WorldWideScience

Sample records for measuring subdiffusion parameters

  1. Meaningful interpretation of subdiffusive measurements in living cells (crowded environment) by fluorescence fluctuation microscopy.

    Science.gov (United States)

    Baumann, Gerd; Place, Robert F; Földes-Papp, Zeno

    2010-08-01

    In living cell or its nucleus, the motions of molecules are complicated due to the large crowding and expected heterogeneity of the intracellular environment. Randomness in cellular systems can be either spatial (anomalous) or temporal (heterogeneous). In order to separate both processes, we introduce anomalous random walks on fractals that represented crowded environments. We report the use of numerical simulation and experimental data of single-molecule detection by fluorescence fluctuation microscopy for detecting resolution limits of different mobile fractions in crowded environment of living cells. We simulate the time scale behavior of diffusion times tau(D)(tau) for one component, e.g. the fast mobile fraction, and a second component, e.g. the slow mobile fraction. The less the anomalous exponent alpha the higher the geometric crowding of the underlying structure of motion that is quantified by the ratio of the Hausdorff dimension and the walk exponent d(f)/d(w) and specific for the type of crowding generator used. The simulated diffusion time decreases for smaller values of alpha # 1 but increases for a larger time scale tau at a given value of alpha # 1. The effect of translational anomalous motion is substantially greater if alpha differs much from 1. An alpha value close to 1 contributes little to the time dependence of subdiffusive motions. Thus, quantitative determination of molecular weights from measured diffusion times and apparent diffusion coefficients, respectively, in temporal auto- and crosscorrelation analyses and from time-dependent fluorescence imaging data are difficult to interpret and biased in crowded environments of living cells and their cellular compartments; anomalous dynamics on different time scales tau must be coupled with the quantitative analysis of how experimental parameters change with predictions from simulated subdiffusive dynamics of molecular motions and mechanistic models. We first demonstrate that the crowding exponent

  2. Observation of Subdiffusion in a Disordered Interacting System

    International Nuclear Information System (INIS)

    Lucioni, E.; Deissler, B.; Tanzi, L.; Roati, G.; Zaccanti, M.; Inguscio, M.; Modugno, G.; Modugno, M.; Larcher, M.; Dalfovo, F.

    2011-01-01

    We study the transport dynamics of matter-waves in the presence of disorder and nonlinearity. An atomic Bose-Einstein condensate that is localized in a quasiperiodic lattice in the absence of atom-atom interaction shows instead a slow expansion with a subdiffusive behavior when a controlled repulsive interaction is added. The measured features of the subdiffusion are compared to numerical simulations and a heuristic model. The observations confirm the nature of subdiffusion as interaction-assisted hopping between localized states and highlight a role of the spatial correlation of the disorder.

  3. A multidimensional subdiffusion model: An arbitrage-free market

    International Nuclear Information System (INIS)

    Li Guo-Hua; Zhang Hong; Luo Mao-Kang

    2012-01-01

    To capture the subdiffusive characteristics of financial markets, the subordinated process, directed by the inverse α-stale subordinator S α (t) for 0 < α < 1, has been employed as the model of asset prices. In this article, we introduce a multidimensional subdiffusion model that has a bond and K correlated stocks. The stock price process is a multidimensional subdiffusion process directed by the inverse α-stable subordinator. This model describes the period of stagnation for each stock and the behavior of the dependency between multiple stocks. Moreover, we derive the multidimensional fractional backward Kolmogorov equation for the subordinated process using the Laplace transform technique. Finally, using a martingale approach, we prove that the multidimensional subdiffusion model is arbitrage-free, and also gives an arbitrage-free pricing rule for contingent claims associated with the martingale measure. (interdisciplinary physics and related areas of science and technology)

  4. Quantitative studies of subdiffusion in living cells and actin networks

    DEFF Research Database (Denmark)

    Munteanu, Emilia-Laura; Olsen, Anja Lea; Tolic-Nørrelykke, Iva Marija

    2006-01-01

    Optical tweezers are a versatile tool in biophysics and have matured from a tool of manipulation to a tool of precise measurements. We argue here that the data analysis with advantage can be developed to a level of sophistication that matches that of the instrument. We review methods of analysis...... of optical tweezers data, primarily baed on the power spectra of time series of postions for trapped spherical objects. The majority of precise studies in the literature are performed on in vitro systems, whereas in the present work, an example of an in vivo system is presented for which precise power...... spectral analysis is both useful and necessary. The biological system is the cytoplasm of fission yeast, S. pombe, in which we observe subdiffusion of lipid granuli. in a search for the cause of subdiffusion, we chemically disrupt the actin network in the cytoplasm and further consider in vitro networks...

  5. Flashing subdiffusive ratchets in viscoelastic media

    International Nuclear Information System (INIS)

    Kharchenko, Vasyl; Goychuk, Igor

    2012-01-01

    We study subdiffusive ratchet transport in periodically and randomly flashing potentials. A central Brownian particle is elastically coupled to the surrounding auxiliary Brownian quasi-particles, which account for the influence of the viscoelastic environment. Similar to standard dynamical modeling of Brownian motion, the external force influences only the motion of the central particle, not affecting directly the environmental degrees of freedom. Just a handful of auxiliary Brownian particles suffices to model subdiffusion over many temporal decades. Time modulation of the potential violates the symmetry of thermal detailed balance and induces an anomalous subdiffusive current which exhibits a remarkably small dispersion at low temperatures, as well as a number of other surprising features such as saturation at low temperatures, and multiple inversions of the transport direction upon a change of the driving frequency in the non-adiabatic regime. It is shown that the subdiffusive current is finite at zero temperature for random flashing and can be finite for periodic flashing for a certain frequency window. Our study generalizes classical Brownian motors towards operating in sticky viscoelastic environments such as the cytosol of biological cells or dense polymer solutions. (paper)

  6. Measuring the chargino parameters

    Indian Academy of Sciences (India)

    by measuring the cross-sections with polarized beams at e+e- collider ... is given by the fundamental SUSY parameters: the SU(2) gaugino mass Е¾, the higgsino .... two points in the plane which are symmetric under the interchange ¾Д ° ¾К.

  7. Parameter measurement of target

    International Nuclear Information System (INIS)

    Gao Dangzhong

    2001-01-01

    The progress of parameter measurement of target (ICF-15) in 1999 are presented, including the design and contract of the microsphere equator profiler, the precise air bearing manufacturing, high-resolution X-ray image of multi-layer shells and the X-ray photos processed with special image and data software, some plastic shells measured in precision of 0.3 μm, the high-resolution observation and photograph system of 'dew-point method', special fixture of target and its temperature distribution measuring, the dew-point temperature and fuel gas pressure of shells measuring with internal pressure of 5 - 15 (x10 5 ) Pa D 2 and wall thickness of 1.5∼3 μm

  8. Crossover from Super- to Subdiffusive Motion and Memory Effects in Crystalline Organic Semiconductors

    Science.gov (United States)

    De Filippis, G.; Cataudella, V.; Mishchenko, A. S.; Nagaosa, N.; Fierro, A.; de Candia, A.

    2015-02-01

    The transport properties at finite temperature of crystalline organic semiconductors are investigated, within the Su-Schrieffer-Heeger model, by combining an exact diagonalization technique, Monte Carlo approaches, and a maximum entropy method. The temperature-dependent mobility data measured in single crystals of rubrene are successfully reproduced: a crossover from super- to subdiffusive motion occurs in the range 150 ≤T ≤200 K , where the mean free path becomes of the order of the lattice parameter and strong memory effects start to appear. We provide an effective model, which can successfully explain features of the absorption spectra at low frequencies. The observed response to slowly varying electric field is interpreted by means of a simple model where the interaction between the charge carrier and lattice polarization modes is simulated by a harmonic interaction between a fictitious particle and an electron embedded in a viscous fluid.

  9. A reaction–subdiffusion model of fluorescence recovery after photobleaching (FRAP)

    International Nuclear Information System (INIS)

    Yuste, S B; Abad, E; Lindenberg, K

    2014-01-01

    Anomalous diffusion, in particular subdiffusion, is frequently invoked as a mechanism of motion in dense biological media and may have a significant impact on the kinetics of binding/unbinding events at the cellular level. In this work we incorporate anomalous diffusion in a previously developed model for FRAP experiments. Our particular implementation of subdiffusive transport is based on a continuous time random walk (CTRW) description of the motion of fluorescent particles, as CTRWs lend themselves particularly well to the inclusion of binding/unbinding events. In order to model switching between bound and unbound states of fluorescent subdiffusive particles, we derive a fractional reaction–subdiffusion equation of rather general applicability. Using suitable initial and boundary conditions, this equation is then incorporated in the model describing 2D kinetics of FRAP experiments. We find that this model can be used to obtain excellent fits to experimental data. Moreover, recovery curves corresponding to different radii of the circular bleach spot can be fitted by a single set of parameters. While not enough evidence has been collected to claim with certainty that the underlying transport mechanism in FRAP experiments is one that leads to anomalous diffusion, the compatibility of our results with experimental data fuels the discussion as to whether normal diffusion or some form of anomalous diffusion is the appropriate model and as to whether anomalous diffusion effects are important to fully understand the outcomes of FRAP experiments. On a more technical side, we derive explicit analytic solutions of our model in certain limits. (paper)

  10. Measurement of plasma parameters

    International Nuclear Information System (INIS)

    1999-01-01

    The physics issues of the measurements of the plasma properties necessary to provide both the control and science data for achieving the goals of the ITER device are discussed. The assessment of the requirements for these measurements is first discussed, together with priorities that relate to the experimental program. Subsequently, some of the proposed measurement techniques, the plasma diagnostics, are described with particular emphasis on their implementation on ITER and their capability to meet the requirements. A judgement on the present status of the diagnostic program on ITER is provided with some indication of the research and development program necessary to demonstrate viability of techniques or their implementation. (author)

  11. Kinetics of subdiffusion-assisted reactions: non-Markovian stochastic Liouville equation approach

    International Nuclear Information System (INIS)

    Shushin, A I

    2005-01-01

    Anomalous specific features of the kinetics of subdiffusion-assisted bimolecular reactions (time-dependence, dependence on parameters of systems, etc) are analysed in detail with the use of the non-Markovian stochastic Liouville equation (SLE), which has been recently derived within the continuous-time random-walk (CTRW) approach. In the CTRW approach, subdiffusive motion of particles is modelled by jumps whose onset probability distribution function is of a long-tailed form. The non-Markovian SLE allows for rigorous describing of some peculiarities of these reactions; for example, very slow long-time behaviour of the kinetics, non-analytical dependence of the reaction rate on the reactivity of particles, strong manifestation of fluctuation kinetics showing itself in very slowly decreasing behaviour of the kinetics at very long times, etc

  12. Subdiffusive master equation with space-dependent anomalous exponent and structural instability

    Science.gov (United States)

    Fedotov, Sergei; Falconer, Steven

    2012-03-01

    We derive the fractional master equation with space-dependent anomalous exponent. We analyze the asymptotic behavior of the corresponding lattice model both analytically and by Monte Carlo simulation. We show that the subdiffusive fractional equations with constant anomalous exponent μ in a bounded domain [0,L] are not structurally stable with respect to the nonhomogeneous variations of parameter μ. In particular, the Gibbs-Boltzmann distribution is no longer the stationary solution of the fractional Fokker-Planck equation whatever the space variation of the exponent might be. We analyze the random distribution of μ in space and find that in the long-time limit, the probability distribution is highly intermediate in space and the behavior is completely dominated by very unlikely events. We show that subdiffusive fractional equations with the nonuniform random distribution of anomalous exponent is an illustration of a “Black Swan,” the low probability event of the small value of the anomalous exponent that completely dominates the long-time behavior of subdiffusive systems.

  13. Precision measurements of electroweak parameters

    CERN Document Server

    Savin, Alexander

    2017-01-01

    A set of selected precise measurements of the SM parameters from the LHC experiments is discussed. Results on W-mass measurement and forward-backward asymmetry in production of the Drell--Yan events in both dielectron and dimuon decay channels are presented together with results on the effective mixing angle measurements. Electroweak production of the vector bosons in association with two jets is discussed.

  14. Measuring the Michel parameter ξ''

    International Nuclear Information System (INIS)

    Knowles, P.; Deutsch, J.; Egger, J.; Fetscher, W.; Foroughi, F.; Govaerts, J.; Hadri, M.; Kirch, K.; Kistryn, S.; Lang, J.; Morelle, X.; Naviliat, O.; Ninane, A.; Prieels, R.; Severijns, N.; Simons, L.; Sromicki, J.; Vandormael, S.; Hove, P. van

    1999-01-01

    Unlike the majority of Michel parameters which are consistent with the Standard Model V-A interaction, the experimental value of ξ''(=0.65±0.36) [1] is poorly known. Our experiment will measure the longitudinal polarization, P L , of positrons emitted from the decay of polarized muons. The value of P L , equal to unity in the Standard Model, will decrease for high energy positrons emitted antiparallel to the muon spin if the combination of Michel parameters ξ''/ξξ' - 1 deviates from the Standard Model value of zero

  15. Subdiffusion kinetics of nanoprecipitate growth and destruction in solid solutions

    Science.gov (United States)

    Sibatov, R. T.; Svetukhin, V. V.

    2015-06-01

    Based on fractional differential generalizations of the Ham and Aaron-Kotler precipitation models, we study the kinetics of subdiffusion-limited growth and dissolution of new-phase precipitates. We obtain the time dependence of the number of impurities and dimensions of new-phase precipitates. The solutions agree with the Monte Carlo simulation results.

  16. Measuring neutrino oscillation parameters using $\

    Energy Technology Data Exchange (ETDEWEB)

    Backhouse, Christopher James [Oriel College, Oxford (United Kingdom)

    2011-01-01

    MINOS is a long-baseline neutrino oscillation experiment. It consists of two large steel-scintillator tracking calorimeters. The near detector is situated at Fermilab, close to the production point of the NuMI muon-neutrino beam. The far detector is 735 km away, 716m underground in the Soudan mine, Northern Minnesota. The primary purpose of the MINOS experiment is to make precise measurements of the 'atmospheric' neutrino oscillation parameters (Δmatm2 and sin2atm). The oscillation signal consists of an energy-dependent deficit of vμ interactions in the far detector. The near detector is used to characterize the properties of the beam before oscillations develop. The two-detector design allows many potential sources of systematic error in the far detector to be mitigated by the near detector observations. This thesis describes the details of the vμ-disappearance analysis, and presents a new technique to estimate the hadronic energy of neutrino interactions. This estimator achieves a significant improvement in the energy resolution of the neutrino spectrum, and in the sensitivity of the neutrino oscillation fit. The systematic uncertainty on the hadronic energy scale was re-evaluated and found to be comparable to that of the energy estimator previously in use. The best-fit oscillation parameters of the vμ-disappearance analysis, incorporating this new estimator were: Δm2 = 2.32-0.08+0.12 x 10-3 eV2, sin 2 2θ > 0.90 (90% C.L.). A similar analysis, using data from a period of running where the NuMI beam was operated in a configuration producing a predominantly $\\bar{v}$μ beam, yielded somewhat different best-fit parameters Δ$\\bar{m}${sup 2} = (3.36-0.40+0.46(stat.) ± 0.06(syst.)) x 10-3eV2, sin2 2$\\bar{θ}$ = 0.86-0.12_0

  17. Methods for measurement of durability parameters

    DEFF Research Database (Denmark)

    Hansen, Ernst Jan De Place

    1996-01-01

    Present selected methods for measurement of durabilty parameters relating to chlorides, corrosion, moisture and freeze-thaw, primarly on concrete. Advantages and drawbacks of the different methods are included.......Present selected methods for measurement of durabilty parameters relating to chlorides, corrosion, moisture and freeze-thaw, primarly on concrete. Advantages and drawbacks of the different methods are included....

  18. Measurements of thermal parameters of solar modules

    International Nuclear Information System (INIS)

    Górecki, K; Krac, E

    2016-01-01

    In the paper the methods of measuring thermal parameters of photovoltaic panels - transient thermal impedance and the absorption factor of light-radiation are presented. The manner of realising these methods is described and the results of measurements of the considered thermal parameters of selected photovoltaic panels are presented. The influence of such selected factors as a type of the investigated panel and its mounting manner on transient thermal impedance of the considered panels is also discussed. (paper)

  19. Amplitude equations for a sub-diffusive reaction-diffusion system

    International Nuclear Information System (INIS)

    Nec, Y; Nepomnyashchy, A A

    2008-01-01

    A sub-diffusive reaction-diffusion system with a positive definite memory operator and a nonlinear reaction term is analysed. Amplitude equations (Ginzburg-Landau type) are derived for short wave (Turing) and long wave (Hopf) bifurcation points

  20. Diffusive and subdiffusive dynamics of indoor microclimate: a time series modeling.

    Science.gov (United States)

    Maciejewska, Monika; Szczurek, Andrzej; Sikora, Grzegorz; Wyłomańska, Agnieszka

    2012-09-01

    The indoor microclimate is an issue in modern society, where people spend about 90% of their time indoors. Temperature and relative humidity are commonly used for its evaluation. In this context, the two parameters are usually considered as behaving in the same manner, just inversely correlated. This opinion comes from observation of the deterministic components of temperature and humidity time series. We focus on the dynamics and the dependency structure of the time series of these parameters, without deterministic components. Here we apply the mean square displacement, the autoregressive integrated moving average (ARIMA), and the methodology for studying anomalous diffusion. The analyzed data originated from five monitoring locations inside a modern office building, covering a period of nearly one week. It was found that the temperature data exhibited a transition between diffusive and subdiffusive behavior, when the building occupancy pattern changed from the weekday to the weekend pattern. At the same time the relative humidity consistently showed diffusive character. Also the structures of the dependencies of the temperature and humidity data sets were different, as shown by the different structures of the ARIMA models which were found appropriate. In the space domain, the dynamics and dependency structure of the particular parameter were preserved. This work proposes an approach to describe the very complex conditions of indoor air and it contributes to the improvement of the representative character of microclimate monitoring.

  1. Transmission Electron Microscope Measures Lattice Parameters

    Science.gov (United States)

    Pike, William T.

    1996-01-01

    Convergent-beam microdiffraction (CBM) in thermionic-emission transmission electron microscope (TEM) is technique for measuring lattice parameters of nanometer-sized specimens of crystalline materials. Lattice parameters determined by use of CBM accurate to within few parts in thousand. Technique developed especially for use in quantifying lattice parameters, and thus strains, in epitaxial mismatched-crystal-lattice multilayer structures in multiple-quantum-well and other advanced semiconductor electronic devices. Ability to determine strains in indivdual layers contributes to understanding of novel electronic behaviors of devices.

  2. Measurement of the Stokes parameters of light

    International Nuclear Information System (INIS)

    Berry, H.G.; Gabrielse, G.; Livingston, A.E.

    1977-01-01

    We describe a measuring system for determing the state of polarization of a beam of light in terms of its Stokes parameters. The technique which can be fully automated incorporates a monochromator and single photon counting detection and can thus be applied over a large wavelength range for very weak optical signals. Fourier transformation of the data by an on-line minicomputer allows immediate calculation of the Stokes parameters. We discuss special applications to light emitted from excited atomic systems with and without cylindrical symmetry

  3. Measured radioecological parameters after the Chernobyl accident

    International Nuclear Information System (INIS)

    Bonka, H.

    1989-01-01

    After the Chernobyl accident the radioactivity in the environment in Aachen was measured in detail. The change of the different radionuclies in the eco-system made it possible to obtain radioecological parameters especially for iodine and caesium. The most important data obtained like deposition velocity, washout coefficient, retention factor, removal rate constant, and transfer factor food-milk, food-beef, and soil-grass are reported. (orig.)

  4. Numerical calculation on a two-step subdiffusion behavior of lateral protein movement in plasma membranes

    Science.gov (United States)

    Sumi, Tomonari; Okumoto, Atsushi; Goto, Hitoshi; Sekino, Hideo

    2017-10-01

    A two-step subdiffusion behavior of lateral movement of transmembrane proteins in plasma membranes has been observed by using single-molecule experiments. A nested double-compartment model where large compartments are divided into several smaller ones has been proposed in order to explain this observation. These compartments are considered to be delimited by membrane-skeleton "fences" and membrane-protein "pickets" bound to the fences. We perform numerical simulations of a master equation using a simple two-dimensional lattice model to investigate the heterogeneous diffusion dynamics behavior of transmembrane proteins within plasma membranes. We show that the experimentally observed two-step subdiffusion process can be described using fence and picket models combined with decreased local diffusivity of transmembrane proteins in the vicinity of the pickets. This allows us to explain the two-step subdiffusion behavior without explicitly introducing nested double compartments.

  5. Recommendations for Measuring Tennis Racket Parameters

    Directory of Open Access Journals (Sweden)

    Tom Allen

    2018-02-01

    Full Text Available Tennis rackets have advanced significantly since the invention of the game in 1874, including innovations in both shape and materials. Advances in these design parameters have implications for racket performance, especially swing speed. This study tested one hundred rackets, spanning brands and eras, using simple, portable instruments in order to pilot protocols and make recommendations for streamlining testing procedures for tennis rackets. A wide range of properties were measured and documented for each racket. We suggest that since Transverse and Lateral Moment of Inertia are well correlated, measuring both is not necessary when processing a large number of rackets. In addition, it is also possible to predict the Transverse Moment of Inertia well from models that use simple dimension and mass measurements, which may be preferable in larger studies. Exploring the use of more complex modelling will allow us to better understand the impact of tennis racket design on performance in the future.

  6. Simultaneous measurement of 3 fluctuating plasma parameters

    International Nuclear Information System (INIS)

    Carlson, A.; Giannone, L.

    1991-01-01

    Langmuir triple probes can provide simultaneous measurements of n e , T e and V pl with good temporal and spatial resolution, and therefore are especially suited to detailed investigations of plasma turbulence in the scrape-off-layer. Unfortunately, the finite tip separation coupled with the fluctuating gradients prevents a simple interpretation of the results. We have developed a method using, essentially, two or more triple probes, which allows a good estimate of the three plasma parameters and their spatial derivatives at each point of time (assuming tip separation is much less than correlation length and dimensionless fluctuation levels are much less than unity). In particular, we can unambiguously measure the temperature fluctuations and the turbulent particle and heat flux. (author) 1 fig

  7. Simultaneous measurement of 3 fluctuating plasma parameters

    International Nuclear Information System (INIS)

    Carlson, A.; Giannone, L.

    1991-01-01

    Langmuir triple probes can provide simultaneous measurements of n e , T e , and V pl with good temporal and spatial resolution, and therefore are especially suited to detailed investigations of plasma turbulence in the scrape-off-layer. Unfortunately, the finite tip separation coupled with the fluctuating gradients prevents a simple interpretation of the results. We have developed a method using, essentially, two or more triple probes, which allows a good estimate of the three plasma parameters and their spatial derivatives at each point of time (assuming tip separation is much less than correlation length and dimensionless fluctuation levels are much less than unity). In particular, we can unambiguously measure the temperature fluctuations and the turbulent particle and heat flux. (orig.)

  8. Simultaneous measurement of 3 fluctuating plasma parameters

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, A; Giannone, L. (Max-Planck-Institut fuer Plasmaphysik, Garching (Germany))

    1991-01-01

    Langmuir triple probes can provide simultaneous measurements of n[sub e], T[sub e] and V[sub pl] with good temporal and spatial resolution, and therefore are especially suited to detailed investigations of plasma turbulence in the scrape-off-layer. Unfortunately, the finite tip separation coupled with the fluctuating gradients prevents a simple interpretation of the results. We have developed a method using, essentially, two or more triple probes, which allows a good estimate of the three plasma parameters and their spatial derivatives at each point of time (assuming tip separation is much less than correlation length and dimensionless fluctuation levels are much less than unity). In particular, we can unambiguously measure the temperature fluctuations and the turbulent particle and heat flux. (author) 1 fig.

  9. Dyes assay for measuring physicochemical parameters.

    Science.gov (United States)

    Moczko, Ewa; Meglinski, Igor V; Bessant, Conrad; Piletsky, Sergey A

    2009-03-15

    A combination of selective fluorescent dyes has been developed for simultaneous quantitative measurements of several physicochemical parameters. The operating principle of the assay is similar to electronic nose and tongue systems, which combine nonspecific or semispecific elements for the determination of diverse analytes and chemometric techniques for multivariate data analysis. The analytical capability of the proposed mixture is engendered by changes in fluorescence signal in response to changes in environment such as pH, temperature, ionic strength, and presence of oxygen. The signal is detected by a three-dimensional spectrofluorimeter, and the acquired data are processed using an artificial neural network (ANN) for multivariate calibration. The fluorescence spectrum of a solution of selected dyes allows discreet reading of emission maxima of all dyes composing the mixture. The variations in peaks intensities caused by environmental changes provide distinctive fluorescence patterns which can be handled in the same way as the signals collected from nose/tongue electrochemical or piezoelectric devices. This optical system opens possibilities for rapid, inexpensive, real-time detection of a multitude of physicochemical parameters and analytes of complex samples.

  10. Measurement of J/ψ resonance parameters

    International Nuclear Information System (INIS)

    Bai Jingzhi; Chen Guangpei; Chen Shaomin

    1995-01-01

    The cross sections of e + e - →hadrons, e + e - , μ + μ - have been measured in the vicinity of J/ψ resonance at BES/BEPC. The fit of the observed cross sections gives the new results of J/ψ resonance parameters: the partial widths to hadrons, electrons and muons are Γ h = 74.1 +- 8.1 keV, Γ e = 5.14 +- 0.39 keV and Γ μ = 5.13 +-0.52 keV respectively; the total width Γ = 84.4 +- 8.9 keV; the branching fractions Γ h /Γ = (87.8 +- 0.5)%, Γ e /Γ (6.09 +- 0.33)%, and Γ μ /Γ = (6.08 +- 0.33)%

  11. Continuous time Black-Scholes equation with transaction costs in subdiffusive fractional Brownian motion regime

    Science.gov (United States)

    Wang, Jun; Liang, Jin-Rong; Lv, Long-Jin; Qiu, Wei-Yuan; Ren, Fu-Yao

    2012-02-01

    In this paper, we study the problem of continuous time option pricing with transaction costs by using the homogeneous subdiffusive fractional Brownian motion (HFBM) Z(t)=X(Sα(t)), 0transaction costs of replicating strategies. We also give the total transaction costs.

  12. Resolving mixed mechanisms of protein subdiffusion at the T cell plasma membrane

    Science.gov (United States)

    Golan, Yonatan; Sherman, Eilon

    2017-06-01

    The plasma membrane is a complex medium where transmembrane proteins diffuse and interact to facilitate cell function. Membrane protein mobility is affected by multiple mechanisms, including crowding, trapping, medium elasticity and structure, thus limiting our ability to distinguish them in intact cells. Here we characterize the mobility and organization of a short transmembrane protein at the plasma membrane of live T cells, using single particle tracking and photoactivated-localization microscopy. Protein mobility is highly heterogeneous, subdiffusive and ergodic-like. Using mobility characteristics, we segment individual trajectories into subpopulations with distinct Gaussian step-size distributions. Particles of low-to-medium mobility consist of clusters, diffusing in a viscoelastic and fractal-like medium and are enriched at the centre of the cell footprint. Particles of high mobility undergo weak confinement and are more evenly distributed. This study presents a methodological approach to resolve simultaneous mixed subdiffusion mechanisms acting on polydispersed samples and complex media such as cell membranes.

  13. Parameters of measuring of european political consciousness

    Directory of Open Access Journals (Sweden)

    M. M. Pikula

    2015-09-01

    Full Text Available In the article the author analyzes the parameters of European political consciousness, i.e. European research field of political consciousness in qualitative and quantitative terms, which may be based on different indicators. The issue of emergence and development of European political consciousness becomes topical because firstly, its formation as the subjective dimension of European integration policy is not a spontaneous process and, secondly, European integration is carried out not only from the top but from the bottom, requiring deliberate interference of the public with the process; the public possesses the formed European political consciousness. Since the latter is a specific mental construct, the author offers to apply the triad «criteria ­ parameters – indicators». The characteristic that makes it possible to evaluate certain processes or phenomena in the system of Europeanness / Europeanism and specifies the quality system of views and opinions, which are realized in European behavior, is considered to be the criterion of European political consciousness. The European political consciousness parameters are seen to include the relevant historical memory, trends of public opinion and awareness regarding the European Union and position of its members in the European integration process, including the assessment of the existence and development of the EU; knowledge and views on the main EU institutions, assessing the importance of the main institutions of the EU and trust in them; a positive vision for the future of the European Union etc. The author considers the performance and objective characteristics and dimensions, including positive correlation of national and European levels of identity (European identity and European behavior to be the indicatiors of European political awareness. On the basis of these indicators the control of the condition and trends of European political consciousness development will be carried out.

  14. Noble internal transport barriers and radial subdiffusion of toroidal magnetic lines

    Energy Technology Data Exchange (ETDEWEB)

    Misguich, J.H.; Reuss, J.D. [Association Euratom-CEA sur la Fusion, CEA/DSM/DRFC, 13 - Saint Paul lez Durance (France); Constantinescu, D.; Steinbrecher, G. [Association Euratom-N.A.S.T.I., Dept. of Physics, University of Craiova (Romania); Vlad, M.; Spineanu, F. [Association Euratom-N.A.S.T.I., National Institute of Laser, Plasma and Radiation Physics, Bucharest (Romania); Weyssow, B.; Balescu, R. [Association Euratom-Etat Belge sur la Fusion, Universite Libre de Bruxelles (Belgium)

    2002-02-01

    Internal transport barriers (ITB's) observed in tokamaks are described by a purely magnetic approach. Magnetic line motion in toroidal geometry with broken magnetic surfaces is studied from a previously derived Hamiltonian map in situation of incomplete chaos. This appears to reproduce in a realistic way the main features of a tokamak, for a given safety factor profile and in terms of a single parameter L representing the amplitude of the magnetic perturbation. New results are given concerning the Shafranov shift as function of L. For small values of L, closed magnetic surfaces exist (KAM tori) and island chains begin to appear on rational surfaces for higher values of L, with chaotic zones around hyperbolic points, as expected. Single trajectories of magnetic line motion indicate the persistence of a central protected plasma core, surrounded by a chaotic shell enclosed in a double-sided transport barrier. Magnetic lines which succeed to escape across this barrier begin to wander in a wide chaotic sea extending up to a very robust barrier (as long as L{<=}1). For values of L{>=}1, above the escape threshold, most magnetic lines succeed to escape out of the external barrier which has become a permeable Cantorus. Statistical analysis of a large number of trajectories, representing the evolution of a bunch of magnetic lines, indicate that the flux variable {psi} asymptotically grows in a diffuse manner as (L{sup 2}t) with a L{sup 2} scaling as expected, but that the average radial position r{sub m}(t) asymptotically grows as (L{sup 2}t){sup 1/4} while the mean square displacement around this average radius asymptotically grows in a sub-diffusive manner as (L{sup 2}t){sup 1/2}. This result shows the slower dispersion in the present incomplete chaotic regime, which is different from the usual quasilinear diffusion in completely chaotic situations. For physical times t{sub {phi}} of the order of the escape time defined by x{sub m}(t{sub {phi}}) {approx}1, the motion

  15. Noble internal transport barriers and radial subdiffusion of toroidal magnetic lines

    International Nuclear Information System (INIS)

    Misguich, J.H.; Reuss, J.D.; Constantinescu, D.; Steinbrecher, G.; Vlad, M.; Spineanu, F.; Weyssow, B.; Balescu, R.

    2002-02-01

    Internal transport barriers (ITB's) observed in tokamaks are described by a purely magnetic approach. Magnetic line motion in toroidal geometry with broken magnetic surfaces is studied from a previously derived Hamiltonian map in situation of incomplete chaos. This appears to reproduce in a realistic way the main features of a tokamak, for a given safety factor profile and in terms of a single parameter L representing the amplitude of the magnetic perturbation. New results are given concerning the Shafranov shift as function of L. For small values of L, closed magnetic surfaces exist (KAM tori) and island chains begin to appear on rational surfaces for higher values of L, with chaotic zones around hyperbolic points, as expected. Single trajectories of magnetic line motion indicate the persistence of a central protected plasma core, surrounded by a chaotic shell enclosed in a double-sided transport barrier. Magnetic lines which succeed to escape across this barrier begin to wander in a wide chaotic sea extending up to a very robust barrier (as long as L≤1). For values of L≥1, above the escape threshold, most magnetic lines succeed to escape out of the external barrier which has become a permeable Cantorus. Statistical analysis of a large number of trajectories, representing the evolution of a bunch of magnetic lines, indicate that the flux variable ψ asymptotically grows in a diffuse manner as (L 2 t) with a L 2 scaling as expected, but that the average radial position r m (t) asymptotically grows as (L 2 t) 1/4 while the mean square displacement around this average radius asymptotically grows in a sub-diffusive manner as (L 2 t) 1/2 . This result shows the slower dispersion in the present incomplete chaotic regime, which is different from the usual quasilinear diffusion in completely chaotic situations. For physical times t φ of the order of the escape time defined by x m (t φ ) ∼1, the motion appears to be super-diffusive, however, but less dangerous than

  16. Stability of parameters in repeated TVA measures

    DEFF Research Database (Denmark)

    Sørensen, Thomas Alrik

    Several recent studies have explored the limitations of human visual short-term memory or VSTM (e.g. Luck & Vogel, 1997; Wheeler & Treisman, 2002; Alvarez & Cavanagh, 2004). Usually researchers agree that VSTM is limited to a capacity of about 3 to 4 objects at any given moment (Cowan, 2001......). Capacity of short-term memory is measured in a range of studies often using the change detection paradigm (CD). However, the whole report paradigm (WR) may be a more reliable paradigm (Cusack, Lehmann, Veldsman, & Mitchell, 2009). Moreover, each individual WR trial yield more information compared to a CD...

  17. Measurement of the Z boson resonance parameters

    International Nuclear Information System (INIS)

    Feldman, G.J.

    1989-11-01

    Using the Mark II detector at the SLC, we measure the Z mass and width to be 91.17 ± 0.18 GeV/c 2 and 1.95 +0. 40 -0.30 GeV, respectively. From a fit in which the visible Z width is constrained to its Standard Model value, the number of neutrino species is determined to be 3.0 ± or <4.4 at the 95% confidence level. 13 refs., 20 figs., 4 tabs

  18. Statistical MOSFET Parameter Extraction with Parameter Selection for Minimal Point Measurement

    Directory of Open Access Journals (Sweden)

    Marga Alisjahbana

    2013-11-01

    Full Text Available A method to statistically extract MOSFET model parameters from a minimal number of transistor I(V characteristic curve measurements, taken during fabrication process monitoring. It includes a sensitivity analysis of the model, test/measurement point selection, and a parameter extraction experiment on the process data. The actual extraction is based on a linear error model, the sensitivity of the MOSFET model with respect to the parameters, and Newton-Raphson iterations. Simulated results showed good accuracy of parameter extraction and I(V curve fit for parameter deviations of up 20% from nominal values, including for a process shift of 10% from nominal.

  19. Speeding up the first-passage for subdiffusion by introducing a finite potential barrier

    International Nuclear Information System (INIS)

    Palyulin, Vladimir V; Metzler, Ralf

    2014-01-01

    We show that for a subdiffusive continuous time random walk with scale-free waiting time distribution the first-passage dynamics on a finite interval can be optimized by introduction of a piecewise linear potential barrier. Analytical results for the survival probability and first-passage density based on the fractional Fokker–Planck equation are shown to agree well with Monte Carlo simulations results. As an application we discuss an improved design for efficient translocation of gradient copolymers compared to homopolymer translocation in a quasi-equilibrium approximation. (fast track communications)

  20. Subdiffusivity of a random walk among a Poisson system of moving traps on ${\\mathbb Z}$

    OpenAIRE

    Athreya, Siva; Drewitz, Alexander; Sun, Rongfeng

    2016-01-01

    We consider a random walk among a Poisson system of moving traps on ${\\mathbb Z}$. In earlier work [DGRS12], the quenched and annealed survival probabilities of this random walk have been investigated. Here we study the path of the random walk conditioned on survival up to time $t$ in the annealed case and show that it is subdiffusive. As a by-product, we obtain an upper bound on the number of so-called thin points of a one-dimensional random walk, as well as a bound on the total volume of th...

  1. Footprint parameters as a measure of arch height.

    Science.gov (United States)

    Hawes, M R; Nachbauer, W; Sovak, D; Nigg, B M

    1992-01-01

    The human foot has frequently been categorized into arch height groups based upon analysis of footprint parameters. This study investigates the relationship between directly measured arch height and many of the footprint parameters that have been assumed to represent arch height. A total of 115 male subjects were measured and footprint parameters were calculated from digitized outlines. Correlation and regression analyses were used to determine the relationship between footprint measures and arch height. It may be concluded from the results that footprint parameters proposed in the literature (arch angle, footprint index, and arch index) and two further parameters suggested in this study (arch length index and truncated arch index) are invalid as a basis for prediction or categorization of arch height. The categorization of the human foot according to the footprint measures evaluated in this paper represent no more than indices and angles of the plantar surface of the foot itself.

  2. Intracellular Transport of Cargo in a Sub-diffusive Environment over an Explicit Cytoskeletal Network

    Science.gov (United States)

    Maelfeyt, Bryan; Gopinathan, Ajay

    Intracellular transport occurs in nearly all eukaryotic cells, where materials such as proteins, lipids, carbohydrates, and nucleic acids travel to target locations through phases of passive, diffusion-based transport and active, motor-driven transport along filaments that make up the cell's cytoskeleton.We develop a computational model of the process with explicit cytoskeletal filament networks. In the active transport phase, cargo moves in straight lines along these filaments that are spread throughout the cell. To model the passive transport phase of cargo in the cytoplasm, where anomalous sub-diffusion is thought to take place, we implement a continuous-time random walk. We use this approach to provide a stepping stone to a predictive model where we can determine transport properties over a cytoskeletal network provided by experimental images of real filaments. We illustrate our approach by modeling the transport of insulin out of the cell and determining the impact of network geometry, anomalous sub-diffusion and motor number on the first-passage time distributions for insulin granules reaching their target destinations on the membrane.

  3. Fractional Klein–Kramers dynamics for subdiffusion and Itô formula

    International Nuclear Information System (INIS)

    Orzeł, Sebastian; Weron, Aleksander

    2011-01-01

    Subdiffusion in the presence of an external force field has been recently described in phase space by the fractional Klein–Kramers equation. In this paper using a subordination method, we identify a two-dimensional stochastic process (position, velocity) whose probability density function is a solution of the fractional Klein–Kramers equation. The structure of this process agrees with the two-stage scenario underlying the anomalous diffusion mechanism, in which trapping events are superimposed on the Langevin dynamics. Applying an extension of the celebrated Itô formula for subdiffusion we found that the velocity process can be represented explicitly by a corresponding fractional Ornstein–Uhlenbeck process. A basic feature arising in the context of this stochastic representation is the random change of time of the system made by subordination. For the position and velocity processes we present a computer visualization of their sample paths and we derive an explicit expression for the two-point correlation function of the velocity process. The obtained stochastic representation is crucial in constructing an algorithm to simulate sample paths of the anomalous diffusion, which in turn allows us to detect and examine many relevant properties of the system under consideration

  4. First Measurements of Higher Order Optics Parameters in the LHC

    CERN Document Server

    Vanbavinckhove, G; Bartolini, R; Calaga, R; Giovannozzi, M; Maclean, E H; Miyamoto, R; Schmidt, F; Tomas, R

    2011-01-01

    Higher order effects can play an important role in the performance of the LHC. Lack of knowledge of these pa- rameters can increase the tune footprint and compromise the beam lifetime. First measurements of these parameters at injection and flattop have been conducted. Detailed sim- ulations are compared to the measurements together with discussions on the measurement limitations.

  5. Estimation of Aerodynamic Parameters in Conditions of Measurement

    Directory of Open Access Journals (Sweden)

    Htang Om Moung

    2017-01-01

    Full Text Available The paper discusses the problem of aircraft parameter identification in conditions of measurement noises. It is assumed that all the signals involved into the process of identification are subjects to measurement noises, that is measurement random errors normally distributed. The results of simulation are presented which show the relation between the noises standard deviations and the accuracy of identification.

  6. Psychoacoustic parameters and its measuring system; Onshitsu hyoka wo hyokasuru tame no parameter to keisoku system

    Energy Technology Data Exchange (ETDEWEB)

    Ohashi, M.; Imaizumi, H.; Ono, T. [Ono Sokki Co. Ltd., Tokyo (Japan)

    1998-05-01

    Human auditory sensation has both extremely excellent performance and general versatility as sound analyzer. At present, it is impossible to make equipment with the same functions as human being, and describe an auditory sensation function as acoustic sensor even by any physical analysis techniques. However, extraction of auditory sensation parameters is becoming possible by using psychoacoustics and binaural signal processing. This paper mainly explains the calculation method of sound quality evaluation parameters derived from psychoacoustic results based on a sound quality evaluation system under development by the authors. This system is based on binaural measurement by dummy head, and calculates psychoacoustic parameters such as loudness, sharpness, roughness, fluctuation strength and tonality through frequency analysis of the measured stereo signals. The system also calculates 2-D parameters such as sensory pleasantness and unbiased annoyance based on the above parameters. 12 refs., 4 figs.

  7. Multi-Parameter Measurement in Unseeded Flows using Femtosecond Lasers

    Data.gov (United States)

    National Aeronautics and Space Administration — Our approach is to use new turn-key femtosecond laser technology along with new high-speed CMOS camera technology to build a multi-parameter measurement system based...

  8. Impacts of Different Types of Measurements on Estimating Unsaturatedflow Parameters

    Science.gov (United States)

    Shi, L.

    2015-12-01

    This study evaluates the value of different types of measurements for estimating soil hydraulic parameters. A numerical method based on ensemble Kalman filter (EnKF) is presented to solely or jointly assimilate point-scale soil water head data, point-scale soil water content data, surface soil water content data and groundwater level data. This study investigates the performance of EnKF under different types of data, the potential worth contained in these data, and the factors that may affect estimation accuracy. Results show that for all types of data, smaller measurements errors lead to faster convergence to the true values. Higher accuracy measurements are required to improve the parameter estimation if a large number of unknown parameters need to be identified simultaneously. The data worth implied by the surface soil water content data and groundwater level data is prone to corruption by a deviated initial guess. Surface soil moisture data are capable of identifying soil hydraulic parameters for the top layers, but exert less or no influence on deeper layers especially when estimating multiple parameters simultaneously. Groundwater level is one type of valuable information to infer the soil hydraulic parameters. However, based on the approach used in this study, the estimates from groundwater level data may suffer severe degradation if a large number of parameters must be identified. Combined use of two or more types of data is helpful to improve the parameter estimation.

  9. Measurement of agricultural parameters using wireless sensor network (WSN)

    Science.gov (United States)

    Guaña-Moya, Javier; Sánchez-Almeida, Tarquino; Salgado-Reyes, Nelson

    2018-04-01

    The technological advances have allowed to create new applications in telecommunications, applying low power and reduced costs in their equipment, thus achieving the evolution of new wireless networks or also denominated Wireless Sensor Network. These technologies allow the generation of measurements and analysis of environmental parameter data and soil. Precision agriculture requires parameters for the improvement of production, obtained through WSN technologies. This research analyzes the climatic requirements and soil parameters in a rose plantation in a greenhouse at an altitude of 3,100 meters above sea level. In the present investigation, maximum parameters were obtained in the production of roses, which are in the optimum range of production, whereas the minimum parameters of temperature, humidity and luminosity, evidenced that these parameters can damage the plants, since temperatures less than 10 °C slow down the growth of the plant and allow the proliferation of diseases and fungi.

  10. Determination of complex microcalorimeter parameters with impedance measurements

    International Nuclear Information System (INIS)

    Saab, T.; Bandler, S.R.; Chervenak, J.; Figueroa-Feliciano, E.; Finkbeiner, F.; Iyomoto, N.; Kelley, R.L.; Kilbourne, C.A.; Lindeman, M.A.; Porter, F.S.; Sadleir, J.

    2006-01-01

    The proper understanding and modeling of a microcalorimeter's response requires accurate knowledge of a handful of parameters, such as C, G, α. While a few of these parameters are directly determined from the IV characteristics, some others, notoriously the heat capacity (C) and α, appear in degenerate combinations in most measurable quantities. The consideration of a complex microcalorimeter leads to an added ambiguity in the determination of the parameters. In general, the dependence of the microcalorimeter's complex impedance on these various parameters varies with frequency. This dependence allows us to determine individual parameters by fitting the prediction of the microcalorimeter model to impedance data. In this paper we describe efforts at characterizing the Goddard X-ray microcalorimeters. With the parameters determined by this method, we compare the pulse shape and noise spectra predictions to data taken with the same devices

  11. Definition and measurement of statistical gloss parameters from curved objects

    Energy Technology Data Exchange (ETDEWEB)

    Kuivalainen, Kalle; Oksman, Antti; Peiponen, Kai-Erik

    2010-09-20

    Gloss standards are commonly defined for gloss measurement from flat surfaces, and, accordingly, glossmeters are typically developed for flat objects. However, gloss inspection of convex, concave, and small products is also important. In this paper, we define statistical gloss parameters for curved objects and measure gloss data on convex and concave surfaces using two different diffractive-optical-element-based glossmeters. Examples of measurements with the two diffractive-optical-element-based glossmeters are given for convex and concave aluminum pipe samples with and without paint. The defined gloss parameters for curved objects are useful in the characterization of the surface quality of metal pipes and other objects.

  12. Definition and measurement of statistical gloss parameters from curved objects

    International Nuclear Information System (INIS)

    Kuivalainen, Kalle; Oksman, Antti; Peiponen, Kai-Erik

    2010-01-01

    Gloss standards are commonly defined for gloss measurement from flat surfaces, and, accordingly, glossmeters are typically developed for flat objects. However, gloss inspection of convex, concave, and small products is also important. In this paper, we define statistical gloss parameters for curved objects and measure gloss data on convex and concave surfaces using two different diffractive-optical-element-based glossmeters. Examples of measurements with the two diffractive-optical-element-based glossmeters are given for convex and concave aluminum pipe samples with and without paint. The defined gloss parameters for curved objects are useful in the characterization of the surface quality of metal pipes and other objects.

  13. Influence of measurement errors and estimated parameters on combustion diagnosis

    International Nuclear Information System (INIS)

    Payri, F.; Molina, S.; Martin, J.; Armas, O.

    2006-01-01

    Thermodynamic diagnosis models are valuable tools for the study of Diesel combustion. Inputs required by such models comprise measured mean and instantaneous variables, together with suitable values for adjustable parameters used in different submodels. In the case of measured variables, one may estimate the uncertainty associated with measurement errors; however, the influence of errors in model parameter estimation may not be so easily established on an experimental basis. In this paper, a simulated pressure cycle has been used along with known input parameters, so that any uncertainty in the inputs is avoided. Then, the influence of errors in measured variables and geometric and heat transmission parameters on the results of a diagnosis combustion model for direct injection diesel engines have been studied. This procedure allowed to establish the relative importance of these parameters and to set limits to the maximal errors of the model, accounting for both the maximal expected errors in the input parameters and the sensitivity of the model to those errors

  14. Measurement of the Acoustic Nonlinearity Parameter for Biological Media.

    Science.gov (United States)

    Cobb, Wesley Nelson

    In vitro measurements of the acoustic nonlinearity parameter are presented for several biological media. With these measurements it is possible to predict the distortion of a finite amplitude wave in biological tissues of current diagnostic and research interest. The measurement method is based on the finite amplitude distortion of a sine wave that is emmitted by a piston source. The growth of the second harmonic component of this wave is measured by a piston receiver which is coaxial with and has the same size as the source. The experimental measurements and theory are compared in order to determine the nonlinearity parameter. The density, sound speed, and attenuation for the medium are determined in order to make this comparison. The theory developed for this study accounts for the influence of both diffraction and attenuation on the experimental measurements. The effects of dispersion, tissue inhomogeneity and gas bubbles within the excised tissues are studied. To test the measurement method, experimental results are compared with established values for the nonlinearity parameter of distilled water, ethylene glycol and glycerol. The agreement between these values suggests that the measurement uncertainty is (+OR-) 5% for liquids and (+OR-) 10% for solid tissues. Measurements are presented for dog blood and bovine serum albumen as a function of concentration. The nonlinearity parameters for liver, kidney and spleen are reported for both human and canine tissues. The values for the fresh tissues displayed little variation (6.8 to 7.8). Measurements for fixed, normal and cirrhotic tissues indicated that the nonlinearity parameter does not depend strongly on pathology. However, the values for fixed tissues were somewhat higher than those of the fresh tissues.

  15. Cloud and Thermodynamic Parameters Retrieved from Satellite Ultraspectral Infrared Measurements

    Science.gov (United States)

    Zhou, Daniel K.; Smith, William L.; Larar, Allen M.; Liu, Xu; Taylor, Jonathan P.; Schluessel, Peter; Strow, L. Larrabee; Mango, Stephen A.

    2008-01-01

    Atmospheric-thermodynamic parameters and surface properties are basic meteorological parameters for weather forecasting. A physical geophysical parameter retrieval scheme dealing with cloudy and cloud-free radiance observed with satellite ultraspectral infrared sounders has been developed and applied to the Infrared Atmospheric Sounding Interferometer (IASI) and the Atmospheric InfraRed Sounder (AIRS). The retrieved parameters presented herein are from radiance data gathered during the Joint Airborne IASI Validation Experiment (JAIVEx). JAIVEx provided intensive aircraft observations obtained from airborne Fourier Transform Spectrometer (FTS) systems, in-situ measurements, and dedicated dropsonde and radiosonde measurements for the validation of the IASI products. Here, IASI atmospheric profile retrievals are compared with those obtained from dedicated dropsondes, radiosondes, and the airborne FTS system. The IASI examples presented here demonstrate the ability to retrieve fine-scale horizontal features with high vertical resolution from satellite ultraspectral sounder radiance spectra.

  16. Limit theorems for random walks on a strip in subdiffusive regimes

    International Nuclear Information System (INIS)

    Dolgopyat, D; Goldsheid, I

    2013-01-01

    We study the asymptotic behaviour of occupation times of a transient random walk (RW) in a quenched random environment (RE) on a strip in a subdiffusive regime. The asymptotic behaviour of hitting times, which is a more traditional object of study, is exactly the same. As a particular case, we solve a long standing problem of describing the asymptotic behaviour of a RW with bounded jumps on a one-dimensional lattice. Our technique results from the development of ideas from our previous work (Dolgopyat and Goldsheid 2012 Commun. Math. Phys. 315 241–77) on the simple RWs in RE and those used in Bolthausen and Goldsheid (2000 Commun. Math. Phys. 214 429–47; 2008 Commun. Math. Phys. 278 253–88) and Goldsheid (2008 Probab. Theory Relat. Fields 141 471–511) for the study of random walks on a strip. (paper)

  17. Statistical modelling of subdiffusive dynamics in the cytoplasm of living cells: A FARIMA approach

    Science.gov (United States)

    Burnecki, K.; Muszkieta, M.; Sikora, G.; Weron, A.

    2012-04-01

    Golding and Cox (Phys. Rev. Lett., 96 (2006) 098102) tracked the motion of individual fluorescently labelled mRNA molecules inside live E. coli cells. They found that in the set of 23 trajectories from 3 different experiments, the automatically recognized motion is subdiffusive and published an intriguing microscopy video. Here, we extract the corresponding time series from this video by image segmentation method and present its detailed statistical analysis. We find that this trajectory was not included in the data set already studied and has different statistical properties. It is best fitted by a fractional autoregressive integrated moving average (FARIMA) process with the normal-inverse Gaussian (NIG) noise and the negative memory. In contrast to earlier studies, this shows that the fractional Brownian motion is not the best model for the dynamics documented in this video.

  18. The out of equilibrium response function in sub-diffusive systems

    International Nuclear Information System (INIS)

    Gradenigo, G; Puglisi, A; Sarracino, A; Vulpiani, A; Villamaina, D

    2012-01-01

    We study the Einstein relation between spontaneous fluctuations and the response to an external perturbation for the comb model and the single file, which are examples of systems with sub-diffusive transport properties. The relevance of nonequilibrium conditions is investigated: when a stationary current (in the form of a drift or an energy flux) is present, the Einstein relation breaks down. In the case of the comb model, a general relation - appearing in the recent literature - between the response function and an unperturbed suitable correlation function allows us to explain the obtained results. This suggests that the relevant ingredient in breaking the Einstein formula, for stationary regimes, is not anomalous diffusion but the presence of currents driving the system out of equilibrium.

  19. Activation method for measurement of neutron spectrum parameters

    International Nuclear Information System (INIS)

    Efimov, B.V.; Demidov, A.M.; Ionov, V.S.; Konjaev, S.I.; Marin, S.V.; Bryzgalov, V.I.

    2007-01-01

    Experimental researches of spectrum parameters of neutrons at nuclear installations RRC KI are submitted. The installations have different designs of the cores, reflector, parameters and types of fuel elements. Measurements were carried out with use of the technique developed in RRC KI for irradiation resonance detectors UKD. The arrangement of detectors in the cores ensured possibility of measurement of neutron spectra with distinguished values of parameters. The spectrum parameters which are introduced by parametrical representation of a neutrons spectrum in the form corresponding to formalism Westcott. On experimental data were determinate absolute values of density neutron flux (DNF) in thermal and epithermal area of a spectrum (F t , f epi ), empirical dependence of temperature of neutron gas (Tn) on parameter of a rigidity of a spectrum (z), density neutron flux in transitional energy area of the spectrum. Dependences of spectral indexes of nuclides (UDy/UX), included in UKD, from a rigidity z and-or temperatures of neutron gas Tn are obtained.B Tools of mathematical processing of results are used for activation data and estimation of parameters of a spectrum (F t , f epi , z, Tn, UDy/UX). In the paper are presented some results of researches of neutron spectrum parameters of the nuclear installations (Authors)

  20. DAQ system for low density plasma parameters measurement

    International Nuclear Information System (INIS)

    Joshi, Rashmi S.; Gupta, Suryakant B.

    2015-01-01

    In various cases where low density plasmas (number density ranges from 1E4 to 1E6 cm -3 ) exist for example, basic plasma studies or LEO space environment measurement of plasma parameters becomes very critical. Conventional tip (cylindrical) Langmuir probes often result into unstable measurements in such lower density plasma. Due to larger surface area, a spherical Langmuir probe is used to measure such lower plasma densities. Applying a sweep voltage signal to the probe and measuring current values corresponding to these voltages gives V-I characteristics of plasma which can be plotted on a digital storage oscilloscope. This plot is analyzed for calculating various plasma parameters. The aim of this paper is to measure plasma parameters using a spherical Langmuir probe and indigenously developed DAQ system. DAQ system consists of Keithley source-meter and a host system connected by a GPIB interface. An online plasma parameter diagnostic system is developed for measuring plasma properties for non-thermal plasma in vacuum. An algorithm is developed using LabVIEW platform. V-I characteristics of plasma are plotted with respect to different filament current values and different locations of Langmuir probe with reference to plasma source. V-I characteristics is also plotted for forward and reverse voltage sweep generated programmatically from the source meter. (author)

  1. Measurement Error Estimation for Capacitive Voltage Transformer by Insulation Parameters

    Directory of Open Access Journals (Sweden)

    Bin Chen

    2017-03-01

    Full Text Available Measurement errors of a capacitive voltage transformer (CVT are relevant to its equivalent parameters for which its capacitive divider contributes the most. In daily operation, dielectric aging, moisture, dielectric breakdown, etc., it will exert mixing effects on a capacitive divider’s insulation characteristics, leading to fluctuation in equivalent parameters which result in the measurement error. This paper proposes an equivalent circuit model to represent a CVT which incorporates insulation characteristics of a capacitive divider. After software simulation and laboratory experiments, the relationship between measurement errors and insulation parameters is obtained. It indicates that variation of insulation parameters in a CVT will cause a reasonable measurement error. From field tests and calculation, equivalent capacitance mainly affects magnitude error, while dielectric loss mainly affects phase error. As capacitance changes 0.2%, magnitude error can reach −0.2%. As dielectric loss factor changes 0.2%, phase error can reach 5′. An increase of equivalent capacitance and dielectric loss factor in the high-voltage capacitor will cause a positive real power measurement error. An increase of equivalent capacitance and dielectric loss factor in the low-voltage capacitor will cause a negative real power measurement error.

  2. Measurement of drill grinding parameters using laser sensor

    Science.gov (United States)

    Yanping, Peng; Kumehara, Hiroyuki; Wei, Zhang; Nomura, Takashi

    2005-12-01

    To measure the grinding parameters and geometry parameters accurately for a drill point is essential to its design and reconditioning. In recent years, a number of non-contact coordinate measuring apparatuses, using CCD camera or laser sensors, are developed. But, a lot work is to be done for further improvement. This paper reports another kind of laser coordinate meter. As an example of its application, the method for geometry inspection of the drill flank surface is detailed. Measured data from laser scanning on the flank surface around some points with several 2-dimensional curves are analyzed with mathematical procedure. If one of these curves turns to be a straight line, it must be the generatrix of the grinding cone. Thus, the grinding parameters are determined by a set of three generatrices. Then, the measurement method and data processing procedure are proposed. Its validity is assessed by measuring a sample with given parameters. The point geometry measured agrees well with the known values. In comparison with other methods in the published literature, it is simpler in computation and more accurate in results.

  3. Research On The Measure Method Of Oblique Pinhole Parameters

    Directory of Open Access Journals (Sweden)

    Ma Yu-Zhen

    2016-01-01

    Full Text Available There are many special advantages in measuring the diameter of blind and deep holes with a capacitive probe, there are still some challenges for the measurement of a oblique pinhole parameters because the measuring device is inconvenient to stretch into the oblique pinhole exactly. A five-dimensional measurement system was adopted in the paper which included a capacitive sensor probe and a three-coordinate measuring machine to accomplish the measurement for oblique pinholes. With the help of the three-dimensional coordinates measured from the pinhole axis, we put forward a comprehensive method of combining the projection method and the least squares method together for fitting spatial straight line to obtain the optimal equation of the spacial axis. Finally, a reliable and entire measurement system was set up.

  4. COMPREHENSIVE CHECK MEASUREMENT OF KEY PARAMETERS ON MODEL BELT CONVEYOR

    Directory of Open Access Journals (Sweden)

    Vlastimil MONI

    2013-07-01

    Full Text Available Complex measurements of characteristic parameters realised on a long distance model belt conveyor are described. The main objective was to complete and combine the regular measurements of electric power on drives of belt conveyors operated in Czech opencast mines with measurements of other physical quantities and to gain by this way an image of their mutual relations and relations of quantities derived from them. The paper includes a short description and results of the measurements on an experimental model conveyor with a closed material transport way.

  5. Activation method for measuring the neutron spectra parameters. Computer software

    International Nuclear Information System (INIS)

    Efimov, B.V.; Ionov, V.S.; Konyaev, S.I.; Marin, S.V.

    2005-01-01

    The description of mathematical statement of a task for definition the spectral characteristics of neutron fields with use developed in RRC KI unified activation detectors (UKD) is resulted. The method of processing of results offered by authors activation measurements and calculation of the parameters used for an estimation of the neutron spectra characteristics is discussed. Features of processing of the experimental data received at measurements of activation with using UKD are considered. Activation detectors UKD contain a little bit specially the picked up isotopes giving at irradiation peaks scale of activity in the common spectrum scale of activity. Computing processing of results of the measurements is applied on definition of spectrum parameters for nuclear reactor installations with thermal and close to such power spectrum of neutrons. The example of the data processing, the measurements received at carrying out at RRC KI research reactor F-1 is resulted [ru

  6. Measurement of the Michel Parameters in Leptonic Tau Decays

    CERN Document Server

    Ackerstaff, K.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Ashby, S.F.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Behnke, T.; Bell, Kenneth Watson; Bella, G.; Bentvelsen, S.; Bethke, S.; Betts, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bobinski, M.; Bock, P.; Bohme, J.; Boutemeur, M.; Braibant, S.; Bright-Thomas, P.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Ciocca, C.; Clarke, P.E.L.; Clay, E.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Couyoumtzelis, C.; Coxe, R.L.; Cuffiani, M.; Dado, S.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; de Roeck, A.; Desch, K.; Dienes, B.; Dixit, M.S.; Doucet, M.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Estabrooks, P.G.; Etzion, E.; Evans, H.G.; Fabbri, F.; Fanfani, A.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fischer, H.M.; Fleck, I.; Folman, R.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Geich-Gimbel, C.; Geralis, T.; Giacomelli, G.; Giacomelli, P.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Hargrove, C.K.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Hocker, James Andrew; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Igo-Kemenes, P.; Imrie, D.C.; Ishii, K.; Jacob, F.R.; Jawahery, A.; Jeremie, H.; Jimack, M.; Joly, A.; Jones, C.R.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kowalewski, Robert V.; Kress, T.; Krieger, P.; von Krogh, J.; Kyberd, P.; Lafferty, G.D.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Lawson, I.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lefebvre, E.; Lellouch, D.; Letts, J.; Levinson, L.; Liebisch, R.; List, B.; Littlewood, C.; Lloyd, A.W.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Lui, D.; Macchiolo, A.; Macpherson, A.; Mannelli, M.; Marcellini, S.; Markopoulos, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Poli, B.; Polok, J.; Przybycien, M.; Rembser, C.; Rick, H.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Roscoe, K.; Rossi, A.M.; Rozen, Y.; Runge, K.; Runolfsson, O.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sang, W.M.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schieck, J.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schorner, T.; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Sproston, M.; Stahl, A.; Stephens, K.; Steuerer, J.; Stoll, K.; Strom, David M.; Strohmer, R.; Tafirout, R.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Torrence, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Van Kooten, Rick J.; Vannerem, P.; Verzocchi, M.; Vikas, P.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilson, G.W.; Wilson, J.A.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.

    1999-01-01

    The Michel parameters of the leptonic tau decays are measured using the OPAL detector at LEP. The Michel parameters are extracted from the energy spectra of the charged decay leptons and from their energy-energy correlations. A new method involving a global likelihood fit of Monte Carlo generated events with complete detector simulation and background treatment has been applied to the data recorded at center-of-mass energies close to sqrt(s) = M(Z) corresponding to an integrated luminosity of 155 pb-1 during the years 1990 to 1995. If e-mu universality is assumed and inferring the tau polarization from neutral current data, the measured Michel parameters are extracted. Limits on non-standard coupling constants and on the masses of new gauge bosons are obtained. The results are in agreement with the V-A prediction of the Standard Model.

  7. Sexual dimorphism in visceral adiposity measures, parameters and ...

    African Journals Online (AJOL)

    Visceral adipose tissue is considered the most important anatomic site of adipose tissue aggregation and is considered the hall mark of metabolic syndrome (MetS) phenotype. The aim of the study was to determine sexual dimorphism in visceral adiposity measures, parameters and biomarkers of metabolic syndrome ...

  8. Measurement of speech parameters in casual speech of dementia patients

    NARCIS (Netherlands)

    Ossewaarde, Roelant; Jonkers, Roel; Jalvingh, Fedor; Bastiaanse, Yvonne

    Measurement of speech parameters in casual speech of dementia patients Roelant Adriaan Ossewaarde1,2, Roel Jonkers1, Fedor Jalvingh1,3, Roelien Bastiaanse1 1CLCG, University of Groningen (NL); 2HU University of Applied Sciences Utrecht (NL); 33St. Marienhospital - Vechta, Geriatric Clinic Vechta

  9. Measuring, calculating and estimating PEP's parasitic mode loss parameters

    International Nuclear Information System (INIS)

    Weaver, J.N.

    1981-01-01

    This note discusses various ways the parasitic mode losses from a bunched beam to a vacuum chamber can be measured, calculated or estimated. A listing of the parameter, k, for the various PEP ring components is included. A number of formulas for calculating multiple and single pass losses are discussed and evaluated for several cases. 25 refs., 1 fig., 1 tab

  10. Local measurement of transport parameters for laser injected trace impurities

    Energy Technology Data Exchange (ETDEWEB)

    Giannella, R; Lauro-Taroni, L [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking

    1994-07-01

    A procedure has been developed that determines local measurements of transport parameters`s profiles for injected impurities. The measured profiles extend from the plasma centre up to a certain radial position (usually {rho} = 0.6-0.7). In the outer region of the plasma the procedure supplies ``most suitable extensions`` up to the plasma edge of the measured transport profiles. The procedure intrinsically assures consistency and excellent agreement between the simulated and experimental data of local broad band soft X-ray emissivity and intensities of individual emission lines from different ion states of the injected impurities. 4 refs., 3 figs.

  11. Equipment for the measurement of non-electrical parameters

    International Nuclear Information System (INIS)

    Lewin, M.I.; Ewtuchow, A.N.

    1977-01-01

    The invention concerns equipment for the measurement of non-electrical parameters, which can be used in data processing and control equipment. The transducer converts non-electrical parameters into electrical signals. The process according to the invention is explained using the example of an inductive transducer, which is fed with alternating current. The measured parameter affects the mutual inductance of the transducer, so that the secondary voltage supplied by it is a function of the measured parameter. Amplitude measurement of this voltage by means of rectification and filtering has the disadvantage of long time constants, where the measuring period would amount to 6 to 10 cycles of the supply voltage. According to the invention the secondary voltage of the transducer is connected to an integrator during a half-cycle between two zeros, which charges a capacitor to a voltage proportional to the amplitude. An analogue-digital converter now produces a digital signal corresponding to the capacitor voltage, which is taken to the control equipment. This conversion occurs during a fraction of the second half-cycle, so that there is still time before the end of this half-cycle, so that there is still time before the end of this half-cycle to discharge the capacitor and to reproduce the initial conditions. In the next cycle the whole process is repeated, so that the measuring process only takes one cycle. In order to make the digital signal independent of the amplitude of the current fed in, this also flows through an identical transducer with constant mutual inductance, and affects the analogue-digital converter via a comparative circuit. (ORU) [de

  12. Measurement of some biophysical parameters in skin lesions of leprosy

    Directory of Open Access Journals (Sweden)

    A B Gupta

    1990-01-01

    Full Text Available Transepidermal water loss (TEWL, high frequency electrical conductance (HFC and the hydration state index (HSI were measured in sldn lesions of 30 paucibacillary leprosy patients and compared with the contralateral uninvolved skin. While the TEWL, HFC and HSI all showed lower values in the lesion site, as compared to the contralateral skin sites, the differences between the two sets of values significant in HFC and. HSI only at 2% and 1% level respectively. A significant positive correlation (r = 0.69 was found to eidst between these two parameters. The parameters correlate well with the known reduced sweating in skin lesions of TT and BT leprosy and may therefore be considered as good objective parameters to confirm hypohydrosis in suspected skin lesions ofleprosy.

