WorldWideScience

Sample records for mdr tb treatment

  1. Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

    Science.gov (United States)

    Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

    2016-07-01

    Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

  2. Community-based MDR-TB care project improves treatment initiation in patients diagnosed with MDR-TB in Myanmar.

    Science.gov (United States)

    Wai, Pyae Phyo; Shewade, Hemant Deepak; Kyaw, Nang Thu Thu; Thein, Saw; Si Thu, Aung; Kyaw, Khine Wut Yee; Aye, Nyein Nyein; Phyo, Aye Mon; Maung, Htet Myet Win; Soe, Kyaw Thu; Aung, Si Thu

    2018-01-01

    The Union in collaboration with national TB programme (NTP) started the community-based MDR-TB care (CBMDR-TBC) project in 33 townships of upper Myanmar to improve treatment initiation and treatment adherence. Patients with MDR-TB diagnosed/registered under NTP received support through the project staff, in addition to the routine domiciliary care provided by NTP staff. Each township had a project nurse exclusively for MDR-TB and 30 USD per month (max. for 4 months) were provided to the patient as a pre-treatment support. To assess whether CBMDR-TBC project's support improved treatment initiation. In this cohort study (involving record review) of all diagnosed MDR-TB between January 2015 and June 2016 in project townships, CBMDR-TBC status was categorized as "receiving support" if date of project initiation in patient's township was before the date of diagnosis and "not receiving support", if otherwise. Cox proportional hazards regression (censored on 31 Dec 2016) was done to identify predictors of treatment initiation. Of 456 patients, 57% initiated treatment: 64% and 56% among patients "receiving support (n = 208)" and "not receiving support (n = 228)" respectively (CBMDR-TBC status was not known in 20 (4%) patients due to missing diagnosis dates). Among those initiated on treatment (n = 261), median (IQR) time to initiate treatment was 38 (20, 76) days: 31 (18, 50) among patients "receiving support" and 50 (26,101) among patients "not receiving support". After adjusting other potential confounders (age, sex, region, HIV, past history of TB treatment), patients "receiving support" had 80% higher chance of initiating treatment [aHR (0.95 CI): 1.8 (1.3, 2.3)] when compared to patients "not receiving support". In addition, age 15-54 years, previous history of TB and being HIV negative were independent predictors of treatment initiation. Receiving support under CBMDR-TBC project improved treatment initiation: it not only improved the proportion initiated but also

  3. Management and treatment outcomes of patients enrolled in MDR-TB treatment in Viet Nam.

    Science.gov (United States)

    Phuong, N T M; Nhung, N V; Hoa, N B; Thuy, H T; Takarinda, K C; Tayler-Smith, K; Harries, A D

    2016-03-21

    The programmatic management of drug-resistant tuberculosis (TB) in Viet Nam has been rapidly scaled up since 2009. To document the annual numbers of patients enrolled for multidrug-resistant tuberculosis (MDR-TB) treatment during 2010-2014 and to determine characteristics and treatment outcomes of patients initiating treatment during 2010-2012. A retrospective cohort study using national reports and data from the national electronic data system for drug-resistant TB. The number of patients enrolled annually for MDR-TB treatment increased from 97 in 2010 to 1522 in 2014. The majority of patients were middle-aged men who had pulmonary disease and had failed a retreatment regimen; 77% had received ⩾2 courses of TB treatment. Favourable outcomes (cured and treatment completed) were attained in 73% of patients. Unfavourable outcomes included loss to follow-up (12.5%), death (8%) and failure (6.3%). Having had ⩾2 previous treatment courses and being human immunodeficiency virus-positive were associated with unfavourable outcomes. Increasing numbers of patients are being treated for MDR-TB each year with good treatment outcomes under national programme management in Viet Nam. However, there is a need to increase case detection-currently at 30% of the estimated 5100 MDR-TB cases per year, reduce adverse outcomes and improve monitoring and evaluation.

  4. Social, economic, and psychological impacts of MDR-TB treatment in Tijuana, Mexico: a patient's perspective.

    Science.gov (United States)

    Morris, M D; Quezada, L; Bhat, P; Moser, K; Smith, J; Perez, H; Laniado-Laborin, R; Estrada-Guzman, J; Rodwell, T C

    2013-07-01

    The State of Baja California, Mexico, had the highest prevalence of multidrug-resistant tuberculosis (MDR-TB) in Mexico in 2009. To understand the socio-economic burden of MDR-TB disease and its treatment on patients in Tijuana and Mexicali, Mexico. From July to November 2009, qualitative interviews were conducted with 12 patients enrolled in a US-Mexico binational MDR-TB treatment program, Puentes de Esperanza (Bridges of Hope), which was designed to support MDR-TB patients. In-depth interviews were coded to identify major themes in patient experiences of MDR-TB diagnosis and care. While some patients were able to maintain their pre-MDR-TB lives to a limited extent, most patients reported losing their sense of identity due to their inability to work, social isolation, and stigmatization from family and friends. The majority of participants expressed appreciation for Puentes' role in 'saving their lives'. Being diagnosed with MDR-TB and undergoing treatment imposes significant psychological, social and economic stress on patients. Strong social support elements within Puentes helped alleviate these burdens. Improvements to the program might include peer-support groups for patients undergoing treatment and transitioning back into the community after treatment.

  5. Comparison of bacteriological conversion and treatment outcomes among MDR-TB patients with and without diabetes in Mexico: Preliminary data

    Directory of Open Access Journals (Sweden)

    M. Muñoz-Torrico

    2017-01-01

    Full Text Available Diabetes mellitus (DM is a well-known risk factor for tuberculosis (TB. However, it is not known to what extent DM affects the outcome in patients with multidrug-resistant (MDR-TB and extensively drug-resistant TB (XDR-TB treated with second-line anti-TB drugs.The objective of this study was to compare the microbiological evolution (sputum smear and culture conversion and final outcomes of MDR/XDR-TB patients with and without DM, managed at the national TB reference centre in Mexico City. Results: Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%, 11 with pre-XDR-TB (e.g. MDR-TB with additional resistance to one injectable drug or a fluoroquinolone, 12.2% and 6 (6.7% with XDR-TB. Out of these, 49 (54.4% had DM and 42 (86% were undergoing insulin treatment.No statistically significant differences were found in treatment outcomes comparing DM vs. non-DM MDR-TB cases: 18/32 (56.3% of DM cases and 19/24 (79.2% non DM patients achieved treatment success (p = 0.07. The time to sputum smear and culture conversion was longer (although not statistically in patients without DM, as follows: the mean (±SD time to sputum smear conversion was 53.9 (±31.4 days in DM patients and 65.2 (±34.8 days in non-DM ones (p = 0.15, while the time to culture conversion was 66.2 (±27.6 days for DM and 81.4 (±37.7 days for non-DM MDR-TB cases (p = 0.06. Conclusions: The study results support the Mexican National TB programme to strengthen its collaboration with the DM programme, as an entry point for TB (and latent TB infection screening and management. Keywords: Diabetes mellitus, Delay, Sputum and culture conversion, MDR-TB, High treatment adherence

  6. Heightened vulnerability to MDR-TB epidemics after controlling drug-susceptible TB.

    Directory of Open Access Journals (Sweden)

    Jason D Bishai

    2010-09-01

    Full Text Available Prior infection with one strain TB has been linked with diminished likelihood of re-infection by a new strain. This paper attempts to determine the role of declining prevalence of drug-susceptible TB in enabling future epidemics of MDR-TB.A computer simulation of MDR-TB epidemics was developed using an agent-based model platform programmed in NetLogo (See http://mdr.tbtools.org/. Eighty-one scenarios were created, varying levels of treatment quality, diagnostic accuracy, microbial fitness cost, and the degree of immunogenicity elicited by drug-susceptible TB. Outcome measures were the number of independent MDR-TB cases per trial and the proportion of trials resulting in MDR-TB epidemics for a 500 year period after drug therapy for TB is introduced.MDR-TB epidemics propagated more extensively after TB prevalence had fallen. At a case detection rate of 75%, improving therapeutic compliance from 50% to 75% can reduce the probability of an epidemic from 45% to 15%. Paradoxically, improving the case-detection rate from 50% to 75% when compliance with DOT is constant at 75% increases the probability of MDR-TB epidemics from 3% to 45%.The ability of MDR-TB to spread depends on the prevalence of drug-susceptible TB. Immunologic protection conferred by exposure to drug-susceptible TB can be a crucial factor that prevents MDR-TB epidemics when TB treatment is poor. Any single population that successfully reduces its burden of drug-susceptible TB will have reduced herd immunity to externally or internally introduced strains of MDR-TB and can experience heightened vulnerability to an epidemic. Since countries with good TB control may be more vulnerable, their self interest dictates greater promotion of case detection and DOTS implementation in countries with poor control to control their risk of MDR-TB.

  7. Adverse Events among HIV/MDR-TB Co-Infected Patients Receiving Antiretroviral and Second Line Anti-TB Treatment in Mumbai, India

    Science.gov (United States)

    Isaakidis, Petros; Varghese, Bhanumati; Mansoor, Homa; Cox, Helen S.; Ladomirska, Joanna; Saranchuk, Peter; Da Silva, Esdras; Khan, Samsuddin; Paryani, Roma; Udwadia, Zarir; Migliori, Giovanni Battista; Sotgiu, Giovanni; Reid, Tony

    2012-01-01

    Background Significant adverse events (AE) have been reported in patients receiving medications for multidrug- and extensively-drug-resistant tuberculosis (MDR-TB & XDR-TB). However, there is little prospective data on AE in MDR- or XDR-TB/HIV co-infected patients on antituberculosis and antiretroviral therapy (ART) in programmatic settings. Methods Médecins Sans Frontières (MSF) is supporting a community-based treatment program for drug-resistant tuberculosis in HIV-infected patients in a slum setting in Mumbai, India since 2007. Patients are being treated for both diseases and the management of AE is done on an outpatient basis whenever possible. Prospective data were analysed to determine the occurrence and nature of AE. Results Between May 2007 and September 2011, 67 HIV/MDR-TB co-infected patients were being treated with anti-TB treatment and ART; 43.3% were female, median age was 35.5 years (Interquartile Range: 30.5–42) and the median duration of anti-TB treatment was 10 months (range 0.5–30). Overall, AE were common in this cohort: 71%, 63% and 40% of patients experienced one or more mild, moderate or severe AE, respectively. However, they were rarely life-threatening or debilitating. AE occurring most frequently included gastrointestinal symptoms (45% of patients), peripheral neuropathy (38%), hypothyroidism (32%), psychiatric symptoms (29%) and hypokalaemia (23%). Eleven patients were hospitalized for AE and one or more suspect drugs had to be permanently discontinued in 27 (40%). No AE led to indefinite suspension of an entire MDR-TB or ART regimen. Conclusions AE occurred frequently in this Mumbai HIV/MDR-TB cohort but not more frequently than in non-HIV patients on similar anti-TB treatment. Most AE can be successfully managed on an outpatient basis through a community-based treatment program, even in a resource-limited setting. Concerns about severe AE in the management of co-infected patients are justified, however, they should not cause delays

  8. "When Treatment Is More Challenging than the Disease": A Qualitative Study of MDR-TB Patient Retention.

    Directory of Open Access Journals (Sweden)

    Kalpita S Shringarpure

    Full Text Available One-fifth of the patients on multidrug-resistant tuberculosis treatment at the Drug-Resistant-TB (DR-TB Site in Gujarat are lost-to-follow-up(LFU.To understand patients' and providers' perspectives on reasons for LFU and their suggestions to improve retention-in-care.Qualitative study conducted between December 2013-March 2014, including in-depth interviews with LFU patients and DOT-providers, and a focus group discussion with DR-TB site supervisors. A thematic-network analysis approach was utilised.Three sub-themes emerged: (i Struggle with prolonged treatment; (ii Strive against stigma and toward support; (iii Divergent perceptions and practices. Daily injections, pill burden, DOT, migratory work, social problems, prior TB treatment, and adverse drugs effects were reported as major barriers to treatment adherence and retention-in-care by patients and providers. Some providers felt that despite their best efforts, LFU patients remain. Patient movements between private practitioners and traditional healers further influenced LFU.The study points to a need for repeated patient counselling and education, improved co-ordination between various tiers of providers engaged in DR-TB care, collaboration between the public, private and traditional practitioners, and promotion of social and economic support to help patients adhere to MDR-TB treatment and avoid LFU.

  9. 8__Aisha_Detection ofMDR-TB

    African Journals Online (AJOL)

    User

    Among the MDR-TB cases rifampicin resistance was associated with rpoB WT gene and rpoB MUT gene in 100% and 62% of the ... diagnosis of TB patients, and proper treatment and management of the infected cases to minimize the spread and ..... in an amino acid change and concluded that this is one of the reasons ...

  10. Clinical and programmatic considerations in the treatment of MDR-TB in children: a series of 16 patients from Lima, Peru.

    Science.gov (United States)

    Mukherjee, J S; Joseph, J K; Rich, M L; Shin, S S; Furin, J J; Seung, K J; Sloutsky, A; Socci, A R; Vanderwarker, C; Vasquez, L; Palacios, E; Guerra, D; Viru, F A; Farmer, P; Del Castillo, H E

    2003-07-01

    Since 2000, the directly observed treatment, short-course (DOTS) strategy has been expanded in several countries to include treatment of multidrug-resistant tuberculosis (MDR-TB). This strategy is known as DOTS-Plus. Tuberculosis is a common cause of morbidity and mortality for children throughout the developing world. Children may also be infected with MDR-TB, yet most developing countries do not specifically address pediatric MDR-TB. To present the intermediate outcomes of the first 16 children enrolled in the Peruvian DOTS-Plus program and to demonstrate the tolerability of second-line anti-tuberculosis drugs. Three children completed therapy and are cured, one child had bacteriologic and clinical failure after 12 months of therapy and died of respiratory insufficiency, and 12 have intermediate outcomes demonstrating favorable clinical, bacteriologic, and radiographic evidence of improvement after 9-19 months of therapy. Of the 16 pediatric DOTS-Plus patients, 15 have tolerated therapy well and have had favorable clinical evolution. However, the diagnosis of pediatric MDR-TB is often extremely delayed due to reliance on the adult case definition and should be changed to prevent progressive, chronic illness in such children. Programmatic changes could facilitate earlier diagnosis and treatment of pediatric MDR-TB in Peru and in other DOTS-Plus programs.

  11. Promising therapy of XDR-TB/MDR-TB with thioridazine an inhibitor of bacterial efflux pumps

    DEFF Research Database (Denmark)

    Amaral, L; Martins, M; Viveiros, M

    2008-01-01

    -TB) - a M. tuberculosis organism that is resistant to the most effective second line drugs available for the treatment of TB. This review provides detailed, significant evidence that supports the use of an old neuroleptic compound, thioridazine (TZ), for the management of MDR-TB and XDR-TB infections...... therapy predictably ineffective and death is inevitable, compassionate therapy with TZ should be contemplated. The risks are small and the rewards great....

  12. Association between health systems performance and treatment outcomes in patients co-infected with MDR-TB and HIV in KwaZulu-Natal, South Africa: implications for TB programmes.

    Directory of Open Access Journals (Sweden)

    Marian Loveday

    Full Text Available To improve the treatment of MDR-TB and HIV co-infected patients, we investigated the relationship between health system performance and patient treatment outcomes at 4 decentralised MDR-TB sites.In this mixed methods case study which included prospective comparative data, we measured health system performance using a framework of domains comprising key health service components. Using Pearson Product Moment Correlation coefficients we quantified the direction and magnitude of the association between health system performance and MDR-TB treatment outcomes. Qualitative data from participant observation and interviews analysed using systematic text condensation (STC complemented our quantitative findings.We found significant differences in treatment outcomes across the sites with successful outcomes varying from 72% at Site 1 to 52% at Site 4 (p<0.01. Health systems performance scores also varied considerably across the sites. Our findings suggest there is a correlation between treatment outcomes and overall health system performance which is significant (r = 0.99, p<0.01, with Site 1 having the highest number of successful treatment outcomes and the highest health system performance. Although the 'integration' domain, which measured integration of MDR-TB services into existing services appeared to have the strongest association with successful treatment outcomes (r = 0.99, p<0.01, qualitative data indicated that the 'context' domain influenced the other domains.We suggest that there is an association between treatment outcomes and health system performance. The chance of treatment success is greater if decentralised MDR-TB services are integrated into existing services. To optimise successful treatment outcomes, regular monitoring and support are needed at a district, facility and individual level to ensure the local context is supportive of new programmes and implementation is according to guidelines.

  13. Cycloserine Induced Late Onset Psychosis and Ethambutol Induced Peripheral Neuropathy Associated with MDR-TB Treatment in an Indian Patient- A Rare Case Report.

    Science.gov (United States)

    Holla, Sadhana; Amberkar, Mohan Babu; Bhandarypanambur, Rajeshkrishna; Kamalkishore, Meenakumari; Janardhanan, Manju

    2015-02-01

    Adverse reactions and toxicity inevitably accompany all treatment courses for drug-resistant TB. Our case underscores the importance of awareness regarding neuropsychiatric adverse reactions due to MDR-TB therapy and reversible nature of it. Cycloserine induced psychosis is most life threatening complication and sometimes could be fatal. A 42-year-old male on MDR-TB therapy got admitted for his persistent psychotic complaints like hallucinations, delusions and suicidal ideations, despite being treated with quetiapine/olanzapine. Eventually patient was rehabilitated, cycloserine was stopped and psychotic events regressed slowly. Other culprit drugs like ethambutol and levofloxacin causing psychosis was ruled out because there was no relapse of psychotic events despite being continued with these drugs. He also complained of tingling, numbness, swaying, pain and weakness. On examination, he had distal motor weakness in lower limbs, tandem gait positive, altered position sense, and tenderness over toes and positive Romberg's sign with ataxia. He was diagnosed to have drug induced sensorimotor peripheral neuropathy. All these symptoms persisted after stopping cycloserine and patient continued to have neuropathy with ethambutol and ethionamide. Considering the nature of neuropathy which was mild, mixed sensorimotor and resolved completely after 2-3 weeks of stopping, it was more in favour of ethambutol. However, we could not rule out the possibility of ethionamide or (ethionamide + ethambutol) causing neuropathy or both could have accelerated the neurotoxic effects of cycloserine which remained elusive.

  14. Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.

    Directory of Open Access Journals (Sweden)

    Kocfa Chung-Delgado

    Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.

  15. Management of MDR-TB in HIV co-infected patients in Eastern Europe

    DEFF Research Database (Denmark)

    Efsen, A M W; Schultze, A; Miller, R F

    2018-01-01

    below the target of 90%, reflecting the challenging patient population and the environment in which health care is provided. Urgent improvement of management of patients with TB/HIV in EE, in particular for those with MDR-TB, is needed and includes widespread access to rapid TB diagnostics, better......OBJECTIVES: Mortality among HIV patients with tuberculosis (TB) remains high in Eastern Europe (EE), but details of TB and HIV management remain scarce. METHODS: In this prospective study, we describe the TB treatment regimens of patients with multi-drug resistant (MDR) TB and use of antiretroviral...... access to and use of second-line TB drugs, timely ART initiation with viral load monitoring, and integration of TB/HIV care....

  16. Analysis of multi drug resistant tuberculosis (MDR-TB) financial protection policy: MDR-TB health insurance schemes, in Chhattisgarh state, India.

    Science.gov (United States)

    Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad

    2018-01-27

    There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak

  17. Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB

    NARCIS (Netherlands)

    Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Arbex, Marcos Abdo; Arrascue, Edith Alarcon; Alffenaar, Jan Willem; Caminero, Jose A.; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmin; Scardigli, Anna; Akkerman, Onno W.; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marin, Felix Antonio; Collahuazo Lopez, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

    No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug-and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution

  18. Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Irwan Supriyanto

    2017-08-01

    Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

  19. A pilot study of an mHealth application for healthcare workers: poor uptake despite high reported acceptability at a rural South African community-based MDR-TB treatment program.

    Directory of Open Access Journals (Sweden)

    Krisda H Chaiyachati

    Full Text Available As the South African province of KwaZulu-Natal addresses a growing multidrug-resistant tuberculosis (MDR-TB epidemic by shifting care and treatment from trained specialty centers to community hospitals, delivering and monitoring MDR-TB therapy has presented new challenges. In particular, tracking and reporting adverse clinical events have been difficult for mobile healthcare workers (HCWs, trained health professionals who travel daily to patient homes to administer and monitor therapy. We designed and piloted a mobile phone application (Mobilize for mobile HCWs that electronically standardized the recording and tracking of MDR-TB patients on low-cost, functional phones.We assess the acceptability and feasibility of using Mobilize to record and submit adverse events forms weekly during the intensive phase of MDR-TB therapy and evaluate mobile HCW perceptions throughout the pilot period.All five mobile HCWs at one site were trained and provided with phones. Utilizing a mixed-methods evaluation, mobile HCWs' usage patterns were tracked electronically for seven months and analyzed. Qualitative focus groups and questionnaires were designed to understand the impact of mobile phone technology on the work environment.Mobile HCWs submitted nine of 33 (27% expected adverse events forms, conflicting with qualitative results in which mobile HCWs stated that Mobilize improved adverse events communication, helped their daily workflow, and could be successfully expanded to other health interventions. When presented with the conflict between their expressed views and actual practice, mobile HCWs cited forgetfulness and believed patients should take more responsibility for their own care.This pilot experience demonstrated poor uptake by HCWs despite positive responses to using mHealth. Though our results should be interpreted cautiously because of the small number of mobile HCWs and MDR-TB patients in this study, we recommend carefully exploring the motivations

  20. A pilot study of an mHealth application for healthcare workers: poor uptake despite high reported acceptability at a rural South African community-based MDR-TB treatment program.

    Science.gov (United States)

    Chaiyachati, Krisda H; Loveday, Marian; Lorenz, Stephen; Lesh, Neal; Larkan, Lee-Megan; Cinti, Sandro; Friedland, Gerald H; Haberer, Jessica E

    2013-01-01

    As the South African province of KwaZulu-Natal addresses a growing multidrug-resistant tuberculosis (MDR-TB) epidemic by shifting care and treatment from trained specialty centers to community hospitals, delivering and monitoring MDR-TB therapy has presented new challenges. In particular, tracking and reporting adverse clinical events have been difficult for mobile healthcare workers (HCWs), trained health professionals who travel daily to patient homes to administer and monitor therapy. We designed and piloted a mobile phone application (Mobilize) for mobile HCWs that electronically standardized the recording and tracking of MDR-TB patients on low-cost, functional phones. We assess the acceptability and feasibility of using Mobilize to record and submit adverse events forms weekly during the intensive phase of MDR-TB therapy and evaluate mobile HCW perceptions throughout the pilot period. All five mobile HCWs at one site were trained and provided with phones. Utilizing a mixed-methods evaluation, mobile HCWs' usage patterns were tracked electronically for seven months and analyzed. Qualitative focus groups and questionnaires were designed to understand the impact of mobile phone technology on the work environment. Mobile HCWs submitted nine of 33 (27%) expected adverse events forms, conflicting with qualitative results in which mobile HCWs stated that Mobilize improved adverse events communication, helped their daily workflow, and could be successfully expanded to other health interventions. When presented with the conflict between their expressed views and actual practice, mobile HCWs cited forgetfulness and believed patients should take more responsibility for their own care. This pilot experience demonstrated poor uptake by HCWs despite positive responses to using mHealth. Though our results should be interpreted cautiously because of the small number of mobile HCWs and MDR-TB patients in this study, we recommend carefully exploring the motivations of HCWs and

  1. Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB.

    Science.gov (United States)

    Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Abdo Arbex, Marcos; Alarcon Arrascue, Edith; Alffenaar, Jan Willem; Caminero, Jose A; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmín; Scardigli, Anna; Akkerman, Onno W; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marín, Félix Antonio; Collahuazo López, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

    2016-06-01

    No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug- and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution of imipenem/clavulanate versus meropenem/clavulanate added to background regimens to treat MDR- and XDR-TB cases.84 patients treated with imipenem/clavulanate-containing regimens showed a similar median number of antibiotic resistances (8 versus 8) but more fluoroquinolone resistance (79.0% versus 48.9%, pimipenem/clavulanate- and meropenem/clavulanate-containing regimens for a median (interquartile range) of 187 (60-428) versus 85 (49-156) days, respectively.Statistically significant differences were observed on sputum smear and culture conversion rates (79.7% versus 94.8%, p=0.02 and 71.9% versus 94.8%, pimipenem/clavulanate and meropenem/clavulanate were reported in 5.4% and 6.5% of cases only.Our study suggests that meropenem/clavulanate is more effective than imipenem/clavulanate in treating MDR/XDR-TB patients. Copyright ©ERS 2016.

  2. MDR-TB Outbreak among HIV-Negative Tunisian Patients followed during 11 Years.

    Directory of Open Access Journals (Sweden)

    Naira Dekhil

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB outbreaks that evolve, from the outset, in a context strictly negative for HIV infection deserve special consideration since they reflect the true intrinsic epidemic potential of the causative strain. To our knowledge, the long-term evolution of such exceptional outbreaks and the treatment outcomes for the involved patients has never been reported hitherto. Here we provide a thorough description, over an 11-year period, of an MDR-TB outbreak that emerged and expanded in an HIV-negative context, Northern Tunisia.From October 2001 to June 2011, the MDR-TB outbreak involved 48 HIV-negative individuals that are mainly young (mean age 31.09 yrs; 89.6% male and noninstitutionalized. Drug susceptibility testing coupled to mutational analysis revealed that initial transmission involved an isolate that was simultaneously resistant to isoniazid, rifampicin, ethambutol, and streptomycin. The causative Haarlem3-ST50 outbreak strain expanded mainly as an 11-banded IS6110 RFLP profile (77.1%, from which a 12-banded subclone evolved. After undergoing a 2-year treatment with second-line drugs, 22 (45.8% patients were cured and 3 (6.2% completed treatment, thus yielding an overall treatment success rate of 52.1%. Among the patients that experienced unfavorable treatment outcomes, 10 (20.8% failed treatment, 3 (6.2% were lost to follow-up, 5 (10.4% died, and 5 (10.4% could not be evaluated. Poor adherence to treatment was found to be the main independent predictor of unfavorable outcomes (HR: 9.15; 95% CI 1.72-48.73; P = 0.014. Intriguingly, the evolved 12-banded subclone proved significantly associated with unfavorable outcomes (HR: 4.90; 95% CI 1.04-23.04, P = 0.044. High rate of fatality and relapse was further demonstrated at the long-term, since 70% of those whose treatment failed have died, and 24% among those deemed successfully treated have relapsed.Taken together, the data obtained in this study indicate that MDR-TB

  3. Molecular detection of multi drug resistant tuberculosis (mdr-tb) in mdr-tb patients' attendant in north western pakistan

    International Nuclear Information System (INIS)

    Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.

    2017-01-01

    Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)

  4. Risk factors for MDR and XDR-TB in a tertiary referral hospital in India.

    Directory of Open Access Journals (Sweden)

    V Balaji

    Full Text Available BACKGROUND: India has a high burden of drug resistant TB, although there are few data on XDR-TB. Although XDR-TB has existed previously in India, the definition has not been widely applied, and surveillance using second line drug susceptibility testing has not been performed. Our objective was to analyze clinical and demographic risk factors associated with isolation of MDR and XDR TB as compared to susceptible controls, at a tertiary center. METHODOLOGY/FINDINGS: Retrospective chart review based on positive cultures isolated in a high volume mycobacteriology laboratory between 2002 and 2007. 47 XDR, 30 MDR and 117 susceptible controls were examined. Drug resistant cases were less likely to be extrapulmonary, and had received more previous treatment regimens. Significant risk factors for XDR-TB included residence outside the local state (OR 7.43, 3.07-18.0 and care costs subsidized (OR 0.23, 0.097-0.54 in bivariate analysis and previous use of a fluoroquinolone and injectable agent (other than streptomycin (OR 7.00, 95% C.I. 1.14-43.03 and an initial treatment regimen which did not follow national guidelines (OR 5.68, 1.24-25.96 in multivariate analysis. Cavitation and HIV did not influence drug resistance. CONCLUSIONS/SIGNIFICANCE: There is significant selection bias in the sample available. Selection pressure from previous treatment and an inadequate initial regimen increases risk of drug resistance. Local patients and those requiring financial subsidies may be at lower risk of XDR-TB.

  5. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  6. Operational challenges in diagnosing multi-drug resistant TB and initiating treatment in Andhra Pradesh, India.

    Directory of Open Access Journals (Sweden)

    Sarabjit S Chadha

    Full Text Available BACKGROUND: Revised National TB Control Programme (RNTCP, Andhra Pradesh, India. There is limited information on whether MDR-TB suspects are identified, undergo diagnostic assessment and are initiated on treatment according to the programme guidelines. OBJECTIVES: To assess i using the programme definition, the number and proportion of MDR-TB suspects in a large cohort of TB patients on first-line treatment under RNTCP ii the proportion of these MDR-TB suspects who underwent diagnosis for MDR-TB and iii the number and proportion of those diagnosed as MDR-TB who were successfully initiated on treatment. METHODS: A retrospective cohort analysis, by reviewing RNTCP records and reports, was conducted in four districts of Andhra Pradesh, India, among patients registered for first line treatment during October 2008 to December 2009. RESULTS: Among 23,999 TB patients registered for treatment there were 559 (2% MDR-TB suspects (according to programme definition of which 307 (55% underwent diagnosis and amongst these 169 (55% were found to be MDR-TB. Of the MDR-TB patients, 112 (66% were successfully initiated on treatment. Amongst those eligible for MDR-TB services, significant proportions are lost during the diagnostic and treatment initiation pathway due to a variety of operational challenges. The programme needs to urgently address these challenges for effective delivery and utilisation of the MDR-TB services.

  7. Malnutrition associated with unfavorable outcome and death among South African MDR-TB and HIV co-infected children.

    Science.gov (United States)

    Hicks, R M; Padayatchi, N; Shah, N S; Wolf, A; Werner, L; Sunkari, V B; O'Donnell, M R

    2014-09-01

    Pediatric multidrug-resistant tuberculosis (MDR-TB) is complicated by difficult diagnosis, complex treatment, and high mortality. In South Africa, these challenges are amplified by human immunodeficiency virus (HIV) co-infection; however, evidence on treatment outcomes among co-infected children is limited. Using conventional and new pediatric definitions, to describe treatment outcomes and identify risk factors for unfavorable outcome and mortality in children aged children (median age 8 years, IQR 4-12) with MDR-TB (n = 78) or XDR-TB (n = 6) initiated treatment. Sixty-four (77%) were HIV-positive and 62 (97%) received antiretroviral therapy. Sixty-six (79%) achieved favorable treatment outcomes. Overall mortality was 11% (n = 9) at 18 months after initiation of treatment. Malnutrition (aOR 27.4, 95%CI 2.7-278.7) and severe radiographic findings (aOR 4.68, 95%CI 1.01-21.9) were associated with unfavorable outcome. New pediatric outcome definitions increased the proportion classified as cured. It is possible to successfully treat pediatric MDR-TB-HIV even in resource-poor settings. Malnutrition is a marker for severe TB-HIV disease, and is a potential target for future interventions in these patients.

  8. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

    Directory of Open Access Journals (Sweden)

    Mohd Zakihalani A. Halim

    2016-03-01

    Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

  9. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    Science.gov (United States)

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  10. Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

    Directory of Open Access Journals (Sweden)

    Freddie Bwanga

    Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

  11. Treatment: Latent TB Infection (LTBI) and TB Disease

    Science.gov (United States)

    ... Adverse Events TB Treatment of Persons Living with HIV TB Treatment and Pregnancy TB Treatment for Children Drug-Resistant TB Research TB Epidemiologic Studies Consortium Research Projects Publications TB Trials Consortium Study ...

  12. Development of a Patient-Centred, Psychosocial Support Intervention for Multi-Drug-Resistant Tuberculosis (MDR-TB Care in Nepal.

    Directory of Open Access Journals (Sweden)

    Sudeepa Khanal

    Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.

  13. E-health systems for management of MDR-TB in resource-poor environments: a decade of experience and recommendations for future work.

    Science.gov (United States)

    Fraser, Hamish S F; Habib, Ali; Goodrich, Mark; Thomas, David; Blaya, Joaquin A; Fils-Aime, Joseph Reginald; Jazayeri, Darius; Seaton, Michael; Khan, Aamir J; Choi, Sharon S; Kerrison, Foster; Falzon, Dennis; Becerra, Mercedes C

    2013-01-01

    Multi-drug resistant TB (MDR-TB) is a complex infectious disease that is a growing threat to global health. It requires lengthy treatment with multiple drugs and specialized laboratory testing. To effectively scale up treatment to thousands of patients requires good information systems to support clinical care, reporting, drug forecasting, supply chain management and monitoring. Over the last decade we have developed the PIH-EMR electronic medical record system, and subsequently OpenMRS-TB, to support the treatment of MDR-TB in Peru, Haiti, Pakistan, and other resource-poor environments. We describe here the experience with implementing these systems and evaluating many aspects of their performance, and review other systems for MDR-TB management. We recommend a new approach to information systems to address the barriers to scale up MDR-TB treatment, particularly access to the appropriate drugs and lab data. We propose moving away from fragmented, vertical systems to focus on common platforms, addressing all stages of TB care, support for open data standards and interoperability, care for a wide range of diseases including HIV, integration with mHealth applications, and ability to function in resource-poor environments.

  14. ASSESSMENT OF EFFECT OF MDR - TB/TB ON SOCIAL, FUNCTIONAL AND ECONOMIC WELL BEING OF PATIENTS – A CROSS SECTIONAL STUDY

    Directory of Open Access Journals (Sweden)

    Shiv Kumar

    2015-06-01

    Full Text Available CONTEXT : Tuberculosis is a contagious disease with social stigma attached to it. Various problems which are social and economic in nature are faced by TB patient. Therefore , it is essential to explore the overall effect of MDR - TB/TB on health and patients perception of Well - being. AIMS : To Document the effect of MDR - TB/TB on social , functional and economic well - being of patients. SETTINGS AND DESIGN : A Cross - sectional study , Conveniently Recruited 68 MDR - TB Patients and 136 non - MDR - TB Patients (from Rural as well as urban Area of Surat District diagnosed by CBNAAT were interviewed for investigating the effect of Tuberculosis. METHODS AND MATERIAL : A pre - tested standardized semi - structured questionnaire was used. Data was collected about socio - demographic profile of patients and interpreted in table. Data about effect of MDR - TB/TB was collected on Likert Scale and Frequency was calculated and Data wa s plotted on multiple bar charts. RESULTS : As compared to healthy status in the past , 93% MDR - TB and 82% TB patients have decreased ability to do work , about half of MDR - TB Patients and TB Patients have detiorated relations with family members , 67% of stud y participants have developed disharmonious relations with neighbor’s , 55% of Study participants have decreased income , 88% of study participants have decreased performance in day to day activities and 78% of study participants have faced discordial and di srespectful behavior from co - workers. CONCLUSION : Working ability more detiorated in MDR - TB patients while rest of the effect on social , functional and economic well - being is same in both TB and Multi Drug Resistant TB patients. This study emphasizes very clearly that social stigma still persist in community about Tuberculosis which needs to be eliminated in community by behavior change communication by health workers at all levels of health care.

  15. Treatment outcomes of MDR-tuberculosis patients in Brazil: a retrospective cohort analysis

    Directory of Open Access Journals (Sweden)

    Mayara Lisboa Bastos

    2017-11-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB is a threat for the global TB epidemic control. Despite existing evidence that individualized treatment of MDR-TB is superior to standardized regimens, the latter are recommended in Brazil, mainly because drug-susceptibility tests (DST are often restricted to first-line drugs in public laboratories. We compared treatment outcomes of MDR-TB patients using standardized versus individualized regimens in Brazil, a high TB-burden, low resistance setting. Methods The 2007–2013 cohort of the national electronic database (SITE-TB, which records all special treatments including drug-resistance, was analysed. Patients classified as MDR-TB in SITE-TB were eligible. Treatment outcomes were classified as successful (cure/treatment completed or unsuccessful (failure/relapse/death/loss to follow-up. The odds for successful treatment according to type of regimen were controlled for demographic and clinical variables. Results Out of 4029 registered patients, we included 1972 recorded from 2010 to 2012, who had more complete outcome data. The overall success proportion was 60%. Success was more likely in non-HIV patients, sputum-negative at baseline, with unilateral disease and without prior DR-TB. Adjusted for these variables, those receiving standardized regimens had 2.7-fold odds of success compared to those receiving individualized treatments when failure/relapse were considered, and 1.4-fold odds of success when death was included as an unsuccessful outcome. When loss to follow-up was added, no difference between types of treatment was observed. Patients who used levofloxacin instead of ofloxacin had 1.5-fold odds of success. Conclusion In this large cohort of MDR-TB patients with a low proportion of successful outcomes, standardized regimens had superior efficacy than individualized regimens, when adjusted for relevant variables. In addition to the limitations of any retrospective observational

  16. EDITORIAL Multi-drug-resistant tuberculosis (MDR-TB): Current ...

    African Journals Online (AJOL)

    A South African Health Systems Trust report indicated that despite a global ... less financial resources performed better. ... Healthcare providers need to be better trained at our various nursing colleges and medical schools on how to manage TB, with regular and intense follow-up in-service training sessions. In addition ...

  17. Tuberculosis (TB): Treatment

    Science.gov (United States)

    ... Education & Training Home Conditions Tuberculosis (TB) Tuberculosis: Treatment Tuberculosis: Treatment Make an Appointment Refer a Patient Ask ... or bones is treated longer. NEXT: Preventive Treatment Tuberculosis: Diagnosis Tuberculosis: History Clinical Trials For more than ...

  18. Procurement and Supply Management System for MDR-TB in Nigeria: Are the Early Warning Targets for Drug Stock Outs and Over Stock of Drugs Being Achieved?

    Science.gov (United States)

    Jatau, Bolajoko; Avong, Yohanna; Ogundahunsi, Olumide; Shah, Safieh; Tayler Smith, Katherine; Van den Bergh, Rafael; Zachariah, Rony; van Griensven, Johan; Ekong, Ernest; Dakum, Patrick

    2015-01-01

    The World Health Organisation (WHO) introduced the twelve early warning indicators for monitoring and evaluating drug Procurement and Supply management (PSM) systems, intended to prevent drug stock-outs and overstocking. Nigeria--one of the high Multi Drug Resistant Tuberculosis (MDR-TB) burden countries, scaled-up treatment in 2012 with the concurrent implementation of a PSM system. We evaluated how well this system functioned using the WHO indicators, including all seven MDR-TB treatment centres in the country that were functional throughout 2013. The quantity of MDR-TB drugs ordered for 2013 matched the annual forecast and all central orders placed during the year were delivered in full and on time. Drug consumption was 81%-106% of the quantity allocated for routine consumption. Timely submission of complete inventory reports ranged from 86-100%, late submissions being 5-15 days late. Forty to 71% of treatment centres placed a drug order when stock was below the minimum level of three months. The proportion of drug orders received at the treatment centres in full and on time ranged from 29-80%, late orders being 1-19 days late. The PSM was found to be performing well in terms of forecasting and procurement of MDR-TB drugs, but there were shortcomings in drug distribution, reporting at treatment centre level and in drug order placements. Despite these gaps, there were no stock outs. These findings indicate that where it matters most, namely ensuring that no drug stock outs affect patient management, the PSM system is effective. Addressing the observed shortcomings will help to strengthen the existing PSM system in anticipation of a growing MDR-TB case burden in the country.

  19. Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

    Science.gov (United States)

    Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

    2010-01-01

    Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

  20. Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

    Directory of Open Access Journals (Sweden)

    Richa Kumari

    Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

  1. Efficacy, safety and tolerability of linezolid containing regimens in treating MDR-TB and XDR-TB : systematic review and meta-analysis

    NARCIS (Netherlands)

    Sotgiu, Giovanni; Centis, Rosella; D'Ambrosio, Lia; Alffenaar, Jan-William C.; Anger, Holly A.; Caminero, Jose A.; Castiglia, Paolo; De Lorenzo, Saverio; Ferrara, Giovanni; Koh, Won-Jung; Schecter, Giesela F.; Shim, Tae S.; Singla, Rupak; Skrahina, Alena; Spanevello, Antonio; Udwadia, Zarir F.; Villar, Miquel; Zampogna, Elisabetta; Zellweger, Jean-Pierre; Zumla, Alimuddin; Migliori, Giovanni Battista

    2012-01-01

    Linezolid is used off-label to treat multidrug-resistant tuberculosis (MDR-TB) in absence of systematic evidence. We performed a systematic review and meta-analysis on efficacy, safety and tolerability of linezolid-containing regimes based on individual data analysis. 12 studies (11 countries from

  2. Physician-initiated courtesy MODS testing for TB and MDR-TB diagnosis and patient management.

    Science.gov (United States)

    Nic Fhogartaigh, C J; Vargas-Prada, S; Huancaré, V; Lopez, S; Rodríguez, J; Moore, D A J

    2008-05-01

    Laboratorio de Investigación de Enfermedades Infecciosas, Universidad Peruana Cayetano Heredia (UPCH) and government health centres, Lima, Peru. To evaluate the contribution of unselected (courtesy) microscopic observation drug susceptibility (MODS) testing to the diagnosis and/or drug susceptibility testing (DST) of tuberculosis and their subsequent impact upon patient management. Retrospective database analysis and case note review of MODS culture-positive cases. Mycobacterium tuberculosis was isolated in 28.9% of 225 samples (209 patients); 22.2% of 63 positive cases were multidrug-resistant. In 58 MODS culture-positive cases with follow-up data available, MODS provided culture confirmation of diagnosis, DST or both in 82.8%, before any standard method. In 41.4%, this result should have prompted a modification in patient management. Delays between laboratory result and initiation or change of treatment, where applicable, took on average 42 and 64 days, respectively, of which a delay of respectively 17 and 48 days occurred after the receipt of results by the health facility. MODS provides important data for clinical management within a meaningful timeframe and should contribute positively to patient outcomes due to earlier initiation of appropriate therapy. Although clinicians may successfully select patients likely to benefit from MODS, ongoing work is required to identify optimal implementation of the assay and to reduce logistical and health system derived delays.

  3. Double Standards in Global Health: Medicine, Human Rights Law and Multidrug-Resistant TB Treatment Policy.

    Science.gov (United States)

    Nicholson, Thomas; Admay, Catherine; Shakow, Aaron; Keshavjee, Salmaan

    2016-06-01

    The human rights arguments that underpinned the fight against HIV over the last three decades were poised, but ultimately failed, to provide a similar foundation for success against multidrug-resistant TB (MDR-TB) and other diseases of the poor. With more than 1.5 million deaths since 2000 attributed to strains of MDR-TB, and with half a million new, and mostly untreated, MDR-TB cases in the world each year, the stakes could not be higher. The World Health Organization (WHO), whose mandate is to champion the attainment by all peoples of the highest possible level of health, recommended unsound medical treatment for MDR-TB patients in resource-poor settings from 1993-2002. Citing cost considerations, WHO did not recommend the available standard of care that had been successfully used to contain and defeat MDR-TB in rich countries. By acting as a strategic gatekeeper in its technical advisory role to donor agencies and countries, it also facilitated the global implementation of a double standard for TB care in low- and middle-income countries (LMICs), upending important legal and scientific priorities. This raises serious questions about whether the organization violated international human rights standards and those established in its own constitution. While calling for additional analysis and discussion on this topic, the authors propose that policymakers should reject double standards of this kind and instead embrace the challenge of implementing the highest standard of care on a global level.

  4. Transmission of MDR and XDR tuberculosis in Shanghai, China.

    Directory of Open Access Journals (Sweden)

    Ming Zhao

    Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.

  5. The Impact of a Line Probe Assay Based Diagnostic Algorithm on Time to Treatment Initiation and Treatment Outcomes for Multidrug Resistant TB Patients in Arkhangelsk Region, Russia.

    Science.gov (United States)

    Eliseev, Platon; Balantcev, Grigory; Nikishova, Elena; Gaida, Anastasia; Bogdanova, Elena; Enarson, Donald; Ornstein, Tara; Detjen, Anne; Dacombe, Russell; Gospodarevskaya, Elena; Phillips, Patrick P J; Mann, Gillian; Squire, Stephen Bertel; Mariandyshev, Andrei

    2016-01-01

    In the Arkhangelsk region of Northern Russia, multidrug-resistant (MDR) tuberculosis (TB) rates in new cases are amongst the highest in the world. In 2014, MDR-TB rates reached 31.7% among new cases and 56.9% among retreatment cases. The development of new diagnostic tools allows for faster detection of both TB and MDR-TB and should lead to reduced transmission by earlier initiation of anti-TB therapy. The PROVE-IT (Policy Relevant Outcomes from Validating Evidence on Impact) Russia study aimed to assess the impact of the implementation of line probe assay (LPA) as part of an LPA-based diagnostic algorithm for patients with presumptive MDR-TB focusing on time to treatment initiation with time from first-care seeking visit to the initiation of MDR-TB treatment rather than diagnostic accuracy as the primary outcome, and to assess treatment outcomes. We hypothesized that the implementation of LPA would result in faster time to treatment initiation and better treatment outcomes. A culture-based diagnostic algorithm used prior to LPA implementation was compared to an LPA-based algorithm that replaced BacTAlert and Löwenstein Jensen (LJ) for drug sensitivity testing. A total of 295 MDR-TB patients were included in the study, 163 diagnosed with the culture-based algorithm, 132 with the LPA-based algorithm. Among smear positive patients, the implementation of the LPA-based algorithm was associated with a median decrease in time to MDR-TB treatment initiation of 50 and 66 days compared to the culture-based algorithm (BacTAlert and LJ respectively, ptime to MDR-TB treatment initiation of 78 days when compared to the culture-based algorithm (LJ, ptime to MDR diagnosis and earlier treatment initiation as well as better treatment outcomes for patients with MDR-TB. These findings also highlight the need for further improvements within the health system to reduce both patient and diagnostic delays to truly optimize the impact of new, rapid diagnostics.

  6. Major Challenges in Clinical Management of TB/HIV Coinfected Patients in Eastern Europe Compared with Western Europe and Latin America

    DEFF Research Database (Denmark)

    Efsen, Anne Marie W; Schultze, Anna; Post, Frank A

    2015-01-01

    OBJECTIVES: Rates of TB/HIV coinfection and multi-drug resistant (MDR)-TB are increasing in Eastern Europe (EE). We aimed to study clinical characteristics, factors associated with MDR-TB and predicted activity of empiric anti-TB treatment at time of TB diagnosis among TB/HIV coinfected patients......% of participants in EE compared with 90-96% in other regions (pmanagement of TB/HIV patients in EE requires...... better access to TB diagnostics including DSTs, empiric anti-TB therapy directed at both susceptible and MDR-TB, and more widespread use of cART....

  7. Drug Susceptibility of Mycobacterium tuberculosis Beijing Genotype and Association with MDR TB

    Science.gov (United States)

    ten Kate, Marian T.; de Knegt, Gerjo J.; Kremer, Kristin; Aarnoutse, Rob E.; Boeree, Martin J.; Verbrugh, Henri A.; van Soolingen, Dick; Bakker-Woudenberg, Irma A.J.M.

    2012-01-01

    To determine differences in the ability of Mycobacterium tuberculosis strains to withstand antituberculosis drug treatment, we compared the activity of antituberculosis drugs against susceptible Beijing and East-African/Indian genotype M. tuberculosis strains. Beijing genotype strains showed high rates of mutation within a wide range of drug concentrations, possibly explaining this genotype’s association with multidrug-resistant tuberculosis. PMID:22469099

  8. Epidemia de tuberculosis multidrogo resistente y extensivamente resistente a drogas (TB MDR/XDR en el Perú: situación y propuestas para su control

    Directory of Open Access Journals (Sweden)

    Hernán Del Castillo

    2009-07-01

    Full Text Available En este artículo se describe el estado actual de las epidemias de tuberculosis multidrogo resitente (TB MDR y tuberculosis extensivamente resistente a drogas (TB XDR en el Perú. Se realiza un análisis de nuestra situación con respecto al resto de Latinoamérica, y de la distribución temporo espacial de los casos de TB XDR en Lima. También presentamos nuestra reflexión de lo que está pasando y debe cambiar; lo que se resume en darle la importancia debida a un problema que nos está rebasando y anteponer a nuestros propios intereses, los intereses de la humanidad; por consiguiente no podemos callar, y debemos declarar a la tuberculosis como emergencia sanitaria nacional. Eso constituye una respuesta, esperamos, aún viable para el Perú.

  9. Time to initiation of multidrug-resistant tuberculosis treatment and its relation with outcome in a high incidence district in Lima, Peru.

    Science.gov (United States)

    Otero, L; De Orbegoso, A; Navarro, A F; Ríos, J; Párraga, T; Gotuzzo, E; Seas, C; Van der Stuyft, P

    2015-03-01

    To determine the time from diagnosis to start of multidrug resistant tuberculosis (MDR TB) treatment in Lima, Peru. We studied new smear-positive TB adults that were started on MDR TB treatment or that were switched to it between June 2008 and December 2011. Time from the first positive smear to MDR-TB treatment was >30 days in 35% (13/37) of patients. Among the 27% (24/88) of patients that switched to MDR-TB treatment, time from the last dose of a drug-susceptible regimen was >30 days. Start of and switching to MDR TB treatment is still delayed. © 2014 John Wiley & Sons Ltd.

  10. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  11. The association between ARV and TB drug resistance on TB treatment outcome among Kazakh TB/HIV patients.

    Science.gov (United States)

    Mishkin, Kathryn; Alaei, Kamiar; Alikeyeva, Elmira; Paynter, Christopher; Aringazina, Altyn; Alaei, Arash

    2018-02-26

    TB drug resistance poses a serious threat to the public health of Kazakhstan. This paper presents findings related to TB treatment outcome and drug resistant status among people coinfected with HIV and TB in Kazakhstan. Cohort study using data were provided by the Kazakhstan Ministry of Health's National Tuberculosis Program for 2014 and 2015. Chi-square and logistical regression were performed to understand factors associated with drug resistant TB status and TB treatment outcome. In bivariate analysis, drug resistant status was significantly associated with year of TB diagnosis (p=0.001) viral load (p=0.03). TB treatment outcome was significantly associated with age at diagnosis (p=01), ARV treatment (p <0.0001), and TB drug resistant status (p=0.02). In adjusted analysis, drug resistance was associated with increased odds of successful completion of treatment with successful result compared to treatment failure (OR 6.94, 95% CI: 1.39-34.44) CONCLUSIONS: Our results suggest that being drug resistant is associated with higher odds of completing treatment with successful outcome, even when controlling for receipt of ARV therapy. Copyright © 2018. Published by Elsevier Ltd.

