud parameters such as liquid water concentration and effective radius. This is accomplished by assuming a droplet distribution with droplet number concentration and width constant with height.

Constraining dark energy with Hubble parameter measurements: an analysis including future redshift-drift observations

International Nuclear Information System (INIS)

Guo, Rui-Yun; Zhang, Xin

2016-01-01

The nature of dark energy affects the Hubble expansion rate (namely, the expansion history) H(z) by an integral over w(z). However, the usual observables are the luminosity distances or the angular diameter distances, which measure the distance.redshift relation. Actually, the property of dark energy affects the distances (and the growth factor) by a further integration over functions of H(z). Thus, the direct measurements of the Hubble parameter H(z) at different redshifts are of great importance for constraining the properties of dark energy. In this paper, we show how the typical dark energy models, for example, the ΛCDM, wCDM, CPL, and holographic dark energy models, can be constrained by the current direct measurements of H(z) (31 data used in total in this paper, covering the redshift range of z @ element of [0.07, 2.34]). In fact, the future redshift-drift observations (also referred to as the Sandage-Loeb test) can also directly measure H(z) at higher redshifts, covering the range of z @ element of [2, 5]. We thus discuss what role the redshift-drift observations can play in constraining dark energy with the Hubble parameter measurements. We show that the constraints on dark energy can be improved greatly with the H(z) data from only a 10-year observation of redshift drift. (orig.)

Standard test method for determining the effective elastic parameter for X-ray diffraction measurements of residual stress

CERN Document Server

American Society for Testing and Materials. Philadelphia

1998-01-01

1.1 This test method covers a procedure for experimentally determining the effective elastic parameter, Eeff, for the evaluation of residual and applied stresses by X-ray diffraction techniques. The effective elastic parameter relates macroscopic stress to the strain measured in a particular crystallographic direction in polycrystalline samples. Eeff should not be confused with E, the modulus of elasticity. Rather, it is nominally equivalent to E/(1 + ν) for the particular crystallographic direction, where ν is Poisson's ratio. The effective elastic parameter is influenced by elastic anisotropy and preferred orientation of the sample material. 1.2 This test method is applicable to all X-ray diffraction instruments intended for measurements of macroscopic residual stress that use measurements of the positions of the diffraction peaks in the high back-reflection region to determine changes in lattice spacing. 1.3 This test method is applicable to all X-ray diffraction techniques for residual stress measurem...

Scintillator-CCD camera system light output response to dosimetry parameters for proton beam range measurement

Energy Technology Data Exchange (ETDEWEB)

Daftari, Inder K., E-mail: idaftari@radonc.ucsf.edu [Department of Radiation Oncology, 1600 Divisadero Street, Suite H1031, University of California-San Francisco, San Francisco, CA 94143 (United States); Castaneda, Carlos M.; Essert, Timothy [Crocker Nuclear Laboratory,1 Shields Avenue, University of California-Davis, Davis, CA 95616 (United States); Phillips, Theodore L.; Mishra, Kavita K. [Department of Radiation Oncology, 1600 Divisadero Street, Suite H1031, University of California-San Francisco, San Francisco, CA 94143 (United States)

2012-09-11

The purpose of this study is to investigate the luminescence light output response in a plastic scintillator irradiated by a 67.5 MeV proton beam using various dosimetry parameters. The relationship of the visible scintillator light with the beam current or dose rate, aperture size and the thickness of water in the water-column was studied. The images captured on a CCD camera system were used to determine optimal dosimetry parameters for measuring the range of a clinical proton beam. The method was developed as a simple quality assurance tool to measure the range of the proton beam and compare it to (a) measurements using two segmented ionization chambers and water column between them, and (b) with an ionization chamber (IC-18) measurements in water. We used a block of plastic scintillator that measured 5 Multiplication-Sign 5 Multiplication-Sign 5 cm{sup 3} to record visible light generated by a 67.5 MeV proton beam. A high-definition digital video camera Moticam 2300 connected to a PC via USB 2.0 communication channel was used to record images of scintillation luminescence. The brightness of the visible light was measured while changing beam current and aperture size. The results were analyzed to obtain the range and were compared with the Bragg peak measurements with an ionization chamber. The luminescence light from the scintillator increased linearly with the increase of proton beam current. The light output also increased linearly with aperture size. The relationship between the proton range in the scintillator and the thickness of the water column showed good linearity with a precision of 0.33 mm (SD) in proton range measurement. For the 67.5 MeV proton beam utilized, the optimal parameters for scintillator light output response were found to be 15 nA (16 Gy/min) and an aperture size of 15 mm with image integration time of 100 ms. The Bragg peak depth brightness distribution was compared with the depth dose distribution from ionization chamber measurements

Measurement of blood flow from an assist ventricle by computation of pneumatic driving parameters.

Science.gov (United States)

Qian, K X

1992-03-01

The measurement of blood flow from an assist ventricle is important but sometimes difficult in artificial heart experiments. Along with the development of a pneumatic cylinder-piston driver coupled with a ventricular assist device, a simplified method for measuring pump flow was established. From driving parameters such as the piston (or cylinder) displacement and air pressure, the pump flow could be calculated by the use of the equation of state for an ideal gas. The results of this method are broadly in agreement with electromagnetic and Doppler measurements.

Calibration Procedure for Measuring S-Parameters in Balun Applications on 150-ohm High-Speed Cables

Science.gov (United States)

Theofylaktos, Onoufrios; Warner, Joseph D.

2012-01-01

In the radiofrequency (RF) world, in order to characterize cables that do not conform to the typical 50-omega impedance, a time domain reflectometer (TDR) would probably be the simplest and quickest tool to attain this goal. In the real world, not every engineer has a TDR at their disposal; however, they most likely have a network analyzer available. Given a generic 50-omega vector network analyzer (VNA), we would like to make S-parameter measurements for non-50-omega devices (DUTs). For that, we utilize RF balanced/unbalanced transformers (called baluns for short), which are primarily used to match the impedance between the two VNA ports and the DUT's input and output ports, for the two-port S-parameter measurements.

Measurement of reactor parameters of the 'Nora' reactor by noise analysis method - power spectral density

International Nuclear Information System (INIS)

Jovanovic, S.; Stormark, E.

1966-01-01

Measurements of reactor parameters the Nora reactor by Power Spectral Density (PSD) method are described. In case of critical reactor this method was applied for direct measurement of β/l ratio, β is the effective yield of delayed neutrons and l is the neutron lifetime. In case of subcritical reactor values of α+β-ρ/l were measured, ρ is the negative reactivity. Out coming PSD was measured by a filter or by ISAC. PSD was registered by ISAC as well as the auto-correlation function [sr

Fundamental course of measuring. II. The electrical measuring of non-electrical parameters. Grundkurs der Messtechnik. T. 2. Das elektrische Messen nichtelektrischer Groessen

Energy Technology Data Exchange (ETDEWEB)

Merz, L [Technische Univ. Muenchen (F.R. Germany). Lehrstuhl und Lab. fuer Steuerungs- und Regelungstechnik

1975-01-01

The fundamental course of the electrical measuring of non-electrical parameters aims to fulfill the task of presenting the present knowledge on the basic measuring methods in simple language and illustrative form. The present part II deals especially with measuring methods in heat and process engineering in the industrial field. Following the introduction in part A, the techniques of electrical probes are mainly described, and it is shown which mechanical probes cannot yet be replaced by electrical ones. Part C describes the techniques of measuring transducers.

Precision measurement of charged kaon decay parameters with an extended NA48 setup

CERN Multimedia

De beer, M; Celeghini, E; Bazylev, S; Falaleev, V; Peyaud, B; Bendel, M; Kekelidze, V; Potrebenikov, Y; Ceccucci, A; Behler, M; Madigozhin, D

2002-01-01

A high statistics study of charged kaon decays is proposed using a novel design for simultaneous $K^+/K^-$ beams, and NA48 setup upgraded with a transition radiation detector. The main goal is to measure CP-violating asymmetry in $K^{\\pm}\\rightarrow \\pi^+ \\pi^- \\pi^{\\pm}$ decays with an accuracy of $2.2 \\times 10^{-4}$. In addition CP-violating asymmetry will be measured in $K^{\\pm}\\rightarrow \\pi^0 \\pi^0 \\pi^{\\pm}$ decays, more than $10^6$ of $K_{e4}$ decays will be accumulated which allow to measure a scattering length parameter $a^0_0$ with an accuracy better than 0.01, and some other rare decays will be studied as well.

Quantitative photoacoustic integrating sphere (QPAIS platform for absorption coefficient and Grüneisen parameter measurements: Demonstration with human blood

Directory of Open Access Journals (Sweden)

Yolanda Villanueva-Palero

2017-06-01

Full Text Available Quantitative photoacoustic imaging in biomedicine relies on accurate measurements of relevant material properties of target absorbers. Here, we present a method for simultaneous measurements of the absorption coefficient and Grüneisen parameter of small volume of liquid scattering and absorbing media using a coupled-integrating sphere system which we refer to as quantitative photoacoustic integrating sphere (QPAIS platform. The derived equations do not require absolute magnitudes of optical energy and pressure values, only calibration of the setup using aqueous ink dilutions is necessary. As a demonstration, measurements with blood samples from various human donors are done at room and body temperatures using an incubator. Measured absorption coefficient values are consistent with known oxygen saturation dependence of blood absorption at 750 nm, whereas measured Grüneisen parameter values indicate variability among five different donors. An increasing Grüneisen parameter value with both hematocrit and temperature is observed. These observations are consistent with those reported in literature.

Analysis on the Initial Cracking Parameters of Cross-Measure Hydraulic Fracture in Underground Coal Mines

Directory of Open Access Journals (Sweden)

Yiyu Lu

2015-07-01

Full Text Available Initial cracking pressure and locations are important parameters in conducting cross-measure hydraulic fracturing to enhance coal seam permeability in underground coalmines, which are significantly influenced by in-situ stress and occurrence of coal seam. In this study, stress state around cross-measure fracturing boreholes was analyzed using in-situ stress coordinate transformation, then a mathematical model was developed to evaluate initial cracking parameters of borehole assuming the maximum tensile stress criterion. Subsequently, the influences of in-situ stress and occurrence of coal seams on initial cracking pressure and locations in underground coalmines were analyzed using the proposed model. Finally, the proposed model was verified with field test data. The results suggest that the initial cracking pressure increases with the depth cover and coal seam dip angle. However, it decreases with the increase in azimuth of major principle stress. The results also indicate that the initial cracking locations concentrated in the second and fourth quadrant in polar coordinate, and shifted direction to the strike of coal seam as coal seam dip angle and azimuth of maximum principle stress increase. Field investigation revealed consistent rule with the developed model that the initial cracking pressure increases with the coal seam dip angle. Therefore, the proposed mathematical model provides theoretical insight to analyze the initial cracking parameters during cross-measure hydraulic fracturing for underground coalmines.

Measurement of dosimetric parameters and dose verification in stereotactic radiosurgery (SRS)

International Nuclear Information System (INIS)

Reduan Abdullah; Nik Ruzman Nik Idris; Ahmad Lutfi Yusof; Mazurawati Mohamed

2013-01-01

Full-text: The purpose of this study was to measure the dosimetric parameters for small photon beams to be used as input data treatment planning computer system (TPS) and to verify dose calculated by TPS in Stereotactic Radiosurgery (SRS) procedure. The beam data required were Percentage Depth Dose (PDD), Off-axis Ratio (OAR), and Scatter Factor of Relative Output Factor. Small beams of 5 mm to 45 mm diameter circular cone collimators used in SRS were utilized for beam data measurements measured using pinpoint 3D ionization chamber (0.016 cc). For second part of this study, we reported the important quality assurance (QA) procedures before SRS treatment that influenced the dose delivery. These QA procedures consist of measurements on the accuracy in target localization and room laser alignment. The dose calculated to be delivered for treatment was verified using pinpoint 3D ionization chamber and TLD 100H. The mean deviation of measured dose using TLD 100H compared to calculated dose was 3.37 %. Beside that, pinpoint ionization 3D chamber give more accurate results of dose compared to TLD 100H. The measured dose using pinpoint 3D ionization chamber are good agreement with calculated dose by TPS with deviation of 2.17 %. The results are acceptable such as recommended by International Commission on Radiation Units and Measurements (ICRU) Report No. 50 (1993) that dose delivered to the target volume must be within ±5 % error. (author)

Identifyability measures to select the parameters to be estimated in a solid-state fermentation distributed parameter model.

Science.gov (United States)

da Silveira, Christian L; Mazutti, Marcio A; Salau, Nina P G

2016-07-08

Process modeling can lead to of advantages such as helping in process control, reducing process costs and product quality improvement. This work proposes a solid-state fermentation distributed parameter model composed by seven differential equations with seventeen parameters to represent the process. Also, parameters estimation with a parameters identifyability analysis (PIA) is performed to build an accurate model with optimum parameters. Statistical tests were made to verify the model accuracy with the estimated parameters considering different assumptions. The results have shown that the model assuming substrate inhibition better represents the process. It was also shown that eight from the seventeen original model parameters were nonidentifiable and better results were obtained with the removal of these parameters from the estimation procedure. Therefore, PIA can be useful to estimation procedure, since it may reduce the number of parameters that can be evaluated. Further, PIA improved the model results, showing to be an important procedure to be taken. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:905-917, 2016. © 2016 American Institute of Chemical Engineers.

Inversion of GPS-measured coseismic displacements for source parameters of Taiwan earthquake

Science.gov (United States)

Lin, J. T.; Chang, W. L.; Hung, H. K.; Yu, W. C.

2016-12-01

We performed a method of determining earthquake location, focal mechanism, and centroid moment tensor by coseismic surface displacements from daily and high-rate GPS measurements. Unlike commonly used dislocation model where fault geometry is calculated nonlinearly, our method makes a point source approach to evaluate these parameters in a solid and efficient way without a priori fault information and can thus provide constrains to subsequent finite source modeling of fault slip. In this study, we focus on the resolving ability of GPS data for moderate (Mw=6.0 7.0) earthquakes in Taiwan, and four earthquakes were investigated in detail: the March 27 2013 Nantou (Mw=6.0), the June 2 2013 Nantou (Mw=6.3) , the October 31 2013 Ruisui (Mw=6.3), and the March 31 2002 Hualien (ML=6.8) earthquakes. All these events were recorded by the Taiwan continuous GPS network with data sampling rates of 30-second and 1 Hz, where the Mw6.3 Ruisui earthquake was additionally recorded by another local GPS network with a sampling rate of 20 Hz. Our inverted focal mechanisms of all these earthquakes are consistent with the results of GCMT and USGS that evaluates source parameters by dynamic information from seismic waves. We also successfully resolved source parameters of the Mw6.3 Ruisui earthquake within only 10 seconds following the earthquake occurrence, demonstrating the potential of high-rate GPS data on earthquake early warning and real-time determination of earthquake source parameters.

ATM Quality of Service Parameters at 45 Mbps Using a Satellite Emulator: Laboratory Measurements

Science.gov (United States)

Ivancic, William D.; Bobinsky, Eric A.

1997-01-01

Results of 45-Mbps DS3 intermediate-frequency loopback measurements of asynchronous transfer mode (ATM) quality of service parameters (cell error ratio and cell loss ratio) are presented. These tests, which were conducted at the NASA Lewis Research Center in support of satellite-ATM interoperability research, represent initial efforts to quantify the minimum parameters for stringent ATM applications, such as MPEG-1 and MPEG-2 video transmission. Portions of these results were originally presented to the International Telecommunications Union's ITU-R Working Party 4B in February 1996 in support of their Draft Preliminary Recommendation on the Transmission of ATM Traffic via Satellite.

A gedankenexperiment for anomalous diffusion in a charge-fluctuating dusty plasma

International Nuclear Information System (INIS)

Kopp, Andreas; Shchekinov, Yuri A.

2014-01-01

Brownian motion with Gaussian-distributed step-sizes is the prototype of diffusive processes with the typical scaling of the mean-square displacement linear with time. There are, however, processes scaling slower or faster in time due to differently (e.g., power-law) distributed step-sizes, commonly referred to as sub- and superdiffusion, respectively. We address the question whether there is actually a physical reason for a discrimination between normal and anomalous diffusion or whether such processes can be regarded as a special case of normal diffusion with a complicated space- and time-dependent diffusion coefficient. In order to get to the bottom of this question, we construct a numerical gedankenexperiment, which is designed to be as simple as possible and consists of dust particles embedded as test particles into a homogeneous magnetic field that randomly changes their charge. The only parameter governing the system is the ratio of the time-scales for gyration and for recharging. By performing full-orbit simulations of such particles, we are for the first time able to (i) describe a system exhibiting sub-, normal, or superdiffusion as an asymptotic behavior, i.e., not merely as an intermediate state during the evolution of the system. We (ii) observe superdiffusion for low values of the controlling parameter, normal diffusion over a wide plateau of intermediate values, and subdiffusion for high values, i.e., we found (iii) a simple system with one single and illustrative parameter controlling whether the system exhibits super-, normal, or subdiffusion. The crucial point is (iv) a competition between ballistic (particles uncharged, extreme superdiffusion) and confined (charged, extreme subdiffusion) motions. Our system is homogeneous in space and time, so that its (v) behavior cannot be described by normal diffusion with a special diffusion coefficient, and the competition is (vi) fundamentally different from a Gaussian random walk and may be regarded as one

Generator Dynamic Model Validation and Parameter Calibration Using Phasor Measurements at the Point of Connection

Energy Technology Data Exchange (ETDEWEB)

Huang, Zhenyu; Du, Pengwei; Kosterev, Dmitry; Yang, Steve

2013-05-01

Disturbance data recorded by phasor measurement units (PMU) offers opportunities to improve the integrity of dynamic models. However, manually tuning parameters through play-back events demands significant efforts and engineering experiences. In this paper, a calibration method using the extended Kalman filter (EKF) technique is proposed. The formulation of EKF with parameter calibration is discussed. Case studies are presented to demonstrate its validity. The proposed calibration method is cost-effective, complementary to traditional equipment testing for improving dynamic model quality.

Parameters for HL-LHC aperture calculations and comparison with aperture measurements

CERN Document Server

Bruce, R; Fartoukh, S; Giovannozzi, M; Redaelli, S; Tomas, R; Wenninger, J

2014-01-01

When β∗ is squeezed to smaller values in the LHC, the beam size in the inner triplet increases so that the aperture risks to be exposed to unwanted beam losses. A 2D calculation model was used during the design stage to study the aperture margins, both there and at other potential bottlenecks. Based on assumptions on orbit and optics errors, as well as mechanical tolerances, it gives the available aperture in units of the RMS beam size, which can be compared with what can be protected by the collimation system. During the LHC Run I in 2010-2013, several of the error tolerances have been found smaller than the design assumptions. Furthermore, the aperture has been measured with beam several times and the results are compatible with a very well aligned machine, with results close to the design values. In this report, we therefore review the assumptions in the model and propose an updated set of input parameters to be used for aperture calculations at top energy in HL-LHC. The new parameter set is based on th...

Voyager microwave scintillation measurements of solar wind plasma parameters

International Nuclear Information System (INIS)

Martin, J.M.

1985-01-01

During the solar conjunctions of Voyager 1 and 2 spacecraft in August 1979, September 1980, and November 1982, temporal variations of intensity and frequency of the dual-wavelength (3.6 and 13 cm) radio transmissions from the spacecraft were observed and subsequently analyzed to infer characteristics of the solar wind plasma flow. Measurements of the temporal wave structure function were used to estimate the spectral index of the power law spatial spectrum of irregularities. Theoretical-intensity scintillation spectra were compared with measured intensity spectra to obtain least-squares estimates of (1) mean velocity, (2) random velocity, (3) axial ratio, and (4) electron density standard deviation. Uncertainties in parameter estimates were calculated by standard propagation of errors techniques. Mean velocity and electron density standard deviations in 1979-1980 show little dependence on solar latitude. Density standard deviation estimates were 3-10% of the background mean density and mean velocity estimates ranged from approx.200 km/s inside 17 solar radii to approx.300 km/s at 25 solar radii. 1982 density standard deviation estimates increased rapidly with latitude near 45 0 N, then sharply decreased north of that latitude, indicating the existence of a polar region of reduced fluctuations surrounded by a thin cone of strong density irregularities

Optimised polarimeter configurations for measuring the Stokes parameters of the Cosmic Microwave Background Radiation

OpenAIRE

Couchot, F.; Delabrouille, J.; Kaplan, J.; Revenu, B.

1998-01-01

We present configurations of polarimeters which measure the three linear Stokes parameters of the Cosmic Microwave Background Radiation with a nearly diagonal error matrix, independent of the global orientation of the polarimeters in the focal plane. These configurations also provide the smallest possible error box volume.

Effect of scintillometer height on structure parameter of the refractive index of air measurements

Science.gov (United States)

Scintillometers measure amount of scintillations by emitting a beam of light over a horizontal path and expresses as the atmospheric turbulence structure parameter as the refractive index of air (Cn**2). Cn**2 represents the turbulent strength of the atmosphere and describes the ability of the atmos...

Equivalent circuit parameters of nickel/metal hydride batteries from sparse impedance measurements

Science.gov (United States)

Nelatury, Sudarshan Rao; Singh, Pritpal

In a recent communication, a method for extracting the equivalent circuit parameters of a lead acid battery from sparse (only three) impedance spectroscopy observations at three different frequencies was proposed. It was based on an equivalent circuit consisting of a bulk resistance, a reaction resistance and a constant phase element (CPE). Such a circuit is a very appropriate model of a lead-acid cell at high state of charge (SOC). This paper is a sequel to it and presents an application of it in case of nickel/metal hydride (Ni/MH) batteries, which also at high SOC are represented by the same circuit configuration. But when the SOC of a Ni/MH battery under interrogation goes low, The EIS curve has a positive slope at the low frequency end and our technique yields complex values for the otherwise real circuit parameters, suggesting the need for additional elements in the equivalent circuit and a definite relationship between parameter consistency and SOC. To improvise the previous algorithm, in order that it works reasonably well at both high and low SOCs, we propose three more measurements—two at very low frequencies to include the Warburg response and one at a high frequency to model the series inductance, in addition to the three in the mid frequency band—totally six measurements. In most of the today's instrumentation, it is the user who should choose the circuit configuration and the number of frequencies where impedance should be measured and the accompanying software performs data fitting by complex nonlinear least squares. The proposed method has built into it an SOC-based decision-making capability—both to choose the circuit configuration and to estimate the values of the circuit elements.

Determination of the resonance parameters for 232Th from high resolution transmission and capture measurements at GELINA

International Nuclear Information System (INIS)

Brusegan, A.; Schillebeeckx, P.; Lobo, G.; Borella, A.; Volev, K.; Janeva, N.

2003-01-01

To deduce the resonance parameters for 232 Th in the resolved resonance region, high resolution transmission and capture measurements are being performed. The measurements are performed at the Time-Of-Flight facility GELINA. A comparison of experimental data resulting from capture (top) and transmission (bottom) are shown. The transmission measurements are performed at a 50 m flight path. The neutron are detected with a 0.25' thick lithium glass (NE912) placed in an Al sphere and viewed by a 5' EMI KQB photomultiplier orthogonal to the neutron beam axis. The injection of a stabilised light pulse in the detector during the measurements provided an efficient tool to control to better than 1% the gain of the entire electronics. The experimental set-up includes a sample-changer, placed at 23 m from the neutron source, which is driven by the acquisition system. The determination of the flight path length, was based on transmission of the 6.673 eV resonance of 238 U. We summarise, for the different energy regions of interest, the scheduled measurement conditions: the operation frequency of the accelerator and the target thickness. A simultaneous analysis of the data using REFIT will result in the resonance parameters from 0 to 4 keV. We show the result of a resonance shape analysis for the resonances at 21.8 and 23.5 eV. The resulting resonance parameters are important for the energy calibration and normalisation of the capture measurements in both the resolved and unresolved resonance region. The capture measurements are completed and were performed at a 60 m flight path. The sample consisted of a metallic natural thorium disc of 8 cm diameter and 1.0 mm thick, corresponding to a thickness of 3.176 10 -3 at/b. The neutron flux was measured with an ionisation chamber loaded with three back-to-back layers of about 40 μg/cm 2 10 B. The gamma rays, originating from the 232 Th(n,γ) reaction, were detected by four C 6 D 6 -based liquid scintillators (NE230) placed

Estimating parameters of a forest ecosystem C model with measurements of stocks and fluxes as joint constraints

Science.gov (United States)

Andrew D. Richardson; Mathew Williams; David Y. Hollinger; David J.P. Moore; D. Bryan Dail; Eric A. Davidson; Neal A. Scott; Robert S. Evans; Holly. Hughes

2010-01-01

We conducted an inverse modeling analysis, using a variety of data streams (tower-based eddy covariance measurements of net ecosystem exchange, NEE, of CO2, chamber-based measurements of soil respiration, and ancillary ecological measurements of leaf area index, litterfall, and woody biomass increment) to estimate parameters and initial carbon (C...

Optoelectronic transport properties in amorphous/crystalline silicon solar cell heterojunctions measured by frequency-domain photocarrier radiometry: Multi-parameter measurement reliability and precision studies

International Nuclear Information System (INIS)

Zhang, Y.; Melnikov, A.; Mandelis, A.; Halliop, B.; Kherani, N. P.; Zhu, R.

2015-01-01

A theoretical one-dimensional two-layer linear photocarrier radiometry (PCR) model including the presence of effective interface carrier traps was used to evaluate the transport parameters of p-type hydrogenated amorphous silicon (a-Si:H) and n-type crystalline silicon (c-Si) passivated by an intrinsic hydrogenated amorphous silicon (i-layer) nanolayer. Several crystalline Si heterojunction structures were examined to investigate the influence of the i-layer thickness and the doping concentration of the a-Si:H layer. The experimental data of a series of heterojunction structures with intrinsic thin layers were fitted to PCR theory to gain insight into the transport properties of these devices. The quantitative multi-parameter results were studied with regard to measurement reliability (uniqueness) and precision using two independent computational best-fit programs. The considerable influence on the transport properties of the entire structure of two key parameters that can limit the performance of amorphous thin film solar cells, namely, the doping concentration of the a-Si:H layer and the i-layer thickness was demonstrated. It was shown that PCR can be applied to the non-destructive characterization of a-Si:H/c-Si heterojunction solar cells yielding reliable measurements of the key parameters

Optoelectronic transport properties in amorphous/crystalline silicon solar cell heterojunctions measured by frequency-domain photocarrier radiometry: multi-parameter measurement reliability and precision studies.

Science.gov (United States)

Zhang, Y; Melnikov, A; Mandelis, A; Halliop, B; Kherani, N P; Zhu, R

2015-03-01

A theoretical one-dimensional two-layer linear photocarrier radiometry (PCR) model including the presence of effective interface carrier traps was used to evaluate the transport parameters of p-type hydrogenated amorphous silicon (a-Si:H) and n-type crystalline silicon (c-Si) passivated by an intrinsic hydrogenated amorphous silicon (i-layer) nanolayer. Several crystalline Si heterojunction structures were examined to investigate the influence of the i-layer thickness and the doping concentration of the a-Si:H layer. The experimental data of a series of heterojunction structures with intrinsic thin layers were fitted to PCR theory to gain insight into the transport properties of these devices. The quantitative multi-parameter results were studied with regard to measurement reliability (uniqueness) and precision using two independent computational best-fit programs. The considerable influence on the transport properties of the entire structure of two key parameters that can limit the performance of amorphous thin film solar cells, namely, the doping concentration of the a-Si:H layer and the i-layer thickness was demonstrated. It was shown that PCR can be applied to the non-destructive characterization of a-Si:H/c-Si heterojunction solar cells yielding reliable measurements of the key parameters.