  13. Effects of measurement noise on modal parameter identification

    International Nuclear Information System (INIS)

    Dorvash, S; Pakzad, S N

    2012-01-01

    In the past decade, much research has been conducted on data-driven structural health monitoring (SHM) algorithms with use of sensor measurements. A fundamental step in this SHM application is to identify the dynamic characteristics of structures. Despite the significant efforts devoted to development and enhancement of the modal parameter identification algorithms, there are still substantial uncertainties in the results obtained in real-life deployments. One of the sources of uncertainties in the results is the existence of noise in the measurement data. Depending on the subsequent application of the system identification, the level of uncertainty in the results and, consequently, the level of noise contamination can be very important. As an effort towards understanding the effect of measurement noise on the modal identification, this paper presents parameters that quantify the effects of measurement noise on the modal identification process and determine their influence on the accuracy of results. The performance of these parameters is validated by a numerically simulated example. They are then used to investigate the accuracy of identified modal properties of the Golden Gate Bridge using ambient data collected by wireless sensors. The vibration monitoring tests of the Golden Gate Bridge provided two synchronized data sets collected by two different sensor types. The influence of the sensor noise level on the accuracy of results is investigated throughout this work and it is shown that high quality sensors provide more accurate results as the physical contribution of response in their measured data is significantly higher. Additionally, higher purity and consistency of modal parameters, identified by higher quality sensors, is observed in the results. (paper)

  14. Neutron capture measurements and resonance parameters of dysprosium

    Energy Technology Data Exchange (ETDEWEB)

    Shin, S.G.; Kye, Y.U.; Namkung, W.; Cho, M.H. [Pohang University of Science and Technology, Division of Advanced Nuclear Engineering, Pohang, Gyeongbuk (Korea, Republic of); Kang, Y.R.; Lee, M.W. [Dongnam Inst. of Radiological and Medical Sciences, Research Center, Busan (Korea, Republic of); Kim, G.N. [Kyungpook National University, Department of Physics, Daegu (Korea, Republic of); Ro, T.I. [Dong-A University, Department of Physics, Busan (Korea, Republic of); Danon, Y.; Williams, D. [Rensselaer Polytechnic Institute, Department of Mechanical, Aerospace, and Nuclear Engineering, Troy, NY (United States); Leinweber, G.; Block, R.C.; Barry, D.P.; Rapp, M.J. [Naval Nuclear Laboratory, Knolls Atomic Power Laboratory, Schenectady, NY (United States)

    2017-10-15

    Neutron capture yields of dysprosium isotopes ({sup 161}Dy, {sup 162}Dy, {sup 163}Dy, and {sup 164}Dy) were measured using the time-of-flight method with a 16 segment sodium iodide multiplicity detector. The measurements were made at the 25m flight station at the Gaerttner LINAC Center at Rensselaer Polytechnic Institute. Resonance parameters were obtained using the multilevel R-matrix Bayesian code SAMMY. The neutron capture data for four enriched dysprosium isotopes and one natural dysprosium sample were sequentially fitted. New resonances not listed in ENDF/B-VII.1 were observed. There were 29 and 17 new resonances from {sup 161}Dy and {sup 163}Dy isotopes, respectively. Six resonances from {sup 161}Dy isotope, two resonances from {sup 163}Dy, and four resonances from {sup 164}Dy were not observed. The capture resonance integrals of each isotope were calculated with the resulting resonance parameters and those of ENDF/B-VII.1 in the energy region from 0.5 eV to 20 MeV and were compared to the capture resonance integrals with the resonance parameters from ENDF/B-VII.1. A resonance integral value of the natural dysprosium calculated with present resonance parameters was 1405 ± 3.5 barn. The value is ∝ 0.3% higher than that obtained with the ENDF/B-VII.1 parameters. The distributions of the present and ENDF/B-VII.1 neutron widths were compared to a Porter-Thomas distribution. Neutron strength functions for {sup 161}Dy and {sup 163}Dy were calculated with the present resonance parameters and both values were in between the values of ''Atlas of Neutron Resonances'' and ENDF/B-VII.1. The present radiation width distributions of {sup 161}Dy and {sup 163}Dy were fitted with the χ{sup 2} distribution by varying the degrees of freedom. (orig.)

  15. Analysis of ESR measurement parameters for detecting irradiated spices

    International Nuclear Information System (INIS)

    Kameya, Hiromi; Hagiwara, Shoji; Todoriki, Setsuko

    2015-01-01

    The side signals from irradiated cellulose radical are used for detecting irradiated spices with the electron spin resonance (ESR). The side signals are two signals observed on both sides of a singlet signal (g≒2.00) from organic free radicals. Since the intensities of the side signals are weak, if the width of the singlet signal is large, these signals are covered and cannot be observed. In this study, we analyzed ESR measurement parameters of seven kinds spices (oregano, basil, parsley, coriander, cumin, white pepper, and black pepper) that would lead to narrow width of the singlet signal for detecting side signals. The results were as follows: 4 mW microwave power for basil, parsley, oregano, coriander, and cumin, and 8 mW for white pepper and black pepper, while modulation amplitude of 4 G, time constant of 20 ms were determined to be the optimal ESR measurement parameters. (author)

  16. Perioperative versus postoperative measurement of Taylor Spatial Frame mounting parameters.

    Science.gov (United States)

    Sökücü, Sami; Demir, Bilal; Lapçin, Osman; Yavuz, Umut; Kabukçuoğlu, Yavuz S

    2014-01-01

    The aim of this study was to determine the differences, if any, between application parameters for the Taylor Spatial Frame (TSF) system obtained during surgery under fluoroscopy and after surgery from digital radiography. This retrospective study included 17 extremities of 15 patients (8 male, 7 female; mean age: 21.9 years, range: 10 to 55 years) who underwent TSF after deformity and fracture. Application parameters measured by fluoroscopy at the end of surgery after mounting the fixator were compared with parameters obtained from anteroposterior and lateral digital radiographs taken 1 day after surgery. Fixator was applied to the femur in 8 patients, tibia in 6 and radius in 3. Mean time to removal of the frame was 3.5 (range: 3 to 7) months. Mean perioperative anteroposterior, lateral and axial frame offsets of patients were 9.1 (range: 3 to 20) mm, 18.1 (range: 5 to 37) mm and 95.3 (range: 25 to 155) mm, respectively. Mean postoperative anteroposterior, lateral and axial frame offset radiographs were 11.8 (range: 2 to 30) mm, 18 (range: 6 to 47) mm and 109.5 (range: 28 to 195) mm, respectively. There was no statistically significant difference between the groups (p>0.05). While measurements taken during operation may lengthen the duration in the operation room, fluoroscopy may provide better images and is easier to perform than digital radiography. On the other hand, there is no difference between measurements taken during perioperative fluoroscopy and postoperative digital radiography.

  17. Express method for contactless measurement of parameters of thermoelectric materials

    Directory of Open Access Journals (Sweden)

    Ashcheulov A. A.

    2015-08-01

    Full Text Available The paper presents an original method for contactless express measurement of parameters of thermoelectric materials. The presence of a combination of AC and DC magnetic fields in the gap of the oscillating circuit, where the monitored sample of the thermoelectric material is located, leads — due to Ampere force — to delamination of geometric regions of the occurrence of half-cycles of Foucault current. This in turn causes the appearance of additional heat losses in the oscillating circuit caused by Peltier effect. Computer modeling of these processes with the use of the software package ComsolFenlab 3.3 allowed determining the nature and magnitude of the electric currents in oscillating circuit, the range of operating frequencies, and the ratio of amplitudes of the variable and fixed components of the magnetic field. These components eventually cause a certain temperature difference along the controlled sample, which difference is proportional to the thermoelectric figure of merit Z of the material. The basic expressions are obtained for determining the value of the Seebeck coefficient a, thermal conductivity ?, electrical conductivity ? and thermoelectric figure of merit Z. A description is given to the design of the device for contactless express measurement of parameters of thermoelectric materials based on Bi—Te—Se—Sb solid solutions. Its distinctive feature is the ability to determine the symmetric and asymmetric components of the electric conductivity of the material values. The actual error in parameter measurement in this case is 2%.

  18. On Measurement of Helicity Parameters in Top Quark Decay

    OpenAIRE

    Nelson, Charles A.; Adler, Jr, L. J.

    2000-01-01

    To enable an evaluation of future measurements of the helicity parameters for " t --> W b " decay in regard to " T_FS violation", this paper considers the effects of an additional pure-imaginary coupling, (i g/2 Lambda) or (i g), associated with a specific, single additional Lorentz structure, i = S, P, S + P, ... Sizable " T_FS violation" signatures can occur for low-effective mass scales (< 320 GeV), but in most cases can be more simply excluded by 10% precision measurement of the probabili...

  19. Space dependence of reactivity parameters on reactor dynamic perturbation measurements

    International Nuclear Information System (INIS)

    Maletti, R.; Ziegenbein, D.

    1985-01-01

    Practical application of reactor-dynamic perturbation measurements for on-power determination of differential reactivity weight of control rods and power coefficients of reactivity has shown a significant dependence of parameters on the position of outcore detectors. The space dependence of neutron flux signal in the core of a VVER-440-type reactor was measured by means of 60 self-powered neutron detectors. The greatest neutron flux alterations are located close to moved control rods and in height of the perturbation position. By means of computations, detector positions can be found in the core in which the one-point model is almost valid. (author)

  20. Measurement of the Z Resonance Parameters at LEP

    CERN Document Server

    Barate, R; Ghez, P; Goy, C; Lees, J P; Lucotte, A; Merle, E; Minard, M N; Pietrzyk, B; Alemany, R; Casado, M P; Chmeissani, M; Comas, P; Crespo, J M; Fernández, E; Fernández-Bosman, M; Garrido, L; Graugès-Pous, E; Juste, A; Martínez, M; Merino, G; Miquel, R; Mir, L M; Orteu, S; Pacheco, A; Park, I C; Perlas, J A; Riu, I; Sánchez, F; Colaleo, A; Creanza, D; De Palma, M; Iaselli, Giuseppe; Maggi, G; Maggi, M; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Bazarko, A; Becker, U; Boix, G; Bird, F; Blucher, E; Bonvicini, G; Bright-Thomas, P G; Cattaneo, M; Cerutti, F; Ciulli, V; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Greening, T C; Hagelberg, R; Halley, A W; Hansen, J B; Harvey, J; Jacobsen, R; Janot, P; Jost, B; Knobloch, J; Lazeyras, Pierre; Lehraus, Ivan; Maley, P; Mato, P; May, J; Moutoussi, A; Ranjard, F; Rolandi, Luigi; Schlatter, W D; Schmitt, M; Schneider, O; Spagnolo, P; Tejessy, W; Teubert, F; Tomalin, I R; Tournefier, E; Veenhof, R; Wiedenmann, W; Wright, A E; Ajaltouni, Ziad J; Badaud, F; Chazelle, G; Deschamps, O; Falvard, A; Ferdi, C; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Bertelsen, H; Fernley, T; Hansen, F; Hansen, J D; Hansen, J R; Hansen, P H; Lindahl, A; Møllerud, R; Nilsson, B S; Rensch, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Siotis, I; Vayaki, Anna; Blondel, A; Bonneaud, G R; Brient, J C; Rougé, A; Rumpf, M; Swynghedauw, M; Tanaka, R; Verderi, M; Videau, H L; Focardi, E; Parrini, G; Zachariadou, K; Cavanaugh, R J; Corden, M; Georgiopoulos, C H; Antonelli, A; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Chiarella, V; Felici, G; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Picchi, P; Colrain, P; ten Have, I; Hughes, I S; Knowles, I G; Lynch, J G; Morton, W T; Raine, C; Reeves, P; O'Shea, V; Scarr, J M; Smith, K; Thompson, A S; Turnbull, R M; Buchmüller, O L; Dhamotharan, S; Geweniger, C; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Goodsir, S M; Martin, E B; Marinelli, N; Nash, J; Sciabà, A; Sedgbeer, J K; Thomson, E; Williams, M D; Ghete, V M; Girtler, P; Kneringer, E; Kuhn, D; Rudolph, G; Bowdery, C K; Buck, P G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Keemer, N R; Robertson, N A; Sloan, Terence; Snow, S W; Williams, M I; Bauerdick, L A T; Van Gemmeren, P; Giehl, I; Jakobs, K; Kasemann, M; Kleinknecht, K; Quast, G; Renk, B; Rohne, E; Sander, H G; Schmelling, M; Wachsmuth, H W; Wanke, R; Zeitnitz, C; Aubert, Jean-Jacques; Benchouk, C; Bonissent, A; Carr, J; Coyle, P; Etienne, F; Motsch, F; Payre, P; Rousseau, D; Talby, M; Thulasidas, M; Aleppo, M; Antonelli, M; Ragusa, F; Büscher, V; Dietl, H; Ganis, G; Hüttmann, K; Lütjens, G; Mannert, C; Männer, W; Moser, H G; Schael, S; Settles, Ronald; Seywerd, H C J; Stenzel, H; Wolf, G; Azzurri, P; Boucrot, J; Callot, O; Chen, S; Cordier, A; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Jacholkowska, A; Le Diberder, F R; Lefrançois, J; Lutz, A M; Schune, M H; Veillet, J J; Videau, I; Zerwas, D; Bagliesi, G; Bettarini, S; Boccali, T; Bozzi, C; Calderini, G; Dell'Orso, R; Fantechi, R; Ferrante, I; Fidecaro, F; Foà, L; Giassi, A; Gregorio, A; Ligabue, F; Lusiani, A; Marrocchesi, P S; Messineo, A; Palla, Fabrizio; Rizzo, G; Sanguinetti, G; Sguazzoni, G; Steinberger, Jack; Tenchini, Roberto; Vannini, C; Venturi, A; Verdini, P G; Blair, G A; Cowan, G D; Green, M G; Medcalf, T; Strong, J A; Von Wimmersperg-Töller, J H; Botterill, David R; Clifft, R W; Edgecock, T R; Edwards, M; Haywood, S J; Norton, P R; Thompson, J C; Bloch-Devaux, B; Colas, P; Emery, S; Kozanecki, Witold; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Roussarie, A; Schuller, J P; Schwindling, J; Vallage, B; Black, S N; Dann, J H; Kim, H Y; Konstantinidis, N P; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Cartwright, S L; Combley, F; Lehto, M H; Thompson, L F; Affholderbach, K; Barberio, E; Böhrer, A; Brandt, S; Burkhardt, H; Feigl, E; Grupen, Claus; Hess, J; Lutters, G; Meinhard, H; Minguet-Rodríguez, J A; Mirabito, L; Misiejuk, A; Neugebauer, E; Prange, G; Rivera, F; Saraiva, P; Schäfer, U; Sieler, U; Smolik, L; Stephan, F; Trier, H; Apollonio, M; Bosisio, L; Della Marina, R; Giannini, G; Gobbo, B; Musolino, G; Pitis, L; Kim, H; Rothberg, J E; Wasserbaech, S R; Armstrong, S R; Bellantoni, L; Cinabro, D; Conway, J S; Elmer, P; Feng, Z; Ferguson, D P S; Gao, Y; González, S; Grahl, J; Harton, J L; Hayes, O J; Hu, H; Jin, S; Johnson, R P; Kile, J; McNamara, P A; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Sharma, V; Walsh, A M; Walsh, J; Wear, J; Wu Sau Lan; Wu, X; Yamartino, J M; Zobernig, G

    2000-01-01

    The properties of the Z resonance are measured from the analysis of 4.5 million Z decays into fermion pairs collected with the \\Aleph\\ detector at L EP. The data are consistent with lepton universality. The resonance parameters are measured to be $\\MZ=(91.1885 \\pm 0.0031)~\\Gevcc$, $\\GZ= (2.4951 \\pm 0.0043)~\\GeV$, $\\spol=(41.559 \\pm 0.058)$~nb and, combining the three lepton flavours $\\Rl= 20.725\\pm 0.039$. The corresponding number of light neutrino species is $N_{\

  1. Measuring the scale parameter of quantum chromodynamics at CHEER

    International Nuclear Information System (INIS)

    Krauss, L.M.

    1981-01-01

    The possibility of measuring the scale parameter of quantum chromodynamics, Λsub(s), at CHEER is discussed. Rationale for the measurement of this quantity are given, along with a discussion of the theoretical difficulties involved. The meaurement of the Q 2 dependence of structure functions and their moments, and methods of measuring αsub(s) and its Q 2 evolution, are discussed, and arguments are given for the advantages and disadvantages of going to high Q 2 values at CHEER. It is concluded that while sensitivity to Λ is lowered at high Q 2 , CHEER will, in principle, be able to provide the first clean measurements of Λ, free from almost all the theoretical confusion involved in interpretations of present data

  2. Determination of electromagnetic absorption parameters by reflection measurements

    International Nuclear Information System (INIS)

    Vittitoe, C.N.

    1975-09-01

    The method described is for determining the electromagnetic absorption parameters of a material by measuring the optical reflection from a thick sample. With linearly polarized incident light (both perpendicular to and parallel to the plane of incidence), the ratio of the reflected intensities at three or more angles of incidence offers promise for determining the complex index of refraction of a material for a broad range of parameter values. The method may be applicable to molten materials, such as UO 2 , where high temperatures cause corrosion and containment difficulties. A method is given for extending the data to neighboring frequencies. Use of the method was successful for all portions of the complex index of refraction plane except for small values of the extinction coefficient

  3. Application of a virtual coordinate measuring machine for measurement uncertainty estimation of aspherical lens parameters

    International Nuclear Information System (INIS)

    Küng, Alain; Meli, Felix; Nicolet, Anaïs; Thalmann, Rudolf

    2014-01-01

    Tactile ultra-precise coordinate measuring machines (CMMs) are very attractive for accurately measuring optical components with high slopes, such as aspheres. The METAS µ-CMM, which exhibits a single point measurement repeatability of a few nanometres, is routinely used for measurement services of microparts, including optical lenses. However, estimating the measurement uncertainty is very demanding. Because of the many combined influencing factors, an analytic determination of the uncertainty of parameters that are obtained by numerical fitting of the measured surface points is almost impossible. The application of numerical simulation (Monte Carlo methods) using a parametric fitting algorithm coupled with a virtual CMM based on a realistic model of the machine errors offers an ideal solution to this complex problem: to each measurement data point, a simulated measurement variation calculated from the numerical model of the METAS µ-CMM is added. Repeated several hundred times, these virtual measurements deliver the statistical data for calculating the probability density function, and thus the measurement uncertainty for each parameter. Additionally, the eventual cross-correlation between parameters can be analyzed. This method can be applied for the calibration and uncertainty estimation of any parameter of the equation representing a geometric element. In this article, we present the numerical simulation model of the METAS µ-CMM and the application of a Monte Carlo method for the uncertainty estimation of measured asphere parameters. (paper)

  4. Parameters affecting level measurement interpretation of nuclear fuel solutions

    International Nuclear Information System (INIS)

    Hunt, B.A.; Landat, D.A.

    1999-01-01

    This paper describes a level measurement technique commonly used in the measurement of radioactive liquids and equipment utilised by the inspectors for safeguards purposes. Some of the influencing parameters affecting the measurement results by this technique are characterised. An essential requisite for successful process operations in chemical facilities involving liquids generally require some physical measurements to be made in-line for both process and quality control in order to achieve the necessary final product specifications . In nuclear fuel reprocessing facilities, the same objectives apply coupled however with an additional requirement of achieving nuclear material accountancy and control. In view of the strategic importance of some of the process vessels in nuclear facilities, accountancy has to be supported by volume and density measurements of low uncertainty. Inspectors therefore require instruments which are at the very least as good as or better than operator's equipment. The classical measurement technique and most widely applied for process liquids in nuclear installations is the bubbler probe or dip-tube technique. Here a regulated flow of air passes through tubes inserted to various depths into the vessel and pressure readings are measured which are a function of the presence of liquid height and density of solution in the tank. These readings, taken together with a pre-determined calibration curve are sufficient for the volume and amount of liquor in a tank to be quantified. All measurement equipment and instrumentation are long distances from the tank environment. The key physical parameter to measure at this location is therefore pressure. Equipment designed developed, commissioned and tested in the tank measurement facilities at Ispra and in nuclear installations in Europe, Japan and the USA, house digital pressure transducer modules with manufacture's declared features of better than 0.01% accuracy and long term stability of 0.01% full

  5. Muon decay: Measurement of the integral asymmetry parameter

    International Nuclear Information System (INIS)

    Beltrami, I.; Burkard, H.; Dincklage, R.D. von; Fetscher, W.; Gerber, H.J.; Johnson, K.F.

    1987-01-01

    The positron directional distribution following muon decay is measured. The polarized muons are derived from pion decay in flight and are brought to rest in Be metal. Using the μSR-technique P μ ξ = 1.0027 ± 0.0084 is deduced. The integral asymmetry parameters ξ bears on the mass of the W tilde (wino, the supersymmetrical partner of the gauge boson W), mediating such decay as μ → eν tilde ν tilde. Assuming very light scalar neutrini msub(n tilde) μ a new lower limit on the wino mass msub(w tilde) > 270 GeV/c 2 (90% CL) is inferred. (orig.)

  6. Precision measurements of thermodynamic parameters of heavy alkali metals

    Science.gov (United States)

    Blagonravov, L. A.; Modenov, A. A.

    2017-11-01

    On the temperature dependences of a number of one-component liquids, regions of anomalous behavior in the form of kinks and also in the form of limited areas of forced growth have been previously observed (LA Blagonravov, LA Orlov, et al., TVT 2000, vol. 38, No. 4, p.566-572). However, the interpretation of these anomalies is complicated by the small magnitude of the effects themselves (the magnitude of the observed effect was 5%, a random error of 2-3%). An increase in the accuracy of measurements is required for a more confident determination of the detailed shape of the anomalies. In the proposed work, thermodynamic parameters are studied using a technique that uses the elastic-thermal effect. The adiabatic thermal coefficient of pressure (a.t.p.c.) is measured: χ = (1/T)(∂T/∂p)S. An installation in which the pressure change is carried out in a periodic mode is used for measurements. The software allows simultaneous averaging of the values of the amplitude of pressure oscillations and the amplitude of temperature response oscillations with the subsequent determination of their ratio. The facility uses an advanced pressure modulator, which allows creating pressure oscillations of the shape close to sinusoidal (the value of the second harmonic is not more than 10%) and a precision SR-810 nanovoltmeter with a synchronous digital detector. The currently used technique provides an acceptable measurement accuracy (error in the region of 0.5-1%). However, to further increase the accuracy, it was decided to make changes in the measuring path. Namely, by developing and applying a scheme of a precision low-noise preamplifier based on the instrument amplifier INA333, a circuit allowing simultaneous measurement of not only the two above parameters but also the current temperature of the sample (to exclude the effect of temperature drift.) Preliminary results of measurements of the temperature dependence of the a.t.p.c. of liquid cesium in the temperature range up to

  7. Geoelectrical Measurement of Multi-Scale Mass Transfer Parameters

    Energy Technology Data Exchange (ETDEWEB)

    Day-Lewis, Frederick David [US Geological Survey, Storrs, CT (United States); Singha, Kamini [Colorado School of Mines, Golden, CO (United States); Johnson, Timothy C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Haggerty, Roy [Oregon State Univ., Corvallis, OR (United States); Binley, Andrew [Lancaster Univ. (United Kingdom); Lane, John W. [US Geological Survey, Storrs, CT (United States)

    2014-11-25

    Mass transfer affects contaminant transport and is thought to control the efficiency of aquifer remediation at a number of sites within the Department of Energy (DOE) complex. An improved understanding of mass transfer is critical to meeting the enormous scientific and engineering challenges currently facing DOE. Informed design of site remedies and long-term stewardship of radionuclide-contaminated sites will require new cost-effective laboratory and field techniques to measure the parameters controlling mass transfer spatially and across a range of scales. In this project, we sought to capitalize on the geophysical signatures of mass transfer. Previous numerical modeling and pilot-scale field experiments suggested that mass transfer produces a geoelectrical signature—a hysteretic relation between sampled (mobile-domain) fluid conductivity and bulk (mobile + immobile) conductivity—over a range of scales relevant to aquifer remediation. In this work, we investigated the geoelectrical signature of mass transfer during tracer transport in a series of controlled experiments to determine the operation of controlling parameters, and also investigated the use of complex-resistivity (CR) as a means of quantifying mass transfer parameters in situ without tracer experiments. In an add-on component to our grant, we additionally considered nuclear magnetic resonance (NMR) to help parse mobile from immobile porosities. Including the NMR component, our revised study objectives were to: 1. Develop and demonstrate geophysical approaches to measure mass-transfer parameters spatially and over a range of scales, including the combination of electrical resistivity monitoring, tracer tests, complex resistivity, nuclear magnetic resonance, and materials characterization; and 2. Provide mass-transfer estimates for improved understanding of contaminant fate and transport at DOE sites, such as uranium transport at the Hanford 300 Area. To achieve our objectives, we implemented a 3

  8. A method for external measurement of toroidal equilibrium parameters

    International Nuclear Information System (INIS)

    Brunsell, P.; Hellblom, G.; Brynolf, J.

    1992-01-01

    A method has been developed for determining from external magnetic field measurements the horizontal shift, the vertical shift and the poloidal field asymmetry parameter (Λ) of a toroidal plasma in force equilibrium. The magnetic measurements consist of two toroidal differential flux loops, giving the average vertical magnetic field and the average radial magnetic field respectively, together with cosine-coils for obtaining the m=1 cosine harmonic of the external poloidal magnetic field component. The method is used to analyse the evolution of the toroidal equilibrium during reversed-field pinch discharges in the Extrap T1-U device. We find that good equilibrium control is needed for long plasma pulses. For non-optimized externally applied vertical fields, the diagnostic clearly shows a horizontal drift motion of the pinch resulting in earlier discharge termination. (au)

  9. Geoelectrical Measurement of Multi-Scale Mass Transfer Parameters

    Energy Technology Data Exchange (ETDEWEB)

    Day-Lewis, Frederick; Singha, Kamini; Haggerty, Roy; Johnson, Tim; Binley, Andrew; Lane, John

    2014-01-16

    Mass transfer affects contaminant transport and is thought to control the efficiency of aquifer remediation at a number of sites within the Department of Energy (DOE) complex. An improved understanding of mass transfer is critical to meeting the enormous scientific and engineering challenges currently facing DOE. Informed design of site remedies and long-term stewardship of radionuclide-contaminated sites will require new cost-effective laboratory and field techniques to measure the parameters controlling mass transfer spatially and across a range of scales. In this project, we sought to capitalize on the geophysical signatures of mass transfer. Previous numerical modeling and pilot-scale field experiments suggested that mass transfer produces a geoelectrical signature—a hysteretic relation between sampled (mobile-domain) fluid conductivity and bulk (mobile + immobile) conductivity—over a range of scales relevant to aquifer remediation. In this work, we investigated the geoelectrical signature of mass transfer during tracer transport in a series of controlled experiments to determine the operation of controlling parameters, and also investigated the use of complex-resistivity (CR) as a means of quantifying mass transfer parameters in situ without tracer experiments. In an add-on component to our grant, we additionally considered nuclear magnetic resonance (NMR) to help parse mobile from immobile porosities. Including the NMR component, our revised study objectives were to: 1. Develop and demonstrate geophysical approaches to measure mass-transfer parameters spatially and over a range of scales, including the combination of electrical resistivity monitoring, tracer tests, complex resistivity, nuclear magnetic resonance, and materials characterization; and 2. Provide mass-transfer estimates for improved understanding of contaminant fate and transport at DOE sites, such as uranium transport at the Hanford 300 Area. To achieve our objectives, we implemented a 3

  10. Measurement of the cp violation parameter sin 2 beta

    International Nuclear Information System (INIS)

    K.F. Kelley

    1999-01-01

    This thesis presents a measurement of the time-dependent asymmetry in the rate of (anti B) d 0 versus B d 0 decays to J/ψK s 0 . In the context of the Standard Model this is interpreted as a measurement of the CP violation parameter sin(2β). A total of 198±17 B d 0 /(anti B) d 0 decays were observed in p(anti p) collisions at √s=1.8 TeV by the CDF detector at the Fermilab Tevatron. The initial B flavor (whether B 0 or (anti B) 0 ) is determined by a same-side flavor tagging technique. The analysis results in sin(2β)=1.8±1.1(stat.)±0.3(syst.). This analysis demonstrates the feasibility of studying CP violation in the B 0 -(anti B) 0 system at a hadron collider. By applying the methods used in this analysis, future, higher-statistics experiments should be able to tightly constrain the parameters of the Standard Model

  11. Measuring Cosmological Parameters with Photometrically Classified Pan-STARRS Supernovae

    Science.gov (United States)

    Jones, David; Scolnic, Daniel; Riess, Adam; Rest, Armin; Kirshner, Robert; Berger, Edo; Kessler, Rick; Pan, Yen-Chen; Foley, Ryan; Chornock, Ryan; Ortega, Carolyn; Challis, Peter; Burgett, William; Chambers, Kenneth; Draper, Peter; Flewelling, Heather; Huber, Mark; Kaiser, Nick; Kudritzki, Rolf; Metcalfe, Nigel; Tonry, John; Wainscoat, Richard J.; Waters, Chris; Gall, E. E. E.; Kotak, Rubina; McCrum, Matt; Smartt, Stephen; Smith, Ken

    2018-01-01

    We use nearly 1,200 supernovae (SNe) from Pan-STARRS and ~200 low-z (z energy equation of state parameter w to be -0.986±0.058 (stat+sys). If we allow w to evolve with redshift as w(a) = w0 + wa(1-a), we find w0 = -0.923±0.148 and wa = -0.404±0.797. These results are consistent with measurements of cosmological parameters from the JLA and from a new analysis of 1049 spectroscopically confirmed SNe Ia (Scolnic et al. 2017). We try four different photometric classification priors for Pan-STARRS SNe and two alternate ways of modeling the CC SN contamination, finding that none of these variants gives a w that differs by more than 1% from the baseline measurement. The systematic uncertainty on w due to marginalizing over the CC SN contamination, σwCC = 0.019, is approximately equal to the photometric calibration uncertainty and is lower than the systematic uncertainty in the SN\\,Ia dispersion model (σwdisp = 0.024). Our data provide one of the best current constraints on w, demonstrating that samples with ~5% CC SN contamination can give competitive cosmological constraints when the contaminating distribution is marginalized over in a Bayesian framework.

  12. Measurement of kinetic parameters in the fast subcritical core MASURCA

    International Nuclear Information System (INIS)

    Baeten, Peter; Abderrahim, Hamid Aiet

    2004-01-01

    In the MUSE shared cost action of the European Fifth Framework Program measurements have been performed to investigate the neutronic behavior of the fast subcritical core MASURCA coupled with the GENEPI accelerator. The aim is to examine the applicability of different measurement techniques for the determination of the main kinetic parameters. The measurement of Rossi-alpha distributions, recorded with the accelerator turned off, showed that the analysis of the obtained distributions is feasible for deep subcritical levels, but with strongly deteriorated statistics. From Rossi-alpha distributions, recorded with the pulsed neutron source in operation, the alpha decay constant was easily derived due to good statistics on the correlated signal resulting from the strong intensity of the neutron pulse. When applying the pulsed neutron source analysis, the reactivity (in dollars) together with the ratio of the mean neutron lifetime l and the effective delayed neutron fraction β eff is immediately derived. Although these first results are very promising, further measurements are needed to qualify the method at larger subcritical levels which are representative for future ADS

  13. Measurement and simulation of the TRR BNCT beam parameters

    Energy Technology Data Exchange (ETDEWEB)

    Bavarnegin, Elham [Nuclear Science and Technology Research Institute (NSTRI), Tehran (Iran, Islamic Republic of); Department of Physics, University of Guilan, Rasht (Iran, Islamic Republic of); Sadremomtaz, Alireza [Department of Physics, University of Guilan, Rasht (Iran, Islamic Republic of); Khalafi, Hossein [Nuclear Science and Technology Research Institute (NSTRI), Tehran (Iran, Islamic Republic of); Kasesaz, Yaser, E-mail: ykasesaz@aeoi.org.ir [Nuclear Science and Technology Research Institute (NSTRI), Tehran (Iran, Islamic Republic of); Golshanian, Mohadeseh; Ghods, Hossein; Ezzati, Arsalan; Keyvani, Mehdi; Haddadi, Mohammad [Nuclear Science and Technology Research Institute (NSTRI), Tehran (Iran, Islamic Republic of)

    2016-09-11

    Recently, the configuration of the Tehran Research Reactor (TRR) thermal column has been modified and a proper thermal neutron beam for preclinical Boron Neutron Capture Therapy (BNCT) has been obtained. In this study, simulations and experimental measurements have been carried out to identify the BNCT beam parameters including the beam uniformity, the distribution of the thermal neutron dose, boron dose, gamma dose in a phantom and also the Therapeutic Gain (TG). To do this, the entire TRR structure including the reactor core, pool, the thermal column and beam tubes have been modeled using MCNPX Monte Carlo code. To measure in-phantom dose distribution a special head phantom has been constructed and foil activation techniques and TLD700 dosimeter have been used. The results show that there is enough uniformity in TRR thermal BNCT beam. TG parameter has the maximum value of 5.7 at the depth of 1 cm from the surface of the phantom, confirming that TRR thermal neutron beam has potential for being used in treatment of superficial brain tumors. For the purpose of a clinical trial, more modifications need to be done at the reactor, as, for example design, and construction of a treatment room at the beam exit which is our plan for future. To date, this beam is usable for biological studies and animal trials. There is a relatively good agreement between simulation and measurement especially within a diameter of 10 cm which is the dimension of usual BNCT beam ports. This relatively good agreement enables a more precise prediction of the irradiation conditions needed for future experiments.

  14. Characterization of Thermal Parameters for Improving Pyranometer and Pyrgeometer Measurements

    Science.gov (United States)

    Tsay, Si-Chee; Jhabvala, Murzy D.; Ji, Qiang; Rapshun, David; Shu, Peter K.

    2000-01-01

    Since the introduction of thermopile, pyranometers (solar, e.g., 0.3-3.0 micrometers) and pyrgeometers (terrestrial, e.g., 4-50 micrometers) have become instruments commonly used for measuring the broadband hemispherical irradiances at the surface in a long-term, monitoring mode for decades. These commercially available radiometers have been manufactured in several countries such as from the United States, Asia, and Europe, and are generally reliable and economical. These worldwide distributions of surface measurements become even more important in the era of Earth remote sensing in studying climate change. However, recent studies from field campaigns have pointed out that erroneous factors (e.g., temperature gradients between the filter dome and detector, emissivity of the thermopile) are responsible for the unacceptable level of uncertainty (e.g., 20 W m(exp -2)). Using a newly developed instrument of Quantum Well Infrared Photodetector (QWTP), we have characterized the brightness temperature fields of pyranometers and pyrgeometers under various sky conditions. The QWIP is based on the superlattice (GaAs/AlGaAs) technology and has a noise equivalent temperature (NEAT) less than 0.1 K. The quality of pyranometer and pyrgeometer measure- ments can be improved largely by applying proper knowledge of the thermal parameters affecting the operation of the thermopile systems. Data correction procedure and algorithm will be presented and discussed.

  15. Measuring the electron-ion ring parameters by bremsstrahlung

    International Nuclear Information System (INIS)

    Inkin, V.D.; Mozelev, A.A.; Sarantsev, V.P.

    1982-01-01

    A system is described for measuring the number of electrons and ions in the electron-ion rings of a collective heavy ion accelerator. The system operation is based on detecting gamma quanta of bremsstrahlung following the ring electron interaction with the nuclei of neutral atoms and ions at different stages of filling the ring with ions. The radiation detector is a scintillation block - a photomultiplier operating for counting with NaI(Tl) crystal sized 30x30 mm and ensuring the detection efficiency close to unity. The system apparatus is made in the CAMAC standard and rems on-line with the TRA/i miniature computer. The block-diagrams of the system and algorithm of data processing are presented. A conclusion is drawn that the results of measuring the ring parameters with the use of the diagnostics system described are in good agreement within the range of measuring errors with those obtained by means of the diagnostics system employing synchrotron radiation and induction sensors

  16. A measurement of the tau Michel parameters at SLD

    International Nuclear Information System (INIS)

    Quigley, J.

    1997-05-01

    This thesis presents a measurement of the tau Michel parameters. This measurement utilizes the highly polarized SLC electron beam to extract these quantities directly from the measured tau decay spectra using the 1993--95 SLD sample of 4,528 tau pair events. The results are ρ e = 0.71 ± 0.14 ± 0.05, ξ e = 1.16 ± 0.52 ± 0.06, and (ξδ) e = 0.85 ± 0.43 ± 0.08 for tau decays to electrons and ρ μ = 0.54 ± 0.28 - 0.14, η μ = -0.59 ± 0.82 ± 0.45, ξ μ = 0.75 ± 0.50 ± 0.14, and (ξδ) μ = 0.82 ± 0.32 ± 0.07 for tau decays to muons. Combining all leptonic tau decays gives ρ = 0.72 ± 0.09 ± 0.03, ξ = 1.05 ± 0.35 ± 0.04, and Ξδ = 0.88 ± 0.27 ± 0.04. These results agree well with the current world average and the Standard Model

  17. Measurements, in vivo, of parameters of the dopamine system

    International Nuclear Information System (INIS)

    Friedman, A.M.; DeJesus, O.T.; Dinerstein, R.; Revenaugh, J.

    1983-01-01

    This paper discusses methods of measuring important parameters of the dopamine system in the living animal by use of PET techniques. One primary concern is the density and binding affinity of post-synaptic neuroreceptors. A second concern is the activity of neurons. In vivo, this is generally related to the turnover of neurotransmitter and can also be related to the uptake of precursor compounds by the neurons. If the transmitter and neuroleptic compound compete for the same binding sites (on the receptor molecule) these two effects are interwoven and are not easily isolated. It appears that the movement of neuroleptic drugs from the brain is slow enough to allow equilibrium to be maintained between ligand and receptor, especially after some time for the initial washout and translocation in the brain. To test the consequences of equilibrium binding and the possible use of the model for measurement of receptor densities by emission tomography we have modified Clark's equilibrium model of ligand binding. In this note we will describe the solutions of the equations and some comparisons of the predictions of the model with data, as well as its application to tomographic measurements

  18. Identification of grid model parameters using synchrophasor measurements

    Energy Technology Data Exchange (ETDEWEB)

    Boicea, Valentin; Albu, Mihaela [Politehnica University of Bucharest (Romania)

    2012-07-01

    Presently a critical element of the energy networks is represented by the active distribution grids, where generation intermittency and controllable loads contribute to a stochastic varability of the quantities characterizing the grid operation. The capability of controlling the electrical energy transfer is also limited by the incomplete knowledge of the detailed electrical model of each of the grid components. Asset management in distribution grids has to consider dynamic loads, while high loading of network sections might already have degraded some of the assets. Moreover, in case of functional microgrids, all elements need to be modelled accurately and an appropriate measurement layer enabling online control needs to be deployed. In this paper a method for online identification of the actual parameter values in grid electrical models is proposed. Laboratory results validating the proposed method are presented. (orig.)

  19. Beta Beams for Precision Measurements of Neutrino Oscillation Parameters

    CERN Document Server

    Wildner, E; Hansen, C; De Melo Mendonca, T; Stora, T; Damjanovic, S; Payet, J; Chancé, A; Zorin, V; Izotov, I; Rasin, S; Sidorov, A; Skalyga, V; De Angelis, G; Prete, G; Cinausero, M; Kravchuk, V; Gramegna, F; Marchi, T; Collazuol, G; Mezzetto, M; Delbar, T; Loiselet, M; Keutgen, T; Mitrofanov, S; Burt, G; Dexter, A; Lamy, T; Latrasse, L; Marie-Jeanne, M; Sortais, P; Thuillier, T; Debray, F; Trophime, C; Hass, M; Hirsh, T; Berkovits, D; Stahl, A; Vardaci, E; Di Nitto, A; Brondi, A; La Rana, G; Moro, R; De Rosa, G; Palladino, V

    2012-01-01

    Neutrino oscillations have implications for the Standard Model of particle physics. The CERN Beta Beam has outstanding capabilities to contribute to precision measurements of the parameters governing neutrino oscillations. The FP7 collaboration EUROnu (2008-2012) is a design study that will review three facilities (Super-Beams, Beta Beams and Neutrino Factories) and perform a cost assessment that, coupled with the physics performance, will give means to the European research authorities to make decisions on future European neutrino oscillation facilities. ”Beta Beams” produce collimated pure electron (anti)neutrinos by accelerating beta active ions to high energies and having them decay in a storage ring. Using existing machines and infrastructure is an advantage for the cost evaluation; however, this choice is also constraining the Beta Beams. Recent work to make the Beta Beam facility a solid option will be described: production of Beta Beam isotopes, the 60 GHz pulsed ECR source development, integratio...

  20. The fluctuation–dissipation relation in sub-diffusive systems: the case of granular single-file diffusion

    International Nuclear Information System (INIS)

    Villamaina, D; Puglisi, A; Vulpiani, A

    2008-01-01

    We study a gas of hard rods on a ring, driven by an external thermostat, with either elastic or inelastic collisions, which exhibits sub-diffusive behavior, 2 > ∼ t 1/2 . We show the validity of the usual fluctuation–dissipation (FD) relation, i.e. the proportionality between the response function and the correlation function, when the gas is elastic or diluted. In contrast, in strongly inelastic or dense cases, when the tracer velocity is no longer independent of the other degrees of freedom, the Einstein formula fails and must be replaced by a more general FD relation. (letter)

  1. Determining tumor blood flow parameters from dynamic image measurements

    Science.gov (United States)

    Libertini, Jessica M.

    2008-11-01

    Many recent cancer treatments focus on preventing angiogenesis, the process by which a tumor promotes the growth of large and efficient capillary beds for the increased nourishment required to support the tumor's rapid growth[l]. To measure the efficacy of these treatments in a timely fashion, there is an interest in using data from dynamic sequences of contrast-enhanced medical imaging, such as MRI and CT, to measure blood flow parameters such as perfusion, permeability-surface-area product, and the relative volumes of the plasma and extracellular-extravascular space. Starting with a two compartment model presented by the radiology community[2], this work challenges the application of a simplification to this problem, which was originally developed to model capillary reuptake[3]. While the primary result of this work is the demonstration of the inaccuracy of this simplification, the remainder of the paper is dedicated to presenting alternative methods for calculating the perfusion and plasma volume coefficients. These methods are applied to model data sets based on real patient data, and preliminary results are presented.

  2. Beam parameter measurements for the SLAC linear collider

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Blocker, C.; Breidenbach, M.

    1982-01-01

    A stable, closely-controlled, high-intensity, single-bunch beam will be required for the SLAC Linear Collider. The characteristics of short-pulse, low-intensity beams in the SLAC linac have been studied. A new, high-intensity thermionic gun, subharmonic buncher and S-band buncher/accelerator section were installed recently at SLAC. With these components, up to 10 11 electrons in a single S-band bunch are available for injection into the linac. the first 100-m accelerator sector has been modified to allow control of short-pulse beams by a model-driven computer program. Additional instrumentation, including a computerized energy analyzer and emittance monitor have been added at the end of the 100-m sector. The beam intensity, energy spectrum, emittance, charge distribution and the effect of wake fields in the first accelerator sector have been measured. The new source and beam control system will be described and the most recent results of the beam parameter measurements will be discussed

  3. Voyager microwave scintillation measurements of solar wind plasma parameters

    International Nuclear Information System (INIS)

    Martin, J.M.

    1985-01-01

    During the solar conjunctions of Voyager 1 and 2 spacecraft in August 1979, September 1980, and November 1982, temporal variations of intensity and frequency of the dual-wavelength (3.6 and 13 cm) radio transmissions from the spacecraft were observed and subsequently analyzed to infer characteristics of the solar wind plasma flow. Measurements of the temporal wave structure function were used to estimate the spectral index of the power law spatial spectrum of irregularities. Theoretical-intensity scintillation spectra were compared with measured intensity spectra to obtain least-squares estimates of (1) mean velocity, (2) random velocity, (3) axial ratio, and (4) electron density standard deviation. Uncertainties in parameter estimates were calculated by standard propagation of errors techniques. Mean velocity and electron density standard deviations in 1979-1980 show little dependence on solar latitude. Density standard deviation estimates were 3-10% of the background mean density and mean velocity estimates ranged from approx.200 km/s inside 17 solar radii to approx.300 km/s at 25 solar radii. 1982 density standard deviation estimates increased rapidly with latitude near 45 0 N, then sharply decreased north of that latitude, indicating the existence of a polar region of reduced fluctuations surrounded by a thin cone of strong density irregularities

  4. Keratoconus diagnosis using Corvis ST measured biomechanical parameters

    Directory of Open Access Journals (Sweden)

    Roghiyeh Elham

    2017-09-01

    Conclusions: The A1T seems a valuable parameter in the diagnosis of keratoconic eyes. It showed excellent diagnostic ability even when controlled for CCT. None of the parameters were reliable index for keratoconus staging.

  5. Synchronization of binocular motion parameters optoelectronic measurement system

    Science.gov (United States)

    Zhang, Lingfei; Ye, Dong; Che, Rensheng; Chen, Gang

    2008-10-01

    The synchronization between high-speed digital cameras and computers is very important for the binocular vision system based on light-weighted passive IR reflective markers and IR LED array PCB board, which is often used to measure the 3-D motion parameters of a rocket motor. In order to solve this problem, a comparison on the existing approaches to camera synchronization in the published literature was conducted. The advantages and disadvantages of the currently used methods were illustrated and their suitable applications were discussed. A new method, which uses self-made hardware resetting camera and software triggering image acquisition board, is provided. The self-made hardware is used to send TTL signal to two image acquisition boards one time per second. The TTL signal is used to reset two cameras and two image acquisition boards as PRIN signal, and then two image acquisition boards send same EXSYNC signal to two cameras. In this way, two cameras can be synchronized to exposure and capture images in the mean time. The test results indicated that the new approach designed in this paper can meet the demand of image acquisition at a speed of 200f/s, whose synchronization accuracy is up to micro second.

  6. Precision Measurement of Neutrino Oscillation Parameters with KamLAND

    Energy Technology Data Exchange (ETDEWEB)

    O' Donnell, Thomas [Univ. of California, Berkeley, CA (United States)

    2011-12-01

    This dissertation describes a measurement of the neutrino oscillation parameters m2 21, θ12 and constraints on θ13 based on a study of reactor antineutrinos at a baseline of ~ 180 km with the KamLAND detector. The data presented here was collected between April 2002 and November 2009, and amounts to a total exposure of 2.64 ± 0.07 × 1032 proton-years. For this exposure we expect 2140 ± 74(syst) antineutrino candidates from reactors, assuming standard model neutrino behavior, and 350±88(syst) candidates from background. The number observed is 1614. The ratio of background-subtracted candidates observed to expected is (NObs - NBkg)/ (NExp) = 0.59 ± 0.02(stat) ± 0.045(syst) which confirms reactor neutrino disappearance at greater than 5σ significance. Interpreting this deficit as being due to neutrino oscillation, the best-fit oscillation parameters from a three-flavor analysis are m2 21= 7.60+0.20 -0.19×10-5eV2, θ12 = 32.5 ± 2.9 degrees and sin2 θ13 = 0.025+0.035 -0.035, the 95% confidence-level upper limit on sin2 θ13 is sin2 θ13 < 0.083. Assuming CPT invariance, a combined analysis of KamLAND and solar neutrino data yields best-fit values: m2 21 = 7.60+0.20 -0.20 × 10-5eV2, θ12 = 33.5+1.0 -1.1 degrees, and sin2 θ13 = 0.013 ± 0.028 or sin2 θ13 < 0.06 at the 95% confidence level.

  7. Kinetic parameter estimation from attenuated SPECT projection measurements

    International Nuclear Information System (INIS)

    Reutter, B.W.; Gullberg, G.T.

    1998-01-01

    Conventional analysis of dynamically acquired nuclear medicine data involves fitting kinetic models to time-activity curves generated from regions of interest defined on a temporal sequence of reconstructed images. However, images reconstructed from the inconsistent projections of a time-varying distribution of radiopharmaceutical acquired by a rotating SPECT system can contain artifacts that lead to biases in the estimated kinetic parameters. To overcome this problem the authors investigated the estimation of kinetic parameters directly from projection data by modeling the data acquisition process. To accomplish this it was necessary to parametrize the spatial and temporal distribution of the radiopharmaceutical within the SPECT field of view. In a simulated transverse slice, kinetic parameters were estimated for simple one compartment models for three myocardial regions of interest, as well as for the liver. Myocardial uptake and washout parameters estimated by conventional analysis of noiseless simulated data had biases ranging between 1--63%. Parameters estimated directly from the noiseless projection data were unbiased as expected, since the model used for fitting was faithful to the simulation. Predicted uncertainties (standard deviations) of the parameters obtained for 500,000 detected events ranged between 2--31% for the myocardial uptake parameters and 2--23% for the myocardial washout parameters

  8. Kinetic parameter estimation from SPECT cone-beam projection measurements

    International Nuclear Information System (INIS)

    Huesman, Ronald H.; Reutter, Bryan W.; Zeng, G. Larry; Gullberg, Grant T.

    1998-01-01

    Kinetic parameters are commonly estimated from dynamically acquired nuclear medicine data by first reconstructing a dynamic sequence of images and subsequently fitting the parameters to time-activity curves generated from regions of interest overlaid upon the image sequence. Biased estimates can result from images reconstructed using inconsistent projections of a time-varying distribution of radiopharmaceutical acquired by a rotating SPECT system. If the SPECT data are acquired using cone-beam collimators wherein the gantry rotates so that the focal point of the collimators always remains in a plane, additional biases can arise from images reconstructed using insufficient, as well as truncated, projection samples. To overcome these problems we have investigated the estimation of kinetic parameters directly from SPECT cone-beam projection data by modelling the data acquisition process. To accomplish this it was necessary to parametrize the spatial and temporal distribution of the radiopharmaceutical within the SPECT field of view. In a simulated chest image volume, kinetic parameters were estimated for simple one-compartment models for four myocardial regions of interest. Myocardial uptake and washout parameters estimated by conventional analysis of noiseless simulated cone-beam data had biases ranging between 3-26% and 0-28%, respectively. Parameters estimated directly from the noiseless projection data were unbiased as expected, since the model used for fitting was faithful to the simulation. Statistical uncertainties of parameter estimates for 10 000 000 events ranged between 0.2-9% for the uptake parameters and between 0.3-6% for the washout parameters. (author)

  9. Phase Method of Invariant Measurement of Active-Inductive Measuring Two-Pole Parameters

    Directory of Open Access Journals (Sweden)

    Boris MAMIKONYAN

    2017-04-01

    Full Text Available There has been given the solution of the technical problem of separate measurement of parameters of inductance coils and inductive primary converters on alternating current without application of potential-current signals. As a measuring circuit the scheme of voltage divider with active-inductive two-pole is used, and as an output signal there has been used the angle of phase shift between two output voltages of the measuring circuit. For forming the output signal temporal separation of measurement channel is used. The advantages of phase method are mostly due to capacity of using microcontrollers. In the technical solutions under consideration the microcontroller regulates the measuring process and develops the measurement results.

  10. Validity and repeatability of inertial measurement units for measuring gait parameters.

    Science.gov (United States)

    Washabaugh, Edward P; Kalyanaraman, Tarun; Adamczyk, Peter G; Claflin, Edward S; Krishnan, Chandramouli

    2017-06-01

    Inertial measurement units (IMUs) are small wearable sensors that have tremendous potential to be applied to clinical gait analysis. They allow objective evaluation of gait and movement disorders outside the clinic and research laboratory, and permit evaluation on large numbers of steps. However, repeatability and validity data of these systems are sparse for gait metrics. The purpose of this study was to determine the validity and between-day repeatability of spatiotemporal metrics (gait speed, stance percent, swing percent, gait cycle time, stride length, cadence, and step duration) as measured with the APDM Opal IMUs and Mobility Lab system. We collected data on 39 healthy subjects. Subjects were tested over two days while walking on a standard treadmill, split-belt treadmill, or overground, with IMUs placed in two locations: both feet and both ankles. The spatiotemporal measurements taken with the IMU system were validated against data from an instrumented treadmill, or using standard clinical procedures. Repeatability and minimally detectable change (MDC) of the system was calculated between days. IMUs displayed high to moderate validity when measuring most of the gait metrics tested. Additionally, these measurements appear to be repeatable when used on the treadmill and overground. The foot configuration of the IMUs appeared to better measure gait parameters; however, both the foot and ankle configurations demonstrated good repeatability. In conclusion, the IMU system in this study appears to be both accurate and repeatable for measuring spatiotemporal gait parameters in healthy young adults. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Health status and measurement of some liver function parameters of ...

    African Journals Online (AJOL)

    Background: A good health program is necessary to optimize health care opportunities so as to make appropriate adjustments for optimal service delivery by our health workers in all health sectors. Aim: To determine some hepatic function parameters as a correlate of health status amongst staff of Niger Delta University ...

  12. Uncertainty In Measuring Noise Parameters Of a Communication Receiver

    International Nuclear Information System (INIS)

    Korcz, Karol; Palczynska, Beata; Spiralski, Ludwik

    2005-01-01

    The paper presents the method of assessing uncertainty in measuring the usable sensitivity Es of communication receiver. The influence of partial uncertainties of measuring the noise factor F and the energy pass band of the receiver Δf on the combined standard uncertainty level is analyzed. The method to assess the uncertainty in measuring the noise factor on the basis of the systematic component of uncertainty, assuming that the main source of measurement uncertainty is the hardware of the measuring system, is proposed. The assessment of uncertainty in measuring the pass band of the receiver is determined with the assumption that input quantities of the measurement equation are not correlated. They are successive, discrete values of the spectral power density of the noise on the output of receiver. The results of the analyses of particular uncertainties components of measuring the sensitivity, which were carried out for a typical communication receiver, are presented

  13. Transport parameter estimation from lymph measurements and the Patlak equation.

    Science.gov (United States)

    Watson, P D; Wolf, M B

    1992-01-01

    Two methods of estimating protein transport parameters for plasma-to-lymph transport data are presented. Both use IBM-compatible computers to obtain least-squares parameters for the solvent drag reflection coefficient and the permeability-surface area product using the Patlak equation. A matrix search approach is described, and the speed and convenience of this are compared with a commercially available gradient method. The results from both of these methods were different from those of a method reported by Reed, Townsley, and Taylor [Am. J. Physiol. 257 (Heart Circ. Physiol. 26): H1037-H1041, 1989]. It is shown that the Reed et al. method contains a systematic error. It is also shown that diffusion always plays an important role for transmembrane transport at the exit end of a membrane channel under all conditions of lymph flow rate and that the statement that diffusion becomes zero at high lymph flow rate depends on a mathematical definition of diffusion.

  14. Continuous radon measurements in schools: time variations and related parameters

    International Nuclear Information System (INIS)

    Giovani, C.; Cappelletto, C.; Garavaglia, M.; Pividore, S.; Villalta, R.

    2004-01-01

    Some results are reported of observations made within a four-year survey, during different seasons and in different conditions of school building use. Natural radon variations (day-night cycles, seasonal and temperature dependent variations etc..) and artificial ones (opening of windows, weekends and vacations, deployment of air conditioning or heating systems. etc.) were investigated as parameters affecting time dependent radon concentrations. (P.A.)

  15. Measurement of lattice parameters of single crystals and thin layers

    Czech Academy of Sciences Publication Activity Database

    Drahokoupil, Jan; Veřtát, P.; Richterová, Kristina; Laufek, František

    2014-01-01

    Roč. 21, č. 2 (2014), s. 97-97 ISSN 1211-5894. [Struktura 2014 : kolokvium Krystalografické společnosti. 09.06.2014-12.06.2014, Kutná Hora] Institutional support: RVO:68378271 Keywords : XRD * lattice parameters Subject RIV: BM - Solid Matter Physics ; Magnetism http://www. xray .cz/ms/bul2014-2/wednesday1.pdf

  16. From stochastic processes to numerical methods: A new scheme for solving reaction subdiffusion fractional partial differential equations

    Energy Technology Data Exchange (ETDEWEB)

    Angstmann, C.N.; Donnelly, I.C. [School of Mathematics and Statistics, UNSW Australia, Sydney NSW 2052 (Australia); Henry, B.I., E-mail: B.Henry@unsw.edu.au [School of Mathematics and Statistics, UNSW Australia, Sydney NSW 2052 (Australia); Jacobs, B.A. [School of Computer Science and Applied Mathematics, University of the Witwatersrand, Johannesburg, Private Bag 3, Wits 2050 (South Africa); DST–NRF Centre of Excellence in Mathematical and Statistical Sciences (CoE-MaSS) (South Africa); Langlands, T.A.M. [Department of Mathematics and Computing, University of Southern Queensland, Toowoomba QLD 4350 (Australia); Nichols, J.A. [School of Mathematics and Statistics, UNSW Australia, Sydney NSW 2052 (Australia)

    2016-02-15

    We have introduced a new explicit numerical method, based on a discrete stochastic process, for solving a class of fractional partial differential equations that model reaction subdiffusion. The scheme is derived from the master equations for the evolution of the probability density of a sum of discrete time random walks. We show that the diffusion limit of the master equations recovers the fractional partial differential equation of interest. This limiting procedure guarantees the consistency of the numerical scheme. The positivity of the solution and stability results are simply obtained, provided that the underlying process is well posed. We also show that the method can be applied to standard reaction–diffusion equations. This work highlights the broader applicability of using discrete stochastic processes to provide numerical schemes for partial differential equations, including fractional partial differential equations.

  17. Long-Time Dynamic Response and Stochastic Resonance of Subdiffusive Overdamped Bistable Fractional Fokker-Planck Systems

    International Nuclear Information System (INIS)

    Yan-Mei, Kang; Yao-Lin, Jiang

    2008-01-01

    To explore the influence of anomalous diffusion on stochastic resonance (SR) more deeply and effectively, the method of moments is extended to subdiffusive overdamped bistable fractional Fokker-Planck systems for calculating the long-time linear dynamic response. It is found that the method of moments attains high accuracy with the truncation order N = 10, and in normal diffusion such obtained spectral amplification factor (SAF) of the first-order harmonic is also confirmed by stochastic simulation. Observing the SAF of the odd-order harmonics we find some interesting results, i.e. for smaller driving frequency the decrease of sub diffusion exponent inhibits the stochastic resonance (SR), while for larger driving frequency the decrease of sub diffusion exponent enhances the second SR peak, but the first one vanishes and a double SR is induced in the third-order harmonic at the same time. These observations suggest that the anomalous diffusion has important influence on the bistable dynamics

  18. Medium Energy measurements on N-N parameters

    International Nuclear Information System (INIS)

    Ambrose, D.; Bachman, M.; Coffey, P.; Glass, G.; Jobst, B.; McNaughton, K.H.; Nguyen, C.; Riley, P.J.

    1992-12-01

    Research is reported on the following topics: Spin transfer measurements in np elastic scattering; pp elastic differential cross section measurements; single pion production in np scattering; and a new search for rare kaon decays (K L →μμ and K L →ee). 68 refs., 33 figs, 3 tabs

  19. Medium energy measurements of N-N parameters

    International Nuclear Information System (INIS)

    Riley, P.J.

    1990-01-01

    This paper discusses the following topics: pp elastic absolute cross section measurement; spin transfer measurements in np elastic scattering; single pion production in np scattering; photoproduction of high P t jets in the wide band beam of the tevatron; and search for K L 0 → μe, K L 0 → ee

  20. Derivation of some geometric parameters from GPS measurements

    Directory of Open Access Journals (Sweden)

    Marcel Mojzeš

    2005-11-01

    Full Text Available Combining GPS and terrestrial data requires a common coordinate system. When the original GPS vectors do not form a network, the 3D network adjustment can not be performed. In this case, in order to integrate the GPS measurements with the terrestrial observations and to perform a combined network adjustment, the GPS measurements should be transformed to this common system. The GPS measurements which are the usual output of the GPS post processing softwares are based on the WGS84 ellipsoid and the S-JTSK local datum is based on the Bessel ellipsoid. Thus, the reduction of measurements to the S-JTSK mapping plane can not be started from the measurements resulting from GPS post processing softwares because GPS and S-JTSK don’t have the same ellipsoid. Another view of this reduction will be described in this paper.

  1. Measurement-Based Transmission Line Parameter Estimation with Adaptive Data Selection Scheme

    DEFF Research Database (Denmark)

    Li, Changgang; Zhang, Yaping; Zhang, Hengxu

    2017-01-01

    Accurate parameters of transmission lines are critical for power system operation and control decision making. Transmission line parameter estimation based on measured data is an effective way to enhance the validity of the parameters. This paper proposes a multi-point transmission line parameter...

  2. Measurement of Microwave Parameters of a Superconducting Niobium Cavity

    Science.gov (United States)

    Azaryan, N. S.; Baturitskii, M. A.; Budagov, Yu. A.; Demin, D. L.; Dem‧yanov, S. E.; Karpovich, V. A.; Kniga, V. V.; Krivosheev, R. M.; Lyubetskii, N. V.; Maksimov, S. I.; Pobol‧, I. L.; Rodionova, V. N.; Shirkov, G. D.; Shumeiko, N. M.; Yurevich, S. V.

    2017-01-01

    This paper describes a method for direct measurement of the amplitude-frequency characteristics and the Q factor of empty superconducting niobium radio frequency Tesla-type cavities. An automated measuring complex that permits recording the superconductivity effect and measuring high Q values has been developed. Measurements have been made of the Q factors of the investigated objects (the first domestic 1.3-GHz niobium cavities) at a level no lower than 0.1·109 (with a maximum value of 1.2·1010) and a level of relative losses lower than 130 dB (with a minimum factor of 139.7 dB) at liquid nitrogen temperature.

  3. Measurements of laser parameters for the Shiva laser fusion facility

    International Nuclear Information System (INIS)

    Ozarski, R.G.

    1979-01-01

    Large laser systems require numerous laser diagnostics to provide configuration, performance and maintenance data to permit efficient operation. The following diagnostics for a large laser system named Shiva are discussed: (1) description of Shiva laser system, (2) what measurements are desired and or required and why, (3) what measurement techniques and packages are employed and a brief description of the operating principles of the sensors employed, and (4) the laser diagnostic data acquisition and display system

  4. Can measurements of electric dipole moments determine the seesaw parameters?

    International Nuclear Information System (INIS)

    Demir, Durmus A.; Farzan, Yasaman

    2005-01-01

    In the context of the supersymmetrized seesaw mechanism embedded in the Minimal Supersymmetric Standard Model (MSSM), complex neutrino Yukawa couplings can induce Electric Dipole Moments (EDMs) for the charged leptons, providing an additional route to seesaw parameters. However, the complex neutrino Yukawa matrix is not the only possible source of CP violation. Even in the framework of Constrained MSSM (CMSSM), there are additional sources, usually attributed to the phases of the trilinear soft supersymmetry breaking couplings and the mu-term, which contribute not only to the electron EDM but also to the EDMs of neutron and heavy nuclei. In this work, by combining bounds on various EDMs, we analyze how the sources of CP violation can be discriminated by the present and planned EDM experiments

  5. Medium energy measurements of N-N parameters

    International Nuclear Information System (INIS)

    Ambrose, D.; Bachman, M.; Coffey, P.; Glass, G.; Jobst, B.; McNaughton, Kok Heong; Nguyen, Chau; Riley, P.J.

    1993-01-01

    Most of the effort was devoted to the study of nucleon-nucleon interactions, specifically, spin transfer measurements in np elastic scattering at LAMPF, pp elastic differential cross section measurements at LAMPF, and single-pion production in np scattering. Differential cross sections and analyzing powers are shown for np→ppπ - interactions. A new search for rare K L 0 decays to μe, μμ, and ee is being undertaken. Collaborative work has been begun on a very large, complex collider detector STAR (Solenoidal Tracker At RHIC). STAR is envisioned as a combination of a silicon vertex tracker, a time projection chamber, a set of trigger scintillators, and time-of-flight counters. It would allow measurements of spin dependence at p T above 10 GeV/c

  6. Field measurement program to determine far field plume dilution parameters

    International Nuclear Information System (INIS)

    Orth, R.C.; Carter, H.H.; Miyasaki, M.T.

    1974-01-01

    A description of the techniques used to obtain measurements of temperature, salinity, tidal velocity and tracer concentration required to determine the far field dilution in a shallow estuary is presented. The study was done to characterize the physical hydrography of the Bush River, a tributary estuary of the Chesapeake Bay, which is a possible recipient of the thermal discharge from a proposed power plant consisting of two 850 MWe nuclear generating units. Measurements of temperature and salinity along the axis of the estuary during periods of high and low fresh water inflow were obtained for use in the development of a one-dimensional-segmented transient state model of the estuary. Computer concentrations from the model compared favorably with measured dye concentrations for the same periods of high and low freshwater inflow

  7. Determination of toroidal equilibrium parameters from magnetic probe measurements

    International Nuclear Information System (INIS)

    Brynolf, J.; Eriksson, H.G.; Persson, H.; Hellblom, G.

    1992-12-01

    A method has been developed by which the poloidal flux function in the vacuum region between the plasma and the external conductors (and the iron core) can be deduced from external magnetic field measurements. The plasma is in equilibrium and the solution is restricted to plasmas without irregularities. The poloidal field components Bθ and B r are measured at different poloidal positions outside the liner and modelled by truncated Fourier series. The Grad-Shafranov equation in the vacuum region is then solved with these modelled values of Bθ and B r as boundary conditions. (authors)

  8. Estimation of atomic interaction parameters by quantum measurements

    DEFF Research Database (Denmark)

    Kiilerich, Alexander Holm; Mølmer, Klaus

    Quantum systems, ranging from atomic systems to field modes and mechanical devices are useful precision probes for a variety of physical properties and phenomena. Measurements by which we extract information about the evolution of single quantum systems yield random results and cause a back actio...... strategies, we address the Fisher information and the Cramér-Rao sensitivity bound. We investigate monitoring by photon counting, homodyne detection and frequent projective measurements respectively, and exemplify by Rabi frequency estimation in a driven two-level system....

  9. Distribution Line Parameter Estimation Under Consideration of Measurement Tolerances

    DEFF Research Database (Denmark)

    Prostejovsky, Alexander; Gehrke, Oliver; Kosek, Anna Magdalena

    2016-01-01

    conductance that the absolute compensated error is −1.05% and −1.07% for both representations, as opposed to the expected uncompensated error of −79.68%. Identification of a laboratory distribution line using real measurement data grid yields a deviation of 6.75% and 4.00%, respectively, from a calculation...

  10. Automatic Measuring System for Oil Stream Paraffin Deposits Parameters

    Science.gov (United States)

    Kopteva, A. V.; Koptev, V. Yu

    2018-03-01

    This paper describes a new method for monitoring oil pipelines, as well as a highly efficient and automated paraffin deposit monitoring method. When operating oil pipelines, there is an issue of paraffin, resin and salt deposits on the pipeline walls that come with the oil stream. It ultimately results in frequent transportation suspension to clean or even replace pipes and other equipment, thus shortening operation periods between repairs, creating emergency situations and increasing production expenses, badly affecting environment, damaging ecology and spoil underground water, killing animals, birds etc. Oil spills contaminate rivers, lakes, and ground waters. Oil transportation monitoring issues are still subject for further studying. Thus, there is the need to invent a radically new automated process control and management system, together with measurement means intellectualization. The measurement principle is based on the Lambert-Beer law that describes the dependence between the gamma-radiation frequency and the density together with the linear attenuation coefficient for a substance. Using the measuring system with high accuracy (± 0,2%), one can measure the thickness of paraffin deposits with an absolute accuracy of ± 5 mm, which is sufficient to ensure reliable operation of the pipeline system. Safety is a key advantage, when using the proposed control system.

  11. Cosmological parameters from pre-planck cosmic microwave background measurements

    NARCIS (Netherlands)

    Calabrese, E.; Hlozek, R.; Battaglia, N.; Battistelli, E.; Bond, J.; Chluba, J.; Crichton, D.; Das, S.; Devlin, M.; Dunkley, J.; Dünner, R.; Farhang, M.; Gralla, M.; Hajian, A.; Halpern, M.; Hasselfield, M.; Hincks, A.; Irwin, K.; Kosowsky, A.; Louis, T.; Marriage, T.; Moodley, K.; Newburgh, L.; Niemack, M.; Nolta, M.; Page, L.; Sehgal, N.; Sherwin, B.; Sievers, J.; Sifon, Andalaft C.J.; Spergel, D.; Staggs, S.; Switzer, E.; Wollack, E.

    2013-01-01

    Recent data from the WMAP, ACT and SPT experiments provide precise measurements of the cosmic microwave background temperature power spectrum over a wide range of angular scales. The combination of these observations is well fit by the standard, spatially flat {$Lambda$}CDM cosmological model,

  12. Measuring and recording system for electron beam welding parameters

    International Nuclear Information System (INIS)

    Lobanova, N.G.; Lifshits, M.L.; Efimov, I.I.

    1987-01-01

    The observation possibility during electron beam welding of circular articles with guaranteed clearance of welding bath leading front in joint gap and flare cloud over the bath by means of television monitor is considered. The composition and operation mode of television measuring system for metric characteristics of flare cloud and altitude of welding bath leading front in the clearance are described

  13. An intelligent instrument for measuring the dynamic parameters of groundwater

    International Nuclear Information System (INIS)

    Du Guoping

    2002-01-01

    An intelligent instrument was developed for measuring direction and velocity of the groundwater, permeability coefficient, hydraulic transmitting coefficient, static level, hydraulic gradient and flow direction of each layer. The instrument can be widely applied for detecting seepage of abutment and river bank, exploitation of groundwater, conservation of water and soil, water surging in mine, survey of groundwater resource and environment protection etc

  14. Measurement of strong interaction parameters in antiprotonic hydrogen and deuterium

    CERN Document Server

    Augsburger, M A; Borchert, G L; Chatellard, D; Egger, J P; El-Khoury, P; Gorke, H; Gotta, D; Hauser, P R; Indelicato, P J; Kirch, K; Lenz, S; Siems, T; Simons, L M

    1999-01-01

    In the PS207 experiment at CERN, X-rays from antiprotonic hydrogen and deuterium have been measured at low pressure. The strong interaction shift and the broadening of the K/sub alpha / transition in antiprotonic hydrogen were $9 determined. Evidence was found for the individual hyperfine components of the protonium ground state. (7 refs).