  12. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  13. Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Agyeman, Akosua Adom; Ofori-Asenso, Richard

    2016-06-22

    Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

  14. Antiretroviral treatment uptake in patients with HIV- associated TB ...

    African Journals Online (AJOL)

    ART results in a 64 - 95% reduction in mortality risk 5 and is an essential component of care. How soon to start. ART after TB treatment initiation has become clearer from randomised controlled trials. These show that integration of ART and TB treatment in all HIV-associated TB patients regardless of CD4 count significantly.

  15. tb diagnostics challenges of tb diagnosis and treatment in south africa

    African Journals Online (AJOL)

    2007-06-01

    Jun 1, 2007 ... 45 currently provides treatment to 3 000 patients. Eighty-nine per cent of those accessing ART have symptomatic HIV disease. (WHO clinical stage 3 and 4) with a median CD4 cell count of. 95 cells/µl. More than 50% have a history of prior completed. TB treatment, 15% are on current TB treatment, 11% are.

  16. Antiretroviral treatment uptake in patients with HIV associated TB ...

    African Journals Online (AJOL)

    Background. Delivery of integrated care for patients with HIV-associated TB is challenging. We assessed the uptake and timing of antiretroviral treatment (ART) among eligible patients attending a primary care service with co-located ART and TB clinics. Methods. In a retrospective cohort study, all HIV-associated TB patients ...

  17. Fixed Dose Combination for TB treatment

    Directory of Open Access Journals (Sweden)

    Tjandra Y. Aditama

    2003-06-01

    Full Text Available According to the World Health Organization, a third of the world’s population is infected with tuberculosis. The disease is responsible for nearly 2 million deaths each year and over 8 million were developing active diseases. Moreover, according to WHO (2000, tuberculosis deaths are estimated to increase to 35 million between 2000-2020. The majority of tuberculosis patients worldwide are still treated with single drugs, or with 2-drug fixed-dose combinations (FDCs. To improve tuberculosis treatment, 2- and 3-drug FDCs were recommended by the World Health Organization (WHO as part of the DOTS strategy. Since 1999 a 4-drug FDC was included on the WHO Model List of Essential Drugs. Today, FDCs are important tools to further improve the quality of care for people with TB, and accelerate DOTS expansion to reach the global TB control targets. Fixed dose combination TB drugs could simplifies both treatment and management of drug supply, and may prevent the emergence of drug resistance .Prevention of drug resistance is just one of the potential benefits of the use of FDCs. FDCs simplify administration of drugs by reducing the number of pills a patient takes each day and decreasing the risk of incorrect prescriptions. Most tuberculosis patients need only take 3–4 FDCs tablets per day during the intensive phase of treatment, instead of the 15–16 tablets per day that is common with single-drug formulations It is much simpler to explain to patients that they need to take four tablets of the same type and colour, rather than a mixture of tablets of different shapes, colours and sizes. Also, the chance of taking an incomplete combination of drugs is eliminated, since the four essential drugs are combined into one tablet. FDCs are also simpler for care-givers as they minimize the risk of confusion. Finally, drug procurement, in all its components (stock management, shipping, distribution, is simplified by FDCs. Adverse reactions to drugs are not more

  18. Integration of TB and ART services fails to improve TB treatment ...

    African Journals Online (AJOL)

    The median CD4+ count of HIV-positive patients was 152 cells/μl (interquartile range (IQR) 71 - 277) for integrated facilities and 148 cells/μl (IQR 67 - 260) for single-service facilities. There was no statistical difference in the TB treatment outcome profile between integrated and single-service facilities for all TB patients (p=0.

  19. Proteins purified from Mycobacterium tuberculosis MDR and Susceptible clinical isolates: Identification by proteomics approach

    Directory of Open Access Journals (Sweden)

    A R. Hadizadeh Tasbiti

    2015-01-01

    Conclusion: Such information could be helpful for the development of newer therapeutic agents or of diagnostic markers for better treatment or diagnosis of TB. This study extends the list of the potential determinants of differences in virulence between the two isolates (MDR and susceptible TB and adds to the current understanding of MTB pathogenesis.

  20. Potential antimicrobial agents for the treatment of multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Alsaad, Noor; Wilffert, Bob; van Altena, Richard; de Lange, Wiel C. M.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.

    2014-01-01

    Treatment of multidrug-resistant (MDR) tuberculosis (TB) is challenging because of the high toxicity of second-line drugs and the longer treatment duration than for drug-susceptible TB patients. In order to speed up novel treatment for MDR-TB, we suggest considering expanding the indications of

  1. Predictors of Prolonged TB Treatment in a Dutch Outpatient Setting.

    Directory of Open Access Journals (Sweden)

    Natasha Van't Boveneind-Vrubleuskaya

    Full Text Available Standard treatment duration for drug-susceptible tuberculosis (TB treatment is 6 months. Treatment duration is often extended-and for various different reasons. The aim of this study was to determine the prevalence and to assess risk factors associated with extended TB treatment.A cross-sectional study was conducted. Data including demographic, clinical, radiological and microbiological information from the Netherlands TB Register (NTR of 90 patients with smear and culture positive pulmonary TB of the region Haaglanden, The Netherlands, was eligible for analysis.Treatment was extended to ≥ 200 days by 46 (51% patients. Extended TB treatment was associated with a higher frequency of symptoms, presumed to be due to adverse drug reactions (ADR; OR 2.39 95% CI: 1.01-5.69, drug-induced liver injury (DILI (OR: 13.51; 95% CI: 1.66-109.82 and longer than 2 month smear and culture conversion rate (OR: 11.00; 95% CI: 1.24-97.96 and OR: 8.56; 95% CI: 1.53-47.96. In the multivariable logistic analysis, development of DILI emerged as the single statistically strong risk factor necessitating extension of TB treatment.This finding will need further confirmation in a prospective study, exploring the possible mutual role of pharmacokinetic and pharmacogenetic determinants of DILI among TB patients.

  2. Testing for TB Infection

    Science.gov (United States)

    ... Adverse Events TB Treatment of Persons Living with HIV TB Treatment and Pregnancy TB Treatment for Children Drug-Resistant TB Research TB Epidemiologic Studies Consortium Research Projects Publications TB Trials Consortium Study ...

  3. HIV, multidrug-resistant TB and depressive symptoms: when three conditions collide.

    Science.gov (United States)

    Das, Mrinalini; Isaakidis, Petros; Van den Bergh, Rafael; Kumar, Ajay M V; Nagaraja, Sharath Burugina; Valikayath, Asmaa; Jha, Santosh; Jadhav, Bindoo; Ladomirska, Joanna

    2014-01-01

    Management of multidrug-resistant TB (MDR-TB) patients co-infected with human immunodeficiency virus (HIV) is highly challenging. Such patients are subject to long and potentially toxic treatments and may develop a number of different psychiatric illnesses such as anxiety and depressive disorders. A mental health assessment before MDR-TB treatment initiation may assist in early diagnosis and better management of psychiatric illnesses in patients already having two stigmatising and debilitating diseases. To address limited evidence on the baseline psychiatric conditions of HIV-infected MDR-TB patients, we aimed to document the levels of depressive symptoms at baseline, and any alteration following individualized clinical and psychological support during MDR-TB therapy, using the Patient Health Questionnaire-9 (PHQ-9) tool, among HIV-infected patients. This was a retrospective review of the medical records of an adult (aged >15 years) HIV/MDR-TB cohort registered for care during the period of August 2012 through to March 2014. A total of 45 HIV/MDR-TB patients underwent baseline assessment using the PHQ-9 tool, and seven (16%) were found to have depressive symptoms. Of these, four patients had moderate to severe depressive symptoms. Individualized psychological and clinical support was administered to these patients. Reassessments were carried out for all patients after 3 months of follow-up, except one, who died during the period. Among these 44 patients, three with baseline depressive symptoms still had depressive symptoms. However, improvements were observed in all but one after 3 months of follow-up. Psychiatric illnesses, including depressive symptoms, during MDR-TB treatment demand attention. Routine administration of baseline mental health assessments by trained staff has the potential to assist in determining appropriate measures for the management of depressive symptoms during MDR-TB treatment, and help in improving overall treatment outcomes. We recommend

  4. Optimal treatment interruptions control of TB transmission model

    Science.gov (United States)

    Nainggolan, Jonner; Suparwati, Titik; Kawuwung, Westy B.

    2018-03-01

    A tuberculosis model which incorporates treatment interruptions of infectives is established. Optimal control of individuals infected with active TB is given in the model. It is obtained that the control reproduction numbers is smaller than the reproduction number, this means treatment controls could optimize the decrease in the spread of active TB. For this model, controls on treatment of infection individuals to reduce the actively infected individual populations, by application the Pontryagins Maximum Principle for optimal control. The result further emphasized the importance of controlling disease relapse in reducing the number of actively infected and treatment interruptions individuals with tuberculosis.

  5. Culture and Next-generation sequencing-based drug susceptibility testing unveil high levels of drug-resistant-TB in Djibouti: results from the first national survey.

    Science.gov (United States)

    Tagliani, Elisa; Hassan, Mohamed Osman; Waberi, Yacine; De Filippo, Maria Rosaria; Falzon, Dennis; Dean, Anna; Zignol, Matteo; Supply, Philip; Abdoulkader, Mohamed Ali; Hassangue, Hawa; Cirillo, Daniela Maria

    2017-12-15

    Djibouti is a small country in the Horn of Africa with a high TB incidence (378/100,000 in 2015). Multidrug-resistant TB (MDR-TB) and resistance to second-line agents have been previously identified in the country but the extent of the problem has yet to be quantified. A national survey was conducted to estimate the proportion of MDR-TB among a representative sample of TB patients. Sputum was tested using XpertMTB/RIF and samples positive for MTB and resistant to rifampicin underwent first line phenotypic susceptibility testing. The TB supranational reference laboratory in Milan, Italy, undertook external quality assurance, genotypic testing based on whole genome and targeted-deep sequencing and phylogenetic studies. 301 new and 66 previously treated TB cases were enrolled. MDR-TB was detected in 34 patients: 4.7% of new and 31% of previously treated cases. Resistance to pyrazinamide, aminoglycosides and capreomycin was detected in 68%, 18% and 29% of MDR-TB strains respectively, while resistance to fluoroquinolones was not detected. Cluster analysis identified transmission of MDR-TB as a critical factor fostering drug resistance in the country. Levels of MDR-TB in Djibouti are among the highest on the African continent. High prevalence of resistance to pyrazinamide and second-line injectable agents have important implications for treatment regimens.

  6. Five years retrospective cohort analysis of treatment outcomes of TB ...

    African Journals Online (AJOL)

    Background: Human immunodeficiency virus (HIV) associated tuberculosis (TB) remains a major global public health challenge, with an estimated 1.4 million patients worldwide. Co-infection with HIV leads to challenges in the diagnosis and treatment of patients. Objectives: The aim of this study was to assess treatment ...

  7. Five years retrospective cohort analysis of treatment outcomes of TB ...

    African Journals Online (AJOL)

    Background: Human immunodeficiency virus (HIV) associated tuberculosis (TB) remains a major global public health chal- lenge, with an estimated 1.4 .... completed treatment and who is smear negative at the end of 6th or 7th month of treat- ..... the course of management of the dual disease entity. Conclusion. This study ...

  8. Impact of diabetes on treatment outcomes and long-term survival in multidrug-resistant tuberculosis.

    Science.gov (United States)

    Kang, Young Ae; Kim, Song Yee; Jo, Kyung-Wook; Kim, Hee Jin; Park, Seung-Kyu; Kim, Tae-Hyung; Kim, Eun Kyung; Lee, Ki Man; Lee, Sung Soon; Park, Jae Seuk; Koh, Won-Jung; Kim, Dae Yun; Shim, Tae Sun

    2013-01-01

    Few studies have investigated the impact of diabetes mellitus (DM), a globally increasing metabolic disease, on treatment outcomes and long-term survival in patients with multidrug-resistant forms of tuberculosis (MDR-TB). We analyzed outcomes in a large cohort to assess the impact of DM on treatment outcomes of patients with MDR-TB. MDR-TB patients newly diagnosed or retreated between 2000 and 2002 and followed for 8-11 years were retrospectively analyzed with respect to the effect of DM as a comorbidity on their treatment outcome and long-term survival. Of 1,407 patients with MDR-TB, 239 (17.0%) had coexisting DM. The mean age and body mass index were higher in MDR-TB patients with DM [MDR-TBDM(+)] than in those without DM [MDR-TBDM(-)]. Patients with MDR-TB and a comorbidity of DM had a significantly lower treatment success rate than those without a history of DM (36.0 vs. 47.2%, p = 0.002). In addition, DM was the negative predictor for MDR-TB treatment success in multivariate analyses [odds ratio 0.51, 95% confidence interval (CI) 0.26-0.99]. Mean survival times were also lower in MDR-TBDM(+) than in MDR-TBDM(-) patients (102 vs. 114 months, p = 0.001), with DM as a significant predictor of poor long-term survival in multivariate analyses (hazard ratio 1.59, 95% CI 1.01-2.50). Among MDR-TB patients, DM was a relatively common comorbidity. In patients undergoing treatment for MDR-TB and followed for 8-11 years, it was found to be independently associated with an increased risk of both treatment failure and death. Copyright © 2013 S. Karger AG, Basel.

  9. MDR and XDR-TB: Revolutionising our approach to facility design for long-term care facilities improved infrastructure and services for South Africa

    CSIR Research Space (South Africa)

    Parsons, SA

    2008-11-01

    Full Text Available of hospital design solutions to accommodate M(X)DR-TB patients and methodologies adopted to fast track the provision of much needed beds in the various high burden provinces in South Africa. TB Healthcare facilities: the South African Tuberculosis Strategic... categories: 20th Congress of the International Federation of Hospital Engineering, 19-22 October 2008, Barcelona, Spain 11 Risk Management As discussed earlier the key design issues in reducing the opportunities for patient-to-patient and patient...

  10. Individualized treatment of multidrug-resistant tuberculosis using therapeutic drug monitoring

    Directory of Open Access Journals (Sweden)

    Mathieu S Bolhuis

    2016-01-01

    Conclusion: TDM is highly valuable to individualize and optimize treatment of complex MDR-TB patients. TDM is routinely applied in Tuberculosis Center Beatrixoord, and high success rates for treatment of MDR-TB patients have been achieved. DBS and LSS make implementation of TDM feasible, even in low- and middle-income countries.

  11. Integration of HIV and TB services results in improved TB treatment outcomes and earlier prioritized ART initiation in a large urban HIV clinic in Uganda.

    Science.gov (United States)

    Hermans, Sabine M; Castelnuovo, Barbara; Katabira, Catherine; Mbidde, Peter; Lange, Joep M A; Hoepelman, Andy I M; Coutinho, Alex; Manabe, Yukari C

    2012-06-01

    The World Health Organization recommends that treatment of tuberculosis (TB) in HIV-infected patients should be integrated with HIV care. In December 2008, a separate outdoor-integrated TB/HIV clinic was instituted for attendees of a large urban HIV clinic in Uganda. We sought to evaluate associated TB and HIV treatment outcomes. Routinely collected clinical, pharmacy, and laboratory data were merged with TB clinic data for patients initiating TB treatment in 2009 and with TB register data for patients in 2007. TB treatment outcomes and (timing of) antiretroviral therapy (ART) initiation in ART-naive patients [overall and stratified by CD4+ T cell (CD4) count] in 2007 and 2009 were compared. Nosocomial transmission rates could not be assessed. Three hundred forty-six patients were initiated on TB treatment in 2007 and 366 in 2009. Median CD4 counts at TB diagnosis did not differ. TB treatment cure or completion increased from 62% to 68%, death or default decreased from 33% to 25% (P ART-naive TB patients were initiated on ART in 2009 versus 2007 (57% and 66%, P = 0.031), but this decrease was only in patients with CD4 counts >250 cells per cubic millimeter (19% vs. 48%, P = 0.003). More patients were started on ART during TB treatment (94% vs. 78%, P ART initiation. This supports rollout of a fully integrated TB/HIV service delivery model throughout high-prevalence TB and HIV settings.

  12. [Reflection on Medical Treatment of Multi-drug Resistance Tuberculosis: The Necessity of Chinese Medicine Holistic View].

    Science.gov (United States)

    Zhang, Lei-lei; Jin, Hua

    2015-12-01

    Causative factors of multi-drug resistance tuberculosis (MDR-TB) were analyzed from iatrogenic angles, patients themselves, and society. Reviewed was the development of treatment strategies for MDR-TB from directly observed treatment short-course (DOTS) to DOTS-Plus. The history of Chinese medicine (CM) fighting TB and characteristics at the present stage were also analyzed. Authors pointed out that CM pays attention not only to killing pathogens and confirms the necessity of getting rid of pathogens, but also to cascade response caused by pathogens. It also regards the occurrence and development of MDR-TB as a whole by combining patients' conditions, climatic, geographic, psychological, and social factors. Authors believed that therapeutic principles under guidance of CM holistic view are of positive significance and inspiration in treating MDR-TB, and emphasized holistic view as basic strategies for treating MDR-TB, but not a single countermeasure.

  13. THE EFFECT OF DIFFERENT TB DRUGS AND ANTIMICROBIAL AGENTS ON THE EFFICIENCY OF TREATMENT OF TUBERCULOSIS PATIENTS WITH MULTIPLE DRUG RESISTANCE

    Directory of Open Access Journals (Sweden)

    I. A. Vasilyeva

    2017-01-01

    Full Text Available Objective of the study: to study the effect of specific TB drugs and antimicrobial agents constituting chemotherapy regimens on the efficiency of treatment of tuberculosis patients with various patterns of multiple drug resistance.Subjects and Methods. 412 pulmonary tuberculosis patients with bacillary excretion and various patterns of multiple drug resistance were enrolled into the study (117 patients with MDR TB (non pre-XDR and non-XDR; 120 patients with pre-XDR TB and 175 with XDR TB. Patients in the subgroups were compatible regarding sex and age. The patients were prescribed regimens including 5-6 drugs in accordance with their drug resistance pattern. The time of sputum conversion (by culture versus the year of treatment was selected as a surrogate endpoint. The effect of specific TB drugs and antimicrobial agents on treatment efficiency was assessed through calculation of odds ratio (OR of achieving a surrogate endpoint in the patients receiving and not receiving a certain drug.Results. In the subgroup of pre-XDR TB, the following drugs demonstrated the valid increase of odds of sputum conversion: ethambutol (OR 11.8, pyrazinamide (OR 10.2, moxifloxacin (OR 7.8, capreomicin (OR 4.41. Sputum conversion was achieved in all 11 patients treated with bedaquiline.In the subgroup of XDR TB, the following drugs provided a positive effect on the achievement of sputum conversion: bedaquiline (OR 9.62, linezolid (OR 8.15, cycloserine (OR 7.88, pyrazinamide (OR 7.29, moxifloxacin (OR 7.08, and ethambutol (OR 6.69. Ofloxacin demonstrated a confident negative effect on achieving sputum conversion (95% CI 0.06-0.32. 

  14. Factors Associated with Mortality among Patients on TB Treatment in the Southern Region of Zimbabwe, 2013

    Science.gov (United States)

    Sandy, Charles; Masuka, Nyasha; Hazangwe, Patrick; Choto, Regis C.; Mutasa-Apollo, Tsitsi; Nkomo, Brilliant; Sibanda, Edwin; Mugurungi, Owen; Siziba, Nicholas

    2017-01-01

    Background. In 2013, the tuberculosis (TB) mortality rate was highest in southern Zimbabwe at 16%. We therefore sought to determine factors associated with mortality among registered TB patients in this region. Methodology. This was a retrospective record review of registered patients receiving anti-TB treatment in 2013. Results. Of 1,971 registered TB patients, 1,653 (84%) were new cases compared with 314 (16%) retreatment cases. There were 1,538 (78%) TB/human immunodeficiency virus (HIV) coinfected patients, of whom 1,399 (91%) were on antiretroviral therapy (ART) with median pre-ART CD4 count of 133 cells/uL (IQR, 46–282). Overall, 428 (22%) TB patients died. Factors associated with increased mortality included being ≥65 years old [adjusted relative risk (ARR) = 2.48 (95% CI 1.35–4.55)], a retreatment TB case [ARR = 1.34 (95% CI, 1.10–1.63)], and being HIV-positive [ARR = 1.87 (95% CI, 1.44–2.42)] whilst ART initiation was protective [ARR = 0.25 (95% CI, 0.22–0.29)]. Cumulative mortality rates were 10%, 14%, and 21% at one, two, and six months, respectively, after starting TB treatment. Conclusion. There was high mortality especially in the first two months of anti-TB treatment, with risk factors being recurrent TB and being HIV-infected, despite a high uptake of ART. PMID:28352474

  15. Factors Associated with Mortality among Patients on TB Treatment in the Southern Region of Zimbabwe, 2013

    Directory of Open Access Journals (Sweden)

    Kudakwashe C. Takarinda

    2017-01-01

    Full Text Available Background. In 2013, the tuberculosis (TB mortality rate was highest in southern Zimbabwe at 16%. We therefore sought to determine factors associated with mortality among registered TB patients in this region. Methodology. This was a retrospective record review of registered patients receiving anti-TB treatment in 2013. Results. Of 1,971 registered TB patients, 1,653 (84% were new cases compared with 314 (16% retreatment cases. There were 1,538 (78% TB/human immunodeficiency virus (HIV coinfected patients, of whom 1,399 (91% were on antiretroviral therapy (ART with median pre-ART CD4 count of 133 cells/uL (IQR, 46–282. Overall, 428 (22% TB patients died. Factors associated with increased mortality included being ≥65 years old [adjusted relative risk (ARR = 2.48 (95% CI 1.35–4.55], a retreatment TB case [ARR = 1.34 (95% CI, 1.10–1.63], and being HIV-positive [ARR = 1.87 (95% CI, 1.44–2.42] whilst ART initiation was protective [ARR = 0.25 (95% CI, 0.22–0.29]. Cumulative mortality rates were 10%, 14%, and 21% at one, two, and six months, respectively, after starting TB treatment. Conclusion. There was high mortality especially in the first two months of anti-TB treatment, with risk factors being recurrent TB and being HIV-infected, despite a high uptake of ART.

  16. Team approach to manage difficult-to-treat TB cases: Experiences in Europe and beyond

    Directory of Open Access Journals (Sweden)

    L. D’Ambrosio

    2018-03-01

    Full Text Available As recommended by the World Health Organization (WHO, optimal management of MDR-TB cases can be ensured by a multi-speciality consultation body known as ‘TB Consilium’. This body usually includes different medical specialities, competences and perspectives (e.g., clinical expertise both for adults and children; surgical, radiological and public health expertise; psychological background and nursing experience, among others, thus lowering the risk of making mistakes – or managing the patients inappropriately, in order to improve their clinical outcomes.At present, several high MDR-TB burden countries in the different WHO regions (and beyond have introduced TB Consilium-like bodies at the national or subnational level to reach consensus on the best treatment approach for their patients affected by TB.In addition, in countries/settings where a formal system of consultation does not exist, specialized staff from MDR-TB reference centres or international organizations usually spend a considerable amount of their working time responding to phone or e-mail clinical queries on how to manage M/XDR-TB cases.The aim of this manuscript is to describe the different experiences with the TB Consilia both at the international level (European Respiratory Society – ERS/WHO TB Consilium and in some of the countries where this experience operates successfully in Europe and beyond. The Consilium experiences are described around the following topics: (1 history, aims and focus; (2 management and funding; (3 technical functioning and structure; (4 results achieved.In addition a comparative analysis of the TB Consilia in the different countries has been performed. Keywords: MDR-TB, XDR-TB, Clinical management, Drug resistance, Prevention, Consilium

  17. Definition of drug resistance of Mycobacterium tuberculosis to antituberculosis drugs in patients with multidrugresistant tuberculosis and TB with extremely drug resistant depending on the case of the disease

    Directory of Open Access Journals (Sweden)

    Kryzhanovsky D.G.

    2014-11-01

    Full Text Available There was studied the profile of drug resistance to the main (I line and reserve (II line antituberculosis drugs in patients with MDR and XDR tuberculosis, depending of the case of the disease. According to the randomized retrospective research 200 patients with MDR and XDR tuberculosis, who received treatment in the clinic of hospital Municipal institution «Dnipropetrovsk rigional clinical association «Phthisiology» Dnipropetrovsk regional Council» during the period 2010 – 2012 were involved. Data about patients contained the data on a case of the disease and the results of the test of drug sensitivity to MBT. XDR – TB was revealed in 7.5% of patients with MDR tuberculosis. In patients with MDR tuberculosis as compared with patients with XDR tuberculosis «new cases» were diagnosed in 19.5% against 18.5% (p <0.05. In patients with MDR tuberculosis and with XDR tuberculosis resistance to the antituberculosis drug more commonly developed to S - 88.5%, E - 55% and Z - 24%. The presence of MDR-TB and XDR-TB prevails in patients, who underwent previous courses of treatment with anti-TB drugs in case history as compared with patients with «new cases» of treatment. The development of resistance to anti-TB drugs depends on the availability of these drugs in the previous treatment regimens.

  18. Challenges of TB diagnosis and treatment in South Africa | Wood ...

    African Journals Online (AJOL)

    It is estimated that 2 billion of the world\\'s population are latently infected with Mycobacterium tuberculosis (Mtb) with a resultant 8 - 9 million cases of active tuberculosis (TB) and 1.6 million deaths annually.1 The tools used for diagnosis of TB have remained largely unchanged since the 1880s when sputum microscopy, Mtb ...

  19. Ambulatory Multi-Drug Resistant Tuberculosis Treatment Outcomes in a Cohort of HIV-Infected Patients in a Slum Setting in Mumbai, India

    Science.gov (United States)

    Isaakidis, Petros; Cox, Helen S.; Varghese, Bhanumati; Montaldo, Chiara; Da Silva, Esdras; Mansoor, Homa; Ladomirska, Joanna; Sotgiu, Giovanni; Migliori, Giovanni B.; Pontali, Emanuele; Saranchuk, Peter; Rodrigues, Camilla; Reid, Tony

    2011-01-01

    Background India carries one quarter of the global burden of multi-drug resistant TB (MDR-TB) and has an estimated 2.5 million people living with HIV. Despite this reality, provision of treatment for MDR-TB is extremely limited, particularly for HIV-infected individuals. Médecins Sans Frontières (MSF) has been treating HIV-infected MDR-TB patients in Mumbai since May 2007. This is the first report of treatment outcomes among HIV-infected MDR-TB patients in India. Methods HIV-infected patients with suspected MDR-TB were referred to the MSF-clinic by public Antiretroviral Therapy (ART) Centers or by a network of community non-governmental organizations. Patients were initiated on either empiric or individualized second-line TB-treatment as per WHO recommendations. MDR-TB treatment was given on an ambulatory basis and under directly observed therapy using a decentralized network of providers. Patients not already receiving ART were started on treatment within two months of initiating MDR-TB treatment. Results Between May 2007 and May 2011, 71 HIV-infected patients were suspected to have MDR-TB, and 58 were initiated on treatment. MDR-TB was confirmed in 45 (78%), of which 18 (40%) were resistant to ofloxacin. Final treatment outcomes were available for 23 patients; 11 (48%) were successfully treated, 4 (17%) died, 6 (26%) defaulted, and 2 (9%) failed treatment. Overall, among 58 patients on treatment, 13 (22%) were successfully treated, 13 (22%) died, 7 (12%) defaulted, two (3%) failed treatment, and 23 (40%) were alive and still on treatment at the end of the observation period. Twenty-six patients (45%) experienced moderate to severe adverse events, requiring modification of the regimen in 12 (20%). Overall, 20 (28%) of the 71 patients with MDR-TB died, including 7 not initiated on treatment. Conclusions Despite high fluoroquinolone resistance and extensive prior second-line treatment, encouraging results are being achieved in an ambulatory MDR-T- program in a

  20. Outcomes of multidrug-resistant tuberculosis treatment with early initiation of antiretroviral therapy for HIV co-infected patients in Lesotho.

    Directory of Open Access Journals (Sweden)

    Hind Satti

    Full Text Available BACKGROUND: Although the importance of concurrent treatment for multidrug-resistant tuberculosis (MDR-TB and HIV co-infection has been increasingly recognized, there have been few studies reporting outcomes of MDR-TB and HIV co-treatment. We report final outcomes of comprehensive, integrated MDR-TB and HIV treatment in Lesotho and examine factors associated with death or treatment failure. METHODS: We reviewed clinical charts of all adult patients who initiated MDR-TB treatment in Lesotho between January 2008 and September 2009. We calculated hazard ratios (HR and used multivariable Cox proportional hazards regression to identify predictors of poor outcomes. RESULTS: Of 134 confirmed MDR-TB patients, 83 (62% were cured or completed treatment, 46 (34% died, 3 (2% transferred, 1 (1% defaulted, and 1 (1% failed treatment. Treatment outcomes did not differ significantly by HIV status. Among the 94 (70% patients with HIV co-infection, 53% were already on antiretroviral therapy (ART before MDR-TB treatment initiation, and 43% started ART a median of 16 days after the start of the MDR-TB regimen. Among HIV co-infected patients who died, those who had not started ART before MDR-TB treatment had a shorter median time to death (80 days vs. 138 days, p=0.065. In multivariable analysis, predictors of increased hazard of failure or death were low and severely low body mass index (HR 2.75, 95% confidence interval [CI] 1.27-5.93; HR 5.50, 95% CI 2.38-12.69, and a history of working in South Africa (HR 2.37, 95% CI 1.24-4.52. CONCLUSIONS: Favorable outcomes can be achieved in co-infected patients using a community-based treatment model when both MDR-TB and HIV disease are treated concurrently and treatment is initiated promptly.

  1. Treatment outcome of tb/hiv positive and negative smear positive ...

    African Journals Online (AJOL)

    Background: In our previous study we found that half of the patients treated at the Nylon District Hospital tuberculosis (TB) treatment centre were seropositive. HIV does not only fuel the number of tuberculosis (TB) cases worldwide but it is also at least in part, responsible for the non-achievement of the 85% cure rate target.

  2. Initiation and adherence to TB treatment in a Pakistani community influenced more by perceptions than by knowledge of tuberculosis

    Directory of Open Access Journals (Sweden)

    Mubashir Zafar

    2013-01-01

    Full Text Available Background: The tuberculosis (TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. Aims: To investigate knowledge about TB, perceptions of (access to TB treatment, and adherence to treatment among a Pakistani population. Setting and Design: Descriptive cross-sectional study. Materials and Methods: A total of 175 participants were selected nonrandomly, 100 were TB patient and 75 were non-TB patient in proportion to the total number of participants in each ward of hospital. Statistical Analysis: Analysis of attitudes and perceptions toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types done by frequency counts and percentages. Regression analysis and logistic regression analysis were performed to test whether differences in age, gender, and education level led to different knowledge scores and different attitudes and preferences toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types. All statistical analyses were performed using Statistical Package for Social Sciences (SPSS 16.0. Result: TB knowledge can be considered fairly well among this community. Respondents′ perceptions suggest that stigma may influence TB patients′ decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Conclusion: Most of the subjects were unaware of TB that seems to be due to their illiteracy and those who knew had got the knowledge from media, but the majority of the patients who were on directly observed treatment, short-course (DOTS were found to be satisfied.

  3. Viral hepatitis and HIV-associated tuberculosis: Risk factors and TB treatment outcomes in Thailand

    Directory of Open Access Journals (Sweden)

    Likanonsakul Sirirat

    2008-07-01

    Full Text Available Abstract Background The occurrence of tuberculosis (TB, human immunodeficiency virus (HIV, and viral hepatitis infections in the same patient poses unique clinical and public health challenges, because medications to treat TB and HIV are hepatotoxic. We conducted an observational study to evaluate risk factors for HBsAg and/or anti-HCV reactivity and to assess differences in adverse events and TB treatment outcomes among HIV-infected TB patients. Methods Patients were evaluated at the beginning, during, and at the end of TB treatment. Blood samples were tested for aspartate aminotransferase (AST, alanine aminotransferase (ALT, total bilirubin (BR, complete blood count, and CD4+ T lymphocyte cell count. TB treatment outcomes were assessed at the end of TB treatment according to international guidelines. Results Of 769 enrolled patients, 752 (98% had serologic testing performed for viral hepatitis: 70 (9% were reactive for HBsAg, 237 (31% for anti-HCV, and 472 (63% non-reactive for both markers. At the beginning of TB treatment, 18 (26% patients with HBsAg reactivity had elevated liver function tests compared with 69 (15% patients non-reactive to any viral marker (p = 0.02. At the end of TB treatment, 493 (64% were successfully treated. Factors independently associated with HBsAg reactivity included being a man who had sex with men (adjusted odds ratio [AOR], 2.1; 95% confidence interval [CI], 1.1–4.3 and having low TB knowledge (AOR, 1.8; CI, 1.0–3.0. Factors most strongly associated with anti-HCV reactivity were having injection drug use history (AOR, 12.8; CI, 7.0–23.2 and living in Bangkok (AOR, 15.8; CI, 9.4–26.5. The rate of clinical hepatitis and death during TB treatment was similar in patients HBsAg reactive, anti-HCV reactive, both HBsAg and anti-HCV reactive, and non-reactive to any viral marker. Conclusion Among HIV-infected TB patients living in Thailand, markers of viral hepatitis infection, particularly hepatitis C virus

  4. Comparative efficacy and safety of treatment options for MDR and XDR Acinetobacter baumannii infections: a systematic review and network meta-analysis.

    Science.gov (United States)

    Kengkla, Kirati; Kongpakwattana, Khachen; Saokaew, Surasak; Apisarnthanarak, Anucha; Chaiyakunapruk, Nathorn

    2018-01-01

    To comprehensively compare and rank the efficacy and safety of available treatment options for patients with MDR and XDR Acinetobacter baumannii (AB) infection. We searched PubMed, Embase and the Cochrane register of trials systematically for studies that examined treatment options for patients with MDR- and XDR-AB infections until April 2016. Network meta-analysis (NMA) was performed to estimate the risk ratio (RR) and 95% CI from both direct and indirect evidence. Primary outcomes were clinical cure and microbiological cure. Secondary outcomes were all-cause mortality and nephrotoxic and non-nephrotoxic adverse events. A total of 29 studies with 2529 patients (median age 60 years; 65% male; median APACHE II score 19.0) were included. Although there were no statistically significant differences between treatment options, triple therapy with colistin, sulbactam and tigecycline had the highest clinical cure rate. Colistin in combination with sulbactam was associated with a significantly higher microbiological cure rate compared with colistin in combination with tigecycline (RR 1.23; 95% CI 1.03-1.47) and colistin monotherapy (RR 1.21; 95% CI 1.06-1.38). No significant differences in all-cause mortality were noted between treatment options. Tigecycline-based therapy also appeared less effective for achieving a microbiological cure and is not appropriate for treating bloodstream MDR- and XDR-AB infections. Combination therapy of colistin with sulbactam demonstrates superiority in terms of microbiological cure with a safety profile similar to that of colistin monotherapy. Thus, our findings support the use of this combination as a treatment for MDR- and XDR-AB infections. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Integration of HIV and TB Services Results in Improved TB Treatment Outcomes and Earlier Prioritized ART Initiation in a Large Urban HIV Clinic in Uganda

    NARCIS (Netherlands)

    Hermans, Sabine M.; Castelnuovo, Barbara; Katabira, Catherine; Mbidde, Peter; Lange, Joep M. A.; Hoepelman, Andy I. M.; Coutinho, Alex; Manabe, Yukari C.

    2012-01-01

    Background: The World Health Organization recommends that treatment of tuberculosis (TB) in HIV-infected patients should be integrated with HIV care. In December 2008, a separate outdoor-integrated TB/HIV clinic was instituted for attendees of a large urban HIV clinic in Uganda. We sought to

  6. How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

    NARCIS (Netherlands)

    Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

    2013-01-01

    Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

  7. Rapid molecular detection of rifampicin resistance facilitates early diagnosis and treatment of multi-drug resistant tuberculosis: case control study.

    Directory of Open Access Journals (Sweden)

    Philly O'Riordan

    2008-09-01

    Full Text Available Multi-drug resistant tuberculosis (MDR-TB is a major public health concern since diagnosis is often delayed, increasing the risk of spread to the community and health care workers. Treatment is prolonged, and the total cost of treating a single case is high. Diagnosis has traditionally relied upon clinical suspicion, based on risk factors and culture with sensitivity testing, a process that can take weeks or months. Rapid diagnostic molecular techniques have the potential to shorten the time to commencing appropriate therapy, but have not been put to the test under field conditions.This retrospective case-control study aimed to identify risk factors for MDR-TB, and analyse the impact of testing for rifampicin resistance using RNA polymerase B (rpoB mutations as a surrogate for MDR-TB. Forty two MDR-TB cases and 84 fully sensitive TB controls were matched by date of diagnosis; and factors including demographics, clinical presentation, microbiology findings, management and outcome were analysed using their medical records. Conventionally recognised risk factors for MDR-TB were absent in almost half (43% of the cases, and 15% of cases were asymptomatic. A significant number of MDR-TB cases were identified in new entrants to the country. Using rpoB mutation testing, the time to diagnosis of MDR-TB was dramatically shortened by a median of 6 weeks, allowing patients to be commenced on appropriate therapy a median of 51days earlier than those diagnosed by conventional culture and sensitivity testing.MDR-TB is frequently an unexpected finding, may be asymptomatic, and is particularly prevalent among TB infected new entrants to the country. Molecular resistance testing of all acid fast bacilli positive specimens has the potential to rapidly identify MDR-TB patients and commence them on appropriate therapy significantly earlier than by conventional methods.

  8. Understanding Market Size and Reporting Gaps for Paediatric TB in Indonesia, Nigeria and Pakistan: Supporting Improved Treatment of Childhood TB in the Advent of New Medicines.

    Science.gov (United States)

    Coghlan, Renia; Gardiner, Elizabeth; Amanullah, Farhana; Ihekweazu, Chikwe; Triasih, Rina; Grzemska, Malgorzata; Sismanidis, Charalambos

    2015-01-01

    We sought to understand gaps in reporting childhood TB cases among public and private sector health facilities (dubbed "non-NTP" facilities) outside the network of national TB control programmes, and the resulting impact of under-reporting on estimates of paediatric disease burden and market demand for new medicines. Exploratory assessments were carried out in Indonesia, Nigeria and Pakistan, reaching a range of facility types in two selected areas of each country. Record reviews and interviews of healthcare providers were carried out to assess numbers of unreported paediatric TB cases, diagnostic pathways followed and treatment regimens prescribed. A total of 985 unreported diagnosed paediatric TB cases were identified over a three month period in 2013 in Indonesia from 64 facilities, 463 in Pakistan from 35 facilities and 24 in Nigeria from 20 facilities. These represent an absolute additional annualised yield to 2013 notifications reported to WHO of 15% for Indonesia, 2% for Nigeria and 7% for Pakistan. Only 12% of all facilities provided age and sex-disaggregated data. Findings highlight the challenges of confirming childhood TB. Diagnosis patterns in Nigeria highlight a very low suspicion for childhood TB. Providers note the need for paediatric medicines aligned to WHO recommendations. This study emphasises the impact of incomplete reporting on the estimation of disease burden and potential market size of paediatric TB medicines. Further studies on "hubs" (facilities treating large numbers of childhood TB cases) will improve our understanding of the epidemic, support introduction efforts for new treatments and better measure markets for new paediatric medicines.

  9. Expanded polyfunctional T cell response to mycobacterial antigens in TB disease and contraction post-treatment.

    Directory of Open Access Journals (Sweden)

    James M Young

    2010-06-01

    Full Text Available T cells producing multiple factors have been shown to be required for protection from disease progression in HIV but we have recently shown this not to be the case in TB. Subjects with active disease had a greater proportion of polyfunctional cells responding to ESAT-6/CFP-10 stimulation than their infected but non-diseased household contacts (HHC. We therefore wanted to assess this profile in subjects who had successfully completed standard TB chemotherapy.We performed a cross-sectional study using PBMC from TB cases (pre- and post-treatment and HHC. Samples were stimulated overnight with TB antigens (ESAT-6/CFP-10 and PPD and their CD4+ and CD8+ T cells were assessed for production of CD107a, IFN-gamma, IL-2 and TNF-alpha and the complexity of the responses was determined using SPICE and PESTLE software.We found that an increase in complexity (i.e., production of more than 1 factor simultaneously of the T cell profile was associated with TB disease and that this was significantly reduced following TB treatment. This implies that T cells are able to respond adequately to TB antigens with active disease (at least initially but the ability of this response to protect the host from disease progression is hampered, presumably due to immune evasion strategies by the bacteria. These findings have implications for the development of new diagnostics and vaccine strategies.

  10. Resistance to fluoroquinolones and second-line injectable drugs: impact on multidrug-resistant TB outcomes

    NARCIS (Netherlands)

    Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.

    2013-01-01

    A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable

  11. Cost-effectiveness of initiating antiretroviral therapy at different points in TB treatment in HIV-TB co-infected ambulatory patients in South Africa

    Science.gov (United States)

    Naidoo, Kogieleum; Grobler, Anneke C; Deghaye, Nicola; Reddy, Tarylee; Gengiah, Santhanalakshmi; Gray, Andrew; Karim, Salim Abdool

    2015-01-01

    Objective Initiation of antiretroviral therapy (ART) during tuberculosis (TB) treatment improves survival in TB-HIV co-infected patients. In patients with CD4+ counts benefit of early ART initiation. The purpose of this study was to assess the costs and cost effectiveness of starting ART at various time points during TB treatment in patients with CD4+ counts ≥50cells/mm3. Methods In the SAPiT trial, 642 HIV-TB co-infected patients were randomized to three arms, either receiving ART within 4 weeks of starting TB treatment (early treatment arm; Arm-1), after the intensive phase of TB treatment (late treatment arm; Arm-2), or after completing TB treatment (sequential arm; Arm-3). Direct healthcare costs were measured from a provider perspective using a micro-costing approach. The incremental cost per death averted was calculated using the trial outcomes. Results For patients with CD4+ count≥50cells/mm3, median monthly variable costs per patient were $116, $113 and $102 in Arms-1, -2 and -3, respectively. There were 12 deaths in 177 patients in Arm-1, 8 deaths in 180 patients in the Arm-2 and 19 deaths in 172 patients in Arm-3. While the costs were lower in Arm-3, it had a substantially higher mortality rate. The incremental cost per death averted associated with moving from Arm-3 to Arm-2 was $4199. There was no difference in mortality between Arm-1 and Arm-2, but Arm-1 was slightly more expensive. Conclusions Initiation of ART after the completion of the intensive phase of TB treatment is cost effective for patients with CD4+ counts≥50cells/mm3. PMID:26167618

  12. Patient reported delays in seeking treatment for Tuberculosis (TB among adult and pediatric TB patients and TB patients co-infected with HIV in Lima, Peru: a qualitative study

    Directory of Open Access Journals (Sweden)

    Valerie A Paz-Soldan

    2014-12-01

    Full Text Available Abstract: Tuberculosis (TB remains a significant public health challenge worldwide, and particularly in Peru with one of the highest incidence rates in Latin America. TB patient behavior has a direct influence on whether a patient will receive timely diagnosis and successful treatment of their illness. Objectives: The objective was to understand the complex factors that can impact TB patient health seeking behavior. Methods: In-depth interviews were conducted with adult and parents of pediatric patients receiving TB treatment (n=43, within that group a sub-group was also co-infected with HIV (n=11. Results: Almost all of the study participants recognized delays in seeking either their child’s or their own diagnosis of their TB symptoms. The principal reasons for treatment-seeking delays were lack of knowledge and confusion of tuberculosis symptoms, fear and embarrassment of receiving a TB diagnosis, and a patient tendency to self-medicate prior to seeking formal medical attention.Conclusions: Health promotion activities that target patient delays have the potential to improve individual patient outcomes and mitigate the spread of TB at a community level.

  13. TB treatment in a chronic complex emergency: treatment outcomes and experiences in Somalia.

    Science.gov (United States)

    Liddle, Karin Fischer; Elema, Riekje; Thi, Sein Sein; Greig, Jane; Venis, Sarah

    2013-11-01

    Médecins Sans Frontières (MSF) provides TB treatment in Galkayo and Marere in Somalia. MSF international supervisory staff withdrew in 2008 owing to insecurity but maintained daily communication with Somali staff. In this paper, we aimed to assess the feasibility of treating TB in a complex emergency setting and describe the programme adaptations implemented to facilitate acceptable treatment outcomes. Routinely collected treatment data from 2005-2012 were retrospectively analysed. In multivariate analyses, factors associated with successful outcome (cure or completion versus failure, death and default) were assessed, including the presence of international supervisory staff. Informal interviews were conducted with Somali staff regarding programmatic factors affecting patient management and perceived reasons for default. In total, 6167 patients were admitted (34.8% female; median age 24.0 years [IQR 13.0-38.0 years]). Treatment success was 79% (programme range 69-87%). Presence of international staff did not improve outcomes (adjusted OR 0.85, 95% CI 0.66-1.09; p=0.27). Perceived reasons for default included being away from family, nomadic group, insecurity, travel cost, need to return to grazing land or feeling better. Despite the challenges, a high percentage of patients were successfully treated. Treatment outcomes were not adversely affected by withdrawal of international supervisory staff.

  14. Concordance of programmatic and laboratory-based multidrug-resistant tuberculosis treatment outcomes in Peru.

    Science.gov (United States)

    Alexy, E R; Podewils, L J; Mitnick, C D; Becerra, M C; Laserson, K F; Bonilla, C

    2012-01-01

    Confirmation of cure for multidrug-resistant tuberculosis (MDR-TB) patients requires laboratory tests for Mycobacterium tuberculosis growth on culture media. Outcome decisions dictate patient management, and inaccuracies place patients at an increased risk of morbidity and mortality, and may contribute to continued transmission of MDR-TB. To examine concordance between programmatic and laboratory-based MDR-TB treatment outcomes. The study population included 1658 MDR-TB patients in Peru treated between 1996 and 2002 with both program and laboratory-based outcomes. Laboratory-based outcomes were assigned according to international standards requiring at least five consecutive negative cultures in the last 12 months of treatment to confirm cure. Compared to the global culture-defined standard classification, only 1.1% of treatment successes, but 54.3% of failures, were misclassified programmatically. Overall, 10.4% of patients identified by a clinician as having a successful treatment outcome still had cultures positive for MDR-TB. Most patients with successful treatment outcomes by strict culture definitions were also classified by clinicians as having successful outcomes. However, many culture-confirmed failures were missed. In light of delays and incomplete access to culture in MDR-TB programs, efforts should be made to improve the accuracy of programmatically determined treatment outcomes.

  15. Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol

    OpenAIRE

    Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

    2016-01-01

    Introduction:\\ud Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This eval...

  16. CT screening before treatment of latent tuberculous infection for the diagnosis of clinical TB among contacts

    International Nuclear Information System (INIS)

    Yoshiyama, Takashi; Ogata, Hideo

    2008-01-01

    The objective of this study was to evaluate the value of CT scan for the detection of tuberculous diseases among persons who are suspected to be infected at the contact examination. The settings of this study was to Fukujuji Hospital, Japan. Retrospective review of the medical records of 22 persons who were normal with plain chest X-ray at an outbreak at a private school, with which total 46 tuberculosis (TB) cases and 93 infected persons were detected by either symptomatic visits or contact examinations done mainly at public health centers. Among the 44 persons who visited Fukujuji Hospital, 4 persons were symptomatic visits, 3 persons were detected as TB cases by the contact examination at public health centers and 3 persons visited Fukujuji Hospital for the purpose of contact examination before examinations at the public health centers. Eight of these 10 persons were with abnormal chest plain X-ray findings and the remaining two persons were normal with plain chest X-ray findings (group A). Among the 34 persons who were referred to Fukujuji Hospital from public health centers as the infected person without diseases, one person showed abnormal chest plain X-ray and 33 persons showed normal chest plain X-ray (group B). Group A persons were examined in June and Group B persons were examined in July. The 2 persons in the group A were with abnormal CT findings. They were not diagnosed as TB by the CT findings but followed up after sputum examinations. Both of them were diagnosed as TB by the positive TB culture. Among the 33 persons in the group B, 20 persons were tested with CT scan at the examination done before starting treatment of latent tuberuclous infection and six of these 20 persons were with abnormal findings and were judged as TB diseases. In the case of outbreak with many TB cases and infected persons, CT should be considered for the detection of TB cases among contacts. (author)

  17. A meta-analysis of drug resistant tuberculosis in Sub-Saharan Africa: how strongly associated with previous treatment and HIV co-infection?

    Science.gov (United States)

    Berhan, Asres; Berhan, Yifru; Yizengaw, Desalegn

    2013-11-01

    In Sub-Saharan Africa, the fight against tuberculosis (TB) has encountered a great challenge because of the emergence of drug resistant TB strains and the high prevalence of HIV infection. The aim of this meta-analysis was to determine the association of drug-resistant TB with anti-TB drug treatment history and HIV co-infection. After electronic based literature search in the databases of Medline, HINARI, EMBASE and the Cochrane library, article selection and data extraction were carried out. HIV co-infection and previous history of TB treatment were used as predictors for the occurrence of any anti-TB drug resistant or multiple drug resistant TB (MDR-TB). The risk ratios for each included study and for the pooled sample were computed using the random-effects model. Heterogeneity test, sensitivity analyses and funnel plots were also done. The pooled analysis showed that the risk of developing drug-resistant TB to at least one anti-TB drug was about 3 times higher in individuals who had a previous history of anti-TB treatment than new TB cases. The risk of having MDR-TB in previously anti-TB treated TB cases was more than 5-fold higher than that of new TB cases. Resistance to Ethambutol and Rifampicin was more than fivefold higher among the previously treated with anti-TB drugs. However, HIV infection was not associated with drug-resistant TB. There was a strong association of previous anti-TB treatment with MDR-TB. Primary treatment warrants special emphasis, and screening for anti-TB drugs sensitivity has to be strengthened.