Measurement techniques of local parameters in the downcomer boiling experiment of APR1400

International Nuclear Information System (INIS)

Lee, Eu Hwak

2004-02-01

In order to investigate boiling phenomena experimentally in the downcomer during LBLOCA with Direct Vessel Injection (DVI), which is a new Safety Injection System (SIS) of Advanced Power Reactor 1400 MW (APR1400), several parameters should be measured through the verification of their applicability. In this study, measurement techniques of the parameters are developed for the downcomer boiling experiment; local phase velocities, local void fraction and heat flux from the heated wall. The experiment has been performed with the heated wall, which has a thickness of 8.2 cm and a height of 32.5 cm and made of the same material as the prototype (APR1400) with chrome coating against rusting. The newly developed pitot tube is applied to the measurement of local liquid velocity and its calibration curve is obtained experimentally with the consideration of the effect according to water temperature and hole size changes. The developed pitot tube measures the local liquid velocity with 0.69 % deviation and it is confirmed that the water temperature and geometrical change does not affect the calibration curve. The high-speed camera and commercial software are used to measure the local vapor velocity with the accuracy of 0.06 m/sec per pixel and the procedure is confirmed in the present study. It turns out that the vapor velocity is insensitive to void size. High-speed camera and image processing are used to measure the local void fraction with the determined intensity criterion for distinguishing each phase and the results are compared with the bulk void fraction by differential pressure transmitters. In the actual experiment, the developed method is applied successfully and the results show that the criterion of intensity has little effect on local void fraction. And, it is observed that the tendency between the measured local and bulk void faction is maintained with time. In order to measure heat flux from the heated wall, two heat flux measurement techniques are developed

Measuring Dark Energy Properties with Photometrically Classified Pan-STARRS Supernovae. II. Cosmological Parameters

Science.gov (United States)

Jones, D. O.; Scolnic, D. M.; Riess, A. G.; Rest, A.; Kirshner, R. P.; Berger, E.; Kessler, R.; Pan, Y.-C.; Foley, R. J.; Chornock, R.; Ortega, C. A.; Challis, P. J.; Burgett, W. S.; Chambers, K. C.; Draper, P. W.; Flewelling, H.; Huber, M. E.; Kaiser, N.; Kudritzki, R.-P.; Metcalfe, N.; Tonry, J.; Wainscoat, R. J.; Waters, C.; Gall, E. E. E.; Kotak, R.; McCrum, M.; Smartt, S. J.; Smith, K. W.

2018-04-01

We use 1169 Pan-STARRS supernovae (SNe) and 195 low-z (z used to infer unbiased cosmological parameters by using a Bayesian methodology that marginalizes over core-collapse (CC) SN contamination. Our sample contains nearly twice as many SNe as the largest previous SN Ia compilation. Combining SNe with cosmic microwave background (CMB) constraints from Planck, we measure the dark energy equation-of-state parameter w to be ‑0.989 ± 0.057 (stat+sys). If w evolves with redshift as w(a) = w 0 + w a (1 ‑ a), we find w 0 = ‑0.912 ± 0.149 and w a = ‑0.513 ± 0.826. These results are consistent with cosmological parameters from the Joint Light-curve Analysis and the Pantheon sample. We try four different photometric classification priors for Pan-STARRS SNe and two alternate ways of modeling CC SN contamination, finding that no variant gives a w differing by more than 2% from the baseline measurement. The systematic uncertainty on w due to marginalizing over CC SN contamination, {σ }wCC}=0.012, is the third-smallest source of systematic uncertainty in this work. We find limited (1.6σ) evidence for evolution of the SN color-luminosity relation with redshift, a possible systematic that could constitute a significant uncertainty in future high-z analyses. Our data provide one of the best current constraints on w, demonstrating that samples with ∼5% CC SN contamination can give competitive cosmological constraints when the contaminating distribution is marginalized over in a Bayesian framework.

A study of calculation methodology and experimental measurements of the kinetic parameters for source driven subcritical systems

International Nuclear Information System (INIS)

Lee, Seung Min

2009-01-01

This work presents a theoretical study of reactor kinetics focusing on the methodology of calculation and the experimental measurements of the so-called kinetic parameters. A comparison between the methodology based on the Dulla's formalism and the classical method is made. The objective is to exhibit the dependence of the parameters on subcriticality level and perturbation. Two different slab type systems were considered: thermal one and fast one, both with homogeneous media. One group diffusion model was used for the fast reactor, and for the thermal system, two groups diffusion model, considering, in both case, only one precursor's family. The solutions were obtained using the expansion method. Also, descriptions of the main experimental methods of measurements of the kinetic parameters are presented in order to put a question about the compatibility of these methods in subcritical region. (author)

Measurements of Physical Parameters of White Dwarfs: A Test of the Mass–Radius Relation

Energy Technology Data Exchange (ETDEWEB)

Bédard, A.; Bergeron, P.; Fontaine, G., E-mail: bedard@astro.umontreal.ca, E-mail: bergeron@astro.umontreal.ca, E-mail: fontaine@astro.umontreal.ca [Département de Physique, Université de Montréal, C.P. 6128, Succ. Centre-Ville, Montréal, Québec H3C 3J7 (Canada)

2017-10-10

We present a detailed spectroscopic and photometric analysis of 219 DA and DB white dwarfs for which trigonometric parallax measurements are available. Our aim is to compare the physical parameters derived from the spectroscopic and photometric techniques, and then to test the theoretical mass–radius relation for white dwarfs using these results. The agreement between spectroscopic and photometric parameters is found to be excellent, especially for effective temperatures, showing that our model atmospheres and fitting procedures provide an accurate, internally consistent analysis. The values of surface gravity and solid angle obtained, respectively, from spectroscopy and photometry, are combined with parallax measurements in various ways to study the validity of the mass–radius relation from an empirical point of view. After a thorough examination of our results, we find that 73% and 92% of the white dwarfs are consistent within 1 σ and 2 σ confidence levels, respectively, with the predictions of the mass–radius relation, thus providing strong support to the theory of stellar degeneracy. Our analysis also allows us to identify 15 stars that are better interpreted in terms of unresolved double degenerate binaries. Atmospheric parameters for both components in these binary systems are obtained using a novel approach. We further identify a few white dwarfs that are possibly composed of an iron core rather than a carbon/oxygen core, since they are consistent with Fe-core evolutionary models.

Offline analysis in SNLS: measurement of type-Ia supernovae explosion rate and cosmological parameters

International Nuclear Information System (INIS)

Lusset, Vincent

2006-01-01

The Supernova Legacy Survey is a second generation experiment for the measurement of cosmological parameters using type-la supernovae. Il follows the discovery of the acceleration of the expansion of the Universe, attributed to an unknown 'dark energy'. This thesis presents a type-la supernovae search using an offline analysis of SNLS data. It makes it possible to detect the supernovae that were missed online and to study possible selection biases. One of its principal characteristics is that it uses entirely automatic selection criteria. This type of automated offline analysis had never been carried out before for data reaching this redshift. This analysis enabled us to discover 73 additional SNIa candidates compared to those identified in the real time analysis on the same data, representing an increase of more than 50% of the number of supernovae. The final Hubble diagram contains 262 SNIa which gives us, for a flat ACDM model, the following values for the cosmological parameters: Ω_M = 0,31 ± 0,028 (stat) ± 0,036 (syst) et Ω_A = 0,69. This offline analysis of SNLS data opens new horizons, both by checking for possible biases in current measurements of cosmological parameters by supernovae experiments and by preparing the third generation experiments, on the ground or in space, which will detect thousands of SNIa. (author) [fr

Towards quantitative measurements of relaxation times and other parameters in the brain

International Nuclear Information System (INIS)

Tofts, P.S.; Du Boulay, E.P.G.H.

1990-01-01

The nature and physical significance of the relaxation times T1 and T2 and of proton density are described. Methods of measuring T1 and T2 are discussed with emphasis on the establishment of precision and the maintenance of accuracy. Reported standards of success are briefly reviewed. We expect sensitivities of the order of 1% to be achievable in serial studies. Although early hopes of disease diagnosis by tissue characterisation were not realised, strict scientific method and careful calibration have made it pracitcable to apply relaxation time measurement to research into disease process. Serial measurements in patients and correlation with similar studies in animal models, biopsy results and autopsy material taken together have provided new knowledge about cerebral oedema, water compartmentation, alcoholism and the natural history of multiple sclerosis. There are prospects of using measurement to monitor treatment in other diseases with diffuse brain abnormalities invisible on the usual images. Secondarily derived parameters and notably the quantification of blood-brain barrier defect after injection of Gadolinium-DTPA also offer prospects of valuable data. (orig.)

Characterization of Thermal Parameters for Improving Pyranometer and Pyrgeometer Measurements

Science.gov (United States)

Tsay, Si-Chee; Jhabvala, Murzy D.; Ji, Qiang; Rapshun, David; Shu, Peter K.

2000-01-01

Since the introduction of thermopile, pyranometers (solar, e.g., 0.3-3.0 micrometers) and pyrgeometers (terrestrial, e.g., 4-50 micrometers) have become instruments commonly used for measuring the broadband hemispherical irradiances at the surface in a long-term, monitoring mode for decades. These commercially available radiometers have been manufactured in several countries such as from the United States, Asia, and Europe, and are generally reliable and economical. These worldwide distributions of surface measurements become even more important in the era of Earth remote sensing in studying climate change. However, recent studies from field campaigns have pointed out that erroneous factors (e.g., temperature gradients between the filter dome and detector, emissivity of the thermopile) are responsible for the unacceptable level of uncertainty (e.g., 20 W m(exp -2)). Using a newly developed instrument of Quantum Well Infrared Photodetector (QWTP), we have characterized the brightness temperature fields of pyranometers and pyrgeometers under various sky conditions. The QWIP is based on the superlattice (GaAs/AlGaAs) technology and has a noise equivalent temperature (NEAT) less than 0.1 K. The quality of pyranometer and pyrgeometer measure- ments can be improved largely by applying proper knowledge of the thermal parameters affecting the operation of the thermopile systems. Data correction procedure and algorithm will be presented and discussed.

Soil water content and evaporation determined by thermal parameters obtained from ground-based and remote measurements

Science.gov (United States)

Reginato, R. J.; Idso, S. B.; Jackson, R. D.; Vedder, J. F.; Blanchard, M. B.; Goettelman, R.

1976-01-01

Soil water contents from both smooth and rough bare soil were estimated from remotely sensed surface soil and air temperatures. An inverse relationship between two thermal parameters and gravimetric soil water content was found for Avondale loam when its water content was between air-dry and field capacity. These parameters, daily maximum minus minimum surface soil temperature and daily maximum soil minus air temperature, appear to describe the relationship reasonably well. These two parameters also describe relative soil water evaporation (actual/potential). Surface soil temperatures showed good agreement among three measurement techniques: in situ thermocouples, a ground-based infrared radiation thermometer, and the thermal infrared band of an airborne multispectral scanner.

A test-bench for measurement of electrical static parameters of strip silicon detectors

International Nuclear Information System (INIS)

Golutvin, I.A.; Dmitriev, A.Yu.; Elsha, V.V.

2003-01-01

An automated test-bench for electrical parameters input control of the strip silicon detectors, used in the End-Cap Preshower detector of the CMS experiment, is described. The test-bench application allows one to solve a problem of silicon detectors input control in conditions of mass production - 1800 detectors over 2 years. The test-bench software is realized in Delphi environment and contains a user-friendly operator interface for data processing and visualization as well as up-to-date facilities for MS-Windows used for the network database. High operating characteristics and reliability of the test-bench were confirmed while more than 800 detectors were tested. Some technical solutions applied to the test-bench could be useful for design and construction of automated facilities for electrical parameters measurements of the microstrip detectors input control. (author)

Determination of K shell absorption jump factors and jump ratios of 3d transition metals by measuring K shell fluorescence parameters

International Nuclear Information System (INIS)

Kaçal, Mustafa Recep; Han, İbrahim; Akman, Ferdi

2015-01-01

Energy dispersive X-ray fluorescence technique (EDXRF) has been employed for measuring K-shell absorption jump factors and jump ratios for Ti, Cr, Fe, Co, Ni and Cu elements. The jump factors and jump ratios for these elements were determined by measuring K shell fluorescence parameters such as the Kα X-ray production cross-sections, K shell fluorescence yields, Kβ-to-Kα X-rays intensity ratios, total atomic absorption cross sections and mass attenuation coefficients. The measurements were performed using a Cd-109 radioactive point source and an Si(Li) detector in direct excitation and transmission experimental geometry. The measured values for jump factors and jump ratios were compared with theoretically calculated and the ones available in the literature. - Highlights: • This work regard the K shell absorption jump ratios and jump factors of Ti, Cr, Fe, Co, Ni and Cu. • This paper presents the first measurement of these parameters using the experimental K shell fluorescence parameters. • A good agreement was found between experimental and theoretical values. • The EDXRF technique was suitable, precise and reliable for the measurement of these atomic parameters

Online measurement for geometrical parameters of wheel set based on structure light and CUDA parallel processing

Science.gov (United States)

Wu, Kaihua; Shao, Zhencheng; Chen, Nian; Wang, Wenjie

2018-01-01

The wearing degree of the wheel set tread is one of the main factors that influence the safety and stability of running train. Geometrical parameters mainly include flange thickness and flange height. Line structure laser light was projected on the wheel tread surface. The geometrical parameters can be deduced from the profile image. An online image acquisition system was designed based on asynchronous reset of CCD and CUDA parallel processing unit. The image acquisition was fulfilled by hardware interrupt mode. A high efficiency parallel segmentation algorithm based on CUDA was proposed. The algorithm firstly divides the image into smaller squares, and extracts the squares of the target by fusion of k_means and STING clustering image segmentation algorithm. Segmentation time is less than 0.97ms. A considerable acceleration ratio compared with the CPU serial calculation was obtained, which greatly improved the real-time image processing capacity. When wheel set was running in a limited speed, the system placed alone railway line can measure the geometrical parameters automatically. The maximum measuring speed is 120km/h.

A measurement-driven approach to assess power line telecommunication (PLT) network quality of service (QoS) performance parameters

International Nuclear Information System (INIS)

Betta, G; Capriglione, D; Ferrigno, L; Laracca, M

2009-01-01

Power line telecommunication (PLT) technology offers cheap and fast ways for providing in-home broadband services and local area networking. Its main advantage is due to the possibility of using the pre-existing electrical grid as a communication channel. Nevertheless, technical challenges arise from the difficulty of operating on a hostile medium, not designed for communication purposes, characterized by complex channel modeling and by varying time response. These aspects put practical problems for designers and testers in the assessment of network quality of service performance parameters such as the throughput, the latency, the jitter, and the reliability. The measurement of these parameters has not yet been standardized so that there do not exist reference test set-ups and measurement methodologies (i.e. the type of isolation from the ac main, the observation time and the number of experiments, the measurement uncertainty and so on). Consequently, experiments executed by adopting different methods may lead to incompatible measurement results, thus making it also impossible to have reliable comparisons of different PLT modems. Really, the development of standard procedures is a very difficult task because the scenarios in which the PLT modems can work are very wide and then the application of an exhaustive approach (in which all the parameters influencing the PLT performance should be considered) would be very complex and time consuming, thus making the modem characterization very expensive. In this paper, the authors propose a methodological approach to develop an efficient measurement procedure able to reliably assess the performance of PLT modems (in terms of network quality of service parameters) with a minimum number of experiments. It is based on both creating a reconfigurable grid to which real disturbing loads are connected and implementing an original design of the experiment technique based on the effects of the uncertainty of the measurement results

Inverse correlation between reactive oxygen species in unwashed semen and sperm motion parameters as measured by a computer-assisted semen analyzer.

Science.gov (United States)

Takeshima, Teppei; Yumura, Yasushi; Yasuda, Kengo; Sanjo, Hiroyuki; Kuroda, Shinnosuke; Yamanaka, Hiroyuki; Iwasaki, Akira

2017-01-01

This study investigated the correlation between sperm motion parameters obtained by a computer-assisted semen analyzer and levels of reactive oxygen species in unwashed semen. In total, 847 patients, except for azoospermic patients were investigated. At the time of each patient's first consultation, semen parameters were measured using SMAS™ or CellSoft 3000™, and production of reactive oxygen species was measured using a computer-driven LKB Wallac Luminometer 1251 Analyzer. The patients were divided into two groups: reactive oxygen species - positive and negative. The semen parameters within each group were measured using one of the two computer-assisted semen analyzer systems and then compared. Correlations between reactive oxygen species levels and sperm motion parameters in semen from the reactive oxygen species - positive group were also investigated. Reactive oxygen species were detected in semen samples of 282 cases (33.3%). Sperm concentration (P semen damage sperm concentration, motility, and other sperm motion parameters.

Simultaneous state-parameter estimation supports the evaluation of data assimilation performance and measurement design for soil-water-atmosphere-plant system

Science.gov (United States)

Hu, Shun; Shi, Liangsheng; Zha, Yuanyuan; Williams, Mathew; Lin, Lin

2017-12-01

Improvements to agricultural water and crop managements require detailed information on crop and soil states, and their evolution. Data assimilation provides an attractive way of obtaining these information by integrating measurements with model in a sequential manner. However, data assimilation for soil-water-atmosphere-plant (SWAP) system is still lack of comprehensive exploration due to a large number of variables and parameters in the system. In this study, simultaneous state-parameter estimation using ensemble Kalman filter (EnKF) was employed to evaluate the data assimilation performance and provide advice on measurement design for SWAP system. The results demonstrated that a proper selection of state vector is critical to effective data assimilation. Especially, updating the development stage was able to avoid the negative effect of ;phenological shift;, which was caused by the contrasted phenological stage in different ensemble members. Simultaneous state-parameter estimation (SSPE) assimilation strategy outperformed updating-state-only (USO) assimilation strategy because of its ability to alleviate the inconsistency between model variables and parameters. However, the performance of SSPE assimilation strategy could deteriorate with an increasing number of uncertain parameters as a result of soil stratification and limited knowledge on crop parameters. In addition to the most easily available surface soil moisture (SSM) and leaf area index (LAI) measurements, deep soil moisture, grain yield or other auxiliary data were required to provide sufficient constraints on parameter estimation and to assure the data assimilation performance. This study provides an insight into the response of soil moisture and grain yield to data assimilation in SWAP system and is helpful for soil moisture movement and crop growth modeling and measurement design in practice.

Measurement of traffic parameters in image sequence using spatio-temporal information

International Nuclear Information System (INIS)

Lee, Daeho; Park, Youngtae

2008-01-01

This paper proposes a novel method for measurement of traffic parameters, such as the number of passed vehicles, velocity and occupancy rate, by video image analysis. The method is based on a region classification followed by spatio-temporal image analysis. Local detection region images in traffic lanes are classified into one of four categories: the road, the vehicle, the reflection and the shadow, by using statistical and structural features. Misclassification at a frame is corrected by using temporally correlated features of vehicles in the spatio-temporal image. This capability of error correction results in the accurate estimation of traffic parameters even in high traffic congestion. Also headlight detection is employed for nighttime operation. Experimental results show that the accuracy is more than 94% in our test database of diverse operating conditions such as daytime, shadowy daytime, highway, urban way, rural way, rainy day, snowy day, dusk and nighttime. The average processing time is 30 ms per frame when four traffic lanes are processed, and real-time operation could be realized while ensuring robust detection performance even for high-speed vehicles up to 150 km h −1

Calculation of kinetic parameters of Caliban metallic core experimental reactor from stochastic neutron measurements

Energy Technology Data Exchange (ETDEWEB)

Casoli, P.; Authier, N.; Baud, J. [Commissariat a l' energie Atomique, Centre de Valduc, 21120 Is-sur-Tille (France)

2009-07-01

Several experimental devices are operated by the Criticality and Neutron Science Research Department of the CEA Valduc Laboratory. One of these is the metallic core reactor Caliban. The knowledge of the fundamental kinetic parameters of the reactor is very useful, indeed necessary, to the operator. The purpose of this study was to develop and perform experiments allowing to determinate some of these parameters. The prompt neutron decay constant and particularly its value at criticality can be measured with reactor noise techniques such as the interval-distribution, the Feynman variance-to-mean, and the Rossi-{alpha} methods. By introducing the Nelson number, the effective delayed neutron fraction and the average neutron lifetime can also be calculated with the Rossi-{alpha} method. Subcritical, critical, and even supercritical experiments were performed. With the Rossi-{alpha} technique, it was found that the prompt neutron decay constant at criticality was (6.02*10{sup 5} {+-} 9%). Experiments also brought out the limitations of the used experimental parameters. (authors)

Beta Beams for Precision Measurements of Neutrino Oscillation Parameters

CERN Document Server

Wildner, E; Hansen, C; De Melo Mendonca, T; Stora, T; Damjanovic, S; Payet, J; Chancé, A; Zorin, V; Izotov, I; Rasin, S; Sidorov, A; Skalyga, V; De Angelis, G; Prete, G; Cinausero, M; Kravchuk, V; Gramegna, F; Marchi, T; Collazuol, G; Mezzetto, M; Delbar, T; Loiselet, M; Keutgen, T; Mitrofanov, S; Burt, G; Dexter, A; Lamy, T; Latrasse, L; Marie-Jeanne, M; Sortais, P; Thuillier, T; Debray, F; Trophime, C; Hass, M; Hirsh, T; Berkovits, D; Stahl, A; Vardaci, E; Di Nitto, A; Brondi, A; La Rana, G; Moro, R; De Rosa, G; Palladino, V

2012-01-01

Neutrino oscillations have implications for the Standard Model of particle physics. The CERN Beta Beam has outstanding capabilities to contribute to precision measurements of the parameters governing neutrino oscillations. The FP7 collaboration EUROnu (2008-2012) is a design study that will review three facilities (Super-Beams, Beta Beams and Neutrino Factories) and perform a cost assessment that, coupled with the physics performance, will give means to the European research authorities to make decisions on future European neutrino oscillation facilities. ”Beta Beams” produce collimated pure electron (anti)neutrinos by accelerating beta active ions to high energies and having them decay in a storage ring. Using existing machines and infrastructure is an advantage for the cost evaluation; however, this choice is also constraining the Beta Beams. Recent work to make the Beta Beam facility a solid option will be described: production of Beta Beam isotopes, the 60 GHz pulsed ECR source development, integratio...

Selected environmental considerations and their measuring parameters for nuclear power plant siting

International Nuclear Information System (INIS)

Norris, J.A.

1975-01-01

The site selection process for nuclear power stations encompasses a broad range of considerations. A categorization of these considerations consistent with the needs of the U. S. Atomic Energy Commission, as the regulatory agency, and of the utility company involves these major areas of concern. They are issues related to safety, environmental impact, and engineering/economics. The more important environmental considerations and their measuring parameters presented in this paper include biota, ecological systems and water quality, land use, aesthetics, water availability, and meteorology. (U.S.)

Current and capacitance measurements as a fast diagnostic tool for evaluation of semiconductor parameters

CERN Document Server

Kemmer, J; Krause, N; Krieglmeyer, C; Yang Yi

2000-01-01

A fast qualitative method is described for evaluation of semiconductor parameters by analyzing both the capacitance/voltage (C/V) and current/voltage (I/V) characteristics of pn- or Schottky-diodes, which are fabricated on the material under investigation. The method is applied for measurement of recombination and generation lifetimes of minority charge carriers and for determination of doping profiles and distribution of active generation/recombination (G/R) centers after irradiation with Am-alpha particles and deep phosphorus implantation. Measurements on epitaxial silicon result in doping profiles and distributions of active impurities within the epi-layer.

The internal strain parameter of gallium arsenide measured by energy-dispersive X-ray diffraction

International Nuclear Information System (INIS)

Cousins, C.S.G.; Sheldon, B.J.; Webster, G.E.; Gerward, L.; Selsmark, B.; Staun Olsen, J.

1989-01-01

The internal strain parameter of GaAs has been measured by observing the stress-dependence of the integrated intensity of the weak 006 reflection, with the compressive stress along the [1anti 10] axis. An energy-dispersive technique was employed so that the reflection could be obtained at a photon energy close to the minimum in the structure factor, thereby approaching closely the strictly-forbidden condition that applies at any energy in the diamond structure. A value anti A=-0.138±0.005, equivalent to a bond-bending parameter ζ=0.55=0.02, has been found. This is in good agreement with recent theoretical calculations and indirect determinations related to the bandstructure of GaAs. (orig.)

Measurement of the asymmetry parameter in the hyperon radiative decay Σ+→pγ

International Nuclear Information System (INIS)

Foucher, M.; Albuquerque, I.F.; Bondar, N.F.; Carrigan, R. Jr.; Chen, D.; Li Chengze; Cooper, P.S.; Denisov, A.S.; Dobrovolsky, A.V.; Dubbs, T.; Endler, A.M.F.; Escobar, C.O.; Tang Fukun; Golovtsov, V.L.; Goritchev, P.A.; Gottschalk, H.; Gouffon, P.; Grachev, V.T.; Shi Huanzhang; Yan Jie; Khanzadeev, A.V.; Kubantsev, M.A.; Kuropatkin, N.P.; Lach, J.; Luksys, M.; Lebedenko, V.N.; Dai Lisheng; Mahon, J.R.P.; McCliment, E.; Morelos, A.; Newsom, C.; Lang Pengfei; Pommot Maia, M.C.; Samsonov, V.M.; Zheng Shuchen; Smith, V.J.; Terentyev, N.K.; Timm, S.; Tkatch, I.I.; Uvarov, L.N.; Vorobyov, A.A.; Zhao Wenheng; Zhong Yuanyuan; Li Yunshan

1992-01-01

We have measured the asymmetry parameter (α γ ) in the hyperon radiative decay Σ + →pγ with a sample of 34 754±212 events obtained in a polarized charged hyperon beam experiment at Fermilab. We find α γ =-0.720±0.086±0.045, where the quoted errors are statistical and systematic, respectively

Parameter Estimation of Inverter and Motor Model at Standstill using Measured Currents Only

DEFF Research Database (Denmark)

Rasmussen, Henrik; Knudsen, Morten; Tønnes, M.

1996-01-01

Methods for estimation of the parameters in the electrical equivalent diagram for the induction motor, based on special designed experiments, are given. In all experriments two of the three phases are given the same potential, i.e., no net torque is generatedand the motor is at standstill. Input...... and 3) the referred rotor rotor resistance and magnetizing inductance. The method developed in the two last experiments is independent of the inverter nonlinearity. New methods for system identification concerning saturation of the magnetic flux are given and a reference value for the flux level...... to the system is the reference values for the stator voltages given as duty cycles for the Pulse With Modulated power device. The system output is the measured stator currents. Three experiments are describedgiving respectively 1) the stator resistance and inverter parameters, 2) the stator transient inductance...

Measurements of Direct CP Violation, CPT Symmetry, and Other Parameters in the Neutral Kaon System

Energy Technology Data Exchange (ETDEWEB)

Worcester, Elizabeth Turner [Univ. of Chicago, IL (United States)

2007-12-01

The authors present precision measurements of the direct CP violation parameter, Re(ϵ'/ϵ), the kaon parameters, Δm and τ_S, and the CPT tests, Φ_± and ΔΦ, in neutral kaon decays. These results are based on the full dataset collected by the KTeV experiment at Fermi National Accelerator Laboratory during 1996, 1997, and 1999. This dataset contains ~ 15 million K → π⁰π⁰ decays and ~ 69 million K → π⁺π^- decays. They describe significant improvements to the precision of these measurements relative to previous KTeV analyses. They find Re(ϵ'/ϵ = [19.2 ± 1.1(stat) ± 1.8(syst)] x 10^-4, Δm = (5265 ± 10) x 10⁶ hs^-1, and τ_S = (89.62 ± 0.05) x 10^-12 s. They measure Φ_± = (44.09 ± 1.00)° and ΔΦ = (0.29 ± 0.31)°; these results are consistent with CPT symmetry.

Measurement of hydrogeologic parameters of Indian volcanic rocks by sub-surface hydronuclear techniques

International Nuclear Information System (INIS)

Bardhan, M.