  15. Comparison for some measured and calculated nuclear Parameters ...

    African Journals Online (AJOL)

    The computed thermal neutron flux levels in the radial and axial direct-ions for different zones of the reactor compared favourably with measured values obtained from the zero power critical experiments. The trends of fast, slowing down, epithermal and thermal fluxes were also predicted. Journal of Applied Science and ...

  16. Plasma-parameter measurements using neutral-particle-beam attenuation

    International Nuclear Information System (INIS)

    Foote, J.H.; Molvik, A.W.; Turner, W.C.

    1982-01-01

    Intense and energetic neutral-particle-beam injection used for fueling or heating magnetically confined, controlled-fusion experimental plasmas can also provide diagnostic measurements of the plasmas. The attenuation of an atomic beam (mainly from charge-exchange and ionization interactions) when passing through a plasma gives the plasma line density. Orthogonal arrays of highly collimated detectors of the secondary-electron-emission type have been used in magnetic-mirror experiments to measure neutral-beam attenuation along chords through the plasma volume at different radial and axial positions. The radial array is used to infer the radial plasma-density profile; the axial array, to infer the axial plasma-density profile and the ion angular distribution at the plasma midplane

  17. Test Station for Measuring Aluminum Tube Geometrical Parameters

    CERN Document Server

    Oansea, D; Gongadze, A L; Gostkin, M I; Dedovich, D V; Evtoukhovitch, P G; Comanescu, B; Kotov, S A; Necsoiu, T; Potrap, I N; Rogalev, E V; Tskhadadze, E G; Chelkov, G A

    2001-01-01

    A test station for quality control of aluminum tube outer diameter and wall thickness is presented. The tested tubes are used for drift detector assembly of ATLAS (LHC, CERN) muon system. The outer diameter and wall thickness of aluminium tubes are measured by means of noncontact optical and ultrasonic methods respectively with the accuracy of 3 {\\mu}m. The testing process is automatic and interacts with the production data base.

  18. Design parameters for measurements of local catalytic activity on surfaces

    DEFF Research Database (Denmark)

    Johansson, Martin; Johannessen, Tue; Jørgensen, Jan Hoffmann

    2006-01-01

    Computational fluid dynamics in combination with experiments is used to characterize a gas sampling device for measurements of the local catalytic activity on surfaces. The device basically consists of a quartz capillary mounted concentrically inside an aluminum tube. Reactant gas is blown toward......, the limits of the range in reaction rate, which can be Studied are estimated. (c) 2005 Elsevier B.V. All rights reserved.......Computational fluid dynamics in combination with experiments is used to characterize a gas sampling device for measurements of the local catalytic activity on surfaces. The device basically consists of a quartz capillary mounted concentrically inside an aluminum tube. Reactant gas is blown toward...... limit for the lateral resolution of the measurement, and that a flow rate of the order of 240 (ml/min)(n) is sufficient to achieve this resolution. The sensitivity is reasonable also with high flow rates, due to the presence of a pocket of stagnant gas under the tip of the capillary. Furthermore...

  19. Instrument maintenance of ultrasonic influences parameters measurement in technological processes

    Directory of Open Access Journals (Sweden)

    Tomal V. S.

    2008-04-01

    Full Text Available The contact and non-contact vibration meters for intermittent and continuous control of the vibration amplitude in the ultrasonic technological equipment have been developed. And in order to estimate the cavitation intensity in liquids the authors have developed cavitation activity indicators and cavitation sensitivity meters, allowing to measure the magnitude of the signal level in the range of maximum spectral density of cavitation noise. The developed instruments allow to improve the quality of products, reduce the defect rate and power consumption of equipment by maintaining optimum conditions of the process.

  20. Measurement and modeling of hyperfine parameters in ferroic materials

    CERN Document Server

    Gonçalves, João Nuno; Correia, J G

    This thesis presents the results of perturbed angular correlation (PAC) experiments , an experimental technique which measures the hyperfine interaction at probes (radioactive ions implanted in the materials to study), from which one infers local information on an atomic scale. Furthermore, abinitio calculations using density functional theory electronic obtain results that directly complement the experiments, and are also used for theoretical research. These methods were applied in two families of materials. The manganites, with the possible existence of magnetic, charge, orbital and ferroelectric orders, are of fundamental and technological interest. The experimental results are obtained in the alkaline-earth manganites (Ca, Ba, Sr), with special interest due to the structural variety of possible polymorphs. With probes of Cd and In the stability of the probe and its location in a wide temperature range is established and a comparison with calculations allows the physical interpretation of the results. Cal...

  1. 40 CFR 91.406 - Engine parameters to be measured and recorded.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Engine parameters to be measured and recorded. 91.406 Section 91.406 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Procedures § 91.406 Engine parameters to be measured and recorded. Measure or calculate, then record, the...

  2. 40 CFR 90.406 - Engine parameters to be measured and recorded.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Engine parameters to be measured and recorded. 90.406 Section 90.406 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Gaseous Exhaust Test Procedures § 90.406 Engine parameters to be measured and recorded. Measure or...

  3. Medium energy measurements of N-N parameters

    International Nuclear Information System (INIS)

    Ambrose, D.; Bachman, M.; Coffey, P.; Glass, G.; Jobst, B.; McNaughton, K.H.; Nguyen, C.; Riley, P.J.

    1993-01-01

    The authors report here progress made during the three year period January 1, 1990, to December 31, 1993, for the Department of Energy Three-Year Grant No. DE-FG05-88ER40446, third year. A major part of the work has been associated with nucleon-nucleon (N-N) research carried out at the Nucleon Physics Laboratory (NPL) at the Los Alamos Meson Physics Facility (LAMPF). During this period they also completed data acquisition and analyses of a TRIUMF experiment, but they have no further plans for experimental work at TRIUMF. Other research has been and will be continued to be carried out at BNL, and involves two rare kaon decay experiments, BNL E791, now completed, and a second generation rare kaon decay experiment, E871, which has just this summer completed an engineering test run. The authors are now also members of a proposed experiment, STAR, (Solenoidal Tracker at RHIC) to be carried out at the Relativistic Heavy Ion Collider facility, RHIC, at BNL. The past three years have been a time of rapid change in the focus of the experimental program. A LAMPF experiment, E1097, in which they spent a large amount of effort during the past three years, was terminated due to funding shortages after they had fabricated the detector, but before data acquisition, and consequently they increased their participation in the rare kaon experiment at BNL, E871. It now appears that there will be no LAMPF N-N program after 1993, so that the research efforts will concentrate on the BNL rare kaon decay measurement, E871, and on STAR. The authors expect that STAR, which requires the fabrication of a large colliding beam detector facility, will use an increasing amount of their research efforts during the next few years. In what follows they describe recent progress on the LAMPF and TRIUMF N-N measurements, on the BNL rare kaon decay work, and on the initial work with the STAR group

  4. Chiral Recognition by Fluorescence: One Measurement for Two Parameters

    Directory of Open Access Journals (Sweden)

    Shanshan Yu

    2014-01-01

    Full Text Available This outlook describes two strategies to simultaneously determine the enantiomeric composition and concentration of a chiral substrate by a single fluorescent measurement. One strategy utilizes a pseudoenantiomeric sensor pair that is composed of a 1,1′-bi-2-naphthol-based amino alcohol and a partially hydrogenated 1,1′-bi-2-naphthol-based amino alcohol. These two molecules have the opposite chiral configuration with fluorescent enhancement at two different emitting wavelengths when treated with the enantiomers of mandelic acid. Using the sum and difference of the fluorescent intensity at the two wavelengths allows simultaneous determination of both concentration and enantiomeric composition of the chiral acid. The other strategy employs a 1,1′-bi-2-naphthol-based trifluoromethyl ketone that exhibits fluorescent enhancement at two emission wavelengths upon interaction with a chiral diamine. One emission responds mostly to the concentration of the chiral diamine and the ratio of the two emissions depends on the chiral configuration of the enantiomer but independent of the concentration, allowing both the concentration and enantiomeric composition of the chiral diamine to be simultaneously determined. These strategies would significantly simplify the practical application of the enantioselective fluorescent sensors in high-throughput chiral assay.

  5. Computation of atmospheric dispersion coefficients from measurements of turbulence parameters

    International Nuclear Information System (INIS)

    Asculai, E.

    1975-04-01

    Some of the spectra of turbulence found in the literature are theoretical and some are experimental. The present work investigates the dependence of the dispersion coefficients (sigma sub(y) especially) on the shape of the spectrum, using the theoretical and the experimental data found in the literature. It seems that, contrary to accepted concepts, the value of P (in the proportion sigma α Tsup(P)) is larger under stable, than under unstable conditions. These values are of order 1, which does not agree with Taylor's asymptotic value of 1/2. The influence of the characteristics of the instrument - especially the time constant - on the estimation of sigma sub(y) is discussed. Inaccurate estimate of sigmasub(y) may result in underestimating concentrations by an order of magnitude (or even more). The results of the computations of sigma sub(y) for various release times given here enable a more accurate estimate of those concentrations. The results of a series of measurements demonstrating the principles discussed are presented, indicating a practical way of estimating the dispersion coefficients. (author)

  6. The Recommendations for Linear Measurement Techniques on the Measurements of Nonlinear System Parameters of a Joint.

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Scott A [Univ. of Maryland Baltimore County (UMBC), Baltimore, MD (United States); Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Catalfamo, Simone [Univ. of Stuttgart (Germany); Brake, Matthew R. W. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Rice Univ., Houston, TX (United States); Schwingshackl, Christoph W. [Imperial College, London (United Kingdom); Reusb, Pascal [Daimler AG, Stuttgart (Germany)

    2017-01-01

    In the study of the dynamics of nonlinear systems, experimental measurements often convolute the response of the nonlinearity of interest and the effects of the experimental setup. To reduce the influence of the experimental setup on the deduction of the parameters of the nonlinearity, the response of a mechanical joint is investigated under various experimental setups. These experiments first focus on quantifying how support structures and measurement techniques affect the natural frequency and damping of a linear system. The results indicate that support structures created from bungees have negligible influence on the system in terms of frequency and damping ratio variations. The study then focuses on the effects of the excitation technique on the response for a linear system. The findings suggest that thinner stingers should not be used, because under the high force requirements the stinger bending modes are excited adding unwanted torsional coupling. The optimal configuration for testing the linear system is then applied to a nonlinear system in order to assess the robustness of the test configuration. Finally, recommendations are made for conducting experiments on nonlinear systems using conventional/linear testing techniques.

  7. A nuclear radiation multi-parameter measurement system based on pulse-shape sampling

    International Nuclear Information System (INIS)

    Qiu Xiaolin; Fang Guoming; Xu Peng; Di Yuming

    2007-01-01

    In this paper, A nuclear radiation multi-parameter measurement system based on pulse-shape sampling is introduced, including the system's characteristics, composition, operating principle, experiment data and analysis. Compared with conventional nuclear measuring apparatus, it has some remarkable advantages such as the synchronous detection using multi-parameter measurement in the same measurement platform and the general analysis of signal data by user-defined program. (authors)

  8. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  9. A double parameters measurement of steam-water two-phase flow with single orifice

    International Nuclear Information System (INIS)

    Zhong Shuoping; Tong Yunxian; Yu Meiying

    1992-08-01

    A double parameters measurement of steam-water two-phase flow with single orifice is described. An on-line measurement device based on micro-computer has been developed. The measured r.m.s error of steam quality is less than 6.5% and the measured relative r.m.s. error of mass flow rate is less than 9%

  10. Pose measurement method with six parameters for microassembly based on an optical micrometer

    Science.gov (United States)

    Ye, Xin; Wang, Qiang; Zhang, Zhi-jing; Sun, Yuan; Zhang, Xiao-feng

    2009-07-01

    This paper presents a new pose measurement method of microminiature parts that is capable of transforming one dimension (1D) contour size obtained by optical micrometer to three dimension (3D) data with six parameters for microassembly. Pose measurement is one of the most important processes for microminiature parts' alignment and insertion in microassembly. During the past few years, researchers have developed their microassembly systems focusing on visual identification to obtain two or three dimension data with no more than three parameters. Scanning electronic microscope (SEM), optical microscope, and stereomicroscope are applied in their systems. However, as structures of microminiature parts become increasingly complex, six parameters to represent their position and orientation are specifically needed. Firstly, The pose measurement model is established based on the introduction of measuring objects and measuring principle of optical micrometer. The measuring objects are microminiature parts with complex 3D structure. Two groups of two dimension (2D) data are gathered at two different measurement positions. Then part pose with 6 parameters is calculated, including 3 position parameters of feature point of the part and 3 orientation parameters of the part axis. Secondly, pose measurement process for a small shaft, vertical orientation determination, and position parameters obtaining are presented. 2D data is gathered by scanning the generatrix of the part, and valid data is extracted and saved in arrays. A vertical orientation criterion is proposed to determine whether the part is parallel to the Z-axis of the coordinate. If not, 2D data will be fixed into a linear equation using least square algorithm. Then orientation parameters are calculated. Center of Part End (CPE) is selected as feature point of the part, and its position parameters are extracted form two group of 2D data. Finally, a fast pose measurement device is developed and representative

  11. Investigation on influence parameters in measurements of the optomechanical hole plate using an optical coordinate measuring machine

    DEFF Research Database (Denmark)

    Morace, Renate Erica; Hansen, Hans Nørgaard; De Chiffre, Leonardo

    2003-01-01

    This paper describes the results of an experimental investigation on influence parameters in optical coordinate measurements of the optomechanical hole plate. Special attention was paid to the background of the object, which strongly influences the measurement result. Furthermore, it is seen that...... influences, the measurements were all performed with no movements of the axes of the CMM....

  12. Effects of Various Architectural Parameters on Six Room Acoustical Measures in Auditoria.

    Science.gov (United States)

    Chiang, Wei-Hwa

    The effects of architectural parameters on six room acoustical measures were investigated by means of correlation analyses, factor analyses and multiple regression analyses based on data taken in twenty halls. Architectural parameters were used to estimate acoustical measures taken at individual locations within each room as well as the averages and standard deviations of all measured values in the rooms. The six acoustical measures were Early Decay Time (EDT10), Clarity Index (C80), Overall Level (G), Bass Ratio based on Early Decay Time (BR(EDT)), Treble Ratio based on Early Decay Time (TR(EDT)), and Early Inter-aural Cross Correlation (IACC80). A comprehensive method of quantifying various architectural characteristics of rooms was developed to define a large number of architectural parameters that were hypothesized to effect the acoustical measurements made in the rooms. This study quantitatively confirmed many of the principles used in the design of concert halls and auditoria. Three groups of room architectural parameters such as the parameters associated with the depth of diffusing surfaces were significantly correlated with the hall standard deviations of most of the acoustical measures. Significant differences of statistical relations among architectural parameters and receiver specific acoustical measures were found between a group of music halls and a group of lecture halls. For example, architectural parameters such as the relative distance from the receiver to the overhead ceiling increased the percentage of the variance of acoustical measures that was explained by Barron's revised theory from approximately 70% to 80% only when data were taken in the group of music halls. This study revealed the major architectural parameters which have strong relations with individual acoustical measures forming the basis for a more quantitative method for advancing the theoretical design of concert halls and other auditoria. The results of this study provide

  13. Innovation of Methods for Measurement and Modelling of Twisted Pair Parameters

    Directory of Open Access Journals (Sweden)

    Lukas Cepa

    2011-01-01

    Full Text Available The goal of this paper is to optimize a measurement methodology for the most accurate broadband modelling of characteristic impedance and other parameters for twisted pairs. Measured values and theirs comparison is presented in this article. Automated measurement facility was implemented at the Department of telecommunication of Faculty of electrical engineering of Czech technical university in Prague. Measurement facility contains RF switches allowing measurements up to 300 MHz or 1GHz. Measured twisted pair’s parameters can be obtained by measurement but for purposes of fundamental characteristics modelling is useful to define functions that model the properties of the twisted pair. Its primary and secondary parameters depend mostly on the frequency. For twisted pair deployment, we are interested in a frequency band range from 1 MHz to 100 MHz.

  14. Ultrasonic motion analysis system - measurement of temporal and spatial gait parameters

    NARCIS (Netherlands)

    Huitema, RB; Hof, AL; Postema, K

    The duration of stance and swing phase and step and stride length are important parameters in human gait. In this technical note a low-cost ultrasonic motion analysis system is described that is capable of measuring these temporal and spatial parameters while subjects walk on the floor. By using the

  15. Secchi depth analysis using bio-optical parameters measured in the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Suresh, T.; Naik, P.; Bandishte, M.; Desa, E.; Mascarenhas, A.A.M.Q.; Matondkar, S.G.P.

    spatial and temporal variability of Secchi depth and their dependence on the optical properties beam attenuation and diffuse attenuation the biological parameter of Chlorophyll. The in-situ measured inherent and apparent optical properties have been used...

  16. THE UNCERTAINTIES OF ENVIRONMENT'S PARAMETERS MEASUREMENTS AS TOLLS OF THE MEASUREMENTS QUALITY IMPROVEMENT

    Directory of Open Access Journals (Sweden)

    Miroslav Badida

    2008-06-01

    Full Text Available Identification of the noise measuring uncertainties by declared measured values is unconditionally necessary and required by legislative. Uncertainty of the measurements expresses all errors that accrue during the measuring. B y indication of uncertainties the measure documents that the objective value is with certain probability found in the interval that is bounded by the measurement uncertainty. The paper deals with the methodology of the uncertainty calculation by noise measurements in living and working environments. metal processing industry and building materials industry.

  17. Radon decay product in-door behaviour - parameter, measurement method, and model review

    International Nuclear Information System (INIS)

    Scofield, P.

    1988-01-01

    This report reviews parameters used to characterize indoor radon daughter behavior and concentrations. Certain parameters that affect indoor radon daughter concentrations are described and the values obtained experimentally or theoretically are summarized. Radon daughter measurement methods are reviewed, such as, PAEC, unattached daughters, particle size distributions, and plateout measurement methods. In addition, certain radon pressure driven/diffusion models and indoor radon daughter models are briefly described. (orig.)

  18. Evaluation of Perfusion and Thermal Parameters of Skin Tissue Using Cold Provocation and Thermographic Measurements

    Directory of Open Access Journals (Sweden)

    Strąkowska Maria

    2016-09-01

    Full Text Available Measurement of the perfusion coefficient and thermal parameters of skin tissue using dynamic thermography is presented in this paper. A novel approach based on cold provocation and thermal modelling of skin tissue is presented. The measurement was performed on a person’s forearm using a special cooling device equipped with the Peltier module. The proposed method first cools the skin, and then measures the changes of its temperature matching the measurement results with a heat transfer model to estimate the skin perfusion and other thermal parameters. In order to assess correctness of the proposed approach, the uncertainty analysis was performed.

  19. Variances as order parameter and complexity measure for random Boolean networks

    International Nuclear Information System (INIS)

    Luque, Bartolo; Ballesteros, Fernando J; Fernandez, Manuel

    2005-01-01

    Several order parameters have been considered to predict and characterize the transition between ordered and disordered phases in random Boolean networks, such as the Hamming distance between replicas or the stable core, which have been successfully used. In this work, we propose a natural and clear new order parameter: the temporal variance. We compute its value analytically and compare it with the results of numerical experiments. Finally, we propose a complexity measure based on the compromise between temporal and spatial variances. This new order parameter and its related complexity measure can be easily applied to other complex systems

  20. Variances as order parameter and complexity measure for random Boolean networks

    Energy Technology Data Exchange (ETDEWEB)

    Luque, Bartolo [Departamento de Matematica Aplicada y EstadIstica, Escuela Superior de Ingenieros Aeronauticos, Universidad Politecnica de Madrid, Plaza Cardenal Cisneros 3, Madrid 28040 (Spain); Ballesteros, Fernando J [Observatori Astronomic, Universitat de Valencia, Ed. Instituts d' Investigacio, Pol. La Coma s/n, E-46980 Paterna, Valencia (Spain); Fernandez, Manuel [Departamento de Matematica Aplicada y EstadIstica, Escuela Superior de Ingenieros Aeronauticos, Universidad Politecnica de Madrid, Plaza Cardenal Cisneros 3, Madrid 28040 (Spain)

    2005-02-04

    Several order parameters have been considered to predict and characterize the transition between ordered and disordered phases in random Boolean networks, such as the Hamming distance between replicas or the stable core, which have been successfully used. In this work, we propose a natural and clear new order parameter: the temporal variance. We compute its value analytically and compare it with the results of numerical experiments. Finally, we propose a complexity measure based on the compromise between temporal and spatial variances. This new order parameter and its related complexity measure can be easily applied to other complex systems.

  1. Ion source plasma parameters measurement based on Langmuir probe with commercial frequency sweep

    International Nuclear Information System (INIS)

    Xie, Y.H.; Hu, C.D.; Liu, S.; Shong, S.H.; Jiang, C.C.; Liu, Z.M.

    2010-01-01

    Langmuir probe is one of the main diagnostic tools to measure the plasma parameters in the ion source. In this article, the commercial frequency power, which is sine wave of 50 Hz, was supplied on the Langmuir probe to measure the plasma parameters. The best feature of this probe sweep voltage is that it does not need extra design. The probe I-V characteristic curve can be got in less than 5 ms and the plasma parameters, the electron temperature and the electron density, varying with the time can be got in one plasma discharge of 400 ms.

  2. Measurements of local two-phase flow parameters in a boiling flow channel

    International Nuclear Information System (INIS)

    Yun, Byong Jo; Park, Goon-CherI; Chung, Moon Ki; Song, Chul Hwa

    1998-01-01

    Local two-phase flow parameters were measured lo investigate the internal flow structures of steam-water boiling flow in an annulus channel. Two kinds of measuring methods for local two-phase flow parameters were investigated. These are a two-conductivity probe for local vapor parameters and a Pitot cube for local liquid parameters. Using these probes, the local distribution of phasic velocities, interfacial area concentration (IAC) and void fraction is measured. In this study, the maximum local void fraction in subcooled boiling condition is observed around the heating rod and the local void fraction is smoothly decreased from the surface of a heating rod to the channel center without any wall void peaking, which was observed in air-water experiments. The distributions of local IAC and bubble frequency coincide with those of local void fraction for a given area-averaged void fraction. (author)

  3. The Research of Screw Thread Parameter Measurement Based on Position Sensitive Detector and Laser

    International Nuclear Information System (INIS)

    Tong, Q B; Ding, Z L; Chen, J C; Ai, L L; Yuan, F

    2006-01-01

    A technique and system of measuring screw thread parameter based on the theory of laser measurement is presented in this paper, which can be carried out the automated measurement of screw thread parameter. An inspection instrument was designed and produced, which included exterior imaging system of optical path, transverse displacement measurement system, axial displacement measurement system, and a module to deal with, control and assess the data in the upper system. The inspection and estimate of the screw thread contour curve were completed by using position sensitive device (PSD) as photoelectric detector to measure the coordinate data of the screw thread contour curve in the transverse section, and using precise raster to measure the axial displacement of the precision worktable under the screw thread test criterion., computer can gives a measured result according to coordinate data of the screw thread obtained by PSD. The relation between measured spot and image is established, and optimum design of the system organization are introduced, including the image length of receiving lens focal length optical system and the choice of PSD , and some main factor affected measuring precision are analyzed. The experimental results show that the measurement uncertainty of screw thread minor diameter can reach 0. 5μm, which can meet most requests for the measurement of screw thread parameter

  4. Measurement of the geometric parameters of power contact wire based on binocular stereovision

    Science.gov (United States)

    Pan, Xue-Tao; Zhang, Ya-feng; Meng, Fei

    2010-10-01

    In the electrified railway power supply system, electric locomotive obtains power from the catenary's wire through the pantograph. Under the action of the pantograph, combined with various factors such as vibration, touch current, relative sliding speed, load, etc, the contact wire will produce mechanical wear and electrical wear. Thus, in electrified railway construction and daily operations, the geometric parameters such as line height, pull value, the width of wear surface must be under real-timely and non-contact detection. On the one hand, the safe operation of electric railways will be guaranteed; on the other hand, the wire endurance will be extended, and operating costs reduced. Based on the characteristics of the worn wires' image signal, the binocular stereo vision technology was applied for measurement of contact wire geometry parameters, a mathematical model of measurement of geometric parameters was derived, and the boundaries of the wound wire abrasion-point value were extracted by means of sub-pixel edge detection method based on the LOG operator with the least-squares fitting, thus measurements of the wire geometry parameters were realized. Principles were demonstrated through simulation experiments, and the experimental results show that the detection methods presented in this paper for measuring the accuracy, efficiency and convenience, etc. are close to or superior to the traditional measurements, which has laid a good foundation for the measurement system of geometric parameters for the contact wire of the development of binocular vision.

  5. A principle for the noninvasive measurement of steady-state heat transfer parameters in living tissues

    Directory of Open Access Journals (Sweden)

    S. Yu. Makarov

    2014-01-01

    Full Text Available Measuring the parameters of biological tissues (include in vivo is of great importance for medical diagnostics. For example, the value of the blood perfusion parameter is associated with the state of the blood microcirculation system and its functioning affects the state of the tissues of almost all organs. This work describes a previously proposed principle [1] in generalized terms. The principle is intended for noninvasive measuring the parameters of stationary heat transfer in biological tissues. The results of some experiments (natural and numeric are also presented in the research.For noninvasive measurement of thermophysical parameters a number of techniques have been developed using non-stationary thermal process in biological tissue [2][3]. But these techniques require the collecting a lot of data to represent the time-dependent thermal signal. In addition, subsequent processing with specialized algorithms is required for optimal selecting the parameters. The goal of this research is to develop an alternative approach using stationary thermal process for non-invasive measuring the parameters of stationary heat transfer in living tissues.A general principle can be formulated for the measurement methods based on this approach. Namely, the variations (changes of two physical values are measured in the experiment at the transition from one thermal stationary state to another. One of these two physical values unambiguously determines the stationary thermal field into the biological tissue under specified experimental conditions while the other one is unambiguously determined through the thermal field. Then, the parameters can be found from the numerical (or analytical functional dependencies linking the measured variations because the dependencies contain unknown parameters.The dependencies are expressed in terms of the formula:dqi = fi({pj},Ui dUi,Here dqi is a variation of a physical value q which is unambiguously determined from the

  6. Kinetics parameter measurements on RSG-GAS, a low-enriched fuel reactor

    International Nuclear Information System (INIS)

    Jujuratisbela, U; Arbie, B; Pinem, S.; Tukiran; Suparlina, L.; Singh, O.P.

    1995-01-01

    Kinetics parameter measurements, such as reactivity worths of control rods and fuel elements, beam tube void reactivity, power reactivity coefficient and xenon poisoning reactivity have been performed on different cores of Reaktor Serba Guna G.A. Siwabessy (RSG-GAS). In parallel, a programme was also initiated to measure the other kinetics parameters like effective delayed neutron life time, prompt neutron decay constant, validation of period reactivity relationship and zero power frequency response function. The paper provides the results of these measurements. (author)

  7. Two-detector cross-correlation noise technique and its application in measuring reactor kinetic parameters

    International Nuclear Information System (INIS)

    Lu Guiping; Peng Feng; Yi Jieyi

    1988-01-01

    The two-detector cross-correlation noise technique is a new method of measuring reactor kinetic parameters developed in the sixties. It has the advantages of non-perturbation in core, high signal to noise ratio, low space dependent effect, and simple and reliable in measurement. A special set of cross-correlation analyzer has been prepared for measuring kinetic parameters of several reactor assemblies, such as the High Flux Engineering Test Reactor, its zero power mock up facility and a low enriched uranium light water lattice zero power facility

  8. Optimal Design of Measurement Programs for the Parameter Identification of Dynamic Systems

    DEFF Research Database (Denmark)

    Kirkegaard, Poul Henning; Sørensen, John Dalsgaard; Brincker, Rune

    The design of a measured program devoted to parameter identification of structural dynamic systems is considered, the design problem is formulated as an optimization problem due to minimize the total expected cost of the measurement program. All the calculations are based on a priori knowledge...... and engineering judgement. One of the contribution of the approach is that the optimal nmber of sensors can be estimated. This is sown in an numerical example where the proposed approach is demonstrated. The example is concerned with design of a measurement program for estimating the modal damping parameters...

  9. Probabilistic teleportation via multi-parameter measurements and partially entangled states

    Science.gov (United States)

    Wei, Jiahua; Shi, Lei; Han, Chen; Xu, Zhiyan; Zhu, Yu; Wang, Gang; Wu, Hao

    2018-04-01

    In this paper, a novel scheme for probabilistic teleportation is presented with multi-parameter measurements via a non-maximally entangled state. This is in contrast to the fact that the measurement kinds for quantum teleportation are usually particular in most previous schemes. The detail implementation producers for our proposal are given by using of appropriate local unitary operations. Moreover, the total success probability and classical information of this proposal are calculated. It is demonstrated that the success probability and classical cost would be changed with the multi-measurement parameters and the entanglement factor of quantum channel. Our scheme could enlarge the research range of probabilistic teleportation.

  10. Development of Single Optical Sensor Method for the Measurement Droplet Parameters

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Tae Ho; Ahn, Tae Hwan; Yun, Byong Jo [Pusan National University, Busan (Korea, Republic of); Bae, Byoung Uhn; Kim, Kyoung Doo [KAERI, Daejeon (Korea, Republic of)

    2016-05-15

    In this study, we tried to develop single optical fiber probe(S-TOP) sensor method to measure droplet parameters such as diameter, droplet fraction, and droplet velocity and so on. To calibrate and confirm the optical fiber sensor for those parameters, we conducted visualization experiments by using a high speed camera with the optical sensor. To evaluate the performance of the S-TOP accurately, we repeated calibration experiments at a given droplet flow condition. Figure. 3 shows the result of the calibration. In this graph, the x axis is the droplet velocity measured by visualization and the y axis is grd, D which is obtained from S-TOP. In this study, we have developed the single tip optical probe sensor to measure the droplet parameters. From the calibration experiments with high speed camera, we get the calibration curve for the droplet velocity. Additionally, the chord length distribution of droplets is measured by the optical probe.

  11. Development of Single Optical Sensor Method for the Measurement Droplet Parameters

    International Nuclear Information System (INIS)

    Kim, Tae Ho; Ahn, Tae Hwan; Yun, Byong Jo; Bae, Byoung Uhn; Kim, Kyoung Doo

    2016-01-01

    In this study, we tried to develop single optical fiber probe(S-TOP) sensor method to measure droplet parameters such as diameter, droplet fraction, and droplet velocity and so on. To calibrate and confirm the optical fiber sensor for those parameters, we conducted visualization experiments by using a high speed camera with the optical sensor. To evaluate the performance of the S-TOP accurately, we repeated calibration experiments at a given droplet flow condition. Figure. 3 shows the result of the calibration. In this graph, the x axis is the droplet velocity measured by visualization and the y axis is grd, D which is obtained from S-TOP. In this study, we have developed the single tip optical probe sensor to measure the droplet parameters. From the calibration experiments with high speed camera, we get the calibration curve for the droplet velocity. Additionally, the chord length distribution of droplets is measured by the optical probe.

  12. Measuring Accurate Body Parameters of Dressed Humans with Large-Scale Motion Using a Kinect Sensor

    Directory of Open Access Journals (Sweden)

    Sidan Du

    2013-08-01

    Full Text Available Non-contact human body measurement plays an important role in surveillance, physical healthcare, on-line business and virtual fitting. Current methods for measuring the human body without physical contact usually cannot handle humans wearing clothes, which limits their applicability in public environments. In this paper, we propose an effective solution that can measure accurate parameters of the human body with large-scale motion from a Kinect sensor, assuming that the people are wearing clothes. Because motion can drive clothes attached to the human body loosely or tightly, we adopt a space-time analysis to mine the information across the posture variations. Using this information, we recover the human body, regardless of the effect of clothes, and measure the human body parameters accurately. Experimental results show that our system can perform more accurate parameter estimation on the human body than state-of-the-art methods.

  13. Measuring Parameters of Massive Black Hole Binaries with Partially Aligned Spins

    Science.gov (United States)

    Lang, Ryan N.; Hughes, Scott A.; Cornish, Neil J.

    2011-01-01

    The future space-based gravitational wave detector LISA will be able to measure parameters of coalescing massive black hole binaries, often to extremely high accuracy. Previous work has demonstrated that the black hole spins can have a strong impact on the accuracy of parameter measurement. Relativistic spin-induced precession modulates the waveform in a manner which can break degeneracies between parameters, in principle significantly improving how well they are measured. Recent studies have indicated, however, that spin precession may be weak for an important subset of astrophysical binary black holes: those in which the spins are aligned due to interactions with gas. In this paper, we examine how well a binary's parameters can be measured when its spins are partially aligned and compare results using waveforms that include higher post-Newtonian harmonics to those that are truncated at leading quadrupole order. We find that the weakened precession can substantially degrade parameter estimation, particularly for the "extrinsic" parameters sky position and distance. Absent higher harmonics, LISA typically localizes the sky position of a nearly aligned binary about an order of magnitude less accurately than one for which the spin orientations are random. Our knowledge of a source's sky position will thus be worst for the gas-rich systems which are most likely to produce electromagnetic counterparts. Fortunately, higher harmonics of the waveform can make up for this degradation. By including harmonics beyond the quadrupole in our waveform model, we find that the accuracy with which most of the binary's parameters are measured can be substantially improved. In some cases, the improvement is such that they are measured almost as well as when the binary spins are randomly aligned.

  14. Software measurement standards for areal surface texture parameters: part 2—comparison of software

    International Nuclear Information System (INIS)

    Harris, P M; Smith, I M; Giusca, C; Leach, R K; Wang, C

    2012-01-01

    A companion paper in this issue describes reference software for the evaluation of areal surface texture parameters, focusing on the definitions of the parameters and giving details of the numerical algorithms employed in the software to implement those definitions. The reference software is used as a benchmark against which software in a measuring instrument can be compared. A data set is used as input to both the software under test and the reference software, and the results delivered by the software under test are compared with those provided by the reference software. This paper presents a comparison of the results returned by the reference software with those reported by proprietary software for surface texture measurement. Differences between the results can be used to identify where algorithms and software for evaluating the parameters differ. They might also be helpful in identifying where parameters are not sufficiently well-defined in standards. (paper)

  15. Prediction of betavoltaic battery output parameters based on SEM measurements and Monte Carlo simulation

    International Nuclear Information System (INIS)

    Yakimov, Eugene B.

    2016-01-01

    An approach for a prediction of "6"3Ni-based betavoltaic battery output parameters is described. It consists of multilayer Monte Carlo simulation to obtain the depth dependence of excess carrier generation rate inside the semiconductor converter, a determination of collection probability based on the electron beam induced current measurements, a calculation of current induced in the semiconductor converter by beta-radiation, and SEM measurements of output parameters using the calculated induced current value. Such approach allows to predict the betavoltaic battery parameters and optimize the converter design for any real semiconductor structure and any thickness and specific activity of beta-radiation source. - Highlights: • New procedure for betavoltaic battery output parameters prediction is described. • A depth dependence of beta particle energy deposition for Si and SiC is calculated. • Electron trajectories are assumed isotropic and uniformly started under simulation.

  16. The Positioning Accuracy of BAUV Using Fusion of Data from USBL System and Movement Parameters Measurements

    Directory of Open Access Journals (Sweden)

    Naus Krzysztof

    2016-08-01

    Full Text Available The article presents a study of the accuracy of estimating the position coordinates of BAUV (Biomimetic Autonomous Underwater Vehicle by the extended Kalman filter (EKF method. The fusion of movement parameters measurements and position coordinates fixes was applied. The movement parameters measurements are carried out by on-board navigation devices, while the position coordinates fixes are done by the USBL (Ultra Short Base Line system. The problem of underwater positioning and the conceptual design of the BAUV navigation system constructed at the Naval Academy (Polish Naval Academy—PNA are presented in the first part of the paper. The second part consists of description of the evaluation results of positioning accuracy, the genesis of the problem of selecting method for underwater positioning, and the mathematical description of the method of estimating the position coordinates using the EKF method by the fusion of measurements with on-board navigation and measurements obtained with the USBL system. The main part contains a description of experimental research. It consists of a simulation program of navigational parameter measurements carried out during the BAUV passage along the test section. Next, the article covers the determination of position coordinates on the basis of simulated parameters, using EKF and DR methods and the USBL system, which are then subjected to a comparative analysis of accuracy. The final part contains systemic conclusions justifying the desirability of applying the proposed fusion method of navigation parameters for the BAUV positioning.

  17. The Positioning Accuracy of BAUV Using Fusion of Data from USBL System and Movement Parameters Measurements.

    Science.gov (United States)

    Krzysztof, Naus; Aleksander, Nowak

    2016-08-15

    The article presents a study of the accuracy of estimating the position coordinates of BAUV (Biomimetic Autonomous Underwater Vehicle) by the extended Kalman filter (EKF) method. The fusion of movement parameters measurements and position coordinates fixes was applied. The movement parameters measurements are carried out by on-board navigation devices, while the position coordinates fixes are done by the USBL (Ultra Short Base Line) system. The problem of underwater positioning and the conceptual design of the BAUV navigation system constructed at the Naval Academy (Polish Naval Academy-PNA) are presented in the first part of the paper. The second part consists of description of the evaluation results of positioning accuracy, the genesis of the problem of selecting method for underwater positioning, and the mathematical description of the method of estimating the position coordinates using the EKF method by the fusion of measurements with on-board navigation and measurements obtained with the USBL system. The main part contains a description of experimental research. It consists of a simulation program of navigational parameter measurements carried out during the BAUV passage along the test section. Next, the article covers the determination of position coordinates on the basis of simulated parameters, using EKF and DR methods and the USBL system, which are then subjected to a comparative analysis of accuracy. The final part contains systemic conclusions justifying the desirability of applying the proposed fusion method of navigation parameters for the BAUV positioning.

  18. Self-adaptive Green-Ampt infiltration parameters obtained from measured moisture processes

    Directory of Open Access Journals (Sweden)

    Long Xiang

    2016-07-01

    Full Text Available The Green-Ampt (G-A infiltration model (i.e., the G-A model is often used to characterize the infiltration process in hydrology. The parameters of the G-A model are critical in applications for the prediction of infiltration and associated rainfall-runoff processes. Previous approaches to determining the G-A parameters have depended on pedotransfer functions (PTFs or estimates from experimental results, usually without providing optimum values. In this study, rainfall simulators with soil moisture measurements were used to generate rainfall in various experimental plots. Observed runoff data and soil moisture dynamic data were jointly used to yield the infiltration processes, and an improved self-adaptive method was used to optimize the G-A parameters for various types of soil under different rainfall conditions. The two G-A parameters, i.e., the effective hydraulic conductivity and the effective capillary drive at the wetting front, were determined simultaneously to describe the relationships between rainfall, runoff, and infiltration processes. Through a designed experiment, the method for determining the G-A parameters was proved to be reliable in reflecting the effects of pedologic background in G-A type infiltration cases and deriving the optimum G-A parameters. Unlike PTF methods, this approach estimates the G-A parameters directly from infiltration curves obtained from rainfall simulation experiments so that it can be used to determine site-specific parameters. This study provides a self-adaptive method of optimizing the G-A parameters through designed field experiments. The parameters derived from field-measured rainfall-infiltration processes are more reliable and applicable to hydrological models.

  19. Focusing on a Probability Element: Parameter Selection of Message Importance Measure in Big Data

    OpenAIRE

    She, Rui; Liu, Shanyun; Dong, Yunquan; Fan, Pingyi

    2017-01-01

    Message importance measure (MIM) is applicable to characterize the importance of information in the scenario of big data, similar to entropy in information theory. In fact, MIM with a variable parameter can make an effect on the characterization of distribution. Furthermore, by choosing an appropriate parameter of MIM,it is possible to emphasize the message importance of a certain probability element in a distribution. Therefore, parametric MIM can play a vital role in anomaly detection of bi...

  20. Generator Dynamic Model Validation and Parameter Calibration Using Phasor Measurements at the Point of Connection

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Zhenyu; Du, Pengwei; Kosterev, Dmitry; Yang, Steve

    2013-05-01

    Disturbance data recorded by phasor measurement units (PMU) offers opportunities to improve the integrity of dynamic models. However, manually tuning parameters through play-back events demands significant efforts and engineering experiences. In this paper, a calibration method using the extended Kalman filter (EKF) technique is proposed. The formulation of EKF with parameter calibration is discussed. Case studies are presented to demonstrate its validity. The proposed calibration method is cost-effective, complementary to traditional equipment testing for improving dynamic model quality.

  1. Using linear time-invariant system theory to estimate kinetic parameters directly from projection measurements

    International Nuclear Information System (INIS)

    Zeng, G.L.; Gullberg, G.T.

    1995-01-01

    It is common practice to estimate kinetic parameters from dynamically acquired tomographic data by first reconstructing a dynamic sequence of three-dimensional reconstructions and then fitting the parameters to time activity curves generated from the time-varying reconstructed images. However, in SPECT, the pharmaceutical distribution can change during the acquisition of a complete tomographic data set, which can bias the estimated kinetic parameters. It is hypothesized that more accurate estimates of the kinetic parameters can be obtained by fitting to the projection measurements instead of the reconstructed time sequence. Estimation from projections requires the knowledge of their relationship between the tissue regions of interest or voxels with particular kinetic parameters and the project measurements, which results in a complicated nonlinear estimation problem with a series of exponential factors with multiplicative coefficients. A technique is presented in this paper where the exponential decay parameters are estimated separately using linear time-invariant system theory. Once the exponential factors are known, the coefficients of the exponentials can be estimated using linear estimation techniques. Computer simulations demonstrate that estimation of the kinetic parameters directly from the projections is more accurate than the estimation from the reconstructed images

  2. The Association between Parameters of Malnutrition and Diagnostic Measures of Sarcopenia in Geriatric Outpatients

    Science.gov (United States)

    Reijnierse, Esmee M.; Trappenburg, Marijke C.; Leter, Morena J.; Blauw, Gerard Jan; de van der Schueren, Marian A. E.; Meskers, Carel G. M.; Maier, Andrea B.

    2015-01-01

    Objectives Diagnostic criteria for sarcopenia include measures of muscle mass, muscle strength and physical performance. Consensus on the definition of sarcopenia has not been reached yet. To improve insight into the most clinically valid definition of sarcopenia, this study aimed to compare the association between parameters of malnutrition, as a risk factor in sarcopenia, and diagnostic measures of sarcopenia in geriatric outpatients. Material and Methods This study is based on data from a cross-sectional study conducted in a geriatric outpatient clinic including 185 geriatric outpatients (mean age 82 years). Parameters of malnutrition included risk of malnutrition (assessed by the Short Nutritional Assessment Questionnaire), loss of appetite, unintentional weight loss and underweight (body mass index malnutrition (independent variables) and diagnostic measures of sarcopenia (dependent variables) were analysed using multivariate linear regression models adjusted for age, body mass, fat mass and height in separate models. Results None of the parameters of malnutrition was consistently associated with diagnostic measures of sarcopenia. The strongest associations were found for both relative and absolute muscle mass; less stronger associations were found for muscle strength and physical performance. Underweight (p = malnutrition relate differently to diagnostic measures of sarcopenia in geriatric outpatients. The association between parameters of malnutrition and diagnostic measures of sarcopenia was strongest for both relative and absolute muscle mass, while less strong associations were found with muscle strength and physical performance. PMID:26284368

  3. A Study of Transmission Control Method for Distributed Parameters Measurement in Large Factories and Storehouses

    Directory of Open Access Journals (Sweden)

    Shujing Su

    2015-01-01

    Full Text Available For the characteristics of parameters dispersion in large factories, storehouses, and other applications, a distributed parameter measurement system is designed that is based on the ring network. The structure of the system and the circuit design of the master-slave node are described briefly. The basic protocol architecture about transmission communication is introduced, and then this paper comes up with two kinds of distributed transmission control methods. Finally, the reliability, extendibility, and control characteristic of these two methods are tested through a series of experiments. Moreover, the measurement results are compared and discussed.

  4. Ultrasonic measurements and other allied parameters of yttrium soaps in mixed organic solvents

    International Nuclear Information System (INIS)

    Mehrotra, K.N.; Tandon, K.

    1990-01-01

    The ultrasonic measurements of yttrium soaps were made in a mixture of 70 % benzene and 30 % dimethylsulfoxide (ν/ν) to determine the critical micelle concentration, soap-solvent interaction and various acoustic and thermodynamic parameters. The values of the CMC decrease with increasing chainlength of fatty acid constituent of the soap molecule and are in agreement with the values obtained from other micellar properties. The various acoustic parameters (intermolecular freelength, adiabatic compressibility, apparent molar compressibility, specific acoustic impedance, apparent molar volume, molar sound velocity, solvation number, available volume and relative association) for yttrium soaps (myristate, palmitate, stearate and oleate) have been evaluated by ultrasonic velocity measurements. (Authors)

  5. A Measurement of the Michel Parameters in Leptonic Decays of the Tau

    Energy Technology Data Exchange (ETDEWEB)

    Ammar, R.; Baringer, P.; Bean, A.; Besson, D.; Coppage, D.; Darling, C.; Davis, R.; Hancock, N.; Kotov, S.; Kravchenko, I.; Kwak, N. [University of Kansas, Lawrence, Kansas 66045 (United States); Anderson, S.; Kubota, Y.; Lattery, M.; ONeill, J.J.; Patton, S.; Poling, R.; Riehle, T.; Savinov, V.; Smith, A. [University of Minnesota, Minneapolis, Minnesota 55455 (United States); Alam, M.S.; Athar, S.B.; Ling, Z.; Mahmood, A.H.; Severini, H.; Timm, S.; Wappler, F. [State University of New York at Albany, Albany, New York 12222 (United States); Anastassov, A.; Blinov, S.; Duboscq, J.E.; Fujino, D.; Fulton, R.; Gan, K.K.; Hart, T.; Honscheid, K.; Kagan, H.; Kass, R.; Lee, J.; Spencer, M.B.; Sung, M.; Undrus, A.; Wanke, R.; Wolf, A.; Zoeller, M. [Ohio State University, Columbus, Ohio 43210 (United States); Nemati, B.; Richichi, S.J.; Ross, W.R.; Skubic, P.; Wood, M. [University of Oklahoma, Norman, Oklahoma 73019 (United States); Bishai, M.; Fast, J.; Gerndt, E.; Hinson, J.W.; Menon, N.; Miller, D.H.; Shibata, E.I.; Shipsey, I.P. [Purdue University, West Lafayette, Indiana 47907 (United States); Yurko, M.; Gibbons, L.; Johnson, S.D.; Kwon, Y.; Roberts, S.; Thorndike, E.H. [University of Rochester, Rochester, New York 14627 (United States); Jessop, C.P.; Lingel, K.; Marsiske, H.; Perl, M.L.; Schaffner, S.F.; Ugolini, D.; Wang, R.; Zhou, X. [Stanford Linear Accelerator Center, Stanford University, Stanford, California 94309 (United States); Coan, T.E.; Fadeyev, V.; Korolkov, I.; Maravin, Y.; Narsky, I.; Shelkov, V.; Staeck, J.; Stroynowski, R.; Volobouev, I.; Ye, J. [Southern Methodist University, Dallas, Texas 75275 (United States); Artuso, M.; Efimov, A.; Frasconi, F.; Gao, M.; Goldberg, M.; He, D.; Kopp, S.; Moneti, G.C.; Mountain, R.; Mukhin, Y.; Schuh, S.; Skwarnicki, T.; Stone, S.; Viehhauser, G.; Xing, X. [Syracuse University, Syracuse, New York 13244 (United States); Bartelt, J.; Csorna, S.E.; Jain, V.; and others

    1997-06-01

    We have measured the spectral shape Michel parameters {rho} and {eta} using leptonic decays of the {tau} , recorded by the CLEO II detector. Assuming e-{mu} universality in the vectorlike couplings, we find {rho}{sub e{mu}}=0.735{plus_minus}0.013{plus_minus}0.008 and {eta}{sub e{mu}}=-0.015{plus_minus}0.061{plus_minus}0.062 , where the first error is statistical and the second systematic. We also present measurements for the parameters for e and {mu} final states separately. {copyright} {ital 1997} {ital The American Physical Society}

  6. Identifyability measures to select the parameters to be estimated in a solid-state fermentation distributed parameter model.

    Science.gov (United States)

    da Silveira, Christian L; Mazutti, Marcio A; Salau, Nina P G

    2016-07-08

    Process modeling can lead to of advantages such as helping in process control, reducing process costs and product quality improvement. This work proposes a solid-state fermentation distributed parameter model composed by seven differential equations with seventeen parameters to represent the process. Also, parameters estimation with a parameters identifyability analysis (PIA) is performed to build an accurate model with optimum parameters. Statistical tests were made to verify the model accuracy with the estimated parameters considering different assumptions. The results have shown that the model assuming substrate inhibition better represents the process. It was also shown that eight from the seventeen original model parameters were nonidentifiable and better results were obtained with the removal of these parameters from the estimation procedure. Therefore, PIA can be useful to estimation procedure, since it may reduce the number of parameters that can be evaluated. Further, PIA improved the model results, showing to be an important procedure to be taken. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:905-917, 2016. © 2016 American Institute of Chemical Engineers.

  7. Pre-Analytical Parameters Affecting Vascular Endothelial Growth Factor Measurement in Plasma: Identifying Confounders.

    Directory of Open Access Journals (Sweden)

    Johanna M Walz

    Full Text Available Vascular endothelial growth factor-A (VEGF-A is intensively investigated in various medical fields. However, comparing VEGF-A measurements is difficult because sample acquisition and pre-analytic procedures differ between studies. We therefore investigated which variables act as confounders of VEGF-A measurements.Following a standardized protocol, blood was taken at three clinical sites from six healthy participants (one male and one female participant at each center twice one week apart. The following pre-analytical parameters were varied in order to analyze their impact on VEGF-A measurements: analyzing center, anticoagulant (EDTA vs. PECT / CTAD, cannula (butterfly vs. neonatal, type of centrifuge (swing-out vs. fixed-angle, time before and after centrifugation, filling level (completely filled vs. half-filled tubes and analyzing method (ELISA vs. multiplex bead array. Additionally, intrapersonal variations over time and sex differences were explored. Statistical analysis was performed using a linear regression model.The following parameters were identified as statistically significant independent confounders of VEGF-A measurements: analyzing center, anticoagulant, centrifuge, analyzing method and sex of the proband. The following parameters were no significant confounders in our data set: intrapersonal variation over one week, cannula, time before and after centrifugation and filling level of collection tubes.VEGF-A measurement results can be affected significantly by the identified pre-analytical parameters. We recommend the use of CTAD anticoagulant, a standardized type of centrifuge and one central laboratory using the same analyzing method for all samples.

  8. Pre-Analytical Parameters Affecting Vascular Endothelial Growth Factor Measurement in Plasma: Identifying Confounders.

    Science.gov (United States)

    Walz, Johanna M; Boehringer, Daniel; Deissler, Heidrun L; Faerber, Lothar; Goepfert, Jens C; Heiduschka, Peter; Kleeberger, Susannah M; Klettner, Alexa; Krohne, Tim U; Schneiderhan-Marra, Nicole; Ziemssen, Focke; Stahl, Andreas

    2016-01-01

    Vascular endothelial growth factor-A (VEGF-A) is intensively investigated in various medical fields. However, comparing VEGF-A measurements is difficult because sample acquisition and pre-analytic procedures differ between studies. We therefore investigated which variables act as confounders of VEGF-A measurements. Following a standardized protocol, blood was taken at three clinical sites from six healthy participants (one male and one female participant at each center) twice one week apart. The following pre-analytical parameters were varied in order to analyze their impact on VEGF-A measurements: analyzing center, anticoagulant (EDTA vs. PECT / CTAD), cannula (butterfly vs. neonatal), type of centrifuge (swing-out vs. fixed-angle), time before and after centrifugation, filling level (completely filled vs. half-filled tubes) and analyzing method (ELISA vs. multiplex bead array). Additionally, intrapersonal variations over time and sex differences were explored. Statistical analysis was performed using a linear regression model. The following parameters were identified as statistically significant independent confounders of VEGF-A measurements: analyzing center, anticoagulant, centrifuge, analyzing method and sex of the proband. The following parameters were no significant confounders in our data set: intrapersonal variation over one week, cannula, time before and after centrifugation and filling level of collection tubes. VEGF-A measurement results can be affected significantly by the identified pre-analytical parameters. We recommend the use of CTAD anticoagulant, a standardized type of centrifuge and one central laboratory using the same analyzing method for all samples.

  9. Measurements of gas parameters in plasma-assisted supersonic combustion processes using diode laser spectroscopy

    International Nuclear Information System (INIS)

    Bolshov, Mikhail A; Kuritsyn, Yu A; Liger, V V; Mironenko, V R; Leonov, S B; Yarantsev, D A

    2009-01-01

    We report a procedure for temperature and water vapour concentration measurements in an unsteady-state combustion zone using diode laser absorption spectroscopy. The procedure involves measurements of the absorption spectrum of water molecules around 1.39 μm. It has been used to determine hydrogen combustion parameters in M = 2 gas flows in the test section of a supersonic wind tunnel. The relatively high intensities of the absorption lines used have enabled direct absorption measurements. We describe a differential technique for measurements of transient absorption spectra, the procedure we used for primary data processing and approaches for determining the gas temperature and H 2 O concentration in the probed zone. The measured absorption spectra are fitted with spectra simulated using parameters from spectroscopic databases. The combustion-time-averaged (∼50 ms) gas temperature and water vapour partial pressure in the hot wake region are determined to be 1050 K and 21 Torr, respectively. The large signal-to-noise ratio in our measurements allowed us to assess the temporal behaviour of these parameters. The accuracy in our temperature measurements in the probed zone is ∼40 K. (laser applications and other topics in quantum electronics)

  10. Hydrological model parameter dimensionality is a weak measure of prediction uncertainty

    Science.gov (United States)

    Pande, S.; Arkesteijn, L.; Savenije, H.; Bastidas, L. A.

    2015-04-01

    This paper shows that instability of hydrological system representation in response to different pieces of information and associated prediction uncertainty is a function of model complexity. After demonstrating the connection between unstable model representation and model complexity, complexity is analyzed in a step by step manner. This is done measuring differences between simulations of a model under different realizations of input forcings. Algorithms are then suggested to estimate model complexity. Model complexities of the two model structures, SAC-SMA (Sacramento Soil Moisture Accounting) and its simplified version SIXPAR (Six Parameter Model), are computed on resampled input data sets from basins that span across the continental US. The model complexities for SIXPAR are estimated for various parameter ranges. It is shown that complexity of SIXPAR increases with lower storage capacity and/or higher recession coefficients. Thus it is argued that a conceptually simple model structure, such as SIXPAR, can be more complex than an intuitively more complex model structure, such as SAC-SMA for certain parameter ranges. We therefore contend that magnitudes of feasible model parameters influence the complexity of the model selection problem just as parameter dimensionality (number of parameters) does and that parameter dimensionality is an incomplete indicator of stability of hydrological model selection and prediction problems.

  11. Measurement of reactor parameters of the 'Nora' reactor by noise analysis method - power spectral density

    International Nuclear Information System (INIS)

    Jovanovic, S.; Stormark, E.

    1966-01-01

    Measurements of reactor parameters the Nora reactor by Power Spectral Density (PSD) method are described. In case of critical reactor this method was applied for direct measurement of β/l ratio, β is the effective yield of delayed neutrons and l is the neutron lifetime. In case of subcritical reactor values of α+β-ρ/l were measured, ρ is the negative reactivity. Out coming PSD was measured by a filter or by ISAC. PSD was registered by ISAC as well as the auto-correlation function [sr

  12. Real-Time Aerodynamic Parameter Estimation without Air Flow Angle Measurements

    Science.gov (United States)

    Morelli, Eugene A.

    2010-01-01

    A technique for estimating aerodynamic parameters in real time from flight data without air flow angle measurements is described and demonstrated. The method is applied to simulated F-16 data, and to flight data from a subscale jet transport aircraft. Modeling results obtained with the new approach using flight data without air flow angle measurements were compared to modeling results computed conventionally using flight data that included air flow angle measurements. Comparisons demonstrated that the new technique can provide accurate aerodynamic modeling results without air flow angle measurements, which are often difficult and expensive to obtain. Implications for efficient flight testing and flight safety are discussed.

  13. The estimation of effective doses using measurement of several relevant physical parameters from radon exposures

    International Nuclear Information System (INIS)

    Ridzikova, A; Fronka, A.; Maly, B.; Moucka, L.

    2003-01-01

    In the present investigation, we will be study the dose relevant factors from continual monitoring in real homes into account getting more accurate estimation of 222 Rn the effective dose. The dose relevant parameters include the radon concentration, the equilibrium factor (f), the fraction (fp) of unattached radon decay products and real time occupancy people in home. The result of the measurement are the time courses of radon concentration that are based on estimation effective doses together with assessment of the real time occupancy people indoor. We found out by analysis that year effective dose is lower than effective dose estimated by ICRP recommendation from the integral measurement that included only average radon concentration. Our analysis of estimation effective doses using measurement of several physical parameters was made only in one case and for the better specification is important to measure in different real occupancy houses. (authors)

  14. A real-time measurement system for parameters of live biology metabolism process with fiber optics

    Science.gov (United States)

    Tao, Wei; Zhao, Hui; Liu, Zemin; Cheng, Jinke; Cai, Rong

    2010-08-01

    Energy metabolism is one of the basic life activities of cellular in which lactate, O2 and CO2 will be released into the extracellular environment. By monitoring the quantity of these parameters, the mitochondrial performance will be got. A continuous measurement system for the concentration of O2, CO2 and PH value is introduced in this paper. The system is made up of several small-sized fiber optics biosensors corresponding to the container. The setup of the system and the principle of measurement of several parameters are explained. The setup of the fiber PH sensor based on principle of light absorption is also introduced in detail and some experimental results are given. From the results we can see that the system can measure the PH value precisely suitable for cell cultivation. The linear and repeatable accuracies are 3.6% and 6.7% respectively, which can fulfill the measurement task.

  15. Measurement of proton-beam parameters by means of digital television diagnostic system

    International Nuclear Information System (INIS)

    Vazhenin, V.A.; Borovkov, S.D.; Evtikhiev, A.V.

    1992-01-01

    A method is described for measurement of the parameters of pulse-packet beams by means of a digital television diagnostic system. Results of tests of the system in measurement of the parameters of a proton beam with an energy of 1.35 GeV in the U-70 circular accelerator and results of measurements of the energy spectrum of the 30-MeV proton beam of the LU-30 linear accelerator are given. The possibility is shown of using the system to measure the integrated characteristics of an entire beam-pulse packet as well as the characteristics of individual pulses with a period of 60 msec. 6 refs., 4 figs., 1 tab

  16. Using Indirect Turbulence Measurements for Real-Time Parameter Estimation in Turbulent Air

    Science.gov (United States)

    Martos, Borja; Morelli, Eugene A.

    2012-01-01

    The use of indirect turbulence measurements for real-time estimation of parameters in a linear longitudinal dynamics model in atmospheric turbulence was studied. It is shown that measuring the atmospheric turbulence makes it possible to treat the turbulence as a measured explanatory variable in the parameter estimation problem. Commercial off-the-shelf sensors were researched and evaluated, then compared to air data booms. Sources of colored noise in the explanatory variables resulting from typical turbulence measurement techniques were identified and studied. A major source of colored noise in the explanatory variables was identified as frequency dependent upwash and time delay. The resulting upwash and time delay corrections were analyzed and compared to previous time shift dynamic modeling research. Simulation data as well as flight test data in atmospheric turbulence were used to verify the time delay behavior. Recommendations are given for follow on flight research and instrumentation.

  17. Measurements of relevant parameters in the formation of clathrate hydrates by a novel experimental apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Arca, S.; Di Profio, P.; Germani, R.; Savelli, G. [Perugia Univ., CEMIN, Perugia (Italy). Dept. of Chemistry

    2008-07-01

    There is a growing interest in understanding the thermodynamics and kinetics of clathrate hydrate formation. This paper presented a study that involved the design, construction, calibration, and testing of a new apparatus that could obtain as many parameters as possible in a single formation batch and that could measure unexplored clathrate hydrate parameters. The apparatus was capable of measuring equilibrium phases involving gaseous components. The paper described the conceptual design as well as the chamber, pressure line, temperature control, liquid addition line, and conductometric probe. The paper also discussed data acquisition, stirring, measurement examples, and internal illumination and video monitoring. It was concluded that refining measurements, particularly those concerning kinetic characterizations, is important in order to clarify several uncertain kinetic behaviors of clathrate hydrates. 6 refs., 16 figs.

  18. Measurements of integrated components' parameters versus irradiation doses gamma radiation (60Co) dosimetry-methodology-tests

    International Nuclear Information System (INIS)

    Fuan, J.

    1991-01-01

    This paper describes the methodology used for the irradiation of the integrated components and the measurements of their parameters, using Quality Insurance of dosimetry: - Measurement of the integrated dose using the competences of the Laboratoire Central des Industries Electriques (LCIE): - Measurement of irradiation dose versus source/component distance, using a calibrated equipment. - Use of ALANINE dosimeters, placed on the support of the irradiated components. - Assembly and polarization of components during the irradiations. Selection of the irradiator. - Measurement of the irradiated components's parameters, using the competences of the societies: - GenRad: GR130 tests equipement placed in the DEIN/SIR-CEN SACLAY. - Laboratoire Central des Industries Electriques (LCIE): GR125 tests equipment and this associated programmes test [fr

  19. Rocket measurements within a polar cap arc - Plasma, particle, and electric circuit parameters

    Science.gov (United States)

    Weber, E. J.; Ballenthin, J. O.; Basu, S.; Carlson, H. C.; Hardy, D. A.; Maynard, N. C.; Kelley, M. C.; Fleischman, J. R.; Pfaff, R. F.

    1989-01-01

    Results are presented from the Polar Ionospheric Irregularities Experiment (PIIE), conducted from Sondrestrom, Greenland, on March 15, 1985, designed for an investigation of processes which lead to the generation of small-scale (less than 1 km) ionospheric irregularities within polar-cap F-layer auroras. An instrumented rocket was launched into a polar cap F layer aurora to measure energetic electron flux, plasma, and electric circuit parameters of a sun-aligned arc, coordinated with simultaneous measurements from the Sondrestrom incoherent scatter radar and the AFGL Airborne Ionospheric Observatory. Results indicated the existence of two different generation mechanisms on the dawnside and duskside of the arc. On the duskside, parameters are suggestive of an interchange process, while on the dawnside, fluctuation parameters are consistent with a velocity shear instability.

  20. Optimised polarimeter configurations for measuring the Stokes parameters of the Cosmic Microwave Background Radiation

    OpenAIRE

    Couchot, F.; Delabrouille, J.; Kaplan, J.; Revenu, B.

    1998-01-01

    We present configurations of polarimeters which measure the three linear Stokes parameters of the Cosmic Microwave Background Radiation with a nearly diagonal error matrix, independent of the global orientation of the polarimeters in the focal plane. These configurations also provide the smallest possible error box volume.

  1. The Vocal Extent Measure: Development of a Novel Parameter in Voice Diagnostics and Initial Clinical Experience

    Directory of Open Access Journals (Sweden)

    Philipp P. Caffier

    2018-01-01

    Full Text Available Voice range profile (VRP and evaluation using the dysphonia severity index (DSI represent essentials of instrument-based objective voice diagnostics and are implemented in different standardized registration programs. The respective measurement results, however, show differences. The aim of the study was to prove these differences statistically and to develop a new parameter, the Vocal Extent Measure (VEM, which is not influenced by the measurement program. VRPs of 97 subjects were recorded by two examiners using the established registration programs DiVAS (XION medical and LingWAVES (WEVOSYS simultaneously. The VEM was developed on the basis of VRP area and perimeter. All 194 VRP files were analyzed for various parameters and gender independence. The registration programs exhibited significant differences in several vocal parameters. A significant gender influence for DSI was found with DiVAS (p<0.01, but not with LingWAVES. The VEM quantified the dynamic performance and frequency range by a unidimensional, interval-scaled value without unit, mostly between 0 and 120. This novel parameter represents an intelligible and user-friendly positive measure of vocal function, allows simple and stable VRP description, and seems to be suitable for quantification of vocal capacity. In contrast to DSI, the VEM proved to be less susceptible to registration program and gender.

  2. Measurement of the asymmetry parameter in the hyperon radiative decay Σ+→pγ

    International Nuclear Information System (INIS)

    Foucher, M.; Albuquerque, I.F.; Bondar, N.F.; Carrigan, R. Jr.; Chen, D.; Li Chengze; Cooper, P.S.; Denisov, A.S.; Dobrovolsky, A.V.; Dubbs, T.; Endler, A.M.F.; Escobar, C.O.; Tang Fukun; Golovtsov, V.L.; Goritchev, P.A.; Gottschalk, H.; Gouffon, P.; Grachev, V.T.; Shi Huanzhang; Yan Jie; Khanzadeev, A.V.; Kubantsev, M.A.; Kuropatkin, N.P.; Lach, J.; Luksys, M.; Lebedenko, V.N.; Dai Lisheng; Mahon, J.R.P.; McCliment, E.; Morelos, A.; Newsom, C.; Lang Pengfei; Pommot Maia, M.C.; Samsonov, V.M.; Zheng Shuchen; Smith, V.J.; Terentyev, N.K.; Timm, S.; Tkatch, I.I.; Uvarov, L.N.; Vorobyov, A.A.; Zhao Wenheng; Zhong Yuanyuan; Li Yunshan

    1992-01-01

    We have measured the asymmetry parameter (α γ ) in the hyperon radiative decay Σ + →pγ with a sample of 34 754±212 events obtained in a polarized charged hyperon beam experiment at Fermilab. We find α γ =-0.720±0.086±0.045, where the quoted errors are statistical and systematic, respectively

  3. Four-Parameter white blood cell differential counting based on light scattering measurements

    NARCIS (Netherlands)

    Terstappen, Leonardus Wendelinus Mathias Marie; de Grooth, B.G.; Visscher, K.; Kouterik, F.A.; Greve, Jan

    1988-01-01

    Measurement of the depolarized orthogonal light scattering in flow cytometry enables one to discriminate human eosinephilic granulocytes from neutrophilic granulocytes. We use this method to perform a four-parameter differential white blood cell analysis. A simple flow cytometer was built equipped

  4. Effect of scintillometer height on structure parameter of the refractive index of air measurements

    Science.gov (United States)

    Scintillometers measure amount of scintillations by emitting a beam of light over a horizontal path and expresses as the atmospheric turbulence structure parameter as the refractive index of air (Cn**2). Cn**2 represents the turbulent strength of the atmosphere and describes the ability of the atmos...

  5. Fast RF-CV characterization through high-speed 1-port S-parameter measurements

    NARCIS (Netherlands)

    Herfst, R.W.; Steeneken, P.G.; Tiggelman, M.P.J.; Stulemeijer, J.; Schmitz, Jurriaan

    2010-01-01

    We present a novel method to measure the capacitance-voltage relation of an electronic device. The approach is accurate, very fast, and cost-effective compared to the existing off-the-shelf solutions. Capacitances are determined using a single-frequency 1-port S-parameter setup constructed from

  6. Measurement of the CP-violation parameter Re(var-epsilon '/var-epsilon)

    International Nuclear Information System (INIS)

    Gibbons, L.K.; Barker, A.R.; Briere, R.A.; Makoff, G.; Papadimitriou, V.; Patterson, J.R.; Schwingenheuer, B.; Somalwar, S.V.; Wah, Y.W.; Winstein, B.; Winston, R.; Woods, M.; Yamamoto, H.; Swallow, E.C.; Bock, G.J.; Coleman, R.; Enagonio, J.; Hsiung, Y.B.; Ramberg, E.; Stanfield, K.; Tschirhart, R.; Yamanaka, T.; Gollin, G.D.; Karlsson, M.; Okamitsu, J.K.; Debu, P.; Peyaud, B.; Turlay, R.; Vallage, B.

    1993-01-01

    A measurement of the CP-violation parameter Re(var-epsilon '/var-epsilon) has been made using the full E731 data set. We find Re(var-epsilon '/var-epsilon)=(7.4±5.2±2.9)x10 -4 where the first error is statistical and the second systematic

  7. Online measurement of LHC beam parameters with the ATLAS High Level Trigger

    International Nuclear Information System (INIS)

    Strauss, E

    2012-01-01

    We present an online measurement of the LHC beamspot parameters in ATLAS using the High Level Trigger (HLT). When a significant change is detected in the measured beamspot, it is distributed to the HLT. There, trigger algorithms like b-tagging which calculate impact parameters or decay lengths benefit from a precise, up-to-date set of beamspot parameters. Additionally, online feedback is sent to the LHC operators in real time. The measurement is performed by an algorithm running on the Level 2 trigger farm, leveraging the high rate of usable events. Dedicated algorithms perform a full scan of the silicon detector to reconstruct event vertices from registered tracks. The distribution of these vertices is aggregated across the farm and their shape is extracted through fits every 60 seconds to determine the beamspot position, size, and tilt. The reconstructed beamspot values are corrected for detector resolution effects, measured in situ using the separation of vertices whose tracks have been split into two collections. Furthermore, measurements for individual bunch crossings have allowed for studies of single-bunch distributions as well as the behavior of bunch trains. This talk will cover the constraints imposed by the online environment and describe how these measurements are accomplished with the given resources. The algorithm tasks must be completed within the time constraints of the Level 2 trigger, with limited CPU and bandwidth allocations. This places an emphasis on efficient algorithm design and the minimization of data requests.