  18. TB treatment initiation and adherence in a South African community influenced more by perceptions than by knowledge of tuberculosis

    Directory of Open Access Journals (Sweden)

    Møller Valerie

    2010-02-01

    Full Text Available Abstract Background Tuberculosis (TB is a global health concern. Inadequate case finding and case holding has been cited as major barrier to the control of TB. The TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. The Eastern Cape is known as a province with high TB incidence, prevalence and with one of the worst cure rates of South Africa. Its inhabitants can be considered lay experts when it comes to TB. Therefore, we investigated knowledge, perceptions of (access to TB treatment and adherence to treatment among an Eastern Cape population. Methods An area-stratified sampling design was applied. A total of 1020 households were selected randomly in proportion to the total number of households in each neighbourhood. Results TB knowledge can be considered fairly good among this community. Respondents' perceptions suggest that stigma may influence TB patients' decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Regression analyses revealed that in this population young and old, men and women and the lower and higher educated share the same attitudes and perceptions. Our findings are therefore likely to reflect the actual situation of TB patients in this population. Conclusions The lay experts' perceptions suggests that stigma appears to effect case holding and case finding. Future interventions should be directed at improving attitudes and perceptions to potentially reduce stigma. This requires a patient-centered approach to empower TB patients and active involvement in the development and implementation of stigma reduction programs.

  19. Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

    Directory of Open Access Journals (Sweden)

    U D Gupta

    2015-01-01

    Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

  20. Risk factors and timing of default from treatment for non-multidrug-resistant tuberculosis in Moldova.

    Science.gov (United States)

    Jenkins, H E; Ciobanu, A; Plesca, V; Crudu, V; Galusca, I; Soltan, V; Cohen, T

    2013-03-01

    The Republic of Moldova, in Eastern Europe, has among the highest reported nationwide proportions of tuberculosis (TB) patients with multidrug-resistant tuberculosis (MDR-TB) worldwide. Default has been associated with increased mortality and amplification of drug resistance, and may contribute to the high MDR-TB rates in Moldova. To assess risk factors and timing of default from treatment for non-MDR-TB from 2007 to 2010. A retrospective analysis of routine surveillance data on all non-MDR-TB patients reported. A total of 14.7% of non-MDR-TB patients defaulted from treatment during the study period. Independent risk factors for default included sociodemographic factors, such as homelessness, living alone, less formal education and spending substantial time outside Moldova in the year prior to diagnosis; and health-related factors such as human immunodeficiency virus co-infection, greater lung pathology and increasing TB drug resistance. Anti-tuberculosis treatment is usually initiated within an institutional setting in Moldova, and the default risk was highest in the month following the phase of hospitalized treatment (among civilians) and after leaving prison (among those diagnosed while incarcerated). Targeted interventions to increase treatment adherence for patients at highest risk of default, and improving the continuity of care for patients transitioning from institutional to community care may substantially reduce risk of default.

  1. Community-based management versus traditional hospitalization in treatment of drug-resistant tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Williams, Abimbola Onigbanjo; Makinde, Olusesan Ayodeji; Ojo, Mojisola

    2016-01-01

    Multidrug drug resistant Tuberculosis (MDR-TB) and extensively drug resistant Tuberculosis (XDR-TB) have emerged as significant public health threats worldwide. This systematic review and meta-analysis aimed to investigate the effects of community-based treatment to traditional hospitalization in improving treatment success rates among MDR-TB and XDR-TB patients in the 27 MDR-TB High burden countries (HBC). We searched PubMed, Cochrane, Lancet, Web of Science, International Journal of Tuberculosis and Lung Disease, and Centre for Reviews and Dissemination (CRD) for studies on community-based treatment and traditional hospitalization and MDR-TB and XDR-TB from the 27 MDR-TB HBC. Data on treatment success and failure rates were extracted from retrospective and prospective cohort studies, and a case control study. Sensitivity analysis, subgroup analyses, and meta-regression analysis were used to explore bias and potential sources of heterogeneity. The final sample included 16 studies involving 3344 patients from nine countries; Bangladesh, China, Ethiopia, Kenya, India, South Africa, Philippines, Russia, and Uzbekistan. Based on a random-effects model, we observed a higher treatment success rate in community-based treatment (Point estimate = 0.68, 95 % CI: 0.59 to 0.76, p   18 months, and regimen with drugs >5 reported higher treatment success rate. In the meta-regression model, age of patients, adverse events, treatment duration, and lost to follow up explains some of the heterogeneity of treatment effects between studies. Community-based management improved treatment outcomes. A mix of interventions with DOTS-Plus throughout therapy and treatment duration > 18 months as well as strategies in place for lost to follow up and adverse events should be considered in MDR-TB and XDR-TB interventions, as they influenced positively, treatment success.

  2. From MDR to MXR

    DEFF Research Database (Denmark)

    Litman, Thomas; Druley, T E; Stein, W D

    2001-01-01

    The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....

  3. Accelerated approach of discovering plant derived drug leads for treatment of TB

    CSIR Research Space (South Africa)

    Naidoo, D

    2010-06-01

    Full Text Available dedicated and comprehensive plant electronic database of a total of 566 plants that are reportedly used for the treatment of tuberculosis. The extracts of these plants are part of the CSIR database of extracts. TB drug lead research is ongoing, and active...

  4. The impact of HIV status and antiretroviral treatment on TB treatment outcomes of new tuberculosis patients attending co-located TB and ART services in South Africa: a retrospective cohort study.

    Science.gov (United States)

    Nglazi, Mweete D; Bekker, Linda-Gail; Wood, Robin; Kaplan, Richard

    2015-11-19

    The implementation of collaborative TB-HIV services is challenging. We, therefore, assessed TB treatment outcomes in relation to HIV infection and antiretroviral therapy (ART) among TB patients attending a primary care service with co-located ART and TB clinics in Cape Town, South Africa. In this retrospective cohort study, all new TB patients aged ≥ 15 years who registered and initiated TB treatment between 1 October 2009 and 30 June 2011 were identified from an electronic database. The effects of HIV-infection and ART on TB treatment outcomes were analysed using a multinomial logistic regression model, in which treatment success was the reference outcome. The 797 new TB patients included in the analysis were categorized as follows: HIV- negative, in 325 patients (40.8 %); HIV-positive on ART, in 339 patients (42.5 %) and HIV-positive not on ART, in 133 patients (16.7 %). Overall, bivariate analyses showed no significant difference in death and default rates between HIV-positive TB patients on ART and HIV-negative patients. Statistically significant higher mortality rates were found among HIV-positive patients not on ART compared to HIV-negative patients (unadjusted odds ratio (OR) 3.25; 95 % confidence interval (CI) 1.53-6.91). When multivariate analyses were conducted, the only significant difference between the patient categories on TB treatment outcomes was that HIV-positive TB patients not on ART had significantly higher mortality rates than HIV-negative patients (adjusted OR 4.12; 95 % CI 1.76-9.66). Among HIV-positive TB patients (n = 472), 28.2 % deemed eligible did not initiate ART in spite of the co-location of TB and ART services. When multivariate analyses were restricted to HIV-positive patients in the cohort, we found that being HIV-positive not on ART was associated with higher mortality (adjusted OR 7.12; 95 % CI 2.95-18.47) and higher default rates (adjusted OR 2.27; 95 % CI 1.15-4.47). There was no significant difference in death and

  5. High variability of TB, HIV, hepatitis C treatment and opioid substitution therapy among prisoners in Germany.

    Science.gov (United States)

    Müller, Jana; Schmidt, Daniel; Kollan, Christian; Lehmann, Marc; Bremer, Viviane; Zimmermann, Ruth

    2017-10-25

    In Germany, medical care of prisoners is completely separated from extramural health care. The extent and quality of medical care among prisoners in Germany are therefore largely unknown. We performed a secondary data analysis of pharmacy sales data for tuberculosis (TB), HIV, hepatitis C (HCV) and opioid substitution treatment (OST) delivered to prisons in 11 federal states (FS) in Germany between 01/2012 and 03/2013. The aims of this study were to assess (i) the treatment availability for the selected diseases and OST in German prisons, (ii) the proportion of prisoners treated per FS and overall for TB, HIV, HCV and OST during the study period. Substances unique to or typically used for the treatment of each disease were defined as marker substances with defined daily doses (DDD). For each marker substance we assessed the cumulative number of DDD, the average daily number of DDD (DDD d ) and average treatment prevalence per day in percent (adTP). Accordingly, the DDD d represents one person treated per day and the adTP means the proportion of prisoners treated per day. We compared the adTP of the diseases with previously measured prevalences. We obtained data from pharmacies supplying prisons in 11 of 16 German FS. Of the included prisons, 41% were supplied with medicines for TB, 71% for HIV and 58% for HCV and OST. Twice as many delivered marker substances for TB were indicated for the continuation phase and chemoprevention than the intensive phase. The HIV adTP ranged from 0.06% to 0.94%, HCV adTP ranged from 0.03% to 0.59% and OST adTP ranged from 0% to 7.90%. The overall adTP for the respective treatment was 0.39% for HIV, 0.12% for HCV and 2.18% for OST. According to our findings treatment rates for TB were consistent with the expected TB prevalence, at least in Berlin. HIV treatment seems to be offered to an adequate proportion of estimated infected prisoners. In contrast, the HCV treatment prevalence was low. High variation among FS in provision of all

  6. [Duties of physicians or other healthcare workers connected with diagnosis, treatment, dissemination of information, assessment and registration of TB patients].

    Science.gov (United States)

    Zielonka, Tadeusz M

    2015-01-01

    Effective laws provide a series of duties to be performed by physicians and other medical personnel associated with TB. Every TB case and death resulting from TB as well as any case of undesirable result of BCG test requires notification and filling in of a special form. The physician has a duty to inform TB patients their legal guardians, close relatives or friends about the need to undergo sanitary and diagnostic procedure, treatment or vaccination, as well as on how to prevent disease from spreading. Persons failing to comply with the relevant numerous legal requirements in this respect are subject to a fine.TB patients can use special sick benefits extending up to 270 days. There is a requirement to use appropriate codes to define TB irrespective of LCD-10 classification.

  7. Optimization of TB/HIV co-treatment in Ethiopian patients

    OpenAIRE

    Degu, Wondwossen Amogne

    2015-01-01

    Tuberculosis (TB) and HIV infection act with deadly synergy. HIV is the most important risk factor for latent TB reactivation and active TB progression following exposure or reinfection while TB accelerates HIV progression. TB is the most frequent cause of morbidity and mortality in HIV infection. Anti-TB therapy (ATT) must precede initiation of combination Antiretroviral Therapy (cART), TB being the most immediate threat. Undoubtedly cART benefits; however, important clinical ...

  8. Questions and Answers about TB

    Science.gov (United States)

    ... disease. Introduction Testing and Treatment TB Disease Glossary Introduction Introduction What is TB? Why is TB still ... chest x-ray is made by exposing a film to x-rays that pass through the chest. ...

  9. TextTB: A Mixed Method Pilot Study Evaluating Acceptance, Feasibility, and Exploring Initial Efficacy of a Text Messaging Intervention to Support TB Treatment Adherence

    Directory of Open Access Journals (Sweden)

    Sarah Iribarren

    2013-01-01

    Full Text Available Objective. To assess a text messaging intervention to promote tuberculosis (TB treatment adherence. Methods. A mixed-methods pilot study was conducted within a public pulmonary-specialized hospital in Argentina. Patients newly diagnosed with TB who were 18 or older, and had mobile phone access were recruited and randomized to usual care plus either medication calendar (n=19 or text messaging intervention (n=18 for the first two months of treatment. Primary outcomes were feasibility and acceptability; secondary outcomes explored initial efficacy. Results. Feasibility was evidenced by high access to mobile phones, familiarity with texting, most phones limited to basic features, a low rate of participant refusal, and many describing suboptimal TB understanding. Acceptability was evidenced by participants indicating feeling cared for, supported, responsible for their treatment, and many self-reporting adherence without a reminder. Participants in the texting group self-reported adherence on average 77% of the days whereas only 53% in calendar group returned diaries. Exploring initial efficacy, microscopy testing was low and treatment outcomes were similar in both groups. Conclusion. The texting intervention was well accepted and feasible with greater reporting of adherence using text messaging than the diary. Further evaluation of the texting intervention is warranted.

  10. Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism

    Directory of Open Access Journals (Sweden)

    Em Sutrisna

    2015-06-01

    Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.

  11. Volume and dose rate dependent (MDR-LDR Ir-192 afterloading interstitial brachytherapy) treatment optimisation, for squamouscell carcinoma of the lip

    International Nuclear Information System (INIS)

    Stas, Nathalie; Goncalves, Julieta; Pinho, Eliana; Trigo, Lurdes; Fernandes, Tome; Vieira, Elio

    1996-01-01

    Introduction: From 1/1/90 to 1/1/95, 53 patients with squamouscell carcinoma of the lip were treated by MDR or LDR Ir-192 afterloading interstitital brachytherapy. We compare the oncological and aesthetical results and sequelae depending on the volume and the dose rate. Material and methods: 53 patients, 41 men and 12 women, median age = 66y; 48 primary tumors (T1 = 26; T2 = 16; T3 = 6; N0 = 47; N1 = 1; M0 = 48) and 5 recurrencies; squamouscell carcinoma (grade 1 =45, g2 =6, g3 =2); clinical extension: buccal comissure=3, check =2, muscular =15, skin =7, lower and upper lip =1. Before radiotherapy, 28 biopsies and 25 excisional surgeries (19 with positive margins, 6 with negative margins) were performed. Brachytherapy was performed alone (dose 60-75 Gy BD85%) or as a boost (dose 10-30 Gy BD85%) associated with external beam (dose 46-50 Gy). MDR or LDR microselectron's afterloading was done after a computerised dosimetry (Paris System): treatment mean time = 30, 98 hours; mean volume = 10,2 cc (T1-T2 8, 61cc); Ir - 192 activity = range 0,7 - 4,792 mCi/cm; reference dose rate 45,6 - 290, 1 cGy/h. Results: 46 patients are alive without cancer, 1 died without responding, 6 died from non oncological diseases; 8 patients had recurrences (5 local, 3 nodal) but are alive. Mean follow-up 30,83 months (range 3-60m), mean DFS = 22,49 m (range 5-57m). Acute secondary effects: 30 radioepithelyties (grade 1 = 7, g2=23, g3=14), and 39 radiomucitis (g1=3; g2=23; g3=13); mean time for complete healing = 21, 66 days. Sequelae: moderate sclerosis of the skin =11, skin retraction = 1, hyperpigmentation2, depigmentation= 10, edema= 6, gingivitis= 7. Aesthetical results: good32; moderate= 18; bad= 2, very bad= 1 (uncontrolled tumor). Conclusions: The sequelae and aesthetical results are closely dependent on the treated volume and the dose rate, less dependent on the total dose, and independent on the Iridium activity. Complete healing time does not influence the late aesthetical results

  12. The relationship between social support, treatment interruption and treatment outcome in patients with multidrug-resistant tuberculosis in China: a mixed-methods study.

    Science.gov (United States)

    Yin, Jia; Wang, Xiaomeng; Zhou, Lin; Wei, Xiaolin

    2018-04-24

    Multidrug-resistant tuberculosis (MDR-TB) has been a major threat for successful TB control. We examined the relationship between social support and treatment outcomes in MDR-TB patients and evaluated barriers to social support. Retrospective cohort study with MDR-TB patients enrolled in the Global Fund program between 1 January 2009 and 30 June 2014 in Zhejiang, China. We reviewed all MDR-TB patients' diagnoses and treatment outcomes. In-depth interviews were conducted with 10 community health workers and 10 patients. Pathway analysis was employed to examine the association between social support and treatment outcomes, and the mediating effect of medication adherence on their relationship. Of 218 participants, 144 (66%) were successfully treated and 59 (27%) had poor treatment adherence. Directly observed therapy (DOT) had an indirect positive effect on treatment success, mediating through medication adherence (β.=0.541, p=0.008; β =0.538, p<0.001). Financial support had both a direct (β.=0.769, p<0.001) and an indirect positive effect on treatment success, which was mediated by a self-reported social support scale (β.=0.541, p=0.008; β =0.538, p<0.001). The interviews indicated poor performance of DOT. Patients often suffered from substantial stigma, but were not provided with psychological support. DOT and financial support were effective strategies for improving successful treatment outcomes in MDR-TB patients, but they were delivered not considering patients' perspectives. There is an urgent need for consistent and specific psychological support for MDR-TB patients in their communities. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  13. Diagnosis and interim treatment outcomes from the first cohort of multidrug-resistant tuberculosis patients in Tanzania.

    Directory of Open Access Journals (Sweden)

    Stellah G Mpagama

    Full Text Available Kibong'oto National Tuberculosis Hospital (KNTH, Kilimanjaro, Tanzania.Characterize the diagnostic process and interim treatment outcomes from patients treated for multidrug-resistant tuberculosis (MDR-TB in Tanzania.A retrospective cohort study was performed among all patients treated at KNTH for pulmonary MDR-TB between November 2009 and September 2011.Sixty-one culture-positive MDR-TB patients initiated therapy, 60 (98% with a prior history of TB treatment. Forty-one (67% were male and 9 (14% were HIV infected with a mean CD4 count of 424 (±106 cells/µl. The median time from specimen collection to MDR-TB diagnosis and from diagnosis to initiation of MDR-TB treatment was 138 days (IQR 101-159 and 131 days (IQR 32-233, respectively. Following treatment initiation four (7% patients died (all HIV negative, 3 (5% defaulted, and the remaining 54 (89% completed the intensive phase. Most adverse drug reactions were mild to moderate and did not require discontinuation of treatment. Median time to culture conversion was 2 months (IQR 1-3 and did not vary by HIV status. In 28 isolates available for additional second-line drug susceptibility testing, fluoroquinolone, aminoglycoside and para-aminosalicylic acid resistance was rare yet ethionamide resistance was present in 9 (32%.The majority of MDR-TB patients from this cohort had survived a prolonged referral process, had multiple episodes of prior TB treatment, but did not have advanced AIDS and converted to culture negative early while completing an intensive inpatient regimen without serious adverse event. Further study is required to determine the clinical impact of second-line drug susceptibility testing and the feasibility of alternatives to prolonged hospitalization.

  14. Direct costs of managing adverse drug reactions during rifampicin-resistant tuberculosis treatment in South Africa.

    Science.gov (United States)

    Schnippel, K; Firnhaber, C; Berhanu, R; Page-Shipp, L; Sinanovic, E

    2018-04-01

    To estimate the provider costs of managing adverse drug reactions (ADRs) to standard long-course treatment for multidrug- and rifampicin-resistant tuberculosis (MDR/RR-TB) according to South African guidelines. We parameterised a published Markov health state model for MDR/RR-TB with guidelines-based, bottom-up public-sector provider costing of ADR management. Frequency of ADR occurrence was extracted from the literature. Costs were estimated over 10 years, discounted 3% annually and tested using probabilistic sensitivity analysis. On average, guidelines-based costing of moderate ADRs weighted by the frequency of occurrence was US$135.76 (standard deviation [SD] US$17.18) and the cost of serious ADRs was US$521.29 (SD US$55.99). We estimated that the incremental costs of ADR management were US$380.17 annually per patient initiating MDR/RR-TB treatment. The incremental costs of ADR management for the public health sector in South Africa was US$4.76 million, 8.3% of the estimated cohort costs of MDR/RR-TB treatment ($57.55 million) for the 2015 cohort of 12 527 patients. Management of multiple ADRs and serious ADRs, which are common during the first 6 months of standard, long-course MDR/RR-TB treatment, substantially increases provider treatment costs. These results need to be taken into account when comparing regimen costs, and highlight the urgent need to identify drug regimens with improved safety profiles.

  15. [Application of TB type thermal balloon endometrial ablation for the treatment of abnormal uterine bleeding].

    Science.gov (United States)

    Wang, W; Zhai, Y; Zhang, Z H; Li, Y; Zhang, Z Y

    2016-11-08

    Objective: To investigate the clinical efficacy, safety and promotion value of TB type thermal balloon endometrial ablation in the treatment of abnormal uterine bleeding. Methods: Fourty three patients who had received TB type endometrial ablation system for treatment of abnormal uterine bleeding from January, 2015 to January, 2016 in theDepartment of gynecology, Beijing Chaoyang Hospital were enrolled in this study. The intra-operative and post-operative complications and improvement of abnormal uterine bleeding and dysmenorrhea were observed. Results: There were nointra-operative complication occurred, such as uterine perforation, massive hemorrhage or surrounding organ damage. At 6 months after operation, 32 patients developed amenorrhea, 6 developed menstrual spotting, 3 developed menstruation with a small volume and 1 had a normal menstruation. No menstruation with an increased volume occurred. The occurrence of amenorrhea was 76.19% and the response rate was 97.62%.At 6 months after operation, 1 case had no response, 2 cases had partial response and 11 cases had complete response among the 14 cases of pre-operative dysmenorrhea; only 3 cases still had anemia among the 23 cases of pre-operative anemia. Compared with before treatment, patients with dysmenorrhea and anemia both significantly reduced with a statistically significant difference( P abnormal uterine bleeding, which could have clinical promotion practice.

  16. Healthcare Resource Uses and Out-of-Pocket Expenses Associated with Pulmonary TB Treatment in Thailand.

    Science.gov (United States)

    Tanvejsilp, Pimwara; Loeb, Mark; Dushoff, Jonathan; Xie, Feng

    2017-08-22

    In Thailand, pharmaceutical care has been recently introduced to a tertiary hospital as an approach to improve adherence to tuberculosis (TB) treatment in addition to home visit and modified directly observed therapy (DOT). However, the economic impact of pharmaceutical care is not known. The aim of this study was to estimate healthcare resource uses and costs associated with pharmaceutical care compared with home visit and modified DOT in pulmonary TB patients in Thailand from a healthcare sector perspective inclusive of out-of-pocket expenditures. We conducted a retrospective study using data abstracted from the hospital billing database associated with pulmonary TB patients who began treatment between 2010 and 2013 in three hospitals in Thailand. We used generalized linear models to compare the costs by accounting for baseline characteristics. All costs were converted to international dollars (Intl$) RESULTS: The mean direct healthcare costs to the public payer were $519.96 (95%confidence interval [CI] 437.31-625.58) associated with pharmaceutical care, $1020.39 (95% CI 911.13-1154.11) for home visit, and $887.79 (95% CI 824.28-955.91) for modified DOT. The mean costs to patients were $175.45 (95% CI 130.26-230.48) for those receiving pharmaceutical care, $53.77 (95% CI 33.25-79.44) for home visit, and $49.33 (95% CI 34.03-69.30) for modified DOT. After adjustment for baseline characteristics, pharmaceutical care was associated with lower total direct costs compared with home visit (-$354.95; 95% CI -285.67 to -424.23) and modified DOT (-$264.61; 95% CI -198.76 to -330.46). After adjustment for baseline characteristics, pharmaceutical care was associated with lower direct costs compared with home visit and modified DOT.

  17. Impact of drug resistance on the tuberculosis treatment outcome

    Directory of Open Access Journals (Sweden)

    E. Lesnic

    2017-03-01

    Full Text Available Background. The standard treatment of a new case of multidrug-resistant tuberculosis (MDR-TB according to WHO recommendations in the Republic of Moldova is performed since 2005 showing a low treatment succes. Actually the treatment success rate increased due to excluding of MDR-TB patients from the general cohort. The major rate of patients with low outcome is represented by the failed and lost to follow-up cases. The purpose of the study was to assess the impact of multidrug-resiatnce and MDR-TB on the tuberculosis treatment outcome. Materials and methods. A retrospective selective, descriptive study targeting social, demographic, economic and epidemiological peculiarities, case-management, diagnostic radiological aspects and microbiological characteristics of 187 patients with pulmonary tuberculosis registered during 2013–2015 distributed in two groups: 1st group (61 patients with established multidrug-resistant strains using conventional cultural methods and the 2nd group (126 patients with MDR-TB. Results. Multidrug-resistance was established more frequently in new cases and MDR-TB in two thirds of retreated patients. No difference was identified in gender and age distribution, social, economical, educational characteristics; case-management assessment identified a similar proportion of patients revealed by general practitioners and specialists, with low rate of screened high risk groups. All patients from the multidrug-resistant group began the standard treatment for drug-responsiveness tuberculosis before drug susceptibility testing and one third of MDR-TB group was treated from the onset with the DOTS-Plus regimen. Highest success rate was identified in the new-case subgroups of both groups and higher rate of died patients was determined in the retreated subgroups. Such a low rate of patients aggrevates the resistance. Conclusions. Early diagnosis, drug responsiveness testing and raising awareness among about treatment compliance will

  18. TB Terms

    Science.gov (United States)

    ... sputum can also be used to do a culture. TB blood test – a test that uses a blood sample to find out if you are infected with TB bacteria. The test measures the response to TB proteins when they are mixed with a small amount of blood. Examples of these TB blood tests include QuantiFERON ® -TB ...

  19. Social franchising of TB care through private GPs in Myanmar: an assessment of treatment results, access, equity and financial protection.

    Science.gov (United States)

    Lönnroth, Knut; Aung, Tin; Maung, Win; Kluge, Hans; Uplekar, Mukund

    2007-05-01

    This article assesses whether social franchising of tuberculosis (TB) services in Myanmar has succeeded in providing quality treatment while ensuring equity in access and financial protection for poor patients. Newly diagnosed TB patients receiving treatment from private general practitioners (GPs) belonging to the franchise were identified. They were interviewed about social conditions, health seeking and health care costs at the time of starting treatment and again after 6 months follow-up. Routine data were used to ascertain clinical outcomes as well as to monitor trends in case notification. The franchisees contributed 2097 (21%) of the total 9951 total new sputum smear-positive pulmonary cases notified to the national TB programme in the study townships. The treatment success rate for new smear-positive cases was 84%, close to the World Health Organization target of 85% and similar to the treatment success of 81% in the national TB programme in Myanmar. People from the lower socio-economic groups represented 68% of the TB patients who access care in the franchise. Financial burden related to direct and indirect health care costs for tuberculosis was high, especially among the poor. Patients belonging to lower socio-economic groups incurred on average costs equivalent to 68% of annual per capita household income, with a median of 28%. However, 83% of all costs were incurred before starting treatment in the franchise, while 'shopping' for care. During treatment in the franchise, the cost of care was relatively low, corresponding to a median proportion of annual per capita income of 3% for people from lower socio-economic groups. This study shows that highly subsidized TB care delivered through a social franchise scheme in the private sector in Myanmar helped reach the poor with quality services, while partly protecting them from high health care expenditure. Extended outreach to others parts of the private sector may reduce diagnostic delay and patient costs

  20. Abandono do tratamento de tuberculose em co-infectados TB/HIV Abandono del tratamiento de la tuberculosis en coinfectados TB/HIV Abandonment of tuberculosis treatment among patinets co-infected with TB/HIV

    Directory of Open Access Journals (Sweden)

    Ivaneide Leal Ataide Rodrigues

    2010-06-01

    ísica, organización del proceso de trabajo y acceso mostraron relevancia para la no adhesión. Los resultados apuntan a la necesidad de alterar las prácticas desarrolladas en los Servicios.This study aimed at analyzing the reasons that patients co-infected with tuberculosis and HIV leave the treatment of tuberculosis and to know the conduct of the health team toward that abandonment. The study, using a qualitative approach, performed semi-structured interviews on 45 professionals working at a referral health center in Pará state. Two units emerged based on the thematic analysis: patient-associated factors that make TB treatment adherence difficult; and service-associated factors that contribute to treatment abandonment. It was found that, in terms of the patients, that their low socioeconomic condition was the most common factor that led to abandonment. Other factors that led to this outcome included the adverse drug effects, the use of illegal drugs, and poor personal motivation. Regarding the service, issues related to the physical structure, working process organization and accessibility were also relevant to their non-adherence. Results show there is a need to change the practices performed at the health care services.

  1. Tuberculosis Treatment Adherence of Patients in Kosovo

    Directory of Open Access Journals (Sweden)

    Shaip Krasniqi

    2017-01-01

    Full Text Available Setting. The poor patient adherence in tuberculosis (TB treatment is considered to be one of the most serious challenges which reflect the decrease of treatment success and emerging of the Multidrug Resistance-TB (MDR-TB. To our knowledge, the data about patients’ adherence to anti-TB treatment in our country are missing. Objective. This study was aimed to investigate the anti-TB treatment adherence rate and to identify factors related to eventual nonadherence among Kosovo TB patients. Design. This study was conducted during 12 months, and the survey was a descriptive study using the standardized questionnaires with total 324 patients. Results. The overall nonadherence for TB patient cohort was 14.5%, 95% CI (0.109–0.188. Age and place of residence are shown to have an effect on treatment adherence. Moreover, the knowledge of the treatment prognosis, daily dosage, side effects, and length of treatment also play a role. This was also reflected in knowledge regarding compliance with regular administration of TB drugs, satisfaction with the treatment, interruption of TB therapy, and the professional monitoring in the administration of TB drugs. Conclusion. The level of nonadherence TB treatment in Kosovar patients is not satisfying, and more health care worker’s commitments need to be addressed for improvement.

  2. Tuberculosis Treatment Adherence of Patients in Kosovo.

    Science.gov (United States)

    Krasniqi, Shaip; Jakupi, Arianit; Daci, Armond; Tigani, Bahri; Jupolli-Krasniqi, Nora; Pira, Mimoza; Zhjeqi, Valbona; Neziri, Burim

    2017-01-01

    The poor patient adherence in tuberculosis (TB) treatment is considered to be one of the most serious challenges which reflect the decrease of treatment success and emerging of the Multidrug Resistance-TB (MDR-TB). To our knowledge, the data about patients' adherence to anti-TB treatment in our country are missing. This study was aimed to investigate the anti-TB treatment adherence rate and to identify factors related to eventual nonadherence among Kosovo TB patients. This study was conducted during 12 months, and the survey was a descriptive study using the standardized questionnaires with total 324 patients. The overall nonadherence for TB patient cohort was 14.5%, 95% CI (0.109-0.188). Age and place of residence are shown to have an effect on treatment adherence. Moreover, the knowledge of the treatment prognosis, daily dosage, side effects, and length of treatment also play a role. This was also reflected in knowledge regarding compliance with regular administration of TB drugs, satisfaction with the treatment, interruption of TB therapy, and the professional monitoring in the administration of TB drugs. The level of nonadherence TB treatment in Kosovar patients is not satisfying, and more health care worker's commitments need to be addressed for improvement.

  3. Impact of rapid molecular diagnostic tests on time to treatment initiation and outcomes in patients with multidrug-resistant tuberculosis, Tamil Nadu, India.

    Science.gov (United States)

    Nair, Dina; Navneethapandian, Pooranaganga D; Tripathy, Jaya Prasad; Harries, Anthony D; Klinton, Joel S; Watson, Basilea; Sivaramakrishnan, Gomathi N; Reddy, Devarajulu S; Murali, Lakshmi; Natrajan, Mohan; Swaminathan, Soumya

    2016-09-01

    India is replacing culture and drug sensitivity testing (CDST) with rapid molecular tests for diagnosing MDR-TB. We assessed the impact of rapid tests on time to initiation of treatment and outcomes in patients with MDR-TB compared with CDST. A retrospective cohort study involving MDR-TB patients from six districts in Tamil Nadu state, who underwent CDST (2010-2011) and rapid tests (2012-2013). There were 135 patients in the CDST group and 389 in the rapid diagnostic test group. Median time from sputum receipt at the laboratory to initiation of MDR-TB treatment was 130 days (IQR 75-213) in the CDST group and 22 days (IQR 14-38) in the rapid diagnostic test group (p30% in both groups and missing data were higher in CDST (13%) compared with rapid tests (3%). There were significantly higher risks of unfavourable treatment outcomes in males (aRR 1.3, 95% CI 1.1-1.5) and those with treatment initiation delays >30 days (aRR 1.3, 95% CI 1.0-1.6). Rapid molecular diagnostic tests shortened the time to initiate treatment which was associated with reduced unfavourable outcomes in MDR-TB patients. This supports the policy to scale up these tests in India. © The Author 2016. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Risk factors and mortality associated with default from multidrug-resistant tuberculosis treatment.

    Science.gov (United States)

    Franke, Molly F; Appleton, Sasha C; Bayona, Jaime; Arteaga, Fernando; Palacios, Eda; Llaro, Karim; Shin, Sonya S; Becerra, Mercedes C; Murray, Megan B; Mitnick, Carole D

    2008-06-15

    Completing treatment for multidrug-resistant (MDR) tuberculosis (TB) may be more challenging than completing first-line TB therapy, especially in resource-poor settings. The objectives of this study were to (1) identify risk factors for default from MDR TB therapy (defined as prolonged treatment interruption), (2) quantify mortality among patients who default from treatment, and (3) identify risk factors for death after default from treatment. We performed a retrospective chart review to identify risk factors for default from MDR TB therapy and conducted home visits to assess mortality among patients who defaulted from such therapy. Sixty-seven (10.0%) of 671 patients defaulted from MDR TB therapy. The median time to treatment default was 438 days (interquartile range, 152-710 days), and 27 (40.3%) of the 67 patients who defaulted from treatment had culture-positive sputum at the time of default. Substance use (hazard ratio, 2.96; 95% confidence interval, 1.56-5.62; P = .001), substandard housing conditions (hazard ratio, 1.83; 95% confidence interval, 1.07-3.11; P = .03), later year of enrollment (hazard ratio, 1.62, 95% confidence interval, 1.09-2.41; P = .02), and health district (P = .02) predicted default from therapy in a multivariable analysis. Severe adverse events did not predict default from therapy. Forty-seven (70.1%) of 67 patients who defaulted from therapy were successfully traced; of these, 25 (53.2%) had died. Poor bacteriologic response, default, low education level, and diagnosis with a psychiatric disorder significantly predicted death after default in a multivariable analysis. The proportion of patients who defaulted from MDR TB treatment was relatively low. The large proportion of patients who had culture-positive sputum at the time of treatment default underscores the public health importance of minimizing treatment default. Prognosis for patients who defaulted from therapy was poor. Interventions aimed at preventing treatment default may

  5. Convergence of a diabetes mellitus, protein energy malnutrition, and TB epidemic: the neglected elderly population.

    Science.gov (United States)

    Menon, Sonia; Rossi, Rodolfo; Nshimyumukiza, Leon; Wusiman, Aibibula; Zdraveska, Natasha; Eldin, Manal Shams

    2016-07-26

    On a global scale, nearly two billion persons are infected with Mycobacterium tuberculosis. From this vast reservoir of latent tuberculosis (TB) infection, a substantial number will develop active TB during their lifetime, with some being able to transmit TB or Multi-drug- resistant (MDR) TB to others. There is clinical evidence pointing to a higher prevalence of infectious diseases including TB among individuals with Diabetes Mellitus (DM). Furthermore, ageing and diabetes mellitus may further aggravate protein-energy malnutrition (PEM), which in turn impairs T-lymphocyte mediated immunologic defenses, thereby increasing the risk of developing active TB and compromising TB treatment. This article aims to a) highlight synergistic mechanisms associated with immunosenescence, DM and PEM in relation to the development of active TB and b) identify nutritional, clinical and epidemiological research gaps. To explore the synergistic relationship between ageing, DM, tuberculosis and PEM, a comprehensive review was undertaken. The MEDLINE and the Google Scholar databases were searched for articles published from 1990 to March 2015, using different MESH keywords in various combinations. Ageing and DM act synergistically to reduce levels of interferon gamma (IFN- γ), thereby increasing susceptibility to TB, for which cell mediated immunity (CMI) plays an instrumental role. These processes can set in motion a vicious nutritional cycle which can predispose to PEM, further impairing the CMI and consequently limiting host defenses. This ultimately transforms the latent TB infection into active disease. A clinical diagnostic algorithm and clinical guidelines need to be established for this population. Given the increase in ageing population with DM and PEM, especially in resource-poor settings, these synergistic tripartite interactions must be examined if a burgeoning TB epidemic is to be averted. Implementation of a comprehensive, all-encompassing approach to curb transmission

  6. Challenges of using new and repurposed drugs for the treatment of multidrug-resistant tuberculosis in children.

    Science.gov (United States)

    Schaaf, H Simon; Garcia-Prats, Anthony J; McKenna, Lindsay; Seddon, James A

    2018-03-01

    New and repurposed antituberculosis drugs are urgently needed to more safely and effectively treat multidrug-resistant (MDR) tuberculosis (TB) in children. Multiple challenges limit timely access to new MDR-TB treatments in children. Areas covered: Diagnosis of MDR-TB in children remains a barrier, with few children with MDR-TB diagnosed and treated. Other barriers to timely access to new and repurposed drugs are discussed, and include delayed initiation of paediatric trials, limited funding for paediatric drug development, fragmented regulatory systems and operational challenges. The status of access to current repurposed and novel drugs is presented. Expert commentary: More timely initiation of paediatric trials is needed and paediatric work should happen and be funded in parallel with each phase of adult trials. Better quality data, increased regulator resources and expertise, harmonization of regulatory requirements across borders/organisations and registration fee waivers would improve registration timelines. Improved diagnosis, recording and reporting will establish better demand. Improved systems for procurement and supply chain management would reduce in-country operational barriers to getting medications to children. The challenges must be addressed to ensure timely and equitable access to new drugs and regimens that are urgently needed for effective, safe and shorter treatment of children with MDR-TB.

  7. Pulmonary resection can improve treatment outcome in re-treatment pulmonary tuberculosis and its complications

    Directory of Open Access Journals (Sweden)

    Ali Rifaat

    2014-04-01

    Conclusions: Surgery is effective when medical therapy fails to control pulmonary TB and its complications. MDR-TB patients are among those who benefit from pulmonary resection. Postoperative medical therapy is important to improve results and in achieving negative sputum conversion in TB patients including MDR-TB patients.

  8. Addressing challenges in scaling up TB and HIV treatment integration in rural primary healthcare clinics in South Africa (SUTHI): a cluster randomized controlled trial protocol.

    Science.gov (United States)

    Naidoo, Kogieleum; Gengiah, Santhanalakshmi; Yende-Zuma, Nonhlanhla; Padayatchi, Nesri; Barker, Pierre; Nunn, Andrew; Subrayen, Priashni; Abdool Karim, Salim S

    2017-11-13

    A large and compelling clinical evidence base has shown that integrated TB and HIV services leads to reduction in human immunodeficiency virus (HIV)- and tuberculosis (TB)-associated mortality and morbidity. Despite official policies and guidelines recommending TB and HIV care integration, its poor implementation has resulted in TB and HIV remaining the commonest causes of death in several countries in sub-Saharan Africa, including South Africa. This study aims to reduce mortality due to TB-HIV co-infection through a quality improvement strategy for scaling up of TB and HIV treatment integration in rural primary healthcare clinics in South Africa. The study is designed as an open-label cluster randomized controlled trial. Sixteen clinic supervisors who oversee 40 primary health care (PHC) clinics in two rural districts of KwaZulu-Natal, South Africa will be randomized to either the control group (provision of standard government guidance for TB-HIV integration) or the intervention group (provision of standard government guidance with active enhancement of TB-HIV care integration through a quality improvement approach). The primary outcome is all-cause mortality among TB-HIV patients. Secondary outcomes include time to antiretroviral therapy (ART) initiation among TB-HIV co-infected patients, as well as TB and HIV treatment outcomes at 12 months. In addition, factors that may affect the intervention, such as conditions in the clinic and staff availability, will be closely monitored and documented. This study has the potential to address the gap between the establishment of TB-HIV care integration policies and guidelines and their implementation in the provision of integrated care in PHC clinics. If successful, an evidence-based intervention comprising change ideas, tools, and approaches for quality improvement could inform the future rapid scale up, implementation, and sustainability of improved TB-HIV integration across sub-Sahara Africa and other resource

  9. Experience with LDR and MDR brachytherapy for cervical cancer

    International Nuclear Information System (INIS)

    Okawa, Tomohiko; Okawa, Midori-Kita; Kaneyasu, Yuko; Karasawa, Kumiko; Fukuhara, Noboru

    1996-01-01

    As the brachytherapy dose-rate increases, it is necessary to reduce the total dose or to increase the fraction number with reducing the fraction dose in order not to increase the incidence of the late effect. With the introduction to the Tokyo Women's Medical College, Hospital of a remote afterloading system of Selectron - MDR, delivering dose-rate to point A became approximately twice of that with our classical cesium LDR manual afterloading technique. Material and Methods: Between 1987 to 1993 a total of, previously untreated 74 patients with cervical cancer received MDR brachytherapy using a Selection - MDR. This analysis is therefore of those patients series who underwent radical radioradiotherapy with MDR, 1987-1993, in comparison with the 347 cases who were treated with classical manual LDR afterloading machine, 1969-1986. The treatment was a brachytherapy during external radiotherapy and dos-rate at point A was 160-180 cGy/hour with MDR and 80-90 cGy/hour with LDR. The mean fraction dose was 800-1000 cGy by MDR and 1000-1200 cGy by LDR and fraction number was increased 1-2times in the MDR group with no change of a total dose at point A. Results: The mean age was 63.3 years in the MDR group and 60.2 in the LDR group. In the MDR group, 4 patients were at stage I, 16 stage II, 32 stage III, and 22 stage IV. In the LDR group, 32 were at stage I, 83 stage II, 183 stage III, and 49 stage IV. The medical rate was not significantly different between two groups. The tumor response by manual examination one month after radiotherapy showed no significant difference. The 5-year survival rate for the MDR and LDR groups were 100% : 78% at stage I, 61% : 71% at stage II and 52% : 53% at stage III, with no significant differences. Late complications by severity with grade II-III according to Kottureire's classification were not significantly different in the rectum or bladder. These results suggested that MDR brachytherapy was useful for the patients' QOL as it reduced the

  10. Pathways to multidrug-resistant tuberculosis diagnosis and treatment initiation: a qualitative comparison of patients' experiences in the era of rapid molecular diagnostic tests.

    Science.gov (United States)

    Naidoo, Pren; van Niekerk, Margaret; du Toit, Elizabeth; Beyers, Nulda; Leon, Natalie

    2015-10-28

    Although new molecular diagnostic tests such as GenoType MTBDRplus and Xpert® MTB/RIF have reduced multidrug-resistant tuberculosis (MDR-TB) treatment initiation times, patients' experiences of diagnosis and treatment initiation are not known. This study aimed to explore and compare MDR-TB patients' experiences of their diagnostic and treatment initiation pathway in GenoType MTBDRplus and Xpert® MTB/RIF-based diagnostic algorithms. The study was undertaken in Cape Town, South Africa where primary health-care services provided free TB diagnosis and treatment. A smear, culture and GenoType MTBDRplus diagnostic algorithm was used in 2010, with Xpert® MTB/RIF phased in from 2011-2013. Participants diagnosed in each algorithm at four facilities were purposively sampled, stratifying by age, gender and MDR-TB risk profiles. We conducted in-depth qualitative interviews using a semi-structured interview guide. Through constant comparative analysis we induced common and divergent themes related to symptom recognition, health-care access, testing for MDR-TB and treatment initiation within and between groups. Data were triangulated with clinical information and health visit data from a structured questionnaire. We identified both enablers and barriers to early MDR-TB diagnosis and treatment. Half the patients had previously been treated for TB; most recognised recurring symptoms and reported early health-seeking. Those who attributed symptoms to other causes delayed health-seeking. Perceptions of poor public sector services were prevalent and may have contributed both to deferred health-seeking and to patient's use of the private sector, contributing to delays. However, once on treatment, most patients expressed satisfaction with public sector care. Two patients in the Xpert® MTB/RIF-based algorithm exemplified its potential to reduce delays, commencing MDR-TB treatment within a week of their first health contact. However, most patients in both algorithms experienced

  11. Implementing the global plan to stop TB, 2011-2015--optimizing allocations and the Global Fund's contribution: a scenario projections study.

    Directory of Open Access Journals (Sweden)

    Eline L Korenromp

    Full Text Available BACKGROUND: The Global Plan to Stop TB estimates funding required in low- and middle-income countries to achieve TB control targets set by the Stop TB Partnership within the context of the Millennium Development Goals. We estimate the contribution and impact of Global Fund investments under various scenarios of allocations across interventions and regions. METHODOLOGY/PRINCIPAL FINDINGS: Using Global Plan assumptions on expected cases and mortality, we estimate treatment costs and mortality impact for diagnosis and treatment for drug-sensitive and multidrug-resistant TB (MDR-TB, including antiretroviral treatment (ART during DOTS for HIV-co-infected patients, for four country groups, overall and for the Global Fund investments. In 2015, China and India account for 24% of funding need, Eastern Europe and Central Asia (EECA for 33%, sub-Saharan Africa (SSA for 20%, and other low- and middle-income countries for 24%. Scale-up of MDR-TB treatment, especially in EECA, drives an increasing global TB funding need--an essential investment to contain the mortality burden associated with MDR-TB and future disease costs. Funding needs rise fastest in SSA, reflecting increasing coverage need of improved TB/HIV management, which saves most lives per dollar spent in the short term. The Global Fund is expected to finance 8-12% of Global Plan implementation costs annually. Lives saved through Global Fund TB support within the available funding envelope could increase 37% if allocations shifted from current regional demand patterns to a prioritized scale-up of improved TB/HIV treatment and secondly DOTS, both mainly in Africa--with EECA region, which has disproportionately high per-patient costs, funded from alternative resources. CONCLUSIONS/SIGNIFICANCE: These findings, alongside country funding gaps, domestic funding and implementation capacity and equity considerations, should inform strategies and policies for international donors, national governments and

  12. Silencage du gene MDR1 et resensibilisation des cellules MCF-7 MDR a la doxorubicine en utilisant les nanoparticules chitosane/MDR1-siARN

    Science.gov (United States)

    El-Ariss, Mohamad

    Cancer is the leading cause of death in Canada and is responsible for about 30% of all deaths in the country.[1] It is estimated that by 2015, one in four Canadians (24% women and 29% men) will die from cancer. In the world and only for 2012, 14 million new cancer cases and 8.2 million deaths from the disease were reported.[2] The worst is yet to come because, according to World Health Organization, the number of new cases is expected to increase by about 70% over the next two decades. The high mortality associated with cancer is partly explained by the acquisition of drug resistance that make patients refractory to chemotherapy. In fact, cancer cells exposed to a cytotoxic agent during chemotherapy, may develop a resistance to this agent as well as various agents sharing structural or functional similarities. These cancer cells are known for multidrug resistance ("Multiple Drug resistant cells"). The development of resistance to chimiodrogues is a major public health problem that presents an obstacle for the development of new cancer treatments. MCF-7 MDR are established cell lines of human breast cancer that have developed resistance to chimiodrogues such as doxorubicin. MCF-7 MDR have the particularity to over-express P-gp protein that is responsible for the detoxification of cells by reflux of chimiodrogues. The purpose of this study was therefore to reduce the expression of P-gp, encoded by the MDR1 gene (also called gene ABCB1) in cancer cells MCF-7, and re-sensitize MCF-7 MDR cells to anti-cancer treatments. In order to modify MDR1 gene expression, we used small RNAi called siRNA that are specific to the MDR1 gene. In total, 4 duplexes of siRNA have been used: siRNA_1, siRNA_1M, siRNA_2 and siRNA_2M. Each of the duplexes strands is consists of 21 nucleic acids and has two protruding nucleic acids (overhangs) at the 3' end. siRNA_1 and siRNA_1M are complementary to the nucleic acid sequence (577-595 nucleic acids ) of the MDR1 gene, whereas siARN_2 and si

  13. CD4 cell levels during treatment for tuberculosis (TB in Ethiopian adults and clinical markers associated with CD4 lymphocytopenia.

    Directory of Open Access Journals (Sweden)

    Sten Skogmar

    Full Text Available BACKGROUND: The clinical correlations and significance of subnormal CD4 levels in HIV-negative patients with TB are unclear. We have determined CD4 cell levels longitudinally during anti-tuberculosis treatment (ATT in patients, with and without HIV co-infection, and their associations with clinical variables. METHOD: Adults diagnosed with TB (maximum duration of ATT for 2 weeks, and with no history of antiretroviral therapy (ART in HIV-positive subjects were included consecutively in eight out-patient clinics in Ethiopia. Healthy individuals were recruited for comparison at one of the study health centers. Data on patient characteristics and physical findings were collected by trained nurses following a structured questionnaire at inclusion and on follow-up visits at 2 and 6 months. In parallel, peripheral blood CD4 cell levels were determined. The evolution of CD4 cell levels during ATT was assessed, and the association between clinical characteristics and low CD4 cell levels at baseline was investigated using regression analysis. RESULTS: In total, 1116 TB patients were included (307 HIV-infected. Among 809 HIV-negative patients, 200 (25% had subnormal CD4 cell counts (<500 cells/mm(3, with <350 cells/mm(3 in 82 (10% individuals. CD4 cell levels increased significantly during the course of ATT in both HIV+ and HIV- TB-patients, but did not reach the levels in healthy subjects (median 896 cells/mm(3. Sputum smear status, signs of wasting (low mid upper arm circumference (MUAC, and bedridden state were significantly associated with low CD4 cell counts. CONCLUSION: A high proportion of Ethiopian TB patients have subnormal CD4 cell counts before starting treatment. Low CD4 cell levels are associated with smear positive disease and signs of wasting. The continuous increase of CD4 cell counts during the course of ATT suggest a reversible impact of active TB on CD4 cell homeostasis, which may be considered in interpretation of CD4 cell counts in HIV/TB

  14. Therapeutic drug monitoring: how to improve drug dosage and patient safety in tuberculosis treatment

    Directory of Open Access Journals (Sweden)

    Giovanni Sotgiu

    2015-03-01

    Full Text Available In this article we describe the key role of tuberculosis (TB treatment, the challenges (mainly the emergence of drug resistance, and the opportunities represented by the correct approach to drug dosage, based on the existing control and elimination strategies. In this context, the role and contribution of therapeutic drug monitoring (TDM is discussed in detail. Treatment success in multidrug-resistant (MDR TB cases is low (62%, with 7% failing or relapsing and 9% dying and in extensively drug-resistant (XDR TB cases is even lower (40%, with 22% failing or relapsing and 15% dying. The treatment of drug-resistant TB is also more expensive (exceeding €50 000 for MDR-TB and €160 000 for XDR-TB and more toxic if compared to that prescribed for drug-susceptible TB. Appropriate dosing of first- and second-line anti-TB drugs can improve the patient's prognosis and lower treatment costs. TDM is based on the measurement of drug concentrations in blood samples collected at appropriate times and subsequent dose adjustment according to the target concentration. The ‘dried blood spot’ technique offers additional advantages, providing the rationale for discussions regarding a possible future network of selected, quality-controlled reference laboratories for the processing of dried blood spots of difficult-to-treat patients from reference TB clinics around the world.