1977-01-01

Sub-surface hydronuclear techniques namely neutron-neutron, gamma-gamma and tracer dilution logging and single and double well tracer methods were adopted to investigate the hitherto inadequately studied hydrophysical properties of the Deccan lava flows which constitute the principal Indian volcanic suit of rocks. The hydrogeologic parameters measured in the field pertain to hydrostratigraphy, hydrostorage properties and geohydraulic characteristics of these layered hard formations. Results of the studies are presented and discussed briefly. (author)

THE MEASUREMENT OF SELECTED SOIL PARAMETERS OF FORMER OPEN PIT MINE WITH THE USE OF TRIAXIAL STRESS APPARATUS

Directory of Open Access Journals (Sweden)

Janusz P. KOGUT

Full Text Available Identification of geotechnical soil conditions often requires execution of laboratory tests, especially if you want to measure dynamic parameters of the soil. At present, the triaxial shear apparatus is widely applied in determination of the parameters of the soil. On the basis of the soil samples analysis, the examination results provide a wide range of data from basic performance parameters, e.g. internal friction angle and cohesion, to most complex ones like Young’s modulus permanent side effective stress of water samples. Furthermore, the Soil Structure Interaction Laboratory of Cracow University of Technology, has carried out the measurements of propagation of shear waves velocity with the use of bender elements tests. This work presents geotechnical conditions and the analysis of the results, which might be found useful to determine the transportation load parameters of designed S-7 and S-52 routes, as well as overall impact on soil/structure and surrounding areas located over the former clay open-pit mine. The landslides existing in the vicinity of the mine have prompted the authors to take that action.

Measuring neutrino oscillation parameters using νμ disappearance in MINOS

International Nuclear Information System (INIS)

Backhouse, Christopher James

2011-01-01

MINOS is a long-baseline neutrino oscillation experiment. It consists of two large steel-scintillator tracking calorimeters. The near detector is situated at Fermilab, close to the production point of the NuMI muon-neutrino beam. The far detector is 735 km away, 716m underground in the Soudan mine, Northern Minnesota. The primary purpose of the MINOS experiment is to make precise measurements of the 'atmospheric' neutrino oscillation parameters (Δm atm 2 and sin 2 2θ atm ). The oscillation signal consists of an energy-dependent deficit of ν μ interactions in the far detector. The near detector is used to characterize the properties of the beam before oscillations develop. The two-detector design allows many potential sources of systematic error in the far detector to be mitigated by the near detector observations. This thesis describes the details of the ν μ -disappearance analysis, and presents a new technique to estimate the hadronic energy of neutrino interactions. This estimator achieves a significant improvement in the energy resolution of the neutrino spectrum, and in the sensitivity of the neutrino oscillation fit. The systematic uncertainty on the hadronic energy scale was re-evaluated and found to be comparable to that of the energy estimator previously in use. The best-fit oscillation parameters of the ν μ -disappearance analysis, incorporating this new estimator were: Δm 2 = 2.32 -0.08 +0.12 x 10 -3 eV 2 , sin 2 2θ > 0.90 (90% C.L.). A similar analysis, using data from a period of running where the NuMI beam was operated in a configuration producing a predominantly (bar ν) μ beam, yielded somewhat different best-fit parameters Δ(bar m) 2 = (3.36 -0.40 +0.46 (stat.) ± 0.06(syst.)) x 10 -3 eV 2 , sin 2 2(bar θ) = 0.86 -0.12 0 .11 (stat.) ± 0.01(syst.). The tension between these results is intriguing, and additional antineutrino data is currently being taken in order to further investigate this apparent discrepancy.

Measurement of the $\\beta$-asymmetry parameter in $^{35}$Ar decay with a laser polarized beam

CERN Multimedia

With this proposal we request beam time for the first two phases of a project that aims at measuring the $\\beta$-asymmetry parameter of the mirror $\\beta$-decay branch in $^{35}$Ar using an optically polarized Ar atom beam. The final goal of the experiment is to measure this parameter to a precision of 0.5%. This will allow the most precise determination of the V$_{ud}$ quark mixing matrix element from all the mirror transitions with an absolute uncertainty of 0.0007. The proposal will be presented in phases and we ask here 11 shifts (7 on-line + 4 off-line) for phase 1 and 15 shifts (6 on-line and 9 off-line) for phase 2. Phase 1 aims at establishing the optimal laser polarization scheme as well as the best implantation host for maintaining the polarization. Phase 2 aims at enhancing the beam polarization by removing the unpolarized part of the beam using re-ionization.

Moderating ratio parameter evaluation for different materials by means of Monte Carlo calculations and reactivity direct measurements

International Nuclear Information System (INIS)

Borio, A.; Cagnazzo, M.; Marchetti, F.; Pappalardo, P.; Salvini, A.

2004-01-01

The aim of this work is to determine moderating properties of different materials (water, graphite, perfluoropolyethers), in particular the slowing down power (SDP) and the moderating ratio (MR), defined as SDP =ξΣ S and MR=ξΣ S /Σ A , where Σ S and Σ A represent the macroscopic scattering and absorption cross section, respectively, and ξ is the average logarithmic energy loss per collision. Slowing-down power indicates how rapidly a neutron will slow down in the material, but it does not fully explain the effectiveness of the material as a moderator. In fact, a material can slow down neutrons with high efficiency because of its big Σ S , but it can be a poor moderator because with high probability it also absorbs neutrons. Thus, the most complete measure of the effectiveness of a moderator is the moderating ratio parameter which takes into account also the absorption effects: the bigger is the moderating ratio values, the more effectively the material performs as a moderator. The first part of the work consisted in the comparison between the SDP and MR parameter evaluated for different materials by means of Monte Carlo simulations and by means of calculations based on their definition formula (they are developed from knowledge of material composition and of microscopic cross section σ i (derived from literature)). It was found that this comparison showed a good agreement with errors less than 10 %. Thus the Monte Carlo code seems to be a good support for the calculation of the moderating parameters, particularly useful when the materials are compounds of many elements. The second part of the work was dedicated to correlate the materials' MR values with the measured variation of reactivity induced by the insertion of the materials in the core of TRIGA Mark II reactor of the University of Pavia. This is possible by definition of a new parameter for the measure. This parameter, named S, depends on the total weight of the sample inserted in the reactor core

Objective image quality parameters of relevance in practice, measured for film-screen combinations - a contribution to quality assurance activities

International Nuclear Information System (INIS)

Angerstein, W.; Wolf, M.

1986-01-01

Objective measurement of the physico-technical parameters determining the image quality is the fastest and most accurate method of quality testing of the systems. The parameters in case of X-ray intensifying screens are imaging quality, servicable life, and mechanical properties. (orig./DG) [de

The influence of fog parameters on aerosol depletion measured in the KAEVER experiments

International Nuclear Information System (INIS)

Poss, G.; Weber, D.; Fritsche, B.

1995-01-01

The release of radioactive aerosols in the environment is one of the most serious hazards in case of an accident in nuclear power plant. Many efforts have been made in the past in numerous experimental programs like NSPP, DEMONA, VANAM, LACE, MARVIKEN, others are still underway to improve the knowledge of the aerosol behavior and depletion in a reactor containment in order to estimate the possible source term and to validate computer codes. In the German single compartment KAEVER facility the influence of size distribution, morphology, composition and solubility on the aerosol behavior is investigated. One of the more specific items is to learn about open-quotes wet depletionclose quotes means, the aerosol depletion behavior in condensing atmospheres. There are no experiments known where the fog parameters like droplet size distribution, volume concentration, respectively airborne liquid water content have been measured in- and on-line explicitly. To the authors knowledge the use of the Battelle FASP photometer, which was developed especially for this reason, for the first time gives insight in condensation behavior under accident typical thermal hydraulic conditions. It delivers a basis for code validation in terms of a real comparison of measurements and calculations. The paper presents results from open-quotes wet depletionclose quotes aerosol experiments demonstrating how depletion velocity depends on the fog parameters and where obviously critical fog parameter seem to change the regime from a open-quotes pseudo dry depletionclose quotes at a relative humidity of 100% but quasi no or very low airborne liquid water content to a real open-quotes wet depletionclose quotes under the presence of fogs with varying densities. Characteristics are outlined how soluble and insoluble particles as well as aerosol mixtures behave under condensing conditions

Identification of Capacitive MEMS Accelerometer Structure Parameters for Human Body Dynamics Measurements

Directory of Open Access Journals (Sweden)

Vincas Benevicius

2013-08-01

Full Text Available Due to their small size, low weight, low cost and low energy consumption, MEMS accelerometers have achieved great commercial success in recent decades. The aim of this research work is to identify a MEMS accelerometer structure for human body dynamics measurements. Photogrammetry was used in order to measure possible maximum accelerations of human body parts and the bandwidth of the digital acceleration signal. As the primary structure the capacitive accelerometer configuration is chosen in such a way that sensing part measures on all three axes as it is 3D accelerometer and sensitivity on each axis is equal. Hill climbing optimization was used to find the structure parameters. Proof-mass displacements were simulated for all the acceleration range that was given by the optimization problem constraints. The final model was constructed in Comsol Multiphysics. Eigenfrequencies were calculated and model’s response was found, when vibration stand displacement data was fed into the model as the base excitation law. Model output comparison with experimental data was conducted for all excitation frequencies used during the experiments.

Synchronization of binocular motion parameters optoelectronic measurement system

Science.gov (United States)

Zhang, Lingfei; Ye, Dong; Che, Rensheng; Chen, Gang

2008-10-01

The synchronization between high-speed digital cameras and computers is very important for the binocular vision system based on light-weighted passive IR reflective markers and IR LED array PCB board, which is often used to measure the 3-D motion parameters of a rocket motor. In order to solve this problem, a comparison on the existing approaches to camera synchronization in the published literature was conducted. The advantages and disadvantages of the currently used methods were illustrated and their suitable applications were discussed. A new method, which uses self-made hardware resetting camera and software triggering image acquisition board, is provided. The self-made hardware is used to send TTL signal to two image acquisition boards one time per second. The TTL signal is used to reset two cameras and two image acquisition boards as PRIN signal, and then two image acquisition boards send same EXSYNC signal to two cameras. In this way, two cameras can be synchronized to exposure and capture images in the mean time. The test results indicated that the new approach designed in this paper can meet the demand of image acquisition at a speed of 200f/s, whose synchronization accuracy is up to micro second.

Measurement of local two-phase flow parameters of nanofluids using conductivity double-sensor probe.

Science.gov (United States)

Park, Yu Sun; Chang, Soon Heung

2011-04-04

A two-phase flow experiment using air and water-based γ-Al2O3 nanofluid was conducted to observe the basic hydraulic phenomenon of nanofluids. The local two-phase flow parameters were measured with a conductivity double-sensor two-phase void meter. The void fraction, interfacial velocity, interfacial area concentration, and mean bubble diameter were evaluated, and all of those results using the nanofluid were compared with the corresponding results for pure water. The void fraction distribution was flattened in the nanofluid case more than it was in the pure water case. The higher interfacial area concentration resulted in a smaller mean bubble diameter in the case of the nanofluid. This was the first attempt to measure the local two-phase flow parameters of nanofluids using a conductivity double-sensor two-phase void meter. Throughout this experimental study, the differences in the internal two-phase flow structure of the nanofluid were identified. In addition, the heat transfer enhancement of the nanofluid can be resulted from the increase of the interfacial area concentration which means the available area of the heat and mass transfer.

Measurement of dose-determining physical parameters (F-factor, fp factor,...) for comparative analysis of outdoor/indoor radon exposure

International Nuclear Information System (INIS)

Anon

1998-01-01

The purpose of the project was to measure the airborne natural radon activity concentrations outdoor and the dose-determining parameters [non-deposited fraction (f p ), radon daughter products (F, PAEC), as well as the radioactive aerosol size distribution]. The impacts of meteorological parameters (pressure, rainfalls, wind velocities and temperature) on the those parameters and the exhalation of radon from the soil were to be determined. The acquired information was to be applied for an evaluation of the radiological outdoor situation and subsequent comparative analysis with the indoor radon exposure. (orig./CB) [de

Information-Measuring System to Control the Electrical and Mechanical Motor Parameters

Directory of Open Access Journals (Sweden)

K. S. Ermakov

2015-01-01

Full Text Available The article considers the issue of creating an information-measuring system for an asynchronous motor. The presented system allows ensuring the failure-free protection of electromotor, considerably reducing costs of its unplanned repair, and reduced economical loss from idle time of the electric motor.The developed system comprises a mathematical model and two subsystems to measure electrical and mechanical parameters of the asynchronous motor.The electrical subsystem comprises a FLUKE company recording multi-meter a signal from which passes through the block of intervals and coding and comes to PC.The mechanical subsystem uses technical tools of phase-chronometric method. This method developed at the department of Metrology and Interchangeability allows an increasing efficiency of developed informative-measuring system. Mathematical modeling is used to link information from subsystems (electrical and mechanical to electromotor construction.The work conducted mathematical modeling of some defects of electric motor, namely: rupture of rotor winding and line surge.The mathematical model in Mathcad was based on a modified formula of Kloss. It allows us to tie the average current value of the torque of the induction motor with shaft speed and take into account the effect of the frequency and voltage.The Matlab Simulink (the package for visual programming environment was used to simulate a rupture of the rotor winding. Simulation results showed how the phase currents of the electric motor changed with the winding rupture.The developed information-measuring system has a number of advantages over traditional systems used in this field (vibration-based diagnostics systems. It will allow an increasing efficiency of the system for diagnostics of electrical machines created on the basis of this information-measuring system.

Parameters of measuring of european political consciousness

Directory of Open Access Journals (Sweden)

M. M. Pikula

2015-09-01

Full Text Available In the article the author analyzes the parameters of European political consciousness, i.e. European research field of political consciousness in qualitative and quantitative terms, which may be based on different indicators. The issue of emergence and development of European political consciousness becomes topical because firstly, its formation as the subjective dimension of European integration policy is not a spontaneous process and, secondly, European integration is carried out not only from the top but from the bottom, requiring deliberate interference of the public with the process; the public possesses the formed European political consciousness. Since the latter is a specific mental construct, the author offers to apply the triad «criteria ­ parameters – indicators». The characteristic that makes it possible to evaluate certain processes or phenomena in the system of Europeanness / Europeanism and specifies the quality system of views and opinions, which are realized in European behavior, is considered to be the criterion of European political consciousness. The European political consciousness parameters are seen to include the relevant historical memory, trends of public opinion and awareness regarding the European Union and position of its members in the European integration process, including the assessment of the existence and development of the EU; knowledge and views on the main EU institutions, assessing the importance of the main institutions of the EU and trust in them; a positive vision for the future of the European Union etc. The author considers the performance and objective characteristics and dimensions, including positive correlation of national and European levels of identity (European identity and European behavior to be the indicatiors of European political awareness. On the basis of these indicators the control of the condition and trends of European political consciousness development will be carried out.

Measurement of Trabecular Bone Parameters in Porcine Vertebral Bodies Using Multidetector CT: Evaluation of Reproducibility of 3-Dimensional CT Histomorphometry

Energy Technology Data Exchange (ETDEWEB)

Hong, Sung Hwan; Goo, Jin Mo [Dept. of Radiology, Seoul National University Hospital, Seoul National University College of Medicine, Seoul (Korea, Republic of); Moon Kyung Chul [Dept. of Pathology, Seoul National University Hospital, Seoul National University College of Medicine, Seoul (Korea, Republic of); An, Sang Bu [Dept. of radiology, National Cancer Center, Goyang (Korea, Republic of); Kim, Kwang Gi [Dept. of Biomedical Engineering, Division of Basic and Applied Sciences, National Cancer Center, Goyang (Korea, Republic of)

2011-05-15

To evaluate the reproducibility of 3-dimensional histomorphometry for the microarchitecture analysis of trabecular bone parameters using multidetector computed tomography (MDCT). Thirty-six specimens from porcine vertebral bodies were imaged five times with a 64- detector row MDCT system using the same scan protocols. Locations of the specimens were nearly identical through the scans. Three-dimensional structural parameters of trabecular bone were derived from the five data sets using image analyzing software. The features measured by the analysis programs were trabecular bone volume, trabecular bone volume/tissue volume, trabecular thickness, trabecular separation, trabecular number, trabecular bone pattern factor, structural model index. The structural trabecular parameters showed excellent reproducibility through repeated scanning. Intraclass correlation coefficients of all seven structural parameters were in the range of 0.998 to 1.000. Coefficients of variation of the six structural parameters, excluding structural model index, were not over 1.6%. The measurement of the trabecular structural parameters using multidetector CT and three-dimensional histomophometry analysis program was validated and showed excellent reproducibility. This method could be used as a noninvasive and easily available test in a clinical setting.

Daily measure of the constancy of rotation in the evaluation of geometric and dosimetric parameters of the tomotherapy

International Nuclear Information System (INIS)

Erzilbengoa, M.; Moral, S.; Bragado, L.; Guisasola, M. A.

2011-01-01

The daily test performance called ''Rotating Constancia'', based on the methodology developed by Balog ''Helical tomotherapy dynamic quality assurance'' (2006), has allowed us over these 2 years to assess the response to TomoTherapy machine parameters given dose, travel speed table offset of the same, position of the green lasers, field size, rotation time and energy index of the beam parameters can be measured without intensity modulation.

The Recommendations for Linear Measurement Techniques on the Measurements of Nonlinear System Parameters of a Joint.

Energy Technology Data Exchange (ETDEWEB)

Smith, Scott A [Univ. of Maryland Baltimore County (UMBC), Baltimore, MD (United States); Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Catalfamo, Simone [Univ. of Stuttgart (Germany); Brake, Matthew R. W. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Rice Univ., Houston, TX (United States); Schwingshackl, Christoph W. [Imperial College, London (United Kingdom); Reusb, Pascal [Daimler AG, Stuttgart (Germany)

2017-01-01

In the study of the dynamics of nonlinear systems, experimental measurements often convolute the response of the nonlinearity of interest and the effects of the experimental setup. To reduce the influence of the experimental setup on the deduction of the parameters of the nonlinearity, the response of a mechanical joint is investigated under various experimental setups. These experiments first focus on quantifying how support structures and measurement techniques affect the natural frequency and damping of a linear system. The results indicate that support structures created from bungees have negligible influence on the system in terms of frequency and damping ratio variations. The study then focuses on the effects of the excitation technique on the response for a linear system. The findings suggest that thinner stingers should not be used, because under the high force requirements the stinger bending modes are excited adding unwanted torsional coupling. The optimal configuration for testing the linear system is then applied to a nonlinear system in order to assess the robustness of the test configuration. Finally, recommendations are made for conducting experiments on nonlinear systems using conventional/linear testing techniques.

Dynamic response of carbon nanotube field-effect transistors analyzed by S-parameters measurement

International Nuclear Information System (INIS)

Bethoux, J.-M.; Happy, H.; Dambrine, G.; Derycke, V.; Goffman, M.; Bourgoin, J.-P.

2006-01-01

Carbon nanotube field-effect transistors (CN-FET) with a metallic back gate have been fabricated. By assembling a number of CNs in parallel, driving currents in the mA range have been obtained. The dynamic response of the CN-FETs has been investigated through S-parameters measurements. A current gain (|H 21 | 2 ) cut-off frequency (f t ) of 8 GHz, and a maximum stable gain (MSG) value of 10 dB at 1 GHz have been obtained. The extraction of an equivalent circuit is proposed

Measurement of the spin-spin correlation parameter C/sub LL/(THETA) in proton-proton scattering

International Nuclear Information System (INIS)

Stuart, S.J.

1982-08-01

The experimental procedures and methods of data analysis used to measure the spin-spin correlation parameter C/sub LL/(THETA) in proton-proton scattering at thirteen different energies in the range 300 to 800 MeV are presented. The results compare favorably with previous data. Good agreement is found with phase shift predictions at energies below 500 MeV

Critical current density measurement of thin films by AC susceptibility based on the penetration parameter h

DEFF Research Database (Denmark)

Li, Xiao-Fen; Grivel, Jean-Claude; Abrahamsen, Asger B.

2012-01-01

We have numerically proved that the dependence of AC susceptibility χ of a E(J) power law superconducting thin disc on many parameters can be reduced to one penetration parameter h, with E the electric field and J the current density. Based on this result, we propose a way of measuring the critical...... current density Jc of superconducting thin films by AC susceptibility. Compared with the normally used method based on the peak of the imaginary part, our method uses a much larger range of the AC susceptibility curve, thus allowing determination of the temperature (T) dependence of Jc from a normally...

The physical interpretation of the parameters measured during the tensile testing of materials at elevated temperatures

International Nuclear Information System (INIS)

Burton, B.

1984-01-01

Hot tensile (or compression) testing, where the stress developed in a material is measured under an imposed strain rate, is often used as an alternative to conventional creep testing. The advantages of the hot tensile test are that its duration can be more closely controlled by the experimenter and also that the technique is more convenient, since high precision testing machines are available. The main disadvantage is that the interpretation of results is more complex. The present paper relates the parameters which are measured in hot tensile tests, to physical processes which occur in materials deforming by a variety of mechanisms. For cases where no significant structural changes occur, as in viscous or superplastic flow, analytical expressions are derived which relate the stresses measured in these tests to material constants. When deformation is controlled by recovery processes, account has to be taken of the structural changes which occur concurrently. A wide variety of behaviour may then be exhibited which depends on the initial dislocation density, the presence of second-phase particles and the relative values of the recovery rate parameters and the velocity imposed by the testing machine. Numerical examples are provided for simple recovery models. (author)

Choice of primary transducers of beam parameters for measuring and control systems of charged particle accelerators

International Nuclear Information System (INIS)

Rybin, V.M.

1981-01-01

Investigations on classification of primary transducers (pT) of the main parameters of charged particle beams are conducted for development of the common series on the base of program- controlled module systems for measuring the parameters of charged particle beams. The PT classification is exercised by: the physical principle of single transformation, the degree of effect on the beam, principle of operation, design, performance, location. It is shown that the optimal choice of PT and their parameters should be necessarily executed in several stages: estimation of the limiting possibilities of PT; choice of PT by time and metrological characteristics as well as sensitivity for the determined operation conditions; choice of the PT by the degree of effect on the beam: choice of the PT type with account of its design performance and location, determination of PT parameters with account of possibility of information, energy and design compatibility of the used standard. The classification results of magnetoinduction and acoustic transducers have shown that the number of their modifications does not exceed 100 [ru

Visual stimulus parameters seriously compromise the measurement of approximate number system acuity and comparative effects between adults and children

Directory of Open Access Journals (Sweden)

Denes eSzucs

2013-07-01

Full Text Available It has been suggested that a simple non-symbolic magnitude comparison task is sufficient to measure the acuity of a putative Approximate Number System (ANS. A proposed measure of the ANS, the so-called 'internal Weber fraction' (w, would provide a clear measure of ANS acuity. However, ANS studies have never presented adequate evidence that the visual stimulus parameters did not compromise measurements of w to such extent that w is actually driven by visual instead of numerical processes. We therefore investigated this question by testing non-symbolic magnitude discrimination in seven-year-old children and adults. We controlled for visual parameters in a more stringent manner than usual. As a consequence of these controls, in some trials numerical cues correlated positively with number while in others they correlated negatively with number. This congruency effect strongly correlated with w, which means that congruency effects were probably driving effects in w. Consequently, in both adults and children congruency had a major impact on the fit of the model underlying the computation of w. Furthermore, children showed larger congruency effects than adults. This suggests that ANS tasks are seriously compromised by the visual stimulus parameters, which cannot be controlled. Hence, they are not pure measures of the ANS and some putative w or ratio effect differences between children and adults in previous ANS studies may be due to the differential influence of the visual stimulus parameters in children and adults. In addition, because the resolution of congruency effects relies on inhibitory (interference suppression function, some previous ANS findings were probably influenced by the developmental state of inhibitory processes especially when comparing children with developmental dyscalculia and typically developing children.

Experimental Measures of Bus Comfort Levels Using Kinematic Parameters Recorded by Smartphone

Energy Technology Data Exchange (ETDEWEB)

Aquila, S. dell' ; Eboli, L.; Futia, G.; Mazzulla, G.; Pungillo, G.

2016-07-01

Comfort on board plays an essential role in the levels of satisfaction of a bus service perceived by passengers. The aim of this paper is to propose a measure of comfort based on two kinds of data: perceptions of passengers (subjective data) and accelerations of bus (objective data). For the collection of subjective data a questionnaire was addressed to a sample of university students, while a smartphone, equipped with GPS device and 3-axis accelerometer, was used to record the accelerations. Based on the recorded parameters, we determined the thresholds of the acceleration values beyond which the level of comfort cannot be considered as good.. (Author)

Measurements of Parameters Controlling the Emissions of Organophosphate Flame Retardants in Indoor Environments.

Science.gov (United States)

Liang, Yirui; Liu, Xiaoyu; Allen, Matthew R

2018-05-15

Emission of semivolatile organic compounds (SVOCs) from source materials usually occurs very slowly in indoor environments due to their low volatility. When the SVOC emission process is controlled by external mass transfer, the gas-phase concentration in equilibrium with the material ( y 0 ) is used as a key parameter to simplify the source models that are based on solid-phase diffusion. A material-air-material (M-A-M) configured microchamber method was developed to rapidly measure y 0 for a polyisocyanurate rigid foam material containing organophosphate flame retardants (OPRFs). The emission test was conducted in 44 mL microchambers for target OPFRs, including tris(2-chloroethyl) phosphate (CASRN: 115-96-8), tris(1-chloro-2-propyl) phosphate (CASRN: 13674-84-5), and tris(1,3-dichloro-2-propyl) phosphate (CASRN: 13674-87-8). In addition to the microchamber emission test, two other types of tests were conducted to determine y 0 for the same foam material: OPFR diffusive tube sampling tests from the OPFR source foam using stainless-steel thermal desorption tubes and sorption tests of OPFR on an OPFR-free foam in a 53 L small chamber. Comparison of parameters obtained from the three methods suggests that the discrepancy could be caused by a combination of theoretical, experimental, and computational differences. Based on the y 0 measurements, a linear relationship between the ratio of y 0 to saturated vapor pressure concentration and material-phase mass fractions has been found for phthalates and OPFRs.

Precision Measurement of Neutrino Oscillation Parameters with KamLAND

Energy Technology Data Exchange (ETDEWEB)

O' Donnell, Thomas [Univ. of California, Berkeley, CA (United States)

2011-12-01

This dissertation describes a measurement of the neutrino oscillation parameters m² ₂₁, θ₁₂ and constraints on θ₁₃ based on a study of reactor antineutrinos at a baseline of ~ 180 km with the KamLAND detector. The data presented here was collected between April 2002 and November 2009, and amounts to a total exposure of 2.64 ± 0.07 × 10³² proton-years. For this exposure we expect 2140 ± 74(syst) antineutrino candidates from reactors, assuming standard model neutrino behavior, and 350±88(syst) candidates from background. The number observed is 1614. The ratio of background-subtracted candidates observed to expected is (N_Obs - N_Bkg)/ (N_Exp) = 0.59 ± 0.02(stat) ± 0.045(syst) which confirms reactor neutrino disappearance at greater than 5σ significance. Interpreting this deficit as being due to neutrino oscillation, the best-fit oscillation parameters from a three-flavor analysis are m² ₂₁= 7.60^+0.20 _-0.19×10^-5eV², θ₁₂ = 32.5 ± 2.9 degrees and sin² θ₁₃ = 0.025^+0.035 _-0.035, the 95% confidence-level upper limit on sin² θ₁₃ is sin² θ₁₃ < 0.083. Assuming CPT invariance, a combined analysis of KamLAND and solar neutrino data yields best-fit values: m² ₂₁ = 7.60^+0.20 _-0.20 × 10^-5eV², θ₁₂ = 33.5^+1.0 _-1.1 degrees, and sin² θ₁₃ = 0.013 ± 0.028 or sin² θ₁₃ < 0.06 at the 95% confidence level.