  8. Neutron Capture and Transmission Measurements and Resonance Parameter Analysis of Samarium

    International Nuclear Information System (INIS)

    Leinweber, G.; Burke, J.A.; Knox, H.D.; Drindak, N.J.; Mesh, D.W.; Haines, W.T.; Ballad, R.V.; Block, R.C.; Slovacek, R.E.; Werner, C.J.; Trbovich, M.J.; Barry, D.P.; Sato, T.

    2001-01-01

    The purpose of the present work is to accurately measure the neutron cross sections of samarium. The most significant isotope is 149 Sm, which has a large neutron absorption cross section at thermal energies and is a 235 U fission product with a 1% yield. Its cross sections are thus of concern to reactor neutronics. Neutron capture and transmission measurements were performed by the time-of-flight technique at the Rensselaer Polytechnic institute (RPI) LINAC facility using metallic and liquid Sm samples. The capture measurements were made at the 25 meter flight station with a multiplicity-type capture detector, and the transmission total cross-section measurements were performed at 15- and 25-meter flight stations with 6 Li glass scintillation detectors. Resonance parameters were determined by a combined analysis of six experiments (three capture and three transmission) using the multi-level R-matrix Bayesian code SAMMY version M2. The significant features of this work are as follows. Dilute samples of samarium nitrate in deuterated water (D 2 O) were prepared to measure the strong resonances at 0.1 and 8 eV without saturation. Disk-shaped spectroscopic quartz cells were obtained with parallel inner surfaces to provide a uniform thickness of solution. The diluent feature of the SAMMY program was used to analyze these data. The SAMMY program also includes multiple scattering corrections to capture yield data and resolution functions specific to the RPI facility. Resonance parameters for all stable isotopes of samarium were deduced for all resonances up to 30 eV. Thermal capture cross-section and capture resonance integral calculations were made using the resultant resonance parameters and were compared to results obtained using resonance parameters from ENDF/B-VI updated through release 3. Extending the definition of the capture resonance integral to include the strong 0.1 eV resonance in 149 Sm, present measurements agree within estimated uncertainties with En

  9. Correlation and agreement of a digital and conventional method to measure arch parameters.

    Science.gov (United States)

    Nawi, Nes; Mohamed, Alizae Marny; Marizan Nor, Murshida; Ashar, Nor Atika

    2018-01-01

    The aim of the present study was to determine the overall reliability and validity of arch parameters measured digitally compared to conventional measurement. A sample of 111 plaster study models of Down syndrome (DS) patients were digitized using a blue light three-dimensional (3D) scanner. Digital and manual measurements of defined parameters were performed using Geomagic analysis software (Geomagic Studio 2014 software, 3D Systems, Rock Hill, SC, USA) on digital models and with a digital calliper (Tuten, Germany) on plaster study models. Both measurements were repeated twice to validate the intraexaminer reliability based on intraclass correlation coefficients (ICCs) using the independent t test and Pearson's correlation, respectively. The Bland-Altman method of analysis was used to evaluate the agreement of the measurement between the digital and plaster models. No statistically significant differences (p > 0.05) were found between the manual and digital methods when measuring the arch width, arch length, and space analysis. In addition, all parameters showed a significant correlation coefficient (r ≥ 0.972; p digital and manual measurements. Furthermore, a positive agreement between digital and manual measurements of the arch width (90-96%), arch length and space analysis (95-99%) were also distinguished using the Bland-Altman method. These results demonstrate that 3D blue light scanning and measurement software are able to precisely produce 3D digital model and measure arch width, arch length, and space analysis. The 3D digital model is valid to be used in various clinical applications.

  10. Evaluation of Hydraulic Parameters Obtained by Different Measurement Methods for Heterogeneous Gravel Soil

    Directory of Open Access Journals (Sweden)

    Chen Zeng

    2012-01-01

    Full Text Available Knowledge of soil hydraulic parameters for the van Genuchten function is important to characterize soil water movement for watershed management. Accurate and rapid prediction of soil water flow in heterogeneous gravel soil has become a hot topic in recent years. However, it is difficult to precisely estimate hydraulic parameters in a heterogeneous soil with rock fragments. In this study, the HYDRUS-2D numerical model was used to evaluate hydraulic parameters for heterogeneous gravel soil that was irregularly embedded with rock fragments in a grape production base. The centrifugal method (CM, tensiometer method (TM and inverse solution method (ISM were compared for various parameters in the van Genuchten function. The soil core method (SCM, disc infiltration method (DIM and inverse solution method (ISM were also investigated for measuring saturated hydraulic conductivity. Simulation with the DIM approach revealed a problem of overestimating soil water infiltration whereas simulation with the SCM approach revealed a problem of underestimating water movement as compared to actual field observation. The ISM approach produced the best simulation result even though this approach slightly overestimated soil moisture by ignoring the impact of rock fragments. This study provides useful information on the overall evaluation of soil hydraulic parameters attained with different measurement methods for simulating soil water movement and distribution in heterogeneous gravel soil.

  11. Classical vs. evolved quenching parameters and procedures in scintillation measurements: The importance of ionization quenching

    International Nuclear Information System (INIS)

    Bagan, H.; Tarancon, A.; Rauret, G.; Garcia, J.F.

    2008-01-01

    The quenching parameters used to model detection efficiency variations in scintillation measurements have not evolved since the decade of 1970s. Meanwhile, computer capabilities have increased enormously and ionization quenching has appeared in practical measurements using plastic scintillation. This study compares the results obtained in activity quantification by plastic scintillation of 14 C samples that contain colour and ionization quenchers, using classical (SIS, SCR-limited, SCR-non-limited, SIS(ext), SQP(E)) and evolved (MWA-SCR and WDW) parameters and following three calibration approaches: single step, which does not take into account the quenching mechanism; two steps, which takes into account the quenching phenomena; and multivariate calibration. Two-step calibration (ionization followed by colour) yielded the lowest relative errors, which means that each quenching phenomenon must be specifically modelled. In addition, the sample activity was quantified more accurately when the evolved parameters were used. Multivariate calibration-PLS also yielded better results than those obtained using classical parameters, which confirms that the quenching phenomena must be taken into account. The detection limits for each calibration method and each parameter were close to those obtained theoretically using the Currie approach

  12. Measurement of specific parameters for dose calculation after inhalation of aerols containing transuranium elements

    International Nuclear Information System (INIS)

    Ramounet-le Gall, B.; Fritsch, P.; Abram, M.C.; Rateau, G.; Grillon, G.; Guillet, K.; Baude, S.; Berard, P.; Ansoborlo, E.; Delforge, J.

    2002-01-01

    A review on specific parameter measurements to calculate doses per unit of incorporation according to recommendations of the International Commission of Radiological Protection has been performed for inhaled actinide oxides. Alpha activity distribution of the particles can be obtained by autoradiography analysis using aerosol sampling filters at the work places. This allows us to characterize granulometric parameters of 'pure' actinide oxides, but complementary analysis by scanning electron microscopy is needed for complex aerosols. Dissolution parameters with their standard deviation are obtained after rat inhalation exposure, taking into account both mechanical lung clearance and actinide transfer to the blood estimated from bone retention. In vitro experiments suggest that the slow dissolution rate might decrease as a function of time following exposure. Dose calculation software packages have been developed to take into account granulometry and dissolution parameters as well as specific physiological parameters of exposed individuals. In the case of poorly soluble actinide oxides, granulometry and physiology appear as the main parameters controlling dose value, whereas dissolution only alters dose distribution. Validation of these software packages are in progress. (author)

  13. The Virtual Fields Method Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements

    CERN Document Server

    Pierron, Fabrice

    2012-01-01

    The Virtual Fields Method: Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements is the first book on the Virtual Fields Method (VFM), a technique to identify materials mechanical properties from full-field measurements. Firmly rooted with extensive theoretical description of the method, the book presents numerous examples of application to a wide range of materials (composites, metals, welds, biomaterials) and situations (static, vibration, high strain rate). The authors give a detailed training section with examples of progressive difficulty to lead the reader to program the VFM and include a set of commented Matlab programs as well as GUI Matlab-based software for more general situations. The Virtual Fields Method: Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements is an ideal book for researchers, engineers, and students interested in applying the VFM to new situations motivated by their research.  

  14. Experimental Characterization of Ultra-Wideband Channel Parameter Measurements in an Underground Mine

    Directory of Open Access Journals (Sweden)

    B. Nkakanou

    2011-01-01

    Full Text Available Experimental results for an ultra-wideband (UWB channel parameters in an underground mining environment over a frequency range of 3 GHz to 10 GHz are reported. The measurements were taken both in LOS and NLOS cases in two different size mine galleries. In the NLOS case, results were acquired for different corridor obstruction angles. The results were obtained during an extensive measurement campaign in the UWB frequency, and the measurement procedure allows both the large- and small-scale parameters such as the path loss exponent, coherence bandwidth, and so forth, to be quantified. The capacity of the UWB channel as a function of the physical depth of the mine gallery has also been recorded for comparison purposes.

  15. Covariance-Based Estimation from Multisensor Delayed Measurements with Random Parameter Matrices and Correlated Noises

    Directory of Open Access Journals (Sweden)

    R. Caballero-Águila

    2014-01-01

    Full Text Available The optimal least-squares linear estimation problem is addressed for a class of discrete-time multisensor linear stochastic systems subject to randomly delayed measurements with different delay rates. For each sensor, a different binary sequence is used to model the delay process. The measured outputs are perturbed by both random parameter matrices and one-step autocorrelated and cross correlated noises. Using an innovation approach, computationally simple recursive algorithms are obtained for the prediction, filtering, and smoothing problems, without requiring full knowledge of the state-space model generating the signal process, but only the information provided by the delay probabilities and the mean and covariance functions of the processes (signal, random parameter matrices, and noises involved in the observation model. The accuracy of the estimators is measured by their error covariance matrices, which allow us to analyze the estimator performance in a numerical simulation example that illustrates the feasibility of the proposed algorithms.

  16. Critical current density measurement of thin films by AC susceptibility based on the penetration parameter h

    DEFF Research Database (Denmark)

    Li, Xiao-Fen; Grivel, Jean-Claude; Abrahamsen, Asger B.

    2012-01-01

    We have numerically proved that the dependence of AC susceptibility χ of a E(J) power law superconducting thin disc on many parameters can be reduced to one penetration parameter h, with E the electric field and J the current density. Based on this result, we propose a way of measuring the critical...... current density Jc of superconducting thin films by AC susceptibility. Compared with the normally used method based on the peak of the imaginary part, our method uses a much larger range of the AC susceptibility curve, thus allowing determination of the temperature (T) dependence of Jc from a normally...

  17. ATM Quality of Service Parameters at 45 Mbps Using a Satellite Emulator: Laboratory Measurements

    Science.gov (United States)

    Ivancic, William D.; Bobinsky, Eric A.

    1997-01-01

    Results of 45-Mbps DS3 intermediate-frequency loopback measurements of asynchronous transfer mode (ATM) quality of service parameters (cell error ratio and cell loss ratio) are presented. These tests, which were conducted at the NASA Lewis Research Center in support of satellite-ATM interoperability research, represent initial efforts to quantify the minimum parameters for stringent ATM applications, such as MPEG-1 and MPEG-2 video transmission. Portions of these results were originally presented to the International Telecommunications Union's ITU-R Working Party 4B in February 1996 in support of their Draft Preliminary Recommendation on the Transmission of ATM Traffic via Satellite.

  18. Resonance parameters for measured keV neutron capture cross sections

    Energy Technology Data Exchange (ETDEWEB)

    Musgrove, A.R. de L

    1969-05-01

    All available neutron capture cross sections in the keV region ({approx} to 100 keV) have been fitted with resonance parameters. Capture cross sections for nuclides with reasonably well known average s-wave parameters, but no measured cross section, have been calculated and tabulated using p-and d- wave strength functions interpolated between fitted values. Several of these nuclides are of interest in the theory of slow nucleosynthesis of heavy elements in stars, and the product of cosmic abundance (due to the s-process) and capture cross section at 30 keV has been plotted versus mass number. (author)

  19. Measurement of blood flow from an assist ventricle by computation of pneumatic driving parameters.

    Science.gov (United States)

    Qian, K X

    1992-03-01

    The measurement of blood flow from an assist ventricle is important but sometimes difficult in artificial heart experiments. Along with the development of a pneumatic cylinder-piston driver coupled with a ventricular assist device, a simplified method for measuring pump flow was established. From driving parameters such as the piston (or cylinder) displacement and air pressure, the pump flow could be calculated by the use of the equation of state for an ideal gas. The results of this method are broadly in agreement with electromagnetic and Doppler measurements.

  20. Optimal Design of Measurement Programs for the Parameter Identification of Dynamic Systems

    DEFF Research Database (Denmark)

    Kirkegaard, Poul Henning; Sørensen, John Dalsgaard; Brincker, Rune

    The design of measurement programs devoted to parameter identification of structural dynamic systems is considered. The design problem is formulated as an optimization problem to minimize the total expected cost that is the cost of failure and the cost of the measurement program. All...... the calculations are based on a priori knowledge and engineering judgement. One of the contribution of the approach is that the optimal number of sensors can be estimated. This is shown in a numerical example where the proposed approach is demonstrated. The example is concerned with design of a measurement program...

  1. Optimal Design of Measurement Programs for the Parameter Identification of Dynamic Systems

    DEFF Research Database (Denmark)

    Kirkegaard, Poul Henning; Sørensen, John Dalsgaard; Brincker, Rune

    1993-01-01

    The design of a measurement program devoted to parameter identification of structural dynamic systems is considered. The design problem is formulated as an optimization problem to minimize the total expected cost that is the cost of failure and the cost of the measurement program. All...... the calculations are based on a priori knowledge and engineering judgement. One of the contribution of the approach is that the optimal number of sensory can be estimated. This is shown in an numerical example where the proposed approach is demonstrated. The example is concerned with design of a measurement...

  2. Optimal Design of Measurement Programs for the Parameter Identification of Dynamic Systems

    DEFF Research Database (Denmark)

    Kirkegaard, Poul Henning; Sørensen, John Dalsgaard; Brincker, Rune

    1991-01-01

    The design of a measurement program devoted to parameter identification of structural dynamic systems is considered. The design problem is formulated as an optimization problem to minimize the total expected cost, i.e. the cost of failure and the cost of the measurement program. All...... the calculations are based on a priori knowledge and engineering judgement. One of the contributions of the approach is that the optimal number of sensors can be estimated. This is shown in a numerical example where the proposed approach is demonstrated. The example is concerned with design of a measurement...

  3. Neutron Capture and Transmission Measurements and Resonance Parameter Analysis of Niobium

    International Nuclear Information System (INIS)

    NJ Drindak; JA Burke; G Leinweber; JA Helm; JG Hoole; RC Block; Y Danon; RE Slovacek; BE Moretti; CJ Werner; ME Overberg; SA Kolda; MJ Trbovich; DP Barry

    2005-01-01

    Epithermal neutron capture and transmission measurements were performed using the time-of-flight method at the RPI linac using metallic Nb samples. The capture measurements were made at the 25-meter flight station with a 16-section sodium iodide multiplicity detector and the transmission measurements at the 25-meter flight station with a Li-6 glass scintillation detector. Resonance parameters were determined for all resonances up to 500eV with a combined analysis of capture and transmission data using the multi-level R-matrix Bayesian code SAMMY. The present results are compared to those presented in ENDF/B-VI, updated through Release 3

  4. Validity of a smartphone protractor to measure sagittal parameters in adult spinal deformity.

    Science.gov (United States)

    Kunkle, William Aaron; Madden, Michael; Potts, Shannon; Fogelson, Jeremy; Hershman, Stuart

    2017-10-01

    Smartphones have become an integral tool in the daily life of health-care professionals (Franko 2011). Their ease of use and wide availability often make smartphones the first tool surgeons use to perform measurements. This technique has been validated for certain orthopedic pathologies (Shaw 2012; Quek 2014; Milanese 2014; Milani 2014), but never to assess sagittal parameters in adult spinal deformity (ASD). This study was designed to assess the validity, reproducibility, precision, and efficiency of using a smartphone protractor application to measure sagittal parameters commonly measured in ASD assessment and surgical planning. This study aimed to (1) determine the validity of smartphone protractor applications, (2) determine the intra- and interobserver reliability of smartphone protractor applications when used to measure sagittal parameters in ASD, (3) determine the efficiency of using a smartphone protractor application to measure sagittal parameters, and (4) elucidate whether a physician's level of experience impacts the reliability or validity of using a smartphone protractor application to measure sagittal parameters in ASD. An experimental validation study was carried out. Thirty standard 36″ standing lateral radiographs were examined. Three separate measurements were performed using a marker and protractor; then at a separate time point, three separate measurements were performed using a smartphone protractor application for all 30 radiographs. The first 10 radiographs were then re-measured two more times, for a total of three measurements from both the smartphone protractor and marker and protractor. The parameters included lumbar lordosis, pelvic incidence, and pelvic tilt. Three raters performed all measurements-a junior level orthopedic resident, a senior level orthopedic resident, and a fellowship-trained spinal deformity surgeon. All data, including the time to perform the measurements, were recorded, and statistical analysis was performed to

  5. MR flow velocity measurement using 2D phase contrast, assessment of imaging parameters

    International Nuclear Information System (INIS)

    Akata, Soichi; Fukushima, Akihiro; Abe, Kimihiko; Darkanzanli, A.; Gmitro, A.F.; Unger, E.C.; Capp, M.P.

    1999-01-01

    The two-dimensional (2D) phase contrast technique using balanced gradient pulses is utilized to measure flow velocities of cerebrospinal fluid and blood. Various imaging parameters affect the accuracy of flow velocity measurements to varying degrees. Assessment of the errors introduced by changing the imaging parameters are presented and discussed in this paper. A constant flow phantom consisting of a pump, a polyethylene tube and a flow meter was assembled. A clinical 1.5 Tesla MR imager was used to perform flow velocity measurements. The phase contrast technique was used to estimate the flow velocity of saline through the phantom. The effects of changes in matrix size, flip angle, flow compensation, and velocity encoding (VENC) value were tested in the pulse sequence. Gd-DTPA doped saline was used to study the effect of changing T1 on the accuracy of flow velocity measurement. Matrix size (within practical values), flip angle, and flow compensation had minimum impact on flow velocity measurements. T1 of the solution also had no effect on the accuracy of measuring the flow velocity. On the other hand, it was concluded that errors as high as 20% can be expected in the flow velocity measurements if the VENC value is not properly chosen. (author)

  6. MR flow velocity measurement using 2D phase contrast, assessment of imaging parameters

    Energy Technology Data Exchange (ETDEWEB)

    Akata, Soichi; Fukushima, Akihiro; Abe, Kimihiko [Tokyo Medical Coll. (Japan); Darkanzanli, A.; Gmitro, A.F.; Unger, E.C.; Capp, M.P.

    1999-11-01

    The two-dimensional (2D) phase contrast technique using balanced gradient pulses is utilized to measure flow velocities of cerebrospinal fluid and blood. Various imaging parameters affect the accuracy of flow velocity measurements to varying degrees. Assessment of the errors introduced by changing the imaging parameters are presented and discussed in this paper. A constant flow phantom consisting of a pump, a polyethylene tube and a flow meter was assembled. A clinical 1.5 Tesla MR imager was used to perform flow velocity measurements. The phase contrast technique was used to estimate the flow velocity of saline through the phantom. The effects of changes in matrix size, flip angle, flow compensation, and velocity encoding (VENC) value were tested in the pulse sequence. Gd-DTPA doped saline was used to study the effect of changing T1 on the accuracy of flow velocity measurement. Matrix size (within practical values), flip angle, and flow compensation had minimum impact on flow velocity measurements. T1 of the solution also had no effect on the accuracy of measuring the flow velocity. On the other hand, it was concluded that errors as high as 20% can be expected in the flow velocity measurements if the VENC value is not properly chosen. (author)

  7. Airborne-Measured Spatially-Averaged Temperature and Moisture Turbulent Structure Parameters Over a Heterogeneous Surface

    Science.gov (United States)

    Platis, Andreas; Martinez, Daniel; Bange, Jens

    2014-05-01

    Turbulent structure parameters of temperature and humidity can be derived from scintillometer measurements along horizontal paths of several 100 m to several 10 km. These parameters can be very useful to estimate the vertical turbulent heat fluxes at the surface (applying MOST). However, there are many assumptions required by this method which can be checked using in situ data, e.g. 1) Were CT2 and CQ2 correctly derived from the initial CN2 scintillometer data (structure parameter of density fluctuations or refraction index, respectively)? 2) What is the influence of the surround hetereogeneous surface regarding its footprint and the weighted averaging effect of the scintillometer method 3) Does MOST provide the correct turbulent fluxes from scintillometer data. To check these issues, in situ data from low-level flight measurements are well suited, since research aircraft cover horizontal distances in very short time (Taylor's hypothesis of a frozen turbulence structure can be applyed very likely). From airborne-measured time series the spatial series are calculated and then their structure functions that finally provide the structure parameters. The influence of the heterogeneous surface can be controlled by the definition of certain moving-average window sizes. A very useful instrument for this task are UAVs since they can fly very low and maintain altitude very precisely. However, the data base of such unmanned operations is still quite thin. So in this contribution we want to present turbulence data obtained with the Helipod, a turbulence probe hanging below a manned helicopter. The structure parameters of temperature and moisture, CT2 and CQ2, in the lower convective boundary layer were derived from data measured using the Helipod in 2003. The measurements were carried out during the LITFASS03 campaign over a heterogeneous land surface around the boundary-layer field site of the Lindenberg Meteorological Observatory-Richard-Aßmann-Observatory (MOL) of the

  8. Measurement-based perturbation theory and differential equation parameter estimation with applications to satellite gravimetry

    Science.gov (United States)

    Xu, Peiliang

    2018-06-01

    The numerical integration method has been routinely used by major institutions worldwide, for example, NASA Goddard Space Flight Center and German Research Center for Geosciences (GFZ), to produce global gravitational models from satellite tracking measurements of CHAMP and/or GRACE types. Such Earth's gravitational products have found widest possible multidisciplinary applications in Earth Sciences. The method is essentially implemented by solving the differential equations of the partial derivatives of the orbit of a satellite with respect to the unknown harmonic coefficients under the conditions of zero initial values. From the mathematical and statistical point of view, satellite gravimetry from satellite tracking is essentially the problem of estimating unknown parameters in the Newton's nonlinear differential equations from satellite tracking measurements. We prove that zero initial values for the partial derivatives are incorrect mathematically and not permitted physically. The numerical integration method, as currently implemented and used in mathematics and statistics, chemistry and physics, and satellite gravimetry, is groundless, mathematically and physically. Given the Newton's nonlinear governing differential equations of satellite motion with unknown equation parameters and unknown initial conditions, we develop three methods to derive new local solutions around a nominal reference orbit, which are linked to measurements to estimate the unknown corrections to approximate values of the unknown parameters and the unknown initial conditions. Bearing in mind that satellite orbits can now be tracked almost continuously at unprecedented accuracy, we propose the measurement-based perturbation theory and derive global uniformly convergent solutions to the Newton's nonlinear governing differential equations of satellite motion for the next generation of global gravitational models. Since the solutions are global uniformly convergent, theoretically speaking

  9. Online Measurement of LHC Beam Parameters with the ATLAS High Level Trigger

    CERN Document Server

    Strauss, E; The ATLAS collaboration

    2011-01-01

    We present an online measurement of the LHC beam parameters in ATLAS using the High Level Trigger (HLT). When a significant change is detected in the measured beamspot, it is distributed to the HLT. There, trigger algorithms like b-tagging which calculate impact parameters or decay lengths benefit from a precise, up-to-date set of beamspot parameters. Additionally, online feedback is sent to the LHC operators in real time. The measurement is performed by an algorithm running on the Level 2 trigger farm, leveraging the high rate of usable events. Dedicated algorithms perform a full scan of the silicon detector to reconstruct event vertices from registered tracks. The distribution of these vertices is aggregated across the farm and their shape is extracted through fits every 60 seconds to determine the beamspot position, size, and tilt. The reconstructed beam values are corrected for detector resolution effects, measured in situ using the separation of vertices whose tracks have been split into two collections....

  10. Online measurement of LHC beam parameters with the ATLAS High Level Trigger

    CERN Document Server

    Strauss, E; The ATLAS collaboration

    2011-01-01

    We present an online measurement of the LHC beam parameters in ATLAS using the High Level Trigger (HLT). When a significant change is detected in the measured beamspot, it is distributed to the HLT. There, trigger algorithms like b-tagging which calculate impact parameters or decay lengths benefit from a precise,up-to-date set of beamspot parameters. Additionally, online feedback is sent to the LHC operators in real time. The measurement is performed by an algorithm running on the Level 2 trigger farm, leveraging the high rate of usable events. Dedicated algorithms perform a full scan of the silicon detector to reconstruct event vertices from registered tracks. The distribution of these vertices is aggregated across the farm and their shape is extracted through fits every 60 seconds to determine the beamspot position, size, and tilt. The reconstructed beam values are corrected for detector resolution effects, measured in situ using the separation of vertices whose tracks have been split into two collections. ...

  11. Rocket measurements within a polar cap arc: Plasma, particle, and electric circuit parameters

    International Nuclear Information System (INIS)

    Weber, E.J.; Ballenthin, J.O.; Basu, S.; Carlson, H.C.; Hardy, D.A.; Maynard, N.C.; Smiddy, M.; Kelley, M.C.; Fleischman, J.R.; Sheehan, R.E.; Pfaff, R.F.; Rodriguez, P.

    1989-01-01

    An instrumented rocket payload was launched into a polar cap F layer aurora to investigate the energetic particle, plasma, and electric circuit parameters of a Sun-aligned arc. On-board instruments measured energetic electron flux, ion composition and density fluctuations, electron density and temperature, electron density fluctuations, and ac and dc electric fields. Real-time all-sky imaging photometer measurements of the location and motion of the aurora, were used to determine the proper geophysical situation for launch. Comparison of the in situ measurements with remote optical measurements shows that the arc was produced by fluxes of low-energy (< 1 keV) electrons. Field-aligned potentials in the arc inferred from the electron spectra had a maximum value of approximately 300 V, and from the spectral shape a parent population of preaccelerated electrons characteristic of the boundary plasma sheet or magnetosheath was inferred. Electric field components along and across the arc show sunward flow within the arc and duskward drift of the arc consistent with the drift direction and speed determined from optical imaging. Thus this arc is drifting duskward under the influence of the convection electric field. Three possible explanations for this (field-aligned currents, chemistry, and transport) are considered. Finally, ionospheric irregularity and electric field fluctuations indicate two different generation mechanisms on the dawnside and duskside of the arc. On the duskside, parameters are suggestive of an interchange process, while on the dawnside, fluctuation parameters are consistent with a velocity shear instability

  12. Study of b→e channel and measurement of B0-antiB0 mixing parameter with L3 parameter

    International Nuclear Information System (INIS)

    Jezequel, S.

    1992-04-01

    This thesis is based on the analysis of the 1990 and 1991 LEP data taken with the L3 detector. It measures the mixing parameter of the B 0 - anti B 0 system. It consists on the comparison of the relative numbers of dileptons with same signs. After having recalled the theoretical background and previous measurements, it describes precisely the selection of prompt electrons from B hadrons. The muon's one is recalled. Different methods are presented to extract the mixing parameter

  13. Measurement methods and accuracy analysis of Chang'E-5 Panoramic Camera installation parameters

    Science.gov (United States)

    Yan, Wei; Ren, Xin; Liu, Jianjun; Tan, Xu; Wang, Wenrui; Chen, Wangli; Zhang, Xiaoxia; Li, Chunlai

    2016-04-01

    Chang'E-5 (CE-5) is a lunar probe for the third phase of China Lunar Exploration Project (CLEP), whose main scientific objectives are to implement lunar surface sampling and to return the samples back to the Earth. To achieve these goals, investigation of lunar surface topography and geological structure within sampling area seems to be extremely important. The Panoramic Camera (PCAM) is one of the payloads mounted on CE-5 lander. It consists of two optical systems which installed on a camera rotating platform. Optical images of sampling area can be obtained by PCAM in the form of a two-dimensional image and a stereo images pair can be formed by left and right PCAM images. Then lunar terrain can be reconstructed based on photogrammetry. Installation parameters of PCAM with respect to CE-5 lander are critical for the calculation of exterior orientation elements (EO) of PCAM images, which is used for lunar terrain reconstruction. In this paper, types of PCAM installation parameters and coordinate systems involved are defined. Measurement methods combining camera images and optical coordinate observations are studied for this work. Then research contents such as observation program and specific solution methods of installation parameters are introduced. Parametric solution accuracy is analyzed according to observations obtained by PCAM scientifically validated experiment, which is used to test the authenticity of PCAM detection process, ground data processing methods, product quality and so on. Analysis results show that the accuracy of the installation parameters affects the positional accuracy of corresponding image points of PCAM stereo images within 1 pixel. So the measurement methods and parameter accuracy studied in this paper meet the needs of engineering and scientific applications. Keywords: Chang'E-5 Mission; Panoramic Camera; Installation Parameters; Total Station; Coordinate Conversion

  14. Measuring Parameters of Massive Black Hole Binaries with Partially-Aligned Spins

    Science.gov (United States)

    Lang, Ryan N.; Hughes, Scott A.; Cornish, Neil J.

    2010-01-01

    It is important to understand how well the gravitational-wave observatory LISA can measure parameters of massive black hole binaries. It has been shown that including spin precession in the waveform breaks degeneracies and produces smaller expected parameter errors than a simpler, precession-free analysis. However, recent work has shown that gas in binaries can partially align the spins with the orbital angular momentum, thus reducing the precession effect. We show how this degrades the earlier results, producing more pessimistic errors in gaseous mergers. However, we then add higher harmonics to the signal model; these also break degeneracies, but they are not affected by the presence of gas. The harmonics often restore the errors in partially-aligned binaries to the same as, or better than/ those that are obtained for fully precessing binaries with no harmonics. Finally, we investigate what LISA measurements of spin alignment can tell us about the nature of gas around a binary,

  15. A Test-Bench for Measurement of Electrical Static Parameters of Strip Silicon Detectors

    CERN Document Server

    Golutvin, I A; Danilevich, V G; Dmitriev, A Yu; Elsha, V V; Zamiatin, Y I; Zubarev, E V; Ziaziulia, F E; Kozus, V I; Lomako, V M; Stepankov, D V; Khomich, A P; Shumeiko, N M; Cheremuhin, A E

    2003-01-01

    An automated test-bench for electrical parameters input control of the strip silicon detectors, used in the End-Cap Preshower detector of the CMS experiment, is described. The test-bench application allows one to solve a problem of silicon detectors input control in conditions of mass production - 1800 detectors over 2 years. The test-bench software is realized in Delphi environment and contains a user-friendly operator interface for measurement data processing and visualization as well as up-to-date facilities for MS-Windows used for the network database. High operating characteristics and reliability of the test-bench were confirmed while more than 800 detectors were tested. Some technical solutions applied to the test-bench could be useful for design and construction of automated facilities for electrical parameters measurements of the microstrip detectors input control.

  16. Measurements for kinetic parameters estimation in the RA-0 research reactor

    International Nuclear Information System (INIS)

    Gomez, A; Bellino, P A

    2012-01-01

    In the present work, measurements based on the neutron noise technique and the inverse kinetic method were performed to estimate the different kinetic parameters of the reactor in its critical state. By means of the neutron noise technique, we obtained the current calibration factor of the ionization chamber M6 belonging to the power range channels of the reactor instrumentation. The maximum current allowed compatible with the maximum power authorized by the operation license was also obtained. Using the neutron noise technique, the reduced mean reproduction time (Λ*) was estimated. This parameter plays a fundamental role in the deterministic analysis of criticality accidents. Comparison with previous values justified performing new measurements to study systematic trends in the value of Λ*. Using the inverse kinetics method, the reactivity worth of the control rods was estimated, confirming the existence of spatial effects and trends previously observed (author)

  17. Autocorrelation spectra of an air-fluidized granular system measured by NMR

    Science.gov (United States)

    Lasic, S.; Stepisnik, J.; Mohoric, A.; Sersa, I.; Planinsic, G.

    2006-09-01

    A novel insight into the dynamics of a fluidized granular system is given by a nuclear magnetic resonance method that yields the spin-echo attenuation proportional to the spectrum of the grain positional fluctuation. Measurements of the air-fluidized oil-filled spheres and mustard seeds at different degrees of fluidization and grain volume fractions provide the velocity autocorrelation that differs from the commonly anticipated exponential Enskog decay. An empiric formula, which corresponds to the model of grain caging at collisions with adjacent beads, fits well to the experimental data. Its parameters are the characteristic collision time, the free path between collisions and the cage-breaking rate or the diffusion-like constant, which decreases with increasing grain volume fraction. Mean-squared displacements calculated from the correlation spectrum clearly show transitions from ballistic, through sub-diffusion and into diffusion regimes of grain motion.

  18. Uncertainty Reduction Via Parameter Design of A Fast Digital Integrator for Magnetic Field Measurement

    CERN Document Server

    Arpaia, P; Lucariello, G; Spiezia, G

    2007-01-01

    At European Centre of Nuclear Research (CERN), within the new Large Hadron Collider (LHC) project, measurements of magnetic flux with uncertainty of 10 ppm at a few of decades of Hz for several minutes are required. With this aim, a new Fast Digital Integrator (FDI) has been developed in cooperation with University of Sannio, Italy [1]. This paper deals with the final design tuning for achieving target uncertainty by means of experimental statistical parameter design.

  19. Measurement of Secular Motion Frequency in Miniature Paul Trap to Ascertain the Stability Parameters

    International Nuclear Information System (INIS)

    Bin, Guo; Hua, Guan; Qu, Liu; Yao, Huang; Xue-Ren, Huang; Ke-Lin, Gao

    2010-01-01

    40 Ca + ions are trapped and laser cooled in a miniature Paul trap. The secular motion was observed by the radio-frequency resonance of the ion cloud and Zeeman profile sidebands of a single ion experimentally. The trap stability parameters a and q are determined with an uncertainty under 1 % by the secular motion frequency measurement. The trap efficiency is 0.75. A practicable suggestion is given for the benefits of a new trap design. (atomic and molecular physics)

  20. Measurement of hydrogeologic parameters of Indian volcanic rocks by sub-surface hydronuclear techniques

    International Nuclear Information System (INIS)

    Bardhan, M.

    1977-01-01

    Sub-surface hydronuclear techniques namely neutron-neutron, gamma-gamma and tracer dilution logging and single and double well tracer methods were adopted to investigate the hitherto inadequately studied hydrophysical properties of the Deccan lava flows which constitute the principal Indian volcanic suit of rocks. The hydrogeologic parameters measured in the field pertain to hydrostratigraphy, hydrostorage properties and geohydraulic characteristics of these layered hard formations. Results of the studies are presented and discussed briefly. (author)

  1. Precision Beam Parameter Monitoring in a Measurement of the Weak Mixing Angle in Moeller Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Cooke, M.S.

    2005-04-11

    A precision measurement of the parity nonconserving left-right asymmetry, A{sub LR}, in Moeller scattering (e{sup -}e{sup -} {yields} e{sup -}e{sup -}) is currently in progress at the Stanford Linear Accelerator Center (SLAC). This experiment, labeled SLAC-E158, scatters longitudinally polarized electrons off atomic electrons in an unpolarized hydrogen target at a Q{sup 2} of 0.03 (GeV/c){sup 2}. The asymmetry, which is the fractional difference in the scattering cross-sections, measures the effective pseudo-scalar weak neutral current coupling, g{sub ee}, governing Moeller scattering. This quantity is in turn proportional to (1/4 - sin{sup 2} {theta}{sub w}), where {theta}{sub w} is the electroweak mixing angle. The goal is to measure the asymmetry to a precision of 1 x 10{sup -8} which corresponds to {delta}(sin{sup 2} {theta}{sub w}) {approx} 0.0007. Since A{sub LR} is a function of the cross-sections, and the cross-sections depend on the beam parameters, the desired precision of A{sub LR} places stringent requirements on the beam parameters. This paper investigates the requirements on the beam parameters and discusses the means by which they are monitored and accounted for.

  2. Analysis on the Initial Cracking Parameters of Cross-Measure Hydraulic Fracture in Underground Coal Mines

    Directory of Open Access Journals (Sweden)

    Yiyu Lu

    2015-07-01

    Full Text Available Initial cracking pressure and locations are important parameters in conducting cross-measure hydraulic fracturing to enhance coal seam permeability in underground coalmines, which are significantly influenced by in-situ stress and occurrence of coal seam. In this study, stress state around cross-measure fracturing boreholes was analyzed using in-situ stress coordinate transformation, then a mathematical model was developed to evaluate initial cracking parameters of borehole assuming the maximum tensile stress criterion. Subsequently, the influences of in-situ stress and occurrence of coal seams on initial cracking pressure and locations in underground coalmines were analyzed using the proposed model. Finally, the proposed model was verified with field test data. The results suggest that the initial cracking pressure increases with the depth cover and coal seam dip angle. However, it decreases with the increase in azimuth of major principle stress. The results also indicate that the initial cracking locations concentrated in the second and fourth quadrant in polar coordinate, and shifted direction to the strike of coal seam as coal seam dip angle and azimuth of maximum principle stress increase. Field investigation revealed consistent rule with the developed model that the initial cracking pressure increases with the coal seam dip angle. Therefore, the proposed mathematical model provides theoretical insight to analyze the initial cracking parameters during cross-measure hydraulic fracturing for underground coalmines.

  3. Measurement of mixing and CP violation parameters in two-body charm decays

    CERN Document Server

    Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amhis, Y; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Arrabito, L; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Bailey, D S; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Bernet, R; Bettler, M-O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chiapolini, N; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Constantin, F; Contu, A; Cook, A; Coombes, M; Corti, G; Cowan, G A; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Capua, S; De Cian, M; De Lorenzi, F; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Estève, L; Falabella, A; Fanchini, E; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gauvin, N; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Gracianiv Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Haefeli, G; Haen, C; Haines, S C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Knecht, M; Koppenburg, P; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li Gioi, L; Lieng, M; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Malde, S; Mamunur, R M D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Messi, R; Miglioranzi, S; Milanes, D A; Minard, M-N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Musy, M; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Nedos, M; Needham, M; Neufeld, N; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, K; Palacios, J; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Paterson, S K; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petrella, A; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Plackett, R; Playfer, S; Plo Casasus, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Rinnert, K; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Rosello, M; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, A C; Smith, N A; Smith, E; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Topp-Joergensen, S; Torr, N; Tournefier, E; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urquijo, P; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Viaud, B; Videau, I; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Voss, H; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yushchenko, O; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zverev, E; Zvyagin, A

    2012-01-01

    A study of mixing and indirect CP violation in $D^0$ mesons through the determination of the parameters $y_{CP}$ and $A_\\Gamma$ is presented. The parameter $y_{CP}$ is the deviation from unity of the ratio of effective lifetimes measured in $D^0$ decays to the CP eigenstate $K^+K^-$ with respect to decays to the Cabibbo favoured mode $K^-\\pi^+$. The result measured using data collected by LHCb in 2010, corresponding to an integrated luminosity of $29~pb^{-1}$, is $$y_{CP} = (5.5\\pm6.3_{\\rm stat}\\pm4.1_{\\rm syst})\\times 10^{-3}.$$ The parameter $A_\\Gamma$ is the asymmetry of effective lifetimes measured in decays of $D^0$ and $\\overline{D}^0$ mesons to $K^+K^-$. The result is $$A_\\Gamma = (-5.9\\pm5.9_{\\rm stat}\\pm2.1_{\\rm syst})\\times 10^{-3}.$$ A data-driven technique is used to correct for lifetime-biasing effects.

  4. Measurement of the main and critical parameters for optimal laser treatment of heart disease

    Science.gov (United States)

    Kabeya, FB; Abrahamse, H.; Karsten, AE

    2017-10-01

    Laser light is frequently used in the diagnosis and treatment of patients. As in traditional treatments such as medication, bypass surgery, and minimally invasive ways, laser treatment can also fail and present serious side effects. The true reason for laser treatment failure or the side effects thereof, remains unknown. From the literature review conducted, and experimental results generated we conclude that an optimal laser treatment for coronary artery disease (named heart disease) can be obtained if certain critical parameters are correctly measured and understood. These parameters include the laser power, the laser beam profile, the fluence rate, the treatment time, as well as the absorption and scattering coefficients of the target treatment tissue. Therefore, this paper proposes different, accurate methods for the measurement of these critical parameters to determine the optimal laser treatment of heart disease with a minimal risk of side effects. The results from the measurement of absorption and scattering properties can be used in a computer simulation package to predict the fluence rate. The computing technique is a program based on the random number (Monte Carlo) process and probability statistics to track the propagation of photons through a biological tissue.

  5. Current and capacitance measurements as a fast diagnostic tool for evaluation of semiconductor parameters

    CERN Document Server

    Kemmer, J; Krause, N; Krieglmeyer, C; Yang Yi

    2000-01-01

    A fast qualitative method is described for evaluation of semiconductor parameters by analyzing both the capacitance/voltage (C/V) and current/voltage (I/V) characteristics of pn- or Schottky-diodes, which are fabricated on the material under investigation. The method is applied for measurement of recombination and generation lifetimes of minority charge carriers and for determination of doping profiles and distribution of active generation/recombination (G/R) centers after irradiation with Am-alpha particles and deep phosphorus implantation. Measurements on epitaxial silicon result in doping profiles and distributions of active impurities within the epi-layer.

  6. Headphone-To-Ear Transfer Function Estimation Using Measured Acoustic Parameters

    Directory of Open Access Journals (Sweden)

    Jinlin Liu

    2018-06-01

    Full Text Available This paper proposes to use an optimal five-microphone array method to measure the headphone acoustic reflectance and equivalent sound sources needed in the estimation of headphone-to-ear transfer functions (HpTFs. The performance of this method is theoretically analyzed and experimentally investigated. With the measured acoustic parameters HpTFs for different headphones and ear canal area functions are estimated based on a computational acoustic model. The estimation results show that HpTFs vary considerably with headphones and ear canals, which suggests that individualized compensations for HpTFs are necessary for headphones to reproduce desired sounds for different listeners.

  7. Production of Single W Bosons at LEP and Measurement of $WW\\gamma$ Gauge Coupling Parameters

    CERN Document Server

    Achard, P; Aguilar-Benítez, M; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alviggi, M G; Anderhub, H; Andreev, V P; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Bajo, A; Baksay, G; Baksay, L; Baldew, S V; Banerjee, S; Banerjee, Sw; Barczyk, A; Barillère, R; Bartalini, P; Basile, M; Batalova, N; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Bellucci, L; Berbeco, R; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Biasini, M; Biglietti, M; Biland, A; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böhm, A; Boldizsar, L; Borgia, B; Bottai, S; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brochu, F; Burger, J D; Burger, W J; Cai, X D; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada, M; Chamizo-Llatas, M; Chang, Y H; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chiefari, G; Cifarelli, Luisa; Cindolo, F; Clare, I; Clare, R; Coignet, G; Colino, N; Costantini, S; de la Cruz, B; Cucciarelli, S; van Dalen, J A; De Asmundis, R; Déglon, P L; Debreczeni, J; Degré, A; Dehmelt, K; Deiters, K; Della Volpe, D; Delmeire, E; Denes, P; De Notaristefani, F; De Salvo, A; Diemoz, M; Dierckxsens, M; Dionisi, C; Dittmar, Michael; Doria, A; Dova, M T; Duchesneau, D; Echenard, B; Eline, A; El-Mamouni, H; Engler, A; Eppling, F J; Ewers, A; Extermann, Pierre; Falagán, M A; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, Marta; Ferguson, T; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisher, W; Fisk, I; Forconi, G; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gataullin, M; Gentile, S; Giagu, S; Gong, Z F; Grenier, G; Grimm, O; Grünewald, M W; Guida, M; van Gulik, R; Gupta, V K; Gurtu, A; Gutay, L J; Haas, D; Hakobyan, R S; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Hirschfelder, J; Hofer, H; Hohlmann, M; Holzner, G; Hou, S R; Hu, Y; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Käfer, D; Kaur, M; Kienzle-Focacci, M N; Kim, J K; Kirkby, Jasper; Kittel, E W; Klimentov, A; König, A C; Kopal, M; Koutsenko, V F; Kräber, M H; Krämer, R W; Krenz, W; Krüger, A; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Levtchenko, M; Levchenko, P M; Li, C; Likhoded, S A; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lü, Y S; Lübelsmeyer, K; Luci, C; Luminari, L; Lustermann, W; Ma Wen Gan; Malgeri, L; Malinin, A; Maña, C; Mangeol, D J J; Mans, J; Martin, J P; Marzano, F; Mazumdar, K; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Mihul, A; Milcent, H; Mirabelli, G; Mnich, J; Mohanty, G B; Muanza, G S; Muijs, A J M; Musicar, B; Musy, M; Nagy, S; Natale, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Niessen, T; Nisati, A; Nowak, H; Ofierzynski, R A; Organtini, G; Palomares, C; Pandoulas, D; Paolucci, P; Paramatti, R; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Pedace, M; Pensotti, S; Perret-Gallix, D; Petersen, B; Piccolo, D; Pierella, F; Pioppi, M; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Pothier, J; Prokofiev, D O; Prokofev, D; Quartieri, J; Rahal-Callot, G; Rahaman, M A; Raics, P; Raja, N; Ramelli, R; Rancoita, P G; Ranieri, R; Raspereza, A V; Razis, P A; Ren, D; Rescigno, M; Reucroft, S; Riemann, S; Riles, K; Roe, B P; Romero, L; Rosca, A; Rosier-Lees, S; Roth, S; Rosenbleck, C; Roux, B; Rubio, Juan Antonio; Ruggiero, G; Rykaczewski, H; Sakharov, A; Saremi, S; Sarkar, S; Salicio, J; Sánchez, E; Sanders, M P; Schäfer, C; Shchegelskii, V; Schmidt-Kärst, S; Schmitz, D; Schopper, Herwig Franz; Schotanus, D J; Schwering, G; Sciacca, C; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shumilov, E; Shvorob, A V; Siedenburg, T; Son, D; Souga, C; Spillantini, P; Steuer, M; Stickland, D P; Stoyanov, B; Strässner, A; Sudhakar, K; Sultanov, G G; Sun, L Z; Sushkov, S V; Suter, H; Swain, J D; Szillási, Z; Tang, X W; Tarjan, P; Tauscher, Ludwig; Taylor, L; Tellili, B; Teyssier, D; Timmermans, C; Ting, Samuel C C; Ting, S M; Tonwar, S C; Tóth, J; Tully, C; Tung, K L; Ulbricht, J; Valente, E; Van de Walle, R T; Vásquez, R P; Veszpremi, V; Vesztergombi, G; Vetlitskii, I; Vicinanza, D; Viertel, Gert M; Villa, S; Vivargent, M; Vlachos, S; Vodopyanov, I; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Wadhwa, M; Wallraff, W; Wang, X L; Wang, Z M; Weber, M; Wienemann, P; Wilkens, H; Wynhoff, S; Xia, L; Xu, Z Z; Yamamoto, J; Yang, B Z; Yang, C G; Yang, H J; Yang, M; Yeh, S C; Zalite, A; Zalite, Yu; Zhang, Z P; Zhao, J; Zhu, G Y; Zhu, R Y; Zhuang, H L; Zichichi, A; Zimmermann, B; Zöller, M

    2002-01-01

    \\documentclass[12pt,a4paper,dvips]{article} \\begin{document} \\begin{center} {Production of Single W Bosons at LEP and \\\\ Measurement of \\boldmath$\\rm W W \\gamma$ Gauge Coupling Parameters} \\end{center} \\begin{abstract} Single W boson production in electron-positron collisions is studied with the L3 detector at centre-of-mass energies between $192\\mathrm{\\ Ge\\kern -0.1em V}$ and $209\\mathrm{\\ Ge\\kern -0.1em V}$. Events with two acoplanar hadronic jets or a single energetic lepton are selected, and the single W cross section is measured. Combining the results with measurements at lower centre-of-mass energies, the ratio of the measured cross section to the Standard Model expectation is found to be $1.12^{+0.11}_{-0.10}\\pm0.03$. From all single W data, the WW$\\gamma$ gauge coupling parameter $\\kappa_\\gamma$ is measured to be $1.116^{+0.082}_{-0.086}\\pm0.068$. \\end{abstract} \\end{document}

  8. Reconstruction of constitutive parameters in isotropic linear elasticity from noisy full-field measurements

    International Nuclear Information System (INIS)

    Bal, Guillaume; Bellis, Cédric; Imperiale, Sébastien; Monard, François

    2014-01-01

    Within the framework of linear elasticity we assume the availability of internal full-field measurements of the continuum deformations of a non-homogeneous isotropic solid. The aim is the quantitative reconstruction of the associated moduli. A simple gradient system for the sought constitutive parameters is derived algebraically from the momentum equation, whose coefficients are expressed in terms of the measured displacement fields and their spatial derivatives. Direct integration of this system is discussed to finally demonstrate the inexpediency of such an approach when dealing with noisy data. Upon using polluted measurements, an alternative variational formulation is deployed to invert for the physical parameters. Analysis of this latter inversion procedure provides existence and uniqueness results while the reconstruction stability with respect to the measurements is investigated. As the inversion procedure requires differentiating the measurements twice, a numerical differentiation scheme based on an ad hoc regularization then allows an optimally stable reconstruction of the sought moduli. Numerical results are included to illustrate and assess the performance of the overall approach. (paper)

  9. Constraining dark energy with Hubble parameter measurements: an analysis including future redshift-drift observations

    International Nuclear Information System (INIS)

    Guo, Rui-Yun; Zhang, Xin

    2016-01-01

    The nature of dark energy affects the Hubble expansion rate (namely, the expansion history) H(z) by an integral over w(z). However, the usual observables are the luminosity distances or the angular diameter distances, which measure the distance.redshift relation. Actually, the property of dark energy affects the distances (and the growth factor) by a further integration over functions of H(z). Thus, the direct measurements of the Hubble parameter H(z) at different redshifts are of great importance for constraining the properties of dark energy. In this paper, we show how the typical dark energy models, for example, the ΛCDM, wCDM, CPL, and holographic dark energy models, can be constrained by the current direct measurements of H(z) (31 data used in total in this paper, covering the redshift range of z @ element of [0.07, 2.34]). In fact, the future redshift-drift observations (also referred to as the Sandage-Loeb test) can also directly measure H(z) at higher redshifts, covering the range of z @ element of [2, 5]. We thus discuss what role the redshift-drift observations can play in constraining dark energy with the Hubble parameter measurements. We show that the constraints on dark energy can be improved greatly with the H(z) data from only a 10-year observation of redshift drift. (orig.)

  10. Integration of neural networks with fuzzy reasoning for measuring operational parameters in a nuclear reactor

    International Nuclear Information System (INIS)

    Ikonomopoulos, A.; Tsoukalas, L.H.

    1993-01-01

    A novel approach is described for measuring variables with operational significance in a complex system such as a nuclear reactor. The methodology is based on the integration of artificial neural networks with fuzzy reasoning. Neural networks are used to map dynamic time series to a set of user-defined linguistic labels called fuzzy values. The process takes place in a manner analogous to that of measurement. Hence, the entire procedure is referred to as virtual measurement and its software implementation as a virtual measuring device. An optimization algorithm based on information criteria and fuzzy algebra augments the process and assists in the identification of different states of the monitored parameter. The proposed technique is applied for monitoring parameters such as performance, valve position, transient type, and reactivity. The results obtained from the application of the neural network-fuzzy reasoning integration in a high power research reactor clearly demonstrate the excellent tolerance of the virtual measuring device to faulty signals as well as its ability to accommodate noisy inputs

  11. Investigation of metrological parameters of measuring system for small temperature changes

    Directory of Open Access Journals (Sweden)

    Samynina M. G.

    2014-02-01

    Full Text Available Metrological parameters of the non-standard contact device were investigated to characterize its performance in temperature change measurements in the specified temperature range. Several series thermistors with a negative temperature coefficient of resistance connected into a linearization circuit were used as the sensing element of the semiconductor device. Increasing the number of thermistors leads to improved circuitry resolving power and reduced dispersion of this parameter. However, there is the question of optimal ratio of the number of thermistors and implemented temperature resolution, due to the nonlinear resolution dependence of the number of series-connected thermoelements. An example of scheme of four similar thermistors as the primary sensor and of a standard measuring instrument, which is working in ohmmeter mode, shows the ability to measure temperature changes at the level of hundredth of a Celsius degree. In this case, a quantization error, which is determined by a resolution of the measuring system, and the ohmmeter accuracy make the main contribution to the overall accuracy of measuring small temperature changes.

  12. Automated egg grading system using computer vision: Investigation on weight measure versus shape parameters

    Science.gov (United States)

    Nasir, Ahmad Fakhri Ab; Suhaila Sabarudin, Siti; Majeed, Anwar P. P. Abdul; Ghani, Ahmad Shahrizan Abdul

    2018-04-01

    Chicken egg is a source of food of high demand by humans. Human operators cannot work perfectly and continuously when conducting egg grading. Instead of an egg grading system using weight measure, an automatic system for egg grading using computer vision (using egg shape parameter) can be used to improve the productivity of egg grading. However, early hypothesis has indicated that more number of egg classes will change when using egg shape parameter compared with using weight measure. This paper presents the comparison of egg classification by the two above-mentioned methods. Firstly, 120 images of chicken eggs of various grades (A–D) produced in Malaysia are captured. Then, the egg images are processed using image pre-processing techniques, such as image cropping, smoothing and segmentation. Thereafter, eight egg shape features, including area, major axis length, minor axis length, volume, diameter and perimeter, are extracted. Lastly, feature selection (information gain ratio) and feature extraction (principal component analysis) are performed using k-nearest neighbour classifier in the classification process. Two methods, namely, supervised learning (using weight measure as graded by egg supplier) and unsupervised learning (using egg shape parameters as graded by ourselves), are conducted to execute the experiment. Clustering results reveal many changes in egg classes after performing shape-based grading. On average, the best recognition results using shape-based grading label is 94.16% while using weight-based label is 44.17%. As conclusion, automated egg grading system using computer vision is better by implementing shape-based features since it uses image meanwhile the weight parameter is more suitable by using weight grading system.

  13. UPTF test instrumentation. Measurement system identification, engineering units and computed parameters

    International Nuclear Information System (INIS)

    Sarkar, J.; Liebert, J.; Laeufer, R.

    1992-11-01

    This updated version of the previous report /1/ contains, besides additional instrumentation needed for 2D/3D Programme, the supplementary instrumentation in the inlet plenum of SG simulator and hot and cold leg of broken loop, the cold leg of intact loops and the upper plenum to meet the requirements (Test Phase A) of the UPTF Programme, TRAM, sponsored by the Federal Minister of Research and Technology (BMFT) of the Federal Republic of Germany. For understanding, the derivation and the description of the identification codes for the entire conventional and advanced measurement systems classifying the function, and the equipment unit, key, as adopted in the conventional power plants, have been included. Amendments have also been made to the appendices. In particular, the list of measurement systems covering the measurement identification code, instrument, measured quantity, measuring range, band width, uncertainty and sensor location has been updated and extended to include the supplementary instrumentation. Beyond these amendments, the uncertainties of measurements have been precisely specified. The measurement identification codes which also stand for the identification of the corresponding measured quantities in engineering units and the identification codes derived therefrom for the computed parameters have been adequately detailed. (orig.)

  14. Selection of entropy-measure parameters for knowledge discovery in heart rate variability data.

    Science.gov (United States)

    Mayer, Christopher C; Bachler, Martin; Hörtenhuber, Matthias; Stocker, Christof; Holzinger, Andreas; Wassertheurer, Siegfried

    2014-01-01

    Heart rate variability is the variation of the time interval between consecutive heartbeats. Entropy is a commonly used tool to describe the regularity of data sets. Entropy functions are defined using multiple parameters, the selection of which is controversial and depends on the intended purpose. This study describes the results of tests conducted to support parameter selection, towards the goal of enabling further biomarker discovery. This study deals with approximate, sample, fuzzy, and fuzzy measure entropies. All data were obtained from PhysioNet, a free-access, on-line archive of physiological signals, and represent various medical conditions. Five tests were defined and conducted to examine the influence of: varying the threshold value r (as multiples of the sample standard deviation σ, or the entropy-maximizing rChon), the data length N, the weighting factors n for fuzzy and fuzzy measure entropies, and the thresholds rF and rL for fuzzy measure entropy. The results were tested for normality using Lilliefors' composite goodness-of-fit test. Consequently, the p-value was calculated with either a two sample t-test or a Wilcoxon rank sum test. The first test shows a cross-over of entropy values with regard to a change of r. Thus, a clear statement that a higher entropy corresponds to a high irregularity is not possible, but is rather an indicator of differences in regularity. N should be at least 200 data points for r = 0.2 σ and should even exceed a length of 1000 for r = rChon. The results for the weighting parameters n for the fuzzy membership function show different behavior when coupled with different r values, therefore the weighting parameters have been chosen independently for the different threshold values. The tests concerning rF and rL showed that there is no optimal choice, but r = rF = rL is reasonable with r = rChon or r = 0.2σ. Some of the tests showed a dependency of the test significance on the data at hand. Nevertheless, as the medical

  15. Choice of primary transducers of beam parameters for measuring and control systems of charged particle accelerators

    International Nuclear Information System (INIS)

    Rybin, V.M.

    1981-01-01

    Investigations on classification of primary transducers (pT) of the main parameters of charged particle beams are conducted for development of the common series on the base of program- controlled module systems for measuring the parameters of charged particle beams. The PT classification is exercised by: the physical principle of single transformation, the degree of effect on the beam, principle of operation, design, performance, location. It is shown that the optimal choice of PT and their parameters should be necessarily executed in several stages: estimation of the limiting possibilities of PT; choice of PT by time and metrological characteristics as well as sensitivity for the determined operation conditions; choice of the PT by the degree of effect on the beam: choice of the PT type with account of its design performance and location, determination of PT parameters with account of possibility of information, energy and design compatibility of the used standard. The classification results of magnetoinduction and acoustic transducers have shown that the number of their modifications does not exceed 100 [ru

  16. Inversion of GPS-measured coseismic displacements for source parameters of Taiwan earthquake

    Science.gov (United States)

    Lin, J. T.; Chang, W. L.; Hung, H. K.; Yu, W. C.

    2016-12-01

    We performed a method of determining earthquake location, focal mechanism, and centroid moment tensor by coseismic surface displacements from daily and high-rate GPS measurements. Unlike commonly used dislocation model where fault geometry is calculated nonlinearly, our method makes a point source approach to evaluate these parameters in a solid and efficient way without a priori fault information and can thus provide constrains to subsequent finite source modeling of fault slip. In this study, we focus on the resolving ability of GPS data for moderate (Mw=6.0 7.0) earthquakes in Taiwan, and four earthquakes were investigated in detail: the March 27 2013 Nantou (Mw=6.0), the June 2 2013 Nantou (Mw=6.3) , the October 31 2013 Ruisui (Mw=6.3), and the March 31 2002 Hualien (ML=6.8) earthquakes. All these events were recorded by the Taiwan continuous GPS network with data sampling rates of 30-second and 1 Hz, where the Mw6.3 Ruisui earthquake was additionally recorded by another local GPS network with a sampling rate of 20 Hz. Our inverted focal mechanisms of all these earthquakes are consistent with the results of GCMT and USGS that evaluates source parameters by dynamic information from seismic waves. We also successfully resolved source parameters of the Mw6.3 Ruisui earthquake within only 10 seconds following the earthquake occurrence, demonstrating the potential of high-rate GPS data on earthquake early warning and real-time determination of earthquake source parameters.

  17. A measurement of the resonance parameters of the neutral intermediate vector boson

    International Nuclear Information System (INIS)

    Nash, J.A.

    1990-01-01

    This thesis presents a measurement of the Z 0 Boson resonance parameters. The measurement was performed at the Stanford Linear Collider using the Mark II detector. Based on a sample of 480 Hadronic and Leptonic decays, the mass is found to be 91.14 ± 0.12 GeV/c 2 , the total width is 2.42 -0.35 +0.45 GeV, and the peak cross section for all Hadronic events, and for Muon and Tau events with cosθ Thrust < 0. 65 is 45 ± 4 nb. By constraining the visible width to the Standard Model value for 5 quarks and 3 charged leptons, and allowing the invisible width to be a parameter, the width to invisible decay modes is found to be 0.46 ± 0.10 GeV. Assuming this width comes from massless neutrinos, this measurement corresponds to 2.8 ± 0.6 neutrino species. This measurement sets an upper limit of 3.9 neutrino generations at the 95% confidence level, ruling out a fourth generation of Standard Model neutrinos at this level. 54 refs., 65 figs., 11 tabs

  18. Measurements of Dune Parameters on Titan Suggest Differences in Sand Availability

    Science.gov (United States)

    Stewart, Brigitte W.; Radebaugh, Jani

    2014-11-01

    The equatorial region of Saturn’s moon Titan has five large sand seas with dunes similar to large linear dunes on Earth. Cassini Radar SAR swaths have high enough resolution (300 m) to measure dune parameters such as width and spacing, which helps inform us about formation conditions and long-term evolution of the sand dunes. Previous measurements in locations scattered across Titan have revealed an average width of 1.3 km and spacing of 2.7 km, with variations by location. We have taken over 1200 new measurements of dune width and spacing in the T8 swath, a region on the leading hemisphere of Titan in the Belet Sand Sea, between -5 and -9 degrees latitude. We have also taken over 500 measurements in the T44 swath, located on the anti-Saturn hemisphere in the Shangri-La Sand Sea, between 0 and 20 degrees latitude. We correlated each group of 50 measurements with the average distance from the edge of the dune field to obtain an estimate of how position within a dune field affects dune parameters. We found that in general, the width and spacing of dunes decreases with distance from the edge of the dune field, consistent with similar measurements in sand seas on Earth. We suggest that this correlation is due to the lesser availability of sand at the edges of dune fields. These measurements and correlations could be helpful in determining differences in sand availability across different dune fields, and along the entire equatorial region of Titan.

  19. On measurement of the acoustic nonlinearity parameter using the finite amplitude insertion substitution (FAIS) technique

    Science.gov (United States)

    Zeqiri, Bajram; Cook, Ashley; Rétat, Lise; Civale, John; ter Haar, Gail

    2015-04-01

    The acoustic nonlinearity parameter, B/A, is an important parameter which defines the way a propagating finite amplitude acoustic wave progressively distorts when travelling through any medium. One measurement technique used to determine its value is the finite amplitude insertion substitution (FAIS) method which has been applied to a range of liquid, tissue and tissue-like media. Importantly, in terms of the achievable measurement uncertainties, it is a relative technique. This paper presents a detailed study of the method, employing a number of novel features. The first of these is the use of a large area membrane hydrophone (30 mm aperture) which is used to record the plane-wave component of the acoustic field. This reduces the influence of diffraction on measurements, enabling studies to be carried out within the transducer near-field, with the interrogating transducer, test cell and detector positioned close to one another, an attribute which assists in controlling errors arising from nonlinear distortion in any intervening water path. The second feature is the development of a model which estimates the influence of finite-amplitude distortion as the acoustic wave travels from the rear surface of the test cell to the detector. It is demonstrated that this can lead to a significant systematic error in B/A measurement whose magnitude and direction depends on the acoustic property contrast between the test material and the water-filled equivalent cell. Good qualitative agreement between the model and experiment is reported. B/A measurements are reported undertaken at (20 ± 0.5) °C for two fluids commonly employed as reference materials within the technical literature: Corn Oil and Ethylene Glycol. Samples of an IEC standardised agar-based tissue-mimicking material were also measured. A systematic assessment of measurement uncertainties is presented giving expanded uncertainties in the range ±7% to ±14%, expressed at a confidence level close to 95

  20. Measurements of Physical Parameters of White Dwarfs: A Test of the Mass–Radius Relation

    Energy Technology Data Exchange (ETDEWEB)

    Bédard, A.; Bergeron, P.; Fontaine, G., E-mail: bedard@astro.umontreal.ca, E-mail: bergeron@astro.umontreal.ca, E-mail: fontaine@astro.umontreal.ca [Département de Physique, Université de Montréal, C.P. 6128, Succ. Centre-Ville, Montréal, Québec H3C 3J7 (Canada)

    2017-10-10

    We present a detailed spectroscopic and photometric analysis of 219 DA and DB white dwarfs for which trigonometric parallax measurements are available. Our aim is to compare the physical parameters derived from the spectroscopic and photometric techniques, and then to test the theoretical mass–radius relation for white dwarfs using these results. The agreement between spectroscopic and photometric parameters is found to be excellent, especially for effective temperatures, showing that our model atmospheres and fitting procedures provide an accurate, internally consistent analysis. The values of surface gravity and solid angle obtained, respectively, from spectroscopy and photometry, are combined with parallax measurements in various ways to study the validity of the mass–radius relation from an empirical point of view. After a thorough examination of our results, we find that 73% and 92% of the white dwarfs are consistent within 1 σ and 2 σ confidence levels, respectively, with the predictions of the mass–radius relation, thus providing strong support to the theory of stellar degeneracy. Our analysis also allows us to identify 15 stars that are better interpreted in terms of unresolved double degenerate binaries. Atmospheric parameters for both components in these binary systems are obtained using a novel approach. We further identify a few white dwarfs that are possibly composed of an iron core rather than a carbon/oxygen core, since they are consistent with Fe-core evolutionary models.

  1. Online measurement for geometrical parameters of wheel set based on structure light and CUDA parallel processing

    Science.gov (United States)

    Wu, Kaihua; Shao, Zhencheng; Chen, Nian; Wang, Wenjie

    2018-01-01

    The wearing degree of the wheel set tread is one of the main factors that influence the safety and stability of running train. Geometrical parameters mainly include flange thickness and flange height. Line structure laser light was projected on the wheel tread surface. The geometrical parameters can be deduced from the profile image. An online image acquisition system was designed based on asynchronous reset of CCD and CUDA parallel processing unit. The image acquisition was fulfilled by hardware interrupt mode. A high efficiency parallel segmentation algorithm based on CUDA was proposed. The algorithm firstly divides the image into smaller squares, and extracts the squares of the target by fusion of k_means and STING clustering image segmentation algorithm. Segmentation time is less than 0.97ms. A considerable acceleration ratio compared with the CPU serial calculation was obtained, which greatly improved the real-time image processing capacity. When wheel set was running in a limited speed, the system placed alone railway line can measure the geometrical parameters automatically. The maximum measuring speed is 120km/h.

  2. Offline analysis in SNLS: measurement of type-Ia supernovae explosion rate and cosmological parameters

    International Nuclear Information System (INIS)

    Lusset, Vincent

    2006-01-01

    The Supernova Legacy Survey is a second generation experiment for the measurement of cosmological parameters using type-la supernovae. Il follows the discovery of the acceleration of the expansion of the Universe, attributed to an unknown 'dark energy'. This thesis presents a type-la supernovae search using an offline analysis of SNLS data. It makes it possible to detect the supernovae that were missed online and to study possible selection biases. One of its principal characteristics is that it uses entirely automatic selection criteria. This type of automated offline analysis had never been carried out before for data reaching this redshift. This analysis enabled us to discover 73 additional SNIa candidates compared to those identified in the real time analysis on the same data, representing an increase of more than 50% of the number of supernovae. The final Hubble diagram contains 262 SNIa which gives us, for a flat ACDM model, the following values for the cosmological parameters: Ω_M = 0,31 ± 0,028 (stat) ± 0,036 (syst) et Ω_A = 0,69. This offline analysis of SNLS data opens new horizons, both by checking for possible biases in current measurements of cosmological parameters by supernovae experiments and by preparing the third generation experiments, on the ground or in space, which will detect thousands of SNIa. (author) [fr

  3. Measurements of the Z boson resonance parameters at SLC [SLAC Linear Collider

    International Nuclear Information System (INIS)

    Hearty, C.