  15. Survey on medicinal plants traditionally used in Senegal for the treatment of tuberculosis (TB) and assessment of their antimycobacterial activity.

    Science.gov (United States)

    Diop, ElHadji Assane; Queiroz, Emerson Ferreira; Kicka, Sébastien; Rudaz, Serge; Diop, Tahir; Soldati, Thierry; Wolfender, Jean-Luc

    2018-04-24

    In West Africa, populations are used to taking traditional medicine as a first aid against common health problems. In this aspect, many plants are claimed to be effective in the treatment of Tuberculosis (TB), which according to the World Health Organization (WHO) remains one of the world's deadliest communicable diseases. The main aim of this study was to identify plants used to treat TB-symptoms by the population of Senegal and to evaluate their possible concomitant use with clinically approved TB-drugs. This approach allowed the selection of plants effectively used in traditional medicine. In order to verify if the usage of some of these plants can be rationalized, the activity of their traditional preparations was assessed with both an intracellular and extracellular antimycobacterial host-pathogen assays. An ethnopharmacological survey conducted on 117 TB-patients and 30 healers in Senegal from March to May 2014. The questionnaires were focused on the use of medicinal plants to treat common TB -symptoms (cough longer than 2 weeks, fever, night sweats, weight loss and bloody sputum). Local plant names, utilized organs (herbal drugs) and traditional formulations of the plants were recorded. Extracts were prepared by mimicking the traditional decoction in boiling water and screened for their antimycobacterial activity using Mycobacterium marinum, as a validated TB surrogate, and an Acanthamoeba castellanii - M. marinum whole-cell based host-pathogen assay, to detect anti-infective activities. By the end of the survey, nearly 30 plants were cited and the 12 most cited herbal drugs were collected and their usage documented by extensive literature search. Extracts of the chosen herbs were screened with the described assays; with a main focus on traditional formulas (mainly herbal decoctions). Two of the water extracts from Combretum aculeatum and Guiera senegalensis showed significant antimycobacterial activities when compared to the positive control drug (rifampin

  16. Use of Transnational Services to Prevent Treatment Interruption in Tuberculosis-Infected Persons Who Leave the United States.

    Science.gov (United States)

    Tschampl, Cynthia A; Garnick, Deborah W; Zuroweste, Edward; Razavi, Moaven; Shepard, Donald S

    2016-03-01

    A major problem resulting from interrupted tuberculosis (TB) treatment is the development of drug-resistant TB, including multidrug-resistant TB (MDR TB), a more deadly and costly-to-treat form of the disease. Global health systems are not equipped to diagnose and treat the current burden of MDR TB. TB-infected foreign visitors and temporary US residents who leave the country during treatment can experience treatment interruption and, thus, are at greater risk for drug-resistant TB. Using epidemiologic and demographic data, we estimated TB incidence among this group, as well as the proportion of patients referred to transnational care-continuity and management services during relocation; each year, ≈2,827 visitors and temporary residents are at risk for TB treatment interruption, 222 (8%) of whom are referred for transnational services. Scale up of transnational services for persons at high risk for treatment interruption is possible and encouraged because of potential health gains and reductions in healthcare costs for the United States and receiving countries.

  17. A randomized controlled study comparing community based with health facility based direct observation of treatment models on patients' satisfaction and TB treatment outcome in Nigeria.

    Science.gov (United States)

    Adewole, Olanisun O; Oladele, T; Osunkoya, Arinola H; Erhabor, Greg E; Adewole, Temitayo O; Adeola, Oluwaseun; Obembe, Olufemi; Ota, Martin O C

    2015-12-01

    Directly observed treatment short-course (DOTS) strategy is an effective mode of treating TB. We aimed to study the cost effectiveness and patients' satisfaction with home based direct observation of treatment (DOT), an innovative approach to community-based DOT (CBDOT) and hospital based DOT (HBDOT). A randomized controlled trial involving 150 newly diagnosed pulmonary TB patients in four TB clinics in Ile Ife , Nigeria, was done. They were randomly assigned to receive treatment with anti TB drugs for the intensive phase administered at home by a TB worker (CBDOT) or at the hospital (HBDOT). Outcome measures were treatment completion/default rates, cost effectiveness and patients' satisfaction with care using a 13 item patients satisfaction questionnaire (PS-13) at 2 months. This trial was registered with pactr.org: number PACTR 201503001058381. At the end of intensive phase, 15/75 (20%) and 2/75 (3%) of patients in the HBDOT and CBDOT, respectively had defaulted from treatment, p= 0.01. Of those with pretreatment positive sputum smear, 97% (68/70) on CBDOT and 54/67 (81%) on HBDOT were sputum negative for AFB at the end of 2 months of treatment, p=0.01. The CBDOT method was associated with a higher patient satisfaction score compared with HBDOT (OR 3.1; 95% CI 1.25-7.70), p=0.001.The total cost for patients was higher in HBDOT (US$159.38) compared with the CBDOT (US$89.52). The incremental cost effectiveness ratio was US$410 per patient who completed the intensive phase treatment with CBDOT. CBDOT is a cost effective approach associated with better compliance to treatment and better patient satisfaction compared to HBDOT. © The Author 2015. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Factors associated with linkage to HIV care and TB treatment at community-based HIV testing services in Cape Town, South Africa.

    Science.gov (United States)

    Meehan, Sue-Ann; Sloot, Rosa; Draper, Heather R; Naidoo, Pren; Burger, Ronelle; Beyers, Nulda

    2018-01-01

    Diagnosing HIV and/or TB is not sufficient; linkage to care and treatment is conditional to reduce the burden of disease. This study aimed to determine factors associated with linkage to HIV care and TB treatment at community-based services in Cape Town, South Africa. This retrospective cohort study utilized routinely collected data from clients who utilized stand-alone (fixed site not attached to a health facility) and mobile HIV testing services in eight communities in the City of Cape Town Metropolitan district, between January 2008 and June 2012. Clients were included in the analysis if they were ≥12 years and had a known HIV status. Generalized estimating equations (GEE) logistic regression models were used to assess the association between determinants (sex, age, HIV testing service and co-infection status) and self-reported linkage to HIV care and/or TB treatment. Linkage to HIV care was 3 738/5 929 (63.1%). Linkage to HIV care was associated with the type of HIV testing service. Clients diagnosed with HIV at mobile services had a significantly reduced odds of linking to HIV care (aOR 0.7 (CI 95%: 0.6-0.8), p<0.001. Linkage to TB treatment was 210/275 (76.4%). Linkage to TB treatment was not associated with sex and service type, but was associated with age. Clients in older age groups were less likely to link to TB treatment compared to clients in the age group 12-24 years (all, p-value<0.05). A large proportion of clients diagnosed with HIV at mobile services did not link to care. Almost a quarter of clients diagnosed with TB did not link to treatment. Integrated community-based HIV and TB testing services are efficient in diagnosing HIV and TB, but strategies to improve linkage to care are required to control these epidemics.

  19. TB or not TB?: a case of isolated testicular TB with scrotal involvement.

    LENUS (Irish Health Repository)

    Bhargava, A

    2009-06-01

    Despite the genitourinary tract being the most common site affected by extrapulmonary TB, isolated testicular TB remains a rare clinical entity. In patients with co-morbidities such as hepatic impairment, treatment proves a challenge, as first-line hepatotoxic pharmaceuticals are contraindicated. Here, we report a case of isolated testicular TB with scrotal involvement, on a background of hepatic dysfunction.

  20. World Health Organization treatment guidelines for drug-resistant tuberculosis, 2016 update.

    Science.gov (United States)

    Falzon, Dennis; Schünemann, Holger J; Harausz, Elizabeth; González-Angulo, Licé; Lienhardt, Christian; Jaramillo, Ernesto; Weyer, Karin

    2017-03-01

    Antimicrobial resistance is a major global concern. Tuberculosis (TB) strains resistant to rifampicin and other TB medicines challenge patient survival and public health. The World Health Organization (WHO) has published treatment guidelines for drug-resistant TB since 1997 and last updated them in 2016 based on reviews of aggregated and individual patient data from published and unpublished studies. An international expert panel formulated recommendations following the GRADE approach. The new WHO guidelines recommend a standardised 9-12 months shorter treatment regimen as first choice in patients with multidrug- or rifampicin-resistant TB (MDR/RR-TB) strains not resistant to fluoroquinolones or second-line injectable agents; resistance to these two classes of core second-line medicines is rapidly detectable with molecular diagnostics also approved by WHO in 2016. The composition of longer regimens for patients ineligible for the shorter regimen was modified. A first-ever meta-analysis of individual paediatric patient data allowed treatment recommendations for childhood MDR/RR-TB to be made. Delamanid is now also recommended in patients aged 6-17 years. Partial lung resection is a recommended option in MDR/RR-TB care. The 2016 revision highlighted the continued shortage of high-quality evidence and implementation research, and reiterated the need for clinical trials and best-practice studies to improve MDR/RR-TB patient treatment outcomes and strengthen policy. The content of this work is copyright of the authors or their employers. Design and branding are copyright ©ERS 2017.

  1. A Pilot Trial of Jawarish Amla as Adjuvant to Anti-Tubercular Treatment Drugs for Control of Adverse Reactions in DOTS Regime in Pulmonary TB

    OpenAIRE

    Sherwani, Arish Mohammad Khan; Zulkifle, Mohammad; Rehmatulla,

    2013-01-01

    Background and objectives One of the greatest challenges of health care systems at the dawn of the 21st century is tuberculosis (TB). Drug resistant strains of TB are becoming a global public health risk. These strains commonly appear due to faulty therapies. Patients frequently stop treatment due to the toxicity of anti-tubercular treatment (ATT) drugs. Amla (Emblica officinalis) is a well-known Unani single drug. Jawarish amla is a Unani compound formulation which is commonly used to admini...

  2. Multidrug-resistant tuberculosis patients’ views of interventions to reduce treatment loss to follow-up

    Science.gov (United States)

    Tupasi, T.; Garfin, A. M. C. G.; Mangan, J. M.; Orillaza-Chi, R.; Naval, L. C.; Balane, G. I.; Basilio, R.; Golubkov, A.; Joson, E. S.; Lew, W-J.; Lofranco, V.; Mantala, M.; Pancho, S.; Sarol, J. N.; Blumberg, A.; Burt, D.; Kurbatova, E. V.

    2017-01-01

    SUMMARY SETTING Patients who initiated treatment for multi-drug-resistant tuberculosis (MDR-TB) at 15 Programmatic Management of Drug-resistant Tuberculosis (PMDT) health facilities in the Philippines between July and December 2012. OBJECTIVES To describe patients’ views of current interventions, and suggest changes likely to reduce MDR-TB loss to follow-up. METHODS In-depth interviews were conducted between April and July 2014 with MDR-TB patients who were undergoing treatment, had finished treatment at the time of the interview (controls), or had been lost to follow-up (LTFU). Responses were thematically analyzed. RESULTS Interviews were conducted with 182 patients who were undergoing or had completed treatment and 91 LTFU patients. Views and suggestions could be thematically categorized as approaches to facilitate adherence or address barriers to adherence. The top themes were the need for transportation assistance or improvements to the current transportation assistance program, food assistance, and difficulties patients encountered related to their medications. These themes were addressed by respectively 63%, 60%, and 32% of the participants. CONCLUSIONS A more patient-centered approach is needed to improve MDR-TB treatment adherence. Programs should strive to provide assistance that considers patient preferences, is adequate to cover actual costs or needs, and is delivered in a timely, uninterrupted manner. PMID:28157461

  3. Chronic airflow obstruction after successful treatment of multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    Anthony L. Byrne

    2017-07-01

    Full Text Available Cross-sectional studies reveal an association between tuberculosis (TB and chronic airflow obstruction, but cannot adequately address confounding. We hypothesised that treated pulmonary TB is an independent risk factor for chronic airflow obstruction. The Pulmones Post TB cohort study enrolled participants from Lima, Peru, aged 10–70 years with a history of drug-susceptible (DS- or multidrug-resistant (MDR-TB who had completed treatment and were clinically cured. Unexposed participants without TB were randomly selected from the same districts. We assessed respiratory symptoms, relevant environmental exposures, and spirometric lung function pre- and post-bronchodilator. In total, 144 participants with DS-TB, 33 with MDR-TB and 161 unexposed participants were fully evaluated. Compared with unexposed participants, MDR-TB patients had lower lung volumes (adjusted mean difference in forced vital capacity −370 mL, 95% CI −644– −97 and post-bronchodilator airflow obstruction (adjusted OR 4.89, 95% CI 1.27–18.78. Participants who had recovered from DS-TB did not have lower lung volumes than unexposed participants, but were more likely to have a reduced forced expiratory volume in 1 s/forced vital capacity ratio <0.70 (adjusted OR 2.47, 95% CI 1.01–6.03. Individuals successfully treated for TB may experience long-lasting sequelae. Interventions facilitating earlier TB treatment and management of chronic respiratory disease should be explored.

  4. Is Chemoprophylaxis for Child Contacts of Drug-Resistant TB Patients Beneficial? A Systematic Review

    Directory of Open Access Journals (Sweden)

    C. Padmapriyadarsini

    2018-01-01

    Full Text Available Background. Preventive therapy for child contacts of multidrug-resistant tuberculosis (MDR-TB patients is poorly studied, and no consensus about the role and the rationale of chemoprophylaxis has been reached. Objective. To conduct systematic review with an aim to determine the effectiveness of TB preventive therapy in reducing the incidence of TB disease in pediatric contacts of MDR-TB patients. Methods. We conducted a literature search for randomized control trials, cohort studies, and case reports of chemoprophylaxis for pediatric contacts of MDR-TB patients in PubMed, EMBASE, Cochrane Databases of Systematic Reviews, metaRegister of Controlled Trials, and other clinical registries through March 2017, using appropriate search strategy. In addition we searched abstracts from international conferences and references of published articles and reviews. Results. Of the 153 references assessed from various databases, seven studies were identified as relevant after adaption of eligibility criteria and assessed for systematic review. Of these, only two studies contributed data for the pooled meta-analysis. Conclusions. Though the available evidences suggest that the chemoprophylaxis for child contacts of MDR-TB patients is beneficial, data to support or reject preventive therapy is very limited. Further clinical research, in Tb endemic settings like India, needs to be performed to prove the beneficial effect of chemoprophylaxis for pediatric contacts of MDR-TB.

  5. Intensive-phase treatment outcomes among hospitalized multidrug-resistant tuberculosis patients: results from a nationwide cohort in Nigeria.

    Directory of Open Access Journals (Sweden)

    Olanrewaju Oladimeji

    Full Text Available BACKGROUND: Nigeria is faced with a high burden of Human Immunodeficiency Virus (HIV infection and multidrug-resistant tuberculosis (MDR-TB. Treatment outcomes among MDR-TB patients registered across the globe have been poor, partly due to high loss-to-follow-up. To address this challenge, MDR-TB patients in Nigeria are hospitalized during the intensive-phase(IP of treatment (first 6-8 months and are provided with a package of care including standardized MDR-TB treatment regimen, antiretroviral therapy (ART and cotrimoxazole prophylaxis (CPT for HIV-infected patients, nutritional and psychosocial support. In this study, we report the end-IP treatment outcomes among them. METHODS: In this retrospective cohort study, we reviewed the patient records of all bacteriologically-confirmed MDR-TB patients admitted for treatment between July 2010 and October 2012. RESULTS: Of 162 patients, 105(65% were male, median age was 34 years and 28(17% were HIV-infected; all 28 received ART and CPT. Overall, 138(85% were alive and culture negative at the end of IP, 24(15% died and there was no loss-to-follow-up. Mortality was related to low CD4-counts at baseline among HIV-positive patients. The median increase in body mass index among those documented to be underweight was 2.6 kg/m2 (p<0.01 and CD4-counts improved by a median of 52 cells/microL among the HIV-infected patients (p<0.01. CONCLUSIONS: End-IP treatment outcomes were exceptional compared to previously published data from international cohorts, thus confirming the usefulness of a hospitalized model of care. However, less than five percent of all estimated 3600 MDR-TB patients in Nigeria were initiated on treatment during the study period. Given the expected scale-up of MDR-TB care, the hospitalized model is challenging to sustain and the national TB programme is contemplating to move to ambulatory care. Hence, we recommend using both ambulatory and hospitalized approaches, with the latter being reserved

  6. Integration and task shifting for TB/HIV care and treatment in highly resource-scarce settings: one size may not fit all.

    Science.gov (United States)

    Van Rie, Annelies; Patel, Monita R; Nana, Mbonze; Vanden Driessche, Koen; Tabala, Martine; Yotebieng, Marcel; Behets, Frieda

    2014-03-01

    A crucial question in managing HIV-infected patients with tuberculosis (TB) concerns when and how to initiate antiretroviral therapy (ART). The effectiveness of CD4-stratified ART initiation in a nurse-centered, integrated TB/HIV program at primary care in Kinshasa, Democratic Republic of Congo, was assessed. Prospective cohort study was conducted to assess the effect of CD4-stratified ART initiation by primary care nurses (513 TB patients, August 2007 to November 2009). ART was to be initiated at 1 month of TB treatment if CD4 count is 350 cells per cubic millimeter. ART uptake and mortality were compared with a historical prospective cohort of 373 HIV-infected TB patients referred for ART to a centralized facility and 3577 HIV-negative TB patients (January 2006 to May 2007). ART uptake increased (17%-69%, P vs 9.8%, P decentralized, nurse-initiated, CD4-stratified ART. Mortality among TB patients with CD4 count >100 cells per cubic millimeter was similar to that of HIV-negative TB patients (5.6% vs 6.3%, P = 0.65), but mortality among those with CD4 count <100 cells per cubic millimeter remained high (18.8%). Nurse-centered, CD4-stratified ART initiation at primary care level was effective in increasing timely ART uptake and reducing mortality among TB patients but may not be adequate to prevent mortality among those presenting with severe immunosuppression. Further research is needed to determine the optimal management at primary care level of TB patients with CD4 counts <100 cells per cubic millimeter.

  7. Treatment outcomes of rifabutin-containing regimens for rifabutin-sensitive multidrug-resistant pulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Hyun Lee

    2017-12-01

    Full Text Available Objectives: The aim of this study was to evaluate whether rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Methods: A retrospective cohort study was performed on 76 patients with rifabutin-sensitive MDR-TB who were treated with or without rifabutin between 2006 and 2011. Results: Overall, 75% (57/76 of patients achieved favorable outcomes, including cure (53/76, 70% and treatment completion (4/76, 5%. In contrast, 25% (19/76 had unfavorable treatment outcomes, which included treatment failure (6/76, 8%, death (2/76, 3%, loss to follow-up (4/76. 5%, and no evaluation due to transfer to other institutions (7/76, 9%. Rifabutin was given to 52 (68% of the 76 patients with rifabutin-sensitive MDR-TB. Although favorable treatment outcomes were more frequent in patients who received rifabutin [81% (42/52] than in those who did not receive rifabutin [63% (15/24], this difference was not statistically significant (P = 0.154. However, in multivariable regression logistic analysis, use of rifabutin was significantly associated with favorable treatment outcomes in patients with rifabutin-sensitive MDR-TB (adjusted odds ratio = 9.80, 95% confidence interval = 1.65–58.37, P = 0.012. Conclusions: These results suggest that the use of rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Keywords: Multidrug-resistant tuberculosis, Extensively drug-resistant tuberculosis, Rifabutin, Treatment outcome

  8. MDR1 siRNA loaded hyaluronic acid-based CD44 targeted nanoparticle systems circumvent paclitaxel resistance in ovarian cancer

    Science.gov (United States)

    Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng

    2015-02-01

    Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.

  9. The effect of HIV coinfection, HAART and TB treatment on cytokine/chemokine responses to Mycobacterium tuberculosis (Mtb) antigens in active TB patients and latently Mtb infected individuals

    NARCIS (Netherlands)

    Kassa, Desta; de Jager, Wilco; Gebremichael, Gebremedhin; Alemayehu, Yodit; Ran, Leonie; Fransen, Justin; Wolday, Dawit; Messele, Tsehaynesh; Tegbaru, Belete; Ottenhoff, Tom H M; van Baarle, Debbie

    2016-01-01

    Identification of Mtb specific induced cytokine/chemokine host biomarkers could assist in developing novel diagnostic, prognostic and therapeutic tools for TB. Levels of IFN-γ, IL-2, IL-17, IL-10, IP-10 and MIP-1α were measured in supernatants of whole blood stimulated with Mtb specific fusion

  10. Listening to Those at the Frontline: Patient and Healthcare Personnel Perspectives on Tuberculosis Treatment Barriers and Facilitators in High TB Burden Regions of Argentina

    Directory of Open Access Journals (Sweden)

    Sarah J. Iribarren

    2014-01-01

    Full Text Available Purpose. In Argentina, tuberculosis (TB control measures have not achieved key treatment targets. The purpose of this study was to identify modes of treatment delivery and explore patient and healthcare personnel perceptions of barriers and facilitators to treatment success. Methods. We used semistructured group and individual interviews for this descriptive qualitative study. Eight high burden municipalities were purposively selected. Patients in treatment for active TB (n=16, multidisciplinary TB team members (n=26, and TB program directors (n=12 at local, municipal, regional, and national levels were interviewed. Interviews were recorded, transcribed verbatim, and analyzed using thematic analysis. Results. Modes of treatment delivery varied across municipalities and types of healthcare facility and were highly negotiated with patients. Self-administration of treatment was common in hospital-based and some community clinics. Barriers to TB treatment success were concentrated at the system level. This level relied heavily on individual personal commitment, and many system facilitators were operating in isolation or in limited settings. Conclusions. We outline experiences and perspectives of the facilitating and challenging factors at the individual, structural, social, and organizational levels. Establishing strong patient-healthcare personnel relationships, responding to patient needs, capitalizing on community resources, and maximizing established decentralized system could mitigate some of the barriers.

  11. Antiretroviral Treatment Scale-Up and Tuberculosis Mortality in High TB/HIV Burden Countries: An Econometric Analysis.

    Science.gov (United States)

    Yan, Isabel; Bendavid, Eran; Korenromp, Eline L

    2016-01-01

    Antiretroviral therapy (ART) reduces mortality in patients with active tuberculosis (TB), but the population-level relationship between ART coverage and TB mortality is untested. We estimated the reduction in population-level TB mortality that can be attributed to increasing ART coverage across 41 high HIV-TB burden countries. We compiled TB mortality trends between 1996 and 2011 from two sources: (1) national program-reported TB death notifications, adjusted for annual TB case detection rates, and (2) WHO TB mortality estimates. National coverage with ART, as proportion of HIV-infected people in need, was obtained from UNAIDS. We applied panel linear regressions controlling for HIV prevalence (5-year lagged), coverage of TB interventions (estimated by WHO and UNAIDS), gross domestic product per capita, health spending from domestic sources, urbanization, and country fixed effects. Models suggest that that increasing ART coverage was followed by reduced TB mortality, across multiple specifications. For death notifications at 2 to 5 years following a given ART scale-up, a 1% increase in ART coverage predicted 0.95% faster mortality rate decline (p = 0.002); resulting in 27% fewer TB deaths in 2011 alone than would have occurred without ART. Based on WHO death estimates, a 1% increase in ART predicted a 1.0% reduced TB death rate (peconometric analysis supports a substantial impact of ART on population-level TB mortality realized already within the first decade of ART scale-up, that is apparent despite variable-quality mortality data.

  12. Patient satisfaction with HIV and TB treatment in a public programme in rural KwaZulu-Natal: evidence from patient-exit interviews

    Science.gov (United States)

    2014-01-01

    Background Patient satisfaction is a determinant of treatment uptake, adherence and retention, and an important health systems outcome. Queues, health worker-patient contact time, staff attitudes, and facility cleanliness may affect patient satisfaction. We quantified dimensions of patient satisfaction among HIV and TB patients in a rural sub-district of KwaZulu-Natal, South Africa, and identified underlying satisfaction factors that explained the data. Methods We conducted patient-exit interviews with 300 HIV and 300 TB patients who were randomly selected using a two-stage cluster random sampling approach with primary sampling units (primary healthcare clinics) selected with probability-proportional-to-size sampling. We performed factor analysis to investigate underlying patient satisfaction factors. We compared the satisfaction with HIV and TB services and examined the relationships between patient satisfaction and patients’ socio-demographic characteristics in multivariable regression. Results Almost all patients (95% HIV, 97% TB) reported to be globally satisfied with the healthcare services received on the day of the interview. However, patient satisfaction with specific concrete aspects of the health services was substantially lower: 52% of HIV and 40% of TB patients agreed that some staff did not treat patients with sufficient respect (p = 0.02 for difference between the two patient groups); 65% of HIV and 40% of TB patients agreed that health worker queues were too long (p patient satisfaction variables could be reduced to a few underlying factors that align broadly with concepts previously identified in the literature as affecting access to healthcare. Increases in health systems resources for HIV and TB, but also improvements in facility maintenance, staff attitudes and communication, are likely to substantially improve HIV and TB patients’ satisfaction with the care they receive in public-sector treatment programmes in rural communities in South

  13. Molecular epidemiology of TB – Its impact on multidrug-resistant tuberculosis control in China☆

    Directory of Open Access Journals (Sweden)

    Biao Xu

    2015-01-01

    Results: In total, 238 bacteriologic confirmed pulmonary TB patients from DQ and 393 from GY diagnosed between 2008 and 2011 were recruited in the study. Of the 631 isolates, 220 (34.9% were resistant to at least one anti-TB drug, including 95 (15.1% simultaneously resistant to isoniazid and rifampicin or MDR, albeit with the similar distribution between DQ and GY (32/238 vs. 63/393; p, 0.378. The MIRU-VNTR genotyping revealed 35 isolates from DQ and 86 from GY exhibited 15 and 32 clustering patterns with four patterns shared between two counties. Compared with GY county, DQ had a significantly lower clustering proportion in MTB isolates susceptible to first-line drugs (25/167 vs. 46/198; p, 0.047 and total drug resistant TB isolates (12/71 vs. 44/149; p, 0.044, but a similar clustering proportion in MDR-TB isolates (8/32 vs. 18/63; p, 0.712. A significant higher clustering proportion was observed in the previously treated patients in both counties, but in the sputum smear-positive patients with cavitaries only in GY. Comparing the previously treated patients between the two counties, the proportion of MDR-TB and clustering proportion exhibited a similar distribution, while the average age of previously treated patients in DQ is significantly older than that in GY. Conclusions: A lower proportion of recent transmissions was observed in the county with long-term DOTS implementation. However, DOTS itself might not have worked enough on blocking the recent transmission of MDR-TB. This observation suggests the urgent needs of implementing the Stop-TB strategies; in particular, accelerating the use of rapid molecularbasedTBdiagnosisand drug susceptibility testing, providing active case findings in a high risk population of MDR-TB and enhancing infection control in high MDR-TB burden countries.

  14. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    Directory of Open Access Journals (Sweden)

    Buddhasukh Duang

    2004-04-01

    Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.

  15. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    International Nuclear Information System (INIS)

    Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang

    2004-01-01

    Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents

  16. Strategy to better select HIV-infected individuals for latent TB treatment in BCG-vaccinated population.

    Directory of Open Access Journals (Sweden)

    Chin-Hui Yang

    Full Text Available OBJECTIVE: To evaluate the T-SPOT.TB interferon-γ releasing assay and the tuberculin skin test (TST, for the diagnosis of latent tuberculosis infection(LTBI and the development of subsequent active tuberculosis, in BCG-vaccinated HIV-infected individuals. METHODS: HIV-infected individuals without clinical suspicion of active TB or a past history of TB were enrolled from 1 January 2008 to 30 November 2010. Both T-SPOT.TB test and TST were offered to the participants whom were followed up prospectively until April 30, 2012 for development of TB. RESULTS: Among the 909 participants, 25% had positive TST reactions with cut-off point of 5 mm and 15% had positive T-SPOT.TB results. After a median follow-up of 2.97 years, there were 5 cases developed culture-confirmed active TB (all had dual positive TST and T-SPOT.TB results, and the incidence was 0.17 per 100 person-years. The relative risks (RRs for subsequent active TB in HIV-infected individuals with positive TST results, positive T-SPOT.TB results and dual positive results compared with the risk for individuals with negative results were 40.6 (95% CI 2.1-767.9, 73.9 (95% CI 3.9-1397.7 and 226.5 (95% CI 12.0-4284, respectively. The number needed to treat to prevent one subsequent TB case among patients with a positive TST, a positive T-SPOT.TB and dual positive results was 35, 22 and 8 respectively. CONCLUSIONS: Adopting positive results of the TST and T-SPOT.TB to screen LTBI among BCG-vaccinated HIV-infected individuals might be feasible. Number needed to treat for isoniazid preventive therapy could be reduced significantly by using dual positive strategy.

  17. Community-based directly observed treatment for TB patients to improve HIV services: a cross-sectional study in a South African province.

    Science.gov (United States)

    Howell, Embry M; Kigozi, N Gladys; Heunis, J Christo

    2018-04-07

    There is uncertainty about how directly observed treatment (DOT) support for tuberculosis (TB) can be delivered most effectively and how DOT support can simultaneously be used to strengthen human immunodeficiency virus (HIV) prevention and control among TB patients. This study describes how DOT support by community health workers (CHWs) was used in four municipalities in the Free State province - a high TB/HIV burden, poorly-resourced setting - to provide HIV outreach, referrals, and health education for TB patients. The study was part of a larger cross-sectional study of HIV counselling and testing (HCT) among 1101 randomly-selected TB patients registered at 40 primary health care (PHC) facilities (clinics and community health centres) across small town/rural and large town/urban settings. Univariate analysis of percentages, chi-square tests and t-tests for difference in means were used to describe differences between the types of TB treatment support and patient characteristics, as well as the types of - and patient satisfaction with - HIV information and referrals received from various types of treatment supporters including home-based DOT supporters, clinic-based DOT supporters or support from family/friends/employers. Multivariate logistic regression was used to predict the likelihood of not having receiving home-based DOT and of never having received HIV counselling. The independent variables include poverty-related health and socio-economic risk factors for poor outcomes. Statistical significance is shown using a 95% confidence interval and a 0.05 p-value. Despite the fact that DOT support for all TB patients was the goal of South African health policy at the time (2012), most TB patients were not receiving formal DOT support. Only 155 (14.1%) were receiving home-based DOT, while 114 (10.4%) received clinic-based DOT. TB patients receiving home-based DOT reported higher rates of HIV counselling than other patients. Public health providers should train DOT

  18. Comparison of PPD test in household contacts of smear-positive and -negative tuberculosis (TB

    Directory of Open Access Journals (Sweden)

    Zohreh Azarkar

    2015-01-01

    Conclusions: The most important way to prevent TB is omission of the disease transmission sources (TB patients by anti-TB treatment. Extensive studies are needed to ensure that contacts of patients with pulmonary TB are identified and appropriately screened.

  19. Factors Associated with Treatment Failure among Smear Positive TB Patients in Khorasan-e-Razavi and Sistan-Baluchistan Provinces, Iran

    Directory of Open Access Journals (Sweden)

    Hekmatollah Khoubfekr, Narges Khanjani, Yunes Jahani, Mahmoud Moosazadeh

    2016-12-01

    Full Text Available Introduction: Tuberculosis (TB treatment failure is one of the major problems of the health sector in developing countries. Poor treatment of patients leads to drug resistance, relapse, death, and ultimately prevents TB control programs. This study was conducted to determine the factors affecting tuberculosis treatment failure in Khorasan and Sistan- Balochistan regions which have a high prevalence of TB. Methods: In this case - control study 270 patients with tuberculosis (90 cases, 180 controls were analyzed. New TB patients registered with failure to treatment according to the national protocol between March 2008 - March 2012 were chosen as cases and new TB patients with negative sputum smear in the same time frame were enrolled as control group. Demographic data and clinical treatment outcomes were collected through interviews and file records. Multivariate logistic regression analysis was used to determine the predictors of treatment failure in SPSS 19. Results: Independent factors and predictors of failure treatment included illiteracy, a three plus positive sputum smear, positive sputum smear at end of the second month, non-implementation of the Directly Observed Treatment Short strategy by healthcare staff, history of addiction and history of diabetes. Conclusion: Intervention programs for early detection and control of diabetes, drug control programs, giving priority to providing DOTS by health care workers, more individual care and attention to patients with initial smear p + 3 or those that remain sputum positive at the end of the second month or those who are less educated is necessary. J Microbiol Infect Dis 2016;6(4: 172-178

  20. Kinetics of the QuantiFERON-TB Gold In-Tube test during treatment of patients with sputum smear-positive tuberculosis in relation to initial TST result and severity of disease

    DEFF Research Database (Denmark)

    Idh, Jonna; Abate, Ebba; Westman, Anna

    2010-01-01

    . Smear-positive TB patients (n = 71) were recruited at Gondar University Hospital, Ethiopia. The TST, QFN, CD4+ cell count and clinical symptoms (TB score) were assessed and followed up during treatment. From baseline to 7 months after treatment, there was a significant decrease in QFN reactivity (93.......8% to 62.5% in HIV-negative/TB; 70.3% to 33.3% in HIV-positive/TB patients) down to a level comparable to a control group of blood donors (51.2%). The agreement between TST and QFN was poor in TB patients compared to healthy controls. A negative TST correlated to more advanced TB in contrast to a negative...

  1. The START Study to evaluate the effectiveness of a combination intervention package to enhance antiretroviral therapy uptake and retention during TB treatment among TB/HIV patients in Lesotho: rationale and design of a mixed-methods, cluster-randomized trial

    Directory of Open Access Journals (Sweden)

    Andrea A. Howard

    2016-06-01

    Full Text Available Background: Initiating antiretroviral therapy (ART early during tuberculosis (TB treatment increases survival; however, implementation is suboptimal. Implementation science studies are needed to identify interventions to address this evidence-to-program gap. Objective: The Start TB Patients on ART and Retain on Treatment (START Study is a mixed-methods, cluster-randomized trial aimed at evaluating the effectiveness, cost-effectiveness, and acceptability of a combination intervention package (CIP to improve early ART initiation, retention, and TB treatment success among TB/HIV patients in Berea District, Lesotho. Design: Twelve health facilities were randomized to receive the CIP or standard of care after stratification by facility type (hospital or health center. The CIP includes nurse training and mentorship, using a clinical algorithm; transport reimbursement and health education by village health workers (VHW for patients and treatment supporters; and adherence support using text messaging and VHW. Routine data were abstracted for all newly registered TB/HIV patients; anticipated sample size was 1,200 individuals. A measurement cohort of TB/HIV patients initiating ART was recruited; the target enrollment was 384 individuals, each to be followed for the duration of TB treatment (6–9 months. Inclusion criteria were HIV-infected; on TB treatment; initiated ART within 2 months of TB treatment initiation; age ≥18; English- or Sesotho-speaking; and capable of informed consent. The exclusion criterion was multidrug-resistant TB. Three groups of key informants were recruited from intervention clinics: early ART initiators; non/late ART initiators; and health care workers. Primary outcomes include ART initiation, retention, and TB treatment success. Secondary outcomes include time to ART initiation, adherence, change in CD4+ count, sputum smear conversion, cost-effectiveness, and acceptability. Follow-up and data abstraction are complete

  2. Shortened first-line TB treatment in Brazil: potential cost savings for patients and health services

    NARCIS (Netherlands)

    Trajman, Anete; Bastos, Mayara Lisboa; Belo, Marcia; Calaça, Janaína; Gaspar, Júlia; Dos Santos, Alexandre Martins; Dos Santos, Camila Martins; Brito, Raquel Trindade; Wells, William A.; Cobelens, Frank G.; Vassall, Anna; Gomez, Gabriela B.

    2016-01-01

    Shortened treatment regimens for tuberculosis are under development to improve treatment outcomes and reduce costs. We estimated potential savings from a societal perspective in Brazil following the introduction of a hypothetical four-month regimen for tuberculosis treatment. Data were gathered in

  3. Tuberculosis treatment and Smoking, Armenia, 2014–2016

    Directory of Open Access Journals (Sweden)

    Dikran Raffi Balian

    2017-08-01

    Full Text Available Introduction: Tuberculosis and tobacco prove to be increasingly apparent world problems. Armenia is a developing country which is facing issues related to the high rates of tobacco consumption. Moreover, it is among the list of high multi-drug resistant (MDR Tuberculosis TB burden countries. Treatment success rate in Armenia for sputum smear-positive cases never reached World Health Organization's (WHO target of 85% in last 15 years. Data from different studies completed across the world suggests that there is an association between smoking and negative treatment outcomes. Methods: This retrospective study was designed to investigate aforementioned associations between TB treatment outcomes and smoking status of TB patients. Data for the study were derived from the national data available in the electronic database of the Armenian National TB Center. Results: Based on inclusion and exclusion criteria 992 TB patients registered in 2014 were enrolled in this study. All of them are were TB patients in which 387 were smokers and 605 were non-smokers. Notably, adjusted analysis showed that individuals who smoked during TB treatment had 1.61 higher odds of having unsuccessful TB treatment outcome. Additionally, consistent with the literature, statistically significant association was identified between TB treatment outcome and other well factors such as sputum smear status (OR=2.24, p<0.01, HIV status (OR,=1.87, p<0.01 of patients, etc. Conclusions: The smoking, HIV positive status, positive sputum smear microscopy test were identified as an important factors associated with the unsuccessful TB treatment outcome in Armenia. It highlights the necessity of having specific restrictions and campaign programs to reduce smoking rates among TB patients in order to improve current TB treatment and care services throughout Armenia. Keywords: Tuberculosis, Smoking, Treatment outcome, Treatment success

  4. Multimodal transfer of MDR by exosomes in human osteosarcoma.

    Science.gov (United States)

    Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola

    2016-07-01

    Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.

  5. TB control programmes: the challenges for Africa.

    Science.gov (United States)

    Harries, T

    1996-11-01

    Governmental neglect of tuberculosis (TB), inadequately managed and inaccurately designed TB control programs, population growth, and the HIV epidemic account for the resurgence of TB in sub-Saharan Africa. The World Health Organization and the International Union against TB and Lung Disease have developed a TB control strategy that aims to reduce mortality, morbidity, and transmission of TB. It aims for an 85% cure rate among detected new cases of smear-positive TB and a 70% rate of detecting existing smear-positive TB cases. The strategy involves the provision of short-course chemotherapy (SCC) to all identified smear-positive TB cases through directly observed treatment (DOTS). SCC treatment regimens for smear-positive pulmonary TB recommended for sub-Saharan African countries are: initial phase = daily administration over 2 months of streptomycin, rifampicin, isoniazid, and pyrazinamide; continuation phase = 3 doses over 4 months of isoniazid and rifampicin or daily administration of thiacetazone and isoniazid or of ethambutol and isoniazid. A TB control policy must be implemented to bring about effective TB control. The essential elements of this policy include political commitment, case detection through passive case-finding, SCC, a regular supply of essential drugs, and a monitoring and evaluation system. Political commitment involves establishing a National TB Control Program to be integrated into the existing health structure. Increased awareness of TB in the community and among health workers and a reference laboratory are needed to make case finding successful. A distribution and logistics system is needed to ensure uninterrupted intake of drugs throughout treatment. These regimens have been very successful and cost-effective but pose several disadvantages (e.g., heavy workload of recommended 3 sputum smear tests). A simplified approach involves 1 initial sputum smear for 6 months; 6-months, intermittent rifampicin-based therapy, 100% DOTS throughout

  6. Multidrug resistant pulmonary tuberculosis treatment regimens and patient outcomes: an individual patient data meta-analysis of 9,153 patients.

    Directory of Open Access Journals (Sweden)

    Shama D Ahuja

    Full Text Available Treatment of multidrug resistant tuberculosis (MDR-TB is lengthy, toxic, expensive, and has generally poor outcomes. We undertook an individual patient data meta-analysis to assess the impact on outcomes of the type, number, and duration of drugs used to treat MDR-TB.Three recent systematic reviews were used to identify studies reporting treatment outcomes of microbiologically confirmed MDR-TB. Study authors were contacted to solicit individual patient data including clinical characteristics, treatment given, and outcomes. Random effects multivariable logistic meta-regression was used to estimate adjusted odds of treatment success. Adequate treatment and outcome data were provided for 9,153 patients with MDR-TB from 32 observational studies. Treatment success, compared to failure/relapse, was associated with use of: later generation quinolones, (adjusted odds ratio [aOR]: 2.5 [95% CI 1.1-6.0], ofloxacin (aOR: 2.5 [1.6-3.9], ethionamide or prothionamide (aOR: 1.7 [1.3-2.3], use of four or more likely effective drugs in the initial intensive phase (aOR: 2.3 [1.3-3.9], and three or more likely effective drugs in the continuation phase (aOR: 2.7 [1.7-4.1]. Similar results were seen for the association of treatment success compared to failure/relapse or death: later generation quinolones, (aOR: 2.7 [1.7-4.3], ofloxacin (aOR: 2.3 [1.3-3.8], ethionamide or prothionamide (aOR: 1.7 [1.4-2.1], use of four or more likely effective drugs in the initial intensive phase (aOR: 2.7 [1.9-3.9], and three or more likely effective drugs in the continuation phase (aOR: 4.5 [3.4-6.0].In this individual patient data meta-analysis of observational data, improved MDR-TB treatment success and survival were associated with use of certain fluoroquinolones, ethionamide, or prothionamide, and greater total number of effective drugs. However, randomized trials are urgently needed to optimize MDR-TB treatment. Please see later in the article for the Editors' Summary.

  7. Providing an address for delivery of nanoencapsulated TB drugs

    CSIR Research Space (South Africa)

    Lemmer, Yolandy

    2010-06-01

    Full Text Available compliance and drug resistance pose a great challenge to TB treatment programs worldwide. To improve the current inadequate therapeutic management of TB, a polymeric anti-TB nanodrug delivery system, for anti-TB drugs, was developed that could enable entry...

  8. The impact of being homeless on the unsuccessful outcome of treatment of pulmonary TB in São Paulo State, Brazil.

    Science.gov (United States)

    Ranzani, Otavio T; Carvalho, Carlos R R; Waldman, Eliseu A; Rodrigues, Laura C

    2016-03-23

    Tuberculosis (TB) is a major public health problem requiring complex treatment, the success of which depends on biological, social, and institutional factors. São Paulo State (SPS), in Brazil, has a high TB burden. Because of high socioeconomic heterogeneity and chaotic urbanisation, homelessness might play an important role in the TB burden in SPS. Our aim was to determine the association between homelessness and outcome of treatment of pulmonary TB (PTB) in SPS. A historical cohort from the routine SPS TB database for 2009-2013 was analysed. The study population was newly diagnosed adult patients with PTB. Homelessness was ascertained at notification or when treatment started. Our outcome was unsuccessful outcome of treatment. We used logistic regression to adjust for potential confounders and multiple imputation for missing data. We analysed 61,817 patients; 1726 (2.8 %, 95%CI 2.7-2.9 %) were homeless. Homeless patients were concentrated in bigger cities, were more frequently middle-aged males, had black/brown skin colour, and had received less education (P homeless patients (43.2 % vs 14.4 %, 30.2 % vs. 9.4 %, P homeless, of whom 17.3 % were HIV positive compared with 8.5 % among the not homeless population (P homeless (91.6 % vs. 84.8 %, P homeless and 17.5 % among the not homeless (OR = 6.32, 95%CI 5.73-6.97, P homelessness remained strongly associated with lower treatment success (aOR = 4.96, 95 % CI 4.27-5.76, P homelessness: among HIV-infected patients, the aOR was 2.45 (95%CI 1.90-3.16, Pinteraction homelessness, alcohol and drug use was almost 20 %. Confirming our hypothesis, homelessness led to a marked reduction in the successful treatment of newly diagnosed pulmonary tuberculosis. Homelessness and associated conditions were important contributors to lack of treatment success in pulmonary tuberculosis in São Paulo. A multifaceted intervention must be implemented to target this vulnerable population.

  9. Access to and affordability of healthcare for TB patients in China: issues and challenges.

    Science.gov (United States)

    Tang, Shenglan; Wang, Lixia; Wang, Hong; Chin, Daniel P

    2016-01-29

    This paper introduces the background, aim and objectives of the project entitled "China-the Gates Foundation Collaboration on TB Control in China" that has been underway for many years. It also summarizes the key findings of the nine papers included in this special issue, which used data from the baseline survey of Phase II of the project. Data were collected from the survey of TB and MDR-TB patients, from designated hospitals, health insurance agencies and the routine health information systems, as well as key informant interviews and focus group discussions with relevant key stakeholders. Key issues discussed in this series of papers include the uses of TB services and anti-TB medicines and their determining factors related to socio-economic and health systems development; expenditures on TB care and the financial burden incurred on TB patients; and the impact of health insurance schemes implemented in China on financial protection.

  10. Access to free or low-cost tuberculosis treatment for migrants and refugees along the Thailand-Myanmar border in Tak province, Thailand.

    Science.gov (United States)

    Tschirhart, Naomi; Nosten, Francois; Foster, Angel M

    2016-07-07

    In Tak province, Thailand migrants and refugees from Myanmar navigate a pluralistic healthcare system to seek Tuberculosis (TB) care from a variety of government and non-governmental providers. This multi-methods qualitative study examined access to TB, TB/HIV and multidrug-resistant tuberculosis (MDR-TB) treatment with an emphasis on barriers to care and enabling factors. In the summer and fall of 2014, we conducted 12 key informant interviews with public health officials and TB treatment providers. We also conducted 11 focus group discussions with migrants and refugees who were receiving TB, TB/HIV and MDR-TB treatment in Tak province as well as non-TB patients. We analyzed these data through thematic analysis using both predetermined and emergent codes. As a second step in the qualitative analysis, we explored the barriers and enabling factors separately for migrants and refugees. We found that refugees face fewer barriers to accessing TB treatment than migrants. For both migrants and refugees, legal status plays an important intermediary role in influencing the population's ability to access care and eligibility for treatment. Our results suggest that there is a large geographical catchment area for migrants who seek TB treatment in Tak province that extends beyond provincial boundaries. Migrant participants described their ability to seek care as linked to the financial and non-financial resources required to travel and undergo treatment. Patients identified language of health services, availability of free or low cost services, and psychosocial support as important health system characteristics that affect accessibility. Access to TB treatment for migrants and refugees occurs at the interface of health system accessibility, population ability and legal status. In Tak province, migrant patients draw upon their social networks and financial resources to navigate a pathway to treatment. We revised a conceptual framework for access to healthcare to incorporate

  11. Multidrug-resistant tuberculosis treatment failure detection depends on monitoring interval and microbiological method

    Science.gov (United States)

    White, Richard A.; Lu, Chunling; Rodriguez, Carly A.; Bayona, Jaime; Becerra, Mercedes C.; Burgos, Marcos; Centis, Rosella; Cohen, Theodore; Cox, Helen; D'Ambrosio, Lia; Danilovitz, Manfred; Falzon, Dennis; Gelmanova, Irina Y.; Gler, Maria T.; Grinsdale, Jennifer A.; Holtz, Timothy H.; Keshavjee, Salmaan; Leimane, Vaira; Menzies, Dick; Milstein, Meredith B.; Mishustin, Sergey P.; Pagano, Marcello; Quelapio, Maria I.; Shean, Karen; Shin, Sonya S.; Tolman, Arielle W.; van der Walt, Martha L.; Van Deun, Armand; Viiklepp, Piret

    2016-01-01

    Debate persists about monitoring method (culture or smear) and interval (monthly or less frequently) during treatment for multidrug-resistant tuberculosis (MDR-TB). We analysed existing data and estimated the effect of monitoring strategies on timing of failure detection. We identified studies reporting microbiological response to MDR-TB treatment and solicited individual patient data from authors. Frailty survival models were used to estimate pooled relative risk of failure detection in the last 12 months of treatment; hazard of failure using monthly culture was the reference. Data were obtained for 5410 patients across 12 observational studies. During the last 12 months of treatment, failure detection occurred in a median of 3 months by monthly culture; failure detection was delayed by 2, 7, and 9 months relying on bimonthly culture, monthly smear and bimonthly smear, respectively. Risk (95% CI) of failure detection delay resulting from monthly smear relative to culture is 0.38 (0.34–0.42) for all patients and 0.33 (0.25–0.42) for HIV-co-infected patients. Failure detection is delayed by reducing the sensitivity and frequency of the monitoring method. Monthly monitoring of sputum cultures from patients receiving MDR-TB treatment is recommended. Expanded laboratory capacity is needed for high-quality culture, and for smear microscopy and rapid molecular tests. PMID:27587552

  12. Tuberculosis Facts - Exposure to TB

    Science.gov (United States)

    Tuberculosis (TB) Facts Exposure to TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  13. Tuberculosis Facts - Testing for TB

    Science.gov (United States)

    Tuberculosis (TB) Facts Testing for TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  14. Risk Factors for DOTS Treatment Default Among New HIV-TB Coinfected Patients in Nalgonda (Dist.) Telangana (State): A Case Control Study.