Uncertainty Reduction Via Parameter Design of A Fast Digital Integrator for Magnetic Field Measurement

CERN Document Server

Arpaia, P; Lucariello, G; Spiezia, G

2007-01-01

At European Centre of Nuclear Research (CERN), within the new Large Hadron Collider (LHC) project, measurements of magnetic flux with uncertainty of 10 ppm at a few of decades of Hz for several minutes are required. With this aim, a new Fast Digital Integrator (FDI) has been developed in cooperation with University of Sannio, Italy [1]. This paper deals with the final design tuning for achieving target uncertainty by means of experimental statistical parameter design.

Dynamic response of carbon nanotube field-effect transistors analyzed by S-parameters measurement

Energy Technology Data Exchange (ETDEWEB)

Bethoux, J.-M. [Institut d' Electronique, de Microelectronique et de Nanotechnologie, C.N.R.S. U.M.R. 8520, BP 60069, F-59652, Villeneuve d' Ascq Cedex (France); Happy, H. [Institut d' Electronique, de Microelectronique et de Nanotechnologie, C.N.R.S. U.M.R. 8520, BP 60069, F-59652, Villeneuve d' Ascq Cedex (France)]. E-mail: henri.happy@iemn.univ-lille1.fr; Dambrine, G. [Institut d' Electronique, de Microelectronique et de Nanotechnologie, C.N.R.S. U.M.R. 8520, BP 60069, F-59652, Villeneuve d' Ascq Cedex (France); Derycke, V. [Laboratoire d' Electronique Moleculaire, SPEC, Commissariat a l' Energie Atomique, Saclay F-91191, Gif sur Yvette Cedex (France); Goffman, M. [Laboratoire d' Electronique Moleculaire, SPEC, Commissariat a l' Energie Atomique, Saclay F-91191, Gif sur Yvette Cedex (France); Bourgoin, J.-P. [Laboratoire d' Electronique Moleculaire, SPEC, Commissariat a l' Energie Atomique, Saclay F-91191, Gif sur Yvette Cedex (France)

2006-12-15

Carbon nanotube field-effect transistors (CN-FET) with a metallic back gate have been fabricated. By assembling a number of CNs in parallel, driving currents in the mA range have been obtained. The dynamic response of the CN-FETs has been investigated through S-parameters measurements. A current gain (|H {sub 21}|{sup 2}) cut-off frequency (f {sub t}) of 8 GHz, and a maximum stable gain (MSG) value of 10 dB at 1 GHz have been obtained. The extraction of an equivalent circuit is proposed.

Reliability and measurement error of sagittal spinal motion parameters in 220 patients with chronic low back pain using a three-dimensional measurement device.

Science.gov (United States)

Mieritz, Rune M; Bronfort, Gert; Jakobsen, Markus D; Aagaard, Per; Hartvigsen, Jan

2014-09-01

A basic premise for any instrument measuring spinal motion is that reliable outcomes can be obtained on a relevant sample under standardized conditions. The purpose of this study was to assess the overall reliability and measurement error of regional spinal sagittal plane motion in patients with chronic low back pain (LBP), and then to evaluate the influence of body mass index, examiner, gender, stability of pain, and pain distribution on reliability and measurement error. This study comprises a test-retest design separated by 7 to 14 days. The patient cohort consisted of 220 individuals with chronic LBP. Kinematics of the lumbar spine were sampled during standardized spinal extension-flexion testing using a 6-df instrumented spatial linkage system. Test-retest reliability and measurement error were evaluated using interclass correlation coefficients (ICC(1,1)) and Bland-Altman limits of agreement (LOAs). The overall test-retest reliability (ICC(1,1)) for various motion parameters ranged from 0.51 to 0.70, and relatively wide LOAs were observed for all parameters. Reliability measures in patient subgroups (ICC(1,1)) ranged between 0.34 and 0.77. In general, greater (ICC(1,1)) coefficients and smaller LOAs were found in subgroups with patients examined by the same examiner, patients with a stable pain level, patients with a body mass index less than below 30 kg/m(2), patients who were men, and patients in the Quebec Task Force classifications Group 1. This study shows that sagittal plane kinematic data from patients with chronic LBP may be sufficiently reliable in measurements of groups of patients. However, because of the large LOAs, this test procedure appears unusable at the individual patient level. Furthermore, reliability and measurement error varies substantially among subgroups of patients. Copyright © 2014 Elsevier Inc. All rights reserved.

On measurement of the acoustic nonlinearity parameter using the finite amplitude insertion substitution (FAIS) technique

Science.gov (United States)

Zeqiri, Bajram; Cook, Ashley; Rétat, Lise; Civale, John; ter Haar, Gail

2015-04-01

The acoustic nonlinearity parameter, B/A, is an important parameter which defines the way a propagating finite amplitude acoustic wave progressively distorts when travelling through any medium. One measurement technique used to determine its value is the finite amplitude insertion substitution (FAIS) method which has been applied to a range of liquid, tissue and tissue-like media. Importantly, in terms of the achievable measurement uncertainties, it is a relative technique. This paper presents a detailed study of the method, employing a number of novel features. The first of these is the use of a large area membrane hydrophone (30 mm aperture) which is used to record the plane-wave component of the acoustic field. This reduces the influence of diffraction on measurements, enabling studies to be carried out within the transducer near-field, with the interrogating transducer, test cell and detector positioned close to one another, an attribute which assists in controlling errors arising from nonlinear distortion in any intervening water path. The second feature is the development of a model which estimates the influence of finite-amplitude distortion as the acoustic wave travels from the rear surface of the test cell to the detector. It is demonstrated that this can lead to a significant systematic error in B/A measurement whose magnitude and direction depends on the acoustic property contrast between the test material and the water-filled equivalent cell. Good qualitative agreement between the model and experiment is reported. B/A measurements are reported undertaken at (20 ± 0.5) °C for two fluids commonly employed as reference materials within the technical literature: Corn Oil and Ethylene Glycol. Samples of an IEC standardised agar-based tissue-mimicking material were also measured. A systematic assessment of measurement uncertainties is presented giving expanded uncertainties in the range ±7% to ±14%, expressed at a confidence level close to 95

Non-invasive measure of respiratory mechanics and conventional respiratory parameters in conscious large animals by high frequency Airwave Oscillometry.

Science.gov (United States)

Bassett, Leanne; Troncy, Eric; Robichaud, Annette; Schuessler, Thomas F; Pouliot, Mylène; Ascah, Alexis; Authier, Simon

2014-01-01

A number of drugs in clinical trials are discontinued due to potentially life-threatening airway obstruction. As some drugs may not cause changes in core battery parameters such as tidal volume (Vt), respiratory rate (RR) or minute ventilation (MV), including measurements of respiratory mechanics in safety pharmacology studies represents an opportunity for design refinement. The present study aimed to test a novel non-invasive methodology to concomitantly measure respiratory system resistance (Rrs) and conventional respiratory parameters (Vt, RR, MV) in conscious Beagle dogs and cynomolgus monkeys. An Airwave Oscillometry system (tremoFlo; THORASYS Inc., Montreal, Canada) was used to concomitantly assess Rrs and conventional respiratory parameters before and after intravenous treatment with a bronchoactive agent. Respiratory mechanics measurements were performed by applying a short (i.e. 16s) single high frequency (19Hz) waveform at the subject's airway opening via a face mask. During measurements, pressure and flow signals were recorded. After collection of baseline measurements, methacholine was administered intravenously to Beagle dogs (n=6) and cynomolgus monkeys (n=4) at 8 and 68μg/kg, respectively. In dogs, methacholine induced significant increases in Vt, RR and MV while in monkeys, it only augmented RR. A significant increase in Rrs was observed after methacholine administration in both species with mean percentage peak increases from baseline of 88 (53)% for dogs and 28 (16)% for cynomolgus monkeys. Airwave Oscillometry appears to be a promising non-invasive methodology to enable respiratory mechanics measurements in conscious large animals, a valuable refinement in respiratory safety pharmacology. Copyright © 2014 Elsevier Inc. All rights reserved.

Profiles of plasma parameters and density of negative hydrogen ions by laser detachment measurements in RF-driven ion sources

International Nuclear Information System (INIS)

Christ-Koch, Sina

2007-01-01

This work shows the application of the Laserdetachment method for spatially resolved measurements of negative Hydrogen/Deuterium ion density. It was applied on a high power low pressure RF-driven ion source. The Laser detachment method is based on the measurement of electron currents on a positively biased Langmuir probe before and during/after a laser pulse. The density ratio of negative ions to electrons can be derived from the ratio of currents to the probe. The absolute density of negative ions can be obtained when the electron density is measured with the standard Langmuir probe setup. Measurements with the Langmuir probe additionally yield information about the floating and plasma potential, the electron temperature and the density of positive ions. The Laser detachment setup had to be adapted to the special conditions of the RF-driven source. In particular the existence of RF fields (1 MHz), high source potential (-20 kV), magnetic fields (∝ 7 mT) and caesium inside the source had to be considered. The density of negative ions could be identified in the range of n(H - )=1.10 17 1/m 3 , which is in the same order of magnitude as the electron density. Only the application of the Laser detachment method with the Langmuir probe measurements will yield spatially resolved plasma parameters and H- density profiles. The influence of diverse external parameters, such as pressure, RF-power, magnetic fields on the plasma parameters and their profiles were studied and explained. Hence, the measurements lead to a detailed understanding of the processes inside the source. (orig.)

Anomalous transport in cellular flows: The role of initial conditions and aging

Science.gov (United States)

Pöschke, Patrick; Sokolov, Igor M.; Nepomnyashchy, Alexander A.; Zaks, Michael A.

2016-09-01

We consider the diffusion-advection problem in two simple cellular flow models (often invoked as examples of subdiffusive tracer motion) and concentrate on the intermediate time range, in which the tracer motion indeed may show subdiffusion. We perform extensive numerical simulations of the systems under different initial conditions and show that the pure intermediate-time subdiffusion regime is only evident when the particles start at the border between different cells, i.e., at the separatrix, and is less pronounced or absent for other initial conditions. The motion moreover shows quite peculiar aging properties, which are also mirrored in the behavior of the time-averaged mean squared displacement for single trajectories. This kind of behavior is due to the complex motion of tracers trapped inside the cell and is absent in classical models based on continuous-time random walks with no dynamics in the trapped state.

Time-dependent Perpendicular Transport of Energetic Particles for Different Turbulence Configurations and Parallel Transport Models

Energy Technology Data Exchange (ETDEWEB)

Lasuik, J.; Shalchi, A., E-mail: andreasm4@yahoo.com [Department of Physics and Astronomy, University of Manitoba, Winnipeg, MB R3T 2N2 (Canada)

2017-09-20

Recently, a new theory for the transport of energetic particles across a mean magnetic field was presented. Compared to other nonlinear theories the new approach has the advantage that it provides a full time-dependent description of the transport. Furthermore, a diffusion approximation is no longer part of that theory. The purpose of this paper is to combine this new approach with a time-dependent model for parallel transport and different turbulence configurations in order to explore the parameter regimes for which we get ballistic transport, compound subdiffusion, and normal Markovian diffusion.

Precision measurements of Standard Model parameters and Review of Drell-Yan and vector boson plus jets measurements with the ATLAS detector

International Nuclear Information System (INIS)

Calace, Noemi

2016-01-01

The inclusive productions of the W and the on- or off-shell Z/γ* bosons are standard candles at hadron colliders, while the productions of light and heavy-flavour jets in association with a W or a Z boson are important processes to study quantum-chromodynamics (QCD) in multi-scale environments. The measurements of their production cross-sections integrated and differential in several variables have been measured at 7 and 8 TeV centre-of-mass energies and are compared to high-order QCD calculations and Monte Carlo simulations. These measurements have an impact on our knowledge of the parton densities of the proton, and test soft resummation effects and hard emissions for small and large momentum transfers and in multi-scale processes. Precision measurements of fundamental Standard Model parameters in Drell-Yan final states are also performed to describe the angular distributions of the decay lepton. Run-1 studies carried out by the ATLAS Collaboration are re-viewed and first LHC Run-2 results are included

Precision neutral current asymmetry parameter measurements from the Tau polarization at LEP

International Nuclear Information System (INIS)

Abbiendi, G.; Aakesson, P.F.

2001-01-01

Measurements of the τ lepton polarization and forward-backward polarization asymmetry near the Z 0 resonance using the OPAL detector are described. The measurements are based on analyses of τ→ν e ν τ , τ→μν μ ν τ , τ→πν τ , τ→ρν τ and τ→ 1 ν τ decays from a sample of 144,810 e + e - →τ + τ - candidates corresponding to an integrated luminosity of 151 pb -1 . Assuming that the τ lepton decays according to V-A theory, we measure the average τ polarization near √(s) =M Z to be left angle P τ right angle = (-14.10 ±0.73 ±0.55)% and the τ polarization forward-backward asymmetry to be A pol FB = (-10.55 ±0.76 ±0.25)%, where the first error is statistical and the second systematic. Taking into account the small effects of the photon propagator, photon-Z 0 interference and photonic radiative corrections, these results can be expressed in terms of the lepton neutral current asymmetry parameters: A τ =0.1456±0.0076±0.0057, A e =0.1454±0.0108±0.0036. These measurements are consistent with the hypothesis of lepton universality and combine to give A l = 0.1455 ±0.0073. Within the context of the Standard Model this combined result corresponds to =0.23172 ±0.00092. Combing these results with those from the other OPAL neutral current measurements yields a value of =0.23211 ±0.00068. (orig.)

1H CSA parameters by ultrafast MAS NMR: Measurement and applications to structure refinement.

Science.gov (United States)

Miah, Habeeba K; Cresswell, Rosalie; Iuga, Dinu; Titman, Jeremy J

2017-10-01

A 1 H anisotropic-isotropic chemical shift correlation experiment which employs symmetry-based recoupling sequences to reintroduce the chemical shift anisotropy in ν 1 and ultrafast MAS to resolve 1 H sites in ν 2 is described. This experiment is used to measure 1 H shift parameters for L-ascorbic acid, a compound with a relatively complex hydrogen-bonding network in the solid. The 1 H CSAs of hydrogen-bonded sites with resolved isotropic shifts can be extracted directly from the recoupled lineshapes. In combination with DFT calculations, hydrogen positions in crystal structures obtained from X-ray and neutron diffraction are refined by comparison with simulations of the full two-dimensional NMR spectrum. The improved resolution afforded by the second dimension allows even unresolved hydrogen-bonded sites 1 H to be assigned and their shift parameters to be obtained. Copyright © 2017 Elsevier Inc. All rights reserved.

Measurement of Secular Motion Frequency in Miniature Paul Trap to Ascertain the Stability Parameters

International Nuclear Information System (INIS)

Bin, Guo; Hua, Guan; Qu, Liu; Yao, Huang; Xue-Ren, Huang; Ke-Lin, Gao

2010-01-01

40 Ca + ions are trapped and laser cooled in a miniature Paul trap. The secular motion was observed by the radio-frequency resonance of the ion cloud and Zeeman profile sidebands of a single ion experimentally. The trap stability parameters a and q are determined with an uncertainty under 1 % by the secular motion frequency measurement. The trap efficiency is 0.75. A practicable suggestion is given for the benefits of a new trap design. (atomic and molecular physics)

Radioisotope albumin flux measurement of microvascular lung permeability: an independent parameter in acute respiratory failure?

International Nuclear Information System (INIS)

Hoegerle, S.; Nitzsche, E.U.; Reinhardt, M.J.; Moser, E.; Benzing, A.; Geiger, K.; Schulte Moenting, J.

2001-01-01

Aim: To evaluate the extent to which single measurements of microvascular lung permeability may be relevant as an additional parameter in a heterogenous clinical patient collective with Acute Lung Injury (ALI) and Acute Respiratory Distress Syndrome (ARDS). Methods: In 36 patients with pneumonia (13), non pneumogenic sepsis (9) or trauma (14) meeting the consensus conference criteria of ALI or ARDS double-isotope protein flux measurements ( 51 Cr erythrocytes as intravascular tracer, Tc-99m human albumin as diffusible tracer) of microvascular lung permeability were performed using the Normalized Slope Index (NSI). The examination was to determine whether there is a relationship between the clinical diagnosis of ALI/ARDS, impaired permeability and clinical parameters, that is the underlying disease, oxygenation, duration of mechanical ventilation and mean pulmonary-artery pressure (PAP). Results: At the time of study, 25 patients presented with increased permeability (NSI > 1 x 10 -3 min -1 ) indicating an exudative stage of disease, and 11 patients with normal permeability. The permeability impairment correlated with the underlying disease (p > 0.05). With respect to survival, there was a negative correlation to PAP (p [de

113Insup(m) radiocardiographic measurements of cardiopulmonary parameters in healthy subjects and in cardiac patients

International Nuclear Information System (INIS)

Kuikka, Jyrki.

1976-05-01

Single detector arrangements are used to measure heart radioactivity curves in healthy subjects and in patients with various heart failures. A method is developed from a modified gamma function to determine the cardiopulmonary parameters from the radiocardiograms: systemic flow, pulmonary flow, right to left shunting flow, left to right shunting flow, regurgitant fractions, stroke volume, atrial blood volumes, ventricular end-diastolic volumes, pulmonary blood volume and ejection fractions. The method is well suited to clinical routine and requires only a desk calculator or a mini-computer for data handling. The cardiopulmonary parameters were measured from 70 healthy subjects with following results: cardiac index 3.46+-0.72 l/min/m 2 , stroke index 49+-9 ml/b/m 2 , right atrial blood volume 35+-13 ml/m 2 , right ventricular end-diastolic volume 76+-15 ml/m 2 , pulmonary blood volume 250+-51 ml/m 2 , left atrial blood volume 41+-15 ml/m 2 , left ventricular end-diastolic volume 75+-15 ml/m 2 , right heart ejection fraction 0.64+-0.11, left heart ejection fraction 0.66+-0.12. These values agree closely with the data accumulated from more elaborate methods. (author)

Measurement of dosimetric parameters for Hi-ART helical tomotherapy unit

International Nuclear Information System (INIS)

Wang Yunlai; Sha Xiangyou; Dai Xiangkun; Ma Lin; Feng Linchun; Qu Baolin

2008-01-01

Objective: To develop a measurement method of dosimetric parameters for Hi-ART tomotherapy unit. Methods: Percentage depth doses and beam profiles were measured using the dedicated mini water phantom, and compared to the results of 6 MV X-ray from Primus accelerator. Following the AAPM TG51 protocol, absolute dose calibration was carried out under SSD of 8.5 cm at depth of 1.5 cm for field of 5 cm x 40 cm. The output linearity and reproducibility were evaluated. The output variation with the gantry rotation was also investigated using 0.6 cm 3 ion chamber in cylindrical perplex phantom and on-board MVCT detectors. Leaf fluence output factors were quantified for the leaf of interest and its adjacent leaves. Results: The buildup depth was around 1.0 cm. The PDD values at 10 cm for Hi-ART and Primus were 59.7% and 64.7%, respectively. Varying with the field width, the lateral and longitudinal beam profiles were not so homogeneous as the Primus fields. The measured dose rate was 848.38 cGy/min. The fitted linear function between the readings of dosimeter and the irradiated time was R(nC) =-0.017 + 0.256· t(sec), with a relative coefficient of 0.999. The maximum deviation and standard deviation of output were 1.6% and less than 0.5%; The maximum deviation and standard deviation of output changed by gantry angle were 1.1% and 0.5%, respectively. Leaf fluence output factors did not increase significantly when leaves were opened beyond the two adjacent leaves. Conclusions: Hi-ART Tomotherapy unit has a very high dose output and inhomogeneous beam profiles owing to its special design of the treatment head. This may be useful in dose calculation and treatment delivery. (authors)

Measurement of the {eta}{yields}3{pi}{sup 0} slope parameter {alpha} with the KLOE detector

Energy Technology Data Exchange (ETDEWEB)

Ambrosino, F., E-mail: Fabio.Ambrosino@na.infn.i [Dipartimento di Scienze Fisiche dell' Universita ' Federico II' , Napoli (Italy); INFN Sezione di Napoli, Napoli (Italy); Antonelli, A.; Antonelli, M. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); Archilli, F. [Dipartimento di Fisica dell' Universita ' Tor Vergata' , Roma (Italy); INFN Sezione di Roma Tor Vergata, Roma (Italy); Beltrame, P. [Institut fuer Kernphysik, Johannes Gutenberg-Universitaet Mainz (Germany); Bencivenni, G. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); Bini, C. [Dipartimento di Fisica dell' Universita ' La Sapienza' , Roma (Italy); INFN Sezione di ' La Sapienza' , Roma (Italy); Bloise, C. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); Bocchetta, S. [Dipartimento di Fisica dell' Universita ' Roma Tre' , Roma (Italy); INFN Sezione di Roma Tre, Roma (Italy); Bossi, F. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); Branchini, P. [INFN Sezione di Roma Tre, Roma (Italy); Campana, P.; Capon, G. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); Capussela, T., E-mail: Tiziana.Capussela@na.infn.i [Dipartimento di Scienze Fisiche dell' Universita ' Federico II' , Napoli (Italy); Ceradini, F. [Dipartimento di Fisica dell' Universita ' Roma Tre' , Roma (Italy); INFN Sezione di Roma Tre, Roma (Italy); Ciambrone, P.; De Lucia, E. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); De Santis, A. [Dipartimento di Fisica dell' Universita ' La Sapienza' , Roma (Italy); INFN Sezione di ' La Sapienza' , Roma (Italy); De Simone, P. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); De Zorzi, G. [Dipartimento di Fisica dell' Universita ' La Sapienza' , Roma (Italy); INFN Sezione di ' La Sapienza' , Roma (Italy)

2010-10-25

We present a measurement of the slope parameter {alpha} for the {eta}{yields}3{pi}{sup 0} decay, with the KLOE experiment at the DA{Phi}NE {phi}-factory, based on a background free sample of {approx}17 million {eta} mesons produced in {phi} radiative decays. By fitting the event density in the Dalitz plot we determine {alpha}=-0.0301{+-}0.0035stat{sub -0.0035}{sup +0.0022}syst. The result is in agreement with recent measurements from hadro- and photo-production experiments.

Measures of the zero power nuclear reactor's kinetic parameters with application of noise analysis

International Nuclear Information System (INIS)

Martins, F.R.

1992-01-01

The purpose of this work was to establish an experimental technique based on noise analysis for measuring the ratio of kinetic parameters β/ Λ and the power of the Zero Power Nuclear Reactor IPEN-MB 01. A through study of the microscopic and macroscopic noise analysis techniques has been carried out. The Langevin technique and the point kinetic model were chosen to describe the stochastic phenomena that occur in the zero power reactor. Measurements have been made using two compensated ionization chambers localized in the water reflector at symmetric positions in order to minimize spatial effects on the neutron flux fluctuation. Power calibrations based on the low frequency plateau of the cross-power spectral density has also been carried out. (author)

Measuring opto-thermal parameters of basalt fibers using digital holographic microscopy.

Science.gov (United States)

Yassien, Khaled M; Agour, Mostafa

2017-02-01

A method for studying the effect of temperature on the optical properties of basalt fiber is presented. It is based on recording a set of phase-shifted digital holograms for the sample under the test. The holograms are obtained utilizing a system based on Mach-Zehnder interferometer, where the fiber sample inserted in an immersion liquid is placed within a temperature controlled chamber. From the recorded digital holograms the optical path differences which are used to calculate the refractive indices are determined. The accuracy in the measurement of refractive indices is in the range of 4 × 10 -4 . The influence of temperature on the dispersion parameters, polarizability per unit volume and dielectric susceptibility are also obtained. Moreover, the values of dispersion and oscillation energies and Cauchy's constants are provided at different temperatures. © 2016 Wiley Periodicals, Inc.

Measurement of alignment parameter for photon induced $L_{3}$ vacancies in the elements 59

CERN Document Server

Ertugrul, M; Sahin, Y

2002-01-01

The alignment parameter was measured using the L/sub alpha //L/sub l/ intensity ratio. For this measurement. the Kamiya et al. ÝPhys. Rev. A 20, 820 (1979)¿ equation was used. The L/sub l/ and L/sub alpha / X-rays of the elements were measured with a Si (Li) detector at a direction of 90 degrees to the projectile. The L/sub 3/ edges of the elements were excited with the selected ionising energies. (13 refs).

Robust estimation of hydrological model parameters

Directory of Open Access Journals (Sweden)

A. Bárdossy

2008-11-01

Full Text Available The estimation of hydrological model parameters is a challenging task. With increasing capacity of computational power several complex optimization algorithms have emerged, but none of the algorithms gives a unique and very best parameter vector. The parameters of fitted hydrological models depend upon the input data. The quality of input data cannot be assured as there may be measurement errors for both input and state variables. In this study a methodology has been developed to find a set of robust parameter vectors for a hydrological model. To see the effect of observational error on parameters, stochastically generated synthetic measurement errors were applied to observed discharge and temperature data. With this modified data, the model was calibrated and the effect of measurement errors on parameters was analysed. It was found that the measurement errors have a significant effect on the best performing parameter vector. The erroneous data led to very different optimal parameter vectors. To overcome this problem and to find a set of robust parameter vectors, a geometrical approach based on Tukey's half space depth was used. The depth of the set of N randomly generated parameters was calculated with respect to the set with the best model performance (Nash-Sutclife efficiency was used for this study for each parameter vector. Based on the depth of parameter vectors, one can find a set of robust parameter vectors. The results show that the parameters chosen according to the above criteria have low sensitivity and perform well when transfered to a different time period. The method is demonstrated on the upper Neckar catchment in Germany. The conceptual HBV model was used for this study.

Measurement of D0-D0 mixing parameters and search for CP violation using D0 → K+ π- decays.

Science.gov (United States)

Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Badalov, A; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M-O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Cheung, S-F; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D C; Cruz Torres, M; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dornan, P; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Falabella, A; Färber, C; Farinelli, C; Farry, S; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gorbounov, P; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grillo, L; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Heß, M; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kurek, K; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Lupton, O; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Maratas, J; Marconi, U; Marino, P; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Martynov, A; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; McCarthy, J; McNab, A; McNulty, R; McSkelly, B; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M-N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pearce, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pescatore, L; Pesen, E; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rachwal, B; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reichert, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Roberts, D A; Rodrigues, A B; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rotondo, M; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Sanmartin Sedes, B; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, N A; Smith, E; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Sutcliffe, W; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szilard, D; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wormser, G; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

2013-12-20

Measurements of charm mixing parameters from the decay-time-dependent ratio of D0 → K+ π- to D0 → K- π+ rates and the charge-conjugate ratio are reported. The analysis uses data, corresponding to 3  fb(-1) of integrated luminosity, from proton-proton collisions at 7 and 8 TeV center-of-mass energies recorded by the LHCb experiment. In the limit of charge-parity (CP ) symmetry, the mixing parameters are determined to be x'2=(5.5±4.9)×10(-5), y'=(4.8±1.0)×10(-3), and RD=(3.568±0.066)×10(-3). Allowing for CP violation, the measurement is performed separately for D0 and D0 mesons yielding AD=(-0.7±1.9)%, for the direct CP-violating asymmetry, and 0.75<|q/p|<1.24 at the 68.3% confidence level, for the parameter describing CP violation in mixing. This is the most precise determination of these parameters from a single experiment and shows no evidence for CP violation.

Ultrasonographic measurement of fetal growth parameters over three successive pregnancies in a captive Malayan tapir (Tapirus indicus).