    1989-07-01

    This paper presents the measurement by the Mark II experiment at the SLAC Linear Collider of the parameters of the Z boson resonance. The results are updated from those presented at the SLAC Summer Institute to include all data presented in the most recent Mark II publication, consisting of 19 nb -1 of data at ten different center-of-mass energies between 89.2 and 93.0 GeV. The resonance parameters are extracted by measuring the Z production cross section at a series of center-of-mass energies (scan points) near the Z peak, then fitting these data with the theoretical cross section. The four major aspects of the analysis are the determination at each scan point of the center-of-mass energy (E), the integrated luminosity, the number of Z decays and the expected cross section as a function of the resonance parameters, such as mass and width. I will discuss each of these steps in turn, after a brief description of the Mark II detector, then conclude with the results of the analysis. 7 refs., 9 figs., 3 tabs

  4. Measurement techniques of local parameters in the downcomer boiling experiment of APR1400

    International Nuclear Information System (INIS)

    Lee, Eu Hwak

    2004-02-01

    In order to investigate boiling phenomena experimentally in the downcomer during LBLOCA with Direct Vessel Injection (DVI), which is a new Safety Injection System (SIS) of Advanced Power Reactor 1400 MW (APR1400), several parameters should be measured through the verification of their applicability. In this study, measurement techniques of the parameters are developed for the downcomer boiling experiment; local phase velocities, local void fraction and heat flux from the heated wall. The experiment has been performed with the heated wall, which has a thickness of 8.2 cm and a height of 32.5 cm and made of the same material as the prototype (APR1400) with chrome coating against rusting. The newly developed pitot tube is applied to the measurement of local liquid velocity and its calibration curve is obtained experimentally with the consideration of the effect according to water temperature and hole size changes. The developed pitot tube measures the local liquid velocity with 0.69 % deviation and it is confirmed that the water temperature and geometrical change does not affect the calibration curve. The high-speed camera and commercial software are used to measure the local vapor velocity with the accuracy of 0.06 m/sec per pixel and the procedure is confirmed in the present study. It turns out that the vapor velocity is insensitive to void size. High-speed camera and image processing are used to measure the local void fraction with the determined intensity criterion for distinguishing each phase and the results are compared with the bulk void fraction by differential pressure transmitters. In the actual experiment, the developed method is applied successfully and the results show that the criterion of intensity has little effect on local void fraction. And, it is observed that the tendency between the measured local and bulk void faction is maintained with time. In order to measure heat flux from the heated wall, two heat flux measurement techniques are developed

  5. Scintillator-CCD camera system light output response to dosimetry parameters for proton beam range measurement

    Energy Technology Data Exchange (ETDEWEB)

    Daftari, Inder K., E-mail: idaftari@radonc.ucsf.edu [Department of Radiation Oncology, 1600 Divisadero Street, Suite H1031, University of California-San Francisco, San Francisco, CA 94143 (United States); Castaneda, Carlos M.; Essert, Timothy [Crocker Nuclear Laboratory,1 Shields Avenue, University of California-Davis, Davis, CA 95616 (United States); Phillips, Theodore L.; Mishra, Kavita K. [Department of Radiation Oncology, 1600 Divisadero Street, Suite H1031, University of California-San Francisco, San Francisco, CA 94143 (United States)

    2012-09-11

    The purpose of this study is to investigate the luminescence light output response in a plastic scintillator irradiated by a 67.5 MeV proton beam using various dosimetry parameters. The relationship of the visible scintillator light with the beam current or dose rate, aperture size and the thickness of water in the water-column was studied. The images captured on a CCD camera system were used to determine optimal dosimetry parameters for measuring the range of a clinical proton beam. The method was developed as a simple quality assurance tool to measure the range of the proton beam and compare it to (a) measurements using two segmented ionization chambers and water column between them, and (b) with an ionization chamber (IC-18) measurements in water. We used a block of plastic scintillator that measured 5 Multiplication-Sign 5 Multiplication-Sign 5 cm{sup 3} to record visible light generated by a 67.5 MeV proton beam. A high-definition digital video camera Moticam 2300 connected to a PC via USB 2.0 communication channel was used to record images of scintillation luminescence. The brightness of the visible light was measured while changing beam current and aperture size. The results were analyzed to obtain the range and were compared with the Bragg peak measurements with an ionization chamber. The luminescence light from the scintillator increased linearly with the increase of proton beam current. The light output also increased linearly with aperture size. The relationship between the proton range in the scintillator and the thickness of the water column showed good linearity with a precision of 0.33 mm (SD) in proton range measurement. For the 67.5 MeV proton beam utilized, the optimal parameters for scintillator light output response were found to be 15 nA (16 Gy/min) and an aperture size of 15 mm with image integration time of 100 ms. The Bragg peak depth brightness distribution was compared with the depth dose distribution from ionization chamber measurements

  6. Measurement of dosimetric parameters and dose verification in stereotactic radiosurgery (SRS)

    International Nuclear Information System (INIS)

    Reduan Abdullah; Nik Ruzman Nik Idris; Ahmad Lutfi Yusof; Mazurawati Mohamed

    2013-01-01

    Full-text: The purpose of this study was to measure the dosimetric parameters for small photon beams to be used as input data treatment planning computer system (TPS) and to verify dose calculated by TPS in Stereotactic Radiosurgery (SRS) procedure. The beam data required were Percentage Depth Dose (PDD), Off-axis Ratio (OAR), and Scatter Factor of Relative Output Factor. Small beams of 5 mm to 45 mm diameter circular cone collimators used in SRS were utilized for beam data measurements measured using pinpoint 3D ionization chamber (0.016 cc). For second part of this study, we reported the important quality assurance (QA) procedures before SRS treatment that influenced the dose delivery. These QA procedures consist of measurements on the accuracy in target localization and room laser alignment. The dose calculated to be delivered for treatment was verified using pinpoint 3D ionization chamber and TLD 100H. The mean deviation of measured dose using TLD 100H compared to calculated dose was 3.37 %. Beside that, pinpoint ionization 3D chamber give more accurate results of dose compared to TLD 100H. The measured dose using pinpoint 3D ionization chamber are good agreement with calculated dose by TPS with deviation of 2.17 %. The results are acceptable such as recommended by International Commission on Radiation Units and Measurements (ICRU) Report No. 50 (1993) that dose delivered to the target volume must be within ±5 % error. (author)

  7. The internal strain parameter of gallium arsenide measured by energy-dispersive X-ray diffraction

    International Nuclear Information System (INIS)

    Cousins, C.S.G.; Sheldon, B.J.; Webster, G.E.; Gerward, L.; Selsmark, B.; Staun Olsen, J.

    1989-01-01

    The internal strain parameter of GaAs has been measured by observing the stress-dependence of the integrated intensity of the weak 006 reflection, with the compressive stress along the [1anti 10] axis. An energy-dispersive technique was employed so that the reflection could be obtained at a photon energy close to the minimum in the structure factor, thereby approaching closely the strictly-forbidden condition that applies at any energy in the diamond structure. A value anti A=-0.138±0.005, equivalent to a bond-bending parameter ζ=0.55=0.02, has been found. This is in good agreement with recent theoretical calculations and indirect determinations related to the bandstructure of GaAs. (orig.)

  8. 1H CSA parameters by ultrafast MAS NMR: Measurement and applications to structure refinement.

    Science.gov (United States)

    Miah, Habeeba K; Cresswell, Rosalie; Iuga, Dinu; Titman, Jeremy J

    2017-10-01

    A 1 H anisotropic-isotropic chemical shift correlation experiment which employs symmetry-based recoupling sequences to reintroduce the chemical shift anisotropy in ν 1 and ultrafast MAS to resolve 1 H sites in ν 2 is described. This experiment is used to measure 1 H shift parameters for L-ascorbic acid, a compound with a relatively complex hydrogen-bonding network in the solid. The 1 H CSAs of hydrogen-bonded sites with resolved isotropic shifts can be extracted directly from the recoupled lineshapes. In combination with DFT calculations, hydrogen positions in crystal structures obtained from X-ray and neutron diffraction are refined by comparison with simulations of the full two-dimensional NMR spectrum. The improved resolution afforded by the second dimension allows even unresolved hydrogen-bonded sites 1 H to be assigned and their shift parameters to be obtained. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Parameter Estimation of Inverter and Motor Model at Standstill using Measured Currents Only

    DEFF Research Database (Denmark)

    Rasmussen, Henrik; Knudsen, Morten; Tønnes, M.

    1996-01-01

    Methods for estimation of the parameters in the electrical equivalent diagram for the induction motor, based on special designed experiments, are given. In all experriments two of the three phases are given the same potential, i.e., no net torque is generatedand the motor is at standstill. Input...... and 3) the referred rotor rotor resistance and magnetizing inductance. The method developed in the two last experiments is independent of the inverter nonlinearity. New methods for system identification concerning saturation of the magnetic flux are given and a reference value for the flux level...... to the system is the reference values for the stator voltages given as duty cycles for the Pulse With Modulated power device. The system output is the measured stator currents. Three experiments are describedgiving respectively 1) the stator resistance and inverter parameters, 2) the stator transient inductance...

  10. Measurement of performance parameters of plasma source for plasma opening switch on Qiangguang-Ⅰ generator

    International Nuclear Information System (INIS)

    Luo Weixi; Zeng Zhengzhong; Lei Tianshi; Wang Liangping; Hu Yixiang; Sun Tieping; Huang Tao

    2012-01-01

    The plasma source (cable guns) of the plasma opening switch (POS) on Qiangguang Ⅰ generator was chosen as the study object. The plasma source performance was investigated by using charge collectors. Experimental results show that the plasma ejection density is positively correlated with the structural parameter, the distance between gun core tip and muzzle plane, and the plasma ejection velocity is negatively correlated with the parameter. The increasing rate of plasma ejection density is less than that of drive current. As far as a plasma source with tens of cable plasma guns is concerned, the influence of single cable gun's discharge dispersancy on plasma uniformity is little. Analysis of uncertainty shows that the uncertainty of measurement can be reduced by increasing the number of experiments and averaging the results. The combined standard uncertainty of plasma ejection density is less than 10%. (authors)

  11. A test-bench for measurement of electrical static parameters of strip silicon detectors

    International Nuclear Information System (INIS)

    Golutvin, I.A.; Dmitriev, A.Yu.; Elsha, V.V.

    2003-01-01

    An automated test-bench for electrical parameters input control of the strip silicon detectors, used in the End-Cap Preshower detector of the CMS experiment, is described. The test-bench application allows one to solve a problem of silicon detectors input control in conditions of mass production - 1800 detectors over 2 years. The test-bench software is realized in Delphi environment and contains a user-friendly operator interface for data processing and visualization as well as up-to-date facilities for MS-Windows used for the network database. High operating characteristics and reliability of the test-bench were confirmed while more than 800 detectors were tested. Some technical solutions applied to the test-bench could be useful for design and construction of automated facilities for electrical parameters measurements of the microstrip detectors input control. (author)

  12. Precision measurement of charged kaon decay parameters with an extended NA48 setup

    CERN Multimedia

    De beer, M; Celeghini, E; Bazylev, S; Falaleev, V; Peyaud, B; Bendel, M; Kekelidze, V; Potrebenikov, Y; Ceccucci, A; Behler, M; Madigozhin, D

    2002-01-01

    A high statistics study of charged kaon decays is proposed using a novel design for simultaneous $K^+/K^-$ beams, and NA48 setup upgraded with a transition radiation detector. The main goal is to measure CP-violating asymmetry in $K^{\\pm}\\rightarrow \\pi^+ \\pi^- \\pi^{\\pm}$ decays with an accuracy of $2.2 \\times 10^{-4}$. In addition CP-violating asymmetry will be measured in $K^{\\pm}\\rightarrow \\pi^0 \\pi^0 \\pi^{\\pm}$ decays, more than $10^6$ of $K_{e4}$ decays will be accumulated which allow to measure a scattering length parameter $a^0_0$ with an accuracy better than 0.01, and some other rare decays will be studied as well.

  13. Retrieval of cloud droplet size distribution parameters from polarized reflectance measurements

    Directory of Open Access Journals (Sweden)

    M. Alexandrov

    2011-09-01

    Full Text Available We present an algorithm for retrieval of cloud droplet size distribution parameters (effective radius and variance from the Research Scanning Polarimeter (RSP measurements. The RSP is an airborne prototype for the Aerosol Polarimetery Sensor (APS, which is due to be launched as part of the NASA Glory Project. This instrument measures both polarized and total reflectances in 9 spectral channels with center wavelengths ranging from 410 to 2250 nm. For cloud droplet size retrievals we utilize the polarized reflectances in the scattering angle range between 140 and 170 degrees where they exhibit rainbow. The shape of the rainbow is determined mainly by single-scattering properties of the cloud particles, that simplifies the inversions and reduces retrieval uncertainties. The retrieval algorithm was tested using realistically simulated cloud radiation fields. Our retrievals of cloud droplet sizes from actual RSP measurements made during two recent field campaigns were compared with the correlative in situ observations.

  14. Measurement of key pool boiling parameters in nanofluids for nuclear applications

    International Nuclear Information System (INIS)

    Bang, In Cheol; Buongiorno, Jacopo; Hu, Lin-Wen; Wang, Hsin

    2007-01-01

    Nanofluids, colloidal dispersions of nanoparticles in a base fluid such as water, can afford very significant Critical Heat Flux (CHF) enhancement. Such engineered fluids potentially could be employed in reactors as advanced coolants in safety systems with significant safety and economic advantages. However, a satisfactory explanation of the CHF enhancement mechanism in nanofluids is lacking. To close this gap, we have identified the important boiling parameters to be measured and have deployed a pool boiling facility to measure them. The facility is equipped with a thin indium-tin-oxide heater deposited over a sapphire substrate. An intra-red high-speed camera and an optical probe are used to measure the temperature distribution on the heater and the hydrodynamics above the heater, respectively. The first data generated with this facility already provide some clue on the CHF enhancement mechanism in nanofluids. (author)

  15. Hybrid method for determining the parameters of condenser microphones from measured membrane velocities and numerical calculations

    DEFF Research Database (Denmark)

    Barrera Figueroa, Salvador; Rasmussen, Knud; Jacobsen, Finn

    2009-01-01

    to this problem is to measure the velocity distribution of the membrane by means of a non-contact method, such as laser vibrometry. The measured velocity distribution can be used together with a numerical formulation such as the boundary element method for estimating the microphone response and other parameters......, e.g., the acoustic center. In this work, such a hybrid method is presented and examined. The velocity distributions of a number of condenser microphones have been determined using a laser vibrometer, and these measured velocity distributions have been used for estimating microphone responses......Typically, numerical calculations of the pressure, free-field, and random-incidence response of a condenser microphone are carried out on the basis of an assumed displacement distribution of the diaphragm of the microphone; the conventional assumption is that the displacement follows a Bessel...

  16. Low-field NMR logging sensor for measuring hydraulic parameters of model soils

    Science.gov (United States)

    Sucre, Oscar; Pohlmeier, Andreas; Minière, Adrien; Blümich, Bernhard

    2011-08-01

    SummaryKnowing the exact hydraulic parameters of soils is very important for improving water management in agriculture and for the refinement of climate models. Up to now, however, the investigation of such parameters has required applying two techniques simultaneously which is time-consuming and invasive. Thus, the objective of this current study is to present only one technique, i.e., a new non-invasive method to measure hydraulic parameters of model soils by using low-field nuclear magnetic resonance (NMR). Hereby, two model clay or sandy soils were respectively filled in a 2 m-long acetate column having an integrated PVC tube. After the soils were completely saturated with water, a low-field NMR sensor was moved up and down in the PVC tube to quantitatively measure along the whole column the initial water content of each soil sample. Thereafter, both columns were allowed to drain. Meanwhile, the NMR sensor was set at a certain depth to measure the water content of that soil slice. Once the hydraulic equilibrium was reached in each of the two columns, a final moisture profile was taken along the whole column. Three curves were subsequently generated accordingly: (1) the initial moisture profile, (2) the evolution curve of the moisture depletion at that particular depth, and (3) the final moisture profile. All three curves were then inverse analyzed using a MATLAB code over numerical data produced with the van Genuchten-Mualem model. Hereby, a set of values ( α, n, θr and θs) was found for the hydraulic parameters for the soils under research. Additionally, the complete decaying NMR signal could be analyzed through Inverse Laplace Transformation and averaged on the 1/ T2 space. Through measurement of the decay in pure water, the effect on the relaxation caused by the sample could be estimated from the obtained spectra. The migration of the sample-related average with decreasing saturation speaks for a enhancement of the surface relaxation as the soil dries, in

  17. Parameters-adjustable front-end controller in digital nuclear measurement system

    International Nuclear Information System (INIS)

    Hao Dejian; Zhang Ruanyu; Yan Yangyang; Wang Peng; Tang Changjian

    2013-01-01

    Background: One digitizer is used to implement a digital nuclear measurement for the acquisition of nuclear information. Purpose: A principle and method of a parameter-adjustable front-end controller is presented for the sake of reducing the quantitative errors while getting the maximum ENOB (effective number of bits) of ADC (analog-to-digital converter) during waveform digitizing, as well as reducing the losing counts. Methods: First of all, the quantitative relationship among the radiation count rate (n), the amplitude of input signal (V in ), the conversion scale of ADC (±V) and the amplification factor (A) was derived. Secondly, the hardware and software of the front-end controller were designed to fulfill matching the output of different detectors, adjusting the amplification linearly through the control of channel switching, and setting of digital potentiometer by CPLD (Complex Programmable Logic Device). Results: (1) Through the measurement of γ-ray of Am-241 under our digital nuclear measurement set-up with CZT detector, it was validated that the amplitude of output signal of detectors of RC feedback type could be amplified linearly with adjustable amplification by the front-end controller. (2) Through the measurement of X-ray spectrum of Fe-5.5 under our digital nuclear measurement set-up with Si-PIN detector, it was validated that the front-end controller was suitable for the switch resetting type detectors, by which high precision measurement under various count rates could be fulfilled. Conclusion: The principle and method of the parameter-adjustable front-end controller presented in this paper is correct and feasible. (authors)

  18. Preliminary Measurement of Neutrino Oscillation Parameters By NuMI/MINOS and Calibration Studies for Improving this Measurement

    International Nuclear Information System (INIS)

    Symes, Philip Andrew; Sussex U.

    2005-01-01

    This thesis explains the origins of neutrinos and their interactions, and the phenomenon of neutrino oscillations. Experiments for measuring neutrino oscillations are mentioned and the experiment investigated in this thesis, the ''Main Injector Neutrino Oscillation Search'', and its neutrino beam, the Fermi National Accelerator Laboratory's ''Neutrinos At The Main Injector'', are described. MINOS is a long baseline (735 km) neutrino oscillation experiment with a near and a far detector, intended to make precision measurements of the atmospheric sector neutrino oscillation parameters. A measurement is made of the ''atmospheric'' neutrino oscillation parameters, Δm 23 2 and sin 2 (2θ 23 ), using neutrinos from the NuMI beam. The results of this analysis are compared to measurements at MINOS using neutrinos from the atmosphere and with other experiments. A more detailed method of beam neutrino analysis is discussed, and the extra calibrations needed to perform that analysis properly are described, with special attention paid to two aspects of the calibration, which comprise the bulk of work for this thesis. The light injection calibration system uses LEDs to illuminate the detector readout and provides a normalization of the stability of the detector over time. The hardware and different modi operandi of the system are described. There is a description of installation and commissioning of the system at one of the MINOS detectors. The response normalization of each detector with cosmic ray muons is described. Special attention is paid to the explanation of necessary corrections that must be made to the muon sample in order for the sample to be used to calibrate each detector to the specified accuracy. The performance of the calibration is shown

  19. Preliminary Measurement of Neutrino Oscillation Parameters By NuMI/MINOS and Calibration Studies for Improving this Measurement

    Energy Technology Data Exchange (ETDEWEB)

    Symes, Philip Andrew [Univ. of Sussex, Brighton (United Kingdom)

    2005-11-01

    This thesis explains the origins of neutrinos and their interactions, and the phenomenon of neutrino oscillations. Experiments for measuring neutrino oscillations are mentioned and the experiment investigated in this thesis, the ''Main Injector Neutrino Oscillation Search'', and its neutrino beam, the Fermi National Accelerator Laboratory's ''Neutrinos At The Main Injector'', are described. MINOS is a long baseline (735 km) neutrino oscillation experiment with a near and a far detector, intended to make precision measurements of the atmospheric sector neutrino oscillation parameters. A measurement is made of the ''atmospheric'' neutrino oscillation parameters, Δm$2\\atop{23}$ and sin2(2θ23), using neutrinos from the NuMI beam. The results of this analysis are compared to measurements at MINOS using neutrinos from the atmosphere and with other experiments. A more detailed method of beam neutrino analysis is discussed, and the extra calibrations needed to perform that analysis properly are described, with special attention paid to two aspects of the calibration, which comprise the bulk of work for this thesis. The light injection calibration system uses LEDs to illuminate the detector readout and provides a normalization of the stability of the detector over time. The hardware and different modi operandi of the system are described. There is a description of installation and commissioning of the system at one of the MINOS detectors. The response normalization of each detector with cosmic ray muons is described. Special attention is paid to the explanation of necessary corrections that must be made to the muon sample in order for the sample to be used to calibrate each detector to the specified accuracy. The performance of the calibration is shown.

  20. Effects of Different Reconstruction Parameters on CT Volumetric Measurement 
of Pulmonary Nodules

    Directory of Open Access Journals (Sweden)

    Rongrong YANG

    2012-02-01

    Full Text Available Background and objective It has been proven that volumetric measurements could detect subtle changes in small pulmonary nodules in serial CT scans, and thus may play an important role in the follow-up of indeterminate pulmonary nodules and in differentiating malignant nodules from benign nodules. The current study aims to evaluate the effects of different reconstruction parameters on the volumetric measurements of pulmonary nodules in chest CT scans. Methods Thirty subjects who underwent chest CT scan because of indeterminate pulmonary nodules in General Hospital of Tianjin Medical University from December 2009 to August 2011 were retrospectively analyzed. A total of 52 pulmonary nodules were included, and all CT data were reconstructed using three reconstruction algorithms and three slice thicknesses. The volumetric measurements of the nodules were performed using the advanced lung analysis (ALA software. The effects of the reconstruction algorithms, slice thicknesses, and nodule diameters on the volumetric measurements were assessed using the multivariate analysis of variance for repeated measures, the correlation analysis, and the Bland-Altman method. Results The reconstruction algorithms (F=13.6, P<0.001 and slice thicknesses (F=4.4, P=0.02 had significant effects on the measured volume of pulmonary nodules. In addition, the coefficients of variation of nine measurements were inversely related with nodule diameter (r=-0.814, P<0.001. The volume measured at the 2.5 mm slice thickness had poor agreement with the volumes measured at 1.25 mm and 0.625 mm, respectively. Moreover, the best agreement was achieved between the slice thicknesses of 1.25 mm and 0.625 mm using the bone algorithm. Conclusion Reconstruction algorithms and slice thicknesses have significant impacts on the volumetric measurements of lung nodules, especially for the small nodules. Therefore, the reconstruction setting in serial CT scans should be consistent in the follow

  1. Do It Yourself solution of Internet of Things Healthcare System: Measuring body parameters and environmental parameters affecting health.

    Directory of Open Access Journals (Sweden)

    Mirjana Maksimović

    2016-03-01

    Full Text Available The rapid advancements in information and communications technologies (ICT and the increasing number of smart things shift an old-fashioned healthcare system to a model better suited for a population of the 21st century. New healthcare approaches based on Internet of Things (IoT/Internet of Medical Things (IoMT powered systems make health monitoring, diagnostics and treatment more personalized, timely and convenient, enabling a global approach to the healthcare system infrastructure development. Commercial systems in this area exist in various forms but usually do not fit the general patient needs, and those that do are usually economically unacceptable due to the high operational and development costs. Do It Yourself (DIY healthcare, including mobile applications and consumer medical devices, nowadays is the top healthcare trend. Therefore, this paper, based on well-known low-cost technologies, presents a DIY IoMT solution for observing human vital parameter as well as environmental factors affecting health.

  2. Modal parameter determination of a lightweight aerospace panel using laser Doppler vibrometer measurements

    Science.gov (United States)

    de Sousa, Kleverson C.; Domingues, Allan C.; Pereira, Pedro P. de S.; Carneiro, Sergio H.; de Morais, Marcus V. G.; Fabro, Adriano T.

    2016-06-01

    The experimental determination of modal parameters, i.e. natural frequencies, mode shapes and damping ratio, are key in characterizing the dynamic behaviour of structures. Typically, such parameters are obtained from dynamic measurements using one or a set of accelerometers, for response measurements, along with force transducers from an impact hammer or an electrodynamic actuator, i.e. a shaker. However, lightweight structures, commonly applied in the aerospace industry, can be significantly affected by the added mass from accelerometers. Therefore, non-contact measurement techniques, like Laser Doppler Vibrometer (LDV), are a more suitable approach in determining the dynamic characteristics of such structures. In this article, the procedures and results of a modal test for a honeycomb sandwich panel for aerospace applications are presented and discussed. The main objectives of the test are the identification of natural frequencies and mode shapes in order to validate a numerical model, as well as the identification of the damping characteristics of the panel. A validated numerical model will be necessary for future detailed response analysis of the satellite, including vibroacoustic investigations to account for acoustic excitations encountered during launching. The numerical model using homogenised material properties is updated to fit the experimental results and very good agreement between experimental and numerically obtained natural frequencies and mode shapes.

  3. The physical interpretation of the parameters measured during the tensile testing of materials at elevated temperatures

    International Nuclear Information System (INIS)

    Burton, B.

    1984-01-01

    Hot tensile (or compression) testing, where the stress developed in a material is measured under an imposed strain rate, is often used as an alternative to conventional creep testing. The advantages of the hot tensile test are that its duration can be more closely controlled by the experimenter and also that the technique is more convenient, since high precision testing machines are available. The main disadvantage is that the interpretation of results is more complex. The present paper relates the parameters which are measured in hot tensile tests, to physical processes which occur in materials deforming by a variety of mechanisms. For cases where no significant structural changes occur, as in viscous or superplastic flow, analytical expressions are derived which relate the stresses measured in these tests to material constants. When deformation is controlled by recovery processes, account has to be taken of the structural changes which occur concurrently. A wide variety of behaviour may then be exhibited which depends on the initial dislocation density, the presence of second-phase particles and the relative values of the recovery rate parameters and the velocity imposed by the testing machine. Numerical examples are provided for simple recovery models. (author)

  4. Measurements of Direct CP Violation, CPT Symmetry, and Other Parameters in the Neutral Kaon System

    Energy Technology Data Exchange (ETDEWEB)

    Worcester, Elizabeth Turner [Univ. of Chicago, IL (United States)

    2007-12-01

    The authors present precision measurements of the direct CP violation parameter, Re(ϵ'/ϵ), the kaon parameters, Δm and τS, and the CPT tests, Φ± and ΔΦ, in neutral kaon decays. These results are based on the full dataset collected by the KTeV experiment at Fermi National Accelerator Laboratory during 1996, 1997, and 1999. This dataset contains ~ 15 million K → π0π0 decays and ~ 69 million K → π+π- decays. They describe significant improvements to the precision of these measurements relative to previous KTeV analyses. They find Re(ϵ'/ϵ = [19.2 ± 1.1(stat) ± 1.8(syst)] x 10-4, Δm = (5265 ± 10) x 106 hs-1, and τS = (89.62 ± 0.05) x 10-12 s. They measure Φ± = (44.09 ± 1.00)° and ΔΦ = (0.29 ± 0.31)°; these results are consistent with CPT symmetry.

  5. Pneumophonic coordination impairments in parkinsonian dysarthria: importance of aerodynamic parameters measurements.

    Science.gov (United States)

    Moustapha, S M; Alain, G; Robert, E; Bernard, T; Mourtalla, Kâ M; Lamine, G; François, V

    2012-01-01

    Among Parkinsonian axial signs, dysarthria represents an important disabling symptom able to lead towards a significant reduction of oral communication. Several methods of dysarthria assessment have been used but aerodynamic evaluation is rare in the literature. To highlight the importance of aerodynamic parameters measurements in assessment of parkinsonian dysarthria. Using a dedicated system (EVA2), 24 parkinsonian patients were recorded after withdrawal of L-dopa for at least 12 h (condition called OFF DOPA) in order to evaluate intra-oral pressure (IOP), mean oral air flow (MOAF) and laryngeal resistance (LR) on six /p/ during realization of the sentence "Papa ne m'a pas parle' de beau-papa" ("Daddy did not speak to me about daddy-in-law") which corresponds to a breath group. 50 control subjects were recorded in parallel in order to define reference measurements. It appeared that there is in Parkinson's disease aerodynamic impairments which were evidenced by the fall in IOP and that of MOAF in patients compared with control subjects. The difference between the two groups was statistically significant. In addition a greater instability of LR in patients compared with control subjects was also noted. Our results show that measurements of aerodynamics parameters, by reflecting the dysfunction induced by disease, may well be relevant factors in parkinsonian dysarthria evaluation.

  6. The final measurements of the muon decay parameters from the TWIST experiment

    International Nuclear Information System (INIS)

    Bayes, R

    2013-01-01

    The TWIST (TRIUMF Weak Interaction Symmetry Test) experiment probes the Lorentz structure of the weak interaction using muon decay. This structure has a very well defined form under the Standard Model (SM) which makes precise predictions for the shape of the decay positron spectrum with respect to momentum and angle. The shape of the spectrum may be described under some rather general assumptions using a set of decay parameters whose values according to the SM are ρ = δ = 3/4, η = 0, and ξ = 1. TWIST uses a large sample of muon decays in a large acceptance spectrometer to measure the decay parameters to an order of magnitude greater precision than previous measurements. This experiment saw its last year of data collection in 2007. As TWIST is a systematics dominated experiment, much effort has been spent on refinements of the estimates of the systematic uncertainties over previous TWIST results. These proceedings will discuss the measures taken to achieve the precision goal of parts in 10 4 , and the physics implications of the experiment.

  7. Comparison of parameters of spinal curves in the sagittal plane measured by photogrammetry and inclinometry.

    Science.gov (United States)

    Walicka-Cupryś, Katarzyna; Drzał-Grabiec, Justyna; Mrozkowiak, Mirosław

    2013-10-31

    BACKGROUND. The photogrammetric method and inclinometer-based measurements are commonly employed to assess the anteroposterior curvatures of the spine. These methods are used both in clinical trials and for screening purposes. The aim of the study was to compare the parameters used to characterise the anteroposterior spinal curvatures as measured by photogrammetry and inclinometry. MATERIAL AND METHODS. The study enrolled 341 subjects: 169 girls and 172 boys, aged 4 to 9 years, from kindergartens and primary schools in Rzeszów. The anteroposterior spinal curvatures were examined by photogrammetry and with a mechanical inclinometer. RESULTS. There were significant differences in the α angle between the inclinometric and photogrammetric assessment in the Student t test (p=0.017) and the Fisher Snedecor test (p=0.0001), with similar differences in the β angle (Student's t p=0.0001, Fisher Snedecor p=0.007). For the γ angle, significant differences were revealed with Student's t test (p=0.0001), but not with the Fisher Snedecor test (p = 0.22). CONCLUSIONS. 1. Measurements of inclination of particular segments of the spine obtained with the photogrammetric method and the inclinometric method in the same study group revealed statistically significant differences. 2. The results of measurements obtained by photogrammetry and inclinometry are not comparable. 3. Further research on agreement between measurements of the anteroposterior spinal curvatures obtained using the available measurement equipment is recommended.

  8. Measurement of key pool boiling parameters in nanofluids for nuclear applications

    International Nuclear Information System (INIS)

    Bang, In Cheol; Buongiorno, Jacopo; Hu, Lin-Wen; Wang, Hsin

    2008-01-01

    Nanofluids, colloidal dispersions of nanoparticles in a base fluid such as water, can afford very significant Critical Heat Flux (CHF) enhancement. Such engineered fluids potentially could be employed in reactors as advanced coolants in safety systems with significant safety and economic advantages. However, a satisfactory explanation of the CHF enhancement mechanism in nanofluids is lacking. To close this gap, we have identified the important boiling parameters to be measured. These are the properties (e.g., density, viscosity, thermal conductivity, specific heat, vaporization enthalpy, surface tension), hydrodynamic parameters (i.e., bubble size, bubble velocity, departure frequency, hot/dry spot dynamics) and surface conditions (i.e., contact angle, nucleation site density). We have also deployed a pool boiling facility in which many such parameters can be measured. The facility is equipped with a thin indium-tin-oxide heater deposited over a sapphire substrate. An infra-red high-speed camera and an optical probe are used to measure the temperature distribution on the heater and the hydrodynamics above the heater, respectively. The first data generated with this facility already provide some clue on the CHF enhancement mechanism in nanofluids. Specifically, the progression to burnout in a pure fluid (ethanol in this case) is characterized by a smoothly-shaped and steadily-expanding hot spot. By contrast, in the ethanol-based nanofluid the hot spot pulsates and the progression to burnout lasts longer, although the nanofluid CHF is higher than the pure fluid CHF. The presence of a nanoparticle deposition layer on the heater surface seems to enhance wettability and aid hot spot dissipation, thus delaying burnout. (author)

  9. A measurement of the Z boson resonance parameters at the SLC [Stanford Linear Center

    International Nuclear Information System (INIS)

    Nash, J.

    1989-11-01

    We have measured the resonance parameters of the Z boson using 480 hadronic and Leptonic Z decays collected by the Mark II Detector at the Stanford Linear Collider. We find the Mass to be 91.14 ± 0.12 GeV/c 2 , and the width to be 2.42 +0.45 -0.35 GeV. If we constrain the visible width to its Standard Model value, we find a partial width to invisible decay modes corresponding to 2.8 ± 0.6 neutrino species with a 95% confidence level limit of 3.9. 9 refs., 1 fig., 4 tabs

  10. Selected environmental considerations and their measuring parameters for nuclear power plant siting

    International Nuclear Information System (INIS)

    Norris, J.A.

    1975-01-01

    The site selection process for nuclear power stations encompasses a broad range of considerations. A categorization of these considerations consistent with the needs of the U. S. Atomic Energy Commission, as the regulatory agency, and of the utility company involves these major areas of concern. They are issues related to safety, environmental impact, and engineering/economics. The more important environmental considerations and their measuring parameters presented in this paper include biota, ecological systems and water quality, land use, aesthetics, water availability, and meteorology. (U.S.)

  11. Measurement of the asymmetry parameter for the decay $\\bar\\Lambda \\to \\bar p\\pi^+$

    OpenAIRE

    BES collaboration

    2009-01-01

    Based on a sample of $58\\times10^6J/\\psi$ decays collected with the BESII detector at the BEPC, the $\\bar\\Lambda$ decay parameter $\\alpha_{\\bar\\Lambda}$ for $\\bar\\Lambda\\to \\bar p \\pi^+$ is measured using about 9000 $J/\\psi\\to\\Lambda\\bar\\Lambda\\to p \\bar p \\pi^+\\pi^-$ decays. A fit to the joint angular distributions yields $\\alpha_{\\bar\\Lambda}(\\bar\\Lambda\\to \\bar p\\pi^+)=-0.755\\pm0.083\\pm0.063$, where the first error is statistical, and the second systematic.

  12. Estimates of genetic parameters and environmental effects for measures of hunting performance in Finnish hounds.

    Science.gov (United States)

    Liinamo, A E; Karjalainen, L; Ojala, M; Vilva, V

    1997-03-01

    Data from field trials of Finnish Hounds between 1988 and 1992 in Finland were used to estimate genetic parameters and environmental effects for measures of hunting performance using REML procedures and an animal model. The original data set included 28,791 field trial records from 5,666 dogs. Males and females had equal hunting performance, whereas experience acquired by age improved trial results compared with results for young dogs (P Hounds with respect to their hunting ability should be based on animal model BLUP methods instead of mere performance testing. The evaluation system of field trials should also be revised for more reliability.

  13. The effect of non-uniformities on the measured transport parameters of electron swarms in hydrogen

    International Nuclear Information System (INIS)

    Blevin, H.A.; Fletcher, J.; Hunter, S.R.

    1978-01-01

    Measurements of transport parameters of pulsed electron swarms moving through a low-pressure gas by observation of the photon flux resulting from electron-molecule collisions have been recently reported by Blevin et al. (J. Phys. D., 9:465, 471 and 1671 (1976)). One of the possible sources of error in this kind of experiment is the variation of mean electron energy through the swarm. This effect is considered here along with the resulting variation of ionisation and excitation frequency through the swarm. The validity of the experimental method is considered in the light of the above factors. (author)

  14. The effect of non-uniformities on the measured transport parameters of electron swarms in hydrogen

    International Nuclear Information System (INIS)

    Blevin, H.A.; Fletcher, J.; Hunter, S.R.

    1978-05-01

    Measurements of transport parameters of pulsed electron swarms moving through a low pressure gas by observation of the photon flux resulting from electron-molecule collisions have been recently reported. One of the possible sources of error in this kind of experiment is the variation of mean electron energy through the swarm. This effect is considered here along with the resulting variation of ionization and excitation frequency through the swarm. The validity of the experimental method is considered in the light of the above factors

  15. Lattice-parameter-difference measurement of heteroepitaxial structures by means of extremely asymmetrical Bragg diffraction

    International Nuclear Information System (INIS)

    Pietsch, U.; Borchard, W.

    1987-01-01

    The sensitivity of measurements of the lattice-parameter difference in monocrystalline heterostructures can be enhanced by use of an extremely asymmetrical diffraction geometry. If the angle of incidence is somewhat higher than the critical angle for total external reflection, the Bragg peak is shifted from the position calculated by kinematic theory. The amount of shift depends on the angle of incidence as well as on the mass density of the material used. For heteroepitaxial structures both the layer and the substrate peaks are shifted but by different amounts. Therefore it becomes possible to characterize layers of totally lattice-matched structures also. (orig.)

  16. Experimental Measures of Bus Comfort Levels Using Kinematic Parameters Recorded by Smartphone

    Energy Technology Data Exchange (ETDEWEB)

    Aquila, S. dell' ; Eboli, L.; Futia, G.; Mazzulla, G.; Pungillo, G.

    2016-07-01

    Comfort on board plays an essential role in the levels of satisfaction of a bus service perceived by passengers. The aim of this paper is to propose a measure of comfort based on two kinds of data: perceptions of passengers (subjective data) and accelerations of bus (objective data). For the collection of subjective data a questionnaire was addressed to a sample of university students, while a smartphone, equipped with GPS device and 3-axis accelerometer, was used to record the accelerations. Based on the recorded parameters, we determined the thresholds of the acceleration values beyond which the level of comfort cannot be considered as good.. (Author)

  17. Measurements of spin parameters in p-p elastic scattering at 6 GeV/c

    International Nuclear Information System (INIS)

    Linn, S.L.; Perlmutter, A.; Crosbie, E.A.; Ratner, L.G.; Schultz, P.F.; O'Fallon, J.R.; Cameron, P.R.; Crabb, D.G.; Fernow, R.C.; Hansen, P.H.; Krisch, A.D.; Salthouse, A.J.; Sandler, B.; Shima, T.; Terwilliger, K.M.

    1982-01-01

    We measured the differential cross section for proton-proton elastic scattering in 6 GeV/c, with both initial spins oriented normal to the scattering plane. The analyzing power A shows significant structure with a large broad peak reaching about 24% near P/sub perpendicular/ 2 = 1.6 (GeV/c) 2 . The spin-spin correlation parameter A/sub n/n exhibits more dramatic structure, with a small but very sharp peak rising rapidly to about 13% at 90 0 /sub tsc.m./. This sharp peak may be caused by particle-identity effects

  18. Dynamic response of carbon nanotube field-effect transistors analyzed by S-parameters measurement

    Energy Technology Data Exchange (ETDEWEB)

    Bethoux, J.-M. [Institut d' Electronique, de Microelectronique et de Nanotechnologie, C.N.R.S. U.M.R. 8520, BP 60069, F-59652, Villeneuve d' Ascq Cedex (France); Happy, H. [Institut d' Electronique, de Microelectronique et de Nanotechnologie, C.N.R.S. U.M.R. 8520, BP 60069, F-59652, Villeneuve d' Ascq Cedex (France)]. E-mail: henri.happy@iemn.univ-lille1.fr; Dambrine, G. [Institut d' Electronique, de Microelectronique et de Nanotechnologie, C.N.R.S. U.M.R. 8520, BP 60069, F-59652, Villeneuve d' Ascq Cedex (France); Derycke, V. [Laboratoire d' Electronique Moleculaire, SPEC, Commissariat a l' Energie Atomique, Saclay F-91191, Gif sur Yvette Cedex (France); Goffman, M. [Laboratoire d' Electronique Moleculaire, SPEC, Commissariat a l' Energie Atomique, Saclay F-91191, Gif sur Yvette Cedex (France); Bourgoin, J.-P. [Laboratoire d' Electronique Moleculaire, SPEC, Commissariat a l' Energie Atomique, Saclay F-91191, Gif sur Yvette Cedex (France)

    2006-12-15

    Carbon nanotube field-effect transistors (CN-FET) with a metallic back gate have been fabricated. By assembling a number of CNs in parallel, driving currents in the mA range have been obtained. The dynamic response of the CN-FETs has been investigated through S-parameters measurements. A current gain (|H {sub 21}|{sup 2}) cut-off frequency (f {sub t}) of 8 GHz, and a maximum stable gain (MSG) value of 10 dB at 1 GHz have been obtained. The extraction of an equivalent circuit is proposed.

  19. Dynamic response of carbon nanotube field-effect transistors analyzed by S-parameters measurement

    International Nuclear Information System (INIS)

    Bethoux, J.-M.; Happy, H.; Dambrine, G.; Derycke, V.; Goffman, M.; Bourgoin, J.-P.

    2006-01-01

    Carbon nanotube field-effect transistors (CN-FET) with a metallic back gate have been fabricated. By assembling a number of CNs in parallel, driving currents in the mA range have been obtained. The dynamic response of the CN-FETs has been investigated through S-parameters measurements. A current gain (|H 21 | 2 ) cut-off frequency (f t ) of 8 GHz, and a maximum stable gain (MSG) value of 10 dB at 1 GHz have been obtained. The extraction of an equivalent circuit is proposed

  20. Measurements of diffusion parameters of methanol on gamma-irradiated polycarbonate

    International Nuclear Information System (INIS)

    Silva, Pietro P.J.C.G.P.O.; Araujo, Elmo S.

    2013-01-01

    Polycarbonate (PC) is an engineering polymer which presents interesting properties such as toughness, light weight and transparency. This material has been used for several important applications including in the medical field. In this particular application, polycarbonate has been exposed frequently to gamma irradiation and to chemical environment that can be able to product significant changes in polymer structure that may lead to future catastrophic fail and rupture. Polymer structural damages induced by gamma irradiation or chemical attack (environment stress cracking) have been studied by several research groups for many years and for many solvent-polymer systems, but few reporters present informations about the simultaneous occurrence of these effects. This present work has the goal to understand the diffusion process of methanol in polycarbonate and to determinate the diffusion parameters on polymer system under 100 kGy of gamma irradiation. Swelling experiments were performed at the samples of polycarbonate divided in two groups: PC-0 (without dose) and PC-100 (with 100 kGy of dose). Diffusion parameters (D) may be measured by slope of the sorption curve for polymers with Fickian behavior. A comparison of the D parameters was made for each set of sample. There were no significant differences on D values of sample groups observed due to the radiation effects. However, stress strain curves obtained show that methanol has great influence on mechanical behavior of PC but the radiation dose don't have significant influence on this mechanical behavior. (author)

  1. Calculation of kinetic parameters of Caliban metallic core experimental reactor from stochastic neutron measurements

    Energy Technology Data Exchange (ETDEWEB)

    Casoli, P.; Authier, N.; Baud, J. [Commissariat a l' energie Atomique, Centre de Valduc, 21120 Is-sur-Tille (France)

    2009-07-01

    Several experimental devices are operated by the Criticality and Neutron Science Research Department of the CEA Valduc Laboratory. One of these is the metallic core reactor Caliban. The knowledge of the fundamental kinetic parameters of the reactor is very useful, indeed necessary, to the operator. The purpose of this study was to develop and perform experiments allowing to determinate some of these parameters. The prompt neutron decay constant and particularly its value at criticality can be measured with reactor noise techniques such as the interval-distribution, the Feynman variance-to-mean, and the Rossi-{alpha} methods. By introducing the Nelson number, the effective delayed neutron fraction and the average neutron lifetime can also be calculated with the Rossi-{alpha} method. Subcritical, critical, and even supercritical experiments were performed. With the Rossi-{alpha} technique, it was found that the prompt neutron decay constant at criticality was (6.02*10{sup 5} {+-} 9%). Experiments also brought out the limitations of the used experimental parameters. (authors)

  2. Final Report: Geoelectrical Measurement of Multi-Scale Mass Transfer Parameters

    Energy Technology Data Exchange (ETDEWEB)

    Haggerty, Roy [Oregon State Univ., Corvallis, OR (United States); Day-Lewis, Fred [U.S. Geological Survey, Storrs, CT (United States); Singha, Kamini [Colorado School of Mines, Golden, CO (United States); Johnson, Timothy [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Binley, Andrew [Lancaster Univ. (United Kingdom); Lane, John [U.S. Geological Survey, Storrs, CT (United States)

    2014-03-20

    Mass transfer affects contaminant transport and is thought to control the efficiency of aquifer remediation at a number of sites within the Department of Energy (DOE) complex. An improved understanding of mass transfer is critical to meeting the enormous scientific and engineering challenges currently facing DOE. Informed design of site remedies and long-term stewardship of radionuclide-contaminated sites will require new cost-effective laboratory and field techniques to measure the parameters controlling mass transfer spatially and across a range of scales. In this project, we sought to capitalize on the geophysical signatures of mass transfer. Previous numerical modeling and pilot-scale field experiments suggested that mass transfer produces a geoelectrical signature—a hysteretic relation between sampled (mobile-domain) fluid conductivity and bulk (mobile + immobile) conductivity—over a range of scales relevant to aquifer remediation. In this work, we investigated the geoelectrical signature of mass transfer during tracer transport in a series of controlled experiments to determine the operation of controlling parameters, and also investigated the use of complex-resistivity (CR) as a means of quantifying mass transfer parameters in situ without tracer experiments. In an add-on component to our grant, we additionally considered nuclear magnetic resonance (NMR) to help parse mobile from immobile porosities. Including the NMR component, our revised study objectives were to: 1. Develop and demonstrate geophysical approaches to measure mass-transfer parameters spatially and over a range of scales, including the combination of electrical resistivity monitoring, tracer tests, complex resistivity, nuclear magnetic resonance, and materials characterization; and 2. Provide mass-transfer estimates for improved understanding of contaminant fate and transport at DOE sites, such as uranium transport at the Hanford 300 Area. To achieve our objectives, we implemented a 3

  3. Interobserver and Intraobserver Variability among Measurements of FDG PET/CT Parameters in Pulmonary Tumors

    Directory of Open Access Journals (Sweden)

    Gülgün Büyükdereli

    2016-06-01

    Full Text Available Background: 18F-fluorodeoxyglucose (FDG positron emission tomography computed tomography (PET/CT provides information about metabolic and morphologic status of malignancies. Tumor size and standardized uptake value (SUV measurements are crucial for cancer treatment monitoring.: 18F-fluorodeoxyglucose (FDG positron emission tomography computed tomography (PET/CT provides information about metabolic and morphologic status of malignancies. Tumor size and standardized uptake value (SUV measurements are crucial for cancer treatment monitoring. Aims: The purpose of our study was to assess the variability of these measurements performed by observers evaluating lung tumors. Study Design: Retrospective cross-sectional study. Methods: FDG PET/CT images of 97 patients with pulmonary tumors were independently evaluated by two experienced nuclear medicine physicians. Primary tumor size (UDCT, maximum SUV (SUVmax, mean SUV (SUVmean and maximum SUV normalized to liver mean SUV (SUVnliv max were measured by each observer at two different times with an interval of at least 2 weeks. Interobserver and intraobserver variabilities of measurements were evaluated through statistical methods. Results: Size of the lesions varied from 0.81 to 13.6 cm (mean 4.29±2.24 cm. Very good agreement was shown with correlation, Bland-Altman and regression analysis for all measured PET/CT parameters. In the interobserver and intraobserver variability analysis, the Pearson correlation coefficients were greater than 0.96 and 0.98, respectively. Conclusion: Semi-quantitative measurements of pulmonary tumors were highly reproducible when determined by experienced physicians with clinically available software for routine FDG PET/CT evaluation. Consistency may be improved if the same observer performs serial measurements for any one patient.

  4. Medium energy measurements of N-N parameters: Progress report, January 1, 1988--December 31, 1988

    International Nuclear Information System (INIS)

    Riley, P.J.

    1988-01-01

    We report here progress made for the period January 1, 1988, to December 31, 1988, for the Department of Energy Three-year Grant No. DE-FG05-88ER40446, first year. A major part of the work has been and will continue to be associated with research done at the Nucleon Physics Laboratory (NPL) at the Los Alamos Meson Physics Facility (LAMPF). The aim of the experimental program is the determination of the nucleon-nucleon amplitudes at medium energies. The required data include both elastic and inelastic experiments, and in addition the measurement of polarization and polarization transfer parameters. The measurements can be broadly categorized into those of proton-proton elastic scattering, which probe the isospin-1 elastic channel, neutron-proton elastic scattering, which allow measurements of isospin-0 amplitudes, proton-proton inelastic scattering, and neutron-proton inelastic scattering. We are nearing completion of a long-range series of p-p elastic scattering measurements, and believe that the required goals have been achieved. During the past few years we have emphasized proton-proton inelastic scattering measurements, and believe that the determination of the I = 1 inelastic phase shifts is progressing well. The I = 0 amplitudes, both elastic, and inelastic, are still poorly determined, at best. These measurements require a much more intense polarized neutron beam than is yet available, and therefore have needed the high-intensity optically pumped polarized ion source, due to come on-line during late 1989. During the past year our work emphasized p-p elastic differential scattering cross-section measurements in the energy range 500--800 MeV at LAMPF. The measurements aimed for an absolute accuracy of 1%, and we believe that this was achieved. We also have been involved in what we believe is the first partial wave analysis of pp → npπ + data

  5. Passive and active measurements of radon-related parameters inside ancient Egyptian tombs in Luxor

    Energy Technology Data Exchange (ETDEWEB)

    Abo-Elmagd, M [Radiation Measurements Department, National Institute for Standard, Giza (Egypt); Metwally, S M [Faculty of Science, Department of Physics, Ain Shams University, Cairo (Egypt); El-Fiki, S A [Faculty of Science, Department of Physics, Ain Shams University, Cairo (Egypt); Eissa, H M [Radiation Measurements Department, National Institute for Standard, Giza (Egypt); Salama, E [Faculty of Science, Department of Physics, Ain Shams University, Cairo (Egypt)

    2007-01-15

    Radon and its related parameters were measured using passive (CR-39) and active (Alpha-Guard analyzer) techniques inside seven ancient Egyptian tombs of the Valley of the Kings in Luxor. The measurements were performed throughout the winter and summer seasons. The average radon concentration inside the tombs ranges from 96.9+/-10.8 to 415+/-43Bqm{sup -3} in winter and from 86.4+/-13.8 to 6102.8+/-573.6 in summer. Because of the variations of tombs dimensions and their ventilation systems, the equilibrium factor between radon and its progeny ranges from 0.228+/-0.02 to 0.95+/-0.05. The effective doses for the tomb workers, the tour guide and visitors were calculated. Active measurements show that radon exhalation rates range from 0.68+/-0.30 to 1.47+/-0.27Bqm{sup -2}h{sup -1} and from 0.60+/-0.03 to 1.42+/-0.05Bqm{sup -2}h{sup -1} for passive measurements. The real radium content was determined for all examined tombs by HPGe detector, while the effective radium content was obtained by Alpha-Guard and sealed cup techniques. Radon exhalation rates were correlated with the real radium content. A good correlation was found between active and passive measurements of radon exhalation rate.

  6. Passive and active measurements of radon-related parameters inside ancient Egyptian tombs in Luxor

    International Nuclear Information System (INIS)

    Abo-Elmagd, M.; Metwally, S.M.; El-Fiki, S.A.; Eissa, H.M.; Salama, E.

    2007-01-01

    Radon and its related parameters were measured using passive (CR-39) and active (Alpha-Guard analyzer) techniques inside seven ancient Egyptian tombs of the Valley of the Kings in Luxor. The measurements were performed throughout the winter and summer seasons. The average radon concentration inside the tombs ranges from 96.9+/-10.8 to 415+/-43Bqm -3 in winter and from 86.4+/-13.8 to 6102.8+/-573.6 in summer. Because of the variations of tombs dimensions and their ventilation systems, the equilibrium factor between radon and its progeny ranges from 0.228+/-0.02 to 0.95+/-0.05. The effective doses for the tomb workers, the tour guide and visitors were calculated. Active measurements show that radon exhalation rates range from 0.68+/-0.30 to 1.47+/-0.27Bqm -2 h -1 and from 0.60+/-0.03 to 1.42+/-0.05Bqm -2 h -1 for passive measurements. The real radium content was determined for all examined tombs by HPGe detector, while the effective radium content was obtained by Alpha-Guard and sealed cup techniques. Radon exhalation rates were correlated with the real radium content. A good correlation was found between active and passive measurements of radon exhalation rate

  7. Measurement of resonance parameters of orbitally excited narrow B0 mesons.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; González, B Alvarez; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Almenar, C Cuenca; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; da Costa, J Guimaraes; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kusakabe, Y; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlok, J; Fernandez, P Movilla; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Griso, S Pagan; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Peiffer, T; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Pueschel, E; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Rekovic, V; Renton, P; Renz, M; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Saltó, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schmidt, M A; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sforza, F; Sfyrla, A; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shiraishi, S; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spreitzer, T; Squillacioti, P; Stanitzki, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Stuart, D; Suh, J S; Sukhanov, A; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thompson, G A; Thomson, E; Tipton, P; Ttito-Guzmán, P; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Tourneur, S; Trovato, M; Tsai, S-Y; Tu, Y; Turini, N; Ukegawa, F; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Veszpremi, V; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Volobouev, I; Volpi, G; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wagner-Kuhr, J; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Weinelt, J; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Würthwein, F; Wynne, S M; Xie, S; Yagil, A; Yamamoto, K; Yamaoka, J; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zhang, X; Zheng, Y; Zucchelli, S

    2009-03-13

    We report a measurement of resonance parameters of the orbitally excited (L=1) narrow B0 mesons in decays to B;{(*)+}pi;{-} using 1.7 fb;{-1} of data collected by the CDF II detector at the Fermilab Tevatron. The mass and width of the B_{2};{*0} state are measured to be m(B_{2};{*0})=5740.2_{-1.8};{+1.7}(stat)-0.8+0.9(syst) MeV/c;{2} and Gamma(B_{2};{*0})=22.7_{-3.2};{+3.8}(stat)-10.2+3.2(syst) MeV/c;{2}. The mass difference between the B_{2};{*0} and B10 states is measured to be 14.9_{-2.5};{+2.2}(stat)-1.4+1.2(syst) MeV/c;{2}, resulting in a B10 mass of 5725.3_{-2.2};{+1.6}(stat)-1.5+1.4(syst) MeV/c;{2}. This is currently the most precise measurement of the masses of these states and the first measurement of the B_{2};{*0} width.

  8. Receiver calibration and the nonlinearity parameter measurement of thick solid samples with diffraction and attenuation corrections.

    Science.gov (United States)

    Jeong, Hyunjo; Barnard, Daniel; Cho, Sungjong; Zhang, Shuzeng; Li, Xiongbing

    2017-11-01

    This paper presents analytical and experimental techniques for accurate determination of the nonlinearity parameter (β) in thick solid samples. When piezoelectric transducers are used for β measurements, the receiver calibration is required to determine the transfer function from which the absolute displacement can be calculated. The measured fundamental and second harmonic displacement amplitudes should be modified to account for beam diffraction and material absorption. All these issues are addressed in this study and the proposed technique is validated through the β measurements of thick solid samples. A simplified self-reciprocity calibration procedure for a broadband receiver is described. The diffraction and attenuation corrections for the fundamental and second harmonics are explicitly derived. Aluminum alloy samples in five different thicknesses (4, 6, 8, 10, 12cm) are prepared and β measurements are made using the finite amplitude, through-transmission method. The effects of diffraction and attenuation corrections on β measurements are systematically investigated. When diffraction and attenuation corrections are all properly made, the variation of β between different thickness samples is found to be less than 3.2%. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Reliability of measuring abductor hallucis muscle parameters using two different diagnostic ultrasound machines

    Directory of Open Access Journals (Sweden)

    Cameron Alyse FM

    2009-11-01

    Full Text Available Abstract Background Diagnostic ultrasound provides a method of analysing soft tissue structures of the musculoskeletal system effectively and reliably. The aim of this study was to evaluate within and between session reliability of measuring muscle dorso-plantar thickness, medio-lateral length and cross-sectional area, of the abductor hallucis muscle using two different ultrasound machines, a higher end Philips HD11 Ultrasound machine and clinically orientated Chison 8300 Deluxe Digital Portable Ultrasound System. Methods The abductor hallucis muscle of both the left and right feet of thirty asymptomatic participants was imaged and then measured using both ultrasound machines. Interclass correlation coefficients (ICC with 95% confidence intervals (CI were used to calculate both within and between session intra-tester reliability. Standard error of the measurement (SEM calculations were undertaken to assess difference between the actual measured score across trials and the smallest real difference (SRD was calculated from the SEM to indicate the degree of change that would exceed the expected trial to trial variability. Results The ICCs, SEM and SRD for dorso-plantar thickness and medial-lateral length were shown to have excellent to high within and between-session reliability for both ultrasound machines. The between-session reliability indices for cross-sectional area were acceptable for both ultrasound machines. Conclusion The results of the current study suggest that regardless of the type ultrasound machine, intra-tester reliability for the measurement the abductor hallucis muscle parameters is very high.

  10. Research on Joint Parameter Inversion for an Integrated Underground Displacement 3D Measuring Sensor

    Directory of Open Access Journals (Sweden)

    Nanying Shentu

    2015-04-01

    Full Text Available Underground displacement monitoring is a key means to monitor and evaluate geological disasters and geotechnical projects. There exist few practical instruments able to monitor subsurface horizontal and vertical displacements simultaneously due to monitoring invisibility and complexity. A novel underground displacement 3D measuring sensor had been proposed in our previous studies, and great efforts have been taken in the basic theoretical research of underground displacement sensing and measuring characteristics by virtue of modeling, simulation and experiments. This paper presents an innovative underground displacement joint inversion method by mixing a specific forward modeling approach with an approximate optimization inversion procedure. It can realize a joint inversion of underground horizontal displacement and vertical displacement for the proposed 3D sensor. Comparative studies have been conducted between the measured and inversed parameters of underground horizontal and vertical displacements under a variety of experimental and inverse conditions. The results showed that when experimentally measured horizontal displacements and vertical displacements are both varied within 0 ~ 30 mm, horizontal displacement and vertical displacement inversion discrepancies are generally less than 3 mm and 1 mm, respectively, under three kinds of simulated underground displacement monitoring circumstances. This implies that our proposed underground displacement joint inversion method is robust and efficient to predict the measuring values of underground horizontal and vertical displacements for the proposed sensor.

  11. First measurement of ADS parameters using B- to D0K- decays in hadron collisions

    International Nuclear Information System (INIS)

    Garosi, Paola

    2011-01-01

    Measurements of branching fractions and CP-asymmetries of B - → D 0 K - modes allow a theoretically-clean extraction of the CKM angle γ. The method proposed by Atwood, Dunietz and Soni (ADS) makes use of a decay chain where color and Cabibbo suppression interfere, which produces large CP-violating asymmetries. The CDF experiment reports the first measurement at a hadron collider of branching fractions and CP-asymmetries of suppressed B - → D 0 h - signals, where h is π or K. Using 5.0 fb -1 of data we found a combined significance exceeding 5σ and we determined the ADS parameters with accuracy comparable with B-factories.

  12. Measures of the zero power nuclear reactor's kinetic parameters with application of noise analysis

    International Nuclear Information System (INIS)

    Martins, F.R.

    1992-01-01

    The purpose of this work was to establish an experimental technique based on noise analysis for measuring the ratio of kinetic parameters β/ Λ and the power of the Zero Power Nuclear Reactor IPEN-MB 01. A through study of the microscopic and macroscopic noise analysis techniques has been carried out. The Langevin technique and the point kinetic model were chosen to describe the stochastic phenomena that occur in the zero power reactor. Measurements have been made using two compensated ionization chambers localized in the water reflector at symmetric positions in order to minimize spatial effects on the neutron flux fluctuation. Power calibrations based on the low frequency plateau of the cross-power spectral density has also been carried out. (author)

  13. Medium energy measurements of n-n parameters. Progress report, January 1-December 31, 1985

    International Nuclear Information System (INIS)

    1986-01-01

    This document constitutes a progress report (1985-86) for the ongoing medium energy nuclear physics research program. A major part of the work has been and will continue to be associated with research done at the Nucleon Physics Laboratory (NPL) at the Los Alamos Meson Physics Facility (LAMPF). The aim of the experimental program is the determination of the nucleon-nucleon amplitudes at medium energy. The required data include both elastic and inelastic experiments, and in addition the measurement of polarization and polarization transfer parameters. We have been emphasizing single pion production measurements using polarized proton beams, and expect that our present data base will provide stringent tests of theoretical models. With the development of the LAMPF high intensity polarized proton source, we expect that a reasonably intense beam of medium energy polarized neutrons will become available, and are planning a series of experiments utilizing polarized neutrons to determine the importance of the I = 0 reaction amplitudes at medium energies

  14. Evaluation of the Effects of Menstrual Cycle on Anterior Chamber Parameters as Measured with Pentacam

    Directory of Open Access Journals (Sweden)

    Arzu Seyhan Karatepe

    2013-01-01

    Full Text Available Pur po se: To evaluate the effects of endogenous gonadotropic hormones (follicle-stimulating hormone, luteinizing hormone and sex steroids (progesterone, estrogen to anterior segment parameters. Ma te ri al and Met hod: Thirty healthy females who had a menstrual cycle of 28±1 day and with a mean age of 36.5±7.56 (range, 20 – 46 years were included in the study. Starting from the first day of their cycle, Pentacam Scheimpflug camera measurements were performed on the 1st, 3rd, 7th, 12th, 16th, 21st, 26th, and 28th days. The central corneal thickness, anterior chamber depth, anterior segment volume, keratometric values, anterior chamber angle value, and pupilla diameter of both eyes were evaluated. Repeated measures analysis of variance test was used for statistical analysis. Re sults: No difference that reaches statistical significance was found in the means of central corneal thickness, anterior chamber volume, keratometric values, anterior chamber angle, and pupilla diameter between the days. Mean anterior chamber depth measurement of the right eyes on the 1st day was 2.72±0.44 mm, whereas it was 2.77±0.46 mm on the 26th day. Mean anterior chamber depth measurement of the left eyes on the 1st day was 2.74±0.42 mm, whereas it was 2.80±0.43 mm on the 26th day. This increment of anterior chamber depth value from the 1st to the 26th days was found to be statistically significant (p≤0.05. Dis cus si on: Progesterone and estrogen that rise in the second half of the menstrual cycle might have a deepening effect on the anterior chamber. These findings should be further investigated with more profound studies that also evaluate the hormonal values and their correlations with anterior segment parameters. (Turk J Ophthalmol 2013; 43: 15-8

  15. The influence of fog parameters on aerosol depletion measured in the KAEVER experiments

    International Nuclear Information System (INIS)

    Poss, G.; Weber, D.; Fritsche, B.

    1995-01-01

    The release of radioactive aerosols in the environment is one of the most serious hazards in case of an accident in nuclear power plant. Many efforts have been made in the past in numerous experimental programs like NSPP, DEMONA, VANAM, LACE, MARVIKEN, others are still underway to improve the knowledge of the aerosol behavior and depletion in a reactor containment in order to estimate the possible source term and to validate computer codes. In the German single compartment KAEVER facility the influence of size distribution, morphology, composition and solubility on the aerosol behavior is investigated. One of the more specific items is to learn about open-quotes wet depletionclose quotes means, the aerosol depletion behavior in condensing atmospheres. There are no experiments known where the fog parameters like droplet size distribution, volume concentration, respectively airborne liquid water content have been measured in- and on-line explicitly. To the authors knowledge the use of the Battelle FASP photometer, which was developed especially for this reason, for the first time gives insight in condensation behavior under accident typical thermal hydraulic conditions. It delivers a basis for code validation in terms of a real comparison of measurements and calculations. The paper presents results from open-quotes wet depletionclose quotes aerosol experiments demonstrating how depletion velocity depends on the fog parameters and where obviously critical fog parameter seem to change the regime from a open-quotes pseudo dry depletionclose quotes at a relative humidity of 100% but quasi no or very low airborne liquid water content to a real open-quotes wet depletionclose quotes under the presence of fogs with varying densities. Characteristics are outlined how soluble and insoluble particles as well as aerosol mixtures behave under condensing conditions

  16. Equivalent circuit parameters of nickel/metal hydride batteries from sparse impedance measurements

    Science.gov (United States)

    Nelatury, Sudarshan Rao; Singh, Pritpal

    In a recent communication, a method for extracting the equivalent circuit parameters of a lead acid battery from sparse (only three) impedance spectroscopy observations at three different frequencies was proposed. It was based on an equivalent circuit consisting of a bulk resistance, a reaction resistance and a constant phase element (CPE). Such a circuit is a very appropriate model of a lead-acid cell at high state of charge (SOC). This paper is a sequel to it and presents an application of it in case of nickel/metal hydride (Ni/MH) batteries, which also at high SOC are represented by the same circuit configuration. But when the SOC of a Ni/MH battery under interrogation goes low, The EIS curve has a positive slope at the low frequency end and our technique yields complex values for the otherwise real circuit parameters, suggesting the need for additional elements in the equivalent circuit and a definite relationship between parameter consistency and SOC. To improvise the previous algorithm, in order that it works reasonably well at both high and low SOCs, we propose three more measurements—two at very low frequencies to include the Warburg response and one at a high frequency to model the series inductance, in addition to the three in the mid frequency band—totally six measurements. In most of the today's instrumentation, it is the user who should choose the circuit configuration and the number of frequencies where impedance should be measured and the accompanying software performs data fitting by complex nonlinear least squares. The proposed method has built into it an SOC-based decision-making capability—both to choose the circuit configuration and to estimate the values of the circuit elements.

  17. Measuring Dark Energy Properties with Photometrically Classified Pan-STARRS Supernovae. II. Cosmological Parameters

    Science.gov (United States)

    Jones, D. O.; Scolnic, D. M.; Riess, A. G.; Rest, A.; Kirshner, R. P.; Berger, E.; Kessler, R.; Pan, Y.-C.; Foley, R. J.; Chornock, R.; Ortega, C. A.; Challis, P. J.; Burgett, W. S.; Chambers, K. C.; Draper, P. W.; Flewelling, H.; Huber, M. E.; Kaiser, N.; Kudritzki, R.-P.; Metcalfe, N.; Tonry, J.; Wainscoat, R. J.; Waters, C.; Gall, E. E. E.; Kotak, R.; McCrum, M.; Smartt, S. J.; Smith, K. W.

    2018-04-01

    We use 1169 Pan-STARRS supernovae (SNe) and 195 low-z (z used to infer unbiased cosmological parameters by using a Bayesian methodology that marginalizes over core-collapse (CC) SN contamination. Our sample contains nearly twice as many SNe as the largest previous SN Ia compilation. Combining SNe with cosmic microwave background (CMB) constraints from Planck, we measure the dark energy equation-of-state parameter w to be ‑0.989 ± 0.057 (stat+sys). If w evolves with redshift as w(a) = w 0 + w a (1 ‑ a), we find w 0 = ‑0.912 ± 0.149 and w a = ‑0.513 ± 0.826. These results are consistent with cosmological parameters from the Joint Light-curve Analysis and the Pantheon sample. We try four different photometric classification priors for Pan-STARRS SNe and two alternate ways of modeling CC SN contamination, finding that no variant gives a w differing by more than 2% from the baseline measurement. The systematic uncertainty on w due to marginalizing over CC SN contamination, {σ }wCC}=0.012, is the third-smallest source of systematic uncertainty in this work. We find limited (1.6σ) evidence for evolution of the SN color-luminosity relation with redshift, a possible systematic that could constitute a significant uncertainty in future high-z analyses. Our data provide one of the best current constraints on w, demonstrating that samples with ∼5% CC SN contamination can give competitive cosmological constraints when the contaminating distribution is marginalized over in a Bayesian framework.