    Science.gov (United States)

    Reddy Satti, Siva Balaji; Kondagunta, Nagaraj

    2016-01-01

    The therapeutic regimens as recommended by the Revised National TB Control Programme (RNTCP) have been shown to be highly effective for both preventing and treating tuberculosis, but poor adherence to medication is a major barrier to its global control. The study was conducted to assess the influence of patient related factors for DOTS Treatment Default among HIV-TB Co-infected cases. This was a case control study conducted in Nalgond, Telangana. All new HIV-TB coinfected and DOTS-defaulted patients registered under RNTCP for the period from January 2010 to December 2012 were selected. Of the 154 patients, 23 had died and 11 could not be traced, and these were excluded. Thus the total number of available cases were 120 for those age- and sex-matched controls (HIV-TB coinfected patients and those who had completed the DOTS regimen successfully) were selected. The mean age was 36.5 ± 9 years; the majority (23.3%) of patients defaulted during the second month of treatment. Significant risk factors associated with defaulting included unskilled occupation [adjusted odds ratio (AOR: 3.56; 95% confidence interval (CI): 1.1-11.56], lower middle class socioeconomic status (AOR: 17.16; 95% CI: 3.93-74.82), small family size (AOR: 21.3; 95% CI: 6.4-70.91), marital disharmony (AOR: 6.78; 95% CI: 1.93-23.76), not being satisfied with the conduct of health personnel (AOR: 7.38; 95% CI: 2.32-23.39), smoking (AOR: 8.5; 95% CI: 2.31-31.21), and side effects of drugs (AOR: 4.18; 95% CI: 1.35-12.9). Unskilled occupation, marital disharmony, small family size, lower middle class socioeconomic status, not being satisfied with the conduct of health personnel, smoking, and drug side effects were significantly associated with defaulting. Information on the pattern of tuberculosis (TB), the outcome of anti-tuberculosis treatment (ATT), and the factors associated with it will help in planning interventions to improve adherence to DOTS treatment.

  15. Find TB. Treat TB. Working together to eliminate TB.

    Centers for Disease Control (CDC) Podcasts

    2014-02-26

    In this podcast, Dr. Sundari Mase, Medical Team Lead in the Field Services and Evaluation Branch in the Division of Tuberculosis Elimination, discusses World TB Day and the 2014 theme.  Created: 2/26/2014 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/26/2014.

  16. Time to ART Initiation among Patients Treated for Rifampicin-Resistant Tuberculosis in Khayelitsha, South Africa: Impact on Mortality and Treatment Success.

    Science.gov (United States)

    Daniels, Johnny Flippie; Khogali, Mohammed; Mohr, Erika; Cox, Vivian; Moyo, Sizulu; Edginton, Mary; Hinderaker, Sven Gudmund; Meintjes, Graeme; Hughes, Jennifer; De Azevedo, Virginia; van Cutsem, Gilles; Cox, Helen Suzanne

    2015-01-01

    Khayelitsha, South Africa, with high burdens of rifampicin-resistant tuberculosis (RR-TB) and HIV co-infection. To describe time to antiretroviral treatment (ART) initiation among HIV-infected RR-TB patients initiating RR-TB treatment and to assess the association between time to ART initiation and treatment outcomes. A retrospective cohort study of patients with RR-TB and HIV co-infection not on ART at RR-TB treatment initiation. Of the 696 RR-TB and HIV-infected patients initiated on RR-TB treatment between 2009 and 2013, 303 (44%) were not on ART when RR-TB treatment was initiated. The median CD4 cell count was 126 cells/mm3. Overall 257 (85%) patients started ART during RR-TB treatment, 33 (11%) within 2 weeks, 152 (50%) between 2-8 weeks and 72 (24%) after 8 weeks. Of the 46 (15%) who never started ART, 10 (21%) died or stopped RR-TB treatment within 4 weeks and 16 (37%) had at least 4 months of RR-TB treatment. Treatment success and mortality during treatment did not vary by time to ART initiation: treatment success was 41%, 43%, and 50% among patients who started ART within 2 weeks, between 2-8 weeks, and after 8 weeks (p = 0.62), while mortality was 21%, 13% and 15% respectively (p = 0.57). Mortality was associated with never receiving ART (adjusted hazard ratio (aHR) 6.0, CI 2.1-18.1), CD4 count ≤100 (aHR 2.1, CI 1.0-4.5), and multidrug-resistant tuberculosis (MDR-TB) with second-line resistance (aHR 2.5, CI 1.1-5.4). Despite wide variation in time to ART initiation among RR-TB patients, no differences in mortality or treatment success were observed. However, a significant proportion of patients did not initiate ART despite receiving >4 months of RR-TB treatment. Programmatic priorities should focus on ensuring all patients with RR-TB/HIV co-infection initiate ART regardless of CD4 count, with special attention for patients with CD4 counts ≤ 100 to initiate ART as soon as possible after RR-TB treatment initiation.

  17. Patient satisfaction with TB care clinical consultations in Kampala: a ...

    African Journals Online (AJOL)

    ... on treatment outcome. Keywords: Patient satisfaction, TB care clinical consultations, cross sectional study. ... Background: Tuberculosis (TB) remains a major global ... Measurement of outcome: Variables considered were; how long the ... Key: ART= Antiretroviral Therapy. Characteristic. Parameter n (%). Sex. Female.

  18. A Pilot Trial of Jawarish Amla as Adjuvant to Anti-Tubercular Treatment Drugs for Control of Adverse Reactions in DOTS Regime in Pulmonary TB.

    Science.gov (United States)

    Sherwani, Arish Mohammad Khan; Zulkifle, Mohammad; Rehmatulla

    2012-01-01

    One of the greatest challenges of health care systems at the dawn of the 21st century is tuberculosis (TB). Drug resistant strains of TB are becoming a global public health risk. These strains commonly appear due to faulty therapies. Patients frequently stop treatment due to the toxicity of anti-tubercular treatment (ATT) drugs. Amla (Emblica officinalis) is a well-known Unani single drug. Jawarish amla is a Unani compound formulation which is commonly used to administer amla. This study tested the efficacy of Jawarish amla as an adjuvant to ATT drugs in reducing their side effects. Half of forty eligible pulmonary tuberculosis patients were randomly assigned to Test (Group B) and the other half to Control (Group A). Six grams of Jawarish amla twice daily was administered to the test group, and the same dosage of placebo was administered to control group along with directly observed treatment, short course chemotherapy (DOTS) for 60 days. Fisher exact test and paired t-test were applied for efficacy evaluation. Grading of symptoms was done to assess the toxicity of ATT and outcome of the adjuvant. Significant improvements were observed in almost all subjective and objective parameters. The exceptions were serum creatine and serum uric acid, which showed non-significant slight elevations within normal limits. Jawarish amla was ascertained to be safe and effective adjuvant of DOTS in combating the adverse effects of ATT drugs.

  19. Mycobacteria and TB

    National Research Council Canada - National Science Library

    Kaufmann, S. H. E. (Stephan H. E.); Hahn, Helmut

    2003-01-01

    .... Scientists investigating the epidemiology, immunology and molecular biology of TB or engaged in vaccine and drug development as well as physicians and social workers treating TB patients will benefit...

  20. Major challenges in clinical management of TB/HIV co-infected patients in Eastern Europe compared with Western Europe and Latin America

    DEFF Research Database (Denmark)

    Efsen, Anne Marie; Schultze, Anna; Post, Frank

    2014-01-01

    identified in logistic regression models. RESULTS: Significant differences were observed between EE (n=844), WE (n=152), SE (n=164) and LA (n=253) for use of combination antiretroviral therapy (cART) at TB diagnosis (17%, 40%, 44% and 35%, pdefinite TB diagnosis (culture and/or PCR positive......, Isoniazid, Pyrazinamide, Ethambutol (RHZE)], the corresponding proportions would have been 64% vs. 86-97%, respectively (Figure 1b). CONCLUSIONS: In EE, TB/HIV patients had poorer exposure to cART, less often a definitive TB diagnosis and more often MDR-TB compared to other parts of Europe and LA. Initial...

  1. Why healthcare workers are sick of TB

    Directory of Open Access Journals (Sweden)

    Arne von Delft

    2015-03-01

    Full Text Available Dr Thato Mosidi never expected to be diagnosed with tuberculosis (TB, despite widely prevalent exposure and very limited infection control measures. The life-threatening diagnosis of primary extensively drug-resistant TB (XDR-TB came as an even greater shock. The inconvenient truth is that, rather than being protected, Dr Mosidi and thousands of her healthcare colleagues are at an increased risk of TB and especially drug-resistant TB. In this viewpoint paper we debunk the widely held false belief that healthcare workers are somehow immune to TB disease (TB-proof and explore some of the key factors contributing to the pervasive stigmatization and subsequent non-disclosure of occupational TB. Our front-line workers are some of the first to suffer the consequences of a progressively more resistant and fatal TB epidemic, and urgent interventions are needed to ensure the safety and continued availability of these precious healthcare resources. These include the rapid development and scale-up of improved diagnostic and treatment options, strengthened infection control measures, and focused interventions to tackle stigma and discrimination in all its forms. We call our colleagues to action to protect themselves and those they care for.

  2. Litigation as TB Rights Advocacy

    Science.gov (United States)

    2016-01-01

    Abstract One thousand people die every day in India as a result of TB, a preventable and treatable disease, even though the Constitution of India, government schemes, and international law guarantee available, accessible, acceptable, quality health care. Failure to address the spread of TB and to provide quality treatment to all affected populations constitutes a public health and human rights emergency that demands action and accountability. As part of a broader strategy, health activists in India employ Public Interest Litigation (PIL) to hold the state accountable for rights violations and to demand new legislation, standards for patient care, accountability for under-spending, improvements in services at individual facilities, and access to government entitlements in marginalized communities. Taking inspiration from right to health PIL cases (PILs), lawyers in a New Delhi-based rights organization used desk research, fact-findings, and the Right To Information Act to build a TB PIL for the Delhi High Court, Sanjai Sharma v. NCT of Delhi and Others (2015). The case argues that inadequate implementation of government TB schemes violates the Constitutional rights to life, health, food, and equality. Although PILs face substantial challenges, this paper concludes that litigation can be a crucial advocacy and accountability tool for people living with TB and their allies. PMID:27781000

  3. Inhibition of ABCB1 (MDR1 expression by an siRNA nanoparticulate delivery system to overcome drug resistance in osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Michiro Susa

    2010-05-01

    Full Text Available The use of neo-adjuvant chemotherapy in treating osteosarcoma has improved patients' average 5 year survival rate from 20% to 70% in the past 30 years. However, for patients who progress after chemotherapy, its effectiveness diminishes due to the emergence of multi-drug resistance (MDR after prolonged therapy.In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure resulting from MDR, we designed and evaluated a novel drug delivery system for MDR1 siRNA delivery. Novel biocompatible, lipid-modified dextran-based polymeric nanoparticles were used as the platform for MDR1 siRNA delivery; and the efficacy of combination therapy with this system was evaluated. In this study, multi-drug resistant osteosarcoma cell lines (KHOS(R2 and U-2OS(R2 were treated with the MDR1 siRNA nanocarriers and MDR1 protein (P-gp expression, drug retention, and immunofluoresence were analyzed. Combination therapy of the MDR1 siRNA loaded nanocarriers with increasing concentrations of doxorubicin was also analyzed. We observed that MDR1 siRNA loaded dextran nanoparticles efficiently suppresses P-gp expression in the drug resistant osteosarcoma cell lines. The results also demonstrated that this approach may be capable of reversing drug resistance by increasing the amount of drug accumulation in MDR cell lines.Lipid-modified dextran-based polymeric nanoparticles are a promising platform for siRNA delivery. Nanocarriers loaded with MDR1 siRNA are a potential treatment strategy for reversing MDR in osteosarcoma.

  4. The role of antiretroviral therapy in reducing TB incidence and mortality in high HIV-TB burden countries

    Directory of Open Access Journals (Sweden)

    Anthony D Harries

    2016-03-01

    Full Text Available With the adoption of the new Sustainable Development Goals in 2016, all countries have committed to end the tuberculosis (TB epidemic by 2030, defined as dramatic reductions in TB incidence and mortality combined with zero TB-induced catastrophic costs for families. This paper explores how antiretroviral therapy (ART in high HIV-TB burden countries may help in reducing TB incidence and mortality and thus contribute to the ambitious goal of ending TB. ART in people living with HIV has a potent TB preventive effect, with this being most apparent in those with the most advanced immunodeficiency. Early ART also significantly reduces the risk of TB, and with new World Health Organization guidance released in 2015 about initiating ART in all persons living with HIV irrespective of CD4 count, there is the potential for enormous benefit at the population level. Already, several countries with high HIVTB burdens have seen dramatic declines in TB case notification rates since ART scale up started in 2004. In patients already diagnosed with HIV-associated TB, mortality can be significantly decreased by ART, especially if started within 2–8 weeks of anti-TB treatment. The benefits of ART on TB incidence and TB mortality can be further augmented respectively by the addition of isoniazid preventive therapy and cotrimoxazole preventive therapy. These interventions must be effectively implemented and scaled up in order to end the TB epidemic by 2030.

  5. Community perceptions of the socio-economic structural context influencing HIV and TB risk, prevention and treatment in a high prevalence area in the era of antiretroviral therapy.

    Science.gov (United States)

    Ngwenya, Nothando; Gumede, Dumile; Shahmanesh, Maryam; McGrath, Nuala; Grant, Alison; Seeley, Janet

    2018-03-01

    Following calls for targeted HIV prevention interventions in so-called "hotspots", we explored subjective perceptions of community members in places considered to be high HIV and tuberculosis (TB) transmission areas and those with low prevalence. Although more people now have access to antiretroviral therapy (ART), some areas are still experiencing high HIV transmission rates, presenting a barrier to the elimination of HIV. A rapid qualitative assessment approach was used to access a sample of 230 people who contributed narratives of their experiences and perceptions of transmission, treatment and prevention of HIV and TB in their communities. Theoretical propositions case study strategy was used to inform and guide the thematic analysis of the data with Research Department of Epidemiology & Public Health, University College London, London, UK. Our results support the concept of linking perceived control to health through the identification of structural factors that increase communities' sense of agency. People in these communities did not feel they had the efficacy to effect change in their milieu. The few socio-economic opportunities promote social mobility in search of better prospects which may have a negative impact on community cohesion and prevention strategies. Communities were more concerned with improving their immediate social and economic situations and prioritised this above the prevention messages. Therefore approaches that focus on changing the structural and environmental barriers to prevention may increase people's perceived control. Multifaceted strategies that address the identified constructs of perceived control may influence the social change necessary to make structural interventions successful.

  6. A systematic review of the cost and cost effectiveness of treatment for multidrug-resistant tuberculosis.

    Science.gov (United States)

    Fitzpatrick, Christopher; Floyd, Katherine

    2012-01-01

    Around 0.4 million cases of multidrug-resistant tuberculosis (MDR-TB) occur each year. Only a small fraction of these cases are treated according to international guidelines. Evidence relevant to decisions about whether to scale-up treatment for MDR-TB includes cost and cost-effectiveness data. Up to 2010, no systematic review of this evidence has been available. Our objective was to conduct a systematic review of the cost and cost effectiveness of treatment for MDR-TB and synthesize the available data. We searched for papers published or prepared for publication in peer-review journals and grey literature using search terms in five languages: English, French, Portuguese, Russian and Spanish. From an initial set of 420 studies, four were included, from Peru, the Philippines, Estonia and Tomsk Oblast in the Russian Federation. Results on costs, effectiveness and cost effectiveness were extracted. Assessment of the quality of each economic evaluation was guided by two existing checklists around which there is broad consensus. Costs were adjusted to a common year of value (2005) to remove distortions caused by inflation, and calculated in two common currencies: $US and international dollars (I$), to standardize for purchasing power parity. Data from the four identified studies were then synthesized using probabilistic sensitivity analysis, to appraise the likely cost and cost effectiveness of MDR-TB treatment in other settings, relative to WHO benchmarks for assessing whether or not an intervention is cost effective. Best estimates are provided as means, with 5th and 95th percentiles of the distributions. The cost per patient for MDR-TB treatment in Estonia, Peru, the Philippines and Tomsk was $US10 880, $US2423, $US3613 and $US14 657, respectively. Best estimates of the cost per disability-adjusted life-year (DALY) averted were $US598 (I$960), $US163 (I$291), $US143 (I$255) and $US745 (I$1059), respectively. The main influences on costs were (i) the model of care

  7. MDR1 P-glycoprotein transports endogenous opioid peptides

    NARCIS (Netherlands)

    Oude Elferink, R. P.; Zadina, J.

    2001-01-01

    MDR1 P-glycoprotein is generally regarded as an efflux pump for amphipathic toxic compounds. The question remains, however, whether certain endogenous compounds are also substrates for this transporter. Certain peptides have been shown to interact with MDR1 Pgp as well and we have therefore

  8. Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

    Science.gov (United States)

    Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

    2017-10-01

    ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. One of the possible mechanisms for the inhibition effect of Tb(III) on peroxidase activity in horseradish (Armoracia rusticana) treated with Tb(III).

    Science.gov (United States)

    Guo, Shaofen; Cao, Rui; Lu, Aihua; Zhou, Qing; Lu, Tianhong; Ding, Xiaolan; Li, Chaojun; Huang, Xiaohua

    2008-05-01

    One of the possible mechanisms for the inhibition effect of Tb(III) on peroxidase activity in horseradish (Armoracia rusticana) treated with Tb(III) was investigated using some biophysical and biochemical methods. Firstly, it was found that a large amount of Tb(III) can be distributed on the cell wall, that some Tb(III) can enter into the horseradish cell, indicating that peroxidase was mainly distributed on cell wall, and thus that Tb(III) would interact with horseradish peroxidase (HRP) in the plant. In addition, peroxidase bioactivity was decreased in the presence of Tb(III). Secondly, a new peroxidase-containing Tb(III) complex (Tb-HRP) was obtained from horseradish after treatment with Tb(III); the molecular mass of Tb-HRP is near 44 kDa and the pI is about 8.80. Thirdly, the electrocatalytic activity of Tb-HRP is much lower than that of HRP obtained from horseradish without treatment with Tb(III). The decrease in the activity of Tb-HRP is due to the destruction (unfolding) of the conformation in Tb-HRP. The planarity of the heme active center in the Tb-HRP molecule was increased and the extent of exposure of Fe(III) in heme was decreased, leading to inhibition of the electron transfer. The microstructure change in Tb-HRP might be the result of the inhibition effect of Tb(III) on peroxidase activity in horseradish.

  10. The antiretroviral efficacy of highly active antiretroviral therapy and plasma nevirapine concentrations in HIV-TB co-infected Indian patients receiving rifampicin based antituberculosis treatment

    Directory of Open Access Journals (Sweden)

    Sinha Sanjeev

    2011-11-01

    Full Text Available Abstract Background Rifampicin reduces the plasma concentrations of nevirapine in human immunodeficiency virus (HIV and tuberculosis (TB co-infected patients, who are administered these drugs concomitantly. We conducted a prospective interventional study to assess the efficacy of nevirapine-containing highly active antiretroviral treatment (HAART when co-administered with rifampicin-containing antituberculosis treatment (ATT and also measured plasma nevirapine concentrations in patients receiving such a nevirapine-containing HAART regimen. Methods 63 cases included antiretroviral treatment naïve HIV-TB co-infected patients with CD4 counts less than 200 cells/mm3 started on rifampicin-containing ATT followed by nevirapine-containing HAART. In control group we included 51 HIV patients without tuberculosis and on nevirapine-containing HAART. They were assessed for clinical and immunological response at the end of 24 and 48 weeks. Plasma nevirapine concentrations were measured at days 14, 28, 42 and 180 of starting HAART. Results 97 out of 114 (85.1% patients were alive at the end of 48 weeks. The CD4 cell count showed a mean increase of 108 vs.113 cells/mm3 (p=0.83 at 24 weeks of HAART in cases and controls respectively. Overall, 58.73% patients in cases had viral loads of less than 400 copies/ml at the end of 48 weeks. The mean (± SD Nevirapine concentrations of cases and control at 14, 28, 42 and 180 days were 2.19 ± 1.49 vs. 3.27 ± 4.95 (p = 0.10, 2.78 ± 1.60 vs. 3.67 ± 3.59 (p = 0.08, 3.06 ± 3.32 vs. 4.04 ± 2.55 (p = 0.10 respectively and 3.04 μg/ml (in cases. Conclusions Good immunological and clinical response can be obtained in HIV-TB co-infected patients receiving rifampicin and nevirapine concomitantly despite somewhat lower nevirapine trough concentrations. This suggests that rifampicin-containing ATT may be co administered in resource limited setting with nevirapine-containing HAART regimen without substantial reduction in

  11. Understanding social context on TB cases

    Science.gov (United States)

    Ariyanto, Y.; Wati, D. M.

    2017-01-01

    Tuberculosis (TB) nowadays still becomes one of the world’s deadliest communicable disease. More than half were in South-East Asia and Western Pacific Regions, including Indonesia. As developing country, Indonesia remains classic problems in overcoming TB, that is discontinuation on treatment. Most of discontinuation on treatment among TB patients are affected by diagnostic delay that caused by patient delay. These phenomena occur in many areas, rural to suburb, coastal to plantation, and so on, and they are related with social context among community that could be social capital for each community to deal with TB. Jember as one of county in East Java is known as plantation area. It also has a high prevalence of TB. This study focused on understanding about social context among community, especially on plantation area. This cross-sectional study involved in three districts of Jember, those are Tanggul, Pakusari, and Kalisat. The data were obtained directly from the TB patients, local community, and Primary Health Care (PHC) where the patients recorded. Spatial analysis and social network analysis (SNA) were applied to obtain health seeking behavior pattern among the TB patients coincide the community. Most of TB patients had already chosen health professionals to lead the treatment, although some of them remained to choose self-medication. Meanwhile, SNA showed that religious leader was considered as main part of countermeasures of TB. But they didn’t ever become central figures. So it can be concluded that there are other parts among community who can contribute due to combatting on TB.

  12. Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

    Directory of Open Access Journals (Sweden)

    Strazzullo Viviana

    2006-12-01

    Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

  13. Lay beliefs of TB and TB/HIV co-infection in Addis Ababa, Ethiopia: a qualitative study

    Directory of Open Access Journals (Sweden)

    Frich Jan C

    2011-08-01

    Full Text Available Abstract Background Knowledge about lay beliefs of etiology, transmission and treatment of TB, and lay perceptions of the relationship between TB and HIV is important for understanding patients' health seeking behavior and adherence to treatment. We conducted a study to explore lay beliefs about TB and TB/HIV co-infection in Addis Ababa, Ethiopia. Findings We conducted a qualitative study using in-depth interviews with 15 TB/HIV co-infected patients and 9 health professionals and focus group discussions with 14 co-infected patients in Addis-Ababa, Ethiopia. We found that a predominant lay belief was that TB was caused by exposure to cold. Excessive sun exposure, exposure to mud, smoking, alcohol, khat and inadequate food intake were also reported as causes for TB. Such beliefs initially led to self-treatment. The majority of patients were aware of an association between TB and HIV. Some reported that TB could transform into HIV, while others said that the body could be weakened by HIV and become more susceptible to illnesses such as TB. Some patients classified TB as either HIV-related or non-HIV-related, and weight loss was a hallmark for HIV-related TB. The majority of patients believed that people in the community knew that there was an association between TB and HIV, and some feared that this would predispose them to HIV-related stigma. Conclusion There is a need for culturally sensitive information and educational efforts to address misperceptions about TB and HIV. Health professionals should provide information about causes and treatment of TB and HIV to co-infected patients.

  14. Application Values of T-SPOT.TB in Clinical Rapid Diagnosis of Tuberculosis.

    Science.gov (United States)

    Zhu, Feng; Ou, Qinfang; Zheng, Jian

    2018-01-01

    This paper aims to explore the application value of tuberculosis-specific enzyme-linked immunospot assay (T-SPOT.TB) in the diagnosis of tuberculosis. Fifty one patients with tuberculosis (TB) admitted to Wuxi No.5 People's Hospital, Wuxi, China from June 2015 to June 2017 were selected as the TB group, and 40 patients without tuberculosis admitted in the same period were randomly selected as the non-TB group. Patients in the two groups received T-SPOT.TB, TB antibody (TB-Ab) test and mycobacterium TB deoxyribonucleic acid (TB-DNA) test, and the results were compared. Comparisons of the sensitivity of the three methods showed that the sensitivity of T-SPOT.TB was the highest, followed by TB-DNA from sputum samples, and that of TB-Ab was the lowest. The specificity of TB-Ab was the highest, followed by T-SPOT.TB, and that of TB-DNA from sputum samples was the lowest. In the receiver operating characteristic (ROC) curve analysis, the area under curve (AUC) of T-SPOT.TB (0.896) was the highest, followed by TB-DNA from sputum samples (0.772), and that of sputum smears (0.698) was the lowest. T-SPOT.TB can quickly and accurately determine the presence of tuberculosis infection, and it is a non-invasive examination, which can further assist in the diagnosis and guide the treatment.

  15. First and second line drug resistance among treatment naïve pulmonary tuberculosis patients in a district under Revised National Tuberculosis Control Programme (RNTCP in New Delhi

    Directory of Open Access Journals (Sweden)

    Vithal Prasad Myneedu

    2015-12-01

    Full Text Available There is limited information of level of drug resistance to first-line and second line anti-tuberculosis agents in treatment naïve pulmonary tuberculosis (PTB patients from the Indian region. Therefore, the present prospective study was conducted to determine the antimicrobial susceptibility to first-line and second line anti-TB drug resistance in such patients. Sputum samples from consecutive treatment naïve PTB cases registered in Lala Ram Sarup (LRS district, under RNTCP containing 12 Directly Observed Treatment Centre’s (DOTS, were enrolled using cluster sampling technology. A total of 453 samples were received from July 2011 to June 2012. All samples were cultured on solid medium followed by drug susceptibility to first and second line anti-tubercular drugs as per RNTCP guidelines. Primary multi-drug resistance (MDR was found to be 18/453; (4.0%. Extensively drug resistance (XDR was found in one strain (0.2%, which was found to be resistant to other antibiotics. Data of drug resistant tuberculosis among treatment naïve TB patients are lacking in India. The presence of XDR-TB and high MDR-TB in small population studied, calls for conducting systematic multi-centric surveillance across the country.

  16. Integration of childhood TB into guidelines for the management of acute malnutrition in high burden countries.

    Science.gov (United States)

    Patel, L N; Detjen, A K

    2017-06-21

    Introduction: Childhood tuberculosis (TB) and undernutrition are major global public health challenges. In 2015, although an estimated 1 million children aged malnutrition from 17 high TB burden countries were reviewed to gather information on TB symptom screening, exposure history, and treatment. Results: Seven (41%) countries recommend routine TB screening among children with acute malnutrition, and six (35%) recommend obtaining a TB exposure history. Conclusion: TB screening is not consistently included in guidelines for acute malnutrition in high TB burden countries. Routine TB risk assessment, especially history of TB exposure, among acutely malnourished children, combined with improved linkages with TB services, would help increase TB case finding and could impact outcomes. Operational research on how best to integrate services at different levels of the health care system is needed.

  17. TB in Captive Elephants

    Centers for Disease Control (CDC) Podcasts

    2017-04-27

    Dr. Barry Kreiswirth, founding director of the Public Health Research Institute, TB Center, at Rutgers University, discusses TB in three captive elephants.  Created: 4/27/2017 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 4/27/2017.

  18. Economic support to patients in HIV and TB grants in rounds 7 and 10 from the global fund to fight AIDS, tuberculosis and malaria.

    Directory of Open Access Journals (Sweden)

    Linda M Richter

    Full Text Available People with TB and/or HIV frequently experience severe economic barriers to health care, including out-of-pocket expenses related to diagnosis and treatment, as well as indirect costs due to loss of income. These barriers can both aggravate economic hardship and prevent or delay diagnosis, treatment and successful outcome, leading to increased transmission, morbidity and mortality. WHO, UNAIDS and the ILO argue that economic support of various kinds is essential to enable vulnerable people to protect themselves from infection, avoid delayed diagnosis and treatment, overcome barriers to adherence, and avert destitution. This paper analyses successful country proposals to the Global Fund to Fight AIDS, Tuberculosis and Malaria that include economic support in Rounds 7 and 10; 36 and 20 HIV and TB grants in Round 7 and 32 and 26, respectively, in Round 10. Of these, up to 84 percent included direct or indirect economic support for beneficiaries, although the amount constituted a very small proportion of the total grant. In TB grants, the objectives of economic support were generally clearly stated, and focused on mechanisms to improve treatment uptake and adherence, and the case was most clearly made for MDR-TB patients. In HIV grants, the objectives were much broader in scope, including mitigation of adverse economic and social effects of HIV and its treatment on both patients and families. The analysis shows that economic support is on the radar for countries developing Global Fund proposals, and a wide range of economic support activities are in place. In order to move forward in this area, the wealth of country experience that exists needs to be collated, assessed and disseminated. In addition to trials, operational research and programme evaluations, more precise guidance to countries is needed to inform evidence-based decision about activities that are cost-effective, affordable and feasible.

  19. Isolation, Characterization and Anti-Multiple Drug Resistant (MDR ...

    African Journals Online (AJOL)

    (MDR) Bacterial Activity of Endophytic Fungi Isolated from ... Institute of Protection & Development of Beibu Wan Ocean Resources, Qinzhou University, Qinzhou, Guangxi Province, ..... isolated from secondary metabolites of the mangrove.

  20. Using mHealth for HIV/TB Treatment Support in Lesotho: Enhancing Patient-Provider Communication in the START Study.

    Science.gov (United States)

    Hirsch-Moverman, Yael; Daftary, Amrita; Yuengling, Katharine A; Saito, Suzue; Ntoane, Moeketsi; Frederix, Koen; Maama, Llang B; Howard, Andrea A

    2017-01-01

    mHealth is a promising means of supporting adherence to treatment. The Start TB patients on ART and Retain on Treatment (START) study included real-time adherence support using short-text messaging service (SMS) text messaging and trained village health workers (VHWs). We describe the use and acceptability of mHealth by patients with HIV/tuberculosis and health care providers. Patients and treatment supporters received automated, coded medication and appointment reminders at their preferred time and frequency, using their own phones, and $3.70 in monthly airtime. Facility-based VHWs were trained to log patient information and text message preferences into a mobile application and were given a password-protected mobile phone and airtime to communicate with community-based VHWs. The use of mHealth tools was analyzed from process data over the study course. Acceptability was evaluated during monthly follow-up interviews with all participants and during qualitative interviews with a subset of 30 patients and 30 health care providers at intervention sites. Use and acceptability were contextualized by monthly adherence data. From April 2013 to August 2015, the automated SMS system successfully delivered 39,528 messages to 835 individuals, including 633 patients and 202 treatment supporters. Uptake of the SMS intervention was high, with 92.1% of 713 eligible patients choosing to receive SMS messages. Patient and provider interviews yielded insight into barriers and facilitators to mHealth utilization. The intervention improved the quality of health communication between patients, treatment supporters, and providers. HIV-related stigma and technical challenges were identified as potential barriers. The mHealth intervention for HIV/tuberculosis treatment support in Lesotho was found to be a low-tech, user-friendly intervention, which was acceptable to patients and health care providers.

  1. HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-glycoprotein.

    Directory of Open Access Journals (Sweden)

    Jianfang Chen

    Full Text Available Multidrug resistance (MDR is one of the major reasons chemotherapy-based treatments fail. Hypoxia is generally associated with tumor chemoresistance. However, the correlation between the heterodimeric hypoxia-inducible factor-1 (HIF-1 and the multidrug resistance (MDR1 gene/transporter P-glycoprotein (P-gp remains unclear. This study aims to explore the molecular mechanisms of reversing colon cancer MDR by focusing on the target gene HIF-1α.A chemotherapeutic sensitivity assay was used to observe the efficiency of MDR reversal in LoVo multicellular spheroids (MCS. The apoptotic level induced by different drugs was examined by flow cytometry (FCM. Binding of HIF-1α to the MDR1 gene promoter was evaluated by Chromatin immunoprecipitation (ChIP. The relationship between HIF-1α/P-gp expression and sensitivity to chemotherapy was analyzed.The sensitivity of LoVo MCS to all four chemotherapy drugs was decreased to varying degrees under hypoxic conditions. After silencing the HIF-1α gene, the sensitivities of LoVo MCS to all four chemotherapy drugs were restored. The apoptotic levels that all the drugs induced were all decreased to various extents in the hypoxic group. After silencing HIF-1α, the apoptosis level induced by all four chemotherapy drugs increased. The expression of HIF-1α and P-gp was significantly enhanced in LoVo MCS after treatment with hypoxia. Inhibiting HIF-1α significantly decreased the expression of MDR1/P-gp mRNA or protein in both the LoVo monolayers and LoVo MCS. The ChIP assay showed that HIF-1α was bound to the MDR1 gene promoter. Advanced colon carcinoma patients with expression of both HIF-1α and P-gp were more resistant to chemotherapy than that with non expression.HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-gp. The expression of HIF-1α and MDR1/P-gp can be used as a predictive marker for chemotherapy resistance in colon cancer.

  2. Psychological distress and its effect on tuberculosis treatment outcomes in Ethiopia

    Directory of Open Access Journals (Sweden)

    Habteyes Hailu Tola

    2015-11-01

    Full Text Available Background: Psychological distress is the major comorbidity among tuberculosis (TB patients. However, its magnitude, associated factors, and effect on treatment outcome have not been adequately studied in low-income countries. Objective: This study aimed to determine the magnitude of psychological distress and its effect on treatment outcome among TB patients on treatment. Design: A follow-up study was conducted in Addis Ababa, Ethiopia, from May to December 2014. Patients (N=330 diagnosed with all types of TB who had been on treatment for 1–2 months were enrolled consecutively from 15 randomly selected health centers and one TB specialized hospital. Data on sociodemographic variables and economic status were collected using a structured questionnaire. The presence of psychological distress was assessed at baseline (within 1–2 months after treatment initiation and end point (6 months after treatment initiation using the 10-item Kessler (K-10 scale. Alcohol use and tobacco smoking history were assessed using WHO Alcohol Use Disorder Identification Test and Australian Smoking Assessment Checklist, respectively. The current WHO TB treatment outcome definition was used to differentiate the end result of each patient at completion of the treatment. Results: The overall psychological distress was 67.6% at 1–2 months and 48.5% at 6 months after treatment initiation. Multiple logistic regression analysis revealed that past TB treatment history [adjusted odds ratio (AOR: 3.76; 95% confidence interval (CI: 1.67–8.45], being on anti-TB and anti-HIV treatments (AOR: 5.35; 95% CI: 1.83–15.65, being unmarried (AOR: 4.29; 95% CI: 2.45–7.53, having alcohol use disorder (AOR: 2.95; 95% CI: 1.25–6.99, and having low economic status (AOR: 4.41; 95% CI: 2.44–7.97 were significantly associated with psychological distress at baseline. However, at 6 months after treatment initiation, only being a multidrug-resistant tuberculosis (MDR-TB patient (AOR: 3

  3. Multidrug-resistant tuberculosis in Europe, 2010-2011

    DEFF Research Database (Denmark)

    Günther, Gunar; van Leth, Frank; Alexandru, Sofia

    2015-01-01

    Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

  4. Accelerating TB notification from the private health sector in Delhi, India.

    Science.gov (United States)

    Kundu, Debashish; Chopra, Kamal; Khanna, Ashwani; Babbar, Neeti; Padmini, T J

    2016-01-01

    In India, almost half of all patients with tuberculosis (TB) seek care in the private sector as the first point of care. The national programme is unable to support such TB patients and facilitate effective treatment, as there is no information on TB and Multi or Extensively Drug Resistant TB (M/XDR-TB) diagnosis and treatment in private sector. To improve this situation, Government of India declared TB a notifiable disease for establishing TB surveillance system, to extend supportive mechanism for TB treatment adherence and standardised practices in the private sector. But TB notification from the private sector is a challenge and still a lot needs to be done to accelerate TB notification. Delhi State TB Control Programme had taken initiatives for improving notification of TB cases from the private sector in 2014. Key steps taken were to constitute a state level TB notification committee to oversee the progress of TB notification efforts in the state and direct 'one to one' sensitisation of private practitioners (PPs) (in single PP's clinic, corporate hospitals and laboratories) by the state notification teams with the help of available tools for sensitising the PP on TB notification - TB Notification Government Order, Guidance Tool for TB Notification and Standards of TB Care in India. As a result of focussed state level interventions, without much external support, there was an accelerated notification of TB cases from the private sector. TB notification cases from the private sector rose from 341 (in 2013) to 4049 (by the end of March 2015). Active state level initiatives have led to increase in TB case notification. Copyright © 2016 Tuberculosis Association of India. Published by Elsevier B.V. All rights reserved.

  5. Alcohol, hospital discharge, and socioeconomic risk factors for default from multidrug resistant tuberculosis treatment in rural South Africa: a retrospective cohort study.

    Science.gov (United States)

    Kendall, Emily A; Theron, Danie; Franke, Molly F; van Helden, Paul; Victor, Thomas C; Murray, Megan B; Warren, Robin M; Jacobson, Karen R

    2013-01-01

    Default from multidrug-resistant tuberculosis (MDR-TB) treatment remains a major barrier to cure and epidemic control. We sought to identify patient risk factors for default from MDR-TB treatment and high-risk time periods for default in relation to hospitalization and transition to outpatient care. We retrospectively analyzed a cohort of 225 patients who initiated MDR-TB treatment between 2007 through 2010 at a rural TB hospital in the Western Cape Province, South Africa. Fifty percent of patients were cured or completed treatment, 27% defaulted, 14% died, 4% failed treatment, and 5% transferred out. Recent alcohol use was common (63% of patients). In multivariable proportional hazards regression, older age (hazard ratio [HR]= 0.97 [95% confidence interval 0.94-0.99] per year of greater age), formal housing (HR=0.38 [0.19-0.78]), and steady employment (HR=0.41 [0.19-0.90]) were associated with decreased risk of default, while recent alcohol use (HR=2.1 [1.1-4.0]), recent drug use (HR=2.0 [1.0-3.6]), and Coloured (mixed ancestry) ethnicity (HR=2.3 [1.1-5.0]) were associated with increased risk of default (PDefaults occurred throughout the first 18 months of the two-year treatment course but were especially frequent among alcohol users after discharge from the initial four-to-five-month in-hospital phase of treatment, with the highest default rates occurring among alcohol users within two months of discharge. Default rates during the first two months after discharge were also elevated for patients who received care from mobile clinics. Among patients who were not cured or did not complete MDR-TB treatment, the majority defaulted from treatment. Younger, economically-unstable patients and alcohol and drug users were particularly at risk. For alcohol users as well as mobile-clinic patients, the early outpatient treatment phase is a high-risk period for default that could be targeted in efforts to increase treatment completion rates.

  6. Ursolic and oleanolic acids as antimicrobial and immunomodulatory compounds for tuberculosis treatment.

    Science.gov (United States)

    Jiménez-Arellanes, Adelina; Luna-Herrera, Julieta; Cornejo-Garrido, Jorge; López-García, Sonia; Castro-Mussot, María Eugenia; Meckes-Fischer, Mariana; Mata-Espinosa, Dulce; Marquina, Brenda; Torres, Javier; Hernández-Pando, Rogelio

    2013-10-07

    New alternatives for the treatment of Tuberculosis (TB) are urgently needed and medicinal plants represent a potential option. Chamaedora tepejilote and Lantana hispida are medicinal plants from Mexico and their hexanic extracts have shown antimycobacterial activity. Bioguided investigation of these extracts showed that the active compounds were ursolic acid (UA) and oleanolic acid (OA). The activity of UA and OA against Mycobacterium tuberculosis H37Rv, four monoresistant strains, and two drug-resistant clinical isolates were determined by MABA test. The intracellular activity of UA and OA against M. tuberculosis H37Rv and a MDR clinical isolate were evaluated in a macrophage cell line. Finally, the antitubercular activity of UA and OA was tested in BALB/c mice infected with M. tuberculosis H37Rv or a MDR strain, by determining pulmonary bacilli loads, tissue damage by automated histomorphometry, and expression of IFN-γ, TNF-α, and iNOS by quantitative RT-PCR. The in vitro assay showed that the UA/OA mixture has synergistic activity. The intracellular activity of these compounds against M. tuberculosis H37Rv and a MDR clinical isolate in a macrophage cell line showed that both compounds, alone and in combination, were active against intracellular mycobacteria even at low doses. Moreover, when both compounds were used to treat BALB/c mice with TB induced by H37Rv or MDR bacilli, a significant reduction of bacterial loads and pneumonia were observed compared to the control. Interestingly, animals treated with UA and OA showed a higher expression of IFN-γ and TNF-α in their lungs, than control animals. UA and OA showed antimicrobial activity plus an immune-stimulatory effect that permitted the control of experimental pulmonary TB.

  7. Tuberculosis Facts - TB and HIV/AIDS

    Science.gov (United States)

    Tuberculosis (TB) Facts TB and HIV/AIDS What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  8. Risk Factors for Acquisition of Drug Resistance during Multidrug-Resistant Tuberculosis Treatment, Arkhangelsk Oblast, Russia, 2005–2010

    Science.gov (United States)

    Ershova, Julia; Vlasova, Natalia; Nikishova, Elena; Tarasova, Irina; Eliseev, Platon; Maryandyshev, Andrey O.; Shemyakin, Igor G.; Kurbatova, Ekaterina; Cegielski, J. Peter

    2015-01-01

    Acquired resistance to antituberculosis drugs decreases effective treatment options and the likelihood of treatment success. We identified risk factors for acquisition of drug resistance during treatment for multidrug-resistant tuberculosis (MDR TB) and evaluated the effect on treatment outcomes. Data were collected prospectively from adults from Arkhangelsk Oblast, Russia, who had pulmonary MDR TB during 2005–2008. Acquisition of resistance to capreomycin and of extensively drug-resistant TB were more likely among patients who received 3 effective drugs (9.4% vs. 0% and 8.6% vs. 0.8%, respectively). Poor outcomes were more likely among patients with acquired capreomycin resistance (100% vs. 25.9%), acquired ofloxacin resistance (83.6% vs. 22.7%), or acquired extensive drug resistance (100% vs. 24.4%). To prevent acquired drug resistance and poor outcomes, baseline susceptibility to first- and second-line drugs should be determined quickly, and treatment should be adjusted to contain >3 effective drugs. PMID:25988954

  9. HIV and Tuberculosis (TB)

    Science.gov (United States)

    ... AIDS Drugs Clinical Trials Apps skip to content HIV and Opportunistic Infections, Coinfections, and Conditions Home Understanding ... 4 p.m. ET) Send us an email HIV and Tuberculosis (TB) Last Reviewed: June 14, 2018 ...

  10. Supporting clinical management of the difficult-to-treat TB cases: the ERS-WHO TB Consilium

    Directory of Open Access Journals (Sweden)

    Lia D’Ambrosio

    2015-03-01

    The primary objective of the ERS/WHO TB Consilium is to provide clinical consultation for drug-resistant TB and other difficult-to-treat TB cases, including co-infection with HIV and paediatric cases. Through technical guidance to clinicians managing complex TB cases, the main contribution and outcome of the initiative will be a public health response aimed at achieving correct treatment of affected patients and preventing further development of drug resistance. The Consilum's secondary objective is to ensure monitoring and evaluation of clinical practices on the ground (diagnosis, treatment and prevention.

  11. Isolation and in vitro evaluation of bacteriophages against MDR-bacterial isolates from septic wound infections.

    Directory of Open Access Journals (Sweden)

    Roja Rani Pallavali

    Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence

  12. Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

    Science.gov (United States)

    Liu, Zhongle; Myers, Lawrence C

    2017-11-01

    Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

  13. Expression of multidrug resistance genes MVP, MDR1, and MRP1 determined sequentially before, during, and after hyperthermic isolated limb perfusion of soft tissue sarcoma and melanoma patients.

    Science.gov (United States)

    Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter

    2002-08-01

    Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.

  14. Epigenetic mechanisms involved in differential MDR1 mRNA expression between gastric and colon cancer cell lines and rationales for clinical chemotherapy

    Directory of Open Access Journals (Sweden)

    Kim Kyung-Jong

    2008-08-01

    Full Text Available Abstract Background The membrane transporters such as P-glycoprotein (Pgp, the MDR1 gene product, are one of causes of treatment failure in cancer patients. In this study, the epigenetic mechanisms involved in differential MDR1 mRNA expression were compared between 10 gastric and 9 colon cancer cell lines. Methods The MDR1 mRNA levels were determined using PCR and real-time PCR assays after reverse transcription. Cytotoxicity was performed using the MTT assay. Methylation status was explored by quantification PCR-based methylation and bisulfite DNA sequencing analyses. Results The MDR1 mRNA levels obtained by 35 cycles of RT-PCR in gastric cancer cells were just comparable to those obtained by 22 cycles of RT-PCR in colon cancer cells. Real-time RT-PCR analysis revealed that MDR1 mRNA was not detected in the 10 gastric cancer cell lines but variable MDR1 mRNA levels in 7 of 9 colon cancer cell lines except the SNU-C5 and HT-29 cells. MTT assay showed that Pgp inhibitors such as cyclosporine A, verapamil and PSC833 sensitized Colo320HSR (colon, highest MDR1 expression but not SNU-668 (gastric, highest and SNU-C5 (gastric, no expression to paclitaxel. Quantification PCR-based methylation analysis revealed that 90% of gastric cancer cells, and 33% of colon cancer cells were methylated, which were completely matched with the results obtained by bisulfite DNA sequencing analysis. 5-aza-2'-deoxcytidine (5AC, a DNA methyltransferase inhibitor increased the MDR1 mRNA levels in 60% of gastric cells, and in 11% of colon cancer cells. Trichostatin A (TSA, histone deacetylase inhibitor increased the MDR1 mRNA levels in 70% of gastric cancer cells and 55% of colon cancer cells. The combined treatment of 5AC with TSA increased the MDR1 mRNA levels additively in 20% of gastric cancer cells, but synergistically in 40% of gastric and 11% of colon cancer cells. Conclusion These results indicate that the MDR1 mRNA levels in gastric cancer cells are significantly

  15. Tuberculosis Facts - You Can Prevent TB

    Science.gov (United States)

    Tuberculosis (TB) Facts You Can Prevent TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination TB Facts: You Can Prevent TB What ...

  16. Tuberculosis Facts - TB Can Be Treated

    Science.gov (United States)

    Tuberculosis (TB) Facts TB Can Be Treated What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination Page 1 of 2 TB Facts: TB ...

  17. Latent Tuberculosis Infection in an Urban Cohort: Screening and Treatment for Latent TB in an Urban Setting

    Science.gov (United States)

    Morano, Jamie P.; Walton, Mary R.; Zelenev, Alexei; Bruce, R. Douglas; Altice, Frederick L.

    2013-01-01

    Background Despite its benefit for treating active tuberculosis, directly observed therapy (DOT) for latent tuberculosis infection (LTBI) has been largely understudied among challenging inner city populations. Methods Utilizing questionnaire data from a comprehensive mobile healthcare clinic in New Haven, CT from 2003 to July 2011, a total of 2523 completed tuberculin skin tests (TST’s) resulted in 357 new LTBIs. Multivariate logistic regression correlated covariates of the two outcomes 1) initiation of isoniazid preventative therapy (IPT) and 2) completion of 9-months IPT. Results Of 357 new LTBIs, 86.3% (n=308) completed screening CXRs: 90.3% (n=278) were normal and 0.3% (n=1) with active tuberculosis. Of those completing CXR screening, 44.0% (n=135) agreed to IPT: 69.6% (n=94) selected DOT, and 30.4% (n=41) selected SAT. Initiating IPT was correlated with undocumented status (AOR=3.43; pmodels for LTBI treatment resulted in similar outcomes, yet outcomes were hampered by differential measurement bias between DOT and SAT participants. PMID:23728822

  18. HIV screening among TB patients and co-trimoxazole preventive therapy for TB/HIV patients in Addis Ababa: facility based descriptive study.

    Science.gov (United States)

    Denegetu, Amenu Wesen; Dolamo, Bethabile Lovely

    2014-01-01

    Collaborative TB/HIV management is essential to ensure that HIV positive TB patients are identified and treated appropriately, and to prevent tuberculosis (TB) in HIV positive patients. The purpose of this study was to assess HIV case finding among TB patients and Co-trimoxazole Preventive Therapy (CPT) for HIV/TB patients in Addis Ababa. A descriptive cross-sectional, facility-based survey was conducted between June and July 2011. Data was collected by interviewing 834 TB patients from ten health facilities in Addis Ababa. Both descriptive and inferential statistics were used to summarize and analyze findings. The proportion of TB patients who (self reported) were offered for HIV test, tested for HIV and tested HIV positive during their anti-TB treatment follow-up were; 87.4%, 69.4% and 20.2%; respectively. Eighty seven HIV positive patients were identified, who knew their status before diagnosed for the current TB disease, bringing the cumulative prevalence of HIV among TB patients to 24.5%. Hence, the proportion of TB patients who knew their HIV status becomes 79.9%. The study revealed that 43.6% of those newly identified HIV positives during anti-TB treatment follow-up were actually treated with CPT. However, the commutative proportion of HIV positive TB patients who were ever treated with CPT was 54.4%; both those treated before the current TB disease and during anti-TB treatment follow-up. HIV case finding among TB patients and provision of CPT for TB/HIV co-infected patients needs boosting. Hence, routine offering of HIV test and provision of CPT for PLHIV should be strengthened in-line with the national guidelines.

  19. Direct Application of the INNO-LiPA Rif.TB Line-Probe Assay for Rapid Identification of Mycobacterium tuberculosis Complex Strains and Detection of Rifampin Resistance in 360 Smear-Positive Respiratory Specimens from an Area of High Incidence of Multidrug-Resistant Tuberculosis

    Science.gov (United States)

    Viveiros, Miguel; Leandro, Clara; Rodrigues, Liliana; Almeida, Josefina; Bettencourt, Rosário; Couto, Isabel; Carrilho, Lurdes; Diogo, José; Fonseca, Ana; Lito, Luís; Lopes, João; Pacheco, Teresa; Pessanha, Mariana; Quirim, Judite; Sancho, Luísa; Salfinger, Max; Amaral, Leonard

    2005-01-01

    The INNO-LiPA Rif.TB assay for the identification of Mycobacterium tuberculosis complex strains and the detection of rifampin (RIF) resistance has been evaluated with 360 smear-positive respiratory specimens from an area of high incidence of multidrug-resistant tuberculosis (MDR-TB). The sensitivity when compared to conventional identification/culture methods was 82.2%, and the specificity was 66.7%; the sensitivity and specificity were 100.0% and 96.9%, respectively, for the detection of RIF resistance. This assay has the potential to provide rapid information that is essential for the effective management of MDR-TB. PMID:16145166

  20. Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins

    NARCIS (Netherlands)

    Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.