Science.gov (United States)

Hoyer, M J; van Engeldorp Gastelaars, H M D

2014-01-01

This study was conducted to establish representative curves that allow evaluation of fetal growth and estimation of gestational age from measurement of fetal structures by ultrasound in Malayan tapirs (Tapirus indicus). Three pregnancies (i.e. 3 fetuses) were examined in one female Malayan tapir. Transabdominal ultrasonographic examination was performed without anesthesia from 79 ± 8 days to 281 ± 48 days (mean ± S.D.) post mating. To assess fetal growth attempts were made to measure biparietal diameter (BPD), head length (HL), thorax diameter A (TDA), thorax height A (THA), thorax diameter B (TDB), thorax height B (THB), abdomen diameter (AD), abdomen height (AH), humerus length (HUL) and Crown rump length (CRL). The value of each parameter as an estimator of gestational age was assessed by ease of observation and the length of time the parameter was measurable throughout gestation. The most precise predictors for gestational age in this study were BPD and CRL (weeks 10-20 of gestation), as well as AD and AH (weeks 14-43 of gestation). The parameters TDB, THB and HUL (weeks 15-41 of gestation) gave almost as good predictions. Fetal viability was assessed by identifying a fetal heartbeat and movement. All pregnancies resulted in normal deliveries and healthy offspring. The ultrasound examination was well tolerated by the female. The gestation lengths (399 ± 3 days) were within reported ranges. The serial transabdominal ultrasound, without the need for anesthesia, was an effective method to evaluate fetal growth, development and well being in a Malayan tapir. © 2014 Wiley Periodicals, Inc.

First measurement of ADS parameters using B- to D0K- decays in hadron collisions

International Nuclear Information System (INIS)

Garosi, Paola

2011-01-01

Measurements of branching fractions and CP-asymmetries of B - → D 0 K - modes allow a theoretically-clean extraction of the CKM angle γ. The method proposed by Atwood, Dunietz and Soni (ADS) makes use of a decay chain where color and Cabibbo suppression interfere, which produces large CP-violating asymmetries. The CDF experiment reports the first measurement at a hadron collider of branching fractions and CP-asymmetries of suppressed B - → D 0 h - signals, where h is π or K. Using 5.0 fb -1 of data we found a combined significance exceeding 5σ and we determined the ADS parameters with accuracy comparable with B-factories.

Measuring Gauge-Mediated SuperSymmetry Breaking Parameters at a 500 GeV $e^{+}e^{-}$ Linear Collider

CERN Document Server

Ambrosanio, S; Ambrosanio, Sandro; Blair, Grahame A.

2000-01-01

We consider the phenomenology of a class of gauge-mediated supersymmetry (SUSY) breaking (GMSB) models at a e+e- Linear Collider (LC) with c.o.m. energy up to 500 GeV. In particular, we refer to a high-luminosity (L ~ 3 x 10^34 cm^-2 s^-1) machine, and use detailed simulation tools for a proposed detector. Among the GMSB-model building options, we define a simple framework and outline its predictions at the LC, under the assumption that no SUSY signal is detected at LEP or Tevatron. Our focus is on the case where a neutralino (N1) is the next-to-lightest SUSY particle (NLSP), for which we determine the relevant regions of the GMSB parameter space. Many observables are calculated and discussed, including production cross sections, NLSP decay widths, branching ratios and distributions, for dominant and rare channels. We sketch how to extract the messenger and electroweak scale model parameters from a spectrum measured via, e.g. threshold-scanning techniques. Several experimental methods to measure the NLSP mass...

Implications of the top quark mass measurement for the CKM parameters, x$_{s}$ and CP asymmetries

CERN Document Server

Ali, A; London, D

1995-01-01

Motivated by the recent determination of the top quark mass by the CDF collaboration, \\mt =174 \\pm 10 ^{+13}_{-12} GeV, we review and update the constraints on the parameters of the quark flavour mixing matrix V_{CKM} in the standard model. In performing our fits, we use inputs from the measurements of the following quantities: (i) \\abseps, the CP-violating parameter in K decays, (ii) \\delmd, the mass difference due to the \\bdbdbar\\ mixing, (iii) the matrix elements \\absvcb and \\absvub, and (iv) B-hadron lifetimes. We find that the allowed region of the unitarity triangle is very large, mostly due to theoretical uncertainties. (This emphasizes the importance of measurements of CP-violating rate asymmetries in the B system.) Nevertheless, the present data do somewhat restrict the allowed values of the coupling constant product f_{B_d}\\sqrt{\\hat{B}_{B_d}} and the renormalization-scale invariant bag constant \\hat{B}_K. With the updated CKM matrix we present the currently-allowed range of the ratio \\vert V_{td}/V...

New approach for rapid assessment of trophic status of Yellow Sea and East China Sea using easy-to-measure parameters

Science.gov (United States)

Kong, Xianyu; Liu, Yanfang; Jian, Huimin; Su, Rongguo; Yao, Qingzhen; Shi, Xiaoyong

2017-10-01

To realize potential cost savings in coastal monitoring programs and provide timely advice for marine management, there is an urgent need for efficient evaluation tools based on easily measured variables for the rapid and timely assessment of estuarine and offshore eutrophication. In this study, using parallel factor analysis (PARAFAC), principal component analysis (PCA), and discriminant function analysis (DFA) with the trophic index (TRIX) for reference, we developed an approach for rapidly assessing the eutrophication status of coastal waters using easy-to-measure parameters, including chromophoric dissolved organic matter (CDOM), fluorescence excitation-emission matrices, CDOM UV-Vis absorbance, and other water-quality parameters (turbidity, chlorophyll a, and dissolved oxygen). First, we decomposed CDOM excitation-emission matrices (EEMs) by PARAFAC to identify three components. Then, we applied PCA to simplify the complexity of the relationships between the water-quality parameters. Finally, we used the PCA score values as independent variables in DFA to develop a eutrophication assessment model. The developed model yielded classification accuracy rates of 97.1%, 80.5%, 90.3%, and 89.1% for good, moderate, and poor water qualities, and for the overall data sets, respectively. Our results suggest that these easy-to-measure parameters could be used to develop a simple approach for rapid in-situ assessment and monitoring of the eutrophication of estuarine and offshore areas.

Confined subdiffusion in three dimensions

International Nuclear Information System (INIS)

Qin Shan-Lin; He Yong

2014-01-01

Three-dimensional (3D) Fick's diffusion equation and fractional diffusion equation are solved for different reflecting boundaries. We use the continuous time random walk model (CTRW) to investigate the time-averaged mean square displacement (MSD) of a 3D single particle trajectory. Theoretical results show that the ensemble average of the time-averaged MSD can be expressed analytically by a Mittag—Leffler function. Our new expression is in agreement with previous formulas in two limiting cases: <δ 2 -bar> ∼ Δ in short lag time and <δ 2 -bar> ∼ Δ 1-α in long lag time. We also simulate the experimental data of mRNA diffusion in living E. coli using a 3D CTRW model under confined and crowded conditions. The simulation results are well consistent with experimental results. The calculations of power spectral density (PSD) further indicate the subdiffsive behavior of an individual trajectory. (general)

Ultra-Weak Fiber Bragg Grating Sensing Network Coated with Sensitive Material for Multi-Parameter Measurements

OpenAIRE

Bai, Wei; Yang, Minghong; Hu, Chenyuan; Dai, Jixiang; Zhong, Xuexiang; Huang, Shuai; Wang, Gaopeng

2017-01-01

A multi-parameter measurement system based on ultra-weak fiber Bragg grating (UFBG) array with sensitive material was proposed and experimentally demonstrated. The UFBG array interrogation principle is time division multiplex technology with two semiconductor optical amplifiers as timing units. Experimental results showed that the performance of the proposed UFBG system is almost equal to that of traditional FBG, while the UFBG array system has obvious superiority with potential multiplexing ...

THE OPTIMIZATION OF TECHNOLOGICAL MINING PARAMETERS IN QUARRY FOR DIMENSION STONE BLOCKS QUALITY IMPROVEMENT BASED ON PHOTOGRAMMETRIC TECHNIQUES OF MEASUREMENT

Directory of Open Access Journals (Sweden)

Ruslan Sobolevskyi

2018-01-01

Full Text Available This research focuses on patterns of change in the dimension stone commodity blocks quality production on previously identifi ed and measured geometrical parameters of natural cracks, modelling and planning out the fi nal dimension of stone products and fi nished products based on the proposed digital photogrammetric techniques. The optimal parameters of surveying are investigated and the infl uence of surveying distance to length and crack area is estimated. Rational technological parameters of dimension stone blocks production are taken into account.

Model-independent measurement of mixing parameters in $D^0 \\to K_S^0 \\pi^+ \\pi^-$ decays

CERN Document Server

Aaij, Roel; Adeva, Bernardo; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; d'Argent, Philippe; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bizzeti, Andrea; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Demmer, Moritz; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Ruscio, Francesco; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fohl, Klaus; Fol, Philip; Fontana, Marianna; Fontanelli, Flavio; Forshaw, Dean Charles; Forty, Roger; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gauld, Rhorry; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gligorov, V.V.; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greening, Edward; Gregson, Sam; Griffith, Peter; Grillo, Lucia; Grünberg, Oliver; Gui, Bin; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; He, Jibo; Head, Timothy; Heijne, Veerle; Hennessy, Karol; Henrard, Pierre; Henry, Louis; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hoballah, Mostafa; Hombach, Christoph; Hulsbergen, Wouter; Humair, Thibaud; Hussain, Nazim; Hutchcroft, David; Hynds, Daniel; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jing, Fanfan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Karbach, Moritz; Karodia, Sarah; Kecke, Matthieu; Kelsey, Matthew; Kenyon, Ian; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Klaver, Suzanne; Klimaszewski, Konrad; Kochebina, Olga; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Kozeiha, Mohamad; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krocker, Georg; Krokovny, Pavel; Kruse, Florian; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Lefèvre, Regis; Leflat, Alexander; Lefrançois, Jacques; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Liles, Myfanwy; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Liu, Xuesong; Loh, David; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Mapelli, Alessandro; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Melnychuk, Dmytro; Merk, Marcel; Michielin, Emanuele; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Molina Rodriguez, Josue; Monroy, Ignacio Alberto; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Mussini, Manuel; Muster, Bastien; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi-Dung; Nguyen-Mau, Chung; Niess, Valentin; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Okhrimenko, Oleksandr; Oldeman, Rudolf; Onderwater, Gerco; Osorio Rodrigues, Bruno; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Pappenheimer, Cheryl; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pilař, Tomas; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rama, Matteo; Rangel, Murilo; Raniuk, Iurii; Rauschmayr, Nathalie; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; Reid, Matthew; dos Reis, Alberto; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vincente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Roiser, Stefan; Romanovsky, Vladimir; Romero Vidal, Antonio; Ronayne, John William; Rotondo, Marcello; Rouvinet, Julien; Ruf, Thomas; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sagidova, Naylya; Sail, Paul; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Edmund; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Soomro, Fatima; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefkova, Slavorima; Steinkamp, Olaf; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Swientek, Stefan; Syropoulos, Vasileios; Szczekowski, Marek; Szumlak, Tomasz; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Todd, Jacob; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Torr, Nicholas; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vázquez Sierra, Carlos; Vecchi, Stefania; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Volkov, Vladimir; Vollhardt, Achim; Volyanskyy, Dmytro; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wandernoth, Sebastian; Wang, Jianchun; Ward, David; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wyllie, Kenneth; Xie, Yuehong; Xu, Zhirui; Yang, Zhenwei; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhelezov, Alexey; Zhokhov, Anatoly; Zhong, Liang; Zucchelli, Stefano

2016-04-06

The first model-independent measurement of the charm mixing parameters in the decay $D^0 \\to K_S \\pi^+ \\pi^-$ is reported, using a sample of $pp$ collision data recorded by the LHCb experiment, corresponding to an integrated luminosity of 1.0 fb$^{-1}$ at a centre-of-mass energy of 7 TeV. The measured values are \\begin{eqnarray*} x &=& ( -0.86 \\pm 0.53 \\pm 0.17 ) \\times 10^{-2}, \\\\ y &=& ( +0.03 \\pm 0.46 \\pm 0.13 ) \\times 10^{-2}, \\end{eqnarray*} where the first uncertainties are statistical and include small contributions due to the external input for the strong phase measured by the CLEO collaboration, and the second uncertainties are systematic.

Ultraviolet Fluorescence LiDAR (UFL as a Measurement Tool for Water Quality Parameters in Turbid Lake Conditions

Directory of Open Access Journals (Sweden)

Heiko Balzter

2013-09-01

Full Text Available Despite longstanding contributions to oceanography, similar use of fluorescence light detection and ranging (LiDAR in lake settings is not routine. The potential for ship-mounted, multispectral Ultraviolet Fluorescence LiDAR (UFL to provide rapid, high-resolution data in variably turbid and productive lake conditions are investigated here through a series of laboratory tank and field measurements carried out on Lake Balaton, Hungary. UFL data, calibrated empirically to a set of coinciding conventionally-analyzed samples, provide simultaneous estimates of three important parameters-chlorophyll a(chla, total suspended matter (TSM and colored dissolved organic matter (CDOM. Successful UFL retrievals from both laboratory and field measurements were achieved for chla (0.01–378 mg∙m−3; R = 0.83–0.92, TSM (0.1–130 g∙m−3; R = 0.90–0.96 and CDOM (0.003–0.125 aCDOM(440; R = 0.80–0.97. Fluorescence emission at 685 nm is shown through tank measurements to display robust but distinct relationships with chla concentration for the two cultured algae species investigated (cyanobacteria, Cylindrospermopsis raciborskii, and chlorophyta, Scenedesmus armatus. The ratio between fluorescence emissions measured at 650 nm, related to the phycocyanin fluorescence maximum, to that at 685 nm is demonstrated to effectively distinguish these two species. Validation through both laboratory measurements and field measurements confirmed that site specific calibration is necessary. This study presents the first known assessment and application of ship-mounted fluorescence LiDAR in freshwater lake conditions and demonstrates the use of UFL in measuring important water quality parameters despite the more complicated hydro-optic conditions of inland waters.

Safeguards systems parameters

International Nuclear Information System (INIS)

Avenhaus, R.; Heil, J.

1979-01-01

In this paper analyses are made of the values of those parameters that characterize the present safeguards system that is applied to a national fuel cycle; those values have to be fixed quantitatively so that all actions of the safeguards authority are specified precisely. The analysis starts by introducing three categories of quantities: The design parameters (number of MBAs, inventory frequency, variance of MUF, verification effort and false-alarm probability) describe those quantities whose values have to be specified before the safeguards system can be implemented. The performance criteria (probability of detection, expected detection time, goal quantity) measure the effectiveness of a safeguards system; and the standards (threshold amount and critical time) characterize the magnitude of the proliferation problem. The means by which the values of the individual design parameters can be determined with the help of the performance criteria; which qualitative arguments can narrow down the arbitrariness of the choice of values of the remaining parameters; and which parameter values have to be fixed more or less arbitrarily, are investigated. As a result of these considerations, which include the optimal allocation of a given inspection effort, the problem of analysing the structure of the safeguards system is reduced to an evaluation of the interplay of only a few parameters, essentially the quality of the measurement system (variance of MUF), verification effort, false-alarm probability, goal quantity and probability of detection

Experimental Platform for measuring the parameters of magnetization of a transformer in a quasi-static transitional regime

International Nuclear Information System (INIS)

Milovanski, Vasil; , Blagoevgrad (Bulgaria))" data-affiliation=" (HMS “Acad. S. P. Corolov, Blagoevgrad (Bulgaria))" >Stoyanov, Krasimir; Milovanska, Stefani

2013-01-01

Some opportunities for development of an experimental module for magnetic research have been examined in the current paper. The goal is to attain a more accurate reading of the measured electrical signals which are directly related to the magnetic parameters and characteristics of the ferromagnetic material

Calculated and measured brachytherapy dosimetry parameters in water for the Xoft Axxent X-Ray Source: an electronic brachytherapy source.

Science.gov (United States)

Rivard, Mark J; Davis, Stephen D; DeWerd, Larry A; Rusch, Thomas W; Axelrod, Steve

2006-11-01

A new x-ray source, the model S700 Axxent X-Ray Source (Source), has been developed by Xoft Inc. for electronic brachytherapy. Unlike brachytherapy sources containing radionuclides, this Source may be turned on and off at will and may be operated at variable currents and voltages to change the dose rate and penetration properties. The in-water dosimetry parameters for this electronic brachytherapy source have been determined from measurements and calculations at 40, 45, and 50 kV settings. Monte Carlo simulations of radiation transport utilized the MCNP5 code and the EPDL97-based mcplib04 cross-section library. Inter-tube consistency was assessed for 20 different Sources, measured with a PTW 34013 ionization chamber. As the Source is intended to be used for a maximum of ten treatment fractions, tube stability was also assessed. Photon spectra were measured using a high-purity germanium (HPGe) detector, and calculated using MCNP. Parameters used in the two-dimensional (2D) brachytherapy dosimetry formalism were determined. While the Source was characterized as a point due to the small anode size, S700 Source exhibited depth dose behavior similar to low-energy photon-emitting low dose rate sources 125I and l03Pd, yet with capability for variable and much higher dose rates and subsequently adjustable penetration capabilities. This paper presents the calculated and measured in-water brachytherapy dosimetry parameters for the model S700 Source at the aforementioned three operating voltages.

In-core program for on line measurements of neutron, photon and nuclear heating parameters inside Jules Horowitz MTR reactor

International Nuclear Information System (INIS)

Lyoussi, A.; Reynard-Carette, C.

2014-01-01

Accurate on-line measurements of key parameters inside experimental channels of Material Testing Reactor are necessary to dimension the irradiation devices and consequently to conduct smart experiments on fuels and materials under suitable conditions. In particular the quantification of nuclear heating, a relevant parameter to reach adapted thermal conditions, has to be improved. These works focus on an important collaborative program between CEA and Aix-Marseille University called INCORE (Instrumentation for Nuclear radiations and Calorimetry On-line in Reactor) dedicated to the development of a new measurement methodology to quantify both nuclear heating and accurate radiation flux levels (neutrons and photons). The methodology, which is based on experiments carried out under irradiation conditions with a multi-sensor device (ionization chamber, fission chamber, gamma thermometer, calorimeter, SPND, SPGD) as well as works performed out-of nuclear/radiative environment on a reference sensor used to measure nuclear heating (calorimeter), is presented (authors)

Measurement of parameters of extracted beams of charged particles at the LVE accelerating complex; Izmerenie parametrov vyvedennykh puchkov zaryazhennykh chastits na uskoritel`nom komplekse LVEh

Energy Technology Data Exchange (ETDEWEB)

Balandikov, A N; Volkov, V I; Gorchenko, V M [and others

1996-12-31

Paper described equipment to measure intensity and space parameters of charged particle beams to be output from the JINR synchrophasotron. Equipment of preliminary recording of signals from multiwire ionization chambers was developed to measure space parameters of beams. 6 refs.; 5 figs.

Direct Extraction of InP/GaAsSb/InP DHBT Equivalent-Circuit Elements From S-Parameters Measured at Cut-Off and Normal Bias Conditions

DEFF Research Database (Denmark)

Johansen, Tom Keinicke; Leblanc, Rémy; Poulain, Julien

2016-01-01

A unique direct parameter extraction method for the small-signal equivalent-circuit model of InP/GaAsSb/InP double heterojunction bipolar transistors (DHBTs) is presented. $S$-parameters measured at cut-off bias are used, at first, to extract the distribution factor $X_{0}$ for the base-collector......A unique direct parameter extraction method for the small-signal equivalent-circuit model of InP/GaAsSb/InP double heterojunction bipolar transistors (DHBTs) is presented. $S$-parameters measured at cut-off bias are used, at first, to extract the distribution factor $X_{0}$ for the base......-collector capacitance at zero collector current and the collector-to-emitter overlap capacitance $C_{ceo}$ present in InP DHBT devices. Low-frequency $S$-parameters measured at normal bias conditions then allows the extraction of the external access resistances $R_{bx}$, $R_{e}$, and $R_{cx}$ as well as the intrinsic...

An Inexpensive, Implantable Electronic Sensor for Autonomous Measurement of Snow Pack Parameters

Science.gov (United States)

De Roo, R. D.; Haengel, E.; Rogacki, S.

2015-12-01

Snow accumulations on the ground are an important source of water in many parts of the world. Mapping the accumulation, usually represented as the snow water equivalent (SWE), is valuable for water resource management. The longest record of regional and global maps of SWE are from orbiting microwave radiometers, which do not directly measure SWE but rather measure the scatter darkening from the snow pack. Robustly linking the scatter darkening to SWE eludes us to this day, in part because the snow pack is highly variable in both time and space. The data needed is currently collected by hand in "snow pits," and the labor-intensive process limits the size of the data sets that can be obtained. In particular, time series measurements are only a one or two samples per day at best, and come at the expense of spatial sampling. We report on the development of a low-power wireless device that can be embedded within a snow pack to report on some of the critical parameters needed to understand scatter darkening. The device autonomously logs temperature, the microwave dielectric constant and infrared backscatter local to the device. The microwave dielectric constant reveals the snow density and the presence of liquid water, while the infrared backscatter measurement, together with the density measurement, reveals a characteristic grain size of the snow pack. The devices are made to be inexpensive (less than $200 in parts each) and easily replicated, so that many can be deployed to monitor variations vertically and horizontally in the snow pack. The low-power operation is important both for longevity of observations as well as insuring minimal anomalous metamorphism of the snow pack. The hardware required for the microwave measurement is intended for wireless communications, and this feature will soon be implemented for near real-time monitoring of snow conditions. We will report on the design, construction and initial deployment of about 30 of these devices in northern lower

Measurement of performance parameters of plasma source for plasma opening switch on Qiangguang-Ⅰ generator

International Nuclear Information System (INIS)

Luo Weixi; Zeng Zhengzhong; Lei Tianshi; Wang Liangping; Hu Yixiang; Sun Tieping; Huang Tao

2012-01-01

The plasma source (cable guns) of the plasma opening switch (POS) on Qiangguang Ⅰ generator was chosen as the study object. The plasma source performance was investigated by using charge collectors. Experimental results show that the plasma ejection density is positively correlated with the structural parameter, the distance between gun core tip and muzzle plane, and the plasma ejection velocity is negatively correlated with the parameter. The increasing rate of plasma ejection density is less than that of drive current. As far as a plasma source with tens of cable plasma guns is concerned, the influence of single cable gun's discharge dispersancy on plasma uniformity is little. Analysis of uncertainty shows that the uncertainty of measurement can be reduced by increasing the number of experiments and averaging the results. The combined standard uncertainty of plasma ejection density is less than 10%. (authors)

Reconstruction of the ion plasma parameters from the current measurements: mathematical tool

Directory of Open Access Journals (Sweden)

E. Séran

Full Text Available Instrument d’Analyse du Plasma (IAP is one of the instruments of the newly prepared ionospheric mission Demeter. This analyser was developed to measure flows of thermal ions at the altitude of ~ 750 km and consists of two parts: (i retarding potential analyser (APR, which is utilised to measure the energy distribution of the ion plasma along the sensor look direction, and (ii velocity direction analyser (ADV, which is used to measure the arrival angle of the ion flow with respect to the analyser axis. The necessity to obtain quick and precise estimates of the ion plasma parameters has prompted us to revise the existing mathematical tool and to investigate different instrumental limitations, such as (i finite angular aperture, (ii grid transparency, (iii potential depression in the space between the grid wires, (iv losses of ions during their passage between the entrance diaphragm and the collector. Simple analytical expressions are found to fit the currents, which are measured by the APR and ADV collectors, and show a very good agreement with the numerical solutions. It was proven that the fitting of the current with the model functions gives a possibility to properly resolve even minor ion concentrations and to find the arrival angles of the ion flow in the multi-species plasma. The discussion is illustrated by an analysis of the instrument response in the ionospheric conditions which are predicted by the International Reference Ionosphere (IRI model.

Key words. Ionosphere (plasma convection; instruments and techniques – Space plasma physics (experimental and mathematical techniques

Reconstruction of the ion plasma parameters from the current measurements: mathematical tool

Directory of Open Access Journals (Sweden)

E. Séran

2003-05-01

Full Text Available Instrument d’Analyse du Plasma (IAP is one of the instruments of the newly prepared ionospheric mission Demeter. This analyser was developed to measure flows of thermal ions at the altitude of ~ 750 km and consists of two parts: (i retarding potential analyser (APR, which is utilised to measure the energy distribution of the ion plasma along the sensor look direction, and (ii velocity direction analyser (ADV, which is used to measure the arrival angle of the ion flow with respect to the analyser axis. The necessity to obtain quick and precise estimates of the ion plasma parameters has prompted us to revise the existing mathematical tool and to investigate different instrumental limitations, such as (i finite angular aperture, (ii grid transparency, (iii potential depression in the space between the grid wires, (iv losses of ions during their passage between the entrance diaphragm and the collector. Simple analytical expressions are found to fit the currents, which are measured by the APR and ADV collectors, and show a very good agreement with the numerical solutions. It was proven that the fitting of the current with the model functions gives a possibility to properly resolve even minor ion concentrations and to find the arrival angles of the ion flow in the multi-species plasma. The discussion is illustrated by an analysis of the instrument response in the ionospheric conditions which are predicted by the International Reference Ionosphere (IRI model.Key words. Ionosphere (plasma convection; instruments and techniques – Space plasma physics (experimental and mathematical techniques

Reliability of measuring abductor hallucis muscle parameters using two different diagnostic ultrasound machines

Directory of Open Access Journals (Sweden)

Cameron Alyse FM

2009-11-01

Full Text Available Abstract Background Diagnostic ultrasound provides a method of analysing soft tissue structures of the musculoskeletal system effectively and reliably. The aim of this study was to evaluate within and between session reliability of measuring muscle dorso-plantar thickness, medio-lateral length and cross-sectional area, of the abductor hallucis muscle using two different ultrasound machines, a higher end Philips HD11 Ultrasound machine and clinically orientated Chison 8300 Deluxe Digital Portable Ultrasound System. Methods The abductor hallucis muscle of both the left and right feet of thirty asymptomatic participants was imaged and then measured using both ultrasound machines. Interclass correlation coefficients (ICC with 95% confidence intervals (CI were used to calculate both within and between session intra-tester reliability. Standard error of the measurement (SEM calculations were undertaken to assess difference between the actual measured score across trials and the smallest real difference (SRD was calculated from the SEM to indicate the degree of change that would exceed the expected trial to trial variability. Results The ICCs, SEM and SRD for dorso-plantar thickness and medial-lateral length were shown to have excellent to high within and between-session reliability for both ultrasound machines. The between-session reliability indices for cross-sectional area were acceptable for both ultrasound machines. Conclusion The results of the current study suggest that regardless of the type ultrasound machine, intra-tester reliability for the measurement the abductor hallucis muscle parameters is very high.

Passive and active measurements of radon-related parameters inside ancient Egyptian tombs in Luxor

Energy Technology Data Exchange (ETDEWEB)

Abo-Elmagd, M [Radiation Measurements Department, National Institute for Standard, Giza (Egypt); Metwally, S M [Faculty of Science, Department of Physics, Ain Shams University, Cairo (Egypt); El-Fiki, S A [Faculty of Science, Department of Physics, Ain Shams University, Cairo (Egypt); Eissa, H M [Radiation Measurements Department, National Institute for Standard, Giza (Egypt); Salama, E [Faculty of Science, Department of Physics, Ain Shams University, Cairo (Egypt)

2007-01-15

Radon and its related parameters were measured using passive (CR-39) and active (Alpha-Guard analyzer) techniques inside seven ancient Egyptian tombs of the Valley of the Kings in Luxor. The measurements were performed throughout the winter and summer seasons. The average radon concentration inside the tombs ranges from 96.9+/-10.8 to 415+/-43Bqm{sup -3} in winter and from 86.4+/-13.8 to 6102.8+/-573.6 in summer. Because of the variations of tombs dimensions and their ventilation systems, the equilibrium factor between radon and its progeny ranges from 0.228+/-0.02 to 0.95+/-0.05. The effective doses for the tomb workers, the tour guide and visitors were calculated. Active measurements show that radon exhalation rates range from 0.68+/-0.30 to 1.47+/-0.27Bqm{sup -2}h{sup -1} and from 0.60+/-0.03 to 1.42+/-0.05Bqm{sup -2}h{sup -1} for passive measurements. The real radium content was determined for all examined tombs by HPGe detector, while the effective radium content was obtained by Alpha-Guard and sealed cup techniques. Radon exhalation rates were correlated with the real radium content. A good correlation was found between active and passive measurements of radon exhalation rate.