  18. Measurement of Water Quality Parameters for Before and After Maintenance Service in Water Filter System

    Directory of Open Access Journals (Sweden)

    Shaharudin Nuraida

    2017-01-01

    Full Text Available An adequate supply of safe drinking water is one of major ways to obtain healthy life. Water filter system is one way to improve the water quality. However, to maintain the performance of the system, it need to undergo the maintenance service. This study evaluate the requirement of maintenance service in water filter system. Water quality was measured before and after maintenance service. Parameters measured were pH, turbidity, residual chlorine, nitrate and heavy metals and these parameters were compared with National Drinking Water Quality Standards. Collection of data were involved three housing areas in Johor. The quality of drinking water from water filter system were analysed using pH meter, turbidity meter, DR6000 and Inductively Coupled Plasma-Mass Spectrometer. pH value was increased from 16.4% for before maintenance services to 30.7% for after maintenance service. Increment of removal percentage for turbidity, residual chlorine and nitrate after maintenance were 21.5, 13.6 and 26.7, respectively. This result shows that maintenance service enhance the performance of the system. However, less significant of maintenance service for enhance the removal of heavy metals which the increment of removal percentage in range 0.3 to 9.8. Only aluminium shows percentage removal for after maintenance with 92.8% lower compared to before maintenance service with 95.5%.

  19. Radioisotope albumin flux measurement of microvascular lung permeability: an independent parameter in acute respiratory failure?

    International Nuclear Information System (INIS)

    Hoegerle, S.; Nitzsche, E.U.; Reinhardt, M.J.; Moser, E.; Benzing, A.; Geiger, K.; Schulte Moenting, J.

    2001-01-01

    Aim: To evaluate the extent to which single measurements of microvascular lung permeability may be relevant as an additional parameter in a heterogenous clinical patient collective with Acute Lung Injury (ALI) and Acute Respiratory Distress Syndrome (ARDS). Methods: In 36 patients with pneumonia (13), non pneumogenic sepsis (9) or trauma (14) meeting the consensus conference criteria of ALI or ARDS double-isotope protein flux measurements ( 51 Cr erythrocytes as intravascular tracer, Tc-99m human albumin as diffusible tracer) of microvascular lung permeability were performed using the Normalized Slope Index (NSI). The examination was to determine whether there is a relationship between the clinical diagnosis of ALI/ARDS, impaired permeability and clinical parameters, that is the underlying disease, oxygenation, duration of mechanical ventilation and mean pulmonary-artery pressure (PAP). Results: At the time of study, 25 patients presented with increased permeability (NSI > 1 x 10 -3 min -1 ) indicating an exudative stage of disease, and 11 patients with normal permeability. The permeability impairment correlated with the underlying disease (p > 0.05). With respect to survival, there was a negative correlation to PAP (p [de

  20. Measurement of local two-phase flow parameters of nanofluids using conductivity double-sensor probe.

    Science.gov (United States)

    Park, Yu Sun; Chang, Soon Heung

    2011-04-04

    A two-phase flow experiment using air and water-based γ-Al2O3 nanofluid was conducted to observe the basic hydraulic phenomenon of nanofluids. The local two-phase flow parameters were measured with a conductivity double-sensor two-phase void meter. The void fraction, interfacial velocity, interfacial area concentration, and mean bubble diameter were evaluated, and all of those results using the nanofluid were compared with the corresponding results for pure water. The void fraction distribution was flattened in the nanofluid case more than it was in the pure water case. The higher interfacial area concentration resulted in a smaller mean bubble diameter in the case of the nanofluid. This was the first attempt to measure the local two-phase flow parameters of nanofluids using a conductivity double-sensor two-phase void meter. Throughout this experimental study, the differences in the internal two-phase flow structure of the nanofluid were identified. In addition, the heat transfer enhancement of the nanofluid can be resulted from the increase of the interfacial area concentration which means the available area of the heat and mass transfer.

  1. Measurement of the $\\beta$-asymmetry parameter in $^{35}$Ar decay with a laser polarized beam

    CERN Multimedia

    With this proposal we request beam time for the first two phases of a project that aims at measuring the $\\beta$-asymmetry parameter of the mirror $\\beta$-decay branch in $^{35}$Ar using an optically polarized Ar atom beam. The final goal of the experiment is to measure this parameter to a precision of 0.5%. This will allow the most precise determination of the V$_{ud}$ quark mixing matrix element from all the mirror transitions with an absolute uncertainty of 0.0007. The proposal will be presented in phases and we ask here 11 shifts (7 on-line + 4 off-line) for phase 1 and 15 shifts (6 on-line and 9 off-line) for phase 2. Phase 1 aims at establishing the optimal laser polarization scheme as well as the best implantation host for maintaining the polarization. Phase 2 aims at enhancing the beam polarization by removing the unpolarized part of the beam using re-ionization.

  2. 113Insup(m) radiocardiographic measurements of cardiopulmonary parameters in healthy subjects and in cardiac patients

    International Nuclear Information System (INIS)

    Kuikka, Jyrki.

    1976-05-01

    Single detector arrangements are used to measure heart radioactivity curves in healthy subjects and in patients with various heart failures. A method is developed from a modified gamma function to determine the cardiopulmonary parameters from the radiocardiograms: systemic flow, pulmonary flow, right to left shunting flow, left to right shunting flow, regurgitant fractions, stroke volume, atrial blood volumes, ventricular end-diastolic volumes, pulmonary blood volume and ejection fractions. The method is well suited to clinical routine and requires only a desk calculator or a mini-computer for data handling. The cardiopulmonary parameters were measured from 70 healthy subjects with following results: cardiac index 3.46+-0.72 l/min/m 2 , stroke index 49+-9 ml/b/m 2 , right atrial blood volume 35+-13 ml/m 2 , right ventricular end-diastolic volume 76+-15 ml/m 2 , pulmonary blood volume 250+-51 ml/m 2 , left atrial blood volume 41+-15 ml/m 2 , left ventricular end-diastolic volume 75+-15 ml/m 2 , right heart ejection fraction 0.64+-0.11, left heart ejection fraction 0.66+-0.12. These values agree closely with the data accumulated from more elaborate methods. (author)

  3. Parameter degeneracies in neutrino oscillation measurement of leptonic CP and T violation

    International Nuclear Information System (INIS)

    Minakata, Hisakazu; Nunokawa, Hiroshi; Parke, Stephen

    2002-01-01

    The measurement of the mixing angle θ 13 , sign of Δm 13 2 , and the CP or T violating phase δ is fraught with ambiguities in neutrino oscillation. In this paper we give an analytic treatment of the parameter degeneracies associated with measuring the ν μ →ν e probability and its CP and/or T conjugates. For CP violation, we give explicit solutions to allow us to obtain the regions where there exist twofold and fourfold degeneracies. We calculate the fractional differences, (Δθ/θ-bar), between the allowed solutions which may be used to compare with the expected sensitivities of the experiments. For T violation we show that there is always a complete degeneracy between solutions with positive and negative Δm 13 2 which arises due to a symmetry and cannot be removed by observing one neutrino oscillation probability and its T conjugate. Thus there is always a fourfold parameter degeneracy apart from exceptional points. Explicit solutions are also given and the fractional differences are computed. The biprobability CP/T trajectory diagrams are extensively used to illuminate the nature of the degeneracies

  4. Measurements of Parameters Controlling the Emissions of Organophosphate Flame Retardants in Indoor Environments.

    Science.gov (United States)

    Liang, Yirui; Liu, Xiaoyu; Allen, Matthew R

    2018-05-15

    Emission of semivolatile organic compounds (SVOCs) from source materials usually occurs very slowly in indoor environments due to their low volatility. When the SVOC emission process is controlled by external mass transfer, the gas-phase concentration in equilibrium with the material ( y 0 ) is used as a key parameter to simplify the source models that are based on solid-phase diffusion. A material-air-material (M-A-M) configured microchamber method was developed to rapidly measure y 0 for a polyisocyanurate rigid foam material containing organophosphate flame retardants (OPRFs). The emission test was conducted in 44 mL microchambers for target OPFRs, including tris(2-chloroethyl) phosphate (CASRN: 115-96-8), tris(1-chloro-2-propyl) phosphate (CASRN: 13674-84-5), and tris(1,3-dichloro-2-propyl) phosphate (CASRN: 13674-87-8). In addition to the microchamber emission test, two other types of tests were conducted to determine y 0 for the same foam material: OPFR diffusive tube sampling tests from the OPFR source foam using stainless-steel thermal desorption tubes and sorption tests of OPFR on an OPFR-free foam in a 53 L small chamber. Comparison of parameters obtained from the three methods suggests that the discrepancy could be caused by a combination of theoretical, experimental, and computational differences. Based on the y 0 measurements, a linear relationship between the ratio of y 0 to saturated vapor pressure concentration and material-phase mass fractions has been found for phthalates and OPFRs.

  5. Towards quantitative measurements of relaxation times and other parameters in the brain

    International Nuclear Information System (INIS)

    Tofts, P.S.; Du Boulay, E.P.G.H.

    1990-01-01

    The nature and physical significance of the relaxation times T1 and T2 and of proton density are described. Methods of measuring T1 and T2 are discussed with emphasis on the establishment of precision and the maintenance of accuracy. Reported standards of success are briefly reviewed. We expect sensitivities of the order of 1% to be achievable in serial studies. Although early hopes of disease diagnosis by tissue characterisation were not realised, strict scientific method and careful calibration have made it pracitcable to apply relaxation time measurement to research into disease process. Serial measurements in patients and correlation with similar studies in animal models, biopsy results and autopsy material taken together have provided new knowledge about cerebral oedema, water compartmentation, alcoholism and the natural history of multiple sclerosis. There are prospects of using measurement to monitor treatment in other diseases with diffuse brain abnormalities invisible on the usual images. Secondarily derived parameters and notably the quantification of blood-brain barrier defect after injection of Gadolinium-DTPA also offer prospects of valuable data. (orig.)

  6. A method to measure the thermal-physical parameter of gas hydrate in porous media

    Energy Technology Data Exchange (ETDEWEB)

    Diao, S.B.; Ye, Y.G.; Yue, Y.J.; Zhang, J.; Chen, Q.; Hu, G.W. [Qingdao Inst. of Marine Geology, Qingdao (China)

    2008-07-01

    It is important to explore and make good use of gas hydrates through the examination of the thermal-physical parameters of sediment. This paper presented a new type of simulation experiment using a device that was designed based on the theories of time domain reflection and transient hot wire method. A series of investigations were performed using this new device. The paper described the experiment, with reference to the experiment device and materials and method. It also presented the results of thermal physical properties; result of the thermal conductivity of water, dry sand and wet sand; and results of wet sand under various pressures. The time domain reflection (TDR) method was utilized to monitor the saturation of the hydrates. Both parallel hot-wire method and cross hot-wire method were utilized to measure the thermal conductivity of the gas hydrate in porous media. A TDR sensor which was equipped with both cross hot-wire probe and parallel hot-wire probe was developed in order to measure the cell temperature with these two methods at one time. It was concluded that the TDR probe could be taken as an online measurement skill in investigating the hydrate thermal physical property in porous media. The TDR sensor could monitor the hydrate formation process and the parallel hot-wire method and cross hot-wire method could effectively measure the thermal physical properties of the hydrates in porous media. 10 refs., 7 figs.

  7. A Measurement of the Parity Violating Parameter Ab with a Muon Tag at the SLD

    Energy Technology Data Exchange (ETDEWEB)

    Bellodi, Giulia

    2001-02-12

    We present a direct measurement of the parity violation parameter A{sub b}, derived from the left-right forward-backward asymmetry of b quarks tagged via muons from semileptonic decays. The value of A{sub b} is extracted using a maximum likelihood fit to the differential cross section for fermion production. The novelty of this measurement consists in the use of topological vertexing information alongside the more traditional decay kinematics to discriminate among the different sources of tagged leptons. The small and stable SLC beam spot and the CCD based vertex detector are used to reconstruct secondary decay vertices and to provide precise kinematic information and a highly efficient and pure B mass tag. A multivariate approach has been used, with a total of 4 tagging variables, whose correlation with each other has been taken into account. The final result has been cross-checked both with a classical cut-and-count method and combining all the information into a neural net. Based on the full SLD dataset of 550K Z{sup 0} events with highly polarized electron beams, this measurement represents an improvement of a factor of 2 with respect to the previously published result (1993-1995 only and with no vertexing information). The statistical sensitivity achieved is around 4% for A{sub b}, making this a world-class single measurement. An estimate of A{sub c} has been simultaneously derived from a common fit, with a precision of about 10%.

  8. Determination of the kinetic parameters of the CALIBAN metallic core reactor from stochastic neutron measurements

    Energy Technology Data Exchange (ETDEWEB)

    Casoli, P.; Authier, N.; Chapelle, A. [Commissariat a l' Energie Atomique et Aux Energies Alternatives, CEA, DAM, F-21120 Is sur Tille (France)

    2012-07-01

    Several experimental devices are operated by the Criticality and Neutron Science Research Dept. of the CEA Valduc Laboratory. One of these is the Caliban metallic core reactor. The purpose of this study is to develop and perform experiments allowing to determinate some of fundamental kinetic parameters of the reactor. The prompt neutron decay constant and particularly its value at criticality can be measured with reactor noise techniques such as Rossi-{alpha} and Feynman variance-to-mean methods. Subcritical, critical, and even supercritical experiments were performed. Fission chambers detectors were put nearby the core and measurements were analyzed with the Rossi-{alpha} technique. A new value of the prompt neutron decay constant at criticality was determined, which allows, using the Nelson number method, new evaluations of the effective delayed neutron fraction and the in core neutron lifetime. As an introduction of this paper, some motivations of this work are given in part 1. In part 2, principles of the noise measurements experiments performed at the CEA Valduc Laboratory are reminded. The Caliban reactor is described in part 3. Stochastic neutron measurements analysis techniques used in this study are then presented in part 4. Results of fission chamber experiments are summarized in part 5. Part 6 is devoted to the current work, improvement of the experimental device using He 3 neutron detectors and first results obtained with it. Finally, conclusions and perspectives are given in part 7. (authors)

  9. DEVICE FOR MEASURING OF THERMAL LENS PARAMETERS IN LASER ACTIVE ELEMENTS WITH A PROBE BEAM METHOD

    Directory of Open Access Journals (Sweden)

    A. N. Zakharova

    2015-01-01

    Full Text Available We have developed a device for measuring of parameters of thermal lens (TL in laser active elements under longitudinal diode pumping. The measurements are based on the probe beam method. This device allows one to determine sign and optical power of the lens in the principal meridional planes, its sensitivity factor with respect to the absorbed pump power and astigmatism degree, fractional heat loading which make it possible to estimate integral impact of the photoelastic effect to the formation of TL in the laser element. The measurements are performed in a linearly polarized light at the wavelength of 532 nm. Pumping of the laser element is performed at 960 nm that makes it possible to study laser materials doped with Yb3+ and (Er3+, Yb3+ ions. The precision of measurements: for sensitivity factor of TL – 0,1 m-1/W, for astigmatism degree – 0,2 m-1/W, for fractional heat loading – 5 %, for the impact of the photoelastic effect – 0,5 × 10-6 K-1. This device is used for characterization of thermal lens in the laser active element from an yttrium vanadate crystal, Er3+,Yb3+:YVO .

  10. Method to measure autonomic control of cardiac function using time interval parameters from impedance cardiography

    International Nuclear Information System (INIS)

    Meijer, Jan H; Boesveldt, Sanne; Elbertse, Eskeline; Berendse, H W

    2008-01-01

    The time difference between the electrocardiogram and impedance cardiogram can be considered as a measure for the time delay between the electrical and mechanical activities of the heart. This time interval, characterized by the pre-ejection period (PEP), is related to the sympathetic autonomous nervous control of cardiac activity. PEP, however, is difficult to measure in practice. Therefore, a novel parameter, the initial systolic time interval (ISTI), is introduced to provide a more practical measure. The use of ISTI instead of PEP was evaluated in three groups: young healthy subjects, patients with Parkinson's disease, and a group of elderly, healthy subjects of comparable age. PEP and ISTI were studied under two conditions: at rest and after an exercise stimulus. Under both conditions, PEP and ISTI behaved largely similarly in the three groups and were significantly correlated. It is concluded that ISTI can be used as a substitute for PEP and, therefore, to evaluate autonomic neuropathy both in clinical and extramural settings. Measurement of ISTI can also be used to non-invasively monitor the electromechanical cardiac time interval, and the associated autonomic activity, under physiological circumstances

  11. Evaluation of nuclear parameters measurements realized during the Angra-1 reactor start-up tests and the theoretical previsions of these parameters

    International Nuclear Information System (INIS)

    Fernandes, V.B.; Ponzoni Filho, P.; Perrotta, J.A.; Silva Ipojuca, T. da

    1982-01-01

    A summary of measuring techniques and the results of the follow nuclear parameters, are presented: a) reactivity of various control bank; b) capacity of reactor shutdown; c) critical concentrations of soluble boron for various core configurations; d) reactivity isothermal coefficients; e) power mapping; f) power reactivity coefficients. (E.G.) [pt

  12. Pressure drop and arterial compliance - Two arterial parameters in one measurement.

    Science.gov (United States)

    Rotman, Oren M; Zaretsky, Uri; Shitzer, Avraham; Einav, Shmuel

    2017-01-04

    Coronary artery pressure-drop and distensibility (compliance) are two major, seemingly unrelated, parameters in the cardiovascular clinical setting, which are indicative of coronary arteries patency and atherosclerosis severity. While pressure drop is related to flow, and therefore serves as a functional indicator of a stenosis severity, the arterial distensibility is indicative of the arterial stiffness, and hence the arterial wall composition. In the present study, we hypothesized that local pressure drops are dependent on the arterial distensibility, and hence can provide information on both indices. The clinical significance is that a single measurement of pressure drop could potentially provide both functional and bio-mechanical metrics of lesions, and thus assist in real-time decision making prior to stenting. The goal of the current study was to set the basis for understanding this relationship, and define the accuracy and sensitivity required from the pressure measurement system. The investigation was performed using numerical fluid-structure interaction (FSI) simulations, validated experimentally using our high accuracy differential pressure measurement system. Simplified silicone mock coronary arteries with zero to intermediate size stenoses were used, and various combinations of arterial distensibility, diameter, and flow rate were simulated. Results of hyperemic flow cases were also compared to fractional flow reserve (FFR). The results indicate the potential clinical superiority of a high accuracy pressure drop-based parameter over FFR, by: (i) being more lesion-specific, (ii) the possibility to circumvent the FFR dependency on pharmacologically-induced hyperemia, and, (iii) by providing both functional and biomechanical lesion-specific information. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Research on CO2 ejector component efficiencies by experiment measurement and distributed-parameter modeling

    International Nuclear Information System (INIS)

    Zheng, Lixing; Deng, Jianqiang

    2017-01-01

    Highlights: • The ejector distributed-parameter model is developed to study ejector efficiencies. • Feasible component and total efficiency correlations of ejector are established. • New efficiency correlations are applied to obtain dynamic characteristics of EERC. • More suitable fixed efficiency value can be determined by the proposed correlations. - Abstract: In this study we combine the experimental measurement data and the theoretical model of ejector to determine CO 2 ejector component efficiencies including the motive nozzle, suction chamber, mixing section, diffuser as well as the total ejector efficiency. The ejector is modeled utilizing the distributed-parameter method, and the flow passage is divided into a number of elements and the governing equations are formulated based on the differential equation of mass, momentum and energy conservation. The efficiencies of ejector are investigated under different ejector geometric parameters and operational conditions, and the corresponding empirical correlations are established. Moreover, the correlations are incorporated into a transient model of transcritical CO 2 ejector expansion refrigeration cycle (EERC) and the dynamic simulations is performed based on variable component efficiencies and fixed values. The motive nozzle, suction chamber, mixing section and diffuser efficiencies vary from 0.74 to 0.89, 0.86 to 0.96, 0.73 to 0.9 and 0.75 to 0.95 under the studied conditions, respectively. The response diversities of suction flow pressure and discharge pressure are obvious between the variable efficiencies and fixed efficiencies referring to the previous studies, while when the fixed value is determined by the presented correlations, their response differences are basically the same.

  14. Monte Carlo calculations and experimental measurements of dosimetric parameters of the IRA-103Pd source

    International Nuclear Information System (INIS)

    Sadeghi, Mahdi; Hosseini, Hamed; Raisali, Gholamreza

    2008-01-01

    Full text: The use of 103 Pd seed sources for permanent prostate implantation has become a popular brachytherapy application. As recommended by AAPM the dosimetric characteristics of the new source must be determined using experimental and Monte Carlo simulations, before its use in clinical applications thus The goal of this report is the experimental and theoretical determination of the dosimetric characteristics of this source following the recommendations in the AAPM TG-43U1 protocol. Figure 1 shows the geometry of the IRA- 103 Pd source. The source consists of a cylindrical silver core, 0.3 cm long x 0.05 cm in diameter, onto which 0.5 nm layer of 103 Pd has been uniformly adsorbed. The effective active length of source is 0.3 cm and the silver core encapsulated inside a hollow titanium tube with 0.45 cm long, 0.07 cm and 0.08 inner and outer diameters and two caps. The Monte Carlo N-Particle (MCNP) code, version 4C, was used to determine the relevant dosimetric parameters of the source. The geometry of the Monte Carlo simulation performed in this study consisted of a sphere with 30 cm diameter. Dose distributions around this source were measured in two Perspex phantom using enough TLD chips. For these measurements, slabs of Perspex material were machined to accommodate the source and TLD chips. A value of 0.67± 1% cGy.h -1 .U -1 for, Λ, was calculated as the ratio of d(r 0 ,θ 0 ) and s K , that may be compared with Λ values obtained for 103 Pd sources. Result of calculations and measurements values of dosimetric parameters of the source including radial dose function, g(r), and anisotropy function, F(r,θ), has been shown in separate figures. The radial dose function, g(r), for the IRA- 103 Pd source and other 103 Pd sources is included in Fig. 2. Comparison between measured and Monte Carlo simulated dose function, g(r), and anisotropy function, F(r,θ), of this source demonstrated that they are in good agreement with each other and The value of Λ is

  15. Parameters for HL-LHC aperture calculations and comparison with aperture measurements

    CERN Document Server

    Bruce, R; Fartoukh, S; Giovannozzi, M; Redaelli, S; Tomas, R; Wenninger, J

    2014-01-01

    When β∗ is squeezed to smaller values in the LHC, the beam size in the inner triplet increases so that the aperture risks to be exposed to unwanted beam losses. A 2D calculation model was used during the design stage to study the aperture margins, both there and at other potential bottlenecks. Based on assumptions on orbit and optics errors, as well as mechanical tolerances, it gives the available aperture in units of the RMS beam size, which can be compared with what can be protected by the collimation system. During the LHC Run I in 2010-2013, several of the error tolerances have been found smaller than the design assumptions. Furthermore, the aperture has been measured with beam several times and the results are compatible with a very well aligned machine, with results close to the design values. In this report, we therefore review the assumptions in the model and propose an updated set of input parameters to be used for aperture calculations at top energy in HL-LHC. The new parameter set is based on th...

  16. Parameters of calibration of the measurement system of 222 Rn based in LR-115

    International Nuclear Information System (INIS)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

    2003-01-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  17. Measurement of traffic parameters in image sequence using spatio-temporal information

    International Nuclear Information System (INIS)

    Lee, Daeho; Park, Youngtae

    2008-01-01

    This paper proposes a novel method for measurement of traffic parameters, such as the number of passed vehicles, velocity and occupancy rate, by video image analysis. The method is based on a region classification followed by spatio-temporal image analysis. Local detection region images in traffic lanes are classified into one of four categories: the road, the vehicle, the reflection and the shadow, by using statistical and structural features. Misclassification at a frame is corrected by using temporally correlated features of vehicles in the spatio-temporal image. This capability of error correction results in the accurate estimation of traffic parameters even in high traffic congestion. Also headlight detection is employed for nighttime operation. Experimental results show that the accuracy is more than 94% in our test database of diverse operating conditions such as daytime, shadowy daytime, highway, urban way, rural way, rainy day, snowy day, dusk and nighttime. The average processing time is 30 ms per frame when four traffic lanes are processed, and real-time operation could be realized while ensuring robust detection performance even for high-speed vehicles up to 150 km h −1

  18. Identification of Capacitive MEMS Accelerometer Structure Parameters for Human Body Dynamics Measurements

    Directory of Open Access Journals (Sweden)

    Vincas Benevicius

    2013-08-01

    Full Text Available Due to their small size, low weight, low cost and low energy consumption, MEMS accelerometers have achieved great commercial success in recent decades. The aim of this research work is to identify a MEMS accelerometer structure for human body dynamics measurements. Photogrammetry was used in order to measure possible maximum accelerations of human body parts and the bandwidth of the digital acceleration signal. As the primary structure the capacitive accelerometer configuration is chosen in such a way that sensing part measures on all three axes as it is 3D accelerometer and sensitivity on each axis is equal. Hill climbing optimization was used to find the structure parameters. Proof-mass displacements were simulated for all the acceleration range that was given by the optimization problem constraints. The final model was constructed in Comsol Multiphysics. Eigenfrequencies were calculated and model’s response was found, when vibration stand displacement data was fed into the model as the base excitation law. Model output comparison with experimental data was conducted for all excitation frequencies used during the experiments.

  19. Automated criterion-based analysis for Cole parameters assessment from cerebral neonatal electrical bioimpedance spectroscopy measurements

    International Nuclear Information System (INIS)

    Seoane, F; Lindecrantz, Kaj; Ward, L C; Lingwood, B E

    2012-01-01

    Hypothermia has been proven as an effective rescue therapy for infants with moderate or severe neonatal hypoxic ischemic encephalopathy. Hypoxia-ischemia alters the electrical impedance characteristics of the brain in neonates; therefore, spectroscopic analysis of the cerebral bioimpedance of the neonate may be useful for the detection of candidate neonates eligible for hypothermia treatment. Currently, in addition to the lack of reference bioimpedance data obtained from healthy neonates, there is no standardized approach established for bioimpedance spectroscopy data analysis. In this work, cerebral bioimpedance measurements (12 h postpartum) in a cross-section of 84 term and near-term healthy neonates were performed at the bedside in the post-natal ward. To characterize the impedance spectra, Cole parameters (R 0 , R ∞ , f C and α) were extracted from the obtained measurements using an analysis process based on a best measurement and highest likelihood selection process. The results obtained in this study complement previously reported work and provide a standardized criterion-based method for data analysis. The availability of electrical bioimpedance spectroscopy reference data and the automatic criterion-based analysis method might support the development of a non-invasive method for prompt selection of neonates eligible for cerebral hypothermic rescue therapy. (paper)

  20. Measurement of the leptonic mixing parameter θ13 at the reactor antineutrino experiment Double Chooz

    International Nuclear Information System (INIS)

    Durand, V.

    2014-01-01

    The Double Chooz experiment aims at measuring the neutrino mixing parameter θ 13 by studying the oscillations of ν-bar e produced by the Chooz nuclear reactors located in France. The experimental concept consists in comparing the signal of 2 identical 10.3 m 3 detectors, allowing the cancellation of most of the experimental systematic uncertainties. The near detector, whose goal is the flux normalization and a measurement without oscillation, is expected to be delivered in 2013. The farthest detector from the source is taking data since april 2011 and is sensitive to θ 13 , which is expected to affect both the rate and the shape of measured ν-bar e . In 102 days with far detector only, 4121 ν-bar e candidates have been observed, while the expectation in case of no-oscillation is 4344 ± 165 events. This deficit is interpreted as evidence for ν-bar e disappearance. From a rate and shape analysis, it is found that sin 2 (θ 13 ) = [0.086±0.041(stat.)±0.030(syst)] with Δm 31 2 =2.4*10 -3 eV 2 , while the no-oscillation hypothesis is even excluded at 94.6%. We present in this document the concept and detection method of the Double Chooz experiment, along with its analysis strategy and first results on θ 13 . (author)

  1. Local drift parameter, j/n/sub e/ and resistivity anomaly measurements in CTX spheromaks

    International Nuclear Information System (INIS)

    Hoida, H.W.; Barnes, C.W.; Henins, I.; Jarboe, T.R.; Marklin, G.; Buchenauer, C.J.; Knox, S.O.

    1985-01-01

    In a spheromak, the magnetic fields confining the plasma are generated primarily by internal currents rather than external coils. In order to provide information on the possible existence of current-driven microinstabilities, localized measurements of the ratio of the drift velocity of the electrons generating the internal current to their thermal velocity, V/sub d//V/sub th/ proportional to j/n/sub e/√T/sub e/ (known as the drift or streaming parameter), and j/n/sub e/ (proportional to V/sub d/) are needed. These microinstabilities are in some theories associated with an increase in the resistivity anomaly factor (eta/eta/sub Spitzer/). We present results on local measurements (at the magnetic axis) of the values of V/sub d//V/sub th/ and eta/eta/sub Spitzer/ by combining data from the spatially-resolved diagnostics employed on the CTX spheromak experiment, coupled with current density profile information from equilibrium measurements. The values of V/sub d//V/sub th/ and j/n/sub e/ appear to be correlated with local variations in eta/eta/sub Spitzer/, and can be changed by varying the plasma density. Data sets are presented for three values of n/sub e/

  2. Information-Measuring System to Control the Electrical and Mechanical Motor Parameters

    Directory of Open Access Journals (Sweden)

    K. S. Ermakov

    2015-01-01

    Full Text Available The article considers the issue of creating an information-measuring system for an asynchronous motor. The presented system allows ensuring the failure-free protection of electromotor, considerably reducing costs of its unplanned repair, and reduced economical loss from idle time of the electric motor.The developed system comprises a mathematical model and two subsystems to measure electrical and mechanical parameters of the asynchronous motor.The electrical subsystem comprises a FLUKE company recording multi-meter a signal from which passes through the block of intervals and coding and comes to PC.The mechanical subsystem uses technical tools of phase-chronometric method. This method developed at the department of Metrology and Interchangeability allows an increasing efficiency of developed informative-measuring system. Mathematical modeling is used to link information from subsystems (electrical and mechanical to electromotor construction.The work conducted mathematical modeling of some defects of electric motor, namely: rupture of rotor winding and line surge.The mathematical model in Mathcad was based on a modified formula of Kloss. It allows us to tie the average current value of the torque of the induction motor with shaft speed and take into account the effect of the frequency and voltage.The Matlab Simulink (the package for visual programming environment was used to simulate a rupture of the rotor winding. Simulation results showed how the phase currents of the electric motor changed with the winding rupture.The developed information-measuring system has a number of advantages over traditional systems used in this field (vibration-based diagnostics systems. It will allow an increasing efficiency of the system for diagnostics of electrical machines created on the basis of this information-measuring system.

  3. Precision neutral current asymmetry parameter measurements from the Tau polarization at LEP

    International Nuclear Information System (INIS)

    Abbiendi, G.; Aakesson, P.F.

    2001-01-01

    Measurements of the τ lepton polarization and forward-backward polarization asymmetry near the Z 0 resonance using the OPAL detector are described. The measurements are based on analyses of τ→ν e ν τ , τ→μν μ ν τ , τ→πν τ , τ→ρν τ and τ→ 1 ν τ decays from a sample of 144,810 e + e - →τ + τ - candidates corresponding to an integrated luminosity of 151 pb -1 . Assuming that the τ lepton decays according to V-A theory, we measure the average τ polarization near √(s) =M Z to be left angle P τ right angle = (-14.10 ±0.73 ±0.55)% and the τ polarization forward-backward asymmetry to be A pol FB = (-10.55 ±0.76 ±0.25)%, where the first error is statistical and the second systematic. Taking into account the small effects of the photon propagator, photon-Z 0 interference and photonic radiative corrections, these results can be expressed in terms of the lepton neutral current asymmetry parameters: A τ =0.1456±0.0076±0.0057, A e =0.1454±0.0108±0.0036. These measurements are consistent with the hypothesis of lepton universality and combine to give A l = 0.1455 ±0.0073. Within the context of the Standard Model this combined result corresponds to =0.23172 ±0.00092. Combing these results with those from the other OPAL neutral current measurements yields a value of =0.23211 ±0.00068. (orig.)

  4. The measurement, control, and validation of critical parameters in an electron beam sterilization facility

    International Nuclear Information System (INIS)

    Burns, P.; Drewell, N.H.; McKeown, J.

    1996-01-01

    The delivery and validation of a specified dose to a medical device are key concerns of operators of electron beam irradiation facilities. In an IMPELA-based irradiator, four of the parameters that directly influence the absorbed dose distribution in the product are controllable in real time - the electron energy, average beam current, scanned area, and the product exposure time. The 10 MeV accelerator operates at 50 kW with a stream of 200 μs wide, 100 mA pulses at a repetition rate of 250 Hz. The combination of short-term intra-pulse regulation with long-term pulse-to-pulse stability makes the IMPELA output attractive for the sterilization of medical products. The measurement and closed-loop control techniques used in the IMPELA design will be described with reference to facilitating compliance with medical sterilization standards. (orig.)

  5. The importance of risk-aversion as a measurable psychological parameter governing risk-taking behaviour

    Science.gov (United States)

    Thomas, P. J.

    2013-09-01

    A utility function with risk-aversion as its sole parameter is developed and used to examine the well-known psychological phenomenon, whereby risk averse people adopt behavioural strategies that are extreme and apparently highly risky. The pioneering work of the psychologist, John W. Atkinson, is revisited, and utility theory is used to extend his mathematical model. His explanation of the psychology involved is improved by regarding risk-aversion not as a discrete variable with three possible states: risk averse, risk neutral and risk confident, but as continuous and covering a large range. A probability distribution is derived, the "motivational density", to describe the process of selecting tasks of different degrees of difficulty. An assessment is then made of practicable methods for measuring risk-aversion.

  6. The importance of risk-aversion as a measurable psychological parameter governing risk-taking behaviour

    International Nuclear Information System (INIS)

    Thomas, P J

    2013-01-01

    A utility function with risk-aversion as its sole parameter is developed and used to examine the well-known psychological phenomenon, whereby risk averse people adopt behavioural strategies that are extreme and apparently highly risky. The pioneering work of the psychologist, John W. Atkinson, is revisited, and utility theory is used to extend his mathematical model. His explanation of the psychology involved is improved by regarding risk-aversion not as a discrete variable with three possible states: risk averse, risk neutral and risk confident, but as continuous and covering a large range. A probability distribution is derived, the m otivational density , to describe the process of selecting tasks of different degrees of difficulty. An assessment is then made of practicable methods for measuring risk-aversion

  7. A domain decomposition approach for full-field measurements based identification of local elastic parameters

    KAUST Repository

    Lubineau, Gilles

    2015-03-01

    We propose a domain decomposition formalism specifically designed for the identification of local elastic parameters based on full-field measurements. This technique is made possible by a multi-scale implementation of the constitutive compatibility method. Contrary to classical approaches, the constitutive compatibility method resolves first some eigenmodes of the stress field over the structure rather than directly trying to recover the material properties. A two steps micro/macro reconstruction of the stress field is performed: a Dirichlet identification problem is solved first over every subdomain, the macroscopic equilibrium is then ensured between the subdomains in a second step. We apply the method to large linear elastic 2D identification problems to efficiently produce estimates of the material properties at a much lower computational cost than classical approaches.

  8. Measurement of $\\omega$ meson parameters in $\\pi^{+}\\pi^{-}\\pi^{0}$ decay mode with CMD-2

    CERN Document Server

    Akhmetshin, R R; Aulchenko, V M; Banzarov, V S; Barkov, L M; Baru, S E; Bashtovoy, N S; Bondar, A E; Bondarev, D V; Chernyak, D V; Dhawan, S K; Eidelman, S I; Fedotovich, G V; Gabyshev, N I; Grebeniuk, A A; Grigoriev, D N; Hughes, V W; Khazin, B I; Koop, I A; Kurdadze, L M; Kuzmin, A S; Logashenko, I B; Lukin, P A; Lysenko, A P; Nesterenko, I N; Okhapkin, V S; Perevedentsev, E A; Polunin, A A; Purlatz, T A; Root, N I; Ruban, A A; Ryskulov, N M; Shamov, A G; Shatunov, Yu M; Shekhtman, A I; Sher, A E; Shwartz, B A; Sidorov, V A; Skrinsky, A N; Smakhtin, V P; Snopkov, I G; Solodov, E P; Stepanov, P Yu; Sukhanov, A Yu; Thompson, J A; Titov, V M; Valishev, A A; Yudin, Yu V; Zverev, S G

    2000-01-01

    About 11 200 $ e^+e^- \\to \\omega \\to \\pi^+\\pi^-\\pi^0$ events selected in the center of mass energy range from 760 to 810 MeV were used for the measurement of the $\\omega$ meson parameters. The following results have been obtained: $\\sigma _{0}=(1457 \\pm 23 \\pm 19 )$ nb, $m_{\\omega }=(782.71 \\pm 0.07 \\pm 0.04)$ MeV/c$^{2}$, $\\Gamma _{\\omega }=(8.68 \\pm 0.23 \\pm 0.10 )$ MeV, $\\Gamma _{e^+e^-}\\cdot$Br$(ømega \\to \\pi^+\\pi^-\\pi^0)= (0.528 \\pm 0.012 \\pm 0.007) \\cdot 10^{-3}$ MeV.

  9. Final Report: Medium Energy Measurements of N-N Parameters, April 1, 1994 - September 30, 1996

    International Nuclear Information System (INIS)

    Ambrose, David; Betts, Wayne; Coffey, Patrick; Glass, George; McDonough, James; Riley, Peter; Tang, Jaw-Luen

    1998-01-01

    Our research program had four main thrusts, only one of which can be considered as measurements of N-N parameters: (1) Finishing the data analyses associated with recent LAMPF and TRIUMPF N-N experiments, whose overall purpose has been the determination of the nucleon-nucleon amplitudes, both for isospin 0 and 1 at medium energies; (2) continuing work on BNL E871, a search for rare decay modes of the KL; (3) work on the RHIC-STAR project, an experiment to create and study a quark gluon plasma and nuclear matter at high energy density; (4) beginning a new AGS experiment (E896) which will search for the lowest mass state of the predicted strange di-baryons, the Ho, and other exotic states of nuclear matter through nucleus-nucleus collisions

  10. Measuring opto-thermal parameters of basalt fibers using digital holographic microscopy.

    Science.gov (United States)

    Yassien, Khaled M; Agour, Mostafa

    2017-02-01

    A method for studying the effect of temperature on the optical properties of basalt fiber is presented. It is based on recording a set of phase-shifted digital holograms for the sample under the test. The holograms are obtained utilizing a system based on Mach-Zehnder interferometer, where the fiber sample inserted in an immersion liquid is placed within a temperature controlled chamber. From the recorded digital holograms the optical path differences which are used to calculate the refractive indices are determined. The accuracy in the measurement of refractive indices is in the range of 4 × 10 -4 . The influence of temperature on the dispersion parameters, polarizability per unit volume and dielectric susceptibility are also obtained. Moreover, the values of dispersion and oscillation energies and Cauchy's constants are provided at different temperatures. © 2016 Wiley Periodicals, Inc.

  11. Standardized uptake value in pediatric patients: an investigation to determine the optimum measurement parameter

    International Nuclear Information System (INIS)

    Yeung, H.W.; Squire, O.D.; Larson, S.M.; Erdi, Y.E.; Sanches, A.; Macapinlac, H.A.

    2002-01-01

    Although the standardized uptake value (SUV) is currently used in fluorine-18 fluorodeoxyglucose positron emission tomography (FDG-PET) imaging, concerns have been raised over its accuracy and clinical relevance. Dependence of the SUV on body weight has been observed in adults and this should be of concern in the pediatric population, since there are significant body changes during childhood. The aim of the present study was to compare SUV measurements based on body weight, body surface area and lean body mass in the pediatric population and to determine a more reliable parameter across all ages. Sixty-eight pediatric FDG-PET studies were evaluated. Age ranged from 2 to 17 years and weight from 11 to 77 kg. Regions of interest were drawn at the liver for physiologic comparison and at FDG-avid malignant lesions. SUV based on body weight (SUV bw ) varied across different weights, a phenomenon less evident when body surface area (SUV bsa ) normalization is applied. Lean body mass-based SUV (SUV lbm ) also showed a positive correlation with weight, which again was less evident when normalized to bsa (SUV bsa-lbm ). The measured liver SUV bw was 1.1±0.3, a much lower value than in our adult population (1.9±0.3). The liver SUV bsa was 7.3±1.3. The tumor sites had an SUV bw of 4.0±2.7 and an SUV bsa of 25.9±15.4 (65% of the patients had neuroblastoma). The bsa-based SUVs were more constant across the pediatric ages and were less dependent on body weight than the SUV bw . These results indicate that SUV calculated on the basis of body surface area is a more uniform parameter than SUV based on body weight in pediatric patients and is probably the most appropriate approach for the follow-up of these patients. (orig.)

  12. Measurement and analysis of geometric parameters of human carotid bifurcation using image post-processing technique

    International Nuclear Information System (INIS)

    Xue Yunjing; Gao Peiyi; Lin Yan

    2008-01-01

    Objective: To investigate variation in the carotid bifurcation geometry of adults of different age by MR angiography images combining image post-processing technique. Methods: Images of the carotid bifurcations of 27 young adults (≤40 years old) and 30 older subjects ( > 40 years old) were acquired via contrast-enhanced MR angiography. Three dimensional (3D) geometries of the bifurcations were reconstructed and geometric parameters were measured by post-processing technique. Results: The geometric parameters of the young versus older groups were as follows: bifurcation angle (70.268 degree± 16.050 degree versus 58.857 degree±13.294 degree), ICA angle (36.893 degree±11.837 degree versus 30.275 degree±9.533 degree), ICA planarity (6.453 degree ± 5.009 degree versus 6.263 degree ±4.250 degree), CCA tortuosity (0.023±0.011 versus 0.014± 0.005), ICA tortuosity (0.070±0.042 versus 0.046±0.022), ICA/CCA diameter ratio (0.693± 0.132 versus 0.728±0.106), ECA/CCA diameter ratio (0.750±0.123 versus 0.809±0.122), ECA/ ICA diameter ratio (1.103±0.201 versus 1.127±0.195), bifurcation area ratio (1.057±0.281 versus 1.291±0.252). There was significant statistical difference between young group and older group in-bifurcation angle, ICA angle, CCA tortuosity, ICA tortuosity, ECA/CCA and bifurcation area ratio (F= 17.16, 11.74, 23.02, 13.38, 6.54, 22.80, respectively, P<0.05). Conclusions: MR angiography images combined with image post-processing technique can reconstruct 3D carotid bifurcation geometry and measure the geometric parameters of carotid bifurcation in vivo individually. It provides a new and convenient method to investigate the relationship of vascular geometry and flow condition with atherosclerotic pathological changes. (authors)

  13. An Inexpensive, Implantable Electronic Sensor for Autonomous Measurement of Snow Pack Parameters

    Science.gov (United States)

    De Roo, R. D.; Haengel, E.; Rogacki, S.

    2015-12-01

    Snow accumulations on the ground are an important source of water in many parts of the world. Mapping the accumulation, usually represented as the snow water equivalent (SWE), is valuable for water resource management. The longest record of regional and global maps of SWE are from orbiting microwave radiometers, which do not directly measure SWE but rather measure the scatter darkening from the snow pack. Robustly linking the scatter darkening to SWE eludes us to this day, in part because the snow pack is highly variable in both time and space. The data needed is currently collected by hand in "snow pits," and the labor-intensive process limits the size of the data sets that can be obtained. In particular, time series measurements are only a one or two samples per day at best, and come at the expense of spatial sampling. We report on the development of a low-power wireless device that can be embedded within a snow pack to report on some of the critical parameters needed to understand scatter darkening. The device autonomously logs temperature, the microwave dielectric constant and infrared backscatter local to the device. The microwave dielectric constant reveals the snow density and the presence of liquid water, while the infrared backscatter measurement, together with the density measurement, reveals a characteristic grain size of the snow pack. The devices are made to be inexpensive (less than $200 in parts each) and easily replicated, so that many can be deployed to monitor variations vertically and horizontally in the snow pack. The low-power operation is important both for longevity of observations as well as insuring minimal anomalous metamorphism of the snow pack. The hardware required for the microwave measurement is intended for wireless communications, and this feature will soon be implemented for near real-time monitoring of snow conditions. We will report on the design, construction and initial deployment of about 30 of these devices in northern lower

  14. Reconstruction of the ion plasma parameters from the current measurements: mathematical tool

    Directory of Open Access Journals (Sweden)

    E. Séran

    Full Text Available Instrument d’Analyse du Plasma (IAP is one of the instruments of the newly prepared ionospheric mission Demeter. This analyser was developed to measure flows of thermal ions at the altitude of ~ 750 km and consists of two parts: (i retarding potential analyser (APR, which is utilised to measure the energy distribution of the ion plasma along the sensor look direction, and (ii velocity direction analyser (ADV, which is used to measure the arrival angle of the ion flow with respect to the analyser axis. The necessity to obtain quick and precise estimates of the ion plasma parameters has prompted us to revise the existing mathematical tool and to investigate different instrumental limitations, such as (i finite angular aperture, (ii grid transparency, (iii potential depression in the space between the grid wires, (iv losses of ions during their passage between the entrance diaphragm and the collector. Simple analytical expressions are found to fit the currents, which are measured by the APR and ADV collectors, and show a very good agreement with the numerical solutions. It was proven that the fitting of the current with the model functions gives a possibility to properly resolve even minor ion concentrations and to find the arrival angles of the ion flow in the multi-species plasma. The discussion is illustrated by an analysis of the instrument response in the ionospheric conditions which are predicted by the International Reference Ionosphere (IRI model.

    Key words. Ionosphere (plasma convection; instruments and techniques – Space plasma physics (experimental and mathematical techniques

  15. Reconstruction of the ion plasma parameters from the current measurements: mathematical tool

    Directory of Open Access Journals (Sweden)

    E. Séran

    2003-05-01

    Full Text Available Instrument d’Analyse du Plasma (IAP is one of the instruments of the newly prepared ionospheric mission Demeter. This analyser was developed to measure flows of thermal ions at the altitude of ~ 750 km and consists of two parts: (i retarding potential analyser (APR, which is utilised to measure the energy distribution of the ion plasma along the sensor look direction, and (ii velocity direction analyser (ADV, which is used to measure the arrival angle of the ion flow with respect to the analyser axis. The necessity to obtain quick and precise estimates of the ion plasma parameters has prompted us to revise the existing mathematical tool and to investigate different instrumental limitations, such as (i finite angular aperture, (ii grid transparency, (iii potential depression in the space between the grid wires, (iv losses of ions during their passage between the entrance diaphragm and the collector. Simple analytical expressions are found to fit the currents, which are measured by the APR and ADV collectors, and show a very good agreement with the numerical solutions. It was proven that the fitting of the current with the model functions gives a possibility to properly resolve even minor ion concentrations and to find the arrival angles of the ion flow in the multi-species plasma. The discussion is illustrated by an analysis of the instrument response in the ionospheric conditions which are predicted by the International Reference Ionosphere (IRI model.Key words. Ionosphere (plasma convection; instruments and techniques – Space plasma physics (experimental and mathematical techniques

  16. The Numerical Calculation and Experimental Measurement of the Inductance Parameters for Permanent Magnet Synchronous Motor in Electric Vehicle

    Science.gov (United States)

    Jiang, Chao; Qiao, Mingzhong; Zhu, Peng

    2017-12-01

    A permanent magnet synchronous motor with radial magnetic circuit and built-in permanent magnet is designed for the electric vehicle. Finite element numerical calculation and experimental measurement are adopted to obtain the direct axis and quadrature axis inductance parameters of the motor which are vital important for the motor control. The calculation method is simple, the measuring principle is clear, the results of numerical calculation and experimental measurement are mutual confirmation. A quick and effective method is provided to obtain the direct axis and quadrature axis inductance parameters of the motor, and then improve the design of motor or adjust the control parameters of the motor controller.

  17. Electric probe diagnostics for measuring SOL parameters, wall and divertor fluxes in KSTAR

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Heung-Su, E-mail: kimhs@nfri.re.kr [National Fusion Research Institute, Daejeon (Korea, Republic of); Bak, Jun-Gyo [National Fusion Research Institute, Daejeon (Korea, Republic of); Bae, Min-Keun; Chung, Kyu-Sun [Hanyang University, Seoul (Korea, Republic of); Hong, Suk-Ho [National Fusion Research Institute, Daejeon (Korea, Republic of)

    2016-11-01

    Highlights: • Some components in EPDs were improved to investigate characteristics of the SOL plasmas and to measure wall and divertor fluxes in the KSTAR tokamak plasmas. From the upgrades in the EPDs, the measured error of the elapsed distance for the evaluation of the SOL profiles can be reduced up to 1%. • In the SOL parameter measurement during IWL plasma, the e-folding lengths in the main SOL region lTe and lne were evaluated as 3.5 cm and 2.1 cm, respectively. • From flux measurement at the far SOL during a diverted ELMy H-mode, peaked heat flux toward to outboard wall during ELMs might be less than 1% of the peaked divertor heat flux. • The movement of an OSP during a diverted H-mode can be detected from the divertor probe measurement, and the peaked heat flux near the OSP was estimated as few MW m-2. - Abstract: Some components in electric probe diagnostics (EPDs) are improved in order to investigate characteristics of edge plasmas in the upstream scrape-off-layer (SOL) region and to measure wall and divertor fluxes during L-mode and H-mode plasma discharges in the Korea Superconducting Tokamak Advanced Research (KSTAR). From the upgrades in the EPDs, the measured error of the elapsed distance for the evaluation of the SOL profiles can be reduced up to 1% and the ion saturation current of up to 1.0 A near an outer strike point (OSP) can be measured at the divertor region. In the SOL profile measurements during L-mode and inner wall limited plasma (B{sub T} = 2.0 T, I{sub p} = 0.4 MA), the e-folding lengths in the main SOL region λ{sub Te} and λ{sub ne} are evaluated as 3.5 cm and 2.1 cm, respectively. From particle flux measurement at the far SOL region during a diverted ELMy H-mode discharge (B{sub T} = 1.8 T, I{sub p} = 0.65 MA), peaked heat flux toward to outboard wall during ELM bursts is estimated up to ∼20 k Wm{sup −2}, which may be less than 1% of the peaked divertor heat flux expected for the neutral beam (NB) heating power P{sub NB

  18. High-speed two-frame gated camera for parameters measurement of Dragon-Ⅰ LIA

    International Nuclear Information System (INIS)

    Jiang Xiaoguo; Wang Yuan; Zhang Kaizhi; Shi Jinshui; Deng Jianjun; Li Jin

    2012-01-01

    The time-resolved measurement system which can work at very high speed is necessary in electron beam parameter diagnosis for Dragon-Ⅰ linear induction accelerator (LIA). A two-frame gated camera system has been developed and put into operation. The camera system adopts the optical principle of splitting the imaging light beam into two parts in the imaging space of a lens with long focus length. It includes lens coupled gated image intensifier, CCD camera, high speed shutter trigger device based on large scale field programmable gate array. The minimum exposure time for each image is about 3 ns, and the interval time between two images can be adjusted with a step of about 0.5 ns. The exposure time and the interval time can be independently adjusted and can reach about 1 s. The camera system features good linearity, good response uniformity, equivalent background illumination (EBI) as low as about 5 electrons per pixel per second, large adjustment range of sensitivity, and excel- lent flexibility and adaptability in applications. The camera system can capture two frame images at one time with the image size of 1024 x 1024. It meets the requirements of measurement for Dragon-Ⅰ LIA. (authors)

  19. Noninvasive measurement of postocclusive parameters in human forearm blood by near infrared spectroscopy

    Science.gov (United States)

    Rao, K. Prahlad; Radhakrishnan, S.; Reddy, M. Ramasubba

    2005-04-01

    Near infrared (NIR) light in the wavelength range from 700 to 900 nm can pass through skin, bone and other tissues relatively easily. As a result, NIR techniques allow a noninvasive assessment of hemoglobin saturation for a wide range of applications, such as in the study of muscle metabolism, the diagnosis of vascular disorders, brain imaging, and breast cancer detection. Near infrared Spectroscopy (NIRS) is an effective tool to measure the hemoglobin concentration in the tissues, which can discriminate optically the oxy- and deoxy- hemoglobin species because of their different near-infrared absorption spectra. We have developed an NIRS probe consisting of a laser diode of 830 nm wavelength and a PIN photodiode in reflectance mode. We have selected a set of healthy volunteers (mean age 30, range 26-40 years) for the study. The probe is placed on forearm of each subject and the backscattered light intensity is measured by occluding the blood flow at 210, 110 and 85 mmHg pressures. Recovery time, peak time and time after 50% release of the cuff pressure are determined from the optical densities during the post occlusive state of forearm. These parameters are useful for determining the transient increase in blood flow after the release of blood occlusion. Clinically, the functional aspects of blood flow in the limbs could be evaluated noninvasively by NIRS.

  20. Measurement of the longitudinal parameters of an electron beam in a storage ring

    International Nuclear Information System (INIS)

    Krinsky, S.

    1989-01-01

    We discuss the determination of the longitudinal parameters of a bunched beam of electrons or positrons circulating in a storage ring. From the analysis of the beam current observed at a fixed azimuthal location, one can learn much about the longitudinal behavior. We present an elementary analysis of the time-dependence of the current. In particular, we discuss the determination of the average current, bunch length, synchrotron oscillation frequency, and the coherent synchrotron oscillation modes associated with longitudinal instabilities. A brief discussion is also given of the incoherent synchrotron oscillations, or Schottky noise. We review the electromagnetic field traveling with a charge in uniform motion, and introduce some of the most common devices used to detect this field: capacitive pick-up, stripline monitor, and DC beam current transformer. Our paper is organized as follows: We discuss the analysis of the time-dependence of the beam current. Then, the measurement of the current is considered. Finally, we describe some measurements of energy spread and bunch lengthening made recently at SLAC on the SLC damping ring. 12 refs., 6 figs

  1. A Comparison between Oceanographic Parameters and Seafloor Pressures; Measured, Theoretical and Modelled, and Terrestrial Seismic Data

    Science.gov (United States)

    Donne, Sarah; Bean, Christopher; Craig, David; Dias, Frederic; Christodoulides, Paul

    2016-04-01

    Microseisms are continuous seismic vibrations which propagate mainly as surface Rayleigh and Love waves. They are generated by the Earth's oceans and there are two main types; primary and secondary microseisms. Primary microseisms are generated through the interaction of travelling surface gravity ocean waves with the seafloor in shallow waters relative to the wavelength of the ocean wave. Secondary microseisms, on the other hand are generated when two opposing wave trains interact and a non-linear second order effect produces a pressure fluctuation which is depth independent. The conditions necessary to produce secondary microseisms are presented in Longuet-Higgins (1950) through the interaction of two travelling waves with the same wave period and which interact at an angle of 180 degrees. Equivalent surface pressure density (p2l) is modelled using the numerical ocean wave model Wavewatch III and this term is considered as the microseism source term. This work presents an investigation of the theoretical second order pressures generated through the interaction of travelling waves with varying wave amplitude, period and angle of incidence. Predicted seafloor pressures calculated off the Southwest coast of Ireland are compared with terrestrially recorded microseism records, measured seafloor pressures and oceanographic parameters. The work presented in this study suggests that a broad set of sea states can generate second order seafloor pressures that are consistent with seafloor pressure measurements. Local seismic arrays throughout Ireland allow us to investigate the temporal covariance of these seafloor pressures with microseism source locations.

  2. Pattern description and reliability parameters of six force-time related indices measured with plantar pressure measurements.

    Science.gov (United States)

    Deschamps, Kevin; Roosen, Philip; Bruyninckx, Herman; Desloovere, Kaat; Deleu, Paul-Andre; Matricali, Giovanni A; Peeraer, Louis; Staes, Filip

    2013-09-01

    Functional interpretation of plantar pressure measurements is commonly done through the use of ratios and indices which are preceded by the strategic combination of a subsampling method and selection of physical quantities. However, errors which may arise throughout the determination of these temporal indices/ratio calculations (T-IRC) have not been quantified. The purpose of the current study was therefore to estimate the reliability of T-IRC following semi-automatic total mapping (SATM). Using a repeated-measures design, two experienced therapists performed three subsampling sessions on three left and right pedobarographic footprints of ten healthy participants. Following the subsampling, six T-IRC were calculated: Rearfoot-Forefoot_fti, Rearfoot-Midfoot_fti, Forefoot medial/lateral_fti, First ray_fti, Metatarsal 1-Metatarsal 5_fti, Foot medial-lateral_fti. Patterns of the T-IRC were found to be consistent and in good agreement with corresponding knowledge from the literature. The inter-session errors of both therapists were similar in pattern and magnitude. The lowest peak inter-therapist error was found in the First ray_fti (6.5 a.u.) whereas the highest peak inter-therapist error was observed in the Forefoot medial/lateral_fti (27.0 a.u.) The magnitude of the inter-session and inter-therapist error varied over time, precluding the calculation of a simple numerical value for the error. The difference between both error parameters of all T-IRC was negligible which underscores the repeatability of the SATM protocol. The current study reports consistent patterns for six T-IRC and similar inter-session and inter-therapist error. The proposed SATM protocol and the T-IRC may therefore serve as basis for functional interpretation of footprint data. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Geotechnical Parameters from Seismic Measurements: Two Field Examples from Egypt and Saudi Arabia

    KAUST Repository

    Khalil, Mohamed H.; Hanafy, Sherif M.

    2016-01-01

    © 2016 EEGS. Geotechnical parameters were used to determine subsurface rock quality for construction purposes. We summarize the mathematical relationships used to calculate the geotechnical parameters from P- and S-wave velocities and density values

  4. Objective image quality parameters of relevance in practice, measured for film-screen combinations - a contribution to quality assurance activities

    International Nuclear Information System (INIS)

    Angerstein, W.; Wolf, M.

    1986-01-01

    Objective measurement of the physico-technical parameters determining the image quality is the fastest and most accurate method of quality testing of the systems. The parameters in case of X-ray intensifying screens are imaging quality, servicable life, and mechanical properties. (orig./DG) [de

  5. Estimating parameters of a forest ecosystem C model with measurements of stocks and fluxes as joint constraints

    Science.gov (United States)

    Andrew D. Richardson; Mathew Williams; David Y. Hollinger; David J.P. Moore; D. Bryan Dail; Eric A. Davidson; Neal A. Scott; Robert S. Evans; Holly. Hughes

    2010-01-01

    We conducted an inverse modeling analysis, using a variety of data streams (tower-based eddy covariance measurements of net ecosystem exchange, NEE, of CO2, chamber-based measurements of soil respiration, and ancillary ecological measurements of leaf area index, litterfall, and woody biomass increment) to estimate parameters and initial carbon (C...

  6. Measurement of Neutrino Oscillation Parameters Using Anti-fiducial Charged Current Events in MINOS

    Energy Technology Data Exchange (ETDEWEB)

    Strait, Matthew Levy [Univ. of Minnesota, Minneapolis, MN (United States)

    2010-09-01

    Abstract The Main Injector Neutrino Oscillation Search (MINOS) obse rves the disappearance of muon neutrinos as they propagate in the long baseline Neutri nos at the Main Injector (NuMI) beam. MINOS consists of two detectors. The near detector sam ples the initial composition of the beam. The far detector, 735 km away, looks for an energy-d ependent deficit in the neutrino spectrum. This energy-dependent deficit is interpreted as q uantum mechanical oscillations be- tween neutrino flavors. A measurement is made of the effective two-neutrino mixing parameters Δ m 2 ≈ Δ m 2 23 and sin 2 2 θ ≈ sin 2 2 θ 23 . The primary MINOS analysis uses charged current events in the fiducial volume of the far detector. This analysis uses the roughly equal-sized sample of events that fails the fiducial cut, consisting of interact ions outside the fiducial region of the detector and in the surrounding rock. These events provide a n independent and complementary measurement, albeit weaker due to incomplete reconstructi on of the events. This analysis reports on an exposure of 7 . 25 × 10 20 protons-on-target. Due to poor energy resolution, the meas urement of sin 2 2 θ is much weaker than established results, but the measuremen t of sin 2 2 θ > 0 . 56 at 90% confidence is consistent with the accepted value. The measur ement of Δ m 2 is much stronger. Assuming sin 2 2 θ = 1 , Δ m 2 = (2 . 20 ± 0 . 18[stat] ± 0 . 14[syst]) × 10 - -3 eV 2 .

  7. Measurement of dosimetric parameters for Hi-ART helical tomotherapy unit

    International Nuclear Information System (INIS)

    Wang Yunlai; Sha Xiangyou; Dai Xiangkun; Ma Lin; Feng Linchun; Qu Baolin

    2008-01-01

    Objective: To develop a measurement method of dosimetric parameters for Hi-ART tomotherapy unit. Methods: Percentage depth doses and beam profiles were measured using the dedicated mini water phantom, and compared to the results of 6 MV X-ray from Primus accelerator. Following the AAPM TG51 protocol, absolute dose calibration was carried out under SSD of 8.5 cm at depth of 1.5 cm for field of 5 cm x 40 cm. The output linearity and reproducibility were evaluated. The output variation with the gantry rotation was also investigated using 0.6 cm 3 ion chamber in cylindrical perplex phantom and on-board MVCT detectors. Leaf fluence output factors were quantified for the leaf of interest and its adjacent leaves. Results: The buildup depth was around 1.0 cm. The PDD values at 10 cm for Hi-ART and Primus were 59.7% and 64.7%, respectively. Varying with the field width, the lateral and longitudinal beam profiles were not so homogeneous as the Primus fields. The measured dose rate was 848.38 cGy/min. The fitted linear function between the readings of dosimeter and the irradiated time was R(nC) =-0.017 + 0.256· t(sec), with a relative coefficient of 0.999. The maximum deviation and standard deviation of output were 1.6% and less than 0.5%; The maximum deviation and standard deviation of output changed by gantry angle were 1.1% and 0.5%, respectively. Leaf fluence output factors did not increase significantly when leaves were opened beyond the two adjacent leaves. Conclusions: Hi-ART Tomotherapy unit has a very high dose output and inhomogeneous beam profiles owing to its special design of the treatment head. This may be useful in dose calculation and treatment delivery. (authors)

  8. Measuring neutrino oscillation parameters using νμ disappearance in MINOS

    International Nuclear Information System (INIS)

    Backhouse, Christopher James

    2011-01-01

    MINOS is a long-baseline neutrino oscillation experiment. It consists of two large steel-scintillator tracking calorimeters. The near detector is situated at Fermilab, close to the production point of the NuMI muon-neutrino beam. The far detector is 735 km away, 716m underground in the Soudan mine, Northern Minnesota. The primary purpose of the MINOS experiment is to make precise measurements of the 'atmospheric' neutrino oscillation parameters (Δm atm 2 and sin 2 2θ atm ). The oscillation signal consists of an energy-dependent deficit of ν μ interactions in the far detector. The near detector is used to characterize the properties of the beam before oscillations develop. The two-detector design allows many potential sources of systematic error in the far detector to be mitigated by the near detector observations. This thesis describes the details of the ν μ -disappearance analysis, and presents a new technique to estimate the hadronic energy of neutrino interactions. This estimator achieves a significant improvement in the energy resolution of the neutrino spectrum, and in the sensitivity of the neutrino oscillation fit. The systematic uncertainty on the hadronic energy scale was re-evaluated and found to be comparable to that of the energy estimator previously in use. The best-fit oscillation parameters of the ν μ -disappearance analysis, incorporating this new estimator were: Δm 2 = 2.32 -0.08 +0.12 x 10 -3 eV 2 , sin 2 2θ > 0.90 (90% C.L.). A similar analysis, using data from a period of running where the NuMI beam was operated in a configuration producing a predominantly (bar ν) μ beam, yielded somewhat different best-fit parameters Δ(bar m) 2 = (3.36 -0.40 +0.46 (stat.) ± 0.06(syst.)) x 10 -3 eV 2 , sin 2 2(bar θ) = 0.86 -0.12 0 .11 (stat.) ± 0.01(syst.). The tension between these results is intriguing, and additional antineutrino data is currently being taken in order to further investigate this apparent discrepancy.

  9. Estimation of inflation parameters for Perturbed Power Law model using recent CMB measurements

    International Nuclear Information System (INIS)

    Mukherjee, Suvodip; Das, Santanu; Souradeep, Tarun; Joy, Minu

    2015-01-01

    Cosmic Microwave Background (CMB) is an important probe for understanding the inflationary era of the Universe. We consider the Perturbed Power Law (PPL) model of inflation which is a soft deviation from Power Law (PL) inflationary model. This model captures the effect of higher order derivative of Hubble parameter during inflation, which in turn leads to a non-zero effective mass m eff for the inflaton field. The higher order derivatives of Hubble parameter at leading order sources constant difference in the spectral index for scalar and tensor perturbation going beyond PL model of inflation. PPL model have two observable independent parameters, namely spectral index for tensor perturbation ν t and change in spectral index for scalar perturbation ν st to explain the observed features in the scalar and tensor power spectrum of perturbation. From the recent measurements of CMB power spectra by WMAP, Planck and BICEP-2 for temperature and polarization, we estimate the feasibility of PPL model with standard ΛCDM model. Although BICEP-2 claimed a detection of r=0.2, estimates of dust contamination provided by Planck have left open the possibility that only upper bound on r will be expected in a joint analysis. As a result we consider different upper bounds on the value of r and show that PPL model can explain a lower value of tensor to scalar ratio (r<0.1 or r<0.01) for a scalar spectral index of n s =0.96 by having a non-zero value of effective mass of the inflaton field m 2 eff /H 2 . The analysis with WP + Planck likelihood shows a non-zero detection of m 2 eff /H 2 with 5.7 σ and 8.1 σ respectively for r<0.1 and r<0.01. Whereas, with BICEP-2 likelihood m 2 eff /H 2  = −0.0237 ± 0.0135 which is consistent with zero

  10. Ethnic differences in lens parameters measured by ocular biometry in a cataract surgery population.

    Science.gov (United States)

    Wang, Dajiang; Amoozgar, Behzad; Porco, Travis; Wang, Zhen; Lin, Shan C

    2017-01-01

    To investigate whether differences exist in lens position and other lens parameters among major ethnic groups with cataractous eyes, which may help explain racial differences in angle closure risk. This retrospective, cross-sectional study included 807 adult patients who had cataract surgery between years 2014 and 2016 at the University of California, San Francisco (UCSF). Adult patients of white, Asian, Hispanic and African-American ethnicity were included. Lens position (LP), defined as anterior chamber depth (ACD) + 1/2 lens thickness (LT), was assessed using measurements from optical biometry. Other assessed biometric parameters included axial length (AL), relative lens position (RLP) (defined as LP/AL), and anterior chamber depth (ACD). A total of 807 patients and 1361 eyes were included in this study from a database of patients having cataract surgery. Mean age was 69.2 years (age range from 18 to 101 years old), and 60.3% of patients were women. The mean LP measurements were 5.54±0.32 mm for white, 5.38±0.32 mm for Asian, 5.32±0.30 mm for Hispanic, and 5.40±0.28 mm for African-American participants. After adjusting for age, sex, and AL, significant differences were found when comparing LP in paired comparisons among White cohort with Asians (P<0.001), Hispanics (P<0.001) and African-Americans (P = 0.003). Additionally, when comparing RLP, similar significant results were found when comparing Whites with Asians (P<0.001), Hispanics (P<0.001) and African-Americans (P = 0.002). Lastly, pair-wise comparison of LT between ethnic groups showed significant differences while comparing Asians with Whites (P = 0.001) and Asians with African-Americans (P<0.001). The results of this study suggest that the LP of Hispanic, Asian, and African-American patients are significantly smaller than that of White patients, and among all ethnic groups, Hispanics and after Asians have the smallest LP (P<0.001) and RLP (P<0.001). These findings may have implications for the

  11. Relationship between lens density measurements by Pentacam Scheimpflug imaging and torsional phacoemulsification parameters

    Directory of Open Access Journals (Sweden)

    Suleyman Demircan

    2014-10-01

    Full Text Available AIM: To evaluate the relationship between the density values of the lens nucleus measured using Pentacam Scheimpflug imaging and torsional phacoemulsification dynamics such as the level of ultrasound energy, as well as the duration and amount of fluid used in patients with age-related nuclear cataract. METHODS: This was a prospective observer-masked study. Pentacam Scheimpflug imaging was performed following pupil dilation. The cataracts were automatically graded from 1 to 5 using pentacam nucleus densitometry(PND, also known as Pentacam nucleus staging(PNSsoftware by the same observer. After phacoemulsification, total Ultrasound(U/Stime, Cumulative dissipated energy(CDE, Torsional U/S time, and Estimated fluid use were automatically calculated and displayed on the monitor of Infiniti OZiL IP phacoemulsification system. One-way analysis of variance(ANOVAwas used to assess differences between groups. The Tamhane test was used for multiple group analysis. Spearman correlation analysis was used to assess the relationship between lens density measured by PND and the dynamics of torsional phacoemulsification. P0.05 was considered statistically significant. RESULTS:In the present study, 125 eyes from 125 patients were evaluated. Mean age was 69.7±9.4y(range: 48-88y, and 61 men and 64 women were included. The highest and lowest values of U/S total time, torsional U/S time, CDE, and Estimated fluid use were 0.70 - 158.90s, 0.70-158.50s, 0.11-42.65, and 21-98 mL in groups, respectively. Significant differences were found among PND groups. When the relationship between phacoemulsification dynamics and PND values were evaluated, there were significant correlations between PND value and total ultrasound time(r=0.767; Pr=0.767; Pr=0.758; Pr=0.602; PCONCLUSION:An objective degree of nucleus density obtained by PND scoring before cataract surgery may allow antecedent determination of intraoperative phacoemulsification parameters. Thus, individualized

  12. Measurement of Michel Parameters ($\\bar\\eta$, $\\xi\\kappa$) in the radiative leptonic decay of tau at Belle

    CERN Document Server

    Abdesselam, A.