    1997-01-01

    The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes

  1. Impact of telemonitoring approaches on integrated HIV and TB diagnosis and treatment interventions in sub-Saharan Africa: a scoping review

    Directory of Open Access Journals (Sweden)

    Clarence S Yah

    2017-03-01

    Results: We found telemonitoring approaches as a convenient and sustained proxy-method of HIV and TB risk reduction strategies including early diagnosis and prompt quality clinical outcomes. This has shown to significantly contribute in decreasing health systems/patients cost, long waiting time in clinics, hospital visits, travels and time off/on from work. Conclusion: Telemonitoring/mhealth (electronic phone text/video/materials messaging adoption, integration, acceptability, access and uptake are crucial in monitoring and improving HIV and TB uptake, retention, adherence and coverage in both local and national interventions programs. Improved integrated HIV and TB telemonitoring sustainability hold great promises in health systems strengthening including patient early centered diagnosis and care delivery, uptake and retention in medications/ services and improvement of patients’ quality of life.

  2. What are the reasons for patients not adhering to their anti-TB ...

    African Journals Online (AJOL)

    2008-11-13

    Nov 13, 2008 ... patients started their anti-TB treatment, according to the known factors that influence TB adherence. The patients .... Inadequate relationship between health care provider and patient ..... on the Internet] [cited 2009 Jan. 12].

  3. Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog

    Directory of Open Access Journals (Sweden)

    Rosa Gagliardi B.

    2013-08-01

    Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.

  4. Tracking and Treating Mobile Populations. The TB Net System. Migrant Clinicians Network Monograph Series. = El Sistema de Red para la TB.

    Science.gov (United States)

    Migrant Clinicians Network, Inc., Austin, TX.

    A comprehensive tracking and referral network that helps provide continuity of care for mobile populations with active tuberculosis (TB) or TB infection is considered essential for effective treatment of TB. However, the interstate referral system that exists between state health departments has been highly inefficient for serving migrant…

  5. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    International Nuclear Information System (INIS)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

    1990-01-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

  6. Treatment practices in pulmonary tuberculosis by private sector physicians of Meerut, Uttar Pradesh.

    Science.gov (United States)

    Yadav, A; Garg, S K; Chopra, H; Bajpai, S K; Bano, T; Jain, S; Kumar, A

    2012-01-01

    Majority of the qualified medical practitioners in the country are in the private sector and more than half of patients with tuberculosis (TB) seek treatment from them. The present study was conducted with the objective of assessing the treatment modalities in pulmonary tuberculosis by the private physicians in Meerut City, Uttar Pradesh, India. A cross-sectional study was carried out covering all the private physicians (graduates and postgraduates in Medicine and Chest Diseases) registered under the Indian Medical Association, Meerut Branch (n = 154). The physicians were interviewed by a pre-designed and pre-tested questionnaire about the treatment modalities practiced by them. Only 43.5% private physicians had attended any Revised National Tuberculosis Control Programme (RNTCP) training in the past five years. Only 33.1% of them were aware of the International Standards of Tuberculosis Care (ISTC). Fifty-three different regimens were used to treat the patients. Majority of physicians (76%) prescribed daily regimens while 24% administered both daily and intermittent treatment. None of the private physicians prescribed exclusive intermittent regimen. Eighty-seven different treatment regimens were used for the treatment of multidrug-resistant TB (MDR-TB) with none of them prescribing standard treatment under RNTCP. As majority of private practitioners do not follow RNTCP guidelines for treating TB, there is an urgent need for their continued education in this area.

  7. Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol.

    Science.gov (United States)

    Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

    2016-10-17

    Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This evaluation is innovative as it combines patient and health system costs, as well as operational modelling in assessing the impact. An economic evaluation nested in a clinical trial with 2 arms will be performed at 4 facilities. The primary outcome measure is incremental cost to the health system of the study regimen compared with the control regimen. Secondary outcome measures are mean incremental costs incurred by patients by treatment outcome; patient costs by category (direct medical costs, transport, food and accommodation costs, and cost of guardians/accompanying persons and lost time); health systems cost by category and drugs; and costs related to serious adverse events. The study has been evaluated and approved by the Ethics Advisory Group of the International Union Against Tuberculosis and Lung Disease; South African Medical Research Ethics Committee; Wits Health Consortium Protocol Review Committee; University of the Witwatersrand Human Research Ethics Committee; University of Kwazulu-Natal Biomedical Research Ethics Committee; St Peter TB Specialized Hospital Ethical Review Committee; AHRI-ALERT Ethical Review Committee, and all participants will provide written informed consent. The results of the economic evaluation will be published in a peer-reviewed journal. ISRCTN78372190. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  8. Nanotechnology-Based Approach in Tuberculosis Treatment

    Directory of Open Access Journals (Sweden)

    Mohammad Nasiruddin

    2017-01-01

    Full Text Available Tuberculosis, commonly known as TB, is the second most fatal infectious disease after AIDS, caused by bacterium called Mycobacterium tuberculosis. Prolonged treatment, high pill burden, low compliance, and stiff administration schedules are factors that are responsible for emergence of MDR and XDR cases of tuberculosis. Till date, only BCG vaccine is available which is ineffective against adult pulmonary TB, which is the most common form of disease. Various unique antibodies have been developed to overcome drug resistance, reduce the treatment regimen, and elevate the compliance to treatment. Therefore, we need an effective and robust system to subdue technological drawbacks and improve the effectiveness of therapeutic drugs which still remains a major challenge for pharmaceutical technology. Nanoparticle-based ideology has shown convincing treatment and promising outcomes for chronic infectious diseases. Different types of nanocarriers have been evaluated as promising drug delivery systems for various administration routes. Controlled and sustained release of drugs is one of the advantages of nanoparticle-based antituberculosis drugs over free drug. It also reduces the dosage frequency and resolves the difficulty of low poor compliance. This paper reviews various nanotechnology-based therapies which can be used for the treatment of TB.

  9. TTFields alone and in combination with chemotherapeutic agents effectively reduce the viability of MDR cell sub-lines that over-express ABC transporters

    International Nuclear Information System (INIS)

    Schneiderman, Rosa S; Shmueli, Esther; Kirson, Eilon D; Palti, Yoram

    2010-01-01

    Exposure of cancer cells to chemotherapeutic agents may result in reduced sensitivity to structurally unrelated agents, a phenomenon known as multidrug resistance, MDR. The purpose of this study is to investigate cell growth inhibition of wild type and the corresponding MDR cells by Tumor Treating Fields - TTFields, a new cancer treatment modality that is free of systemic toxicity. The TTFields were applied alone and in combination with paclitaxel and doxorubicin. Three pairs of wild type/MDR cell lines, having resistivity resulting from over-expression of ABC transporters, were studied: a clonal derivative (C11) of parental Chinese hamster ovary AA8 cells and their emetine-resistant sub-line Emt R1 ; human breast cancer cells MCF-7 and their mitoxantrone-resistant sub lines MCF-7/Mx and human breast cancer cells MDA-MB-231 and their doxorubicin resistant MDA-MB-231/Dox cells. TTFields were applied for 72 hours with and without the chemotherapeutic agents. The numbers of viable cells in the treated cultures and the untreated control groups were determined using the XTT assay. Student t-test was applied to asses the significance of the differences between results obtained for each of the three cell pairs. TTFields caused a similar reduction in the number of viable cells of wild type and MDR cells. Treatments by TTFields/drug combinations resulted in a similar increased reduction in cell survival of wild type and MDR cells. TTFields had no effect on intracellular doxorubicin accumulation in both wild type and MDR cells. The results indicate that TTFields alone and in combination with paclitaxel and doxorubicin effectively reduce the viability of both wild type and MDR cell sub-lines and thus can potentially be used as an effective treatment of drug resistant tumors

  10. Role of MRP-1 and GST-Pi in MDR and their inhibition by ...

    African Journals Online (AJOL)

    Samia A. Ebeed

    2016-08-16

    Aug 16, 2016 ... Various mechanisms were proposed that underlie MDR in malignant cells. ... the gene that confers MDR in lung cancer cells. MRP1 acts in order to protect ... the many physiological and pathophysiological processes influ-.

  11. Specificity of drug transport mediated by CaMDR1: a major facilitator ...

    Indian Academy of Sciences (India)

    Unknown

    CaMDR1 encodes a major facilitator superfamily (MFS) protein in Candida albicans whose expression has been linked to .... by plaque assay and the integration of CaMDR1 at the ... with recombinant virus, vAcCaMDR1 and cells infected.

  12. Mechanisms of antibiotic resistance in Mycobacterium tuberculosis, validation of methods BACTECTM MGIT 960 and AnyplexM TII MTB / MDR / XDR Detection for detection of antibiotic resistance to first and second line in Mycobacterium tuberculosis strains

    International Nuclear Information System (INIS)

    Centeno Urena, Yadel

    2014-01-01

    A literature review is developed of drug-resistant TB in the world and in Costa Rica. The mechanisms of resistance to antibiotics are studied of the bacterium that causes tuberculosis; drug resistance to first-line and second-line, treatment regimen according to the World Health Organization and edge detection methods available in the market. The agreement between the results is studied by the phenotypic detection system of resistance of M. tuberculosis BACTEC MGIT960 and PCR, in real-time of commercial kit Anyplex II MTB/MDR/XDR, for genotypic identification of M. tuberculosis and related mutations to resistance with the referring results to thirty strains provided by the Pan American Health Organization, allowing a significant shortening in the time of obtaining reliable results. The results obtained have allowed to suggest a possible implementation at the Centro Nacional de Referencia en Micobacteriologia (CNRM), to perform antibiotic susceptibility testing and genotypic testing of multidrug cases respectively. The study results have allowed the implementation of the technology of genotypic detection of M. tuberculosis in the CNRM, obtaining for the first time in Costa Rica, information about genes of M. tuberculosis related to the generation of resistance to the major drugs of Primary treatment scheme as well as testing of resistance to second-line drug for resistant strains referred to the Centro Nacional de Referencia en Micobacteriologia in 2013. (author) [es

  13. RESEARCH Improving access and quality of care in a TB control ...

    African Journals Online (AJOL)

    or treatment. Improving access and quality of care in a. TB control programme. Vera Scott, Virginia Azevedo, Judy Caldwell. Objectives. To use a quality improvement approach to improve access to and quality of tuberculosis (TB) diagnosis and care in. Cape Town. Methods. Five HIV/AIDS/sexually transmitted infections/TB.

  14. The progression of tb diagnosis in the hiv era: from microscopes to ...

    African Journals Online (AJOL)

    smear-negative pulmonary TB, hospitalised. HIV-infected patients with advanced and disseminated disease, young children and patients with extrapulmonary forms of TB, clinical case definitions and algorithms can be beneficial for guiding the empiric use of anti-TB treatment. Multiple clinical case definitions and algorithms ...

  15. The time delay of patients presenting with symptoms of TB at TC ...

    African Journals Online (AJOL)

    Tuberculosis (TB) is a major health problem in South Africa. The early detection and treatment of TB cases are essential. The impression of senior staff working at the TC Newman Community Health Centre (TCN), Paarl was that there often is an unnecessary time delay between the presentation of TB symptoms and the ...

  16. Changes of Tc-99m sestamibi uptake in P-glycoprotein expressing leukaemia cells treated in vivo with antisense oligodeoxynucleotide complementary to mdr1 mRNA

    International Nuclear Information System (INIS)

    Kinuya, S.; Yokoyama, K; Fukuoka, M.; Michigishi, T.; Tonami, N.; Shiba, K.; Mori, H.; Watanabe, N.; Shuke, N.

    2006-01-01

    We examined the feasibility of Tc-99m sestamibi to monitor changes of mRNA expression of MDRl/P-glycoprotein (Pgp) following antisense oligodeoxynucleotide (AS-ODN) treatment in vivo. Three days after the intraperitoneal inoculation of murine leukaemia P388/R cells expressing MDR1/P-gp in CDFI mice, 15-mer phosphorothioate ASODN to the initiation codon of mouse mdr1 mRNA was administered intraperitoneally at 10 mg/kg daily for 3 or 4 days. Cells collected from ascites were suspended in medium for Tc-99m sestamibi uptake studies. To know the duration of antisense effects, cells were harvested 2 days later after the 3-day treatment. AS-ODN treatment increased Tc-99m sestamibi uptake. Effects of 3-day treatment and 4-day treatment were the same. Treatment effects were not detected when uptake was observed 2 days after 3-day treatment. Based on the results it was concluded that in vivo treatment with AS-ODN specific to the coding portion of mdr1 mRNA increased Tc-99m sestamibi uptake in leukaemia cells possessing MDR function. (author)

  17. Poor Outcomes in a Cohort of HIV-Infected Adolescents Undergoing Treatment for Multidrug-Resistant Tuberculosis in Mumbai, India

    Science.gov (United States)

    Isaakidis, Petros; Paryani, Roma; Khan, Samsuddin; Mansoor, Homa; Manglani, Mamta; Valiyakath, Asmaa; Saranchuk, Peter; Furin, Jennifer

    2013-01-01

    Background Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB) in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10–19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF) project in Mumbai, India. Methods A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. Results The median age was 16 (IQR 14–18) years and 54% were female. Five (46%) adolescents had pulmonary TB (PTB), two (18%) extrapulmonary disease (EPTB) and four (36%) had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8–250.5). By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5%) patients: one was cured and three were still on treatment with negative culture results. Seven patients (64%) had poor outcomes: four (36.5%) died and three (27%) defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100%) on-treatment experienced adverse events (AEs): two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. Conclusions Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial

  18. Poor outcomes in a cohort of HIV-infected adolescents undergoing treatment for multidrug-resistant tuberculosis in Mumbai, India.

    Directory of Open Access Journals (Sweden)

    Petros Isaakidis

    Full Text Available BACKGROUND: Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10-19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF project in Mumbai, India. METHODS: A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. RESULTS: The median age was 16 (IQR 14-18 years and 54% were female. Five (46% adolescents had pulmonary TB (PTB, two (18% extrapulmonary disease (EPTB and four (36% had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8-250.5. By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5% patients: one was cured and three were still on treatment with negative culture results. Seven patients (64% had poor outcomes: four (36.5% died and three (27% defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100% on-treatment experienced adverse events (AEs: two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. CONCLUSIONS: Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial

  19. Poor outcomes in a cohort of HIV-infected adolescents undergoing treatment for multidrug-resistant tuberculosis in Mumbai, India.

    Science.gov (United States)

    Isaakidis, Petros; Paryani, Roma; Khan, Samsuddin; Mansoor, Homa; Manglani, Mamta; Valiyakath, Asmaa; Saranchuk, Peter; Furin, Jennifer

    2013-01-01

    Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB) in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10-19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF) project in Mumbai, India. A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. The median age was 16 (IQR 14-18) years and 54% were female. Five (46%) adolescents had pulmonary TB (PTB), two (18%) extrapulmonary disease (EPTB) and four (36%) had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8-250.5). By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5%) patients: one was cured and three were still on treatment with negative culture results. Seven patients (64%) had poor outcomes: four (36.5%) died and three (27%) defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100%) on-treatment experienced adverse events (AEs): two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial support for co-infected adolescents

  20. Editorial: Carpe diem ('Seize the day'): Building on the findings of the ...

    African Journals Online (AJOL)

    Editorial: Carpe diem ('Seize the day'): Building on the findings of the 2015 World Health Organization evaluation of the multidrugresistant tuberculosis (MDR-TB) programme to make the most of shortened MDR-TB treatment in South Africa.

  1. Diabetes and Other Risk Factors for Multi-drug Resistant Tuberculosis in a Mexican Population with Pulmonary Tuberculosis: Case Control Study.

    Science.gov (United States)

    Gómez-Gómez, Alejandro; Magaña-Aquino, Martin; López-Meza, Salvador; Aranda-Álvarez, Marcelo; Díaz-Ornelas, Dora E; Hernández-Segura, María Guadalupe; Salazar-Lezama, Miguel Ángel; Castellanos-Joya, Martín; Noyola, Daniel E

    2015-02-01

    Multidrug resistant tuberculosis (MDR-TB) poses problems in treatment, costs and treatment outcomes. It is not known if classically described risk factors for MDR-TB in other countries are the same in Mexico and the frequency of the association between diabetes mellitus (DM) and MDR-TB in our country is not clear. We undertook this study to analyze risk factors associated with the development of MDR-TB, with emphasis on DM. A case-control study in the state of San Luis Potosi (SLP), Mexico was carried out. All pulmonary MDR-TB patients diagnosed in the state of SLP between 1998 and 2013 (36 cases) evaluated at a state pharmacoresistant tuberculosis (TB) clinic and committee; 139 controls were randomly selected from all pulmonary non-multidrug-resistant tuberculosis (non-MDR-TB) cases identified between 2003 and 2008. Cases and controls were diagnosed and treated under programmatic conditions. Age, gender, malnutrition, being a health-care worker, HIV/AIDS status, and drug abuse were not significantly different between MDR-TB and non-MDR-TB patients. Significant differences between MDR-TB and non-MDR-TB patients were DM (47.2 vs. 28.1%; p = 0.028); previous anti-TB treatments (3 vs. 0, respectively; p <0.001), and duration of first anti-TB treatment (8 vs. 6 months, respectively; p <0.001). MDR-TB and DM are associated in 47.2% of MDR TB cases (17/36) in this study. Other recognized factors were not found to be significantly different in MDR-TB compared to non-MDR-TB in this study. Cost-feasible strategies must be implemented in the treatment of DM-TB in order to prevent the selection of MDR-TB. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

  2. Treatment results of patients with multiple and extensive drug resistance registered in 2012 in the Russian Federation and in the world

    Directory of Open Access Journals (Sweden)

    S. A. Sterlikov

    2016-01-01

    Full Text Available The chemotherapy results have been analyzed in tuberculosis patients suffering from multiple drug resistance registered for treatment in the Russian Federation in 2011-2012 compared with the treatment outcomes of MDR patients registered for treatment in the world, BRICS and countries of the former Soviet Union in 2011. Treatment outcomes of XDR TB patients have been analyzed for the first time. Chemotherapy efficiency in MDR TB patients in the Russian Federation in the cohort of 2011 made 37.1%, and in the cohort of 2012 made 39.1%, which significantly lower than in the world in general (47.5%, in BRICS and countries of the former Soviet Union; this low treatment efficiency is mostly due to treatment failures (18.3% and those died (19.1%. The treatment efficiency of XDR TB patients registered for treatment in the Russian Federation in 2012 made 26.2% versus 22.0% in the cohort of 2011. Considering the significant financial costs spent on the treatment, the chemotherapy efficiency of M/XDR TB patients in the Russian Federation is too low to improve the epidemic situation and some additional measures are to be taken for its improvement.

  3. Tuberculosis Treatment

    African Journals Online (AJOL)

    Tuberculosis Treatment, Lusaka, Zambia. 1. 2. 2. 3. 3 ... TB treatment has contributed to the steady rise of TB incidence in ... respondents (89.4%) had positive attitude towards TB treatment ..... respondents described feelings of depression, anger and apathy .... Journal of Personality and Social Psychology,. 1979, 37:1-11.

  4. Provider-initiated HIV testing and counselling for TB patients and suspects in Nairobi, Kenya.

    Science.gov (United States)

    Odhiambo, J; Kizito, W; Njoroge, A; Wambua, N; Nganga, L; Mburu, M; Mansoer, J; Marum, L; Phillips, E; Chakaya, J; De Cock, K M

    2008-03-01

    Integrated tuberculosis (TB) and human immunodeficiency virus (HIV) services in a resource-constrained setting. Pilot provider-initiated HIV testing and counselling (PITC) for TB patients and suspects. Through partnerships, resources were mobilised to establish and support services. After community sensitisation and staff training, PITC was introduced to TB patients and then to TB suspects from December 2003 to December 2005. Of 5457 TB suspects who received PITC, 89% underwent HIV testing. Although not statistically significant, TB suspects with TB disease had an HIV prevalence of 61% compared to 63% for those without. Of the 614 suspects who declined HIV testing, 402 (65%) had TB disease. Of 2283 patients referred for cotrimoxazole prophylaxis, 1951 (86%) were enrolled, and of 1727 patients assessed for antiretroviral treatment (ART), 1618 (94%) were eligible and 1441 (83%) started treatment. PITC represents a paradigm shift and is feasible and acceptable to TB patients and TB suspects. Clear directives are nevertheless required to change practice. When offered to TB suspects, PITC identifies large numbers of persons requiring HIV care. Community sensitisation, staff training, multitasking and access to HIV care contributed to a high acceptance of HIV testing. Kenya is using this experience to inform national response and advocate wide PITC implementation in settings faced with the TB-HIV epidemic.

  5. TIME Impact - a new user-friendly tuberculosis (TB) model to inform TB policy decisions.

    Science.gov (United States)

    Houben, R M G J; Lalli, M; Sumner, T; Hamilton, M; Pedrazzoli, D; Bonsu, F; Hippner, P; Pillay, Y; Kimerling, M; Ahmedov, S; Pretorius, C; White, R G

    2016-03-24

    Tuberculosis (TB) is the leading cause of death from infectious disease worldwide, predominantly affecting low- and middle-income countries (LMICs), where resources are limited. As such, countries need to be able to choose the most efficient interventions for their respective setting. Mathematical models can be valuable tools to inform rational policy decisions and improve resource allocation, but are often unavailable or inaccessible for LMICs, particularly in TB. We developed TIME Impact, a user-friendly TB model that enables local capacity building and strengthens country-specific policy discussions to inform support funding applications at the (sub-)national level (e.g. Ministry of Finance) or to international donors (e.g. the Global Fund to Fight AIDS, Tuberculosis and Malaria).TIME Impact is an epidemiological transmission model nested in TIME, a set of TB modelling tools available for free download within the widely-used Spectrum software. The TIME Impact model reflects key aspects of the natural history of TB, with additional structure for HIV/ART, drug resistance, treatment history and age. TIME Impact enables national TB programmes (NTPs) and other TB policymakers to better understand their own TB epidemic, plan their response, apply for funding and evaluate the implementation of the response.The explicit aim of TIME Impact's user-friendly interface is to enable training of local and international TB experts towards independent use. During application of TIME Impact, close involvement of the NTPs and other local partners also builds critical understanding of the modelling methods, assumptions and limitations inherent to modelling. This is essential to generate broad country-level ownership of the modelling data inputs and results. In turn, it stimulates discussions and a review of the current evidence and assumptions, strengthening the decision-making process in general.TIME Impact has been effectively applied in a variety of settings. In South Africa, it

  6. Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)

    International Nuclear Information System (INIS)

    Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.

    2002-01-01

    Full text: Cellular resistance or Multidrug Resistance (MDR) to cytotoxic agents is the major cause of treatment failure in many human cancers. P-glycoprotein (Pgp), a Mr 17,0000 transmembrane protein and Multi Resistance Protein (MRP) are two proteins that are over expressed and confer resistance to a large number of chemotherapeutic agents by enhancing their extracellular transport. P-glycoprotein is expressed at a relative high level in treated and untreated human malignant tumours, including renal, colonic, adrenal, hepatocellular carcinoma and a considerable percentage of breast carcinomas. 99m Tc-Sestamibi, a lipophilic cationic complex is a transport substrate for Pgp. In clinical studies of human neoplasms it was found that tumour uptake and clearance of this tracer correlate with Pgp expression and may be used for the phenotypic assessment of MDR. However, new tracers with better substrate specificity for Pgp and other drug transporters would greatly assist in optimising chemotherapeutic treatment and improving patient management by predicting tumour response to therapy and to assist in the development of antagonists, which may reverse or halt MDR. The aim of this project is therefore to develop PET and SPECT radiopharmaceuticals with improved affinity and selectivity for Pgp and MRP for the clinical evaluation of MDR in cancer patients. To optimise cellular transport characteristics, a number of chemical families that have been found to be substrates of Pgp and other drug efflux pumps, will be investigated. In the first instance, a series of drugs based on the flavonol natural product, Quercetin will be developed, screened for MDR and radiolabelled with PET and SPECT isotopes. Quercetin and related flavonol derivatives have been selected for this project because of their moderate to good affinity for Pgp. With the assistance of molecular modeling and in vitro studies, structural modification will be undertaken to improve the specificity and affinity for

  7. Reversing multidrug resistance in Caco-2 by silencing MDR1, MRP1, MRP2, and BCL-2/BCL-xL using liposomal antisense oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Yu-Li Lo

    Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity

  8. PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR

    Directory of Open Access Journals (Sweden)

    Nagaraju Anreddy

    2014-06-01

    Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.

  9. Infrequent detection of Pneumocystis jirovecii by PCR in oral wash specimens from TB patients with or without HIV and healthy contacts in Tanzania

    DEFF Research Database (Denmark)

    Jensen, Lotte; Jensen, Andreas V; Praygod, George

    2010-01-01

    In tuberculosis (TB) endemic parts of the world, patients with pulmonary symptoms are managed as "smear-negative TB patients" if they do not improve on a two-week presumptive, broad-spectrum course of antibiotic treatment even if they are TB microscopy smear negative. These patients are frequentl......- and TB-endemic area of sub-Saharan Africa....

  10. Concordant or discordant results by the tuberculin skin test and the quantiFERON-TB test in children reflect immune biomarker profiles

    DEFF Research Database (Denmark)

    Dhanasekaran, S; Jenum, S; Stavrum, R

    2014-01-01

    The tuberculin skin test (TST) and QuantiFERON-TB-Gold-In-tube (QFTGIT) are adjunctive tests used in the diagnosis of pediatric tuberculosis (TB). Neither test can rule out TB; however, a positive test usually triggers preventive treatment in TB contacts aged <5 years. TST and QFTGIT can give div...

  11. TB-IRIS and remodelling of the T cell compartment in highly immunosuppressed HIV+ patients with TB: the CAPRI T (ANRS-12614) study

    Science.gov (United States)

    Haridas, V.; Pean, P.; Jasenosky, L.D.; Madec, Y.; Laureillard, D.; Sok, T.; Sath, S.; Borand, L.; Marcy, O.; Chan, S.; Tsitsikov, E.; Delfraissy, J.-F.; Blanc, F.-X.; Goldfeld, A.E.

    2015-01-01

    Objective To investigate the impact of tuberculosis (TB)-associated immune reconstitution syndrome (IRIS) upon immunological recovery and the T cell compartment after initiation of TB and antiretroviral therapy (ART). Design and methods We prospectively evaluated T cell immunophenotypes by flow cytometry and cytokines by Luminex assays in a subset (n=154) of highly immunosuppressed HIV+ patients with TB from the CAMELIA randomized clinical trial. We compared findings from patients who developed TB-IRIS to findings from patients who did not develop TB-IRIS. Data were evaluated with mixed effect linear regression, Kaplan-Meier estimates, and Wilcoxon rank sum tests, and q-values were calculated to control for multiple comparisons. Results Development of TB-IRIS was associated with significantly greater pre-ART frequencies of HLA-DR+CD45RO+CD4+, CCR5+CD4+, OX40+CD4+, and Fas+ effector memory (EM) CD8+ T cells, and significantly elevated levels of plasma IL-6, IL-1β, IL-8, and IL-10 and viral load. Post-ART initiation, EM CD4+ and Fas+ EM CD4+ T cell frequencies significantly expanded, and central memory (CM) CD4+ T cell frequencies significantly contracted in patients who experienced TB-IRIS. By week 34 post-TB treatment initiation, EM/CM CD4+ T cell ratios were markedly higher in TB-IRIS versus non-TB-IRIS patients. Conclusions A distinct pattern of pre-ART T cell and cytokine markers appear to poise the immune response to develop TB-IRIS. Experience of TB-IRIS is then associated with long-term remodeling of the CD4+ T cell memory compartment towards an EM-dominated phenotype. We speculate that these pre- and post-ART TB-IRIS-associated immune parameters may contribute to superior immune control of TB/HIV co-infection and better clinical outcome. PMID:25486415

  12. Sequential analysis as a tool for detection of amikacin ototoxicity in the treatment of multidrug-resistant tuberculosis.

    Science.gov (United States)

    Vasconcelos, Karla Anacleto de; Frota, Silvana Maria Monte Coelho; Ruffino-Netto, Antonio; Kritski, Afrânio Lineu

    2018-04-01

    To investigate early detection of amikacin-induced ototoxicity in a population treated for multidrug-resistant tuberculosis (MDR-TB), by means of three different tests: pure-tone audiometry (PTA); high-frequency audiometry (HFA); and distortion-product otoacoustic emission (DPOAE) testing. This was a longitudinal prospective cohort study involving patients aged 18-69 years with a diagnosis of MDR-TB who had to receive amikacin for six months as part of their antituberculosis drug regimen for the first time. Hearing was assessed before treatment initiation and at two and six months after treatment initiation. Sequential statistics were used to analyze the results. We included 61 patients, but the final population consisted of 10 patients (7 men and 3 women) because of sequential analysis. Comparison of the test results obtained at two and six months after treatment initiation with those obtained at baseline revealed that HFA at two months and PTA at six months detected hearing threshold shifts consistent with ototoxicity. However, DPOAE testing did not detect such shifts. The statistical method used in this study makes it possible to conclude that, over the six-month period, amikacin-associated hearing threshold shifts were detected by HFA and PTA, and that DPOAE testing was not efficient in detecting such shifts.

  13. Preferential cytotoxicity of bortezomib toward highly malignant human liposarcoma cells via suppression of MDR1 expression and function

    International Nuclear Information System (INIS)

    Hu, Yamei; Wang, Lingxian; Wang, Lu; Wu, Xuefeng; Wu, Xudong; Gu, Yanhong; Shu, Yongqian; Sun, Yang; Shen, Yan; Xu, Qiang

    2015-01-01

    Liposarcoma is the most common soft tissue sarcoma with a high risk of relapse. Few therapeutic options are available for the aggressive local or metastatic disease. Here, we report that the clinically used proteasome inhibitor bortezomib exhibits significantly stronger cytotoxicity toward highly malignant human liposarcoma SW872-S cells compared with its parental SW872 cells, which is accompanied by enhanced activation of apoptotic signaling both in vitro and in vivo. Treatment of cells with Jun-N-terminal kinase (JNK) inhibitor SP60015 or the translation inhibitor cycloheximide ameliorated this enhanced apoptosis. Bortezomib inhibited MDR1 expression and function more effectively in SW872-S cells than in SW872 cells, indicating that the increased cytotoxicity relies on the degree of proteasome inhibition. Furthermore, the pharmacological or genetic inhibition of sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2, which is highly expressed in SW872-S cells, resulted in partial reversal of cell growth inhibition and increase of MDR1 expression in bortezomib-treated SW872-S cells. These results show that bortezomib exhibits preferential cytotoxicity toward SW872-S cells possibly via highly expressed SERCA2-associated MDR1 suppression and suggest that bortezomib may serve as a potent agent for treating advanced liposarcoma. - Highlights: • We compare the cytotoxicity of different drugs between SW872-S and SW872 cells. • Highly malignant liposarcoma cells SW872-S show hypersensitivity to bortezomib. • Apoptotic signaling is robustly enhanced in bortezomib-treated SW872-S cells. • Bortezomib has strong suppression on MDR1 expression and function in SW872-S cells. • Inhibition of SERCA2 protects SW872-S cells from bortezomib

  14. Preferential cytotoxicity of bortezomib toward highly malignant human liposarcoma cells via suppression of MDR1 expression and function

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Yamei; Wang, Lingxian; Wang, Lu; Wu, Xuefeng; Wu, Xudong [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Gu, Yanhong; Shu, Yongqian [Department of Clinical Oncology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029 (China); Sun, Yang [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Shen, Yan, E-mail: shenyan@nju.edu.cn [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Xu, Qiang, E-mail: molpharm@163.com [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China)

    2015-02-15

    Liposarcoma is the most common soft tissue sarcoma with a high risk of relapse. Few therapeutic options are available for the aggressive local or metastatic disease. Here, we report that the clinically used proteasome inhibitor bortezomib exhibits significantly stronger cytotoxicity toward highly malignant human liposarcoma SW872-S cells compared with its parental SW872 cells, which is accompanied by enhanced activation of apoptotic signaling both in vitro and in vivo. Treatment of cells with Jun-N-terminal kinase (JNK) inhibitor SP60015 or the translation inhibitor cycloheximide ameliorated this enhanced apoptosis. Bortezomib inhibited MDR1 expression and function more effectively in SW872-S cells than in SW872 cells, indicating that the increased cytotoxicity relies on the degree of proteasome inhibition. Furthermore, the pharmacological or genetic inhibition of sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2, which is highly expressed in SW872-S cells, resulted in partial reversal of cell growth inhibition and increase of MDR1 expression in bortezomib-treated SW872-S cells. These results show that bortezomib exhibits preferential cytotoxicity toward SW872-S cells possibly via highly expressed SERCA2-associated MDR1 suppression and suggest that bortezomib may serve as a potent agent for treating advanced liposarcoma. - Highlights: • We compare the cytotoxicity of different drugs between SW872-S and SW872 cells. • Highly malignant liposarcoma cells SW872-S show hypersensitivity to bortezomib. • Apoptotic signaling is robustly enhanced in bortezomib-treated SW872-S cells. • Bortezomib has strong suppression on MDR1 expression and function in SW872-S cells. • Inhibition of SERCA2 protects SW872-S cells from bortezomib.

  15. When students become patients: TB disease among medical undergraduates in Cape Town, South Africa

    Directory of Open Access Journals (Sweden)

    Helene-Mari van der Westhuizen

    2017-06-01

    Full Text Available Background. Medical students acquire latent tuberculosis (TB infection at a rate of 23 cases/100 person-years. The frequency and impact of occupational TB disease in this population are unknown. Methods. A self-administered questionnaire was distributed via email and social media to current medical students and recently graduated doctors (2010 - 2015 at two medical schools in Cape Town. Individuals who had developed TB disease as undergraduate students were eligible to participate. Quantitative and qualitative data collected from the questionnaire and semi-structured interviews were analysed with descriptive statistics and a framework approach to identify emerging themes. Results. Twelve individuals (10 female reported a diagnosis of TB: pulmonary TB (n=6, pleural TB (n=3, TB lymphadenitis (n=2 and TB spine (n=1; 2/12 (17% had drug-resistant disease (DR-TB. Mean diagnostic delay post consultation was 8.1 weeks, with only 42% of initial diagnoses being correct. Most consulted private healthcare providers (general practitioners (n=7; pulmonologists (n=4, and nine underwent invasive procedures (bronchoscopy, pleural fluid aspiration and tissue biopsy. Substantial healthcare costs were incurred (mean ZAR25 000 for drug-sensitive TB, up to ZAR104 000 for DR-TB. Students struggled to obtain treatment, incurred high transport costs and missed academic time. Students with DR-TB interrupted their studies and experienced severe side-effects (hepatotoxicity, depression and permanent ototoxicity. Most participants cited poor TB infection-control practices at their training hospitals as a major risk factor for occupational TB. Conclusions. Undergraduate medical students in Cape Town are at high risk of occupationally acquired TB, with an unmet need for comprehensive occupational health services and support.

  16. Does the integration of TB medical services in the general hospital improve the quality of TB care? Evidence from a case study in China.

    Science.gov (United States)

    Sun, Qiang; Yin, Jia; Yin, Xiao; Zou, Guanyang; Liang, Mingli; Zhong, Jieming; Walley, John; Wei, Xiaolin

    2013-06-01

    Moving the clinical services from tuberculosis (TB) dispensary to the integrated county hospital (called integrated approach) has been practiced in China; however, it is unknown the quality of TB care in the integrated approach and in the dispensary approach. A total of 202 new TB patients were investigated using structured questionnaires in three counties implementing the integrated approach and one county implementing the dispensary approach. The quality of TB care is measured based on success rate of treatment, medical expenditure, health system delay and second-line drug use. The integrated approach showed a high success treatment rate. The medical expenditure in the integrated approach was USD 432, significantly lower than that in the dispensary approach (Z = -5.771, P < 0.001). The integrated approach had a shorter health system delay (5 days) than the dispensary approach (32 days). Twenty-six percent of patients in integrated hospitals were prescribed with second-line TB drugs, significantly lower than that in the TB dispensary (47%, χ(2) = 7.452, P = 0.006). However, the medical expenditure, use of second-line anti-TB drug and liver-protection drugs indeed varied greatly across the three integrated hospitals. The integrated approach showed better quality of TB care, but the performance of the integrated hospitals varied greatly. A method to standardize TB treatment and management of this approach is urgent.

  17. Detectemos la TB. Tratemos la TB. Trabajemos juntos para eliminar la TB. (Find TB. Treat TB. Working together to eliminate TB.)

    Centers for Disease Control (CDC) Podcasts

    2014-02-26

    Este podcast trata sobre el Día Mundial de la Tuberculosis y el tema de los CDC para el año 2014.  Created: 2/26/2014 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/26/2014.

  18. Construction of retrovirus vector taking MDR1/ACBC1 and its ...

    African Journals Online (AJOL)

    We successfully observed the expression of the reporter gene-GFP by using the green light fluorescence microscope and the p-glycoprotein (P-gp) expressed by exogenous gene MDR1 by Western Blotting. All these facts indicated that the retroviral vector PMX-flag-MDR1-GFP had successfully been transfected into ...

  19. Splice form variant and amino acid changes in MDR49 confers DDT resistance in transgenic Drosophila.

    Science.gov (United States)

    Seong, Keon Mook; Sun, Weilin; Clark, John M; Pittendrigh, Barry R

    2016-03-22

    The ATP-binding cassette (ABC) transporters represent a superfamily of proteins that have important physiological roles in both prokaryotes and eukaryotes. In insects, ABC transporters have previously been implicated in insecticide resistance. The 91-R strain of Drosophila melanogaster has been intensely selected with DDT over six decades. A recent selective sweeps analysis of 91-R implicated the potential role of MDR49, an ABC transporter, in DDT resistance, however, to date the details of how MDR49 may play a role in resistance have not been elucidated. In this study, we investigated the impact of structural changes and an alternative splicing event in MDR49 on DDT-resistance in 91-R, as compared to the DDT susceptible strain 91-C. We observed three amino acid differences in MDR49 when 91-R was compared with 91-C, and only one isoform (MDR49B) was implicated in DDT resistance. A transgenic Drosophila strain containing the 91-R-MDR49B isoform had a significantly higher LD50 value as compared to the 91-C-MDR49B isoform at the early time points (6 h to 12 h) during DDT exposure. Our data support the hypothesis that the MDR49B isoform, with three amino acid mutations, plays a role in the early aspects of DDT resistance in 91-R.

  20. Importancia pronóstica de la expresión de MDR-1 en la leucemia mieloblástica aguda

    Directory of Open Access Journals (Sweden)

    J. Arbelbide

    2003-08-01

    group of patients treated for AML. The expression of MDR-1 was retrospectively assessed in a cohort of 55 patients with AML, older than 16 years old, who received chemotherapy from 1990 to 2000. The presence of MDR-1/gp-P170 was evaluated on bone marrow biopsy by immunohistochemistry. A ROC curve established that an expression of > 50% of MDR-1 on blastic cells was significant for the achievement of complete remission. The expression of MDR-1+ correlated with the presence of leucocytosis (p:0.002, expression of CD34+ cells (p:0.006, less achievement of complete remission (p:0.001, more rate of relapse (p:0.02 and of non-favorable cytogenetics (p:0.02. The event-free survival was of 21.2% SE:9.3 with a follow up of 22 months for the group of MDR-1+ versus 56.4% SE 12.5 with a follow-up of 78 months for the MDR-1- group (p:0.007. It can be concluded that the expression of MDR-1 is a prognostic factor of resistance to chemotherapy. These patients present a lower rate of complete remission, a higher rate of relapse with persistence of post treatment residual disease, which produces a shorter global survival.

  1. Recovery, modernization and computerization of the monochromator MDR-23

    International Nuclear Information System (INIS)

    Miranda, L. J.

    2012-01-01

    For use in the Optics Laboratory, newly created in the CEADEN, one of the necessary equipment is the Monochromator MDR-23, which was necessary for recovery, modernization (replacing the power supply and control) and computerization by designing a VI (virtual instrument) to control stepper motor through a PC using Lab VIEW 7.1 that allows users to select the address mode, the number of steps and the engine speed and give the initial value of the position and limits the range of the monochromator to start working with it. The principle of operation of the program is done in detail to facilitate understanding of how to operate and use the graphical programming designed and achieve efficient use of equipment. (Author)

  2. A preliminary characterisation of recovered uranium produced by MDR

    International Nuclear Information System (INIS)

    Kwon, Hyuk Il; Davison, J.; Marsh, G.

    1997-10-01

    The CANFLEX-RU fuel to be developed for the future should be verified if it has any major problems in RU handling techniques and related technology development. For this purpose, a preliminary R and D efforts on the RU handling characteristics were executed by joint effort with BNFL in following area. 1) preparation of RU powder by the MDR process 2) Compaction and sintering characteristics of RU powder 3) required special process for the production of CANFLEX-RU fuel 4) characterization of fission product residue composition in the RU powder 5) radiological characterization of RU powder and sintered pellets. Physical characterization of RU UO 2 powder and pellet produced by the MDR process were similar with those of NU UO 2 powder and pellet. The density of RU pellets, however, were higher than those of NU pellets and RU pellets showed little higher values in pore size distributions. RU contained only negligibly low concentrations of fission products and actinides. Especially, the Cs-137 content in the powder (before sintering) were undetectable and therefore would not contaminate the sintering furnace. RU pellet showed higher impurity levels, especially in the Ni content. Radioactivity on the RU powder showed about twice higher value at the surface than those of NU, but showed drastic reduction by distance and became similar at the 1 meter distance. RU pellets showed close coincidence between NU and RU at any distance. This result could be used close coincidence between NU and RU at any distance. This result could be used as a basis of the feasibility assessment on the development of CANFLEX-RU. Through basic research works on the improvement of CANFLEX-RU fabrication processes, compatibility with CANFLEX-NU fabrication process will be evaluated and analysed. (author). 4 refs

  3. A preliminary characterisation of recovered uranium produced by MDR

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Hyuk Il [Korea Atomic Energy Research Inst., Daeduk (Korea, Republic of); Davison, J.; Marsh, G. [British Nuclear Forum, London (United Kingdom)

    1997-10-01

    The CANFLEX-RU fuel to be developed for the future should be verified if it has any major problems in RU handling techniques and related technology development. For this purpose, a preliminary R and D efforts on the RU handling characteristics were executed by joint effort with BNFL in following area. 1) preparation of RU powder by the MDR process 2) Compaction and sintering characteristics of RU powder 3) required special process for the production of CANFLEX-RU fuel 4) characterization of fission product residue composition in the RU powder 5) radiological characterization of RU powder and sintered pellets. Physical characterization of RU UO{sub 2} powder and pellet produced by the MDR process were similar with those of NU UO{sub 2} powder and pellet. The density of RU pellets, however, were higher than those of NU pellets and RU pellets showed little higher values in pore size distributions. RU contained only negligibly low concentrations of fission products and actinides. Especially, the Cs-137 content in the powder (before sintering) were undetectable and therefore would not contaminate the sintering furnace. RU pellet showed higher impurity levels, especially in the Ni content. Radioactivity on the RU powder showed about twice higher value at the surface than those of NU, but showed drastic reduction by distance and became similar at the 1 meter distance. RU pellets showed close coincidence between NU and RU at any distance. This result could be used close coincidence between NU and RU at any distance. This result could be used as a basis of the feasibility assessment on the development of CANFLEX-RU. Through basic research works on the improvement of CANFLEX-RU fabrication processes, compatibility with CANFLEX-NU fabrication process will be evaluated and analysed. (author). 4 refs.

  4. ECG-triggered MDR-CT for the detection of pulmonary metastases

    International Nuclear Information System (INIS)

    Pauls, S.; Wahl, J.; Aschoff, A.J.; Brambs, H.J.; Fleiter, T.R.

    2003-01-01

    Purpose: Comparison of multidetector-row CT (MDR-CT) of the chest with and without ECG triggering for the detection of pulmonary metastases. Materials and Methods: Fifty patients with malignant tumors underwent CT of the chest. The unenhanced phase was performed with ECG-triggered MDR-CT and the contrast-enhanced phase with helical MDR-CT. The ECG-triggered and standard helical scans were interpreted in separate sessions, with the analysis determining the number and demarcation of the intrapulmonary nodules and the delineation of the mediastinal structure (rated 1 = excellent to 5 = poor). Results: ECG-MDR-CT images detected 38% more pulmonary nodules than MDR-CT. The detection rate for tumors [de

  5. Treatment of Mycobacterium tuberculosis-Infected Macrophages with Poly(Lactic-Co-Glycolic Acid) Microparticles Drives NFκB and Autophagy Dependent Bacillary Killing.

    LENUS (Irish Health Repository)

    Lawlor, Ciaran

    2016-01-01

    The emergence of multiple-drug-resistant tuberculosis (MDR-TB) has pushed our available repertoire of anti-TB therapies to the limit of effectiveness. This has increased the urgency to develop novel treatment modalities, and inhalable microparticle (MP) formulations are a promising option to target the site of infection. We have engineered poly(lactic-co-glycolic acid) (PLGA) MPs which can carry a payload of anti-TB agents, and are successfully taken up by human alveolar macrophages. Even without a drug cargo, MPs can be potent immunogens; yet little is known about how they influence macrophage function in the setting of Mycobacterium tuberculosis (Mtb) infection. To address this issue we infected THP-1 macrophages with Mtb H37Ra or H37Rv and treated with MPs. In controlled experiments we saw a reproducible reduction in bacillary viability when THP-1 macrophages were treated with drug-free MPs. NFκB activity was increased in MP-treated macrophages, although cytokine secretion was unaltered. Confocal microscopy of immortalized murine bone marrow-derived macrophages expressing GFP-tagged LC3 demonstrated induction of autophagy. Inhibition of caspases did not influence the MP-induced restriction of bacillary growth, however, blockade of NFκB or autophagy with pharmacological inhibitors reversed this MP effect on macrophage function. These data support harnessing inhaled PLGA MP-drug delivery systems as an immunotherapeutic in addition to serving as a vehicle for targeted drug delivery. Such "added value" could be exploited in the generation of inhaled vaccines as well as inhaled MDR-TB therapeutics when used as an adjunct to existing treatments.

  6. Frequency of canine nt230(del4) MDR1 mutation in prone pure breeds, their crosses and mongrels in Israel - insights from a worldwide comparative perspective.

    Science.gov (United States)

    Dekel, Yaron; Machluf, Yossy; Stoler, Aviad; Aderet, Arava; Baumel, Daniel; Kellerman, Efrat; Plotsky, Yoram; Noked Partouche, Oshrat; Elhalal, Gal; Ben-Shlomo, Izhar; Bercovich, Dani

    2017-11-13

    Sensitivity to macrocyclic lactones, which are commonly used in veterinary clinics, was first found in Rough Collies, and was attributed in 2001 to a 4 bp deletion in the MDR1 gene. The list of affected breeds currently includes 13 breeds. Researchers from different countries and continents examined the allelic frequencies of the nt230(del4) MDR1 mutation, emphasizing the clinical importance of this test not only to mutation-prone dogs, but also to their crosses and mongrels, since treatment of a deletion carrier with these compounds may lead to its death. In this study, the allelic frequencies of nt230(del4) MDR1 mutation in affected breeds, their crosses, unrelated pure breeds and mongrels are reported for the state of Israel (n = 1416 dogs). The Israeli data were compared with reports from the US, Europe, UK, Australia and Japan. The allelic frequencies of nt230(del4) MDR1 mutation in Israel for Australian, Swiss and German Shepherds (31%, 17% and 2.4%, respectively) are similar to the corresponding frequencies worldwide, much higher for Border Collies (4.8%), twice lower for Rough Collies (28%, compared to 55% or more elsewhere), and ~1% for mongrels. The frequencies for crosses of Australian Shepherd and Border Collies in Israel are 4 and 1.6 times lower, respectively, compared to the frequencies for the respective pure breeds. This work, that for the first time presents the frequency of nt230(del4) MDR1 mutation in Israel, along with a worldwide survey, has implications for clinicians, owners and breeders of sheepdogs and their crosses and supports the need for extra care in treatment and in future breeding. Of note, the relative proportion of affected breeds, in the overall tested dogs, might be higher than their actual proportion in Israel due to directed samples collection by veterinarians for clinical purposes, as these are mainly limited to certain affected breeds or dogs that resemble them.

  7. HIV and intestinal parasites in adult TB patients in a teaching hospital in Northwest Ethiopia.

    Science.gov (United States)

    Kassu, Afework; Mengistu, Getahun; Ayele, Belete; Diro, Ermias; Mekonnen, Firew; Ketema, Dereje; Moges, Feleke; Mesfin, Tsehay; Getachew, Assefa; Ergicho, Bahiru; Elias, Daniel; Wondmikun, Yared; Aseffa, Abraham; Ota, Fusao

    2007-10-01

    The level of HIV infection and intestinal parasitoses among TB patients was assessed in a hospital-based cross-sectional study involving 257 patients in Gondar, Ethiopia. In TB patients, our study reported co-infection with HIV (52.1%) and intestinal parasites (40.9%) The high prevalence of HIV and intestinal parasites indicates an increased morbidity inTB patients and emphasized the importance of continued HIV sero-surveillance, stool analysis and treatment.

  8. MDR1 haplotypes conferring an increased expression of intestinal CYP3A4 rather than MDR1 in female living-donor liver transplant patients.

    Science.gov (United States)

    Hosohata, Keiko; Masuda, Satohiro; Yonezawa, Atsushi; Katsura, Toshiya; Oike, Fumitaka; Ogura, Yasuhiro; Takada, Yasutsugu; Egawa, Hiroto; Uemoto, Shinji; Inui, Ken-Ichi

    2009-07-01

    This study investigated whether haplotypes in the multidrug resistance 1 (MDR1) gene had effects on mRNA expression levels of MDR1 and cytochrome P450 (CYP) 3A4, and on the pharmacokinetics of tacrolimus in living-donor liver transplant (LDLT) patients, considering the gender difference. Haplotype analysis of MDR1 with G2677T/A and C3435T was performed in 63 de novo Japanese LDLT patients (17 to 55 years; 44.4% women). The expression levels of MDR1 and CYP3A4 mRNAs in jejunal biopsy specimens were quantified by real-time PCR. Intestinal CYP3A4 mRNA expression levels (amol/microg total RNA) showed significantly higher values in women carrying the 2677TT-3435TT haplotype (median, 10.7; range, 5.92-15.2) than those with 2677GG-3435CC (3.03; range 1.38-4.68) and 2677GT-3435CT (median, 4.31; range, 0.07-9.42) (P = 0.022), but not in men (P = 0.81). However, MDR1 haplotype did not influence mRNA expression levels of MDR1 nor the concentration/dose ratio [(ng/mL)/(mg/day)] of oral tacrolimus for the postoperative 7 days, irrespective of gender. MDR1 haplotype may have a minor association with the tacrolimus pharmacokinetics after LDLT, but could be a good predictor of the inter-individual variation of intestinal expression of CYP3A4 in women.