Passive and active measurements of radon-related parameters inside ancient Egyptian tombs in Luxor

International Nuclear Information System (INIS)

Abo-Elmagd, M.; Metwally, S.M.; El-Fiki, S.A.; Eissa, H.M.; Salama, E.

2007-01-01

Radon and its related parameters were measured using passive (CR-39) and active (Alpha-Guard analyzer) techniques inside seven ancient Egyptian tombs of the Valley of the Kings in Luxor. The measurements were performed throughout the winter and summer seasons. The average radon concentration inside the tombs ranges from 96.9+/-10.8 to 415+/-43Bqm -3 in winter and from 86.4+/-13.8 to 6102.8+/-573.6 in summer. Because of the variations of tombs dimensions and their ventilation systems, the equilibrium factor between radon and its progeny ranges from 0.228+/-0.02 to 0.95+/-0.05. The effective doses for the tomb workers, the tour guide and visitors were calculated. Active measurements show that radon exhalation rates range from 0.68+/-0.30 to 1.47+/-0.27Bqm -2 h -1 and from 0.60+/-0.03 to 1.42+/-0.05Bqm -2 h -1 for passive measurements. The real radium content was determined for all examined tombs by HPGe detector, while the effective radium content was obtained by Alpha-Guard and sealed cup techniques. Radon exhalation rates were correlated with the real radium content. A good correlation was found between active and passive measurements of radon exhalation rate

Selection of noise parameters for Kalman filter

Institute of Scientific and Technical Information of China (English)

Ka-Veng Yuen; Ka-In Hoi; Kai-Meng Mok

2007-01-01

The Bayesian probabilistic approach is proposed to estimate the process noise and measurement noise parameters for a Kalman filter. With state vectors and covariance matrices estimated by the Kalman filter, the likehood of the measurements can be constructed as a function of the process noise and measurement noise parameters. By maximizing the likklihood function with respect to these noise parameters, the optimal values can be obtained. Furthermore, the Bayesian probabilistic approach allows the associated uncertainty to be quantified. Examples using a single-degree-of-freedom system and a ten-story building illustrate the proposed method. The effect on the performance of the Kalman filter due to the selection of the process noise and measurement noise parameters was demonstrated. The optimal values of the noise parameters were found to be close to the actual values in the sense that the actual parameters were in the region with significant probability density. Through these examples, the Bayesian approach was shown to have the capability to provide accurate estimates of the noise parameters of the Kalman filter, and hence for state estimation.

Medium energy measurements of N-N parameters. Progress in research, January 1, 1983-December 31, 1983

International Nuclear Information System (INIS)

1983-12-01

The aim of the experimental program is the determination of the nucleon-nucleon amplitudes at medium energy. Experiments described include D/sub SS/, D/sub LS/, D/sub SL/, D/sub LL/, and P for p-p elastic scattering, the measurement of polarization observables in ppvector → pvector π + nu and ppvector → ppvector π, and measurements of the spin rotation parameters for pvector d → pvector d elastic scattering at 496, 647, and 800 MeV. Also, progress on an energy dependent proton-carbon analyzing power fit is reported. Current approved LAMPF proposals are described and 1983 publications are listed

Test-retest reliability of spatial and temporal gait parameters in children with cerebral palsy as measured by an electronic walkway.

Science.gov (United States)

Sorsdahl, Anne Brit; Moe-Nilssen, Rolf; Strand, Liv Inger

2008-01-01

The purpose of this study was to examine test-retest reliability of seven selected temporal and spatial gait parameters and asymmetry measures in children with cerebral palsy. Seventeen children with CP between 3 and 13 years of age walked at three different speeds across an electronic walkway of 5.2m. The tests were repeated after approximately 25 min. The scores were normalized to a walking speed of 1.1m/s to avoid the confounding effect of gait speed on speed dependent gait parameters. Intraclass correlation coefficients (ICC(1,1) and ICC(3,1)) with 95% confidence intervals, within-subject standard deviation (S(w)) and smallest detectable difference (SDD) were calculated. The relative reliability of cadence, step length, stride length and single stance time was high to excellent (ICC(1,1) between 0.73 and 0.95), while it was poor for step width (ICC(1,1)=0.27 and 0.35). The relative reliability for two calculated asymmetry measures were high for the step length index (ICC(1,1)=0.82) and moderate for the single stance time index (ICC(1,1)=0.49). The absolute reliability values for all gait parameters are reported. Five of seven gait parameters measured by an electronic walkway and normalized to a common walking speed, appear to be highly repeatable in a short-term time span in children with CP who were able to walk without assistive walking devices, provided sufficient cognitive function.

Measurement of the asymmetry parameter for the decay $\\bar\\Lambda \\to \\bar p\\pi^+$

OpenAIRE

BES collaboration

2009-01-01

Based on a sample of $58\\times10^6J/\\psi$ decays collected with the BESII detector at the BEPC, the $\\bar\\Lambda$ decay parameter $\\alpha_{\\bar\\Lambda}$ for $\\bar\\Lambda\\to \\bar p \\pi^+$ is measured using about 9000 $J/\\psi\\to\\Lambda\\bar\\Lambda\\to p \\bar p \\pi^+\\pi^-$ decays. A fit to the joint angular distributions yields $\\alpha_{\\bar\\Lambda}(\\bar\\Lambda\\to \\bar p\\pi^+)=-0.755\\pm0.083\\pm0.063$, where the first error is statistical, and the second systematic.

Measurements of spin parameters in p-p elastic scattering at 6 GeV/c

International Nuclear Information System (INIS)

Linn, S.L.; Perlmutter, A.; Crosbie, E.A.; Ratner, L.G.; Schultz, P.F.; O'Fallon, J.R.; Cameron, P.R.; Crabb, D.G.; Fernow, R.C.; Hansen, P.H.; Krisch, A.D.; Salthouse, A.J.; Sandler, B.; Shima, T.; Terwilliger, K.M.

1982-01-01

We measured the differential cross section for proton-proton elastic scattering in 6 GeV/c, with both initial spins oriented normal to the scattering plane. The analyzing power A shows significant structure with a large broad peak reaching about 24% near P/sub perpendicular/ 2 = 1.6 (GeV/c) 2 . The spin-spin correlation parameter A/sub n/n exhibits more dramatic structure, with a small but very sharp peak rising rapidly to about 13% at 90 0 /sub tsc.m./. This sharp peak may be caused by particle-identity effects

Effects of Different Reconstruction Parameters on CT Volumetric Measurement 
of Pulmonary Nodules

Directory of Open Access Journals (Sweden)

Rongrong YANG

2012-02-01

Full Text Available Background and objective It has been proven that volumetric measurements could detect subtle changes in small pulmonary nodules in serial CT scans, and thus may play an important role in the follow-up of indeterminate pulmonary nodules and in differentiating malignant nodules from benign nodules. The current study aims to evaluate the effects of different reconstruction parameters on the volumetric measurements of pulmonary nodules in chest CT scans. Methods Thirty subjects who underwent chest CT scan because of indeterminate pulmonary nodules in General Hospital of Tianjin Medical University from December 2009 to August 2011 were retrospectively analyzed. A total of 52 pulmonary nodules were included, and all CT data were reconstructed using three reconstruction algorithms and three slice thicknesses. The volumetric measurements of the nodules were performed using the advanced lung analysis (ALA software. The effects of the reconstruction algorithms, slice thicknesses, and nodule diameters on the volumetric measurements were assessed using the multivariate analysis of variance for repeated measures, the correlation analysis, and the Bland-Altman method. Results The reconstruction algorithms (F=13.6, P<0.001 and slice thicknesses (F=4.4, P=0.02 had significant effects on the measured volume of pulmonary nodules. In addition, the coefficients of variation of nine measurements were inversely related with nodule diameter (r=-0.814, P<0.001. The volume measured at the 2.5 mm slice thickness had poor agreement with the volumes measured at 1.25 mm and 0.625 mm, respectively. Moreover, the best agreement was achieved between the slice thicknesses of 1.25 mm and 0.625 mm using the bone algorithm. Conclusion Reconstruction algorithms and slice thicknesses have significant impacts on the volumetric measurements of lung nodules, especially for the small nodules. Therefore, the reconstruction setting in serial CT scans should be consistent in the follow

Identification of hydrological model parameters for flood forecasting using data depth measures

Science.gov (United States)

Krauße, T.; Cullmann, J.

2011-03-01

The development of methods for estimating the parameters of hydrological models considering uncertainties has been of high interest in hydrological research over the last years. Besides the very popular Markov Chain Monte Carlo (MCMC) methods which estimate the uncertainty of model parameters in the settings of a Bayesian framework, the development of depth based sampling methods, also entitled robust parameter estimation (ROPE), have attracted an increasing research interest. These methods understand the estimation of model parameters as a geometric search of a set of robust performing parameter vectors by application of the concept of data depth. Recent studies showed that the parameter vectors estimated by depth based sampling perform more robust in validation. One major advantage of this kind of approach over the MCMC methods is that the formulation of a likelihood function within a Bayesian uncertainty framework gets obsolete and arbitrary purpose-oriented performance criteria defined by the user can be integrated without any further complications. In this paper we present an advanced ROPE method entitled the Advanced Robust Parameter Estimation by Monte Carlo algorithm (AROPEMC). The AROPEMC algorithm is a modified version of the original robust parameter estimation algorithm ROPEMC developed by Bárdossy and Singh (2008). AROPEMC performs by merging iterative Monte Carlo simulations, identifying well performing parameter vectors, the sampling of robust parameter vectors according to the principle of data depth and the application of a well-founded stopping criterion applied in supervised machine learning. The principals of the algorithm are illustrated by means of the Rosenbrock's and Rastrigin's function, two well known performance benchmarks for optimisation algorithms. Two case studies demonstrate the advantage of AROPEMC compared to state of the art global optimisation algorithms. A distributed process-oriented hydrological model is calibrated and

Multi-fractal measures of city-size distributions based on the three-parameter Zipf model

International Nuclear Information System (INIS)

Chen Yanguang; Zhou Yixing

2004-01-01

A multi-fractal framework of urban hierarchies is presented to address the rank-size distribution of cities. The three-parameter Zipf model based on a pair of exponential-type scaling laws is generalized to multi-scale fractal measures. Then according to the equivalent relationship between Zipf's law and Pareto distribution, a set of multi-fractal equations are derived using dual conversion and the Legendre transform. The US city population data coming from the 2000 census are employed to verify the multi-fractal models and the results are satisfying. The multi-fractal measures reveal some strange symmetry regularity of urban systems. While explaining partially the remains of the hierarchical step-like frequency distribution of city sizes suggested by central place theory, the mathematical framework can be interpreted with the entropy-maximizing principle and some related ideas from self-organization

Calculated and measured brachytherapy dosimetry parameters in water for the Xoft Axxent X-Ray Source: An electronic brachytherapy source

International Nuclear Information System (INIS)

Rivard, Mark J.; Davis, Stephen D.; DeWerd, Larry A.; Rusch, Thomas W.; Axelrod, Steve

2006-01-01

A new x-ray source, the model S700 Axxent trade mark sign X-Ray Source (Source), has been developed by Xoft Inc. for electronic brachytherapy. Unlike brachytherapy sources containing radionuclides, this Source may be turned on and off at will and may be operated at variable currents and voltages to change the dose rate and penetration properties. The in-water dosimetry parameters for this electronic brachytherapy source have been determined from measurements and calculations at 40, 45, and 50 kV settings. Monte Carlo simulations of radiation transport utilized the MCNP5 code and the EPDL97-based mcplib04 cross-section library. Inter-tube consistency was assessed for 20 different Sources, measured with a PTW 34013 ionization chamber. As the Source is intended to be used for a maximum of ten treatment fractions, tube stability was also assessed. Photon spectra were measured using a high-purity germanium (HPGe) detector, and calculated using MCNP. Parameters used in the two-dimensional (2D) brachytherapy dosimetry formalism were determined. While the Source was characterized as a point due to the small anode size, P (5) were 0.20, 0.24, and 0.29 for the 40, 45, and 50 kV voltage settings, respectively. For 1 125 I and 103 Pd, yet with capability for variable and much higher dose rates and subsequently adjustable penetration capabilities. This paper presents the calculated and measured in-water brachytherapy dosimetry parameters for the model S700 Source at the aforementioned three operating voltages

Problems posed by the model of bipolar transistor used and the measurement of the parameters associated in the IMAG.1 program

International Nuclear Information System (INIS)

Imbrechts, Claude; Le Ber, Jacques

1969-02-01

The IMAG-1 program uses, for diodes and transistors, bipolar models of the Ebers and Moll modified type. This model is already used in the US NET.1 program. The object of this paper is essentially to pose the problem of the measurement of the parameters associated with the Ebers and Moll model. However, the authors' ambition is not to solve it but to attract attention to the need to speak the same language to define the model, the methods of measuring the associated parameters and their dispersions in order to better appreciate inaccuracies due to the model's approximations

Measurement of Water Quality Parameters for Before and After Maintenance Service in Water Filter System

Directory of Open Access Journals (Sweden)

Shaharudin Nuraida

2017-01-01

Full Text Available An adequate supply of safe drinking water is one of major ways to obtain healthy life. Water filter system is one way to improve the water quality. However, to maintain the performance of the system, it need to undergo the maintenance service. This study evaluate the requirement of maintenance service in water filter system. Water quality was measured before and after maintenance service. Parameters measured were pH, turbidity, residual chlorine, nitrate and heavy metals and these parameters were compared with National Drinking Water Quality Standards. Collection of data were involved three housing areas in Johor. The quality of drinking water from water filter system were analysed using pH meter, turbidity meter, DR6000 and Inductively Coupled Plasma-Mass Spectrometer. pH value was increased from 16.4% for before maintenance services to 30.7% for after maintenance service. Increment of removal percentage for turbidity, residual chlorine and nitrate after maintenance were 21.5, 13.6 and 26.7, respectively. This result shows that maintenance service enhance the performance of the system. However, less significant of maintenance service for enhance the removal of heavy metals which the increment of removal percentage in range 0.3 to 9.8. Only aluminium shows percentage removal for after maintenance with 92.8% lower compared to before maintenance service with 95.5%.

Study of electroweak parameters at LEP

International Nuclear Information System (INIS)

Blum, W.

1991-10-01

The measurement of the line shape and asymmetry parameters of the Z 0 in its leptonic and hadronic decays are reviewed. Progress is reported about a considerable increase in measurement accuracy. Several tests of the Standard Model confirm it to better than one per cent. New values for the effective mixing parameter are derived from the line shape parameters averaged over the four LEP experiments. The corresponding limits on the top mass are presented. (orig.)

Comparison between wire-mesh sensors and conductive needle-probes for measurements of two-phase flow parameters

International Nuclear Information System (INIS)

Manera, A.; Ozar, B.; Paranjape, S.; Ishii, M.; Prasser, H.-M.

2009-01-01

Measurements of two-phase flow parameters such as void-fraction, bubble velocities, and interfacial area density have been performed in an upwards air-water flow at atmospheric pressure by means of a four-tip needle-probe and a wire-mesh sensor. For the first time, a direct comparison between the two measuring techniques has been carried out. Both techniques are based on the measurement of the fluid conductivity. For void-fraction and velocity measurements, similarity exists between the two methodologies for signal analysis. A significantly different approach is followed, instead, for the estimation of the interfacial area concentration: while the evaluation based on the needle-probe signal is carried out by using projections of the gas-liquid interface velocity, the evaluation based on the wire-mesh signals consist in a full reconstruction of the bubbles interfaces. The comparison between the two techniques shows a good agreement.

Comparison between wire-mesh sensors and conductive needle-probes for measurements of two-phase flow parameters

Energy Technology Data Exchange (ETDEWEB)

Manera, A. [Paul Scherrer Institute, 5232 Villigen (Switzerland); Research Center Dresden Rossendorf, Dresden (Germany)], E-mail: annalisa.manera@psi.ch; Ozar, B.; Paranjape, S.; Ishii, M. [Purdue University, West Lafayette (United States); Prasser, H.-M. [Research Center Dresden Rossendorf, Dresden (Germany); ETH Zuerich, Sonneggstrasse 3, 8092 Zuerich (Switzerland)

2009-09-15

Measurements of two-phase flow parameters such as void-fraction, bubble velocities, and interfacial area density have been performed in an upwards air-water flow at atmospheric pressure by means of a four-tip needle-probe and a wire-mesh sensor. For the first time, a direct comparison between the two measuring techniques has been carried out. Both techniques are based on the measurement of the fluid conductivity. For void-fraction and velocity measurements, similarity exists between the two methodologies for signal analysis. A significantly different approach is followed, instead, for the estimation of the interfacial area concentration: while the evaluation based on the needle-probe signal is carried out by using projections of the gas-liquid interface velocity, the evaluation based on the wire-mesh signals consist in a full reconstruction of the bubbles interfaces. The comparison between the two techniques shows a good agreement.

Research on Joint Parameter Inversion for an Integrated Underground Displacement 3D Measuring Sensor

Directory of Open Access Journals (Sweden)

Nanying Shentu

2015-04-01

Full Text Available Underground displacement monitoring is a key means to monitor and evaluate geological disasters and geotechnical projects. There exist few practical instruments able to monitor subsurface horizontal and vertical displacements simultaneously due to monitoring invisibility and complexity. A novel underground displacement 3D measuring sensor had been proposed in our previous studies, and great efforts have been taken in the basic theoretical research of underground displacement sensing and measuring characteristics by virtue of modeling, simulation and experiments. This paper presents an innovative underground displacement joint inversion method by mixing a specific forward modeling approach with an approximate optimization inversion procedure. It can realize a joint inversion of underground horizontal displacement and vertical displacement for the proposed 3D sensor. Comparative studies have been conducted between the measured and inversed parameters of underground horizontal and vertical displacements under a variety of experimental and inverse conditions. The results showed that when experimentally measured horizontal displacements and vertical displacements are both varied within 0 ~ 30 mm, horizontal displacement and vertical displacement inversion discrepancies are generally less than 3 mm and 1 mm, respectively, under three kinds of simulated underground displacement monitoring circumstances. This implies that our proposed underground displacement joint inversion method is robust and efficient to predict the measuring values of underground horizontal and vertical displacements for the proposed sensor.

Interpretation of acoustic parameters obtained by EMAR measurement for non-destructive hydrogen concentration measurement in Zr alloy

International Nuclear Information System (INIS)

Nakatsuka, Masafumi; Uchida, Katsuya; Miyazaki, Akihiro; Ishii, Yoshiaki

2007-01-01

An obvious quantitative relation between hydrogen concentrations in zirconium alloy and acoustic anisotropy parameters obtained by the electromagnetic acoustic resonance (EMAR) method was reported. To elucidate the mechanism, the acoustic parameters were calculated based on the elastic theory and the equation of motion. The acoustic parameters of obtained by the EMAR method were interpreted quantitatively using the anisotropic elastic constants of the specimen, and value calculated from texture data for non-hydrogen charged specimens showed good agreement with those obtained by the EMAR method. Calculated temperature dependence of the acoustic anisotropy for the non-hydrogen charged specimen also agreed well with that by the EMAR method. The consistencies demonstrated that the absolute values of the acoustic parameters for non-hydrogen charged specimen can be calculated from both the texture data of (0002) pole figure and the elastic constants of the specimen. Hydrogen addition up to approximately 650ppm was found not to change the original (0002) pole figure and, correspondingly, no hydrogen concentration dependence of the acoustic parameters was obtained from the calculation. These results implied that the zirconium hydride itself played an important role for the change in the acoustic parameters of the hydrogen charged specimens, and the importance of obtaining the information on the elastic constants of the zirconium hydride was pointed out. (author)

A measurement of the Z boson resonance parameters at the SLC [Stanford Linear Center

International Nuclear Information System (INIS)

Nash, J.

1989-11-01

We have measured the resonance parameters of the Z boson using 480 hadronic and Leptonic Z decays collected by the Mark II Detector at the Stanford Linear Collider. We find the Mass to be 91.14 ± 0.12 GeV/c 2 , and the width to be 2.42 +0.45 -0.35 GeV. If we constrain the visible width to its Standard Model value, we find a partial width to invisible decay modes corresponding to 2.8 ± 0.6 neutrino species with a 95% confidence level limit of 3.9. 9 refs., 1 fig., 4 tabs

Lattice-parameter-difference measurement of heteroepitaxial structures by means of extremely asymmetrical Bragg diffraction

International Nuclear Information System (INIS)

Pietsch, U.; Borchard, W.

1987-01-01

The sensitivity of measurements of the lattice-parameter difference in monocrystalline heterostructures can be enhanced by use of an extremely asymmetrical diffraction geometry. If the angle of incidence is somewhat higher than the critical angle for total external reflection, the Bragg peak is shifted from the position calculated by kinematic theory. The amount of shift depends on the angle of incidence as well as on the mass density of the material used. For heteroepitaxial structures both the layer and the substrate peaks are shifted but by different amounts. Therefore it becomes possible to characterize layers of totally lattice-matched structures also. (orig.)

Measurement of the longitudinal parameters of an electron beam in a storage ring

International Nuclear Information System (INIS)

Krinsky, S.

1989-01-01

We discuss the determination of the longitudinal parameters of a bunched beam of electrons or positrons circulating in a storage ring. From the analysis of the beam current observed at a fixed azimuthal location, one can learn much about the longitudinal behavior. We present an elementary analysis of the time-dependence of the current. In particular, we discuss the determination of the average current, bunch length, synchrotron oscillation frequency, and the coherent synchrotron oscillation modes associated with longitudinal instabilities. A brief discussion is also given of the incoherent synchrotron oscillations, or Schottky noise. We review the electromagnetic field traveling with a charge in uniform motion, and introduce some of the most common devices used to detect this field: capacitive pick-up, stripline monitor, and DC beam current transformer. Our paper is organized as follows: We discuss the analysis of the time-dependence of the beam current. Then, the measurement of the current is considered. Finally, we describe some measurements of energy spread and bunch lengthening made recently at SLAC on the SLC damping ring. 12 refs., 6 figs

Design and development of microcontroller-based clinical chemistry analyser for measurement of various blood biochemistry parameters.

Science.gov (United States)

Taneja, S R; Gupta, R C; Kumar, Jagdish; Thariyan, K K; Verma, Sanjeev

2005-01-01

Clinical chemistry analyser is a high-performance microcontroller-based photometric biochemical analyser to measure various blood biochemical parameters such as blood glucose, urea, protein, bilirubin, and so forth, and also to measure and observe enzyme growth occurred while performing the other biochemical tests such as ALT (alkaline amino transferase), amylase, AST (aspartate amino transferase), and so forth. These tests are of great significance in biochemistry and used for diagnostic purposes and classifying various disorders and diseases such as diabetes, liver malfunctioning, renal diseases, and so forth. An inexpensive clinical chemistry analyser developed by the authors is described in this paper. This is an open system in which any reagent kit available in the market can be used. The system is based on the principle of absorbance transmittance photometry. System design is based around 80C31 microcontroller with RAM, EPROM, and peripheral interface devices. The developed system incorporates light source, an optical module, interference filters of various wave lengths, peltier device for maintaining required temperature of the mixture in flow cell, peristaltic pump for sample aspiration, graphic LCD display for displaying blood parameters, patients test results and kinetic test graph, 40 columns mini thermal printer, and also 32-key keyboard for executing various functions. The lab tests conducted on the instrument include versatility of the analyzer, flexibility of the software, and treatment of sample. The prototype was tested and evaluated over 1000 blood samples successfully for seventeen blood parameters. Evaluation was carried out at Government Medical College and Hospital, the Department of Biochemistry. The test results were found to be comparable with other standard instruments.

Genetic parameters for androstenone, skatole, indole, and human nose scores as measures of boar taint and their relationship with finishing traits

NARCIS (Netherlands)

Windig, J.J.; Mulder, H.A.; Napel, ten J.; Knol, E.F.; Mathur, P.K.; Crump, R.E.

2012-01-01

The purpose of this study was to evaluate measures of boar (Sus scrofa) taint as potential selection criteria to reduce boar taint so that castration of piglets will become unnecessary. Therefore, genetic parameters of boar taint measures and their genetic correlations with finishing traits were

A NEW METHOD TO QUANTIFY AND REDUCE THE NET PROJECTION ERROR IN WHOLE-SOLAR-ACTIVE-REGION PARAMETERS MEASURED FROM VECTOR MAGNETOGRAMS

Energy Technology Data Exchange (ETDEWEB)

Falconer, David A.; Tiwari, Sanjiv K.; Moore, Ronald L. [NASA Marshall Space Flight Center, Huntsville, AL 35812 (United States); Khazanov, Igor, E-mail: David.a.Falconer@nasa.gov [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)

2016-12-20

Projection errors limit the use of vector magnetograms of active regions (ARs) far from the disk center. In this Letter, for ARs observed up to 60° from the disk center, we demonstrate a method for measuring and reducing the projection error in the magnitude of any whole-AR parameter that is derived from a vector magnetogram that has been deprojected to the disk center. The method assumes that the center-to-limb curve of the average of the parameter’s absolute values, measured from the disk passage of a large number of ARs and normalized to each AR’s absolute value of the parameter at central meridian, gives the average fractional projection error at each radial distance from the disk center. To demonstrate the method, we use a large set of large-flux ARs and apply the method to a whole-AR parameter that is among the simplest to measure: whole-AR magnetic flux. We measure 30,845 SDO /Helioseismic and Magnetic Imager vector magnetograms covering the disk passage of 272 large-flux ARs, each having whole-AR flux >10{sup 22} Mx. We obtain the center-to-limb radial-distance run of the average projection error in measured whole-AR flux from a Chebyshev fit to the radial-distance plot of the 30,845 normalized measured values. The average projection error in the measured whole-AR flux of an AR at a given radial distance is removed by multiplying the measured flux by the correction factor given by the fit. The correction is important for both the study of the evolution of ARs and for improving the accuracy of forecasts of an AR’s major flare/coronal mass ejection productivity.

Interobserver and Intraobserver Variability among Measurements of FDG PET/CT Parameters in Pulmonary Tumors

Directory of Open Access Journals (Sweden)

Gülgün Büyükdereli

2016-06-01

Full Text Available Background: 18F-fluorodeoxyglucose (FDG positron emission tomography computed tomography (PET/CT provides information about metabolic and morphologic status of malignancies. Tumor size and standardized uptake value (SUV measurements are crucial for cancer treatment monitoring.: 18F-fluorodeoxyglucose (FDG positron emission tomography computed tomography (PET/CT provides information about metabolic and morphologic status of malignancies. Tumor size and standardized uptake value (SUV measurements are crucial for cancer treatment monitoring. Aims: The purpose of our study was to assess the variability of these measurements performed by observers evaluating lung tumors. Study Design: Retrospective cross-sectional study. Methods: FDG PET/CT images of 97 patients with pulmonary tumors were independently evaluated by two experienced nuclear medicine physicians. Primary tumor size (UDCT, maximum SUV (SUVmax, mean SUV (SUVmean and maximum SUV normalized to liver mean SUV (SUVnliv max were measured by each observer at two different times with an interval of at least 2 weeks. Interobserver and intraobserver variabilities of measurements were evaluated through statistical methods. Results: Size of the lesions varied from 0.81 to 13.6 cm (mean 4.29±2.24 cm. Very good agreement was shown with correlation, Bland-Altman and regression analysis for all measured PET/CT parameters. In the interobserver and intraobserver variability analysis, the Pearson correlation coefficients were greater than 0.96 and 0.98, respectively. Conclusion: Semi-quantitative measurements of pulmonary tumors were highly reproducible when determined by experienced physicians with clinically available software for routine FDG PET/CT evaluation. Consistency may be improved if the same observer performs serial measurements for any one patient.