    2017-06-22

    We present the first measurement of the Michel parameters $\\bar{\\eta}$ and $\\xi\\kappa$ in the radiative leptonic decay of the $\\tau$ lepton using 703 f$\\mathrm{b}^{-1}$ of data collected with the Belle detector at the KEKB $e^+e^-$ collider. The Michel parameters are measured by an unbinned maximum likelihood fit to the kinematic information of $e^+e^-\\rightarrow\\tau^+\\tau^-\\rightarrow (\\pi^+\\pi^0 \\bar{\

  13. Measurement of the mixing leptonic parameter θ13 at the Double Chooz reactor antineutrino experiment

    International Nuclear Information System (INIS)

    Durand, V.

    2012-01-01

    The Double Chooz experiment aims at measuring the neutrino mixing parameter θ13 by studying the oscillations of de ν-bar e produced by the Chooz nuclear reactors located in France. The experimental concept consists in comparing the signal of two identical 10.3 m 3 detectors, allowing to cancel most of the experimental systematic uncertainties. The near detector, whose goal is the flux normalization and a measurement without oscillation, is expected to be delivered in 2013. The farthest detector from the source is taking data since April 2011 and is sensitive to θ 13 , which is expected to affect both the rate and the shape of the measured de ν-bar e . In this thesis, are first presented the Double Chooz experiment, with its ν-bar e source, its detection method, and the expected signal and backgrounds. In order to perform a selection, important quantities have to be reconstructed, calibrated, and saved in data files. The channel time offsets determination, the energy and vertex reconstruction algorithm CocoReco, the reconstruction packages of the Common Trunk, and the light trees maker Cheetah are especially presented. Concerning the data analysis, all the selection cuts and results for signal and backgrounds are discussed, particularly the multiplicity cut, the multiple off time window method, the lithium veto cut, and the cosmogenic 9 Li background studies. The Double Chooz experiment observed 8,249 de ν-bar e candidates in 227.93 days in its far detector only. The reactor antineutrino flux prediction used the Bugey 4 flux measurement after correction for differences in core composition. The expectation in case of no-oscillation is 8,937 events and this deficit is interpreted as evidence for ν-bar e disappearance. From a rate and shape analysis, is found sin 2 2θ = 0,109± 0,030 (stat) ± 0,025 (syst), with Δm 2 31 = 2,32 x 10 -3 eV 2 , while the no-oscillation hypothesis is even excluded at 2.9 σ. (author) [fr

  14. Production of a hot ion plasma at the lower hybrid resonance and measurement of its parameters

    International Nuclear Information System (INIS)

    Glagolev, V.M.; Dyubajlov, A.G.; Krivov, N.A.; Martynenko, V.V.; Skosyrev, Yu.V.

    1975-01-01

    Electromagnetic fields delayed along a magnetic field have been created within a plasma with the aid of a coil encircling the plasma column. When these waves were propagated transversely in relation to the magnetic field in a plasma with density rising along its radius, they were delayed in the direction of propagation. The amplitude and phase distributions of the electromagentic fields along the radius of the plasma column were measured at different moments in time. The existence of an absorption band of these waves within the plasma was detected. The absorption band was shifted towards the outer boundary from the plasma when plasma density was increased. By four independent methods it was established that the gas-kinetic pressure of the plasma, measured according to its diamagnetism, is determined by the ion component. It was found that the energy of electrons at right angles to the magnetic field is considerably less than that of the ions. The cause of limited heating was an increase in density and energy losses in the charge-exchange process. In order to improve vacuum conditions, the coil around the plasma was placed in a metallic chamber, and the UHF plasma source used in the original experiments was replaced by a hydride-film source. This made it possible to increase the internal energy of the plasma to 3x10 15 eV cm -3 at a density of (1-3)x10 12 cm -3 . The mean energy of atoms leaving the plasma at right angles to the magnetic field as a result of charge exchange reached 1 keV. The region of change in plasma parameters (density and magnetic field) for which heating was observed corresponded to the linear transformation theory. Non-linear effects could occur only in the first stage of heating, when the electric fields were strong, but plasma temperature was low. Heating efficiency was measured by a reflectometer installed in the coaxial line connecting the generator and the HF input coil to the plasma. The measurements showed that about 20% of the power

  15. Retrievals of chlorine chemistry kinetic parameters from Antarctic ClO microwave radiometer measurements

    Directory of Open Access Journals (Sweden)

    S. Kremser

    2011-06-01

    Full Text Available Key kinetic parameters governing the partitioning of chlorine species in the Antarctic polar stratosphere were retrieved from 28 days of chlorine monoxide (ClO microwave radiometer measurements made during the late winter/early spring of 2005 at Scott Base (77.85° S, 166.75° E. During day-time the loss of the ClO dimer chlorine peroxide (ClOOCl occurs mainly by photolysis. Some time after sunrise, a photochemical equilibrium is established and the ClO/ClOOCl partitioning is determined by the ratio of the photolysis frequency, J, and the dimer formation rate, kf. The values of J and kf from laboratory studies remain uncertain to a considerable extent, and as a complement to these ongoing studies, the goal of this work is to provide a constraint on that uncertainty based on observations of ClO profiles in the Antarctic. First an optimal estimation technique was used to derive J/kf ratios for a range of Keq values. The optimal estimation forward model was a photochemical box model that takes J, kf, and Keq as inputs, together with a priori profiles of activated chlorine (ClOx = ClO+2×ClOOCl, profiles of ozone, temperature, and pressure. JPL06 kinetics are used as a priori in the optimal estimation and for all other chemistry in the forward model. Using the more recent JPL09 kinetics results in insignificant differences in the retrieved value of J/kf. A complementary approach was used to derive the optimal kinetic parameters; the full parameter space of J, kf, Keq and ClOx was sampled to find the minimum in differences between measured and modelled ClO profiles. Furthermore, values of Keq up to 2.0 times larger than recommended by JPL06 were explored to test the sensitivity of the

  16. Ultra-Weak Fiber Bragg Grating Sensing Network Coated with Sensitive Material for Multi-Parameter Measurements

    Directory of Open Access Journals (Sweden)

    Wei Bai

    2017-06-01

    Full Text Available A multi-parameter measurement system based on ultra-weak fiber Bragg grating (UFBG array with sensitive material was proposed and experimentally demonstrated. The UFBG array interrogation principle is time division multiplex technology with two semiconductor optical amplifiers as timing units. Experimental results showed that the performance of the proposed UFBG system is almost equal to that of traditional FBG, while the UFBG array system has obvious superiority with potential multiplexing ability for multi-point and multi-parameter measurement. The system experimented on a 144 UFBG array with the reflectivity of UFBG ~0.04% for the four target parameters: hydrogen, humidity, temperature and salinity. Moreover, a uniform solution was customized to divide the cross-sensitivity between temperature and other target parameters. It is expected that this scheme will be capable of handling thousands of multi-parameter sensors in a single fiber.

  17. Ultra-Weak Fiber Bragg Grating Sensing Network Coated with Sensitive Material for Multi-Parameter Measurements.

    Science.gov (United States)

    Bai, Wei; Yang, Minghong; Hu, Chenyuan; Dai, Jixiang; Zhong, Xuexiang; Huang, Shuai; Wang, Gaopeng

    2017-06-26

    A multi-parameter measurement system based on ultra-weak fiber Bragg grating (UFBG) array with sensitive material was proposed and experimentally demonstrated. The UFBG array interrogation principle is time division multiplex technology with two semiconductor optical amplifiers as timing units. Experimental results showed that the performance of the proposed UFBG system is almost equal to that of traditional FBG, while the UFBG array system has obvious superiority with potential multiplexing ability for multi-point and multi-parameter measurement. The system experimented on a 144 UFBG array with the reflectivity of UFBG ~0.04% for the four target parameters: hydrogen, humidity, temperature and salinity. Moreover, a uniform solution was customized to divide the cross-sensitivity between temperature and other target parameters. It is expected that this scheme will be capable of handling thousands of multi-parameter sensors in a single fiber.

  18. Serum adipokines, adipose tissue measurements and metabolic parameters in patients with advanced radiographic knee osteoarthritis.

    Science.gov (United States)

    Toussirot, Eric; Michel, Fabrice; Béreau, Matthieu; Dehecq, Barbara; Gaugler, Béatrice; Wendling, Daniel; Grandclément, Emilie; Saas, Philippe; Dumoulin, Gilles

    2017-11-01

    We conducted the present study to evaluate the serum levels of adipokines (leptin, total and high molecular adiponectin, resistin), a marker of cartilage breakdown (C2C), and ghrelin together with body composition in patients with knee osteoarthritis (OA). Fifty patients and 50 sex-matched healthy subjects (HS) were evaluated. Knee OA was scored according to the Kellgren-Lawrence (KL) grade. Body composition parameters including lean mass and measurements of fat mass (total fat, adiposity, fat in the android and gynoid regions, visceral fat and trunk/legs fat ratio) were obtained using dual energy X-ray absorptiometry. Most of the recruited patients (88%) had advanced knee OA with KL grade 3 or 4. The patients had higher body mass index than HS (p < 0.0001). Serum leptin, high molecular adiponectin, resistin and ghrelin levels did not differ between patients and HS. Total adiponectin was higher in women with OA compared to women from the HS group (p = 0.004). Total fat mass, adiposity and measurements of central adiposity (fat in the android region, trunk/lower limbs fat ratio and visceral fat) were increased in patients with knee OA (all p < 0.05). Total adiponectin was borderline associated with the severity of OA. Our results show that total adiponectin is significantly increased in women with advanced knee OA. Independently of gender, patients with severe knee OA were characterized by a significant excess of fat with a distribution toward the visceral region. This abnormal body composition may contribute to the cardiometabolic profile that is described in patients with knee OA.

  19. Cardiac MRI in pulmonary artery hypertension: correlations between morphological and functional parameters and invasive measurements

    Energy Technology Data Exchange (ETDEWEB)

    Alunni, Jean-Philippe; Otal, Philippe; Rousseau, Herve; Chabbert, Valerie [CHU Rangueil, Department of Radiology, Toulouse (France); Degano, Bruno; Tetu, Laurent; Didier, Alain [CHU Larrey, Department of Pneumology, Toulouse (France); Arnaud, Catherine [CHU Rangueil, Department of Methods in Clinical Research, Toulouse (France); Blot-Souletie, Nathalie [CHU Rangueil, Department of Cardiology, Toulouse (France)

    2010-05-15

    To compare cardiac MRI with right heart catheterisation in patients with pulmonary hypertension (PH) and to evaluate its ability to assess PH severity. Forty patients were included. MRI included cine and phase-contrast sequences, study of ventricular function, cardiac cavity areas and ratios, position of the interventricular septum (IVS) in systole and diastole, and flow measurements. We defined four groups according to the severity of PH and three groups according to IVS position: A, normal position; B, abnormal in diastole; C, abnormal in diastole and systole. IVS position was correlated with pulmonary artery pressures and PVR (pulmonary vascular resistance). Median pulmonary artery pressures and resistance were significantly higher in patients with an abnormal septal position compared with those with a normal position. Correlations were good between the right ventricular ejection fraction and PVR, right ventricular end-systolic volume and PAP, percentage of right ventricular area change and PVR, and diastolic and systolic ventricular area ratio and PVR. These parameters were significantly associated with PH severity. Cardiac MRI can help to assess the severity of PH. (orig.)

  20. Influence of selected test parameters on measured values during the MSCR test

    Science.gov (United States)

    Benešová, Lucie; Valentin, Jan

    2017-09-01

    One of today’s most commonly used test on a Dynamic Shear Rheometer (DSR) is the Multiple Stress Creep Recovery (MSCR) test. The test is described in the standard EN 16659, which is valid in the Czech Republic since October 2016. The principle of the test is based on repeated loading and recovering of a bitumen sample, according to which it is possible to determine the percentage of elastic recovery (R) and non-recoverable creep compliance (Jnr) of the bituminous binder. This method has been recently promoted as the most suitable test for assessing the resistance of bituminous binders to permanent deformation. The test is performed at higher temperatures and is particularly suitable for modified bituminous binders. The paper deals with the comparison of the different input parameters set on the DSR device - different levels of stress, temperature of test, the geometry of the measuring device and also a comparison of the results for a different number of loading cycles. The research study was focused mainly on modified bituminous binders, but to compare the MSCR test it is performed even with conventional paving grade binders.

  1. Determination of Performance Measuring Parameters of an Improved Dual Paraboloid Solar Cooker

    Directory of Open Access Journals (Sweden)

    Suhail Zaki Farooqui

    2017-01-01

    Full Text Available An experimental investigation into the performance evaluation of an improved dual reflector foldable paraboloid solar cooker has been reported, along with its energy and exergy analysis. The best attribute of this lightweight and low-cost solar cooker is its high performance coupled with the ease of handling. The cooker utilizes two paraboloid reflectors made out of Mylar-coated fiberglass dishes, each having a diameter of 90 cm and focal length of 105 cm. The total intercepted radiation energy is 1.08 kW under standard test conditions. Stagnation temperatures of up to 330°C and cooking temperatures of up to 290°C have been attained with load. Altogether, 9 experiments have been performed with and without load. Loaded tests have been conducted with water and vegetable oil. Results indicate an average cooking power of 485 W, peak exergy gain of 60.53 W, quality factor of 0.077, and a high product of temperature difference gap at half peak power to peak power of 4364.33 W·K. The maximum exergy output power attained was 70 W, while maximum exergy efficiency was 8–10%. All performance measuring parameters indicate that it is a high performance solar cooker for rural and urban communities and is suitable for all types of oil- and water-based cooking.

  2. Reconstruction of Chernobyl source parameters using gamma dose rate measurements in town Pripjat

    Directory of Open Access Journals (Sweden)

    M. M. Talerko

    2010-06-01

    Full Text Available With the help of mathematical modeling of atmospheric transport the calculations of accidental release dispersion from the Chernobyl NPP to town Pripjat during period from 26 till 29 April 1986 have been carried out. Data of gamma rate measurements which was made in 31 points of the town were used. Based on the solution of atmospheric transport inverse problem the reconstruction of Chernobyl source parameters has been made including release intensity and effective source height. The input of main dose-forming radionuclides into the exposure dose during the first 40 hours after the accident (the period of population residence in the town before the evacuation has been estimated. According to the calculations the 131I deposition density averaged over the town territory was about 5.2 × 104 kBq/m2 (on 29.04.86. Minimum and maximum 131I deposition values were 2.8 × 104 kBq/m2 (western part, distance to the unit is 4.5 km and 1.2 × 105 kBq/m2 (north-eastern part of town, 2 km from the unit accordingly. For the moment of the evacuation dated April 27, deposition values were about 90 percent of these values.

  3. Evaluation of moving-coil loudspeaker and passive radiator parameters using normal-incidence sound transmission measurements: theoretical developments.

    Science.gov (United States)

    Leishman, Timothy W; Anderson, Brian E

    2013-07-01

    The parameters of moving-coil loudspeaker drivers are typically determined using direct electrical excitation and measurement. However, as electro-mechano-acoustical devices, their parameters should also follow from suitable mechanical or acoustical evaluations. This paper presents the theory of an acoustical method of excitation and measurement using normal-incidence sound transmission through a baffled driver as a plane-wave tube partition. Analogous circuits enable key parameters to be extracted from measurement results in terms of open and closed-circuit driver conditions. Associated tools are presented that facilitate adjacent field decompositions and derivations of sound transmission coefficients (in terms of driver parameters) directly from the circuits. The paper also clarifies the impact of nonanechoic receiving tube terminations and the specific benefits of downstream field decompositions.

  4. Impact of Endogenous and Exogenous Interferences on Clinical Chemistry Parameters Measured on Blood Gas Analyzers.

    Science.gov (United States)

    Grieme, Caleb V; Voss, Dena R; Davis, Scott R; Krasowski, Matthew D

    2017-03-01

    The prevalence of hemolysis, icterus, and lipemia (HIL) was determined for residual whole blood specimens analyzed for clinical chemistry parameters on blood gas analyzers. The frequency and potential impact of exogenous interference from iodide, salicylate, and thiocyanate (metabolite of sodium nitroprusside) on analysis of whole blood chloride was also assessed. Over an approximately two month period at an academic medical center, indices for HIL were determined on Roche cobas c502 analyzers for 1,986 residual whole blood specimens that had been previously analyzed for clinical chemistry parameters on Radiometer ABL90 FLEX blood gas analyzers. To examine exogenous interferences, retrospective analysis was performed over multiple years to ascertain whether patient samples analyzed for whole blood chloride were potentially affected by interference from iodide, salicylate, or thiocyanate. Some degree of hemolysis (defined as hemolysis index of greater than 60) was present in 9.7% of the whole blood specimens. Increasing rates of hemolysis were associated with higher whole blood potassium concentrations. Nearly 60% of specimens with potassium concentrations between 6.0 and 6.9 mEq/L had hemolysis indices of 100 or greater, and 75% of specimens with a potassium concentration of 7.0 mEq/L or greater were severely hemolyzed (hemolysis index of 300 or greater). In contrast to the hemolysis results, icterus and lipemia were determined to have minimal impact on patient results. For the exogenous interferences, we did not identify any patient samples where elevated salicylate levels or pharmaceutical iodide administration overlapped with whole blood chloride analysis (out of 75,887 and 169,229 total chloride measurements, respectively). We did, however, find that for patients receiving nitroprusside therapy in the inpatient setting, whole blood chloride concentrations were significantly higher during nitroprusside therapy [106.7 +/- 6.2 mEq/L (mean, SD)] compared to before

  5. Interpretation of acoustic parameters obtained by EMAR measurement for non-destructive hydrogen concentration measurement in Zr alloy

    International Nuclear Information System (INIS)

    Nakatsuka, Masafumi; Uchida, Katsuya; Miyazaki, Akihiro; Ishii, Yoshiaki

    2007-01-01

    An obvious quantitative relation between hydrogen concentrations in zirconium alloy and acoustic anisotropy parameters obtained by the electromagnetic acoustic resonance (EMAR) method was reported. To elucidate the mechanism, the acoustic parameters were calculated based on the elastic theory and the equation of motion. The acoustic parameters of obtained by the EMAR method were interpreted quantitatively using the anisotropic elastic constants of the specimen, and value calculated from texture data for non-hydrogen charged specimens showed good agreement with those obtained by the EMAR method. Calculated temperature dependence of the acoustic anisotropy for the non-hydrogen charged specimen also agreed well with that by the EMAR method. The consistencies demonstrated that the absolute values of the acoustic parameters for non-hydrogen charged specimen can be calculated from both the texture data of (0002) pole figure and the elastic constants of the specimen. Hydrogen addition up to approximately 650ppm was found not to change the original (0002) pole figure and, correspondingly, no hydrogen concentration dependence of the acoustic parameters was obtained from the calculation. These results implied that the zirconium hydride itself played an important role for the change in the acoustic parameters of the hydrogen charged specimens, and the importance of obtaining the information on the elastic constants of the zirconium hydride was pointed out. (author)

  6. Hydrological model parameter dimensionality is a weak measure of prediction uncertainty (discussion paper)

    NARCIS (Netherlands)

    Pande, S.; Arkesteijn, L.; Savenije, H.H.G.; Bastidas, L.A.

    2014-01-01

    This paper presents evidence that model prediction uncertainty does not necessarily rise with parameter dimensionality (the number of parameters). Here by prediction we mean future simulation of a variable of interest conditioned on certain future values of input variables. We utilize a relationship

  7. High-speed infrared thermography for the measurement of microscopic boiling parameters on micro- and nano-structured surfaces

    International Nuclear Information System (INIS)

    Park, Youngjae; Kim, Hyungdae; Kim, Hyungmo; Kim, Joonwon

    2014-01-01

    Micro- and nano-scale structures on boiling surfaces can enhance nucleate boiling heat transfer coefficient (HTC) and critical heat flux (CHF). A few studies were conducted to explain the enhancements of HTC and CHF using the microscopic boiling parameters. Quantitative measurements of microscopic boiling parameters are needed to understand the physical mechanism of the boiling heat transfer augmentation on structured surfaces. However, there is no existing experimental techniques to conveniently measure the boiling parameters on the structured surfaces because of the small (parameters. Finally, quantitative microscopic boiling parameters are used to interpret the enhancement of HTC and CHF. In this study, liquid-vapor phase distributions of each surface were clearly visualized by IR thermography during the nucleate boiling phenomena. From the visualization results, following microscopic boiling parameters were quantitatively measured by image processing. - Number density of dry patch, NDP IR thermography technique was demonstrated by nucleate pool boiling experiments with M- and N surfaces. The enhancement of HTC and CHF could be explained by microscopic boiling parameters

  8. Effects of X-ray tube parameters on thickness measure precision in X-ray profile gauge

    International Nuclear Information System (INIS)

    Miao Jichen; Wu Zhifang; Xing Guilai

    2011-01-01

    Instantaneous profile gauge technology has been widely used in metallurgy industry because it can on-line get the profile of steel strip. It has characters of high measure precision and wide measure range, but the X-ray tube parameters only can be set few different values during measurement. The relations of thickness measure precision and X-ray tube current, X-ray tube voltage were analyzed. The results show that the X-ray tube current affects the thickness measure precision and the X-ray tube voltage determines the thickness measure range. The method of estimating the X-ray current by thickness measure precision was provided in the end. This method is the base of X-ray source selection and X-ray source parameter's setting in the instantaneous profile gauge. (authors)

  9. Identification of hydrological model parameters for flood forecasting using data depth measures

    Science.gov (United States)

    Krauße, T.; Cullmann, J.

    2011-03-01

    The development of methods for estimating the parameters of hydrological models considering uncertainties has been of high interest in hydrological research over the last years. Besides the very popular Markov Chain Monte Carlo (MCMC) methods which estimate the uncertainty of model parameters in the settings of a Bayesian framework, the development of depth based sampling methods, also entitled robust parameter estimation (ROPE), have attracted an increasing research interest. These methods understand the estimation of model parameters as a geometric search of a set of robust performing parameter vectors by application of the concept of data depth. Recent studies showed that the parameter vectors estimated by depth based sampling perform more robust in validation. One major advantage of this kind of approach over the MCMC methods is that the formulation of a likelihood function within a Bayesian uncertainty framework gets obsolete and arbitrary purpose-oriented performance criteria defined by the user can be integrated without any further complications. In this paper we present an advanced ROPE method entitled the Advanced Robust Parameter Estimation by Monte Carlo algorithm (AROPEMC). The AROPEMC algorithm is a modified version of the original robust parameter estimation algorithm ROPEMC developed by Bárdossy and Singh (2008). AROPEMC performs by merging iterative Monte Carlo simulations, identifying well performing parameter vectors, the sampling of robust parameter vectors according to the principle of data depth and the application of a well-founded stopping criterion applied in supervised machine learning. The principals of the algorithm are illustrated by means of the Rosenbrock's and Rastrigin's function, two well known performance benchmarks for optimisation algorithms. Two case studies demonstrate the advantage of AROPEMC compared to state of the art global optimisation algorithms. A distributed process-oriented hydrological model is calibrated and

  10. How far are transmission measurements of pre-equilibrium stopping influenced by impact parameter selection?

    International Nuclear Information System (INIS)

    Semrad, D.; Bergsmann, M.; Bauer, P.; Diez-Muino, R.; Arnau, S.A.

    2000-01-01

    A slow ion that impinges on a target will need to travel a certain distance within the target - called pre-equilibrium length - in order to reach charge equilibrium. In this transient region, projectiles may suffer energy loss different from the mean value. For gas targets, most of the relevant cross-sections and energy transfers can be determined separately by experiment. This allows one to relate these data to the stopping cross-section and to simulate the passage of ions through gas by Monte-Carlo techniques. For solid targets matter is worse, but a universal formalism how pre-equilibrium processes may be determined from transmission data is well documented by Sigmund [14-15]. In transmission experiments usually only these projectiles are analyzed that have missed the central region of the target atoms. It is, however, a matter of fact that projectiles passing closer to the nucleus are more likely to lose energy. In the case of thin targets these projectiles are deflected out of the detector acceptance leading to a reduction of the measured average energy loss. Hence, stopping data may be influenced by so-called impact parameter selection (IPS) according to the layout of the experiment. This IPS clearly acts also in the regime of pre-equilibrium stopping. Using Monte-Carlo simulation we studied to which extent in a typical transmission experiment energy loss is influenced by pre-equilibrium stopping and by IPS, respectively. For feasibility, instead of a solid target, we follow the trajectories through a dense gas target. We find that in an actual experiment with small detector opening angle the formalism to describe pre-equilibrium stopping has to include IPS

  11. Estimation of subsurface hydrological parameters around Akwuke, Enugu, Nigeria using surface resistivity measurements

    International Nuclear Information System (INIS)

    Utom, Ahamefula U; Odoh, Benard I; Egboka, Boniface C E; Egboka, Nkechi E; Okeke, Harold C

    2013-01-01

    As few boreholes may be available and carrying out pumping tests can be expensive and time consuming, relationships between aquifer characteristics and the electrical parameters of different geoelectric layers exist. Data from 19 vertical electrical soundings (VESs; 13 of these selected for evaluation) was recorded with a Schlumberger electrode configuration in the area around Akwuke, Enugu, Nigeria. The data was interpreted by computer iterative modelling with curve matching for calibration purposes. Geoelectric cross-sections along a number of lines were prepared to ascertain the overall distribution of the resistivity responses of the subsurface lithology. Identified probable shallow aquifer resistivity, thickness and depth values are in the range of 28–527 Ωm, 2.1–22.5 m and 3.1–28.3 m respectively. As our aquifer system consists of fine-grained, clay–silty sand materials, a modification of the Archie equations (Waxman–Smits model) was adopted to determine the true formation factor using the relationship between the apparent formation factor and the pore water resistivity. This representation of the effects of a separate conducting path due to the presence of clay particles in the aquifer materials was used in making reliable estimations of aquifer properties. The average hydraulic conductivity of 8.96 × 10 −4 m s −1 transmissivity ranging between 1.88 × 10 −3 and 2.02 × 10 −3 m 2 s −1 estimated from surface resistivity measurements correlated well with the available field data. Results of the study also showed a direct relationship between aquifer transmissivity and modified transverse resistance (R 2 = 0.85). (paper)

  12. Experimental investigation on local parameter measurement using optical probes in two-phase flow under rolling condition

    International Nuclear Information System (INIS)

    Tian Daogui; Sun Licheng; Yan Changqi; Liu Guoqiang

    2013-01-01

    In order to get more local interfacial information as well as to further comprehend the intrinsic mechanism of two-phase flow under rolling condition, a method was proposed to measure the local parameters by using optical probes under rolling condition in this paper. An experimental investigation of two-phase flow under rolling condition was conducted using the probe fabricated by the authors. It is verified that the probe method is feasible to measure the local parameters in two'-phase flow under rolling condition. The results show that the interfacial parameters distribution near wall region has a distinct periodicity due to the rolling motion. The averaged deviation of the void fraction measured by the probe from that obtained from measured pressure drop is about 8%. (authors)

  13. Stability Analysis for Li-Ion Battery Model Parameters and State of Charge Estimation by Measurement Uncertainty Consideration

    Directory of Open Access Journals (Sweden)

    Shifei Yuan

    2015-07-01

    Full Text Available Accurate estimation of model parameters and state of charge (SoC is crucial for the lithium-ion battery management system (BMS. In this paper, the stability of the model parameters and SoC estimation under measurement uncertainty is evaluated by three different factors: (i sampling periods of 1/0.5/0.1 s; (ii current sensor precisions of ±5/±50/±500 mA; and (iii voltage sensor precisions of ±1/±2.5/±5 mV. Firstly, the numerical model stability analysis and parametric sensitivity analysis for battery model parameters are conducted under sampling frequency of 1–50 Hz. The perturbation analysis is theoretically performed of current/voltage measurement uncertainty on model parameter variation. Secondly, the impact of three different factors on the model parameters and SoC estimation was evaluated with the federal urban driving sequence (FUDS profile. The bias correction recursive least square (CRLS and adaptive extended Kalman filter (AEKF algorithm were adopted to estimate the model parameters and SoC jointly. Finally, the simulation results were compared and some insightful findings were concluded. For the given battery model and parameter estimation algorithm, the sampling period, and current/voltage sampling accuracy presented a non-negligible effect on the estimation results of model parameters. This research revealed the influence of the measurement uncertainty on the model parameter estimation, which will provide the guidelines to select a reasonable sampling period and the current/voltage sensor sampling precisions in engineering applications.

  14. The constitutive compatibility method for identification of material parameters based on full-field measurements

    KAUST Repository

    Moussawi, Ali; Lubineau, Gilles; Florentin, É ric; Blaysat, Benoî t

    2013-01-01

    We revisit here the concept of the constitutive relation error for the identification of elastic material parameters based on image correlation. An additional concept, so called constitutive compatibility of stress, is introduced defining a subspace

  15. Daily measure of the constancy of rotation in the evaluation of geometric and dosimetric parameters of the tomotherapy

    International Nuclear Information System (INIS)

    Erzilbengoa, M.; Moral, S.; Bragado, L.; Guisasola, M. A.

    2011-01-01

    The daily test performance called ''Rotating Constancia'', based on the methodology developed by Balog ''Helical tomotherapy dynamic quality assurance'' (2006), has allowed us over these 2 years to assess the response to TomoTherapy machine parameters given dose, travel speed table offset of the same, position of the green lasers, field size, rotation time and energy index of the beam parameters can be measured without intensity modulation.

  16. THE OPTIMIZATION OF TECHNOLOGICAL MINING PARAMETERS IN QUARRY FOR DIMENSION STONE BLOCKS QUALITY IMPROVEMENT BASED ON PHOTOGRAMMETRIC TECHNIQUES OF MEASUREMENT

    Directory of Open Access Journals (Sweden)

    Ruslan Sobolevskyi

    2018-01-01

    Full Text Available This research focuses on patterns of change in the dimension stone commodity blocks quality production on previously identifi ed and measured geometrical parameters of natural cracks, modelling and planning out the fi nal dimension of stone products and fi nished products based on the proposed digital photogrammetric techniques. The optimal parameters of surveying are investigated and the infl uence of surveying distance to length and crack area is estimated. Rational technological parameters of dimension stone blocks production are taken into account.

  17. The construction of the CMS electromagnetic calorimeter: automatic measurements of the physics parameters of PWO crystals

    CERN Multimedia

    2005-01-01

    Crystal properties (dimensions, optical transmission, light yield) are automatically measured. The pictures show different measurement stations of the automatic machine. Crystals are measured on trays containing five crystals each.

  18. Standard test method for determining the effective elastic parameter for X-ray diffraction measurements of residual stress

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1998-01-01

    1.1 This test method covers a procedure for experimentally determining the effective elastic parameter, Eeff, for the evaluation of residual and applied stresses by X-ray diffraction techniques. The effective elastic parameter relates macroscopic stress to the strain measured in a particular crystallographic direction in polycrystalline samples. Eeff should not be confused with E, the modulus of elasticity. Rather, it is nominally equivalent to E/(1 + ν) for the particular crystallographic direction, where ν is Poisson's ratio. The effective elastic parameter is influenced by elastic anisotropy and preferred orientation of the sample material. 1.2 This test method is applicable to all X-ray diffraction instruments intended for measurements of macroscopic residual stress that use measurements of the positions of the diffraction peaks in the high back-reflection region to determine changes in lattice spacing. 1.3 This test method is applicable to all X-ray diffraction techniques for residual stress measurem...

  19. Island based radar and microwave radiometer measurements of stratus cloud parameters during the Atlantic Stratocumulus Transition Experiment (ASTEX)

    Energy Technology Data Exchange (ETDEWEB)

    Frisch, A.S. [Colorado State Univ., Fort Collins, CO (United States); Fairall, C.W.; Snider, J.B. [NOAA Environmental Technology Lab., Boulder, CO (United States); Lenshow, D.H.; Mayer, S.D. [National Center for Atmospheric Research, Boulder, CO (United States)

    1996-04-01

    During the Atlantic Stratocumulus Transition Experiment (ASTEX) in June 1992, simultaneous measurements were made with a vertically pointing cloud sensing radar and a microwave radiometer. The radar measurements are used to estimate stratus cloud drizzle and turbulence parameters. In addition, with the microwave radiometer measurements of reflectivity, we estimated the profiles of cloud liquid water and effective radius. We used radar data for computation of vertical profiles of various drizzle parameters such as droplet concentration, modal radius, and spread. A sample of these results is shown in Figure 1. In addition, in non-drizzle clouds, with the radar and radiometer we can estimate the verticle profiles of stratus cloud parameters such as liquid water concentration and effective radius. This is accomplished by assuming a droplet distribution with droplet number concentration and width constant with height.

  20. Quantitatively assessed CT imaging measures of pulmonary interstitial pneumonia: Effects of reconstruction algorithms on histogram parameters

    International Nuclear Information System (INIS)

    Koyama, Hisanobu; Ohno, Yoshiharu; Yamazaki, Youichi; Nogami, Munenobu; Kusaka, Akiko; Murase, Kenya; Sugimura, Kazuro

    2010-01-01

    This study aimed the influences of reconstruction algorithm for quantitative assessments in interstitial pneumonia patients. A total of 25 collagen vascular disease patients (nine male patients and 16 female patients; mean age, 57.2 years; age range 32-77 years) underwent thin-section MDCT examinations, and MDCT data were reconstructed with three kinds of reconstruction algorithm (two high-frequencies [A and B] and one standard [C]). In reconstruction algorithm B, the effect of low- and middle-frequency space was suppressed compared with reconstruction algorithm A. As quantitative CT parameters, kurtosis, skewness, and mean lung density (MLD) were acquired from a frequency histogram of the whole lung parenchyma in each reconstruction algorithm. To determine the difference of quantitative CT parameters affected by reconstruction algorithms, these parameters were compared statistically. To determine the relationships with the disease severity, these parameters were correlated with PFTs. In the results, all the histogram parameters values had significant differences each other (p < 0.0001) and those of reconstruction algorithm C were the highest. All MLDs had fair or moderate correlation with all parameters of PFT (-0.64 < r < -0.45, p < 0.05). Though kurtosis and skewness in high-frequency reconstruction algorithm A had significant correlations with all parameters of PFT (-0.61 < r < -0.45, p < 0.05), there were significant correlations only with diffusing capacity of carbon monoxide (DLco) and total lung capacity (TLC) in reconstruction algorithm C and with forced expiratory volume in 1 s (FEV1), DLco and TLC in reconstruction algorithm B. In conclusion, reconstruction algorithm has influence to quantitative assessments on chest thin-section MDCT examination in interstitial pneumonia patients.

  1. Quantitatively assessed CT imaging measures of pulmonary interstitial pneumonia: Effects of reconstruction algorithms on histogram parameters

    Energy Technology Data Exchange (ETDEWEB)

    Koyama, Hisanobu [Department of Radiology, Hyogo Kaibara Hospital, 5208-1 Kaibara, Kaibara-cho, Tanba 669-3395 (Japan)], E-mail: hisanobu19760104@yahoo.co.jp; Ohno, Yoshiharu [Department of Radiology, Kobe University Graduate School of Medicine, 7-5-2 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan)], E-mail: yosirad@kobe-u.ac.jp; Yamazaki, Youichi [Department of Medical Physics and Engineering, Faculty of Health Sciences, Graduate School of Medicine, Osaka University, 1-7 Yamadaoka, Suita 565-0871 (Japan)], E-mail: y.yamazk@sahs.med.osaka-u.ac.jp; Nogami, Munenobu [Division of PET, Institute of Biomedical Research and Innovation, 2-2 MInamimachi, Minatojima, Chu0-ku, Kobe 650-0047 (Japan)], E-mail: aznogami@fbri.org; Kusaka, Akiko [Division of Radiology, Kobe University Hospital, 7-5-2 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan)], E-mail: a.kusaka@hosp.kobe-u.ac.jp; Murase, Kenya [Department of Medical Physics and Engineering, Faculty of Health Sciences, Graduate School of Medicine, Osaka University, 1-7 Yamadaoka, Suita 565-0871 (Japan)], E-mail: murase@sahs.med.osaka-u.ac.jp; Sugimura, Kazuro [Department of Radiology, Kobe University Graduate School of Medicine, 7-5-2 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan)], E-mail: sugimura@med.kobe-u.ac.jp

    2010-04-15

    This study aimed the influences of reconstruction algorithm for quantitative assessments in interstitial pneumonia patients. A total of 25 collagen vascular disease patients (nine male patients and 16 female patients; mean age, 57.2 years; age range 32-77 years) underwent thin-section MDCT examinations, and MDCT data were reconstructed with three kinds of reconstruction algorithm (two high-frequencies [A and B] and one standard [C]). In reconstruction algorithm B, the effect of low- and middle-frequency space was suppressed compared with reconstruction algorithm A. As quantitative CT parameters, kurtosis, skewness, and mean lung density (MLD) were acquired from a frequency histogram of the whole lung parenchyma in each reconstruction algorithm. To determine the difference of quantitative CT parameters affected by reconstruction algorithms, these parameters were compared statistically. To determine the relationships with the disease severity, these parameters were correlated with PFTs. In the results, all the histogram parameters values had significant differences each other (p < 0.0001) and those of reconstruction algorithm C were the highest. All MLDs had fair or moderate correlation with all parameters of PFT (-0.64 < r < -0.45, p < 0.05). Though kurtosis and skewness in high-frequency reconstruction algorithm A had significant correlations with all parameters of PFT (-0.61 < r < -0.45, p < 0.05), there were significant correlations only with diffusing capacity of carbon monoxide (DLco) and total lung capacity (TLC) in reconstruction algorithm C and with forced expiratory volume in 1 s (FEV1), DLco and TLC in reconstruction algorithm B. In conclusion, reconstruction algorithm has influence to quantitative assessments on chest thin-section MDCT examination in interstitial pneumonia patients.

  2. Development of time-resolved optical measurement and diagnostic system for parameters of high current and pulsed electron beam

    International Nuclear Information System (INIS)

    Jiang Xiaoguo; Wang Yuan; Yang Guojun; Xia Liansheng; Li Hong; Zhang Zhuo; Liao Shuqing; Shi Jinshui

    2013-01-01

    The beam parameters measurement is the most important work for the study of linear induction accelerator(LIA). The beam parameters are important to evaluate the character of the beam. The demands of beam parameters measurement are improving while the development of accelerator is improving. The measurement difficulty feature higher time-resolved ability, higher spatial resolution, larger dynamic range and higher intuitionistic view data. The measurement technology of beam spot, beam emittance, beam energy have been developed for the past several years. Some high performance equipment such as high speed framing camera are developed recently. Under this condition, the relative integrated optical measurement and diagnostic system for the beam parameters is developed based on several principles. The system features time-resolved ability of up to 2 ns, high sensitivity and large dynamic range. The processing program is compiled for the data process and the local real-time process is reached. The measurement and diagnostic system has provided full and accurate data for the debug work and has been put into applications. (authors)

  3. Effect of window function for measurement of ultrasonic nonlinear parameter using fast fourier transform of tone-burst signal

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Kyoung Jun; Kim, Jong Beom; Song, Dong Gil; Jhang, Kyung Young [Dept. of Mechanical Engineering, Hanyang University, Seoul (Korea, Republic of)

    2015-08-15

    In ultrasonic nonlinear parameter measurement using the fast Fourier transform(FFT) of tone-burst signals, the side lobe and leakage on spectrum because of finite time and non-periodicity of signals makes it difficult to measure the harmonic magnitudes accurately. The window function made it possible to resolve this problem. In this study, the effect of the Hanning and Turkey window functions on the experimental measurement of nonlinear parameters was analyzed. In addition, the effect of changes in tone burst signal number with changes in the window function on the experimental measurement was analyzed. The result for both window functions were similar and showed that they enabled reliable nonlinear parameter measurement. However, in order to restore original signal amplitude, the amplitude compensation coefficient should be considered for each window function. On a separate note, the larger number of tone bursts was advantageous for stable nonlinear parameter measurement, but this effect was more advantageous in the case of the Hanning window than the Tukey window.

  4. Impact of Uncertainties in the Cosmological Parameters on the Measurement of Primordial non-Gaussianity

    CERN Document Server

    Liguori, M

    2008-01-01

    We study the impact of cosmological parameters' uncertainties on estimates of the primordial NG parameter f_NL in local and equilateral models of non-Gaussianity. We show that propagating these errors increases the f_NL relative uncertainty by 16% for WMAP and 5 % for Planck in the local case, whereas for equilateral configurations the correction term are 14% and 4%, respectively. If we assume for local f_NL a central value of order 60, according to recent WMAP 5-years estimates, we obtain for Planck a final correction \\Delta f_NL = 3. Although not dramatic, this correction is at the level of the expected estimator uncertainty for Planck, and should then be taken into account when quoting the significance of an eventual future detection. In current estimates of f_NL the cosmological parameters are held fixed at their best-fit values. We finally note that the impact of uncertainties in the cosmological parameters on the final f_NL error bar would become totally negligible if the parameters were allowed to vary...

  5. Approaches to measurement of thermal-hydraulic parameters in liquid-metal-cooled fast breeder reactors

    International Nuclear Information System (INIS)

    Sackett, J.I.

    1983-01-01

    This lecture considers instrumentation for liquid-metal-cooled fast breeder reactors (LMFBR's). Included is instrumentation to measure sodium flow, pressure, temperature, acoustic noise, and sodium purity. It is divided into three major parts: (1) measurement requirements for sodium cooled reactor systems, (2) in-core and out-of-core measurements in liquid metal systems, and (3) performance measurements of water steam generators

  6. Assessment of printability for printed electronics patterns by measuring geometric dimensions and defining assessment parameters

    International Nuclear Information System (INIS)

    Jeon, Sung Woong; Kim, Cheol; Kim, Chung Hwan

    2016-01-01

    The printability of patterns for printed electronic devices determines the performance, yield rate, and reliability of the devices; therefore, it should be assessed quantitatively. In this paper, parameters for printability assessment of printed patterns for width, pinholes, and edge waviness are suggested. For quantitative printability assessment, printability grades for each parameter are proposed according to the parameter values. As examples of printability assessment, printed line patterns and mesh patterns obtained using roll-to-roll gravure printing are used. Both single-line patterns and mesh patterns show different levels of printability, even in samples obtained using the same printing equipment and conditions. Therefore, for reliable assessment, it is necessary to assess the printability of the patterns by enlarging the sampling area and increasing the number of samples. We can predict the performance of printed electronic devices by assessing the printability of the patterns that constitute them

  7. Assessment of printability for printed electronics patterns by measuring geometric dimensions and defining assessment parameters

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Sung Woong [Dept. of Robotics Engineering, Daegu Gyeongbuk Institute of Science and Technology (DGIST), Daegu (Korea, Republic of); Kim, Cheol; Kim, Chung Hwan [Chungnam National University, Daejeon (Korea, Republic of)

    2016-12-15

    The printability of patterns for printed electronic devices determines the performance, yield rate, and reliability of the devices; therefore, it should be assessed quantitatively. In this paper, parameters for printability assessment of printed patterns for width, pinholes, and edge waviness are suggested. For quantitative printability assessment, printability grades for each parameter are proposed according to the parameter values. As examples of printability assessment, printed line patterns and mesh patterns obtained using roll-to-roll gravure printing are used. Both single-line patterns and mesh patterns show different levels of printability, even in samples obtained using the same printing equipment and conditions. Therefore, for reliable assessment, it is necessary to assess the printability of the patterns by enlarging the sampling area and increasing the number of samples. We can predict the performance of printed electronic devices by assessing the printability of the patterns that constitute them.

  8. Geotechnical Parameters from Seismic Measurements: Two Field Examples from Egypt and Saudi Arabia

    KAUST Repository

    Khalil, Mohamed H.

    2016-03-18

    © 2016 EEGS. Geotechnical parameters were used to determine subsurface rock quality for construction purposes. We summarize the mathematical relationships used to calculate the geotechnical parameters from P- and S-wave velocities and density values. These relationships are applied to two field examples; the first is a regional seismic study in Egypt and the second is a 2-D seismic profile recorded in Saudi Arabia. Results from both field examples are used to determine the subsurface rock quality and locate zones that should be avoided during construction. We suggest combining all geotechnical parameters into one map using a normalized-weighted relation, which helps to locate the zones with high versus low rock quality for engineering purposes.

  9. Estimation of intra-operator variability in perfusion parameter measurements using DCE-US.

    Science.gov (United States)

    Gauthier, Marianne; Leguerney, Ingrid; Thalmensi, Jessie; Chebil, Mohamed; Parisot, Sarah; Peronneau, Pierre; Roche, Alain; Lassau, Nathalie

    2011-03-28

    To investigate intra-operator variability of semi-quantitative perfusion parameters using dynamic contrast-enhanced ultrasonography (DCE-US), following bolus injections of SonoVue(®). The in vitro experiments were conducted using three in-house sets up based on pumping a fluid through a phantom placed in a water tank. In the in vivo experiments, B16F10 melanoma cells were xenografted to five nude mice. Both in vitro and in vivo, images were acquired following bolus injections of the ultrasound contrast agent SonoVue(®) (Bracco, Milan, Italy) and using a Toshiba Aplio(®) ultrasound scanner connected to a 2.9-5.8 MHz linear transducer (PZT, PLT 604AT probe) (Toshiba, Japan) allowing harmonic imaging ("Vascular Recognition Imaging") involving linear raw data. A mathematical model based on the dye-dilution theory was developed by the Gustave Roussy Institute, Villejuif, France and used to evaluate seven perfusion parameters from time-intensity curves. Intra-operator variability analyses were based on determining perfusion parameter coefficients of variation (CV). In vitro, different volumes of SonoVue(®) were tested with the three phantoms: intra-operator variability was found to range from 2.33% to 23.72%. In vivo, experiments were performed on tumor tissues and perfusion parameters exhibited values ranging from 1.48% to 29.97%. In addition, the area under the curve (AUC) and the area under the wash-out (AUWO) were two of the parameters of great interest since throughout in vitro and in vivo experiments their variability was lower than 15.79%. AUC and AUWO appear to be the most reliable parameters for assessing tumor perfusion using DCE-US as they exhibited the lowest CV values.

  10. Correlating Gas Transport Parameters and X-ray Computed Tomography Measurements in Porous Media

    DEFF Research Database (Denmark)

    Naveed, Muhammad; Hamamoto, Shoichiro; Kawamoto, Ken

    2013-01-01

    physical processes. The objective of this study was to characterize the relationships between gas transport parameters and soil-pore geometry revealed by X-ray CT. Sands of different shapes with a mean particle diameter (d50) ranging from 0.19 to 1.51 mm were used as porous media under both air...... was found between α and tortuosity calculated from gas transport parameters (Equation (Uncited) Image Tools), indicating that gas dispersivity has a linear and inverse relationship with gas diffusivity. A linear relationship was also found between ka and d50/TUMS2, indicating a strong dependency of ka...

  11. A new peak shear strength criterion for rock joints which includes spectral parameters as roughness measures

    International Nuclear Information System (INIS)

    Kulatilake, P.H.S.W.; Shou, G.; Huang, T.H.

    1996-01-01

    Most of the natural rock joint surface profiles do not belong to the self similar fractal category. In general, roughness profiles of rock joints consist of non-stationary and stationary components. At the simplest level, only one parameter is sufficient to quantify non-stationary joint roughness. The average inclination angle I, along with the direction considered for the joint surface, is suggested to capture the non-stationary roughness. It is shown that even though the fractal dimension D is a useful parameter, it alone is insufficient to quantify the stationary roughness of non-self similar profiles

  12. Measurement of Trabecular Bone Parameters in Porcine Vertebral Bodies Using Multidetector CT: Evaluation of Reproducibility of 3-Dimensional CT Histomorphometry

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Sung Hwan; Goo, Jin Mo [Dept. of Radiology, Seoul National University Hospital, Seoul National University College of Medicine, Seoul (Korea, Republic of); Moon Kyung Chul [Dept. of Pathology, Seoul National University Hospital, Seoul National University College of Medicine, Seoul (Korea, Republic of); An, Sang Bu [Dept. of radiology, National Cancer Center, Goyang (Korea, Republic of); Kim, Kwang Gi [Dept. of Biomedical Engineering, Division of Basic and Applied Sciences, National Cancer Center, Goyang (Korea, Republic of)

    2011-05-15

    To evaluate the reproducibility of 3-dimensional histomorphometry for the microarchitecture analysis of trabecular bone parameters using multidetector computed tomography (MDCT). Thirty-six specimens from porcine vertebral bodies were imaged five times with a 64- detector row MDCT system using the same scan protocols. Locations of the specimens were nearly identical through the scans. Three-dimensional structural parameters of trabecular bone were derived from the five data sets using image analyzing software. The features measured by the analysis programs were trabecular bone volume, trabecular bone volume/tissue volume, trabecular thickness, trabecular separation, trabecular number, trabecular bone pattern factor, structural model index. The structural trabecular parameters showed excellent reproducibility through repeated scanning. Intraclass correlation coefficients of all seven structural parameters were in the range of 0.998 to 1.000. Coefficients of variation of the six structural parameters, excluding structural model index, were not over 1.6%. The measurement of the trabecular structural parameters using multidetector CT and three-dimensional histomophometry analysis program was validated and showed excellent reproducibility. This method could be used as a noninvasive and easily available test in a clinical setting.

  13. Field measurements of key parameters associated with nocturnal OBT formation in vegetables grown under Canadian conditions

    International Nuclear Information System (INIS)

    Kim, S.B.; Workman, W.G.; Korolevych, V.; Davis, P.A.

    2012-01-01

    The objective of this study was to provide the parameter values required to model OBT formation in the edible parts of plants following a hypothetical accidental tritium release to the atmosphere at night. The parameters considered were leaf area index, stomatal resistance, photosynthesis rate, the photosynthetic production rate of starch, the nocturnal hydrolysis rate of starch, the fraction of starch produced daily by photosynthesis that appears in the fruits, and the mass of the fruit. Values of these parameters were obtained in the summer of 2002 for lettuce, radishes and tomatoes grown under typical Canadian environmental conditions. Based on the maximum observed photosynthetic rate and growth rate, the fraction of starch translocated to the fruit was calculated to be 17% for tomato fruit and 14% for radish root. - Highlights: ► Plant physiological parameters affecting nocturnal OBT formation have been investigated. ► The fraction of starch produced daily by photosynthesis in the leaves that appears in the fruit was calculated. ► Realistic estimates of OBT concentrations following a nighttime accidental HTO release to the atmosphere.

  14. Measurement of the meteorological parameters in Almirante Alvaro Alberto nuclear power plant using captive balloon

    International Nuclear Information System (INIS)

    Silva Lobo, M.A. da; Lima e Silva Filho, P.P. de; Eschebach, B.M.

    1984-01-01

    A methodology to obtain the meteorological parameters in the vicinity of the Almirante Alvaro Alberto nuclear power plant is presented. The study of the atmospheric dispersion is done by the analysis of the results and it is a complement of the meteorological operation of Angra-1 and pre-operation of Angra-2 and 3 program. (M.C.K.) [pt

  15. UAV-based multi-angular measurements for improved crop parameter retrieval

    NARCIS (Netherlands)

    Roosjen, Peter P.J.

    2017-01-01

    Optical remote sensing enables the estimation of crop parameters based on reflected light through empirical-statistical methods or inversion of radiative transfer models. Natural surfaces, however, reflect light anisotropically, which means that the intensity of reflected light depends on the

  16. Parameter sensitivity analysis of nonlinear piezoelectric probe in tapping mode atomic force microscopy for measurement improvement

    Energy Technology Data Exchange (ETDEWEB)

    McCarty, Rachael; Nima Mahmoodi, S., E-mail: nmahmoodi@eng.ua.edu [Department of Mechanical Engineering, The University of Alabama, Box 870276, Tuscaloosa, Alabama 35487 (United States)

    2014-02-21

    The equations of motion for a piezoelectric microcantilever are derived for a nonlinear contact force. The analytical expressions for natural frequencies and mode shapes are obtained. Then, the method of multiple scales is used to analyze the analytical frequency response of the piezoelectric probe. The effects of nonlinear excitation force on the microcantilever beam's frequency and amplitude are analytically studied. The results show a frequency shift in the response resulting from the force nonlinearities. This frequency shift during contact mode is an important consideration in the modeling of AFM mechanics for generation of more accurate imaging. Also, a sensitivity analysis of the system parameters on the nonlinearity effect is performed. The results of a sensitivity analysis show that it is possible to choose parameters such that the frequency shift minimizes. Certain parameters such as tip radius, microcantilever beam dimensions, and modulus of elasticity have more influence on the nonlinearity of the system than other parameters. By changing only three parameters—tip radius, thickness, and modulus of elasticity of the microbeam—a more than 70% reduction in nonlinearity effect was achieved.

  17. Internal measuring models in trained neural networks for parameter estimation from images

    NARCIS (Netherlands)

    Feng, Tian-Jin; Feng, T.J.; Houkes, Z.; Korsten, Maarten J.; Spreeuwers, Lieuwe Jan

    1992-01-01

    The internal representations of 'learned' knowledge in neural networks are still poorly understood, even for backpropagation networks. The paper discusses a possible interpretation of learned knowledge of a network trained for parameter estimation from images. The outputs of the hidden layer are the

  18. Genetic parameters for fillet traits and body measurements in Nile tilapia (Oreochromis niloticus L.)

    NARCIS (Netherlands)

    Rutten, M.J.M.; Bovenhuis, H.; Komen, J.

    2005-01-01

    Fillet weight is an economically important trait in Nile tilapia production for the European market which asks for fish with average body weights of at least 700 g. Genetic parameters to design or optimize breeding programs for these body weights are lacking. In an earlier study we showed that high

  19. Determining generator parameters of Camargos hydroelectric power plant through frequency response measurement

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, Sebastiao E.M. de; Padua Guarini, Antonio de [Centro de Pesquisas de Energia Eletrica (CEPEL), Rio de Janeiro, RJ (Brazil); Souza, Joao A. de; Valgas, Helio M; Pinto, Roberto del Giudice R. [Companhia Energetica de Minas Gerais (CEMIG), Belo Horizonte, MG (Brazil)

    1994-12-31

    This work describes the results of the set frequency response tests performed in the generator number 2, 6.9 kV, 25 MVA, of Camargos hydroelectric power plant, CEMIG, and the parameters relatives to determined structures of model. This tests are unpublished in Brazil. (author) 7 refs., 16 figs., 7 tabs.

  20. Bayesian `hyper-parameters' approach to joint estimation: the Hubble constant from CMB measurements

    Science.gov (United States)

    Lahav, O.; Bridle, S. L.; Hobson, M. P.; Lasenby, A. N.; Sodré, L.

    2000-07-01

    Recently several studies have jointly analysed data from different cosmological probes with the motivation of estimating cosmological parameters. Here we generalize this procedure to allow freedom in the relative weights of various probes. This is done by including in the joint χ2 function a set of `hyper-parameters', which are dealt with using Bayesian considerations. The resulting algorithm, which assumes uniform priors on the log of the hyper-parameters, is very simple: instead of minimizing \\sum \\chi_j2 (where \\chi_j2 is per data set j) we propose to minimize \\sum Nj (\\chi_j2) (where Nj is the number of data points per data set j). We illustrate the method by estimating the Hubble constant H0 from different sets of recent cosmic microwave background (CMB) experiments (including Saskatoon, Python V, MSAM1, TOCO and Boomerang). The approach can be generalized for combinations of cosmic probes, and for other priors on the hyper-parameters.

  1. Improvement of the accuracy by the measurement of the electrical cell membrane parameters

    Czech Academy of Sciences Publication Activity Database

    Rohlíček, Vojtěch; Rech, František

    2002-01-01

    Roč. 51, č. 2 (2002), s. 169-177 ISSN 0862-8408 Institutional research plan: CEZ:AV0Z5011922 Keywords : patch clamp technique * electrical parameters of the cell membrane * memebrane capacity Subject RIV: BO - Biophysics Impact factor: 0.984, year: 2002

  2. In-situ measurements of material thermal parameters for accurate LED lamp thermal modelling

    NARCIS (Netherlands)

    Vellvehi, M.; Perpina, X.; Jorda, X.; Werkhoven, R.J.; Kunen, J.M.G.; Jakovenko, J.; Bancken, P.; Bolt, P.J.

    2013-01-01

    This work deals with the extraction of key thermal parameters for accurate thermal modelling of LED lamps: air exchange coefficient around the lamp, emissivity and thermal conductivity of all lamp parts. As a case study, an 8W retrofit lamp is presented. To assess simulation results, temperature is

  3. Measurement of np elastic scattering spin-spin correlation parameters at 484, 634, and 788 MeV

    International Nuclear Information System (INIS)

    Garnett, R.W.

    1989-03-01

    The spin-spin correlation parameters C/sub LL/ and C/sub SL/ were measured for np elastic scattering at the incident neutron kinetic energy of 634 MeV. Good agreement was obtained with previously measured data. Additionally, the first measurement of the correlation parameter C/sub SS/ was made at the three energies, 484, 634, and 788 MeV. It was found that the new values, in general, do not agree well with phase shift predictions. A study was carried out to determine which of the isospin-0 partial waves will be affected by this new data. It was found that the 1 P 1 partial wave will be affected significantly at all three measurement energies. At 634 and 788 MeV, the 3 S 1 phase shifts will also change. 29 refs., 21 figs., 16 tabs

  4. A study of calculation methodology and experimental measurements of the kinetic parameters for source driven subcritical systems

    International Nuclear Information System (INIS)

    Lee, Seung Min

    2009-01-01

    This work presents a theoretical study of reactor kinetics focusing on the methodology of calculation and the experimental measurements of the so-called kinetic parameters. A comparison between the methodology based on the Dulla's formalism and the classical method is made. The objective is to exhibit the dependence of the parameters on subcriticality level and perturbation. Two different slab type systems were considered: thermal one and fast one, both with homogeneous media. One group diffusion model was used for the fast reactor, and for the thermal system, two groups diffusion model, considering, in both case, only one precursor's family. The solutions were obtained using the expansion method. Also, descriptions of the main experimental methods of measurements of the kinetic parameters are presented in order to put a question about the compatibility of these methods in subcritical region. (author)

  5. A measurement-driven approach to assess power line telecommunication (PLT) network quality of service (QoS) performance parameters

    International Nuclear Information System (INIS)

    Betta, G; Capriglione, D; Ferrigno, L; Laracca, M

    2009-01-01

    Power line telecommunication (PLT) technology offers cheap and fast ways for providing in-home broadband services and local area networking. Its main advantage is due to the possibility of using the pre-existing electrical grid as a communication channel. Nevertheless, technical challenges arise from the difficulty of operating on a hostile medium, not designed for communication purposes, characterized by complex channel modeling and by varying time response. These aspects put practical problems for designers and testers in the assessment of network quality of service performance parameters such as the throughput, the latency, the jitter, and the reliability. The measurement of these parameters has not yet been standardized so that there do not exist reference test set-ups and measurement methodologies (i.e. the type of isolation from the ac main, the observation time and the number of experiments, the measurement uncertainty and so on). Consequently, experiments executed by adopting different methods may lead to incompatible measurement results, thus making it also impossible to have reliable comparisons of different PLT modems. Really, the development of standard procedures is a very difficult task because the scenarios in which the PLT modems can work are very wide and then the application of an exhaustive approach (in which all the parameters influencing the PLT performance should be considered) would be very complex and time consuming, thus making the modem characterization very expensive. In this paper, the authors propose a methodological approach to develop an efficient measurement procedure able to reliably assess the performance of PLT modems (in terms of network quality of service parameters) with a minimum number of experiments. It is based on both creating a reconfigurable grid to which real disturbing loads are connected and implementing an original design of the experiment technique based on the effects of the uncertainty of the measurement results

  6. Windowing UWB microwave, mm-wave multi-port S-parameter measurements using open-ended excess electrical length

    Directory of Open Access Journals (Sweden)

    Gholamreza Askari

    2017-05-01

    Full Text Available Multi-port measurements are a big challenge in circuits' verification, especially when the frequency increases. This study presents a new technique for measuring S-parameters of multi-port ultra-wideband (UWB microwave and mm-wave circuits. The concepts are based on direct or indirect applying modulated UWB impulse radio in desired bandwidth to the one port of the modified multi-port circuit and gathering the reflected signal in the same port and the output signal in the second port in time domain, and the other ports are left opened with a special designed added electrical length. Then by applying intelligent windowing in time domain to the gathering data, and using fast Fourier transform, the desired S-parameters are extracted. Validation of this technique is verified by design and fabrication of a three-port UWB Wilkinson power divider in 22–30 GHz. The simulation and measurement results of the reflection and transmission S-parameters by using this new technique are very close to those are extracted with the conventional vector network analysers S-parameters measurements and show the ability and the accuracy of this technique.

  7. 40 CFR Table 3 to Subpart Ec of... - Operating Parameters To Be Monitored and Minimum Measurement and Recording Frequencies

    Science.gov (United States)

    2010-07-01

    ... Which Construction is Commenced After June 20, 1996 Pt. 60, Subpt. Ec, Table 3 Table 3 to Subpart Ec of... Operating parameters to be monitored Minimum frequency Data measurement Data recording Control system Dry scrubber followed by fabric filter Wet scrubber Dry scrubber followed by fabric filter and wet scrubber...

  8. Experimental Platform for measuring the parameters of magnetization of a transformer in a quasi-static transitional regime

    International Nuclear Information System (INIS)

    Milovanski, Vasil; , Blagoevgrad (Bulgaria))" data-affiliation=" (HMS “Acad. S. P. Corolov, Blagoevgrad (Bulgaria))" >Stoyanov, Krasimir; Milovanska, Stefani

    2013-01-01

    Some opportunities for development of an experimental module for magnetic research have been examined in the current paper. The goal is to attain a more accurate reading of the measured electrical signals which are directly related to the magnetic parameters and characteristics of the ferromagnetic material

  9. Synthesis of Algorithm for Range Measurement Equipment to Track Maneuvering Aircraft Using Data on Its Dynamic and Kinematic Parameters

    Science.gov (United States)

    Pudovkin, A. P.; Panasyuk, Yu N.; Danilov, S. N.; Moskvitin, S. P.

    2018-05-01

    The problem of improving automated air traffic control systems is considered through the example of the operation algorithm synthesis for a range measurement channel to track the aircraft, using its kinematic and dynamic parameters. The choice of the state and observation models has been justified, the computer simulations have been performed and the results of the investigated algorithms have been obtained.

  10. Usability of a theory of visual attention (TVA) for parameter-based measurement of attention I

    DEFF Research Database (Denmark)

    Finke, Kathrin; Bublak, Peter; Krummenacher, Joseph

    2005-01-01

    four separable attentional components: processing speed, working memory storage capacity, spatial distribution of attention, and top-down control. A number of studies (Duncan et al., 1999; Habekost & Bundesen, 2003; Peers et al., 2005) have already demonstrated the clinical relevance......The present study investigated the usability of whole and partial report of briefly displayed letter arrays as a diagnostic tool for the assessment of attentional functions. The tool is based on Bundesen’s (1990, 1998, 2002; Bundesen et al., 2005) theory of visual attention (TVA), which assumes...... of these parameters. The present study was designed to examine whether (a) a shortened procedure bears sufficient accuracy and reliability, (b) whether the procedures reveal attentional constructs with clinical relevance, and (c) whether the mathematically independent parameters are also empirically independent...

  11. [Measurement of plasma parameters in cluster hexagon pattern discharge by optical emission spectrum].

    Science.gov (United States)

    Dong, Li-Fang; Shen, Zhong-Kai; Li, Xin-Chun; Liu, Liang; Lu, Ning; Shang, Jie

    2012-09-01

    The cluster hexagon pattern was obtained in a dielectric barrier discharge in air/argon for the first time. Three plasma parameters, i. e. the molecular vibrational temperature, the molecular rotational temperature and the average electron energy of individual cluster in cluster hexagon pattern discharge, were studied by changing the air content. The molecular vibrational temperature and the molecular rotational temperature were calculated using the second positive band system of nitrogen molecules (C 3IIu --> B 3IIg) and the first negative band system of nitrogen molecular ions (B 2Sigma(u)+ --> Chi2 Sigma(g)+). The relative intensities of the first negative system of nitrogen molecular ions (391. 4 nm) and nitrogen molecules emission spectrum line (337.1 nm) were analyzed for studying the variations of the electron energy. It was found that the three plasma parameters of individual cluster in cluster hexagon pattern increase with air content increasing from 16% to 24%.

  12. Automated capacitive spectrometer for measuring the parameters of deep centers in semiconductor materials

    International Nuclear Information System (INIS)

    Shajmeev, S.S.

    1985-01-01

    An automated capacitive spectrometer for determining deep centers parameters in semiconductor materials and instruments is described. The facility can be used in studying electrically active defects (impurity, radiation, thermal) having deep levels in the forbidden semiconductor zone. The facility permits to determine the following parameters of the deep centers: concentration of each deep level taken separately within 5x10 -1 +-5x10 -15 of the alloying impurity concentration, level energy position in the forbidden semiconductor zone in the range from 0.08 MeV above the valency zone ceiling to 0.08 eV below the conductivity zone bottom, hole or electron capture cross-section on the deep center; concentration profile of deep levels

  13. The constitutive compatibility method for identification of material parameters based on full-field measurements

    KAUST Repository

    Moussawi, Ali

    2013-10-01

    We revisit here the concept of the constitutive relation error for the identification of elastic material parameters based on image correlation. An additional concept, so called constitutive compatibility of stress, is introduced defining a subspace of the classical space of statically admissible stresses. The key idea is to define stresses as compatible with the observed deformation field through the chosen class of constitutive equation. This makes possible the uncoupling of the identification of stress from the identification of the material parameters. As a result, the global cost of the identification is strongly reduced. This uncoupling also leads to parametrized solutions in cases where the solution is non-unique as demonstrated on 2D numerical examples. © 2013 Elsevier B.V.

  14. A goal-oriented field measurement filtering technique for the identification of material model parameters

    KAUST Repository

    Lubineau, Gilles

    2009-05-16

    The post-processing of experiments with nonuniform fields is still a challenge: the information is often much richer, but its interpretation for identification purposes is not straightforward. However, this is a very promising field of development because it would pave the way for the robust identification of multiple material parameters using only a small number of experiments. This paper presents a goal-oriented filtering technique in which data are combined into new output fields which are strongly correlated with specific quantities of interest (the material parameters to be identified). Thus, this combination, which is nonuniform in space, constitutes a filter of the experimental outputs, whose relevance is quantified by a quality function based on global variance analysis. Then, this filter is optimized using genetic algorithms. © 2009 Springer-Verlag.

  15. Inexpensive, Open-Source, Internet of Things-Enabled Sensing Stations for Environmental Parameter Measurements

    Science.gov (United States)

    Marchetto, P. M.; Hofmeister, K.; Walter, M. T.

    2015-12-01

    In the age of the Internet, data is inherently portable. Given the shrinking numbers of stream gauges in the US under the banner of the USGS and the lack of collocation of sensors for environmental parameters, it is clear the only way to collect these data is with near real-time, multi-parameters sensing stations. We are designing a system that can be built and deployed for under $300 by community groups interested in learning more about the land that they are protecting, such as conservation groups, or groups interested in the basic science behind sensing and ecology, such as makerspaces. Sensing stations like these will enable a greater diversity of data collection while increasing public awareness of environmental issues and the research process.