  9. First reported case of fulminant TB with progression of infection from lungs to the genitourinary region

    Directory of Open Access Journals (Sweden)

    Tatjana Adzic-Vukicevic

    Full Text Available ABSTRACT Although tuberculosis (TB is a curable disease, it continues to be one of the leading infections associated with death in the world. Extra-pulmonary TB (EPTB occurs in approximately 10% of the total cases, presenting with lymph nodes, pleura, bone and genitourinary tract as the most common locations. Genitourinary tuberculosis, the second most common EPTB, is very difficult to diagnose unless there is a high index of suspicion. Isolated TB orchitis or prostatitis without clinical evidence of renal involvement is a rare entity among genitourinary tuberculosis. We presented the first reported case of TB prostatitis and orchitis associated with pulmonary TB and the presence of an acute massive caseous pneumonia in an immunocompetent man. Despite the anti-TB therapy, the patient presented a rapid progression of disease and deterioration of general conditions taking to death, which occurred four days after TB treatment had started. Disseminated TB is a relatively uncommon cause of acute massive caseous pneumonia; however, there should always be suspicion of the disease, since it is a potentially treatable cause. This rare case supports the assertion that TB should be considered as an important differential diagnosis of genitourinary tumors irrespective of evidence of active TB elsewhere in the body.

  10. Dioscin enhances methotrexate absorption by down-regulating MDR1 in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lijuan, E-mail: jlwang1979@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Wang, Changyuan, E-mail: wangcyuan@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Peng, Jinyong, E-mail: jinyongpeng2005@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Liu, Qi, E-mail: llaqii@yahoo.com.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Meng, Qiang, E-mail: mengq531@yahoo.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Sun, Huijun, E-mail: sunhuijun@hotmail.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Huo, Xiaokui, E-mail: huoxiaokui@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); and others

    2014-06-01

    The purpose of this study was to investigate the enhancing effect of dioscin on the absorption of methotrexate (MTX) and clarify the molecular mechanism involved in vivo and in vitro. Dioscin increased MTX chemosensitivity and transepithelial flux in the absorptive direction, significantly inhibiting multidrug resistance 1 (MDR1) mRNA and protein expression and MDR1 promoter and nuclear factor κ-B (NF-κB) activities in Caco-2 cells. Moreover, inhibitor κB-α (IκB-α) degradation was inhibited by dioscin. Dioscin enhanced the intracellular concentration of MTX by down-regulating MDR1 expression through a mechanism that involves NF-κB signaling pathway inhibition in Caco-2 cells. Dioscin strengthened MTX absorption by inhibiting MDR1 expression in rat intestine. In addition, even though MTX is absorbed into the enterocytes, there was no increase in toxicity observed, and that, in fact, decreased toxicity was seen. - Highlights: • Dioscin raised MTX concentration by inhibiting MDR1 in Caco-2 cells. • Dioscin suppresses MDR1 by inhibiting NF-κB signaling pathway in Caco-2 cells. • Dioscin can enhance MTX absorption via inhibiting MDR1 in vivo and in vitro. • Dioscin did not increase MTX-induced gastrointestinal mucosal toxicity.

  11. Osteoarticular infection caused by MDR Pseudomonas aeruginosa: the benefits of combination therapy with colistin plus β-lactams.

    Science.gov (United States)

    Ribera, Alba; Benavent, Eva; Lora-Tamayo, Jaime; Tubau, Fe; Pedrero, Salvador; Cabo, Xavier; Ariza, Javier; Murillo, Oscar

    2015-12-01

    In the era of emergence of MDR Pseudomonas aeruginosa, osteoarticular infections (OIs) add more difficulties to its treatment. The role of β-lactams (BLs) is questioned and older drugs need to be reconsidered. The objective of this study was to describe our experience in the management of OIs caused by MDR P. aeruginosa and evaluate different therapeutic options. This was a retrospective analysis of a prospectively collected cohort (2004-13) of patients with OI caused by MDR P. aeruginosa. We created two groups: (i) Group A (more difficult to treat), prosthetic joint infections (PJIs) and osteoarthritis (OA) managed with device retention; and (ii) Group B (less difficult to treat), OA managed without device retention. Antibiotic treatment was administered according to clinician criteria: monotherapy/combined therapy; and BL used by intermittent bolus (IB)/continuous infusion. Of 34 patients, 15 (44.1%) had PJI and 19 (55.9%) had OA (8 related to an orthopaedic device). Twenty-three cases (68%) were caused by XDR P. aeruginosa. The initial management included removal of an orthopaedic device in 14 cases, together with antibiotic [alone, 19 (55.9%; 4 colistin, 14 BL-IB and 1 BL continuous infusion); and in combination, 15 (44.1%; 5 BL-IB and 10 BL continuous infusion)]. The overall cure rate was 50% (39% and 63% in Groups A and B, respectively), ranging from 31.6% with monotherapy to 73.3% with combined therapy (P = 0.016), with special interest within Group A (cure rate with combined therapy 71.4%, P = 0.049). After rescue therapy, which included removal of remaining devices, the cure rate reached 85.3%. We suggest that the BL/colistin combination is an optimized therapy for OI caused by MDR P. aeruginosa, together with an appropriate surgical treatment. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Significance of MDR1 and multiple drug resistance in refractory human epileptic brain

    Directory of Open Access Journals (Sweden)

    Dini Gabriele

    2004-10-01

    Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.

  13. Bakteri Simbion Gastropoda Pleuroploca trapesium Dari Perairan Ternate, Sebagai Alternatif Antibakteri MDR (Bacterial Symbiont Gastropoda Pleuroploca trapezium from Ternate, as Alternative Antibacterial MDR

    Directory of Open Access Journals (Sweden)

    Delianis Pringgenies

    2014-03-01

    The bacteria resistant to some antibiotics are known as multi drug resistant (MDR. To overcome the problem, it is needed to search for a new antibiotic compounds more effectively and efficiently. This study aims to identify potential from symbionts of Pleuroploca trapezium as a source of antibacteria MDR and identifying the bacteria that were active against the MDR. Samples were collected from Ternate, Maluku. Isolation of symbiotic bacteria, screening for bacteria which producing secondary metabolites as anti-MDR bacteria, antibacterial test, isolation of clinical pathogenic bacteria of MDR. Conducting anti-bacterial sensitivity test,  sensitivity test for antibacterial,  DNA exctraction, DNA amplification based on PCR method, DNA sequencing.  Result of 16S r-DNA sequence was then analyzed and edited using GENETYX program and followed by 16S rDNA sequence analysis. Screening of bacteria associated with P. trapezium resulted in 19 isolates with 5 active bacteria. Based on the size of the zone forming and the consistency of zone, so the best isolate is TPT 4.7. The identification shows that TPT 4.7 has a close relationship with the Paracoccus sp. MBIC4019 with homologi of 95%, which shows the relationship at the genus level. Its suggest that these results are very promising as a new antibacterial material. Keywords: antibacterial, symbiotic bacteria, Pleuroploca trapezium, multi drugs resistant

  14. Diabetes is a strong predictor of mortality during tuberculosis treatment

    DEFF Research Database (Denmark)

    Faurholt-Jepsen, Daniel; Range, Nyagosya; PrayGod, George

    2013-01-01

    Strong evidence suggests diabetes may be associated with tuberculosis (TB) and could influence TB treatment outcomes. We assessed the role of diabetes on sputum culture conversion and mortality among patients undergoing TB treatment.......Strong evidence suggests diabetes may be associated with tuberculosis (TB) and could influence TB treatment outcomes. We assessed the role of diabetes on sputum culture conversion and mortality among patients undergoing TB treatment....

  15. Problems in diagnosis and treatment of tuberculosis infection.

    Science.gov (United States)

    Tsara, V; Serasli, E; Christaki, P

    2009-01-01

    Tuberculosis is still a major health problem in industrialized countries due to specific socioeconomic factors and there is the growing need of new rapid and accurate diagnostic methods, in order to achieve higher sensitivity and specificity compared to traditional methods of microscopic sputum examination and culture. Such methods, recently introduced, are nucleic acid amplification (NAA) tests, used directly on clinical specimens and blood tests (QuantiFERON-TB, T-SPOT.TB test), measuring the IFN-gamma released by stimulated T cells. Furthermore, new drugs for the disease need to be developed, aiming to better treatment results and to prevention of Multiple Drug Resistance (MDR) cases. Critical aspects in the management of drug resistance cases should be the careful choices of drugs combination, the close follow up of the patients alongside with the patients adherence to therapy. The role of national and international tuberculosis programs is invaluable in TB control and therapy, as well as the collaboration of all the health system departments. However, most of the clinical problems that may arise are addressed by the International Standards for Tuberculosis Care-ISTC and these guidelines should be taken into consideration, at least until future research provides more promising diagnostic and therapeutic modalities for control of the disease.

  16. Global evidence directing regional preventive strategies in Southeast Asia for fighting TB/HIV.

    Science.gov (United States)

    Aung, Myo Nyein; Moolphate, Saiyud; Paudel, Damodar; Jayathunge Ph, Mangalasiri; Duangrithi, Duangjai; Wangdi, Kinley; Aung, Thin Nyein Nyein; Lorga, Thaworn; Higuchi, Kazue

    2013-03-14

    Tuberculosis (TB) and human immunodeficiency virus (HIV) co-epidemics form a huge burden of disease in the Southeast Asia region. Five out of eleven nations in this region are high TB/HIV burden countries: Myanmar, Thailand, India, Indonesia and Nepal. The trends of TB incidence in these countries have been rising in recent years, in contrast to a falling global trend. Experts in the field of TB control and health service providers have been perplexed by the association of TB and HIV infections which causes a mosaic clinical presentation, a unique course with poor treatment outcomes including death. We conducted a review of contemporary evidence relating to TB/HIV control with the aims of assisting integrated health system responses in Southeast Asia and demystifying current evidence to facilitate translating it into practice.

  17. Immunoendocrine Interactions during HIV-TB Coinfection: Implications for the Design of New Adjuvant Therapies

    Directory of Open Access Journals (Sweden)

    Guadalupe Veronica Suarez

    2015-01-01

    Full Text Available Worldwide, around 14 million individuals are coinfected with both tuberculosis (TB and human immunodeficiency virus (HIV. In coinfected individuals, both pathogens weaken immunological system synergistically through mechanisms that are not fully understood. During both HIV and TB infections, there is a chronic state of inflammation associated to dramatic changes in immune cytokine and endocrine hormone levels. Despite this, the relevance of immunoendocrine interaction on both the orchestration of an effective immune response against both pathogens and the control of the chronic inflammation induced during HIV, TB, or both infections is still controversial. The present study reviews immunoendocrine interactions occurring during HIV and TB infections. We also expose our own findings on immunoendocrine cross talk in HIV-TB coinfection. Finally, we evaluate the use of adrenal hormones and their derivatives in immune-therapy and discuss the use of some of these compounds like the adjuvant for the prevention and treatment of TB in HIV patients.

  18. Sharing the spotlight in Durban: A report from IAS TB2016 at AIDS2016

    Directory of Open Access Journals (Sweden)

    J.A. Whitaker

    2017-05-01

    Full Text Available Tuberculosis (TB is now recognized as the number one cause of death worldwide due to a single infectious pathogen and is the cause of death in one-third of people living with HIV worldwide. An inaugural pre-conference focused on TB (TB2016 was held at the International AIDS Society Conference AIDS2016. This report focuses on key messages from the TB2016 conference that are important for the medical, public health, activist, and scientific communities. Keywords: Tuberculosis, HIV, Epidemiology, Public health, Treatment, Prevention

  19. Biomarkers of latent TB infection

    DEFF Research Database (Denmark)

    Ruhwald, Morten; Ravn, Pernille

    2009-01-01

    For the last 100 years, the tuberculin skin test (TST) has been the only diagnostic tool available for latent TB infection (LTBI) and no biomarker per se is available to diagnose the presence of LTBI. With the introduction of M. tuberculosis-specific IFN-gamma release assays (IGRAs), a new area...... of in vitro immunodiagnostic tests for LTBI based on biomarker readout has become a reality. In this review, we discuss existing evidence on the clinical usefulness of IGRAs and the indefinite number of potential new biomarkers that can be used to improve diagnosis of latent TB infection. We also present...... early data suggesting that the monocyte-derived chemokine inducible protein-10 may be useful as a novel biomarker for the immunodiagnosis of latent TB infection....

  20. Impact of ART on TB case fatality stratified by CD4 count for HIV-positive TB patients in Cape Town, South Africa (2009-2011).

    Science.gov (United States)

    Kaplan, Richard; Caldwell, Judy; Middelkoop, Keren; Bekker, Linda-Gail; Wood, Robin

    2014-08-15

    To identify determinants of tuberculosis (TB) case fatality including the impact of antiretroviral therapy (ART) at different CD4 thresholds for HIV-positive adult and adolescent TB patients. Through a retrospective analysis of the electronic TB database, we identified the HIV status of newly registered patients aged ≥15 years. Multivariable Cox proportional hazard models were used to determine the risk factors for TB case fatality in these patients. In 2009, 2010, and 2011, 25,841, 26,104, and 25,554 newly registered adult TB patients were treated in primary health care clinics in Cape Town, of whom 49.7%, 50.4%, and 50.9% were HIV positive. ART uptake increased over 3 years from 43% to 64.9%, and case fatality of the HIV-positive patients decreased from 7.0% to 5.8% (P ART had a substantial decrease in case fatality. The difference in case fatality between patients on ART and not on ART was most pronounced at low CD4 counts with the positive influence of ART noted up to a CD4 count threshold of 350 cells per cubic millimeter (P ART uptake, in 2011, 21% of the patients with CD4 counts ART during TB treatment. This study showed a relatively poor uptake of ART among severely immune-compromised TB patients. Patients with CD4 counts ART during TB treatment, and ART initiation should be prioritized for this category of patients.

  1. Impact of tuberculosis treatment on CD4 cell count, HIV RNA, and p24 antigen in patients with HIV and tuberculosis

    DEFF Research Database (Denmark)

    Wejse, Christian; Furtado, A.; Camara, C.

    2013-01-01

    To describe HIV RNA levels during tuberculosis (TB) infection in patients co-infected with TB and HIV. Moreover, to examine the p24 antigen profile during TB treatment.......To describe HIV RNA levels during tuberculosis (TB) infection in patients co-infected with TB and HIV. Moreover, to examine the p24 antigen profile during TB treatment....

  2. Pathway to care for drug resistant tuberculosis cases identified during a retrospective study conducted in high TB burden wards in Mumbai.

    Science.gov (United States)

    Lobo, Eunice; Shah, Shimoni; Rangan, Sheela; Dholakia, Yatin; Mistry, Nerges

    2018-05-10

    Background: Mumbai is witnessing a rising incidence of all forms of drug resistant tuberculosis (DR-TB). Methods: A population-based, retrospective study was conducted between April and July 2014, in 15 high TB burden wards in Mumbai, to capture the patient pathways to TB care. A total of 23 DR-TB patients were identified and their pathways to access DR-TB care were recorded using semi-structured interviews. Results: The total DR-TB pathway time of new patients (who did not report any past episode of TB) (180 days; IQR 123,346) was found to be more than twice that of retreatment patients (who reported a past episode of TB) (69 days; IQR 42,128). Conclusions: The unacceptable delay for diagnosis and treatment of DR-TB in Mumbai advocates for consistent implementation of early screening of patients using rapid gene-based technologies.

  3. XDR TB in South Africa - What lies ahead? | Thaver | South African ...

    African Journals Online (AJOL)

    The emergence of XDR TB coupled with the high prevalence of HIV/AIDS has intensified the need to identify new treatment strategies and accelerate research into antibiotics against XDR TB before the world is faced with a global public health crisis. This article gives a short overview on the important health implications of ...

  4. TB and HIV co-infection: when to start antiretroviral therapy

    African Journals Online (AJOL)

    2011-10-02

    Oct 2, 2011 ... HIV and TB treatment in co-infected patients is a critical one. Previously, TB ... Indications for ART are based on an assessment of individual risk- benefit analysis of ..... An HIV test was positive, a lumbar puncture was acellular ...

  5. Management of TB/HIV Co-Infection in the Context of the DOTS ...

    African Journals Online (AJOL)

    The reason for this deterioration in both developed and developing countries are mainly due to improper diagnosis and treatment, poor drug compliance, increase travel and migration, multi-resistant TB, increase number of refugee from wars and famine and lately to the pandemic of HIV/AIDS(4). Key Words: TB/HIV, ...

  6. HUBUNGAN ANTARA PERILAKU PENCEGAHAN DAN KEPATUHAN BEROBAT PENDERITA TB DI INDONESIA

    Directory of Open Access Journals (Sweden)

    Noor Edi Widya Sukoco

    2012-11-01

    Full Text Available Background: Indonesia constitutes the third highest of Tuberculosis (TB cases after India and China. One of the problem in TB control is still low of drug treatment compliance of TB patients. The objective of this study was to know the relationship between TB disease prevention behaviors with treatment compliance of TB patients in Indonesia. Methods: Data explored from National Basic Health Survey (Riskesdas 2010. The data is designed to represent provinces. Design of study is cross sectional. The population is all respondents of Riskesdas 2010, while samples were chosen aged > 5 years with Pulmonary TB, particularly the TB patients who was received medication and treated by health facilities. The number of samples are all 968 patients. Interviews were conducted by skilled interviewers. Data were processed by SPSS 15 version. Results: The behavior of respondents drying the wrong mattress have risk non-compliant treatment about 1. 64 compared with the behavior of respondents drying the right mattress (OR = 1. 64; P = 0.001; confidence interval (CI=1. 21-2.22. Likewise, low education has risk non-compliant treatment in the amount of 1.62 compared with highly educated respondents (OR= 1.62; P = 0.005; confidence interval (CI = 1.15-2.27. Conclusion: The updated data signify that analysis of drug adherence TB patients will show significantly in correlation between drug adherence with level of education, and behaviour of dry mattress. Key words: drug compliance, preventive behavior. tuberculosis

  7. Multi-drug resistance (MDR1 gene and P-glycoprotein influence on pharmacokinetic and pharmacodymanic of therapeutic drugs

    Directory of Open Access Journals (Sweden)

    Linardi Renata Lehn

    2006-01-01

    Full Text Available (MDR1 gene expressed in tumor cells and also in several normal tissues, such as intestine, liver, kidney, blood-brain barrier, spinal cord, and placenta. P-gp has been identified in mice, rat, bovine, monkey, rodents, and human beings and has been receiving a particular clinical relevance because this protein expression limits brain access and intestinal absorption of many drugs. This protein plays a role as a protective barrier against a wide variety of substrates, avoiding drug entry into the central nervous system. P-glycoprotein also interferes with drug bioavailability and disposition, including absorption, distribution, metabolization, and excretion, influencing pharmacokinetic and pharmacodynamic of drugs. Modulation of P-gp may help the efficacy of treatment of several diseases and can explain some adverse central nervous system effects induced by drugs after intravenous administration and the poor response of oral administration in patients. Alteration in P-gp expression or function has been associated with several diseases susceptibility in humans and animals. Furthermore, additional studies relating MDR1 and P-gp expression has an important clinical implication also in terms of treatment efficacy.

  8. TB in Children in the United States

    Science.gov (United States)

    ... Regimen for Latent TB Infection-Patient Education Brochure Posters Mantoux Tuberculin Skin Test Wall Chart World TB ... site? Adobe PDF file Microsoft PowerPoint file Microsoft Word file Microsoft Excel file Audio/Video file Apple ...

  9. Screening of Antibacterial MDR derived from Sponge Associated Fungus of Riung Water, Nusa Tenggara Timur

    OpenAIRE

    Khoeruddin Wittriansyah; Agus Trianto; Sekar Widyaningsih; Ocky Karna Radjasa; Rudhi Pribadi

    2016-01-01

    Marine sponge-associated fungi are the sources of bioactive compounds with various pharmacologicals potency. This study aimed to isolate the sponge-associated fungi as the producer of the MDR anti-bacterial compounds.  The associated fungi were isolated from the sponges collected from Riung water, Nusa Tenggara Timur. Five of the best isolates were cultured on MEA to obtain the methanolic extract for further studies.  The antagonistic test was conducted using overlay method towards the MDR St...

  10. Extensively Drug-Resistant TB

    Centers for Disease Control (CDC) Podcasts

    2016-12-16

    Dr. Charlotte Kvasnovsky, a surgery resident and Ph.D. candidate in biostatistics, discusses various types of drug resistance in TB patients in South Africa.  Created: 12/16/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 12/16/2016.

  11. TB in Wild Asian Elephants

    Centers for Disease Control (CDC) Podcasts

    2017-05-10

    Dr. Susan Mikota, co-founder of Elephant Care International, discusses TB in wild Asian elephants.  Created: 5/10/2017 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 5/10/2017.

  12. Community Involvement in TB Research

    NARCIS (Netherlands)

    M. van der Werf (Marloes); S.G. Heumann (Silke); E.M.H. Mitchell

    2011-01-01

    textabstractWhile communities at risk have been both drivers and partners in HIV research, their important role in TB research is yet to be fully realized. Involvement of communities in tuberculosis care and prevention is currently on the international agenda. This creates opportunities and

  13. The Xenobiotic Transporter Mdr1 Enforces T Cell Homeostasis in the Presence of Intestinal Bile Acids.

    Science.gov (United States)

    Cao, Wei; Kayama, Hisako; Chen, Mei Lan; Delmas, Amber; Sun, Amy; Kim, Sang Yong; Rangarajan, Erumbi S; McKevitt, Kelly; Beck, Amanda P; Jackson, Cody B; Crynen, Gogce; Oikonomopoulos, Angelos; Lacey, Precious N; Martinez, Gustavo J; Izard, Tina; Lorenz, Robin G; Rodriguez-Palacios, Alex; Cominelli, Fabio; Abreu, Maria T; Hommes, Daniel W; Koralov, Sergei B; Takeda, Kiyoshi; Sundrud, Mark S

    2017-12-19

    CD4 + T cells are tightly regulated by microbiota in the intestine, but whether intestinal T cells interface with host-derived metabolites is less clear. Here, we show that CD4 + T effector (Teff) cells upregulated the xenobiotic transporter, Mdr1, in the ileum to maintain homeostasis in the presence of bile acids. Whereas wild-type Teff cells upregulated Mdr1 in the ileum, those lacking Mdr1 displayed mucosal dysfunction and induced Crohn's disease-like ileitis following transfer into Rag1 -/- hosts. Mdr1 mitigated oxidative stress and enforced homeostasis in Teff cells exposed to conjugated bile acids (CBAs), a class of liver-derived emulsifying agents that actively circulate through the ileal mucosa. Blocking ileal CBA reabsorption in transferred Rag1 -/- mice restored Mdr1-deficient Teff cell homeostasis and attenuated ileitis. Further, a subset of ileal Crohn's disease patients displayed MDR1 loss of function. Together, these results suggest that coordinated interaction between mucosal Teff cells and CBAs in the ileum regulate intestinal immune homeostasis. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Measurement of 160Tb and 161Tb in nuclear forensics samples

    International Nuclear Information System (INIS)

    Jiang, J.; Davies, A.V.; Britton, R.E.

    2017-01-01

    160 Tb and 161 Tb are important radionuclides to measure when analysing a Nuclear Forensics sample. An analytical method for the measurement of both 160 Tb and 161 Tb was developed in this study. Terbium was separated and purified using exchange resin and TrisKem LN Resin. The purified fraction containing 160 Tb and 161 Tb was measured by gamma spectrometry and liquid scintillation counting. The counting efficiencies of 160 Tb and 161 Tb were determined using the CIEMAT/NIST efficiency tracing method. The LSC count rate ratio, R160 Tb /R161 Tb , on the reference date was determined by sequential counting and calculated using a custom script based on their half-lives. (author)

  15. Litigation as TB Rights Advocacy: A New Delhi Case Study.

    Science.gov (United States)

    McBroom, Kerry

    2016-06-01

    One thousand people die every day in India as a result of TB, a preventable and treatable disease, even though the Constitution of India, government schemes, and international law guarantee available, accessible, acceptable, quality health care. Failure to address the spread of TB and to provide quality treatment to all affected populations constitutes a public health and human rights emergency that demands action and accountability. As part of a broader strategy, health activists in India employ Public Interest Litigation (PIL) to hold the state accountable for rights violations and to demand new legislation, standards for patient care, accountability for under-spending, improvements in services at individual facilities, and access to government entitlements in marginalized communities. Taking inspiration from right to health PIL cases (PILs), lawyers in a New Delhi-based rights organization used desk research, fact-findings, and the Right To Information Act to build a TB PIL for the Delhi High Court, Sanjai Sharma v. NCT of Delhi and Others (2015). The case argues that inadequate implementation of government TB schemes violates the Constitutional rights to life, health, food, and equality. Although PILs face substantial challenges, this paper concludes that litigation can be a crucial advocacy and accountability tool for people living with TB and their allies.

  16. Solution growth of Tb doped Gd_2O_3 film

    International Nuclear Information System (INIS)

    Ghosh, M.; Pitale, S.; Desai, D.G.; Patra, G.D.; Sen, S.; Gadkari, S.C.

    2016-01-01

    Nanomaterials of Gd_2O_3 have proven applications in medical imaging and cancer therapy due to the presence of element Gd. Also Gd_2O_3 films have been grown by vapor phase method as well as self assembly in solution and studied as a high-k dielectric and efficient luminescence material. Here, we report a method to obtain Tb doped Gd_2O_3 film by solution growth method followed by suitable heat treatment. Uniform films of Tb doped Gadolinium hydroxycarbonate have been deposited on fused quartz substrates kept inside a solution containing gadolinium nitrate, terbium nitrate and Urea maintained at 90°C. Gadolinium hydroxy-carbonate films are then treated at 800°C for 2 hour to obtain Tb doped cubic Gd_2O_3 as confirmed by X-ray diffraction measurement. The photoluminescence spectra display characteristic Tb emission at 544 nm when excited at 285 nm. The lifetime of Tb emission is found to be of the order of few microseconds. (author)

  17. EXAFS study of Tb-doped silica xerogels

    International Nuclear Information System (INIS)

    Rocca, F.; Monti, F.; Kuzmin, A.; Dalmaso, A.; Pasqualini, D.

    1999-01-01

    The modification of the local environment of Tb 3+ ions in optically active silica xerogels as a function of concentration (from 400 ppm to 40000 ppm) and thermal treatment (which induces densification) was studied by x-ray absorption spectroscopy at the Tb L 3 edge. Quantitative analysis of the first Tb-O coordination shell was performed using the experimental signal from Tb 3+ ions in water solution as a reference. The radial distribution functions (RDF) of the non-thermally treated (NT) gels are characterised by a nearly gaussian shape, as for the reference sample. On the contrary, the RDF of the densified gels (T) are asymmetric having the main peak at a shorter distance, with a reduced coordination number (N=4-5) and a secondary peak, with N=1-2, at a longer distance. The local environment of Tb in the low concentration sample (400 ppm) is different from that at higher concentrations, both in the NT- and in the T-gels. (au)

  18. EXAFS study of Tb-doped silica xerogels

    Energy Technology Data Exchange (ETDEWEB)

    Rocca, F. [CeFsa - Centro CNR-ITC de Fisica degli Stati Aggregati, Povo (Italy); Monti, F. [Univ. de Verona, Facolta di Scienze (Italy); Kuzmin, A. [Inst. of Solid State Physics, Riga (Latvia); Dalmaso, A.; Pasqualini, D. [Univ. di Trento, INFM - Dipartimento di Fisica (Italy)

    1999-11-01

    The modification of the local environment of Tb{sup 3+} ions in optically active silica xerogels as a function of concentration (from 400 ppm to 40000 ppm) and thermal treatment (which induces densification) was studied by x-ray absorption spectroscopy at the Tb L{sub 3} edge. Quantitative analysis of the first Tb-O coordination shell was performed using the experimental signal from Tb{sup 3+} ions in water solution as a reference. The radial distribution functions (RDF) of the non-thermally treated (NT) gels are characterised by a nearly gaussian shape, as for the reference sample. On the contrary, the RDF of the densified gels (T) are asymmetric having the main peak at a shorter distance, with a reduced coordination number (N=4-5) and a secondary peak, with N=1-2, at a longer distance. The local environment of Tb in the low concentration sample (400 ppm) is different from that at higher concentrations, both in the NT- and in the T-gels. (au) 15 refs.

  19. EXAFS study of Tb-doped silica xerogels

    CERN Document Server

    Rocca, F; Kuzmin, A; Dalmaso, A; Pasqualini, D

    1999-01-01

    The modification of the local environment of Tb/sup 3+/ ions in optically active silica xerogels as a function of concentration (from 400 ppm to 40000 ppm) and thermal treatment (which induces densification) was studied by X-ray absorption spectroscopy at the Tb L/sub 3/ edge. Quantitative analysis of the first Tb-O coordination shell was performed using the experimental signal from Tb/sup 3+/ ions in water solution as a reference. The radial distribution functions (RDF) of the non-thermally treated (NT) gels are characterized by a nearly Gaussian shape, as for the reference sample. On the contrary, the RDF of the densified gels (T) are asymmetric having the main peak at a shorter distance, with a reduced coordination number (N=4-5) and a secondary peak, with N=1-2, at a longer distance. The local environment of Tb in the low concentration sample (400 ppm) is different from that at higher concentrations, both in the NT- and in the T-gels. (15 refs).

  20. Prospective use of soluble urokinase plasminogen activator receptor to screen TB co-infected with HIV patient among TB patient

    Directory of Open Access Journals (Sweden)

    Tri Yudani Mardining Raras

    2017-10-01

    Conclusion: Plasma suPAR level of TB patients co-infected with HIV showed significantly difference from that of TB-AFB(+ patients suggested its potential to screen the TB/HIV among pulmonary TB-AFB(+ patients.

  1. Reaching out to take on TB in Somalia.

    Science.gov (United States)

    Moore, David A J; Granat, Simo M

    2014-01-01

    Among the many challenges facing populations disrupted by complex emergencies, personal security and food security rank much higher than access to healthcare. However, over time health needs assume increasing importance. Many complex crises occur in settings where the background incidence of TB is already high; social and economic conditions in crises are then highly conducive to amplification of the existing TB problem. Innovative approaches to delivery of diagnostic and treatment services, transition planning and integration with other healthcare providers and services are vital. In the extremely challenging environment of Somalia, multiple partners are making headway though collaboration and innovation.

  2. EDITORIAL South Africa and national TB control: Are we making ...

    African Journals Online (AJOL)

    accounting for 7.2% of deaths, followed by diabetes mellitus with 5.4% of deaths. Although tuberculosis has maintained its position ... and indirect costs before, during, and after a TB diagnosis. The largest costs these patients incur are for hospitalization, medication, transportation, and treatment or care in the private sector.

  3. Needs assessment for adapting TB directly observed treatment intervention programme in Limpopo Province, South Africa: A community-based participatory research approach

    Directory of Open Access Journals (Sweden)

    Jabu T. Mabunda

    2016-07-01

    Full Text Available Background: Limpopo Province is one of the hardest hit by tuberculosis and human immune virus infections in the country. The province has been implementing directly observed treatment strategy since 1996. However, the cure rate was 64% in 2015 and remains far from the set target by the World Health Organization of 85%. Poor health-care seeking and adherence behaviours were identified as major risk behaviours. Aim: To apply a community-based participatory research approach in identifying barriers and facilitators to health-care seeking and adherence to treatment, and to determine strategies and messages in order to inform the design of an adapted intervention programme. Setting: This study was conducted in three districts in the Limpopo Province, Capricorn, Mopani and Sekhukhune districts. Methods: Community participatory research approach was applied. Purposive sampling was used to sample participants. Focus group discussions were used to collect data. Participatory analysis was used comparing findings within and across all the participants. Results: A total of 161 participated in the study. Participants included coordinators, professional nurses, supporters and patients. Major modifiable behavioural-related barriers were lack of knowledge about tuberculosis, misinformation and misperceptions cultural beliefs, stigma and refusal of treatment support. Environment-related barriers were attitudes of health workers, lack of support by family and community, lack of food and use of alcohol and drugs. Strategies and messages included persuasive and motivational messages to promote healthy behaviour. Conclusion: Joint programmatic collaboration between the community and academic researchers is really needed for interventions to address the needs of the community. Keywords: Health seeking, Adherence, Community based participatory research, Tuberculosis

  4. The search for the mdr1-1Δ mutation of the MDR1 gene in four canine breeds in Uruguay (preliminary study

    Directory of Open Access Journals (Sweden)

    Rosa Gagliardi B.

    2015-01-01

    Full Text Available Objective. The objective of this study is to analyze the frequency of mdr1-1Δ mutation in German Shepherd, Doberman, Border Collie and Greyhound dog breeds in Uruguay. Materials and methods. A total of 95 animals from the four breeds mentioned above were studied. DNA was isolated from blood using potassium acetate with a subsequent degradation from RNA with RNAsaH. The concentration and quality of the DNA obtained was evaluated with a Nanodrop, ND-1000 spectrophotometer. To determine the presence or absence of the mdr1-1Δ mutation, DNA samples were sent to Gene Seek, Neogen Corporation of Chicago, United States, for genotyping. Results. In all 95 animals studied, the mdr1-1Δ mutation was not present. Conclusions. Based on the preliminary results obtained, other elements that may cause adverse drug reactions must be considered: unidentified mutations in other regions of the MDR1 gene; mutations in other genes involved in the transport of drugs from the same subfamily or another; mutations in enzymes involved in drug metabolism (e.g. Cytochrome P450. Moreover, especially with Border Collies and Greyhounds, it is advisable to increase the number of animals in the study.

  5. The association between alcohol use, alcohol use disorders and tuberculosis (TB. A systematic review

    Directory of Open Access Journals (Sweden)

    Room Robin

    2009-12-01

    Full Text Available Abstract Background In 2004, tuberculosis (TB was responsible for 2.5% of global mortality (among men 3.1%; among women 1.8% and 2.2% of global burden of disease (men 2.7%; women 1.7%. The present work portrays accumulated evidence on the association between alcohol consumption and TB with the aim to clarify the nature of the relationship. Methods A systematic review of existing scientific data on the association between alcohol consumption and TB, and on studies relevant for clarification of causality was undertaken. Results There is a strong association between heavy alcohol use/alcohol use disorders (AUD and TB. A meta-analysis on the risk of TB for these factors yielded a pooled relative risk of 2.94 (95% CI: 1.89-4.59. Numerous studies show pathogenic impact of alcohol on the immune system causing susceptibility to TB among heavy drinkers. In addition, there are potential social pathways linking AUD and TB. Heavy alcohol use strongly influences both the incidence and the outcome of the disease and was found to be linked to altered pharmacokinetics of medicines used in treatment of TB, social marginalization and drift, higher rate of re-infection, higher rate of treatment defaults and development of drug-resistant forms of TB. Based on the available data, about 10% of the TB cases globally were estimated to be attributable to alcohol. Conclusion The epidemiological and other evidence presented indicates that heavy alcohol use/AUD constitute a risk factor for incidence and re-infection of TB. Consequences for prevention and clinical interventions are discussed.

  6. Knowledge, attitude and practice of private practitioners regarding tb-dots in a rural district of Sindh, Pakistan

    International Nuclear Information System (INIS)

    Ahmed, M.; Fatmi, Z.; Ali, S.; Ahmed, S.; Ara, N.

    2009-01-01

    Tuberculosis is prevailing in both urban and rural areas of Pakistan. Knowledge, attitude and practice (KAP) of private practitioners (PPs) regarding tuberculosis management have been reported only in urban areas of Pakistan. This survey was conducted for the first time in a rural area of Sindh, Pakistan. This survey was conducted in January 2007 at Thatta, a rural district of Sindh, Pakistan. Study subjects were twenty-two allopathic qualified (MBBS) doctors of district Thatta, who were practicing in private setups for at least last one year. Before TB-DOTS training PPs had filled the KAP questionnaire regarding tuberculosis (TB) diagnosis and management through DOTS. Survey data was analysed through SPSS version 11.05 software. On average, five TB suspects per month were seen by each PP. Only 14% of PPs advised sputum microscopy solely for pulmonary TB diagnosis, while 86% of PPs used different combination of tests (chest x-ray/sputum microscopy/ESR/tuberculin test) for TB diagnosis. Over 40% PPs did not prescribe TB treatment regimen according to TB-DOTS category. Majority PPs (85%) did not follow the treatment through sputum microscopy and instead relied on clinical improvement and x-ray clearance. Nearly 60% of TB patients at PPs clinic did not show compliance to the TB treatment and none of PPs were following the retrieval of default cases. A gross lack of PPs knowledge and right practice regarding TB diagnosis and management through DOTS was identified and needed to be addressed through providing DOTS training. (author)

  7. FAM-MDR: a flexible family-based multifactor dimensionality reduction technique to detect epistasis using related individuals.

    Directory of Open Access Journals (Sweden)

    Tom Cattaert

    Full Text Available We propose a novel multifactor dimensionality reduction method for epistasis detection in small or extended pedigrees, FAM-MDR. It combines features of the Genome-wide Rapid Association using Mixed Model And Regression approach (GRAMMAR with Model-Based MDR (MB-MDR. We focus on continuous traits, although the method is general and can be used for outcomes of any type, including binary and censored traits. When comparing FAM-MDR with Pedigree-based Generalized MDR (PGMDR, which is a generalization of Multifactor Dimensionality Reduction (MDR to continuous traits and related individuals, FAM-MDR was found to outperform PGMDR in terms of power, in most of the considered simulated scenarios. Additional simulations revealed that PGMDR does not appropriately deal with multiple testing and consequently gives rise to overly optimistic results. FAM-MDR adequately deals with multiple testing in epistasis screens and is in contrast rather conservative, by construction. Furthermore, simulations show that correcting for lower order (main effects is of utmost importance when claiming epistasis. As Type 2 Diabetes Mellitus (T2DM is a complex phenotype likely influenced by gene-gene interactions, we applied FAM-MDR to examine data on glucose area-under-the-curve (GAUC, an endophenotype of T2DM for which multiple independent genetic associations have been observed, in the Amish Family Diabetes Study (AFDS. This application reveals that FAM-MDR makes more efficient use of the available data than PGMDR and can deal with multi-generational pedigrees more easily. In conclusion, we have validated FAM-MDR and compared it to PGMDR, the current state-of-the-art MDR method for family data, using both simulations and a practical dataset. FAM-MDR is found to outperform PGMDR in that it handles the multiple testing issue more correctly, has increased power, and efficiently uses all available information.

  8. vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.

    Science.gov (United States)

    Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej

    2017-06-01

    The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  9. Community referral for presumptive TB in Nigeria: a comparison of four models of active case finding

    Directory of Open Access Journals (Sweden)

    A. O. Adejumo

    2016-02-01

    Full Text Available Abstract Background Engagement of communities and civil society organizations is a critical part of the Post-2015 End TB Strategy. Since 2007, many models of community referral have been implemented to boost TB case detection in Nigeria. Yet clear insights into the comparative TB yield from particular approaches have been limited. Methods We compared four models of active case finding in three Nigerian states. Data on presumptive TB case referral by community workers (CWs, TB diagnoses among referred clients, active case finding model characteristics, and CWs compensation details for 2012 were obtained from implementers and CWs via interviews and log book review. Self-reported performance data were triangulated against routine surveillance data to assess concordance. Analysis focused on assessing the predictors of presumptive TB referral. Results CWs referred 4–22 % of presumptive TB clients tested, and 4–24 % of the total TB cases detected. The annual median referral per CW ranged widely among the models from 1 to 48 clients, with an overall average of 13.4 referrals per CW. The highest median referrals (48 per CW/yr and mean TB diagnoses (7.1/yr per CW (H =70.850, p < 0.001 was obtained by the model with training supervision, and $80/quarterly payments (Comprehensive Quotas-Oriented model. The model with irregularly supervised, trained, and compensated CWs contributed the least to TB case detection with a median of 13 referrals per CW/yr and mean of 0.53 TB diagnoses per CW/yr. Hours spent weekly on presumptive TB referral made the strongest unique contribution (Beta = 0.514, p < 0.001 to explaining presumptive TB referral after controlling for other variables. Conclusion All community based TB case-finding projects studied referred a relative low number of symptomatic individuals. The study shows that incentivized referral, appropriate selection of CWs, supportive supervision, leveraged treatment support roles, and a

  10. CHANGES IN THE PREVALENCE OF DRUG RESISTANT TUBERCULOSIS

    Directory of Open Access Journals (Sweden)

    V. B. Galkin

    2017-01-01

    Full Text Available The tendency of tuberculosis prevalence reduction observed in the Russian Federation is mostly related to the cases without multiple drug resistance (MDR. In general the number of MDR TB cases still tends to be increasing in the Russian Federation. Confident long-term reduction is registered only in the Central and North-Western Districts with relatively low level of MDR TB prevalence. From 2017 MDR TB patients are expected to prevail in the structure of the sputum positive cases which surely provides negative impact on the treatment efficiency and epidemic trends. The system of dispensary follow-up allows evaluating the annual number of MDT TB cases and following the ways of its increase and reduction. Taking MDR TB sources on and off the register is less intensive compared to the same flows of non-MDR infectious cases. The number of MDR TB sources is increasing mostly due new tuberculosis cases however acquired MDR TB makes significant contribution to the growth of MDR TB sources number. The increase in the ratio of respiratory MDR TB patients with sputum conversion to those died reflects the success in the improvement of the treatment strategy of MDR TB patients.

  11. Effects of magnetic and structural properties on magnetoresistance in amorphous TbFeCo

    International Nuclear Information System (INIS)

    Yumoto, S.; Hidaka, Y.; Okada, O.

    1990-01-01

    An extraordinary magnetoresistance effect, linearly dependent on the external magnetic field, is observed in amorphous TbFeCo films. The electrical resistance jumps by δρ at magnetization reversal. δρ depends on Tb concentration and it becomes nearly zero at about Tb 26 at. % concentration. To clarify the Tb concentration dependence of δρ, the magnetic properties and the heat treatment effect are examined. It is found that the magnetic anisotropy field (H k ) is maximum at about Tb 26 at. % and the gradient of linear magnetoresistance, δρ/(ρ 0 H c ), is proportional to the -H k + const, where ρ 0 is the electric resistance in zero field, H c is the coercive force, and the constant is about 100 kOe. The structural relaxation, a coercive force change by the heat treatment up to 200 degree C, is examined. It is found that as δρ/(ρ 0 H c ) in the as-sputtered state decreases, the coercive force change by the heat treatment decreases. The coercive force change is minimum at about Tb 26 at. %, where δρ/(ρ 0 H c ) becomes zero. These results mean that linear magnetoresistance is related to structure relaxation by heat treatment. The δρ disappearance at about Tb 26 at. % is based on the stable structure against heat treatment and the largest magnetic anisotropy field

  12. Patients direct costs to undergo TB diagnosis.

    Science.gov (United States)

    de Cuevas, Rachel M Anderson; Lawson, Lovett; Al-Sonboli, Najla; Al-Aghbari, Nasher; Arbide, Isabel; Sherchand, Jeevan B; Nnamdi, Emenyonu E; Aseffa, Abraham; Yassin, Mohammed A; Abdurrahman, Saddiq T; Obasanya, Joshua; Olanrewaju, Oladimeji; Datiko, Daniel; Theobald, Sally J; Ramsay, Andrew; Squire, S Bertel; Cuevas, Luis E

    2016-03-24

    A major impediment to the treatment of TB is a diagnostic process that requires multiple visits. Descriptions of patient costs associated with diagnosis use different protocols and are not comparable. We aimed to describe the direct costs incurred by adults attending TB diagnostic centres in four countries and factors associated with expenditure for diagnosis. Surveys of 2225 adults attending smear-microscopy centres in Nigeria, Nepal, Ethiopia and Yemen. Adults >18 years with cough >2 weeks were enrolled prospectively. Direct costs were quantified using structured questionnaires. Patients with costs >75(th) quartile were considered to have high expenditure (cases) and compared with patients with costs <75(th) quartile to identify factors associated with high expenditure. The most significant expenses were due to clinic fees and transport. Most participants attended the centres with companions. High expenditure was associated with attending with company, residing in rural areas/other towns and illiteracy. The costs incurred by patients are substantial and share common patterns across countries. Removing user fees, transparent charging policies and reimbursing clinic expenses would reduce the poverty-inducing effects of direct diagnostic costs. In locations with limited resources, support could be prioritised for those most at risk of high expenditure; those who are illiterate, attend the service with company and rural residents.

  13. CD4 cell count recovery in HIV/TB co-infected patients versus TB uninfected HIV patients

    Directory of Open Access Journals (Sweden)

    Wanchu A

    2010-10-01

    Full Text Available Background: There is lack of data comparing the improvement in CD4 count following antitubercular (ATT and antiretroviral therapy (ART in patients presenting with Human Immunodeficiency Virus/Tuberculosis (HIV/TB dual infection compared with CD4 matched cohort of TB uninfected HIV patients initiated on ART. We sought to test the hypothesis; TB additionally contributes to reduction in CD4 count in HIV/TB co-infected patients and this would result in greater improvement in count following treatment compared with CD4 matched TB uninfected individuals. Materials and Methods: In a retrospective cohort study design we studied the change in CD4 cell counts in two groups of patients - those with CD4 cell count >100 cells / mm 3 (Group 1 and <100/mm 3 (Group 2 at presentation. In each group the change in CD4 cell count in dually infected patients following six-month ATT and ART was compared to cohorts of CD4 matched TB uninfected patients initiated on ART. Results: In Group 1 (52 patients dually infected subjects′ CD4 count improved from 150 cells/ mm 3 to 345 cells/mm 3 (P=0.001. In the control TB uninfected patients, the change was from 159 cells/mm 3 to 317 cells/mm 3 (P=0.001. Additional improvement in dually infected patients compared to the control group was not statistically significant (P=0.24. In Group 2 (65 patients dually infected subjects count improved from 49 cells/mm3 to 249 cells/mm 3 (P=0.001 where as in control TB uninfected patients improvement was from 50 cells/ mm 3 to 205 cells/mm 3 (P=0.001, there being statistically significant additional improvement in dually infected subjects (P=0.01. Conclusion: Greater increment in CD4 counts with ATT and ART in dually infected patients suggests that TB additionally influences the reduction of CD4 counts in HIV patients.

  14. Catching the missing million: experiences in enhancing TB & DR-TB detection by providing upfront Xpert MTB/RIF testing for people living with HIV in India.

    Directory of Open Access Journals (Sweden)

    Neeraj Raizada

    Full Text Available A critical challenge in providing TB care to People Living with HIV (PLHIV is establishing an accurate bacteriological diagnosis. Xpert MTB/RIF, a highly sensitive and specific rapid tool, offers a promising solution in addressing these challenges. This study presents results from PLHIV taking part in a large demonstration study across India wherein upfront Xpert MTB/RIF testing was offered to all presumptive PTB cases in public health facilities.The study covered a population of 8.8 million across 18 sub-district level tuberculosis units (TU, with one Xpert MTB/RIF platform established at each TU. All HIV-infected patients suspected of TB (both TB and Drug Resistant TB (DR-TB accessing public health facilities in study area were prospectively enrolled and provided upfront Xpert MTB/RIF testing.2,787 HIV-infected presumptive pulmonary TB cases were enrolled and 867 (31.1%, 95% Confidence Interval (CI 29.4‒32.8 HIV-infected TB cases were diagnosed under the study. Overall 27.6% (CI 25.9-29.3 of HIV-infected presumptive PTB cases were positive by Xpert MTB/RIF, compared with 12.9% (CI 11.6-14.1 who had positive sputum smears. Upfront Xpert MTB/RIF testing of presumptive PTB and DR-TB cases resulted in diagnosis of 73 (9.5%, CI 7.6‒11.8 and 16 (11.2%, CI 6.7‒17.1 rifampicin resistance cases, respectively. Positive predictive value (PPV for rifampicin resistance detection was high 97.7% (CI 89.3‒99.8, with no significant difference with or without prior history of TB treatment.The study results strongly demonstrate limitations of using smear microscopy for TB diagnosis in PLHIV, leading to low TB and DR-TB detection which can potentially lead to either delayed or sub-optimal TB treatment. Our findings demonstrate the usefulness and feasibility of addressing this diagnostic gap with upfront of Xpert MTB/RIF testing, leading to overall strengthening of care and support package for PLHIV.

  15. Responding to the multidrug-resistant tuberculosis crisis: mainstreaming programmatic management to the Philippine National Tuberculosis Programme.

    Science.gov (United States)

    Quelapio, M I D; Mira, N R C; Orillaza-Chi, R B; Belen, V; Muñez, N; Belchez, R; Egos, G E; Evangelista, M; Vianzon, R; Tupasi, T E

    2010-06-01

    The Philippines ranks eighth among 27 priority countries for multidrug-resistant TB (MDR-TB). To describe a model of public-private partnership in MDR-TB management. An exploratory study of integrating MDR-TB management initiated in private-public mix DOTS into the National TB Programme (NTP). Recognising that MDR-TB was a threat to DOTS, the Tropical Disease Foundation initiated MDR-TB management in 1999. An official mandate for the integration of MDR-TB services into the NTP was issued by the Department of Health in 2008. With an increased government budget augmented by support from the Global Fund to Fight AIDS, Tuberculosis and Malaria, 1294 MDR-TB patients were placed on treatment from 1999 to 2008. The treatment success rate improved from 64% in 1999 to 75% in 2005. There are now five MDR-TB treatment centres with 181 treatment sites in Metro Manila, and three culture centres. People trained include 12 master trainers, 31 trainers, 25 treatment centre and 381 treatment site staff. Mainstreaming into the NTP of this unique model of MDR-TB management through a dynamic public-private collaboration can be considered best practice in implementation science of an evidence-based intervention leading to change in health care policy and practice.