Sensitivities of Key Parameters in the Preparation of Silver/Silver Chloride Electrodes Used in Harned Cell Measurements of pH

Directory of Open Access Journals (Sweden)

Richard J. C. Brown

2011-08-01

Full Text Available A questionnaire was completed by fourteen world leading national metrology institutes to study the influence of several variables in the preparation of Ag/AgCl electrodes on the accuracy of Harned cell measurements of pH. The performance of each institute in the last decade has been assessed based on their results in eight key comparisons, organized by the Bureau International des Poids et Measures Consultative Committee for Amount of Substance, involving the measurement of pH of phosphate, phthalate, carbonate, borate and tetroxalate buffer solutions. The performance of each laboratory has been correlated to the results of the questionnaire to determine the critical parameters in the preparation of Ag/AgCl electrodes and their sensitivities with respect to the accuracy of pH measurement. This study reveals that the parameters most closely correlated to performance in comparisons are area of electrode wire exposed to the electrolyte, diameter and porosity of the Ag sphere prior to anodisation, amount of Ag converted to AgCl during anodisation, stability times employed for electrodes to reach equilibrium in solution prior to measurement, electrode rejection criteria employed and purity of reagents.

Development of a digital image correlation procedure adapted for kinematic measurements in polycrystals: application to the identification of crystal plasticity laws parameters

International Nuclear Information System (INIS)

Guery, Adrien

2014-01-01

A digital image correlation procedure adapted to kinematic measurements in polycrystals has been developed in this work to identify parameters of crystal plasticity laws. 2D kinematic measurements are performed on the surface of 316LN austenitic steel polycrystals from a sequence of images acquired using a Scanning Electron Microscope (SEM) during in-situ tensile tests for various mean grain sizes. To enable digital image correlation, a speckle adapted to the microscopic scale is deposited onto the specimen surface by a microlithography process. Spatial distortions resulting from both patterning and SEM imaging techniques are quantified. The knowledge of the microstructure at the surface by electron backscattered diffraction allows for kinematic measurements to be performed using an unstructured finite element mesh taking as support the grain or twin boundaries. This same mesh is then used for the simulation of each tensile test on the experimental microstructure with the measured nodal displacements prescribed as boundary conditions with their time evolution. Two local crystal plasticity laws are considered to simulate the observed strain heterogeneities, namely, the Meric-Cailletaud model and the DD-CFC law developed at EDF R and D. Comparisons between measurements and simulations are performed in terms of displacements, strains but also activated slip systems. Last, an inverse identification method is proposed for the identification of the sought constitutive parameters based on both the local displacement fields and the material homogenized behavior. The parameters associated with isotropic hardening of Meric-Cailletaud law are thus identified for various mean grain sizes. It is also shown that some of the interaction parameters of slip systems can be estimated. (author)

Millimeter-Wave Radar Field Measurements and Inversion of Cloud Parameters for the 1999 Mt. Washington Icing Sensors Project

Science.gov (United States)

Pazmany, Andrew L.; Reehorst, Andrew (Technical Monitor)

2001-01-01

The Mount Washington Icing Sensors Project (MWISP) was a multi-investigator experiment with participants from Quadrant Engineering, NOAA Environmental Technology Laboratory (NOAA/ETL), the Microwave Remote Sensing Laboratory (MIRSL) of the University of Massachusetts (UMass), and others. Radar systems from UMass and NOAA/ETL were used to measure X-, Ka-, and W-band backscatter data from the base of Mt. Washington, while simultaneous in-situ particle measurements were made from aircraft and from the observatory at the summit. This report presents range and time profiles of liquid water content and particle size parameters derived from range profiles of radar reflectivity as measured at X-, Ka-, and W-band (9.3, 33.1, and 94.9 GHz) using an artificial neural network inversion algorithm. In this report, we provide a brief description of the experiment configuration, radar systems, and a review of the artificial neural network used to extract cloud parameters from the radar data. Time histories of liquid water content (LWC), mean volume diameter (MVD) and mean Z diameter (MZD) are plotted at 300 m range intervals for slant ranges between 1.1 and 4 km. Appendix A provides details on the extraction of radar reflectivity from measured radar power, and Appendix B provides summary logs of the weather conditions for each day in which we processed data.

Evaluation of the Effects of Menstrual Cycle on Anterior Chamber Parameters as Measured with Pentacam

Directory of Open Access Journals (Sweden)

Arzu Seyhan Karatepe

2013-01-01

Full Text Available Pur po se: To evaluate the effects of endogenous gonadotropic hormones (follicle-stimulating hormone, luteinizing hormone and sex steroids (progesterone, estrogen to anterior segment parameters. Ma te ri al and Met hod: Thirty healthy females who had a menstrual cycle of 28±1 day and with a mean age of 36.5±7.56 (range, 20 – 46 years were included in the study. Starting from the first day of their cycle, Pentacam Scheimpflug camera measurements were performed on the 1st, 3rd, 7th, 12th, 16th, 21st, 26th, and 28th days. The central corneal thickness, anterior chamber depth, anterior segment volume, keratometric values, anterior chamber angle value, and pupilla diameter of both eyes were evaluated. Repeated measures analysis of variance test was used for statistical analysis. Re sults: No difference that reaches statistical significance was found in the means of central corneal thickness, anterior chamber volume, keratometric values, anterior chamber angle, and pupilla diameter between the days. Mean anterior chamber depth measurement of the right eyes on the 1st day was 2.72±0.44 mm, whereas it was 2.77±0.46 mm on the 26th day. Mean anterior chamber depth measurement of the left eyes on the 1st day was 2.74±0.42 mm, whereas it was 2.80±0.43 mm on the 26th day. This increment of anterior chamber depth value from the 1st to the 26th days was found to be statistically significant (p≤0.05. Dis cus si on: Progesterone and estrogen that rise in the second half of the menstrual cycle might have a deepening effect on the anterior chamber. These findings should be further investigated with more profound studies that also evaluate the hormonal values and their correlations with anterior segment parameters. (Turk J Ophthalmol 2013; 43: 15-8

CO2 uptake and ecophysiological parameters of the grain crops of midcontinent North America: estimates from flux tower measurements

Science.gov (United States)

Gilmanov, Tagir; Wylie, Bruce; Tieszen, Larry; Meyers, Tilden P.; Baron, Vern S.; Bernacchi, Carl J.; Billesbach, David P.; Burba, George G.; Fischer, Marc L.; Glenn, Aaron J.; Hanan, Niall P.; Hatfield, Jerry L.; Heuer, Mark W.; Hollinger, Steven E.; Howard, Daniel M.; Matamala, Roser; Prueger, John H.; Tenuta, Mario; Young, David G.

2013-01-01

We analyzed net CO2 exchange data from 13 flux tower sites with 27 site-years of measurements over maize and wheat fields across midcontinent North America. A numerically robust “light-soil temperature-VPD”-based method was used to partition the data into photosynthetic assimilation and ecosystem respiration components. Year-round ecosystem-scale ecophysiological parameters of apparent quantum yield, photosynthetic capacity, convexity of the light response, respiration rate parameters, ecological light-use efficiency, and the curvature of the VPD-response of photosynthesis for maize and wheat crops were numerically identified and interpolated/extrapolated. This allowed us to gap-fill CO2 exchange components and calculate annual totals and budgets. VPD-limitation of photosynthesis was systematically observed in grain crops of the region (occurring from 20 to 120 days during the growing season, depending on site and year), determined by the VPD regime and the numerical value of the curvature parameter of the photosynthesis-VPD-response, σVPD. In 78% of the 27 site-years of observations, annual gross photosynthesis in these crops significantly exceeded ecosystem respiration, resulting in a net ecosystem production of up to 2100 g CO2 m−2 year−1. The measurement-based photosynthesis, respiration, and net ecosystem production data, as well as the estimates of the ecophysiological parameters, provide an empirical basis for parameterization and validation of mechanistic models of grain crop production in this economically and ecologically important region of North America.

The effect of non-uniformities on the measured transport parameters of electron swarms in hydrogen

International Nuclear Information System (INIS)

Blevin, H.A.; Fletcher, J.; Hunter, S.R.

1978-05-01

Measurements of transport parameters of pulsed electron swarms moving through a low pressure gas by observation of the photon flux resulting from electron-molecule collisions have been recently reported. One of the possible sources of error in this kind of experiment is the variation of mean electron energy through the swarm. This effect is considered here along with the resulting variation of ionization and excitation frequency through the swarm. The validity of the experimental method is considered in the light of the above factors

The Power of Heterogeneity: Parameter Relationships from Distributions

Science.gov (United States)

Röding, Magnus; Bradley, Siobhan J.; Williamson, Nathan H.; Dewi, Melissa R.; Nann, Thomas; Nydén, Magnus

2016-01-01

Complex scientific data is becoming the norm, many disciplines are growing immensely data-rich, and higher-dimensional measurements are performed to resolve complex relationships between parameters. Inherently multi-dimensional measurements can directly provide information on both the distributions of individual parameters and the relationships between them, such as in nuclear magnetic resonance and optical spectroscopy. However, when data originates from different measurements and comes in different forms, resolving parameter relationships is a matter of data analysis rather than experiment. We present a method for resolving relationships between parameters that are distributed individually and also correlated. In two case studies, we model the relationships between diameter and luminescence properties of quantum dots and the relationship between molecular weight and diffusion coefficient for polymers. Although it is expected that resolving complicated correlated relationships require inherently multi-dimensional measurements, our method constitutes a useful contribution to the modelling of quantitative relationships between correlated parameters and measurements. We emphasise the general applicability of the method in fields where heterogeneity and complex distributions of parameters are obstacles to scientific insight. PMID:27182701

Identifiability of altimetry-based rating curve parameters in function of river morphological parameters

Science.gov (United States)

Paris, Adrien; André Garambois, Pierre; Calmant, Stéphane; Paiva, Rodrigo; Walter, Collischonn; Santos da Silva, Joecila; Medeiros Moreira, Daniel; Bonnet, Marie-Paule; Seyler, Frédérique; Monnier, Jérôme

2016-04-01

Estimating river discharge for ungauged river reaches from satellite measurements is not straightforward given the nonlinearity of flow behavior with respect to measurable and non measurable hydraulic parameters. As a matter of facts, current satellite datasets do not give access to key parameters such as river bed topography and roughness. A unique set of almost one thousand altimetry-based rating curves was built by fit of ENVISAT and Jason-2 water stages with discharges obtained from the MGB-IPH rainfall-runoff model in the Amazon basin. These rated discharges were successfully validated towards simulated discharges (Ens = 0.70) and in-situ discharges (Ens = 0.71) and are not mission-dependent. The rating curve writes Q = a(Z-Z0)b*sqrt(S), with Z the water surface elevation and S its slope gained from satellite altimetry, a and b power law coefficient and exponent and Z0 the river bed elevation such as Q(Z0) = 0. For several river reaches in the Amazon basin where ADCP measurements are available, the Z0 values are fairly well validated with a relative error lower than 10%. The present contribution aims at relating the identifiability and the physical meaning of a, b and Z0given various hydraulic and geomorphologic conditions. Synthetic river bathymetries sampling a wide range of rivers and inflow discharges are used to perform twin experiments. A shallow water model is run for generating synthetic satellite observations, and then rating curve parameters are determined for each river section thanks to a MCMC algorithm. Thanks to twin experiments, it is shown that rating curve formulation with water surface slope, i.e. closer from Manning equation form, improves parameter identifiability. The compensation between parameters is limited, especially for reaches with little water surface variability. Rating curve parameters are analyzed for riffle and pools for small to large rivers, different river slopes and cross section shapes. It is shown that the river bed

Hybrid method for determining the parameters of condenser microphones from measured membrane velocities and numerical calculations

DEFF Research Database (Denmark)

Barrera Figueroa, Salvador; Rasmussen, Knud; Jacobsen, Finn

2009-01-01

to this problem is to measure the velocity distribution of the membrane by means of a non-contact method, such as laser vibrometry. The measured velocity distribution can be used together with a numerical formulation such as the boundary element method for estimating the microphone response and other parameters......, e.g., the acoustic center. In this work, such a hybrid method is presented and examined. The velocity distributions of a number of condenser microphones have been determined using a laser vibrometer, and these measured velocity distributions have been used for estimating microphone responses......Typically, numerical calculations of the pressure, free-field, and random-incidence response of a condenser microphone are carried out on the basis of an assumed displacement distribution of the diaphragm of the microphone; the conventional assumption is that the displacement follows a Bessel...

Research on CO2 ejector component efficiencies by experiment measurement and distributed-parameter modeling

International Nuclear Information System (INIS)

Zheng, Lixing; Deng, Jianqiang

2017-01-01

Highlights: • The ejector distributed-parameter model is developed to study ejector efficiencies. • Feasible component and total efficiency correlations of ejector are established. • New efficiency correlations are applied to obtain dynamic characteristics of EERC. • More suitable fixed efficiency value can be determined by the proposed correlations. - Abstract: In this study we combine the experimental measurement data and the theoretical model of ejector to determine CO 2 ejector component efficiencies including the motive nozzle, suction chamber, mixing section, diffuser as well as the total ejector efficiency. The ejector is modeled utilizing the distributed-parameter method, and the flow passage is divided into a number of elements and the governing equations are formulated based on the differential equation of mass, momentum and energy conservation. The efficiencies of ejector are investigated under different ejector geometric parameters and operational conditions, and the corresponding empirical correlations are established. Moreover, the correlations are incorporated into a transient model of transcritical CO 2 ejector expansion refrigeration cycle (EERC) and the dynamic simulations is performed based on variable component efficiencies and fixed values. The motive nozzle, suction chamber, mixing section and diffuser efficiencies vary from 0.74 to 0.89, 0.86 to 0.96, 0.73 to 0.9 and 0.75 to 0.95 under the studied conditions, respectively. The response diversities of suction flow pressure and discharge pressure are obvious between the variable efficiencies and fixed efficiencies referring to the previous studies, while when the fixed value is determined by the presented correlations, their response differences are basically the same.

Geoelectrical Measurement of Multi-Scale Mass Transfer Parameters Final Report to the Subsurface Biogeochemical Research Program

Energy Technology Data Exchange (ETDEWEB)

Day-Lewis, Frederick; Singha, Kamini; Haggerty, Roy; Johnson, Timothy; Binley, Andrew; Lane, John

2014-03-10

. In this project, we sought to capitalize on the geophysical signatures of mass transfer. Previous numerical modeling and pilot-scale field experiments suggested that mass transfer produces a geoelectrical signature—a hysteretic relation between sampled (mobile-domain) fluid conductivity and bulk (mobile + immobile) conductivity—over a range of scales relevant to aquifer remediation. In this work, we investigated the geoelectrical signature of mass transfer during tracer transport in a series of controlled experiments to determine the operation of controlling parameters, and also investigated the use of complex-resistivity (CR) as a means of quantifying mass transfer parameters in situ without tracer experiments. In an add-on component to our grant, we additionally considered nuclear magnetic resonance (NMR) to help parse mobile from immobile porosities. Our study objectives were to: 1. Develop and demonstrate geophysical approaches to measure mass-transfer parameters spatially and over a range of scales, including the combination of electrical resistivity monitoring, tracer tests, complex resistivity, nuclear magnetic resonance, and materials characterization; and 2. Provide mass-transfer estimates for improved understanding of contaminant fate and transport at DOE sites, such as uranium transport at the Hanford 300 Area. To achieve our objectives, we implemented a 3-part research plan involving (1) development of computer codes and techniques to estimate mass-transfer parameters from time-lapse electrical data; (2) bench-scale experiments on synthetic materials and materials from cores from the Hanford 300 Area; and (3) field demonstration experiments at the DOE’s Hanford 300 Area.

Extraction of optical parameters of thin films from spectral measurements for design and optical performance of multilayer structures

International Nuclear Information System (INIS)

Muellerova, J.; Jurecka, S.; Kucerova, A.

2003-01-01

Optical parameters of a-Si:H and indium tin oxide (ITO) thin films deposited on glass substrates are determined from spectral measurements of reflectance and/or transmittance. It is shown how important the exact knowledge of optical parameters as well as thicknesses of the layers for the design and the optical performance of multilayer structures is. The model of the p-i-n based a:Si-H solar cell with ITO as transparent conductive oxide layer is used for illustrating. The modeling of the solar cell integral reflectance in the spectral region of (650-830) nm is used as a criterion to reverse engineering of a multilayer structure with suppressed reflectance losses. The reflectance of a solar cell is modelled and the simulation of the varying optical parameters of individual layers including their thicknesses is discussed. Besides this,the advantage of using an antireflective layer under ITO is discussed (Authors)

Nonlinear parameter (B/A) measurements in methanol, 1-butanol and 1-octanol for different pressures and temperatures

International Nuclear Information System (INIS)

Plantier, F.; Daridon, J.L.; Lagourette, B.

2002-01-01

Experimental determinations versus pressure of the nonlinear acoustic parameter B/A have been conducted for methanol, 1-butanol and 1-octanol in the pressure range 0-50 MPa and temperature range 303.15-373.15 K. These measurements proceed from an experimental technique based on a phase comparison method allowing to measure the change in sound speed with the pressure for an isentropic process. The value of B/A is found to decrease with increasing pressure and seems to be an increasing function of temperature. A comparison with the data determined numerically by the classical thermodynamic method has also been performed. (author)

Optimal configuration of partial Mueller matrix polarimeter for measuring the ellipsometric parameters in the presence of Poisson shot noise and Gaussian noise

Science.gov (United States)

Quan, Naicheng; Zhang, Chunmin; Mu, Tingkui

2018-05-01

We address the optimal configuration of a partial Mueller matrix polarimeter used to determine the ellipsometric parameters in the presence of additive Gaussian noise and signal-dependent shot noise. The numerical results show that, for the PSG/PSA consisting of a variable retarder and a fixed polarizer, the detection process immune to these two types of noise can be optimally composed by 121.2° retardation with a pair of azimuths ±71.34° and a 144.48° retardation with a pair of azimuths ±31.56° for four Mueller matrix elements measurement. Compared with the existing configurations, the configuration presented in this paper can effectively decrease the measurement variance and thus statistically improve the measurement precision of the ellipsometric parameters.

Medium energy measurements of n-n parameters. Progress report, January 1-December 31, 1985

International Nuclear Information System (INIS)

1986-01-01

This document constitutes a progress report (1985-86) for the ongoing medium energy nuclear physics research program. A major part of the work has been and will continue to be associated with research done at the Nucleon Physics Laboratory (NPL) at the Los Alamos Meson Physics Facility (LAMPF). The aim of the experimental program is the determination of the nucleon-nucleon amplitudes at medium energy. The required data include both elastic and inelastic experiments, and in addition the measurement of polarization and polarization transfer parameters. We have been emphasizing single pion production measurements using polarized proton beams, and expect that our present data base will provide stringent tests of theoretical models. With the development of the LAMPF high intensity polarized proton source, we expect that a reasonably intense beam of medium energy polarized neutrons will become available, and are planning a series of experiments utilizing polarized neutrons to determine the importance of the I = 0 reaction amplitudes at medium energies

Measurement and analysis of geometric parameters of human carotid bifurcation using image post-processing technique

International Nuclear Information System (INIS)

Xue Yunjing; Gao Peiyi; Lin Yan

2008-01-01

Objective: To investigate variation in the carotid bifurcation geometry of adults of different age by MR angiography images combining image post-processing technique. Methods: Images of the carotid bifurcations of 27 young adults (≤40 years old) and 30 older subjects ( > 40 years old) were acquired via contrast-enhanced MR angiography. Three dimensional (3D) geometries of the bifurcations were reconstructed and geometric parameters were measured by post-processing technique. Results: The geometric parameters of the young versus older groups were as follows: bifurcation angle (70.268 degree± 16.050 degree versus 58.857 degree±13.294 degree), ICA angle (36.893 degree±11.837 degree versus 30.275 degree±9.533 degree), ICA planarity (6.453 degree ± 5.009 degree versus 6.263 degree ±4.250 degree), CCA tortuosity (0.023±0.011 versus 0.014± 0.005), ICA tortuosity (0.070±0.042 versus 0.046±0.022), ICA/CCA diameter ratio (0.693± 0.132 versus 0.728±0.106), ECA/CCA diameter ratio (0.750±0.123 versus 0.809±0.122), ECA/ ICA diameter ratio (1.103±0.201 versus 1.127±0.195), bifurcation area ratio (1.057±0.281 versus 1.291±0.252). There was significant statistical difference between young group and older group in-bifurcation angle, ICA angle, CCA tortuosity, ICA tortuosity, ECA/CCA and bifurcation area ratio (F= 17.16, 11.74, 23.02, 13.38, 6.54, 22.80, respectively, P<0.05). Conclusions: MR angiography images combined with image post-processing technique can reconstruct 3D carotid bifurcation geometry and measure the geometric parameters of carotid bifurcation in vivo individually. It provides a new and convenient method to investigate the relationship of vascular geometry and flow condition with atherosclerotic pathological changes. (authors)

Comparison of parameters of spinal curves in the sagittal plane measured by photogrammetry and inclinometry.

Science.gov (United States)

Walicka-Cupryś, Katarzyna; Drzał-Grabiec, Justyna; Mrozkowiak, Mirosław

2013-10-31

BACKGROUND. The photogrammetric method and inclinometer-based measurements are commonly employed to assess the anteroposterior curvatures of the spine. These methods are used both in clinical trials and for screening purposes. The aim of the study was to compare the parameters used to characterise the anteroposterior spinal curvatures as measured by photogrammetry and inclinometry. MATERIAL AND METHODS. The study enrolled 341 subjects: 169 girls and 172 boys, aged 4 to 9 years, from kindergartens and primary schools in Rzeszów. The anteroposterior spinal curvatures were examined by photogrammetry and with a mechanical inclinometer. RESULTS. There were significant differences in the α angle between the inclinometric and photogrammetric assessment in the Student t test (p=0.017) and the Fisher Snedecor test (p=0.0001), with similar differences in the β angle (Student's t p=0.0001, Fisher Snedecor p=0.007). For the γ angle, significant differences were revealed with Student's t test (p=0.0001), but not with the Fisher Snedecor test (p = 0.22). CONCLUSIONS. 1. Measurements of inclination of particular segments of the spine obtained with the photogrammetric method and the inclinometric method in the same study group revealed statistically significant differences. 2. The results of measurements obtained by photogrammetry and inclinometry are not comparable. 3. Further research on agreement between measurements of the anteroposterior spinal curvatures obtained using the available measurement equipment is recommended.

Method to measure autonomic control of cardiac function using time interval parameters from impedance cardiography

International Nuclear Information System (INIS)

Meijer, Jan H; Boesveldt, Sanne; Elbertse, Eskeline; Berendse, H W

2008-01-01

The time difference between the electrocardiogram and impedance cardiogram can be considered as a measure for the time delay between the electrical and mechanical activities of the heart. This time interval, characterized by the pre-ejection period (PEP), is related to the sympathetic autonomous nervous control of cardiac activity. PEP, however, is difficult to measure in practice. Therefore, a novel parameter, the initial systolic time interval (ISTI), is introduced to provide a more practical measure. The use of ISTI instead of PEP was evaluated in three groups: young healthy subjects, patients with Parkinson's disease, and a group of elderly, healthy subjects of comparable age. PEP and ISTI were studied under two conditions: at rest and after an exercise stimulus. Under both conditions, PEP and ISTI behaved largely similarly in the three groups and were significantly correlated. It is concluded that ISTI can be used as a substitute for PEP and, therefore, to evaluate autonomic neuropathy both in clinical and extramural settings. Measurement of ISTI can also be used to non-invasively monitor the electromechanical cardiac time interval, and the associated autonomic activity, under physiological circumstances

Analysis of influence on back-EMF based sensorless control of PMSM due to parameter variations and measurement errors

DEFF Research Database (Denmark)

Wang, Z.; Lu, K.; Ye, Y.

2011-01-01

To achieve better performance of sensorless control of PMSM, a precise and stable estimation of rotor position and speed is required. Several parameter uncertainties and variable measurement errors may lead to estimation error, such as resistance and inductance variations due to temperature...... and flux saturation, current and voltage errors due to measurement uncertainties, and signal delay caused by hardwares. This paper reveals some inherent principles for the performance of the back-EMF based sensorless algorithm embedded in a surface mounted PMSM system adapting vector control strategy...

A measurement of the B0 anti B0 mixing parameter at LEP using a neural network

International Nuclear Information System (INIS)

Los, M.E.

1995-01-01

In this thesis the B 0 - anti B 0 mixing parameter χ is measured. The data have been collected using the DELPHI detector at the electron-positron accelerator LEP at CERN in Geneva. At the LEP energy of about 91 GeV the Z 0 particle is produced. About 15 percent of the time the Z 0 decays into a b anti b-pair, which makes LEP an ideal environment to study the properties of the heavy b quark. In this thesis, the signal for the measurement of χ consists of events in which there are two leptons in the final state. If both leptons directly originate from a b quark decay (b→l), then their charge reflects the one of the b quark. Events with leptons of the same sign indicate the presence of B 0 - anti B 0 mixing. The neural network variable achieves a better separation between the signal and the background than the transverse moemntum. Using data recorded by DELPHI in 1992, one obtains for the mixing parameter χ=8.6%±2.3%(stat)±0.6%(sys). (orig./WL)

A comparison between two powder compaction parameters of plasticity: the effective medium A parameter and the Heckel 1/K parameter.

Science.gov (United States)

Mahmoodi, Foad; Klevan, Ingvild; Nordström, Josefina; Alderborn, Göran; Frenning, Göran

2013-09-10

The purpose of the research was to introduce a procedure to derive a powder compression parameter (EM A) representing particle yield stress using an effective medium equation and to compare the EM A parameter with the Heckel compression parameter (1/K). 16 pharmaceutical powders, including drugs and excipients, were compressed in a materials testing instrument and powder compression profiles were derived using the EM and Heckel equations. The compression profiles thus obtained could be sub-divided into regions among which one region was approximately linear and from this region, the compression parameters EM A and 1/K were calculated. A linear relationship between the EM A parameter and the 1/K parameter was obtained with a strong correlation. The slope of the plot was close to 1 (0.84) and the intercept of the plot was small in comparison to the range of parameter values obtained. The relationship between the theoretical EM A parameter and the 1/K parameter supports the interpretation of the empirical Heckel parameter as being a measure of yield stress. It is concluded that the combination of Heckel and EM equations represents a suitable procedure to derive a value of particle plasticity from powder compression data. Copyright © 2013 Elsevier B.V. All rights reserved.

Critical parameters for ammonia

International Nuclear Information System (INIS)

Sato, M.; Masui, G.; Uematsu, M.

2005-01-01

(p, ρ, T) measurements and visual observations of the meniscus for ammonia were carried out carefully in the critical region over the range of temperatures: -1 K (T - T c ) 0.04 K, and of densities: -19 kg . m -3 (ρ - ρ c ) 19 kg . m -3 by a metal-bellows volumometer with an optical cell. Vapor pressures were also measured at T = (310, 350, and 400) K. The critical parameters of T c and ρ c were determined based on the results of observation of the critical opalescence. The critical pressure p c was determined from the present measurements at T c on the vapor pressure curve. Comparisons of the critical parameters with values given in the literature are presented

Application of function-oriented roughness parameters using confocal microscopy

Directory of Open Access Journals (Sweden)

K. Klauer

2018-06-01

Full Text Available Optical measuring instruments are widely used for the functional characterization of surface topography. However, due to the interaction of the surface with the incident light, effects occur that can influence the measured topography height values and the obtained surface texture parameters. Therefore, we describe a systematic investigation of the influences of optical surface topography measurement on the acquisition of function-oriented roughness parameters. The same evaluation areas of varying cylinder liners which represent a typical application of function-oriented roughness parameters were measured with a confocal microscope and a stylus instrument. Functional surface texture parameters as given in the standards ISO 13565–2, ISO 13565–3 and ISO 25178–2 were evaluated for both measurement methods and compared. The transmission of specific surface features was described and a correlation analysis for the surface topographies obtained with the different measurement methods and their resulting functional roughness parameters was carried out. Keywords: Functional surface characterization, Optical metrology, Topography measurement, Roughness

Investigation of optimized experimental parameters including laser wavelength for boron measurement in photovoltaic grade silicon using laser-induced breakdown spectroscopy

International Nuclear Information System (INIS)

Darwiche, S.; Benmansour, M.; Eliezer, N.; Morvan, D.