  16. Hartmann-Shack wave front measurements for real time determination of laser beam propagation parameters

    International Nuclear Information System (INIS)

    Schaefer, B.; Luebbecke, M.; Mann, K.

    2006-01-01

    The suitability of the Hartmann-Shack technique for the determination of the propagation parameters of a laser beam is faced against the well known caustic approach according to the ISO 11146 standard. A He-Ne laser (543 nm) was chosen as test beam, both in its fundamental mode as well as after intentional distortion, introducing a moderate amount of spherical aberration. Results are given for the most important beam parameters M 2 , divergence, and beam widths, indicating an agreement of better than 10% and for adapted beam diameter <5%. Furthermore, the theoretical background, pros and cons, as well as some features of the software implementation for the Hartmann-Shack sensor are briefly reviewed

  17. Quality parameters of mango and potential of non-destructive techniques for their measurement- a review

    International Nuclear Information System (INIS)

    Jha, S.N.; Narsaiah, K.; Sharma, A.D.; Singh, M.; Bansal, S.; Kumar, R.

    2010-01-01

    The king of fruits 'Mango' (Mangifera indica L.) is very nutritious and rich in carotenes. India produces about 50% of the total world's mango. Many researchers have reported the maturity indices and quality parameters for determination of harvesting time and eating quality. The methods currently used for determination of quality of mango are mostly based on the biochemical analysis, which leads to destruction of the fruits. Numerous works are being carried out to explore some non-destructive methods such as Near Infrared (NIR), Nuclear Magnetic Resonance (NMR), X-ray and Computed Tomography (CT), electronic nose, machine vision and ultrasound for quality determination of fruits. This paper deals with some recent work reported on quality parameters, harvesting and post-harvest treatments in relation to quality of mango fruits and reviews on some of the potential non-destructive techniques that can be explored for quality determination of mango cultivars. (author)

  18. Efficacious of estimatives of thermal-hydraulic conditions of the PWR core by measured parameters

    International Nuclear Information System (INIS)

    Camargo, C.T.M.; Pontedeiro, A.C.

    1985-01-01

    Using ALMOD 3W2 and COBRA IIIP computer codes an evaluation of usual methods of estimatives of heat transfer conditions in the PWR core was made, using variables of the monitored processes. It was done a parametric study in conditions of the permanent regim to verify the influence of variables such as, pressure, temperature and power in the value of critical heat flux. Parameters to prevent the DNB phenomenon in KWU power plants and Westinghouse were calculated and implemented in the ALMOD 3W2 program to estimate the DNBR evolution. It was identified a common origin to both methods and comparing with detailed calculations of the COBRA IIIP code, it was settled limitations in the application of parameters. (M.C.K.) [pt

  19. Evaluation of water balance parameters from isotopic measurements in evaporation pans

    International Nuclear Information System (INIS)

    Allison, G.B.

    1979-01-01

    The evaluation of the parameters governing the isotopic composition of evaporating water bodies was attempted by means of evaporation pans. The instability of the meteorological conditions, however, makes it virtually impossible to evaluate the atmospheric relative humidity and its isotopic composition with pans. Pans are only suitable to obtain seasonal trends of the isotopic composition of the net evaporated water. For this, a technique based on two pans is also proposed. (author)

  20. Reactor parameters and constants determination by using measurements in subcritical and exponential assembly

    International Nuclear Information System (INIS)

    Voi, Dante Luiz; Santos Bastos, Wilma dos

    1995-01-01

    Subcritical and exponential experiments are important for Reactor Physics integral parameter determinations both to validate and confirm theoretical models for reactor calculations. An exponential and subcritical facility has been constructed to be used on the internal thermal column of the Argonauta reactor at IEN-CNEN- Rio de Janeiro. An experimental research program has been developed for the determination of fundamental reactor constants as buckling, migration areas, resonance escape probabilities, thermal utilization, fast fission and fuel eta factors. (author) 23 refs

  1. Study on photoelectric parameter measurement method of high capacitance solar cell

    Science.gov (United States)

    Zhang, Junchao; Xiong, Limin; Meng, Haifeng; He, Yingwei; Cai, Chuan; Zhang, Bifeng; Li, Xiaohui; Wang, Changshi

    2018-01-01

    The high efficiency solar cells usually have high capacitance characteristic, so the measurement of their photoelectric performance usually requires long pulse width and long sweep time. The effects of irradiance non-uniformity, probe shielding and spectral mismatch on the IV curve measurement are analyzed experimentally. A compensation method for irradiance loss caused by probe shielding is proposed, and the accurate measurement of the irradiance intensity in the IV curve measurement process of solar cell is realized. Based on the characteristics that the open circuit voltage of solar cell is sensitive to the junction temperature, an accurate measurement method of the temperature of solar cell under continuous irradiation condition is proposed. Finally, a measurement method with the characteristic of high accuracy and wide application range for high capacitance solar cell is presented.

  2. Uncertainty in the use of MAMA software to measure particle morphological parameters from SEM images

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, Daniel S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Tandon, Lav [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-06-05

    The MAMA software package developed at LANL is designed to make morphological measurements on a wide variety of digital images of objects. At LANL, we have focused on using MAMA to measure scanning electron microscope (SEM) images of particles, as this is a critical part of our forensic analysis of interdicted radiologic materials. In order to successfully use MAMA to make such measurements, we must understand the level of uncertainty involved in the process, so that we can rigorously support our quantitative conclusions.

  3. Fundamental course of measuring. II. The electrical measuring of non-electrical parameters. Grundkurs der Messtechnik. T. 2. Das elektrische Messen nichtelektrischer Groessen

    Energy Technology Data Exchange (ETDEWEB)

    Merz, L [Technische Univ. Muenchen (F.R. Germany). Lehrstuhl und Lab. fuer Steuerungs- und Regelungstechnik

    1975-01-01

    The fundamental course of the electrical measuring of non-electrical parameters aims to fulfill the task of presenting the present knowledge on the basic measuring methods in simple language and illustrative form. The present part II deals especially with measuring methods in heat and process engineering in the industrial field. Following the introduction in part A, the techniques of electrical probes are mainly described, and it is shown which mechanical probes cannot yet be replaced by electrical ones. Part C describes the techniques of measuring transducers.

  4. Quantitative photoacoustic integrating sphere (QPAIS platform for absorption coefficient and Grüneisen parameter measurements: Demonstration with human blood

    Directory of Open Access Journals (Sweden)

    Yolanda Villanueva-Palero

    2017-06-01

    Full Text Available Quantitative photoacoustic imaging in biomedicine relies on accurate measurements of relevant material properties of target absorbers. Here, we present a method for simultaneous measurements of the absorption coefficient and Grüneisen parameter of small volume of liquid scattering and absorbing media using a coupled-integrating sphere system which we refer to as quantitative photoacoustic integrating sphere (QPAIS platform. The derived equations do not require absolute magnitudes of optical energy and pressure values, only calibration of the setup using aqueous ink dilutions is necessary. As a demonstration, measurements with blood samples from various human donors are done at room and body temperatures using an incubator. Measured absorption coefficient values are consistent with known oxygen saturation dependence of blood absorption at 750 nm, whereas measured Grüneisen parameter values indicate variability among five different donors. An increasing Grüneisen parameter value with both hematocrit and temperature is observed. These observations are consistent with those reported in literature.

  5. In-core program for on line measurements of neutron, photon and nuclear heating parameters inside Jules Horowitz MTR reactor

    International Nuclear Information System (INIS)

    Lyoussi, A.; Reynard-Carette, C.

    2014-01-01

    Accurate on-line measurements of key parameters inside experimental channels of Material Testing Reactor are necessary to dimension the irradiation devices and consequently to conduct smart experiments on fuels and materials under suitable conditions. In particular the quantification of nuclear heating, a relevant parameter to reach adapted thermal conditions, has to be improved. These works focus on an important collaborative program between CEA and Aix-Marseille University called INCORE (Instrumentation for Nuclear radiations and Calorimetry On-line in Reactor) dedicated to the development of a new measurement methodology to quantify both nuclear heating and accurate radiation flux levels (neutrons and photons). The methodology, which is based on experiments carried out under irradiation conditions with a multi-sensor device (ionization chamber, fission chamber, gamma thermometer, calorimeter, SPND, SPGD) as well as works performed out-of nuclear/radiative environment on a reference sensor used to measure nuclear heating (calorimeter), is presented (authors)

  6. Markov chain beam randomization: a study of the impact of PLANCK beam measurement errors on cosmological parameter estimation

    Science.gov (United States)

    Rocha, G.; Pagano, L.; Górski, K. M.; Huffenberger, K. M.; Lawrence, C. R.; Lange, A. E.

    2010-04-01

    We introduce a new method to propagate uncertainties in the beam shapes used to measure the cosmic microwave background to cosmological parameters determined from those measurements. The method, called markov chain beam randomization (MCBR), randomly samples from a set of templates or functions that describe the beam uncertainties. The method is much faster than direct numerical integration over systematic “nuisance” parameters, and is not restricted to simple, idealized cases as is analytic marginalization. It does not assume the data are normally distributed, and does not require Gaussian priors on the specific systematic uncertainties. We show that MCBR properly accounts for and provides the marginalized errors of the parameters. The method can be generalized and used to propagate any systematic uncertainties for which a set of templates is available. We apply the method to the Planck satellite, and consider future experiments. Beam measurement errors should have a small effect on cosmological parameters as long as the beam fitting is performed after removal of 1/f noise.

  7. Different atmospheric parameters influence on spectral UV radiation (measurements and modelling)

    Energy Technology Data Exchange (ETDEWEB)

    Chubarova, N Y [Moscow State Univ. (Russian Federation). Meteorological Observatory; Krotkov, N A [Maryland Univ., MD (United States). JCESS/Meteorology Dept.; Geogdzhaev, I V; Bushnev, S V; Kondranin, T V [SUMGF/MIPT, Dolgoprudny (Russian Federation); Khattatov, V U [Central Aerological Observatory, Dolgoprudny (Russian Federation)

    1996-12-31

    The ultraviolet (UV) radiation plays a vital role in the biophysical processes despite its small portion in the total solar flux. UV radiation is subject to large variations at the Earth surface depending greatly on solar elevation, ozone and cloud amount, aerosols and surface albedo. The analysis of atmospheric parameters influence is based on the spectral archive data of three spectral instruments: NSF spectroradiometer (Barrow network) (NSF Polar Programs UV Spectroradiometer Network 1991-1992,1992), spectrophotometer (SUVS-M) of Central Aerological Observatory CAO, spectroradiometer of Meteorological Observatory of the Moscow State University (MO MSU) and model simulations based on delta-Eddington approximation

  8. Measurement of casting parameters in ZnAlCu3 molds created by additive technology

    Directory of Open Access Journals (Sweden)

    S. Medić

    2016-10-01

    Full Text Available This paper examines the parameters of casting ZnAl4Cu3 alloy (volume, castability, density and occupancy of the mold in mold made additive technology. Molds made by additive technology are: cheaper in production of a small number of castings, geometrically more accurate and faster made. From obtained results of this paper it is clearly seen that printed mold must be protected with thermal coating because liquid adhesive of powder otherwise evaporates during casting and creates additional moisture in the mold, as it was noted.

  9. Different atmospheric parameters influence on spectral UV radiation (measurements and modelling)

    Energy Technology Data Exchange (ETDEWEB)

    Chubarova, N.Y. [Moscow State Univ. (Russian Federation). Meteorological Observatory; Krotkov, N.A. [Maryland Univ., MD (United States). JCESS/Meteorology Dept.; Geogdzhaev, I.V.; Bushnev, S.V.; Kondranin, T.V. [SUMGF/MIPT, Dolgoprudny (Russian Federation); Khattatov, V.U. [Central Aerological Observatory, Dolgoprudny (Russian Federation)

    1995-12-31

    The ultraviolet (UV) radiation plays a vital role in the biophysical processes despite its small portion in the total solar flux. UV radiation is subject to large variations at the Earth surface depending greatly on solar elevation, ozone and cloud amount, aerosols and surface albedo. The analysis of atmospheric parameters influence is based on the spectral archive data of three spectral instruments: NSF spectroradiometer (Barrow network) (NSF Polar Programs UV Spectroradiometer Network 1991-1992,1992), spectrophotometer (SUVS-M) of Central Aerological Observatory CAO, spectroradiometer of Meteorological Observatory of the Moscow State University (MO MSU) and model simulations based on delta-Eddington approximation

  10. Measurement of alignment parameter for photon induced $L_{3}$ vacancies in the elements 59

    CERN Document Server

    Ertugrul, M; Sahin, Y

    2002-01-01

    The alignment parameter was measured using the L/sub alpha //L/sub l/ intensity ratio. For this measurement. the Kamiya et al. ÝPhys. Rev. A 20, 820 (1979)¿ equation was used. The L/sub l/ and L/sub alpha / X-rays of the elements were measured with a Si (Li) detector at a direction of 90 degrees to the projectile. The L/sub 3/ edges of the elements were excited with the selected ionising energies. (13 refs).

  11. Measurement of the Lightweight Rotor Eigenfrequencies and Tuning of its Model Parameters

    Directory of Open Access Journals (Sweden)

    Luboš SMOLÍK

    2013-06-01

    Full Text Available The common sizes and weights of rotors, which can be found e.g. in the energy production industry, allow to employ a standard methodology of an experimental modal analysis. However, certain applications with rotors of small weights lead to the usage of alternative measuring methods suitable for the identification of rotor eigenfrequencies. One of these methods, which is characterized by the measuring of noise, is introduced in this paper and the results for a particular rotor is presented. Moreover the tuning of the finite element rotor model on the basis of such measured values is shown.

  12. Determination of the resonance parameters for 232Th from high resolution transmission and capture measurements at GELINA

    International Nuclear Information System (INIS)

    Brusegan, A.; Schillebeeckx, P.; Lobo, G.; Borella, A.; Volev, K.; Janeva, N.

    2003-01-01

    To deduce the resonance parameters for 232 Th in the resolved resonance region, high resolution transmission and capture measurements are being performed. The measurements are performed at the Time-Of-Flight facility GELINA. A comparison of experimental data resulting from capture (top) and transmission (bottom) are shown. The transmission measurements are performed at a 50 m flight path. The neutron are detected with a 0.25' thick lithium glass (NE912) placed in an Al sphere and viewed by a 5' EMI KQB photomultiplier orthogonal to the neutron beam axis. The injection of a stabilised light pulse in the detector during the measurements provided an efficient tool to control to better than 1% the gain of the entire electronics. The experimental set-up includes a sample-changer, placed at 23 m from the neutron source, which is driven by the acquisition system. The determination of the flight path length, was based on transmission of the 6.673 eV resonance of 238 U. We summarise, for the different energy regions of interest, the scheduled measurement conditions: the operation frequency of the accelerator and the target thickness. A simultaneous analysis of the data using REFIT will result in the resonance parameters from 0 to 4 keV. We show the result of a resonance shape analysis for the resonances at 21.8 and 23.5 eV. The resulting resonance parameters are important for the energy calibration and normalisation of the capture measurements in both the resolved and unresolved resonance region. The capture measurements are completed and were performed at a 60 m flight path. The sample consisted of a metallic natural thorium disc of 8 cm diameter and 1.0 mm thick, corresponding to a thickness of 3.176 10 -3 at/b. The neutron flux was measured with an ionisation chamber loaded with three back-to-back layers of about 40 μg/cm 2 10 B. The gamma rays, originating from the 232 Th(n,γ) reaction, were detected by four C 6 D 6 -based liquid scintillators (NE230) placed

  13. Examining the Correlation between Objective Injury Parameters, Personality Traits and Adjustment Measures among Burn Victims

    Directory of Open Access Journals (Sweden)

    Josef Mordechai Haik

    2015-03-01

    Full Text Available Background: Burn victims experience immense physical and mental hardship during their process of rehabilitation and regaining functionality. We examined different objective burn related factors as well as psychological ones, in the form of personality traits, that may affect the rehabilitation process and its outcome. Objective: To assess the influence and correlation of specific personality traits and objective injury related parameters on the adjustment of burn victims post-injury. Methods: 62 male patients admitted to our burn unit due to burn injuries were compared with 36 healthy male individuals by use of questionnaires to assess each group's psychological adjustment parameters. Multivariate and hierarchical regression analysis was conducted to identify differences between the groups. Results: A significant negative correlation was found between the objective burn injury severity (e.g. TBSA and burn depth and the adjustment of burn victims (p<0.05, p<0.001, table 3. Moreover, patients more severely injured tend to be more neurotic (p<0.001, and less extroverted and agreeable (p<0.01, table 4. Conclusions: Extroverted burn victims tend to adjust better to their post-injury life while the neurotic patients tend to have difficulties adjusting. This finding may suggest new tools for early identification of maladjustment-prone patients and therefore provide them with better psychological support in a more dedicated manner.

  14. Electron transport parameters in CO$_2$: scanning drift tube measurements and kinetic computations

    OpenAIRE

    Vass, M.; Korolov, I.; Loffhagen, D.; Pinhao, N.; Donko, Z.

    2016-01-01

    This work presents transport coefficients of electrons (bulk drift velocity, longitudinal diffusion coefficient, and effective ionization frequency) in CO2 measured under time-of-flight conditions over a wide range of the reduced electric field, 15Td

  15. A new radiometric instrument designed to measure the parameters of bituminous coal on transport belts

    International Nuclear Information System (INIS)

    Kubicek, P.

    1993-01-01

    A new radiometric instrument developed in Czechoslovakia, for the measurement of ash content of bituminous coal, and for the determination of approximate values of moisture and weight is described. (Author)

  16. Measurement of S Parameters ofan Accelerating Structure with Double-Feed Couplers

    CERN Document Server

    Fandos, R; Wuensch, W

    2006-01-01

    A method for measuring the transmission and reflection coefficients of an accelerating structure with double-feed input and output couplers using a 2 port network analyzer is presented. This method avoids the use of magic Ts and hybrids, whose symmetry is not obvious. The procedure is extended to devices with n symmetrical input and m symmetrical output ports. The method to make bead pull measurements for such devices is described.

  17. Energy balance measurements for the determination of physical and technical operation parameters of thermionic converters

    International Nuclear Information System (INIS)

    Ritz, K.

    1975-01-01

    An introduction into the fundamental theoretical principles of the thermionic Cs converter is followed by the set-up of a special measuring converter as proposed by J. Bohdansky which permits the defined setting of the electrode distance under service conditions. Measurements thus carried out present quantitative data on efficiency, on energy transfer between the electrodes by means of radiation and heat transfer, and on the actual collector potential, the latter which surprisingly shows a distance dependency. (orig./GG) [de

  18. Soil water content and evaporation determined by thermal parameters obtained from ground-based and remote measurements

    Science.gov (United States)

    Reginato, R. J.; Idso, S. B.; Jackson, R. D.; Vedder, J. F.; Blanchard, M. B.; Goettelman, R.

    1976-01-01

    Soil water contents from both smooth and rough bare soil were estimated from remotely sensed surface soil and air temperatures. An inverse relationship between two thermal parameters and gravimetric soil water content was found for Avondale loam when its water content was between air-dry and field capacity. These parameters, daily maximum minus minimum surface soil temperature and daily maximum soil minus air temperature, appear to describe the relationship reasonably well. These two parameters also describe relative soil water evaporation (actual/potential). Surface soil temperatures showed good agreement among three measurement techniques: in situ thermocouples, a ground-based infrared radiation thermometer, and the thermal infrared band of an airborne multispectral scanner.

  19. Extraction of optical parameters of thin films from spectral measurements for design and optical performance of multilayer structures

    International Nuclear Information System (INIS)

    Muellerova, J.; Jurecka, S.; Kucerova, A.

    2003-01-01

    Optical parameters of a-Si:H and indium tin oxide (ITO) thin films deposited on glass substrates are determined from spectral measurements of reflectance and/or transmittance. It is shown how important the exact knowledge of optical parameters as well as thicknesses of the layers for the design and the optical performance of multilayer structures is. The model of the p-i-n based a:Si-H solar cell with ITO as transparent conductive oxide layer is used for illustrating. The modeling of the solar cell integral reflectance in the spectral region of (650-830) nm is used as a criterion to reverse engineering of a multilayer structure with suppressed reflectance losses. The reflectance of a solar cell is modelled and the simulation of the varying optical parameters of individual layers including their thicknesses is discussed. Besides this,the advantage of using an antireflective layer under ITO is discussed (Authors)

  20. Activation method for measuring the reaction rates and studying the neutron spectra parameters, based on using the unified composition detectors

    International Nuclear Information System (INIS)

    Demidov, A.M.; Dikarev, V.S.; Efimov, B.V.; Ionov, V.S.; Marin, S.V.

    2005-01-01

    The method proposed for estimation of parameters thermal and epithermal parts of energy distribution of neutrons is described. The method based on application of activation measuring with use of unified composition detectors (UCD) and samples of fuel. The method is applicable for definition of neutron spectrum parameters and velocities of division in fuel of nuclear installations. Theoretical bases and the description of a method, expedients of manufacturing and calibration for the detectors, the experimental data, carried out in RRC KI are given and processing of experimental data, and also. The parametric model of a spectrum constructed on the basis of Westcott's formalism is described. The parameter of stiffness is entered and its role for temperature of neutron gas, spectral coefficients of isotopes of detectors, the transition area thermal and epithermal parts of neutron spectra is observationally appreciated. It is offered to confirm the found results by calculations with use of MCU Monte Carlo code [ru

  1. Calculated and measured brachytherapy dosimetry parameters in water for the Xoft Axxent X-Ray Source: an electronic brachytherapy source.

    Science.gov (United States)

    Rivard, Mark J; Davis, Stephen D; DeWerd, Larry A; Rusch, Thomas W; Axelrod, Steve

    2006-11-01

    A new x-ray source, the model S700 Axxent X-Ray Source (Source), has been developed by Xoft Inc. for electronic brachytherapy. Unlike brachytherapy sources containing radionuclides, this Source may be turned on and off at will and may be operated at variable currents and voltages to change the dose rate and penetration properties. The in-water dosimetry parameters for this electronic brachytherapy source have been determined from measurements and calculations at 40, 45, and 50 kV settings. Monte Carlo simulations of radiation transport utilized the MCNP5 code and the EPDL97-based mcplib04 cross-section library. Inter-tube consistency was assessed for 20 different Sources, measured with a PTW 34013 ionization chamber. As the Source is intended to be used for a maximum of ten treatment fractions, tube stability was also assessed. Photon spectra were measured using a high-purity germanium (HPGe) detector, and calculated using MCNP. Parameters used in the two-dimensional (2D) brachytherapy dosimetry formalism were determined. While the Source was characterized as a point due to the small anode size, S700 Source exhibited depth dose behavior similar to low-energy photon-emitting low dose rate sources 125I and l03Pd, yet with capability for variable and much higher dose rates and subsequently adjustable penetration capabilities. This paper presents the calculated and measured in-water brachytherapy dosimetry parameters for the model S700 Source at the aforementioned three operating voltages.

  2. Visual stimulus parameters seriously compromise the measurement of approximate number system acuity and comparative effects between adults and children

    Directory of Open Access Journals (Sweden)

    Denes eSzucs

    2013-07-01

    Full Text Available It has been suggested that a simple non-symbolic magnitude comparison task is sufficient to measure the acuity of a putative Approximate Number System (ANS. A proposed measure of the ANS, the so-called 'internal Weber fraction' (w, would provide a clear measure of ANS acuity. However, ANS studies have never presented adequate evidence that the visual stimulus parameters did not compromise measurements of w to such extent that w is actually driven by visual instead of numerical processes. We therefore investigated this question by testing non-symbolic magnitude discrimination in seven-year-old children and adults. We controlled for visual parameters in a more stringent manner than usual. As a consequence of these controls, in some trials numerical cues correlated positively with number while in others they correlated negatively with number. This congruency effect strongly correlated with w, which means that congruency effects were probably driving effects in w. Consequently, in both adults and children congruency had a major impact on the fit of the model underlying the computation of w. Furthermore, children showed larger congruency effects than adults. This suggests that ANS tasks are seriously compromised by the visual stimulus parameters, which cannot be controlled. Hence, they are not pure measures of the ANS and some putative w or ratio effect differences between children and adults in previous ANS studies may be due to the differential influence of the visual stimulus parameters in children and adults. In addition, because the resolution of congruency effects relies on inhibitory (interference suppression function, some previous ANS findings were probably influenced by the developmental state of inhibitory processes especially when comparing children with developmental dyscalculia and typically developing children.

  3. Major parameters affecting the calculation of equilibrium factor using SSNTD-measured track densities

    International Nuclear Information System (INIS)

    Abo-Elmagd, M.; Mansy, M.; Eissa, H.M.; El-Fiki, M.A.

    2006-01-01

    The equilibrium factor F between radon and its daughters as a function of the track density ratio D/D 0 between bare and in can track detectors is solved graphically and gave more accurate solution than that solved mathematically elsewhere. The advantages of the graphical solution come from its simplicity and does not need any tedious mathematical formula or a computer program. The simplicity of this solution makes us study many parameters that affect the equilibrium factor determination such as the detector type, the diffusion chamber dimensions, the membrane specifications and the behavior of α-emitters around the detector. The results show that the equilibrium factor as a function of D/D 0 takes different form according to the facility used. The range of this study covers two widely used detectors (CR-39 and LR-115) equipped in two widely used diffusion chambers (small and medium chambers)

  4. Optimization of measure parameters for an X- and gamma-ray spectrometry portable system

    International Nuclear Information System (INIS)

    Fernandes, Jaquiel S.; Appoloni, Carlos R.

    2008-01-01

    In order to optimize the use of a system for in situ gamma (γ)- and X-ray spectrometry composed of a 3x3x1 mm 3 Cadmium Telluride (CdTe) detector with respect to the detection of low-activity radioactive sources, a two level factorial planning was accomplished, involving three factors that could modify the system response. This planning was made with a 137 Cs punctual source, analyzing the X-ray energy line of 32 keV from 137m Ba. It was concluded that, for the system optimization, the best configuration for the involved parameters was to work with the detector at temperature of -22 o C, shaping time of 3 μs and rise time discrimination (RTD) with value 3

  5. Partition function as a Laplace transform of a positive measure in the strength parameter

    International Nuclear Information System (INIS)

    Bessis, D.

    1980-01-01

    We shall consider the partition function Z(lambda), of an N-body system whose Hamiltonian reads: H = H/sub O/ + lambdaH/sub I/. H/sub O/ is an exactly solvable Hamiltonian, one for which, for example all thermodynamical quantities can be calculated. H/sub I/ is the perturbation. We are interested in the analytic properties in the strength parameter lambda of the partition function Z(lambda) = Tr e/sup -ν[H 0 + lambdaH/sub I/]/ where for convenience the volume V and inverse temperature ν dependence has been suppressed on the left hand side. The representation for Z(lambda) is given and discussed, and applications are described

  6. A frequency domain global parameter estimation method for multiple reference frequency response measurements

    Science.gov (United States)

    Shih, C. Y.; Tsuei, Y. G.; Allemang, R. J.; Brown, D. L.

    1988-10-01

    A method of using the matrix Auto-Regressive Moving Average (ARMA) model in the Laplace domain for multiple-reference global parameter identification is presented. This method is particularly applicable to the area of modal analysis where high modal density exists. The method is also applicable when multiple reference frequency response functions are used to characterise linear systems. In order to facilitate the mathematical solution, the Forsythe orthogonal polynomial is used to reduce the ill-conditioning of the formulated equations and to decouple the normal matrix into two reduced matrix blocks. A Complex Mode Indicator Function (CMIF) is introduced, which can be used to determine the proper order of the rational polynomials.

  7. Multi Parameter Flow Meter for On-Line Measurement of Gas Mixture Composition

    Directory of Open Access Journals (Sweden)

    Egbert van der Wouden

    2015-04-01

    Full Text Available In this paper we describe the development of a system and model to analyze the composition of gas mixtures up to four components. The system consists of a Coriolis mass flow sensor, density, pressure and thermal flow sensor. With this system it is possible to measure the viscosity, density, heat capacity and flow rate of the medium. In a next step the composition can be analyzed if the constituents of the mixture are known. This makes the approach universally applicable to all gasses as long as the number of components does not exceed the number of measured properties and as long as the properties are measured with a sufficient accuracy. We present measurements with binary and ternary gas mixtures, on compositions that range over an order of magnitude in value for the physical properties. Two platforms for analyses are presented. The first platform consists of sensors realized with MEMS fabrication technology. This approach allows for a system with a high level of integration. With this system we demonstrate a proof of principle for the analyses of binary mixtures with an accuracy of 10%. In the second platform we utilize more mature steel sensor technology to demonstrate the potential of this approach. We show that with this technique, binary mixtures can be measured within 1% and ternary gas mixtures within 3%.

  8. Physically-Retrieving Cloud and Thermodynamic Parameters from Ultraspectral IR Measurements

    Science.gov (United States)

    Zhou, Daniel K.; Smith, William L., Sr.; Liu, Xu; Larar, Allen M.; Mango, Stephen A.; Huang, Hung-Lung

    2007-01-01

    A physical inversion scheme has been developed, dealing with cloudy as well as cloud-free radiance observed with ultraspectral infrared sounders, to simultaneously retrieve surface, atmospheric thermodynamic, and cloud microphysical parameters. A fast radiative transfer model, which applies to the clouded atmosphere, is used for atmospheric profile and cloud parameter retrieval. A one-dimensional (1-d) variational multi-variable inversion solution is used to improve an iterative background state defined by an eigenvector-regression-retrieval. The solution is iterated in order to account for non-linearity in the 1-d variational solution. It is shown that relatively accurate temperature and moisture retrievals can be achieved below optically thin clouds. For optically thick clouds, accurate temperature and moisture profiles down to cloud top level are obtained. For both optically thin and thick cloud situations, the cloud top height can be retrieved with relatively high accuracy (i.e., error < 1 km). NPOESS Airborne Sounder Testbed Interferometer (NAST-I) retrievals from the Atlantic-THORPEX Regional Campaign are compared with coincident observations obtained from dropsondes and the nadir-pointing Cloud Physics Lidar (CPL). This work was motivated by the need to obtain solutions for atmospheric soundings from infrared radiances observed for every individual field of view, regardless of cloud cover, from future ultraspectral geostationary satellite sounding instruments, such as the Geosynchronous Imaging Fourier Transform Spectrometer (GIFTS) and the Hyperspectral Environmental Suite (HES). However, this retrieval approach can also be applied to the ultraspectral sounding instruments to fly on Polar satellites, such as the Infrared Atmospheric Sounding Interferometer (IASI) on the European MetOp satellite, the Cross-track Infrared Sounder (CrIS) on the NPOESS Preparatory Project and the following NPOESS series of satellites.

  9. A Comparative Survey on Parameters Influencing on Hexavalent Chromium Measurement as an Occupational Carcinogen

    Directory of Open Access Journals (Sweden)

    A. Tirgar

    2008-07-01

    Full Text Available Introduction & Objective: Hexavalent chromium, Cr+6, is a very harmful pollutant and a relatively unstable compound that is present in many industries. It is a known human respiratory carcinogen and occupational exposure to this chemical is associated with different health hazards. The purpose of this study was to evaluate the effects of four parameters including: type of sampling head, sampling height from the surface of electroplating solution, sampling duration, and sample storage duration on Cr+6 mist monitoring.Materials & Methods: To evaluate the influence of the main parameters as an experimental study, the 24 factorial design was applied at constant electroplating condition. A chromium electroplating bath with the ability to produce homogenous mist was used to create Cr+6 mist in laboratory setting. The National Institute for Occupational Safety and Health (NIOSH method 7600 was used to determine the Cr+6 concentration. Results: The results of 48 Cr+6 mist samples showed that Cr+6 concentration was higher: (1 for sampling by closed-face filter cassettes than for sampling by open-face filter cassettes (P<0.001; (2 for samples collected at 35 cm above the electroplating solution surface than for samples collected at 50 cm (P <0.001; (3 for sampling duration of 30 minutes than for sampling duration of 180 minutes (P <0.001; and, (4 for samples extracted immediately after sampling than for samples with delayed extraction (24 hours after sampling (P <0.001. Conclusion: It is concluded that the accuracy of Cr+6 mist sampling in electroplating shops will be enhanced when: (1 a closed-face filter cassette is used to prevent liquid splash contamination; (2 the sampling height is suitable as determined by further research; (3 the sampling duration is short (approximately 30 minutes; and, (4 the extraction of the Cr+6 sample is performed as soon as the sampling is completed.

  10. Measurements of kinetic parameters by noise techniques on the MINERVE reactor

    International Nuclear Information System (INIS)

    Carre, J.C.; Da Costa Oliveira, J.

    1975-01-01

    Noise measurements were determined on ERMINE a fast thermal coupled reactor built in MINERVE. A reactor without feedback, and a reactor with an automatic control rod were both considered. The first case concerned the measurements of auto and cross power spectral density obtained with one or two neutron detectors, and the determination of: neutron lifetime; efficiency for one ion chamber; power level of the reactor; maximal speed and acceleration of the control rod for the design of an automatic reactor control actuator. The second case was concerned with measurements of the auto power spectral density in reactivity for the control rod, and the estimation of: the transfer function of the automatic pilot; the neutron lifetime; and the standard error affecting the results obtained by the oscillation method. The results proved that the pile noise theory with a point kinetic model is sufficient for application on zero power reactors. (U.K.)

  11. Ultrasonic preliminary measurements of oenological malolactic fermentation parameters in red wine

    Science.gov (United States)

    Novoa-Díaz, D. F.; Puig-Pujol, A.; García-Álvarez, J.; Chávez, J. A.; Turó, A.; Mínguez, S.; García-Hernández, M. J.; Bertran, E.; Salazar, J.

    2012-12-01

    In the winemaking process, the malolactic fermentation is an essential process in the production of high quality red wines which concerns the conversion of malate into lactate. In this work, the ultrasonic velocity through wine samples with different concentrations of malate and lactate was measured using the pulse echo technique with 1 MHz tone burst signals. The evolution of these concentrations during malolactic fermentation was taken into account in order to determine the ratio between concentrations of malate and lactate of the different samples. These preliminary results have revealed that the ultrasonic velocity increases during the conversion of malate to lactate. In addition, measurements have been conducted to quantify the influence of variations in turbidity and temperature on test samples. Therefore, these results show the possibility of using ultrasonic velocity measurements for on-line monitoring the malolactic fermentation of red wine and may help to improve and contribute to the development of the winemaking process.

  12. Estimates for Parameter Littlewood-Paley gκ⁎ Functions on Nonhomogeneous Metric Measure Spaces

    Directory of Open Access Journals (Sweden)

    Guanghui Lu

    2016-01-01

    Full Text Available Let (X,d,μ be a metric measure space which satisfies the geometrically doubling measure and the upper doubling measure conditions. In this paper, the authors prove that, under the assumption that the kernel of Mκ⁎ satisfies a certain Hörmander-type condition, Mκ⁎,ρ is bounded from Lebesgue spaces Lp(μ to Lebesgue spaces Lp(μ for p≥2 and is bounded from L1(μ into L1,∞(μ. As a corollary, Mκ⁎,ρ is bounded on Lp(μ for 1

  13. UPWIND Metrology, Deliverable D 1A2.1, List of measurement Parameters

    DEFF Research Database (Denmark)

    Hansen, Kurt Schaldemose

    performance measurements - Improvement of aerodynamic codes - Assessment of wind resources In general terms the uncertainty of the testing techniques and methods are typically much higher than the need. Since this problem covers many areas of wind energy, the work package is de-fined as a crosscutting...... activity. The problem is especially relevant for the following areas: Production related - Power performance testing especially in wind farms - Testing of turbine improvements in the order of several percent - Testing of aerodynamic codes - Testing of turbine response to effects such as turbulence...... profiles, turbulence, surface shear recovery distances etc) - Measurements of the interaction wind farms and microclimate The objectives of the metrology work package are to develop metrology tools in wind energy to significantly enhance the quality of measurement and testing techniques. The development...

  14. The variance of the locally measured Hubble parameter explained with different estimators

    DEFF Research Database (Denmark)

    Odderskov, Io Sandberg Hess; Hannestad, Steen; Brandbyge, Jacob

    2017-01-01

    We study the expected variance of measurements of the Hubble constant, H0, as calculated in either linear perturbation theory or using non-linear velocity power spectra derived from N-body simulations. We compare the variance with that obtained by carrying out mock observations in the N......-body simulations, and show that the estimator typically used for the local Hubble constant in studies based on perturbation theory is different from the one used in studies based on N-body simulations. The latter gives larger weight to distant sources, which explains why studies based on N-body simulations tend...... to obtain a smaller variance than that found from studies based on the power spectrum. Although both approaches result in a variance too small to explain the discrepancy between the value of H0 from CMB measurements and the value measured in the local universe, these considerations are important in light...

  15. Ultrasonic preliminary measurements of oenological malolactic fermentation parameters in red wine

    International Nuclear Information System (INIS)

    Novoa-Díaz, D F; García-Álvarez, J; Chávez, J A; Turó, A; García-Hernández, M J; Salazar, J; Puig-Pujol, A; Mínguez, S; Bertran, E

    2012-01-01

    In the winemaking process, the malolactic fermentation is an essential process in the production of high quality red wines which concerns the conversion of malate into lactate. In this work, the ultrasonic velocity through wine samples with different concentrations of malate and lactate was measured using the pulse echo technique with 1 MHz tone burst signals. The evolution of these concentrations during malolactic fermentation was taken into account in order to determine the ratio between concentrations of malate and lactate of the different samples. These preliminary results have revealed that the ultrasonic velocity increases during the conversion of malate to lactate. In addition, measurements have been conducted to quantify the influence of variations in turbidity and temperature on test samples. Therefore, these results show the possibility of using ultrasonic velocity measurements for on-line monitoring the malolactic fermentation of red wine and may help to improve and contribute to the development of the winemaking process.

  16. A Measure of the Conformity of a Parameter Set to a Trend: The Partially Ordered Case.

    Science.gov (United States)

    1983-05-01

    A-A3214 A MEASURE OF THE CONFORMIYO QAPARAMEfERSETO QA / TREND: THE PARTIAL .U) IOWA UNIV IOWA CIT DEPT OF ......STATISTICS AND ACTURIAL SCIENCE.T...and j with i o j. Such a vector 0 = (Oi,0j,.... 0k is said to be isotone (with respect to _). In studying such inference procedures it is helpful to...noticed that none of the measures studied here are applicable in alIl the situations considered. In studying locat ion pa rameter- wlhich are not

  17. Application of radioactive methods for the measurement of physical parameters used in industrial nuclear plants

    International Nuclear Information System (INIS)

    Bignan, G.

    1989-01-01

    The thesis presents the development of non-destructive and non-intrusive assay using source of rays (neutrons or gammas) which is external to the system to characterize (activation methods). They are intended to measure physical values used in industrial nuclear plants (Fissile matter concentration, neutronic multiplicity, presence of heavy nuclei...). The presentation is as follows: - Theoretical study of the suggested methods and development of signal processing to ensure the representativeness of the measurement. - Experimental qualification. - Implantation of these techniques in an industrial context [fr

  18. Asymmetrical effects of mesophyll conductance on fundamental photosynthetic parameters and their relationships estimated from leaf gas exchange measurements.

    Science.gov (United States)

    Sun, Ying; Gu, Lianhong; Dickinson, Robert E; Pallardy, Stephen G; Baker, John; Cao, Yonghui; DaMatta, Fábio Murilo; Dong, Xuejun; Ellsworth, David; Van Goethem, Davina; Jensen, Anna M; Law, Beverly E; Loos, Rodolfo; Martins, Samuel C Vitor; Norby, Richard J; Warren, Jeffrey; Weston, David; Winter, Klaus

    2014-04-01

    Worldwide measurements of nearly 130 C3 species covering all major plant functional types are analysed in conjunction with model simulations to determine the effects of mesophyll conductance (g(m)) on photosynthetic parameters and their relationships estimated from A/Ci curves. We find that an assumption of infinite g(m) results in up to 75% underestimation for maximum carboxylation rate V(cmax), 60% for maximum electron transport rate J(max), and 40% for triose phosphate utilization rate T(u) . V(cmax) is most sensitive, J(max) is less sensitive, and T(u) has the least sensitivity to the variation of g(m). Because of this asymmetrical effect of g(m), the ratios of J(max) to V(cmax), T(u) to V(cmax) and T(u) to J(max) are all overestimated. An infinite g(m) assumption also limits the freedom of variation of estimated parameters and artificially constrains parameter relationships to stronger shapes. These findings suggest the importance of quantifying g(m) for understanding in situ photosynthetic machinery functioning. We show that a nonzero resistance to CO2 movement in chloroplasts has small effects on estimated parameters. A non-linear function with gm as input is developed to convert the parameters estimated under an assumption of infinite gm to proper values. This function will facilitate gm representation in global carbon cycle models. © 2013 John Wiley & Sons Ltd.

  19. THE MEASUREMENT OF SELECTED SOIL PARAMETERS OF FORMER OPEN PIT MINE WITH THE USE OF TRIAXIAL STRESS APPARATUS

    Directory of Open Access Journals (Sweden)

    Janusz P. KOGUT

    Full Text Available Identification of geotechnical soil conditions often requires execution of laboratory tests, especially if you want to measure dynamic parameters of the soil. At present, the triaxial shear apparatus is widely applied in determination of the parameters of the soil. On the basis of the soil samples analysis, the examination results provide a wide range of data from basic performance parameters, e.g. internal friction angle and cohesion, to most complex ones like Young’s modulus permanent side effective stress of water samples. Furthermore, the Soil Structure Interaction Laboratory of Cracow University of Technology, has carried out the measurements of propagation of shear waves velocity with the use of bender elements tests. This work presents geotechnical conditions and the analysis of the results, which might be found useful to determine the transportation load parameters of designed S-7 and S-52 routes, as well as overall impact on soil/structure and surrounding areas located over the former clay open-pit mine. The landslides existing in the vicinity of the mine have prompted the authors to take that action.

  20. CO2 uptake and ecophysiological parameters of the grain crops of midcontinent North America: estimates from flux tower measurements

    Science.gov (United States)

    Gilmanov, Tagir; Wylie, Bruce; Tieszen, Larry; Meyers, Tilden P.; Baron, Vern S.; Bernacchi, Carl J.; Billesbach, David P.; Burba, George G.; Fischer, Marc L.; Glenn, Aaron J.; Hanan, Niall P.; Hatfield, Jerry L.; Heuer, Mark W.; Hollinger, Steven E.; Howard, Daniel M.; Matamala, Roser; Prueger, John H.; Tenuta, Mario; Young, David G.

    2013-01-01

    We analyzed net CO2 exchange data from 13 flux tower sites with 27 site-years of measurements over maize and wheat fields across midcontinent North America. A numerically robust “light-soil temperature-VPD”-based method was used to partition the data into photosynthetic assimilation and ecosystem respiration components. Year-round ecosystem-scale ecophysiological parameters of apparent quantum yield, photosynthetic capacity, convexity of the light response, respiration rate parameters, ecological light-use efficiency, and the curvature of the VPD-response of photosynthesis for maize and wheat crops were numerically identified and interpolated/extrapolated. This allowed us to gap-fill CO2 exchange components and calculate annual totals and budgets. VPD-limitation of photosynthesis was systematically observed in grain crops of the region (occurring from 20 to 120 days during the growing season, depending on site and year), determined by the VPD regime and the numerical value of the curvature parameter of the photosynthesis-VPD-response, σVPD. In 78% of the 27 site-years of observations, annual gross photosynthesis in these crops significantly exceeded ecosystem respiration, resulting in a net ecosystem production of up to 2100 g CO2 m−2 year−1. The measurement-based photosynthesis, respiration, and net ecosystem production data, as well as the estimates of the ecophysiological parameters, provide an empirical basis for parameterization and validation of mechanistic models of grain crop production in this economically and ecologically important region of North America.

  1. Measurement of D0-D0 mixing parameters and search for CP violation using D0 → K+ π- decays.

    Science.gov (United States)

    Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Badalov, A; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M-O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Cheung, S-F; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D C; Cruz Torres, M; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dornan, P; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Falabella, A; Färber, C; Farinelli, C; Farry, S; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gorbounov, P; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grillo, L; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Heß, M; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kurek, K; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Lupton, O; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Maratas, J; Marconi, U; Marino, P; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Martynov, A; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; McCarthy, J; McNab, A; McNulty, R; McSkelly, B; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M-N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pearce, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pescatore, L; Pesen, E; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rachwal, B; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reichert, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Roberts, D A; Rodrigues, A B; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rotondo, M; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Sanmartin Sedes, B; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, N A; Smith, E; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Sutcliffe, W; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szilard, D; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wormser, G; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

    2013-12-20

    Measurements of charm mixing parameters from the decay-time-dependent ratio of D0 → K+ π- to D0 → K- π+ rates and the charge-conjugate ratio are reported. The analysis uses data, corresponding to 3  fb(-1) of integrated luminosity, from proton-proton collisions at 7 and 8 TeV center-of-mass energies recorded by the LHCb experiment. In the limit of charge-parity (CP ) symmetry, the mixing parameters are determined to be x'2=(5.5±4.9)×10(-5), y'=(4.8±1.0)×10(-3), and RD=(3.568±0.066)×10(-3). Allowing for CP violation, the measurement is performed separately for D0 and D0 mesons yielding AD=(-0.7±1.9)%, for the direct CP-violating asymmetry, and 0.75<|q/p|<1.24 at the 68.3% confidence level, for the parameter describing CP violation in mixing. This is the most precise determination of these parameters from a single experiment and shows no evidence for CP violation.

  2. Implications of the top quark mass measurement for the CKM parameters x$_{s}$ and CP asymmetries

    CERN Document Server

    Ali, A

    1995-01-01

    Motivated by the recent determination of the top quark mass by the CDF collaboration, \\mt =174 \\pm 10 ^{+13}_{-12} GeV, we review and update constraints on the parameters of the quark flavour mixing matrix V_{CKM} in the standard model. In performing these fits, we use inputs from the measurements of \\abseps, the CP-violating parameter in K decays, \\xd = (\\delm)/\\Gamma, the mixing parameter in \\bdbdbar\\ mixing, the present measurements of the matrix elements \\absvcb and \\absvub, and the B-hadron lifetimes. The CDF value for \\mt considerably reduces the CKM-parameter space previously allowed. An interesting result of our analysis is that the present data can be used to restrict the coupling constant product ratio f_{B_d}\\sqrt{B_{B_d}} to the range 110-270 MeV -- in comfortable agreement with existing theoretical estimates of this quantity. We use the updated CKM matrix to predict the \\bsbsbar\\ mixing ratio \\xs, as well as the quantities \\sin 2\\alpha, \\sin 2\\beta and \\sin^2\\gamma, which characterize CP-violatin...

  3. Confined subdiffusion in three dimensions

    International Nuclear Information System (INIS)

    Qin Shan-Lin; He Yong

    2014-01-01

    Three-dimensional (3D) Fick's diffusion equation and fractional diffusion equation are solved for different reflecting boundaries. We use the continuous time random walk model (CTRW) to investigate the time-averaged mean square displacement (MSD) of a 3D single particle trajectory. Theoretical results show that the ensemble average of the time-averaged MSD can be expressed analytically by a Mittag—Leffler function. Our new expression is in agreement with previous formulas in two limiting cases: <δ 2 -bar> ∼ Δ in short lag time and <δ 2 -bar> ∼ Δ 1-α in long lag time. We also simulate the experimental data of mRNA diffusion in living E. coli using a 3D CTRW model under confined and crowded conditions. The simulation results are well consistent with experimental results. The calculations of power spectral density (PSD) further indicate the subdiffsive behavior of an individual trajectory. (general)

  4. Measurement of Two-Phase Flow and Heat Transfer Parameters using Infrared Thermometry

    Science.gov (United States)

    Kim, Tae-Hoon; Kommer, Eric; Dessiatoun, Serguei; Kim, Jungho

    2012-01-01

    A novel technique to measure heat transfer and liquid film thickness distributions over relatively large areas for two-phase flow and heat transfer phenomena using infrared (IR)thermometry is described. IR thermometry is an established technology that can be used to measure temperatures when optical access to the surface is available in the wavelengths of interest. In this work, a midwave IR camera (3.6-5.1 microns) is used to determine the temperature distribution within a multilayer consisting of a silicon substrate coated with a thin insulator. Since silicon is largely transparent to IR radiation, the temperature of the inner and outer walls of the multilayer can be measured by coating selected areas with a thin, IR opaque film. If the fluid used is also partially transparent to IR, the flow can be visualized and the liquid film thickness can be measured. The theoretical basis for the technique is given along with a description of the test apparatus and data reduction procedure. The technique is demonstrated by determining the heat transfer coefficient distributions produced by droplet evaporation and flow boiling heat transfer.

  5. Review article – Optimisation of exposure parameters for spinal curvature measurements in paediatric radiography

    NARCIS (Netherlands)

    de Haan, Seraphine; Reis, Cláudia; Ndlovu, Junior; Serrenho, Catarina; Akhtar, Ifrah; Garcia, José Antonio; Linde, Daniël; Thorskog, Martine; Franco, Loris; Hogg, Peter

    2015-01-01

    This review aims to identify strategies to optimise radiography practice using digital technologies, for full spine studies on paediatrics focusing particularly on methods used to diagnose and measure severity of spinal curvatures. The literature search was performed on different databases (PubMed,

  6. Prototype for the measurement of parameters in the Mammography Unity using photodiodes

    International Nuclear Information System (INIS)

    Mercado H, I.; Ramirez J, F.J.; Tovar M, V.; Becerril V, A.

    1999-01-01

    It has been developed a prototype which makes possible to measure the kilo voltage applied to the X-ray tube, the exposure time of the radiation beam and the yield expressed in kerma in air K a (mGy/m As) o a mammography unit. The instrument consists of a radiation detector, an acquisition circuit, a stage of analogical processing of the signal connected to an analogic-digital converter and a display system of the results. The detection section is composed by a pair of photodiodes PIN type in which to do make the measurement of kilo voltage one of them is covered by an aluminium filter (Al) and the other one by a molybdenum filter (Mo). The measurements were done in a mammography unit which possess a generator of high frequency, with a molybdenum anode, a window 8 mm Beryllium (Be) and an additional filtration of 30 μ m Mo. The measurements obtained were compared with commercial instruments finding maximum variations of 2 % of value obtained. This prototype has been developed with the idea to obtain in a future a commercial instrument, for be used mainly in the hospitable institutions as an auxiliary tool in the Quality assurance programs in radiodiagnostic. (Author)

  7. Laboratory calibrations of airborne gamma-ray spectrometers. Measurements and discussions of important parameters

    International Nuclear Information System (INIS)

    Korsbech, U.

    1994-02-01

    This report is the fourth of reports from The Department of Electrophysics covering measurement and interpretation of airborne gamma-spectrometry measurements. It describes different topics concerning the construction of a suitable calibration setup in the laboratory. The goal is to build a simple and cheap laboratory setup that can produce most of the gamma-ray data needed for an interpretation of spectra measured 50 to 120 m above ground level. A simple calibration setup has been build and tested. It may produce gamma-ray spectra similar to those measured in the air - from surface contamination with artificial nuclides and from 'bulk' natural radioactivity. It is possible to investigate the influence of the air above an aircraft carrying the detector (skyshine: scattering of gamma photons in the air above the detector). In order to reduce the influence of non-detected pile-up the count rates are kept low without reaching levels where the background spectra (to be subtracted) would cause unacceptable counting statistical fluctuations. Sources selected for the calibrations are heavy minerals sand (with thorium and uranium), potassium nitrate (with 40 K). These sources are 'bulk sources' of natural radioactivity. Cesium-137 has been selected as the basic artifical surface contamination nuclide. The report also discusses methods for comparing two spectra a priori assumed equal. Finally the properties of some materials that could be used as 'air-substitutes' in the calibration setup have been tested with respect to stability against moisture sorption. (au)

  8. The Association between Parameters of Malnutrition and Diagnostic Measures of Sarcopenia in Geriatric Outpatients

    NARCIS (Netherlands)

    Reijnierse, E.M.; Trappenburg, M.C.; Leter, M.J.; Blauw, G. J.; van Bokhorst-de van der Schueren, M.A.E.; Meskers, C.G.M.; Maier, A.B.

    2015-01-01

    Objectives: Diagnostic criteria for sarcopenia include measures of muscle mass, muscle strength and physical performance. Consensus on the definition of sarcopenia has not been reached yet. To improve insight into the most clinically valid definition of sarcopenia, this study aimed to compare the

  9. Parameter optimization of measuring and control elements in the monitoring systems of complex technical objects

    Science.gov (United States)

    Nekrylov, Ivan; Korotaev, Valery; Blokhina, Anastasia; Kleshchenok, Maksim

    2017-06-01

    In the world is the widespread adoption of measuring equipment of new generation, which is characterized by small size, high automation level, a multi-channel, digital filtering, satellite synchronization, wireless communication, digital record in long-term memory with great resource, powered by long-lived sources, etc. However, modern equipment base of the Russian institutions and the level of development of technical facilities and measuring technologies lag far behind developed countries. For this reason, the vacated niches are actively developed by foreign companies. For example, more than 70% instrumentation performing works on the territory of Russia, equipped with imported equipment (products of Sweden and Germany companies); the amount of work performed with German equipment is more than 70% of the total volume of these works; more than 80% of industrial measurements are performed using HEXAGON equipment (Sweden). These trends show that the Russian sector of measuring technology gradually become import-dependent, which poses a threat to the economic security of the country and consistent with national priorities. The results of the research will allow to develop the theory of formation of control systems of the displacement with high accuracy and unattainable for the existing analogue ergonomic and weight characteristics combined with a comparable or lower cost. These advantages will allow you to be successful competition, and eventually to supplant the existing system, which had no fundamental changes in the last 20 years and, therefore, retained all the drawbacks: large size and weight, high power consumption, the dependence on magnetic fields

  10. Calibration Procedure for Measuring S-Parameters in Balun Applications on 150-ohm High-Speed Cables

    Science.gov (United States)

    Theofylaktos, Onoufrios; Warner, Joseph D.

    2012-01-01

    In the radiofrequency (RF) world, in order to characterize cables that do not conform to the typical 50-omega impedance, a time domain reflectometer (TDR) would probably be the simplest and quickest tool to attain this goal. In the real world, not every engineer has a TDR at their disposal; however, they most likely have a network analyzer available. Given a generic 50-omega vector network analyzer (VNA), we would like to make S-parameter measurements for non-50-omega devices (DUTs). For that, we utilize RF balanced/unbalanced transformers (called baluns for short), which are primarily used to match the impedance between the two VNA ports and the DUT's input and output ports, for the two-port S-parameter measurements.

  11. Passive and Active Measurements of Radon related parameters inside ancient Egyptian Tombs in Luxor

    International Nuclear Information System (INIS)

    Abo-Elmagd, M.; Eissa, H.M.; Metwally, S.M.; Fiki, S.A.; Salama, E.

    2005-01-01

    Radon concentration and its exhalation rate were measured using active (Alpha-Guard analyzer) and passive (CR-39) techniques inside seven ancient Egyptian tombs of the Kings valley in Luxor. The measurements were performed during the winter season of tourism (15/10/2003 up to 09/02/2004). The real radium content was determine for all examined tombs by HPGe detector, while the effective radium content was obtained by Alpha-Guard and sealed cup techniques. The average radon concentration inside the tombs based on the active technique ranges from 116 42 to 362 115 Bq m-3 and the exhalation rate ranges from 0.68 to 1.47 Bq m-2 h-1. For passive measurements, the average radon concentrations inside the tombs vary from 88 5 to 517 8 Bq m-3 while the exhalation rate ranges from 0.60 to 1.42 0.05 Bq m-2 h-1. Because of the variations of tombs dimensions and their ventilation systems, the equilibrium factor between radon and its progeny ranges from 0.10 0.04 to 0.99 0.14 based on Can and Bare measurement method. The effective dose rate inside the tombs varies from 0.11 0.04 to 4.28 0.68 Sv/h, based on UNSCEAR 2000 dose conversion factors for radon and its progeny. Radon exhalation rate was correlated with the real radium content. Moreover, a good correlation was found between active and passive measurements. So it may be useful to use passive technique in large scale instead of the active one

  12. Passive and Active Measurements of Radon related parameters inside ancient Egyptian Tombs in Luxor

    Energy Technology Data Exchange (ETDEWEB)

    Abo-Elmagd, M; Eissa, H M [National institute for standerd, radiation Measurements department, Giza (Egypt); Metwally, S M; Fiki, S A; Salama, E [Faculty of Science Department of physics, Ain Shams University, Cairo (Egypt)

    2005-04-01

    Radon concentration and its exhalation rate were measured using active (Alpha-Guard analyzer) and passive (CR-39) techniques inside seven ancient Egyptian tombs of the Kings valley in Luxor. The measurements were performed during the winter season of tourism (15/10/2003 up to 09/02/2004). The real radium content was determine for all examined tombs by HPGe detector, while the effective radium content was obtained by Alpha-Guard and sealed cup techniques. The average radon concentration inside the tombs based on the active technique ranges from 116 42 to 362 115 Bq m-3 and the exhalation rate ranges from 0.68 to 1.47 Bq m-2 h-1. For passive measurements, the average radon concentrations inside the tombs vary from 88 5 to 517 8 Bq m-3 while the exhalation rate ranges from 0.60 to 1.42 0.05 Bq m-2 h-1. Because of the variations of tombs dimensions and their ventilation systems, the equilibrium factor between radon and its progeny ranges from 0.10 0.04 to 0.99 0.14 based on Can and Bare measurement method. The effective dose rate inside the tombs varies from 0.11 0.04 to 4.28 0.68 Sv/h, based on UNSCEAR 2000 dose conversion factors for radon and its progeny. Radon exhalation rate was correlated with the real radium content. Moreover, a good correlation was found between active and passive measurements. So it may be useful to use passive technique in large scale instead of the active one.

  13. The determination of parameters of the upper atmosphere by the radio-meteor measurements

    Science.gov (United States)

    Shamukov, Damir; Fahrutdinova, Antonina; Nugmanov, Ildus

    Study of the parameters of the upper atmosphere on the basis of amplitude-time characteristics of meteor ionization. Together with various methods meteor observations (optical, photographic, visual, spectral, television), the most effective modern method of studying meteors means is radar. The development of modern radar technology allows us to apply this tool to monitor meteors. This method allows to determine the parameters of temperature and atmospheric pressure. Actual issue is the development of methods of determining the coefficient of ambipolar diffusion, pressure, density and temperature of the atmosphere in the meteor zone. Graph of amplitude-time characteristic has the exponential form. This fact allows to determine the coefficient of ambipolar diffusion. New algorithm for estimation of the ambipolar diffusion coefficient based on a set of statistical methods and techniques of digital signal processing. There are decomposition of data on singular values and Prony's method. This method of modeling the sample data as a linear combination of exponential. Prony’s method approximates the amplitude-time characteristics of using a deterministic exponential model. Input data is amplitude-time characteristics of the meteor trail x[1]…x[N]. The method allows to estimate x[n] p-membered exponential model: begin{center} x[n]=Sigma2A_{k}exp[a _{k}(n-1)]Cos[2Pif_{k}(n-1)T+Fi_{k}] (1) end{center} 1<=n<=N, T - time range in seconds, A_{k} and a_{k} - amplitude and damping coefficient, f_{k} and Fi_{k} - frequency and initial phase. The equation describing the decay of radio signal: begin{center} A=A_{0}exp(-16Pi^{2}$D_{a}t/λ (2) ). (2) lambdaλ - radar wavelength. The output of the algorithm - the ambipolar diffusion coefficient values D_{a}. begin{center} T=0.5lnD-T_{0}+mg/2kT_{0} (3) Last equation allows to obtain temperature values using the coefficient of ambipolar diffusion depends on the height.

  14. Measurement of the spin-spin correlation parameter C/sub LL/(THETA) in proton-proton scattering

    International Nuclear Information System (INIS)

    Stuart, S.J.

    1982-08-01

    The experimental procedures and methods of data analysis used to measure the spin-spin correlation parameter C/sub LL/(THETA) in proton-proton scattering at thirteen different energies in the range 300 to 800 MeV are presented. The results compare favorably with previous data. Good agreement is found with phase shift predictions at energies below 500 MeV

  15. Measurements of parameters for determining the radon load in the framework of the Dutch national research program SAWORA

    International Nuclear Information System (INIS)

    Groen, G.C.H.; Groot, T.J.H. de; Nyqvist, R.G.; Keverling Buisman, A.S.; Stoute, J.R.D.

    1986-06-01

    This report describes a series of measurements related to the indoor exposure to daughters of radon and thoron. Important parameters are the Potential Alpha Energy Concentration (PAEC) and the Activity Median Aerodynamic Diameter (AMAD). The results for indoor atmosphere are presented leading to an order of magnitude estimate of the effective dose-equivalent rate of 500 μSv/y. The thoron daughter concentrations are relatively high with respect to those of radon daughters. (Auth.)

  16. Ultra-Weak Fiber Bragg Grating Sensing Network Coated with Sensitive Material for Multi-Parameter Measurements

    OpenAIRE

    Bai, Wei; Yang, Minghong; Hu, Chenyuan; Dai, Jixiang; Zhong, Xuexiang; Huang, Shuai; Wang, Gaopeng

    2017-01-01

    A multi-parameter measurement system based on ultra-weak fiber Bragg grating (UFBG) array with sensitive material was proposed and experimentally demonstrated. The UFBG array interrogation principle is time division multiplex technology with two semiconductor optical amplifiers as timing units. Experimental results showed that the performance of the proposed UFBG system is almost equal to that of traditional FBG, while the UFBG array system has obvious superiority with potential multiplexing ...

  17. Profiles of plasma parameters and density of negative hydrogen ions by laser detachment measurements in RF-driven ion sources

    International Nuclear Information System (INIS)

    Christ-Koch, Sina

    2007-01-01

    This work shows the application of the Laserdetachment method for spatially resolved measurements of negative Hydrogen/Deuterium ion density. It was applied on a high power low pressure RF-driven ion source. The Laser detachment method is based on the measurement of electron currents on a positively biased Langmuir probe before and during/after a laser pulse. The density ratio of negative ions to electrons can be derived from the ratio of currents to the probe. The absolute density of negative ions can be obtained when the electron density is measured with the standard Langmuir probe setup. Measurements with the Langmuir probe additionally yield information about the floating and plasma potential, the electron temperature and the density of positive ions. The Laser detachment setup had to be adapted to the special conditions of the RF-driven source. In particular the existence of RF fields (1 MHz), high source potential (-20 kV), magnetic fields (∝ 7 mT) and caesium inside the source had to be considered. The density of negative ions could be identified in the range of n(H - )=1.10 17 1/m 3 , which is in the same order of magnitude as the electron density. Only the application of the Laser detachment method with the Langmuir probe measurements will yield spatially resolved plasma parameters and H- density profiles. The influence of diverse external parameters, such as pressure, RF-power, magnetic fields on the plasma parameters and their profiles were studied and explained. Hence, the measurements lead to a detailed understanding of the processes inside the source. (orig.)

  18. Non-invasive measure of respiratory mechanics and conventional respiratory parameters in conscious large animals by high frequency Airwave Oscillometry.

    Science.gov (United States)

    Bassett, Leanne; Troncy, Eric; Robichaud, Annette; Schuessler, Thomas F; Pouliot, Mylène; Ascah, Alexis; Authier, Simon

    2014-01-01

    A number of drugs in clinical trials are discontinued due to potentially life-threatening airway obstruction. As some drugs may not cause changes in core battery parameters such as tidal volume (Vt), respiratory rate (RR) or minute ventilation (MV), including measurements of respiratory mechanics in safety pharmacology studies represents an opportunity for design refinement. The present study aimed to test a novel non-invasive methodology to concomitantly measure respiratory system resistance (Rrs) and conventional respiratory parameters (Vt, RR, MV) in conscious Beagle dogs and cynomolgus monkeys. An Airwave Oscillometry system (tremoFlo; THORASYS Inc., Montreal, Canada) was used to concomitantly assess Rrs and conventional respiratory parameters before and after intravenous treatment with a bronchoactive agent. Respiratory mechanics measurements were performed by applying a short (i.e. 16s) single high frequency (19Hz) waveform at the subject's airway opening via a face mask. During measurements, pressure and flow signals were recorded. After collection of baseline measurements, methacholine was administered intravenously to Beagle dogs (n=6) and cynomolgus monkeys (n=4) at 8 and 68μg/kg, respectively. In dogs, methacholine induced significant increases in Vt, RR and MV while in monkeys, it only augmented RR. A significant increase in Rrs was observed after methacholine administration in both species with mean percentage peak increases from baseline of 88 (53)% for dogs and 28 (16)% for cynomolgus monkeys. Airwave Oscillometry appears to be a promising non-invasive methodology to enable respiratory mechanics measurements in conscious large animals, a valuable refinement in respiratory safety pharmacology. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Nonlinear optical parameters of nanocrystalline AZO thin film measured at different substrate temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Jilani, Asim, E-mail: asim.jilane@gmail.com [Centre of Nanotechnology, King Abdulaziz University, Jeddah (Saudi Arabia); Abdel-wahab, M.Sh [Centre of Nanotechnology, King Abdulaziz University, Jeddah (Saudi Arabia); Materials Science and Nanotechnology Department, Faculty of Postgraduate Studies for Advanced Sciences, Beni -Suef University, Beni-Suef (Egypt); Al-ghamdi, Attieh A. [Centre of Nanotechnology, King Abdulaziz University, Jeddah (Saudi Arabia); Dahlan, Ammar sadik [Department of architecture, faculty of environmental design, King Abdulaziz University, Jeddah (Saudi Arabia); Yahia, I.S. [Department of Physics, Faculty of Science, King Khalid University, P.O. Box 9004, Abha (Saudi Arabia); Nano-Science & Semiconductor Labs, Department of Physics, Faculty of Education, Ain Shams University, Roxy, 11757 Cairo (Egypt)

    2016-01-15

    The 2.2 wt% of aluminum (Al)-doped zinc oxide (AZO) transparent and preferential c-axis oriented thin films were prepared by using radio frequency (DC/RF) magnetron sputtering at different substrate temperature ranging from room temperature to 200 °C. For structural analysis, X-ray Diffraction (XRD) and Atomic Force Electron Microscope (AFM) was used for morphological studies. The optical parameters such as, optical energy gap, refractive index, extinction coefficient, dielectric loss, tangent loss, first and third order nonlinear optical properties of transparent films were investigated. High transmittance above 90% and highly homogeneous surface were observed in all samples. The substrate temperature plays an important role to get the best transparent conductive oxide thin films. The substrate temperature at 150 °C showed the growth of highly transparent AZO thin film. Energy gap increased with the increased in substrate temperature of Al doped thin films. Dielectric constant and loss were found to be photon energy dependent with substrate temperature. The change in substrate temperature of Al doped thin films also affect the non-liner optical properties of thin films. The value of χ{sup (3)} was found to be changed with the grain size of the thin films that directly affected by the substrate temperature of the pure and Al doped ZnO thin films.

  20. Measurement of distance parameter using semiclassical model in various heavy ion interactions

    Energy Technology Data Exchange (ETDEWEB)

    Nasir, Tabassum [Department of Physics, Gomal University D.I. Khan (Pakistan); Khan, E U [Department of Physics, CIIT, Islamabad (Pakistan); Baluch, J J [Department of Environmental Sciences, CIIT, Abbottabad (Pakistan); Qureshi, I E [Pakistan Atomic Energy Commission, P.O. Box 1114, Islamabad (Pakistan); Sajid, M; Shahzad, M I; Khan, H A [Physics Research Division, PINSTECH, P.O. Nilore, Islamabad (Pakistan)

    2008-08-15

    The technique of solid state nuclear track detection was employed to collect data of elastic scattering as well as inelastic reaction channel. The elastic data of the reactions {sup 238}U+{sup 209}Bi, {sup 238}U+{sup 197}Au, {sup 208}Pb+{sup 197}Au and {sup 197}Au+{sup 197}Au were used to calculate the experimental elastic scattering cross-sections for various angular bins. The ratio of these cross-sections to Rutherford/Mott cross-sections were plotted with respect to distance d({theta}). Distance parameter d{sub 0} in all four reactions was obtained from the discontinuity of the slope following the method suggested in the semiclassical model. Partial reaction cross-sections were also obtained from the inelastic binary as well as multiprong events in the heavy ion interactions of {sup 208}Pb+{sup 197}Au and {sup 197}Au+{sup 197}Au both at 11.67 MeV/u beam energy. The higher values of partial cross-sections of two prong inelastic events as compared with {sigma}{sub 3} and {sigma}{sub 4} have been attributed to the emission of intermediate mass fragments in both the reactions.