2010-01-01

The quantification of boron and other impurities in photovoltaic grade silicon was investigated using the LIBS technique with attention to the laser wavelength employed, temporal parameters, and the nature of the ambient gas. The laser wavelength was found to have a moderate effect on the performance of the process, while the type of purge gas and temporal parameters had a strong effect on the signal-to-background ratio (SBR) of the boron spectral emission, which was used to determine the boron concentration in silicon. The three parameters are not independent, meaning that for each different purge gas, different optimal temporal parameters are observed. Electron density was also calculated from Stark broadening of the 390.5 nm silicon emission line in order to better understand the different performances observed when using different gases and gating parameters. Calibration curves were made for boron measurement in silicon using certified standards with different purge gases while using the temporal parameters which had been optimized for that gas. By comparing the calibration curves, it was determined that argon is superior to helium or air for use as the analysis chamber purge gas with an UV laser.

Asymmetrical effects of mesophyll conductance on fundamental photosynthetic parameters and their relationships estimated from leaf gas exchange measurements.

Science.gov (United States)

Sun, Ying; Gu, Lianhong; Dickinson, Robert E; Pallardy, Stephen G; Baker, John; Cao, Yonghui; DaMatta, Fábio Murilo; Dong, Xuejun; Ellsworth, David; Van Goethem, Davina; Jensen, Anna M; Law, Beverly E; Loos, Rodolfo; Martins, Samuel C Vitor; Norby, Richard J; Warren, Jeffrey; Weston, David; Winter, Klaus

2014-04-01

Worldwide measurements of nearly 130 C3 species covering all major plant functional types are analysed in conjunction with model simulations to determine the effects of mesophyll conductance (g(m)) on photosynthetic parameters and their relationships estimated from A/Ci curves. We find that an assumption of infinite g(m) results in up to 75% underestimation for maximum carboxylation rate V(cmax), 60% for maximum electron transport rate J(max), and 40% for triose phosphate utilization rate T(u) . V(cmax) is most sensitive, J(max) is less sensitive, and T(u) has the least sensitivity to the variation of g(m). Because of this asymmetrical effect of g(m), the ratios of J(max) to V(cmax), T(u) to V(cmax) and T(u) to J(max) are all overestimated. An infinite g(m) assumption also limits the freedom of variation of estimated parameters and artificially constrains parameter relationships to stronger shapes. These findings suggest the importance of quantifying g(m) for understanding in situ photosynthetic machinery functioning. We show that a nonzero resistance to CO2 movement in chloroplasts has small effects on estimated parameters. A non-linear function with gm as input is developed to convert the parameters estimated under an assumption of infinite gm to proper values. This function will facilitate gm representation in global carbon cycle models. © 2013 John Wiley & Sons Ltd.

Serum Levels of sRAGE Are Associated with Body Measurements, but Not Glycemic Parameters in Patients with Prediabetes.

Science.gov (United States)

Guclu, Metin; Ali, Asuman; Eroglu, Derya Ustun; Büyükuysal, Sema Oral; Cander, Soner; Ocak, Nihal

2016-02-01

Our aim was to assess serum levels of the soluble receptor for advanced glycation end products (sRAGE) and to examine their association with anthropometric and metabolic parameters in patients with prediabetes and obese controls. The two study groups were composed of 42 patients with prediabetes and diabetic neuropathy and 42 age-, gender-, body weight (BW)-, and body mass index (BMI)-matched obese adults as the control group. Prediabetes was diagnosed by the following criteria issued by the American Diabetes Association: impaired fasting glucose [fasting plasma glucose (FPG) level of 100-125 mg/dL], impaired glucose tolerance (2 hr plasma glucose level of 140-199 mg/dL after a 75 grams oral glucose challenge), or a glycated hemoglobin (HbA1C) level of 5.7%-6.4%. There were no differences between the groups in terms of age, gender distribution, BW, or BMI. Despite these similarities, patients with prediabetes had higher FPG, HbA1c, and 2-hr postchallenge glucose levels, higher systolic and diastolic blood pressure, and larger waist and hip circumferences compared with the obese controls. Lipid measurements, complete blood counts, kidney and liver function tests, high-sensitivity C-reactive protein, and sRAGE levels were similar between the two groups. We found significant negative correlations between sRAGE levels and BW, BMI, waist and hip circumferences, waist-to-hip ratios, and low-density lipoprotein (LDL) cholesterol levels. There were no significant correlations with other parameters, including demographic, metabolic, and blood pressure measurements. In contrast to glycemic parameters, serum levels of sRAGE were negatively correlated with body measurements indicative of obesity in the prediabetic state. In addition, the negative correlation with LDL cholesterol levels suggests that sRAGE has a more robust association with metabolic syndrome than with prediabetes.

Polarisation parameter measurement in the proton-proton elastic scattering from 0.5 to 1.2 GeV

International Nuclear Information System (INIS)

Ducros, Yves

1970-01-01

The angular distribution of the polarisation parameter was measured in the proton-proton elastic - scattering at seven energies between 0.5 and 1.2 GeV. A polarized proton target was used. The results show a maximum of the polarisation parameter of 0.6, at 0.73 GeV. This maximum is due to the important increase of the total cross section between 0.6 and 0.73 GeV. At 1.2 GeV the angular distribution of the polarisation shows a minimum for a momentum transfer value of -1 (GeV/c) 2 . A phase shift analysis was done at 0.66 GeV, using all available experimental data at this energy. There is no evidence of a di-baryonic resonance in the 1 D 2 phase. (author) [fr

In vitro and in vivo measurements of the dissolution parameters of uranium and plutonium mixed oxides in biological environment

International Nuclear Information System (INIS)

Matton, S.

1999-01-01

During the mixed-oxide fuel fabrication process, inhalation is potentially the main route of internal contamination. The International Commission on Radiological Protection recommends experimental measurement of parameters such as size and dissolution rate for specific industrial compounds. First, we validated the use of PERALS (Photon Electron Rejecting Alpha Liquid Scintillation) for alpha measurement in biological samples which, in some cases, could improve detection limit. We characterised physical chemical properties in terms of size, specific area and activity of 3 different powders: MOX made according to either the MIMAS process, which showed heterogeneous chemical composition, or the SOLGEL, which showed homogeneous chemical composition and industrial PuO 2 . Their dissolution parameters, f r and s s , as defined in the simplest model proposed by ICRP 66 were measured in vivo, after inhalation in the rat, and in vitro. The statistical variation of these values were expressed as standard deviation. Moreover, in vitro studies demonstrated variation of the s s value depending on the duration of the incubation. We also developed methods to characterise interactions between UO 2 particles and phosphate ions which could be involved in the actinide toxicity. (author) [fr

Medium Energy measurements on N-N parameters

International Nuclear Information System (INIS)

Ambrose, D.; Bachman, M.; Coffey, P.; Glass, G.; Jobst, B.; McNaughton, K.H.; Nguyen, C.; Riley, P.J.

1992-12-01

Research is reported on the following topics: Spin transfer measurements in np elastic scattering; pp elastic differential cross section measurements; single pion production in np scattering; and a new search for rare kaon decays (K L →μμ and K L →ee). 68 refs., 33 figs, 3 tabs

State Estimation-based Transmission line parameter identification

Directory of Open Access Journals (Sweden)

Fredy Andrés Olarte Dussán

2010-01-01

Full Text Available This article presents two state-estimation-based algorithms for identifying transmission line parameters. The identification technique used simultaneous state-parameter estimation on an artificial power system composed of several copies of the same transmission line, using measurements at different points in time. The first algorithm used active and reactive power measurements at both ends of the line. The second method used synchronised phasor voltage and current measurements at both ends. The algorithms were tested in simulated conditions on the 30-node IEEE test system. All line parameters for this system were estimated with errors below 1%.

A Comparative Study of Distribution System Parameter Estimation Methods

Energy Technology Data Exchange (ETDEWEB)

Sun, Yannan; Williams, Tess L.; Gourisetti, Sri Nikhil Gup

2016-07-17

In this paper, we compare two parameter estimation methods for distribution systems: residual sensitivity analysis and state-vector augmentation with a Kalman filter. These two methods were originally proposed for transmission systems, and are still the most commonly used methods for parameter estimation. Distribution systems have much lower measurement redundancy than transmission systems. Therefore, estimating parameters is much more difficult. To increase the robustness of parameter estimation, the two methods are applied with combined measurement snapshots (measurement sets taken at different points in time), so that the redundancy for computing the parameter values is increased. The advantages and disadvantages of both methods are discussed. The results of this paper show that state-vector augmentation is a better approach for parameter estimation in distribution systems. Simulation studies are done on a modified version of IEEE 13-Node Test Feeder with varying levels of measurement noise and non-zero error in the other system model parameters.

Fourier transform measurements of water vapor line parameters in the 4200-6600 cm{sup -1} region

Energy Technology Data Exchange (ETDEWEB)

Jenouvrier, Alain [Groupe de Spectrometrie Moleculaire et Atmospherique, UMR CNRS 6089, UFR Sciences, Moulin de la Housse, B.P. 1039, 51067 Reims Cedex 2 (France)]. E-mail: alain.jenouvrier@univ-reims.fr; Daumont, Ludovic [Groupe de Spectrometrie Moleculaire et Atmospherique, UMR CNRS 6089, UFR Sciences, Moulin de la Housse, B.P. 1039, 51067 Reims Cedex 2 (France); Regalia-Jarlot, Laurence [Groupe de Spectrometrie Moleculaire et Atmospherique, UMR CNRS 6089, UFR Sciences, Moulin de la Housse, B.P. 1039, 51067 Reims Cedex 2 (France); Tyuterev, Vladimir G. [Groupe de Spectrometrie Moleculaire et Atmospherique, UMR CNRS 6089, UFR Sciences, Moulin de la Housse, B.P. 1039, 51067 Reims Cedex 2 (France); Carleer, Michel [Service de Chimie Quantique et de Photophysique, CP 160/09, Universite Libre de Bruxelles, 50 Av. F.D. Roosevelt, B-1050 Brussels (Belgium); Vandaele, Ann Carine [Institut d' Aeronomie Spatiale de Belgique, Av. Circulaire 3, B-1180 Brussels (Belgium); Mikhailenko, Semen [Laboratory of Theoretical Spectroscopy, Institute of Atmospheric Optics, Russian Academy of Sciences, 1, Av. Akademichesskii, 634055 Tomsk (Russian Federation); Fally, Sophie [Service de Chimie Quantique et de Photophysique, CP 160/09, Universite Libre de Bruxelles, 50 Av. F.D. Roosevelt, B-1050 Brussels (Belgium)

2007-06-15

New high-resolution water vapor absorption spectra were obtained at room temperature in the 4200-6600 cm{sup -1} spectral region by combining Fourier transform spectrometers (FTS) with single and multiple reflection cells. With absorption paths from 0.3 to 1800 m in pure and air diluted water vapor, accurate measurements of about 10400 lines in an intensity range from 10{sup -29} to 10{sup -19} cm/molecule have been performed. Positions, intensities, self- and air-broadening coefficients and air-induced shifts were determined for the H{sub 2} {sup 16}O, H{sub 2} {sup 17}O, H{sub 2} {sup 18}O and HDO isotopologues. The rovibrational assignment of the observed lines was performed with the use of global variational predictions and allowed the identification of several new energy levels. One major contribution of this work consists of the identification of 3280 new weak lines. A very close agreement between the new measured parameters and those listed in the database is reported as well as between the observations and the most recent variational calculations for the positions and the intensities. The present parameters provide an extended and homogeneous data set for water vapor, which is shown to significantly improve the databases for atmospheric applications, especially in the transmission windows on both sides of the band centered at 5400 cm{sup -1}.

Determination of cosmological parameters: An introduction for non ...

Indian Academy of Sciences (India)

Then I show how the age of the universe depends on them, followed by the evolution of the scale parameter of the universe for various values of the density parameters. Then I define strategies for measuring them, and show the results for the recent determination of these parameters from measurements on supernovas of ...

Receiver calibration and the nonlinearity parameter measurement of thick solid samples with diffraction and attenuation corrections.

Science.gov (United States)

Jeong, Hyunjo; Barnard, Daniel; Cho, Sungjong; Zhang, Shuzeng; Li, Xiongbing

2017-11-01

This paper presents analytical and experimental techniques for accurate determination of the nonlinearity parameter (β) in thick solid samples. When piezoelectric transducers are used for β measurements, the receiver calibration is required to determine the transfer function from which the absolute displacement can be calculated. The measured fundamental and second harmonic displacement amplitudes should be modified to account for beam diffraction and material absorption. All these issues are addressed in this study and the proposed technique is validated through the β measurements of thick solid samples. A simplified self-reciprocity calibration procedure for a broadband receiver is described. The diffraction and attenuation corrections for the fundamental and second harmonics are explicitly derived. Aluminum alloy samples in five different thicknesses (4, 6, 8, 10, 12cm) are prepared and β measurements are made using the finite amplitude, through-transmission method. The effects of diffraction and attenuation corrections on β measurements are systematically investigated. When diffraction and attenuation corrections are all properly made, the variation of β between different thickness samples is found to be less than 3.2%. Copyright © 2017 Elsevier B.V. All rights reserved.

Assessing the Effects of Water Deficit on Photosynthesis Using Parameters Derived from Measurements of Leaf Gas Exchange and of Chlorophyll a Fluorescence.

Science.gov (United States)

Urban, Laurent; Aarrouf, Jawad; Bidel, Luc P R

2017-01-01

Water deficit (WD) is expected to increase in intensity, frequency and duration in many parts of the world as a consequence of global change, with potential negative effects on plant gas exchange and growth. We review here the parameters that can be derived from measurements made on leaves, in the field, and that can be used to assess the effects of WD on the components of plant photosynthetic rate, including stomatal conductance, mesophyll conductance, photosynthetic capacity, light absorbance, and efficiency of absorbed light conversion into photosynthetic electron transport. We also review some of the parameters related to dissipation of excess energy and to rerouting of electron fluxes. Our focus is mainly on the techniques of gas exchange measurements and of measurements of chlorophyll a fluorescence (ChlF), either alone or combined. But we put also emphasis on some of the parameters derived from analysis of the induction phase of maximal ChlF, notably because they could be used to assess damage to photosystem II. Eventually we briefly present the non-destructive methods based on the ChlF excitation ratio method which can be used to evaluate non-destructively leaf contents in anthocyanins and flavonols.

Assessing the Effects of Water Deficit on Photosynthesis Using Parameters Derived from Measurements of Leaf Gas Exchange and of Chlorophyll a Fluorescence

Directory of Open Access Journals (Sweden)

Laurent Urban

2017-12-01

Full Text Available Water deficit (WD is expected to increase in intensity, frequency and duration in many parts of the world as a consequence of global change, with potential negative effects on plant gas exchange and growth. We review here the parameters that can be derived from measurements made on leaves, in the field, and that can be used to assess the effects of WD on the components of plant photosynthetic rate, including stomatal conductance, mesophyll conductance, photosynthetic capacity, light absorbance, and efficiency of absorbed light conversion into photosynthetic electron transport. We also review some of the parameters related to dissipation of excess energy and to rerouting of electron fluxes. Our focus is mainly on the techniques of gas exchange measurements and of measurements of chlorophyll a fluorescence (ChlF, either alone or combined. But we put also emphasis on some of the parameters derived from analysis of the induction phase of maximal ChlF, notably because they could be used to assess damage to photosystem II. Eventually we briefly present the non-destructive methods based on the ChlF excitation ratio method which can be used to evaluate non-destructively leaf contents in anthocyanins and flavonols.

Medium energy measurements of N-N parameters

International Nuclear Information System (INIS)

Riley, P.J.

1990-01-01

This paper discusses the following topics: pp elastic absolute cross section measurement; spin transfer measurements in np elastic scattering; single pion production in np scattering; photoproduction of high P t jets in the wide band beam of the tevatron; and search for K L 0 → μe, K L 0 → ee

The Sensitivity of the Input Impedance Parameters of Track Circuits to Changes in the Parameters of the Track

Directory of Open Access Journals (Sweden)

Lubomir Ivanek

2017-01-01

Full Text Available This paper deals with the sensitivity of the input impedance of an open track circuit in the event that the parameters of the track are changed. Weather conditions and the state of pollution are the most common reasons for parameter changes. The results were obtained from the measured values of the parameters R (resistance, G (conductance, L (inductance, and C (capacitance of a rail superstructure depending on the frequency. Measurements were performed on a railway siding in Orlova. The results are used to design a predictor of occupancy of a track section. In particular, we were interested in the frequencies of 75 and 275 Hz for this purpose. Many parameter values of track substructures have already been solved in different works in literature. At first, we had planned to use the parameter values from these sources when we designed the predictor. Deviations between them, however, are large and often differ by three orders of magnitude (see Tab.8. From this perspective, this article presents data that have been updated using modern measurement devices and computer technology. And above all, it shows a transmission (cascade matrix used to determine the parameters.

On possibility of measuring G and H parameters in the γp→nπ+ and γp → pπ0 reactions

International Nuclear Information System (INIS)

Gorbenko, V.G.; Gushchin, V.A.; Karnaukhov, I.M.; Kolesnikov, L.Ya.; Sporov, E.A.; Telegin, Yu.N.; Sorokin, P.V.

1982-01-01

Possibilities for measuring G and H-parameters in γp → nπ + and γp → pπ 0 reactions in a twice-polarized experiment using linearly-polarized photons and polarized proton target with proton polarization in the reaction plane are considered. Particle trajectories in the magnetic field of the polarized proton target are calculated, limitations in possible experiments are shown which are connected with particle deviation from the plane of magnetic spectrometers. On the basis of calculations of the trajectory the ranges for possible measurements of parameters for different reactions for the routine regime of target operation and the frosen spin regime are shown

Critical parameters for ammonia

Energy Technology Data Exchange (ETDEWEB)

Sato, M. [Center for Mechanical Engineering and Applied Mechanics, Keio University, Hiyoshi 3-14-1, Kohoku-ku, Yokohama 223-8522 (Japan); Masui, G. [Center for Mechanical Engineering and Applied Mechanics, Keio University, Hiyoshi 3-14-1, Kohoku-ku, Yokohama 223-8522 (Japan); Uematsu, M. [Center for Mechanical Engineering and Applied Mechanics, Keio University, Hiyoshi 3-14-1, Kohoku-ku, Yokohama 223-8522 (Japan)]. E-mail: uematsu@mech.keio.ac.jp

2005-09-15

(p, {rho}, T) measurements and visual observations of the meniscus for ammonia were carried out carefully in the critical region over the range of temperatures: -1 K (T - T {sub c}) 0.04 K, and of densities: -19 kg . m{sup -3} ({rho} - {rho} {sub c}) 19 kg . m{sup -3} by a metal-bellows volumometer with an optical cell. Vapor pressures were also measured at T = (310, 350, and 400) K. The critical parameters of T {sub c} and {rho} {sub c} were determined based on the results of observation of the critical opalescence. The critical pressure p {sub c} was determined from the present measurements at T {sub c} on the vapor pressure curve. Comparisons of the critical parameters with values given in the literature are presented.

Europium resonance parameters from neutron capture and transmission measurements in the energy range 0.01–200 eV

International Nuclear Information System (INIS)

Leinweber, G.; Barry, D.P.; Burke, J.A.; Rapp, M.J.; Block, R.C.; Danon, Y.; Geuther, J.A.; Saglime III, F.J.

2014-01-01

Highlights: • Metal samples were sealed and imaged with X-rays to determine sample uniformity. • Eleven new resonances were identified below 100 eV. • The resonance regions of 151 Eu and 153 Eu have been extended from 100 to 200 eV. • The thermal total cross section for 151 Eu was measured, up (9 ± 3)% from ENDF/B-VII.1. • Radiation widths were assigned for all resonances from experimental data. - Abstract: Europium is a good absorber of neutrons suitable for use as a nuclear reactor control material. It is also a fission product in the low-yield tail at the high end of the fission fragment mass distribution. Measurements have been made of the stable isotopes with natural and enriched samples. The linear electron accelerator center (LINAC) at the Rensselaer Polytechnic Institute (RPI) was used to explore neutron interactions with europium in the energy region from 0.01 to 200 eV. Neutron capture and transmission measurements were performed by the time-of-flight technique. Two transmission measurements were performed at flight paths of 15 and 25 m with 6 Li glass scintillation detectors. The neutron capture measurements were performed at a flight path of 25 m with a 16-segment sodium iodide multiplicity detector. Resonance parameters were extracted from the data using the multilevel R-matrix Bayesian code SAMMY. A table of resonance parameters and their uncertainties is presented. To prevent air oxidation metal samples were sealed in airtight aluminum cans in an inert environment. Metal samples of natural europium, 47.8 atom% 151 Eu, 52.2 atom% 153 Eu, as well as metal samples enriched to 98.77 atom% 153 Eu were measured. The measured neutron capture resonance integral for 153 Eu is (9.9 ± 0.4)% larger than ENDF/B-VII.1. The capture resonance integral for 151 Eu is (7 ± 1)% larger than ENDF/B-VII.1. Another significant finding from these measurements was a significant increase in thermal total cross section for 151 Eu, up (9 ± 3)% from ENDF/B-VII.1

Monte Carlo calculations and experimental measurements of dosimetric parameters of the IRA-103Pd source

International Nuclear Information System (INIS)

Sadeghi, Mahdi; Hosseini, Hamed; Raisali, Gholamreza

2008-01-01

Full text: The use of 103 Pd seed sources for permanent prostate implantation has become a popular brachytherapy application. As recommended by AAPM the dosimetric characteristics of the new source must be determined using experimental and Monte Carlo simulations, before its use in clinical applications thus The goal of this report is the experimental and theoretical determination of the dosimetric characteristics of this source following the recommendations in the AAPM TG-43U1 protocol. Figure 1 shows the geometry of the IRA- 103 Pd source. The source consists of a cylindrical silver core, 0.3 cm long x 0.05 cm in diameter, onto which 0.5 nm layer of 103 Pd has been uniformly adsorbed. The effective active length of source is 0.3 cm and the silver core encapsulated inside a hollow titanium tube with 0.45 cm long, 0.07 cm and 0.08 inner and outer diameters and two caps. The Monte Carlo N-Particle (MCNP) code, version 4C, was used to determine the relevant dosimetric parameters of the source. The geometry of the Monte Carlo simulation performed in this study consisted of a sphere with 30 cm diameter. Dose distributions around this source were measured in two Perspex phantom using enough TLD chips. For these measurements, slabs of Perspex material were machined to accommodate the source and TLD chips. A value of 0.67± 1% cGy.h -1 .U -1 for, Λ, was calculated as the ratio of d(r 0 ,θ 0 ) and s K , that may be compared with Λ values obtained for 103 Pd sources. Result of calculations and measurements values of dosimetric parameters of the source including radial dose function, g(r), and anisotropy function, F(r,θ), has been shown in separate figures. The radial dose function, g(r), for the IRA- 103 Pd source and other 103 Pd sources is included in Fig. 2. Comparison between measured and Monte Carlo simulated dose function, g(r), and anisotropy function, F(r,θ), of this source demonstrated that they are in good agreement with each other and The value of Λ is

Local drift parameter, j/n/sub e/ and resistivity anomaly measurements in CTX spheromaks

International Nuclear Information System (INIS)

Hoida, H.W.; Barnes, C.W.; Henins, I.; Jarboe, T.R.; Marklin, G.; Buchenauer, C.J.; Knox, S.O.

1985-01-01

In a spheromak, the magnetic fields confining the plasma are generated primarily by internal currents rather than external coils. In order to provide information on the possible existence of current-driven microinstabilities, localized measurements of the ratio of the drift velocity of the electrons generating the internal current to their thermal velocity, V/sub d//V/sub th/ proportional to j/n/sub e/√T/sub e/ (known as the drift or streaming parameter), and j/n/sub e/ (proportional to V/sub d/) are needed. These microinstabilities are in some theories associated with an increase in the resistivity anomaly factor (eta/eta/sub Spitzer/). We present results on local measurements (at the magnetic axis) of the values of V/sub d//V/sub th/ and eta/eta/sub Spitzer/ by combining data from the spatially-resolved diagnostics employed on the CTX spheromak experiment, coupled with current density profile information from equilibrium measurements. The values of V/sub d//V/sub th/ and j/n/sub e/ appear to be correlated with local variations in eta/eta/sub Spitzer/, and can be changed by varying the plasma density. Data sets are presented for three values of n/sub e/

Evaluation of Measurements Collected with Multi-Parameter Continuous Water-Quality Monitors in Selected Illinois Streams, 2001-03

Science.gov (United States)

Groschen, George E.; King, Robin B.

2005-01-01

Eight streams, representing a wide range of environmental and water-quality conditions across Illinois, were monitored from July 2001 to October 2003 for five water-quality parameters as part of a pilot study by the U.S. Geological Survey (USGS) in cooperation with the Illinois Environmental Protection Agency (IEPA). Continuous recording multi-parameter water-quality monitors were installed to collect data on water temperature, dissolved-oxygen concentrations, specific conductivity, pH, and turbidity. The monitors were near USGS streamflow-gaging stations where stage and streamflow are continuously recorded. During the study period, the data collected for these five parameters generally met the data-quality objectives established by the USGS and IEPA at all eight stations. A similar pilot study during this period for measurement of chlorophyll concentrations failed to achieve the data-quality objectives. Of all the sensors used, the temperature sensors provided the most accurate and reliable measurements (generally within ?5 percent of a calibrated thermometer reading). Signal adjustments and calibration of all other sensors are dependent upon an accurate and precise temperature measurement. The dissolved-oxygen sensors were the next most reliable during the study and were responsive to changing conditions and accurate at all eight stations. Specific conductivity was the third most accurate and reliable measurement collected from the multi-parameter monitors. Specific conductivity at the eight stations varied widely-from less than 40 microsiemens (?S) at Rayse Creek near Waltonville to greater than 3,500 ?S at Salt Creek at Western Springs. In individual streams, specific conductivity often changed quickly (greater than 25 percent in less than 3 hours) and the sensors generally provided good to excellent record of these variations at all stations. The widest range of specific-conductivity measurements was in Salt Creek at Western Springs in the Greater Chicago

Exploiting intrinsic fluctuations to identify model parameters.

Science.gov (United States)

Zimmer, Christoph; Sahle, Sven; Pahle, Jürgen

2015-04-01

Parameterisation of kinetic models plays a central role in computational systems biology. Besides the lack of experimental data of high enough quality, some of the biggest challenges here are identification issues. Model parameters can be structurally non-identifiable because of functional relationships. Noise in measured data is usually considered to be a nuisance for parameter estimation. However, it turns out that intrinsic fluctuations in particle numbers can make parameters identifiable that were previously non-identifiable. The authors present a method to identify model parameters that are structurally non-identifiable in a deterministic framework. The method takes time course recordings of biochemical systems in steady state or transient state as input. Often a functional relationship between parameters presents itself by a one-dimensional manifold in parameter space containing parameter sets of optimal goodness. Although the system's behaviour cannot be distinguished on this manifold in a deterministic framework it might be distinguishable in a stochastic modelling framework. Their method exploits this by using an objective function that includes a measure for fluctuations in particle numbers. They show on three example models, immigration-death, gene expression and Epo-EpoReceptor interaction, that this resolves the non-identifiability even in the case of measurement noise with known amplitude. The method is applied to partially observed recordings of biochemical systems with measurement noise. It is simple to implement and it is usually very fast to compute. This optimisation can be realised in a classical or Bayesian fashion.

Estimation of inflation parameters for Perturbed Power Law model using recent CMB measurements