  16. Commercial grade item (CGI) dedication of MDR relays for nuclear safety related applications

    Science.gov (United States)

    Das, Ranjit K.; Julka, Anil; Modi, Govind

    1994-08-01

    MDR relays manufactured by Potter & Brumfield (P&B) have been used in various safety related applications in commercial nuclear power plants. These include emergency safety features (ESF) actuation systems, emergency core cooling systems (ECCS) actuation, and reactor protection systems. The MDR relays manufactured prior to May 1990 showed signs of generic failure due to corrosion and outgassing of coil varnish. P&B has made design changes to correct these problems in relays manufactured after May 1990. However, P&B does not manufacture the relays under any 10CFR50 Appendix B quality assurance (QA) program. They manufacture the relays under their commercial QA program and supply these as commercial grade items. This necessitates CGI Dedication of these relays for use in nuclear-safety-related applications. This paper presents a CGI dedication program that has been used to dedicate the MDR relays manufactured after been used to dedicate the MDR relays manufactured after May 1990. The program is in compliance with current Nuclear Regulatory Commission (NRC) and Electric Power Research Institute (EPRI) guidelines and applicable industry standards; it specifies the critical characteristics of the relays, provides the tests and analysis required to verify the critical characteristics, the acceptance criteria for the test results, performs source verification to quality P&B for its control of the critical characteristics, and provides documentation. The program provides reasonable assurance that the new MDR relays will perform their intended safety functions.

  17. Prevalence of post-traumatic stress symptoms and associated factors in tuberculosis (TB), TB retreatment and/or TB-HIV co-infected primary public health-care patients in three districts in South Africa.

    Science.gov (United States)

    Peltzer, Karl; Naidoo, Pamela; Matseke, Gladys; Louw, Julia; McHunu, Gugu; Tutshana, Bomkazi

    2013-01-01

    High rates of tuberculosis (TB) and TB/HIV co-infection is often linked with mental health issues such as post-traumatic stress disorder (PTSD) symptoms, which is further associated with poor health outcomes. In a country such as South Africa where rates of these infectious diseases are high, it is concerning that there is limited/no data on prevalence rates of mental disorders such as PTSD and its associated factors. Therefore, the aim of this study was to establish the prevalence of PTSD symptoms and associated factors in TB, TB retreatment and/or TB-HIV co-infected primary public health-care patients in three districts in South Africa. Brief screening self-report tools were used to measure: PTSD symptoms, psychological distress (anxiety and depression) and alcohol misuse. Other relevant measures, such as adherence to medication, stressful life events and sexual risk-taking behaviours, were obtained through structured questions. A total of 4900 public primary care adult patients from clinics in high TB burden districts from three provinces in South Africa participated. All the patients screened positive for TB (either new or retreatment cases). The prevalence of PTSD symptoms was 29.6%. Patients who screened positive for PTSD symptoms and psychological distress were more likely to be on antidepressant medication. Factors that predicted PTSD symptoms were poverty, residing in an urban area, psychological distress, suicide attempt, alcohol and/or drug use before sex, unprotected sex, TB-HIV co-infected and the number of other chronic conditions. Health-care systems should be strengthened to improve delivery of mental health care, by focusing on existing programmes and activities, such as those which address the prevention and treatment of TB and HIV.

  18. Inappropriate Tuberculosis Treatment Regimens in Chinese Tuberculosis Hospitals

    NARCIS (Netherlands)

    Xue He, Guang; van den Hof, Susan; van der Werf, Marieke J.; Guo, Hui; Hu, Yuan Lian; Fan, Ji Huan; Zhang, Wei Min; Tostado, Christopher P.; Borgdorff, Martien W.

    2011-01-01

    This investigation of tuberculosis (TB) treatment regimens in 6 TB hospitals in China showed that only 18% of patients with new cases and 9% of patients with retreatment cases were prescribed standard TB treatment regimens. Adherence to treatment guidelines needs to be improved in TB hospitals to

  19. FEATURES OF ADOLESCENTS TUBERCULOSIS AT A REFERRAL TB'S HOSPITAL IN TEHRAN, IRAN

    Directory of Open Access Journals (Sweden)

    Ferial Lotfian

    2016-01-01

    Full Text Available Abstract OBJECTIVE: To identify the pattern of the clinical, radiological, diagnostic procedures and loss to follow -up of the diagnosed cases of active tuberculosis (TB adolescents. METHODS: This study was a retrospective analysis of the medical records of 143 adolescents aged 10 to 18 years with tuberculosis who were admitted TB wards of National Research Institute of Tuberculosis and Lung Disease (NRITLD in Tehran, Iran, between March 2006 and March2011. RESULTS: Of the 143 patients identified, 62.9% were females. Median age of the patients was 16 years. The contact source was identified in 47.5%.The most common presenting symptom was cough (86%.Isolated pulmonary TB (PTB was detected in 113 patients (79%, 21 patients (14.7% had extrapulmonary TB(EPTB, and 9 patients (6.3% had PTB and EP TB .The most common site of  EPTB was pleural (14% .The most common radiographic finding was infiltration (61%.Positive acid fast smears were seen in 67.8%.Positive cultures for Mycobacterium tuberculosis(M. TB were seen in 31.6%. Positive PCR results were seen in 60%.The adolescents aged 15 to 18 years were more likely to lose weight (p=0.001, smear positive (p=0.002and have positive PCR results (p=0.009. The type of TB (p=0.017 was a significant factor influencing loss to follow-up. CONCLUSIONS: Adolescents with the high rate of positive sputum smear results and the high treatment default rate are more likely to increase risk for TB transmission to the community. The TB control programs should pay more attention to prevention and treatment of TB in adolescents.     Key words: adolescents, tuberculosis, Lost to follow-up, prevention

  20. Perception of stigma towards TB among patients on DOTS & patients attending general OPD in Delhi.

    Science.gov (United States)

    Anand, Tanu; Kumar, D Arun; Sharma, Nandini; Saha, Renuka; Krishnamurthy, Laxmi; Singh, S V; Ingle, G K

    2014-01-01

    In India, Tuberculosis (TB) continues to be a public health problem. One of the key reasons for it is the stigma associated with the disease which affects the treatment seeking behaviour and hence the outcome. To assess the perceived and enacted stigma among TB patients and perceptions of other patients related to TB in Central Delhi. A cross-sectional study conducted in urban field practice area of a medical college of Delhi, using a pre-designed questionnaire containing items for assessment of stigma being faced by a TB patient in family, social life and workplace. It also contained questions pertaining to reaction of patients from general OPD to a family member who develops TB. A total of 100 patients on DOTS and 200 patients from general OPD were interviewed. There were 21 patients who reported to have delayed treatment seeking due to stigma. Nearly one third patients (n=34; 34%) noted negative changes in the behaviour of their family members towards them while 40% were isolated on being diagnosed with the disease. Out of the 36 employed TB patients, 65.5% (n=23) experienced negative change in the behaviour of their colleagues. In general OPD patients, significantly higher proportion of female patients said that they would not disclose the disease status of a family member suffering from TB to their neighbours (pstigma like delayed treatment seeking.

  1. Breed distribution of the nt230(del4) MDR1 mutation in dogs.

    Science.gov (United States)

    Gramer, Irina; Leidolf, Regina; Döring, Barbara; Klintzsch, Stefanie; Krämer, Eva-Maria; Yalcin, Ebru; Petzinger, Ernst; Geyer, Joachim

    2011-07-01

    A 4-bp deletion mutation associated with multiple drug sensitivity exists in the canine multidrug resistance (MDR1) gene. This mutation has been detected in more than 10 purebred dog breeds as well as in mixed breed dogs. To evaluate the breed distribution of this mutation in Germany, 7378 dogs were screened, including 6999 purebred and 379 mixed breed dogs. The study included dog breeds that show close genetic relationship or share breeding history with one of the predisposed breeds but in which the occurrence of the MDR1 mutation has not been reported. The breeds comprised Bearded Collies, Anatolian Shepherd Dog, Greyhound, Belgian Tervuren, Kelpie, Borzoi, Australian Cattle Dog and the Irish Wolfhound. The MDR1 mutation was not detected is any of these breeds, although it was found as expected in the Collie, Longhaired Whippet, Shetland Sheepdog, Miniature Australian Shepherd, Australian Shepherd, Wäller, White Swiss Shepherd, Old English Sheepdog and Border Collie with varying allelic frequencies for the mutant MDR1 allele of 59%, 45%, 30%, 24%, 22%, 17%, 14%, 4% and 1%, respectively. Allelic frequencies of 8% and 2% were determined in herding breed mixes and unclassified mixed breeds, respectively. Because of its widespread breed distribution and occurrence in many mixed breed dogs, it is difficult for veterinarians and dog owners to recognise whether MDR1-related drug sensitivity is relevant for an individual animal. This study provides a comprehensive overview of all affected dog breeds and many dog breeds that are probably unaffected on the basis of ∼15,000 worldwide MDR1 genotyping data. Copyright © 2010 Elsevier Ltd. All rights reserved.

  2. Nitrofuranyl Methyl Piperazines as New Anti-TB Agents: Identification, Validation, Medicinal Chemistry, and PK Studies

    Science.gov (United States)

    2015-01-01

    Whole-cell screening of 20,000 drug-like small molecules led to the identification of nitrofuranyl methylpiperazines as potent anti-TB agents. In the present study, validation followed by medicinal chemistry has been used to explore the structure–activity relationship. Ten compounds demonstrated potent MIC in the range of 0.17–0.0072 μM against H37Rv Mycobacterium tuberculosis (MTB) and were further investigated against nonreplicating and resistant (RifR and MDR) strains of MTB. These compounds were also tested for cytotoxicity. Among the 10 tested compounds, five showed submicromolar to nanomolar potency against nonreplicating and resistant (RifR and MDR) strains of MTB along with a good safety index. Based on their overall in vitro profiles, the solubility and pharmacokinetic properties of five potent compounds were studied, and two analogues, 14f and 16g, were found to have comparatively better solubility than others tested and acceptable pharmacokinetic properties. This study presents the rediscovery of a nitrofuranyl class of compounds with improved aqueous solubility and acceptable oral PK properties, opening a new direction for further development. PMID:26487909

  3. Congenital Multidrug-resistant Tuberculosis in a Neonate: A Case Report.

    Science.gov (United States)

    Lhadon, Tenzin; Jullien, Sophie

    2018-04-20

    Multidrug-resistant tuberculosis (MDR-TB) is a well-identified raising public health concern worldwide. However, the data available on MDR-TB in children and particularly in the neonate age group are limited. Congenital tuberculosis (TB) is rare, and its diagnosis is challenging because of non-specific manifestations. The choice of anti-tubercular drugs is difficult because of the lack of international consensus as a consequence of the scarcity of evidence-based data on this age group. We hereby present a case from Bhutan of a 23-day-old male neonate with congenital MDR-TB. His mother was diagnosed with disseminated TB, and treatment was commenced 11 days post-partum. Congenital transmission of TB was suspected, as direct postnatal transmission was unlikely and thorough screening of contacts for TB was negative. In this case, the mother's MDR-TB status was revealed only after her newborn's MDR-TB diagnosis.

  4. Clinical characteristics, drug resistance, and treatment outcomes among tuberculosis patients with diabetes in Peru.

    Science.gov (United States)

    Magee, M J; Bloss, E; Shin, S S; Contreras, C; Huaman, H Arbanil; Ticona, J Calderon; Bayona, J; Bonilla, C; Yagui, M; Jave, O; Cegielski, J P

    2013-06-01

    Diabetes is a risk factor for active tuberculosis (TB). Data are limited regarding the association between diabetes and TB drug resistance and treatment outcomes. We examined characteristics of TB patients with and without diabetes in a Peruvian cohort at high risk for drug-resistant TB. Among TB patients with diabetes (TB-DM), we studied the association between diabetes clinical/management characteristics and TB drug resistance and treatment outcomes. During 2005-2008, adults with suspected TB with respiratory symptoms in Lima, Peru, who received rapid drug susceptibility testing (DST), were prospectively enrolled and followed during treatment. Bivariate and Kaplan-Meier analyses were used to examine the relationships of diabetes characteristics with drug-resistant TB and TB outcomes. Of 1671 adult TB patients enrolled, 186 (11.1%) had diabetes. TB-DM patients were significantly more likely than TB patients without diabetes to be older, have had no previous TB treatment, and to have a body mass index (BMI) >18.5 kg/m(2) (pdiabetes, and 12% and 28%, respectively, among TB-DM patients. Among 149 TB-DM patients with DST results, 104 (69.8%) had drug-susceptible TB and 45 (30.2%) had drug-resistant TB, of whom 29 had multidrug-resistant TB. There was no association between diabetes characteristics and drug-resistant TB. Of 136 TB-DM patients with outcome information, 107 (78.7%) had a favorable TB outcome; active diabetes management was associated with a favorable outcome. Diabetes was common in a cohort of TB patients at high risk for drug-resistant TB. Despite prevalent multidrug-resistant TB among TB-DM patients, the majority had a favorable TB treatment outcome. Copyright © 2013 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  5. Effectiveness of TB sensitization initiatives in improving the involvement of self help group members in rural TB control in south India.

    Science.gov (United States)

    Thomas, Beena; Priscilla Rebecca, B; Dhanalakshmi, A; Rani, S; Deepa Lakshmi, A; Watson, Basilea; Vijayalakshmi, R; Muniyandi, M; Karikalan, N

    2016-12-01

    The 'End TB strategy' has highlighted the importance of inter-sectoral collaboration and community mobilization for achieving zero TB deaths by 2020. The aim of the study was to develop and test a model TB sensitization programme involving self help groups (SHGs). This experimental study was conducted in two blocks (intervention and control), in Tiruvallur district. The intervention content included short-lecture, musical story telling activity, role play, short film on TB. The impact was compared at baseline, third and sixth months in terms of SHGs' awareness, promotion of awareness, identification and referral of presumptive TB cases and provision of TB treatment. A total of 764 vs 796 SHGs were enrolled in control and intervention groups, respectively. The knowledge attitude, and practice score (lower score indicated a better attitude and practice), from baseline to 6 months was significantly reduced (29 to 24) in the intervention group. Similarly, a significant difference was observed in identification and referral of chest symptomatics in the intervention group at 3 and 6 months. During the 3 month follow-up a significantly higher proportion of SHG members were involved in TB awareness activities in the intervention (623/748 [83.3%]) vs control group (471/728 [64.7%]; p<0.001). Findings from this study highlight the feasibility of involving SHGs through a model TB sensitization program for strengthening TB prevention and control activities. © The Author 2017. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Ecdysteroids Sensitize MDR and Non-MDR Cancer Cell Lines to Doxorubicin, Paclitaxel, and Vincristine but Tend to Protect Them from Cisplatin

    Directory of Open Access Journals (Sweden)

    Ana Martins

    2015-01-01

    Full Text Available Ecdysteroids, analogs of the insect molting hormone, are known for their various mild, nonhormonal bioactivities in mammals. Previously, we reported that less-polar ecdysteroids can modulate the doxorubicin resistance of a multidrug resistant (MDR mouse lymphoma cell line expressing the human ABCB1 transporter. Here, we describe the ability of 20-hydroxyecdysone (1 and its mono- (2 and diacetonide (3 derivatives to sensitize various MDR and non-MDR cancer cell lines towards doxorubicin, paclitaxel, vincristine, or cisplatin. Drug IC50 values with or without ecdysteroid were determined by MTT assay. Compound 3 significantly sensitized all cell lines to each chemotherapeutic except for cisplatin, whose activity was decreased. In order to overcome solubility and stability issues for the future in vivo administration of compound 3, liposomal formulations were developed. By means of their combination index values obtained via checkerboard microplate method, a formulation showed superior activity to that of compound 3 alone. Because ecdysteroids act also on non-ABCB1 expressing (sensitive cell lines, our results demonstrate that they do not or not exclusively exert their adjuvant anticancer activity as ABCB1 inhibitors, but other mechanisms must be involved, and they opened the way towards their in vivo bioactivity testing against various cancer xenografts.

  7. ANALYSIS OF MUTATIONS OF TUBERCULOUS MYCOBACTERIA DEFINING DRUG RESISTANCE IN HIV POSITIVE AND HIV NEGATIVE TUBERCULOSIS PATIENTS WITHOUT PRIOR HISTORY OF TREATMENT IN SVERDLOVSK REGION

    Directory of Open Access Journals (Sweden)

    G. V. Panov

    2017-01-01

    Full Text Available Goal of the study: to identify profile of mutations of tuberculous mycobacteria responsible for resistance to anti-tuberculosis drugs in HIV positive and HIV negative tuberculosis patients without prior history of treatment.Materials and methods. 165 strains of tuberculous mycobacteria from HIV positive patients and 166 strains of tuberculous mycobacteria from HIV negative patients were studied in Sverdlovsk Region (TB Dispensary, Yekaterinburg. Mutations in genes were identified using microchips of TB-BIOCHIP® and TB-BIOCHIP®-2 in compliance with the manufacturer's guidelines (OOO Biochip-IMB, Moscow.Results. It was observed that 85/165 (51.52% strains isolated from HIV positive tuberculosis patients and 58/166 (34.94% strains isolated from tuberculosis patients not associated with HIV possessed MDR genotype (p < 0.01. The majority of MDR strains had mutations in the 531th codon of rpoB (Ser→Leu and 315th codon of katG (Ser→Thr (64/85, 75.29% and 38/58, 65.52% respective the groups, resulting in the high level of resistance to rifampicin and isoniazid. Each group also had approximately equal ratio (11/165, 6.67% and 12/166, 7.23% respective the groups of strains with genomic mutations defining the resistance to isoniazid, rifampicin and fluoruquinolones. No confident difference was found in mutation patterns of genome of tuberculous mycobacteria isolated from HIV positive and HIV negative tuberculosis patients. 

  8. The high burden of tuberculosis (TB) and human immunodeficiency virus (HIV) in a large Zambian prison: a public health alert.

    Science.gov (United States)

    Henostroza, German; Topp, Stephanie M; Hatwiinda, Sisa; Maggard, Katie R; Phiri, Winifreda; Harris, Jennifer B; Krüüner, Annika; Kapata, Nathan; Ayles, Helen; Chileshe, Chisela; Reid, Stewart E

    2013-01-01

    Tuberculosis (TB) and human immunodeficiency virus (HIV) represent two of the greatest health threats in African prisons. In 2010, collaboration between the Centre for Infectious Disease Research in Zambia, the Zambia Prisons Service, and the National TB Program established a TB and HIV screening program in six Zambian prisons. We report data on the prevalence of TB and HIV in one of the largest facilities: Lusaka Central Prison. Between November 2010 and April 2011, we assessed the prevalence of TB and HIV amongst inmates entering, residing, and exiting the prison, as well as in the surrounding community. The screening protocol included complete history and physical exam, digital radiography, opt-out HIV counseling and testing, sputum smear and culture. A TB case was defined as either bacteriologically confirmed or clinically diagnosed. A total of 2323 participants completed screening. A majority (88%) were male, median age 31 years and body mass index 21.9. TB symptoms were found in 1430 (62%). TB was diagnosed in 176 (7.6%) individuals and 52 people were already on TB treatment at time of screening. TB was bacteriologically confirmed in 88 cases (3.8%) and clinically diagnosed in 88 cases (3.8%). Confirmed TB at entry and exit interventions were 4.6% and 5.3% respectively. Smear was positive in only 25% (n = 22) of bacteriologically confirmed cases. HIV prevalence among inmates currently residing in prison was 27.4%. Ineffective TB and HIV screening programs deter successful disease control strategies in prison facilities and their surrounding communities. We found rates of TB and HIV in Lusaka Central Prison that are substantially higher than the Zambian average, with a trend towards concentration and potential transmission of both diseases within the facility and to the general population. Investment in institutional and criminal justice reform as well as prison-specific health systems is urgently required.

  9. The High Burden of Tuberculosis (TB) and Human Immunodeficiency Virus (HIV) in a Large Zambian Prison: A Public Health Alert

    Science.gov (United States)

    Henostroza, German; Topp, Stephanie M.; Hatwiinda, Sisa; Maggard, Katie R.; Phiri, Winifreda; Harris, Jennifer B.; Krüüner, Annika; Kapata, Nathan; Ayles, Helen; Chileshe, Chisela; Reid, Stewart E.

    2013-01-01

    Background Tuberculosis (TB) and human immunodeficiency virus (HIV) represent two of the greatest health threats in African prisons. In 2010, collaboration between the Centre for Infectious Disease Research in Zambia, the Zambia Prisons Service, and the National TB Program established a TB and HIV screening program in six Zambian prisons. We report data on the prevalence of TB and HIV in one of the largest facilities: Lusaka Central Prison. Methods Between November 2010 and April 2011, we assessed the prevalence of TB and HIV amongst inmates entering, residing, and exiting the prison, as well as in the surrounding community. The screening protocol included complete history and physical exam, digital radiography, opt-out HIV counseling and testing, sputum smear and culture. A TB case was defined as either bacteriologically confirmed or clinically diagnosed. Results A total of 2323 participants completed screening. A majority (88%) were male, median age 31 years and body mass index 21.9. TB symptoms were found in 1430 (62%). TB was diagnosed in 176 (7.6%) individuals and 52 people were already on TB treatment at time of screening. TB was bacteriologically confirmed in 88 cases (3.8%) and clinically diagnosed in 88 cases (3.8%). Confirmed TB at entry and exit interventions were 4.6% and 5.3% respectively. Smear was positive in only 25% (n = 22) of bacteriologically confirmed cases. HIV prevalence among inmates currently residing in prison was 27.4%. Conclusion Ineffective TB and HIV screening programs deter successful disease control strategies in prison facilities and their surrounding communities. We found rates of TB and HIV in Lusaka Central Prison that are substantially higher than the Zambian average, with a trend towards concentration and potential transmission of both diseases within the facility and to the general population. Investment in institutional and criminal justice reform as well as prison-specific health systems is urgently required. PMID

  10. Expression of LRP and MDR1 in locally advanced breast cancer predicts axillary node invasion at the time of rescue mastectomy after induction chemotherapy

    International Nuclear Information System (INIS)

    Schneider, José; Gonzalez-Roces, Severino; Pollán, Marina; Lucas, Raul; Tejerina, Armando; Martin, Miguel; Alba, Alfonso

    2001-01-01

    Axillary node status after induction chemotherapy for locally advanced breast cancer has been shown on multivariate analysis to be an independent predictor of relapse. However, it has been postulated that responders to induction chemotherapy with a clinically negative axilla could be spared the burden of lymphadenectomy, because most of them will not show histological nodal invasion. P-glycoprotein expression in the rescue mastectomy specimen has finally been identified as a significant predictor of patient survival. We studied the expression of the genes encoding multidrug resistance associated protein (MDR1) and lung cancer associated resistance protein (LRP) in formalin-fixed, paraffin-embedded tumor samples from 52 patients treated for locally advanced breast cancer by means of induction chemotherapy followed by rescue mastectomy. P-glycoprotein expression was assessed by means of immunohistochemistry before treatment in 23 cases, and by means of reverse-transcriptase-mediated polymerase chain reaction (RT-PCR) after treatment in 46 (6 failed). LRP expression was detected by means of immunohistochemistry, with the LRP-56 monoclonal antibody, in 31 cases before treatment. Immunohistochemistry for detecting the expression of c-erb-B2, p53, Ki67, estrogen receptor and progesterone receptor are routinely performed in our laboratory in every case, and the results obtained were included in the study. All patients had received between two and six cycles of standard 5-fluorouracil, doxorubicin and cyclophosphamide (FAC) chemotherapy, with two exceptions [one patient received four cycles of a docetaxel-adriamycin combination, and the other four cycles of standard cyclophosphamide-methotrexate-5-fluorouracil (CMF) polychemotherapy]. Response was assessed in accordance with the Response Evaluation Criteria In Solid Tumors (RECIST). By these, 2 patients achieved a complete clinical response, 37 a partial response, and the remaining 13 showed stable disease. This makes a

  11. Optimizing the Safety of Multidrug-resistant Tuberculosis Therapy in Namibia

    NARCIS (Netherlands)

    Sagwa, Evans

    2017-01-01

    Introduction: Multidrug-resistant tuberculosis (MDR-TB), a growing global menace, is seriously undermining the previous successes made in the elimination of TB. MDR-TB treatment takes a long time, is complex, and is frequently associated with the occurrence of adverse drug reactions, some of which

  12. Stop TB in My Lifetime: A Call for a World Free of TB - World TB Day 2013

    Centers for Disease Control (CDC) Podcasts

    2012-03-12

    In this podcast Dr. Kenneth Castro, Director of the Division of Tuberculosis Elimination, discusses World TB Day, the 2013 slogan and theme.  Created: 3/12/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/13/2012.

  13. The process behind the expression of mdr-1/P-gp and mrp/MRP in human leukemia/lymphoma.

    Science.gov (United States)

    Hirose, Masao

    2009-04-01

    There is a controversy over the link between phenotypes of multidrug resistance (MDR) and clinical outcome in leukemia/lymphoma patients. This may be because the process behind the induction and loss of expression of genotypes and phenotypes by which MDR develops and the role of MDR in fresh cells of human leukemia/lymphoma are not clearly defined. P-glycoprotein (P-gp) increased and decreased along with mdr-1 expression in three cell lines out of five vincristine (VCR)-resistant cell lines. MRP appeared with increased mrp expression in the other two cell lines. After the drug was removed from the culture system, mdr-1/P-gp changed in parallel with the level of VCR resistance, although mrp and MRP did not. It was concluded that P-gp is directly derived from mdr-1 and that mdr-1/P-gp supports the VCR-resistance but mrp/MRP is not directly linked to the VCR-resistance. These results should contribute to a better understanding of MDR phenomenon in cancer.

  14. Mice heterozygous for the Mdr2 gene demonstrate decreased PEMT activity and diminished steatohepatitis on the MCD diet.

    Science.gov (United States)

    Igolnikov, Alexander C; Green, Richard M

    2006-03-01

    The administration of a methionine and choline deficient (MCD) diet to mice serves as an animal model of NASH. The multidrug resistant 2 (Mdr2) P-glycoprotein encodes for the canalicular phospholipid transporter, and Mdr2 (+/-) mice secrete 40% less phosphatidylcholine than wild-type mice. We have hypothesized that phosphatidylethanolamine-N-methyl transferase (PEMT) up-regulation is a consequence of MCD diet administration, and is important for the pathogenesis of steatohepatitis in this model. However, the effect of decreased phosphatidylcholine secretion and modulation of PEMT on the development of diet-induced steatohepatitis in Mdr2 (+/-) mice has not been explored. Thus, the purpose of the study is to examine the effects of the MCD diet on Mdr2 (+/-) mice. Mdr2 (+/-) and Mdr2 (+/+) mice were treated with an MCD or control diet for up to 30 days, and the severity of steatohepatitis, PEMT activity and hepatic S-adenosylmethionine (SAM), and S-adenosylhomocysteine (SAH) levels were measured. Serum ALT levels, hepatic inflammation, and PEMT activity were significantly lower, and hepatic SAM:SAH ratios were significantly higher in Mdr2 (+/-) mice at 7 and 30 days on the MCD diet. Mdr2 (+/-) mice have diminished susceptibility to MCD diet-induced NASH, which is associated with a relative decrease in PEMT activity and increased SAM:SAH ratios.

  15. Infrequent detection of Pneumocystis jirovecii by PCR in oral wash specimens from TB patients with or without HIV and healthy contacts in Tanzania

    DEFF Research Database (Denmark)

    Jensen, Lotte; Jensen, Andreas V.; Praygod, George

    2010-01-01

    In tuberculosis (TB) endemic parts of the world, patients with pulmonary symptoms are managed as "smear-negative TB patients" if they do not improve on a two-week presumptive, broad-spectrum course of antibiotic treatment even if they are TB microscopy smear negative. These patients are frequently...... HIV positive and have a higher mortality than smear-positive TB patients. Lack of access to diagnose Pneumocystis jirovecii pneumonia might be a contributing reason. We therefore assessed the prevalence of P. jirovecii by PCR in oral wash specimens among TB patients and healthy individuals in an HIV...

  16. Coumpounds affecting cell membrane functions and integrity: MDR pumps and theit exploration

    Czech Academy of Sciences Publication Activity Database

    Sigler, Karel; Gášková, D.

    2002-01-01

    Roč. 51, č. 24 (2002), s. 19-22 ISSN 0137-1398. [Uroczyste Seminarium z okazji urodzin Profesora Stanislawa Witka /70./. Wroclaw, 21.07.2002] R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Keywords : xenobioticexporting * multidrug resistance * mdr pumps Subject RIV: EE - Microbiology, Virology

  17. Monoclonal antibody to an external epitope of the human mdr1 P-glycoprotein

    NARCIS (Netherlands)

    Arceci, R. J.; Stieglitz, K.; Bras, J.; Schinkel, A.; Baas, F.; Croop, J.

    1993-01-01

    A membrane glycoprotein, termed P-glycoprotein, has been shown to be responsible for cross-resistance to a broad range of structurally and functionally distinct cytotoxic agents. P-glycoprotein, encoded in humans by the mdr1 gene, functions as an energy-dependent efflux pump to exclude these

  18. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  19. Beyond cellular detoxification: a plethora of physiological roles for MDR transporter homologs in plants

    Science.gov (United States)

    Remy, Estelle; Duque, Paula

    2014-01-01

    Higher plants possess a multitude of Multiple Drug Resistance (MDR) transporter homologs that group into three distinct and ubiquitous families—the ATP-Binding Cassette (ABC) superfamily, the Major Facilitator Superfamily (MFS), and the Multidrug And Toxic compound Extrusion (MATE) family. As in other organisms, such as fungi, mammals, and bacteria, MDR transporters make a primary contribution to cellular detoxification processes in plants, mainly through the extrusion of toxic compounds from the cell or their sequestration in the central vacuole. This review aims at summarizing the currently available information on the in vivo roles of MDR transporters in plant systems. Taken together, these data clearly indicate that the biological functions of ABC, MFS, and MATE carriers are not restricted to xenobiotic and metal detoxification. Importantly, the activity of plant MDR transporters also mediates biotic stress resistance and is instrumental in numerous physiological processes essential for optimal plant growth and development, including the regulation of ion homeostasis and polar transport of the phytohormone auxin. PMID:24910617

  20. 75 FR 59176 - DoD Mandatory Declassification Review (MDR) Program

    Science.gov (United States)

    2010-09-27

    ..., VA 22060-6201. (13) Missile Defense Agency. Missile Defense Agency, Attention: MDA/DS, 7100 Defense... DEPARTMENT OF DEFENSE Office of the Secretary 32 CFR Part 222 [DoD-2010-OS-0043; RIN 0790-AI62] DoD Mandatory Declassification Review (MDR) Program AGENCY: Department of Defense. ACTION: Proposed...

  1. Targeted nanodrug delivery systems for the treatment of Tuberculosis

    CSIR Research Space (South Africa)

    Lemmer, Yolandy

    2010-06-01

    Full Text Available patient treatment compliance and drug resistance pose a great challenge to TB treatment programs worldwide. To improve the current inadequate therapeutic management of TB, a polymeric anti-TB nanodrug delivery system for anti-TB drugs was developed...

  2. Extensively Drug-Resistant Tuberculosis (XDR TB)

    Science.gov (United States)

    ... TB Reference Laboratory Network, the National TB Surveillance System in the United States, the national reference laboratory of South Korea, and ... capacity in the U.S. and abroad; and Developing education, risk, and media communications ... – United States, 1993–2006 CDC. CDC’s Role in Preventing XDR ...

  3. TB Testing for People Living with HIV

    Centers for Disease Control (CDC) Podcasts

    2012-07-23

    Dr. Kenneth Castro, Director of the Division of Tuberculosis Elimination, explains why it is important for people living with HIV to be tested for TB.  Created: 7/23/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 7/23/2012.

  4. Enhancing TB case detection: experience in offering upfront Xpert MTB/RIF testing to pediatric presumptive TB and DR TB cases for early rapid diagnosis of drug sensitive and drug resistant TB.

    Directory of Open Access Journals (Sweden)

    Neeraj Raizada

    Full Text Available Diagnosis of pulmonary tuberculosis (PTB in children is challenging due to difficulties in obtaining good quality sputum specimens as well as the paucibacillary nature of disease. Globally a large proportion of pediatric tuberculosis (TB cases are diagnosed based only on clinical findings. Xpert MTB/RIF, a highly sensitive and specific rapid tool, offers a promising solution in addressing these challenges. This study presents the results from pediatric groups taking part in a large demonstration study wherein Xpert MTB/RIF testing replaced smear microscopy for all presumptive PTB cases in public health facilities across India.The study covered a population of 8.8 million across 18 programmatic sub-district level tuberculosis units (TU, with one Xpert MTB/RIF platform established at each study TU. Pediatric presumptive PTB cases (both TB and Drug Resistant TB (DR-TB accessing any public health facilities in study area were prospectively enrolled and tested on Xpert MTB/RIF following a standardized diagnostic algorithm.4,600 pediatric presumptive pulmonary TB cases were enrolled. 590 (12.8%, CI 11.8-13.8 pediatric PTB were diagnosed. Overall 10.4% (CI 9.5-11.2 of presumptive PTB cases had positive results by Xpert MTB/RIF, compared with 4.8% (CI 4.2-5.4 who had smear-positive results. Upfront Xpert MTB/RIF testing of presumptive PTB and presumptive DR-TB cases resulted in diagnosis of 79 and 12 rifampicin resistance cases, respectively. Positive predictive value (PPV for rifampicin resistance detection was high (98%, CI 90.1-99.9, with no statistically significant variation with respect to past history of treatment.Upfront access to Xpert MTB/RIF testing in pediatric presumptive PTB cases was associated with a two-fold increase in bacteriologically-confirmed PTB, and increased detection of rifampicin-resistant TB cases under routine operational conditions across India. These results suggest that routine Xpert MTB/RIF testing is a promising

  5. Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas.

    Science.gov (United States)

    Fairchild, C R; Ivy, S P; Rushmore, T; Lee, G; Koo, P; Goldsmith, M E; Myers, C E; Farber, E; Cowan, K H

    1987-11-01

    We have previously reported the isolation of a human breast cancer cell line resistant to doxorubicin (adriamycin; AdrR MCF-7 cells) that has also developed the phenotype of multidrug resistance (MDR). MDR in this cell line is associated with increased expression of mdr (P glycoprotein) gene sequences. The development of MDR in AdrR MCF-7 cells is also associated with changes in the expression of several phase I and phase II drug-detoxifying enzymes. These changes are remarkably similar to those associated with development of xenobiotic resistance in rat hyperplastic liver nodules, a well-studied model system of chemical carcinogenesis. Using an mdr-encoded cDNA sequence isolated from AdrR MCF-7 cells, we have examined the expression of mdr sequences in rat livers under a variety of experimental conditions. The expression of mdr increased 3-fold in regenerating liver. It was also elevated (3- to 12-fold) in several different samples of rat hyperplastic nodules and in four of five hepatomas that developed in this system. This suggests that overexpression of mdr, a gene previously associated with resistance to antineoplastic agents, may also be involved in the development of resistance to xenobiotics in rat hyperplastic nodules. In addition, although the acute administration of 2-acetylaminofluorene induced an 8-fold increase in hepatic mdr-encoded RNA, performance of a partial hepatectomy either before or after administration of 2-acetylaminofluorene resulted in a greater than 80-fold increase in mdr gene expression over that in normal untreated livers. This represents an important in vivo model system in which to study the acute regulation of this drug resistance gene.

  6. A deadly combination of AIDS, TB and cardiac tumour

    OpenAIRE

    Sahasrabudhe, Tushar Ramesh

    2013-01-01

    Immunocompromised status in AIDS makes differential diagnosis of any symptom very difficult for a clinician. Sharp clinical judgement and plenty of investigations may be needed to reach the diagnosis, as in this case. We hereby present a case of AIDS and active tuberculosis (TB) under treatment. The patient developed acute onset multifocal neurological symptoms following an episode of fever and diarrhoea. The MRI scan revealed numerous large cerebral infarcts. On investigations to evaluate br...

  7. TB and HIV Therapeutics: Pharmacology Research Priorities

    Directory of Open Access Journals (Sweden)

    Kelly E. Dooley

    2012-01-01

    Full Text Available An unprecedented number of investigational drugs are in the development pipeline for the treatment of tuberculosis. Among patients with tuberculosis, co-infection with HIV is common, and concurrent treatment of tuberculosis and HIV is now the standard of care. To ensure that combinations of anti-tuberculosis drugs and antiretrovirals are safe and are tested at doses most likely to be effective, selected pharmacokinetic studies based on knowledge of their metabolic pathways and their capacity to induce or inhibit metabolizing enzymes of companion drugs must be conducted. Drug interaction studies should be followed up by evaluations in larger populations to evaluate safety and pharmacodynamics more fully. Involving patients with HIV in trials of TB drugs early in development enhances the knowledge gained from the trials and will ensure that promising new tuberculosis treatments are available to patients with HIV as early as possible. In this review, we summarize current and planned pharmacokinetic and drug interaction studies involving investigational and licensed tuberculosis drugs and antiretrovirals and suggest priorities for tuberculosis-HIV pharmacokinetic, pharmacodynamic, and drug-drug interaction studies for the future. Priority studies for children and pregnant women with HIV and tuberculosis co-infection are briefly discussed.

  8. Impact of BCRP/MXR, MRP1 and MDR1/P-Glycoprotein on thermoresistant variants of atypical and classical multidrug resistant cancer cells

    DEFF Research Database (Denmark)

    Stein, Ulrike; Lage, Hermann; Jordan, Andreas

    2002-01-01

    The impact of the ABC transporters breast cancer resistance protein/mitoxantrone resistance associated transporter (BCRP/MXR), multidrug resistance-associated protein 1 (MRP1) and multidrug resistance gene-1/P-glycoprotein (MDR1/PGP) on the multidrug resistance (MDR) phenotype in chemoresistance...... expression of BCRP/MXR and of MRP1 were clearly enhanced (vs. parental and classical MDR lines). MDR1/PGP expression was distinctly elevated in the classical MDR subline EPG85-257RDB (vs. parental and atypical MDR sublines). In all thermoresistant counterparts basal expression of BCRP/MXR, MRP1 and MDR1/PGP...... was increased relative to thermosensitive sublines. Although it could be shown that the overexpressed ABC transporters were functionally active, however, no decreased drug accumulations of doxorubicin, mitoxantrone and rhodamine 123 were observed. Thus, expression of BCRP/MXR, MRP1 and MDR1/PGP was found...

  9. EXSPRESSION OF MDR-GENES AND MONORESISTANCE GENES IN NON-SMALL-CELL LUNG CANCER

    Directory of Open Access Journals (Sweden)

    E. L. Yumov

    2014-01-01

    Full Text Available We studied the expression of multidrug resistance genes (MDR and monoresistance genes in normal bronchial tissue and tumor tissue of the non-small cell lung cancer (NSCLC after neoadjuvant chemotherapy (NACT (vinorelbine-carboplatine. The study included 30 patients with NSCLC (Т2–4N0–3M0. Normal bronchial tissue, normal lung tissue and tumor tissue collected during surgery following neoadjuvant chemotherapy (NACT served as a material of the study. The expression levels of MDR genes (ABCB1, ABCB2, ABCC1, ABCC2, ABCС5, ABCG1, ABCG2, GSTP and MVP, and monoresistance genes (BRCA1, ERCC1, RRM1, TOP1, TOP2A, TUBB3 and TYMS were estimated by quantitative reverse transcriptase PCR (RT-qPCR. The expression levels of some MDR genes and monoresistance genes (АВСВ1, АВСВ2, ABCG1, ERCC1, GSTP1 and MVP were significantly higher in the bronchi than in tumor tissue. The expression of ABCG1, ABCG2 and ERCC1 genes was higher in patients with T1-2 cancer than in patients with T3-4 cancer. Patients with adenocarcinoma had higher expression of BRCA1, MVP and ABCB1 genes than patients with squamous cell lung cancer. A tendency towards reduction in the expression level of MDR-genes and monoresistance genes was observed in patients with partial tumor regression compared to that observed in patients with stable disease. These findings were consistent with the previous data on reduction in the MDR-gene expression after chemotherapy with a good response in breast cancer patients.

  10. HIV-1 integrase inhibitors are substrates for the multidrug transporter MDR1-P-glycoprotein

    Directory of Open Access Journals (Sweden)

    Cara Andrea

    2007-03-01

    Full Text Available Abstract Background The discovery of diketoacid-containing derivatives as inhibitors of HIV-1 Integrase (IN (IN inhibitors, IINs has played a major role in validating this enzyme as an important target for antiretroviral therapy. Since the in vivo efficacy depends on access of these drugs to intracellular sites where HIV-1 replicates, we determined whether the IINs are recognized by the multidrug transporter MDR1-P-glycoprotein (P-gp thereby reducing their intracellular accumulation. To address the effect of IINs on drug transport, nine quinolonyl diketo acid (DKA derivatives active on the HIV-1 IN strand transfer (ST step and with EC50 ranging from 1.83 to >50 μm in cell-based assays were tested for their in vitro interaction with P-gp in the CEM-MDR cell system. IINs were investigated for the inhibition and induction of the P-gp function and expression as well as for multidrug resistance (MDR reversing ability. Results The HIV-1 IINs act as genuine P-gp substrates by inhibiting doxorubicin efflux and inducing P-gp functional conformation changes as evaluated by the modulation of UIC2 mAb epitope. Further, IINs chemosensitize MDR cells to vinblastine and induce P-gp expression in drug sensitive revertants of CEM-MDR cells. Conclusion To our knowledge, this is the first demonstration that HIV-1 IINs are P-gp substrates. This biological property may influence the absorption, distribution and elimination of these novels anti HIV-1 compounds.

  11. Detection of expression and modulation of multidrug-resistance (MDR) and establishment of a new bioassay

    International Nuclear Information System (INIS)

    Berger, W.

    1993-08-01

    The present thesis deals with the resistance of human malignant cells against cellular toxicity of anticancer drugs, a phenomenon representing one of the major obstacles to successful chemotherapy. One mechanism underlying a cross-resistance to different drugs called multidrug resistance (MDR) is characterized by the expression of an active transport protein (P-glycoprotein), causing decreased intracellular drug retention and cytotoxicity. The main subjects of the present work were to establish different detection methods for MDR and its modulation (by substances blocking activity of P-glycoprotein) including immunological methods (immunocytochemistry, radioimmunoassay), molecular biology (slot-blot analysis, in-situ hybridization) and functional assays (drug-accumulation analysis, drug-cytotoxicity analysis). The methods were evaluated and compared using human and mouse MDR control cell lines and human tumor cell lines established in our laboratory. In cell lines derived from human melanoma - a malignancy insensitive to chemotherapy - expression of P-glycoprotein of relatively low transporting activity was detected by different methods in 8 of 33 cases. Furthermore a new sensitive in vitro assay for the functional detection of MDR was established using the biological features of cytochalasins, a microfilament disrupting substance group. These compounds were shown to be substrates for the P-glycoprotein efflux pump and their effects on cell division (blockade of cytokinesis resulting in multinucleate cells) correlated with MDR-activity of the tested cells. With this new assay P-glycoprotein activity can be demonstrated and analysed over a wide range of resistance against different cytotoxic drugs. Therefore it may by a suitable tool for research and diagnosis in the field of drug resistance

  12. HIV/TB co-infection:perspectives of TB patients and providers on the integrated HIV/TB pilot program in Tamilnadu, India

    OpenAIRE

    Lakshminarayanan, Mahalakshmi

    2009-01-01

    The WHO recommends routine HIV testing among TB patients as a key strategy to combat the dual HIV/TB epidemic. India has integrated its HIV and TB control programs and is offering provider initiated HIV testing for all TB patients since 2007. Using a mixed methods approach, this study aims to understand the perspectives of TB patients and providers on the integrated HIV/TB pilot program in Tamilnadu, India. A survey conducted by the Tuberculosis Research Center, India on 300 TB patients is th...

  13. Colesevelam attenuates cholestatic liver and bile duct injury in Mdr2-/- mice by modulating composition, signalling and excretion of faecal bile acids.

    Science.gov (United States)

    Fuchs, Claudia Daniela; Paumgartner, Gustav; Mlitz, Veronika; Kunczer, Victoria; Halilbasic, Emina; Leditznig, Nadja; Wahlström, Annika; Ståhlman, Marcus; Thüringer, Andrea; Kashofer, Karl; Stojakovic, Tatjana; Marschall, Hanns-Ulrich; Trauner, Michael

    2018-04-10

    Interruption of the enterohepatic circulation of bile acids (BAs) may protect against BA-mediated cholestatic liver and bile duct injury. BA sequestrants are established to treat cholestatic pruritus, but their impact on the underlying cholestasis is still unclear. We aimed to explore the therapeutic effects and mechanisms of the BA sequestrant colesevelam in a mouse model of sclerosing cholangitis. Mdr2 -/- mice received colesevelam for 8 weeks. Gene expression profiles of BA homeostasis, inflammation and fibrosis were explored in liver, intestine and colon. Hepatic and faecal BA profiles and gut microbiome were analysed. Glucagon-like peptide 1 (GLP-1) levels in portal blood were measured by ELISA. Furthermore, Mdr2 -/- mice as well as wild-type 3,5-diethoxy-carbonyl-1,4-dihydrocollidine-fed mice were treated with GLP-1-receptor agonist exendin-4 for 2 weeks prior to analysis. Colesevelam reduced serum liver enzymes, BAs and expression of proinflammatory and profibrogenic markers. Faecal BA profiling revealed increased levels of secondary BAs after resin treatment, while hepatic and biliary BA composition showed a shift towards more hydrophilic BAs. Colonic GLP-1 secretion, portal venous GLP-1 levels and intestinal messenger RNA expression of gut hormone Proglucagon were increased, while ileal Fgf15 expression was abolished by colesevelam. Exendin-4 treatment increased bile duct mass without promoting a reactive cholangiocyte phenotype in mouse models of sclerosing cholangitis. Microbiota analysis showed an increase of the phylum δ-Proteobacteria after colesevelam treatment and a shift within the phyla Firmicutes from Clostridiales to Lactobacillus . Colesevelam increases faecal BA excretion and enhances BA conversion towards secondary BAs, thereby stimulating secretion of GLP-1 from enteroendocrine L-cells and attenuates liver and bile duct injury in Mdr2 -/- mice. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article

  14. Cost-effectiveness of adding bedaquiline to drug regimens for the treatment of multidrug-resistant tuberculosis in the UK.

    Directory of Open Access Journals (Sweden)

    Lara J Wolfson

    Full Text Available To evaluate the cost-effectiveness of adding bedaquiline to a background regimen (BR of drugs for multidrug-resistant tuberculosis (MDR-TB in the United Kingdom (UK.A cohort-based Markov model was developed to estimate the incremental cost-effectiveness ratio of bedaquiline plus BR (BBR versus BR alone (BR in the treatment of MDR-TB, over a 10-year time horizon. A National Health Service (NHS and personal social services perspective was considered. Cost-effectiveness was evaluated in terms of Quality-Adjusted Life Years (QALYs and Disability-Adjusted Life Years (DALYs. Data were sourced from a phase II, placebo-controlled trial, NHS reference costs, and the literature; the US list price of bedaquiline was used and converted to pounds (£18,800. Costs and effectiveness were discounted at a rate of 3.5% per annum. Probabilistic and deterministic sensitivity analysis was conducted.The total discounted cost per patient (pp on BBR was £106,487, compared with £117,922 for BR. The total discounted QALYs pp were 5.16 for BBR and 4.01 for BR. The addition of bedaquiline to a BR resulted in a cost-saving of £11,434 and an additional 1.14 QALYs pp over a 10-year period, and is therefore considered to be the dominant (less costly and more effective strategy over BR. BBR remained dominant in the majority of sensitivity analyses, with a 81% probability of being dominant versus BR in the probabilistic analysis.In the UK, bedaquiline is likely to be cost-effective and cost-saving, compared with the current MDR-TB standard of care under a range of scenarios. Cost-savings over a 10-year period were realized from reductions in length of hospitalization, which offset the bedaquiline drug costs. The cost-benefit conclusions held after several sensitivity analyses, thus validating assumptions made, and suggesting that the results would hold even if the actual price of bedaquiline in the UK were higher than in the US.

  15. Fabrication, magnetostriction properties and applications of Tb-Dy-Fe alloys: a review

    Directory of Open Access Journals (Sweden)

    Nai-juan Wang

    2016-03-01

    Full Text Available As an excellent giant-magnetostrictive material, Tb-Dy-Fe alloys (based on Tb0.27-0.30Dy0.73-0.70Fe1.9-2 Laves compound can be applied in many engineering fields, such as sonar transducer systems, sensors, and micro-actuators. However, the cost of the rare earth elements Tb and Dy is too high to be widely applied for the materials. Nowadays, there are two different ways to substitute for these alloying elements. One is to partially replace Tb or Dy by cheaper rare earth elements, such as Pr, Nd, Sm and Ho; and the other is to use non-rare earth elements, such as Co, Al, Mn, Si, Ce, B, Be and C, to substitute Fe to form single MgCu2-type Laves phase and a certain amount of Re-rich phase, which can reduce the brittleness and improve the corrosion resistance of the alloy. This paper systemically introduces the development, the fabrication methods and the corresponding preferred growth directions of Tb-Dy-Fe alloys. In addition, the effects of alloying elements and heat treatment on magnetostrictive and mechanical properties of Tb-Dy-Fe alloys are also reviewed, respectively. Finally, some possible applications of Tb-Dy-Fe alloys are presented.

  16. Predictive and prognostic properties of TB-LAM among HIV-positive patients initiating ART in Johannesburg, South Africa.

    Science.gov (United States)

    d'Elia, Alexander; Evans, Denise; McNamara, Lynne; Berhanu, Rebecca; Sanne, Ian; Lönnermark, Elisabet

    2015-01-01

    While the diagnostic properties of the TB LAM urine assay (LAM) have been well-described, little is known about its predictive and prognostic properties at ART initiation in a routine clinic setting. We describe the predictive and prognostic properties of LAM in HIV-positive patients initiating ART at an urban hospital in Johannesburg, South Africa. Retrospective study of HIV-positive adults (>18 years) who initiated standard first-line ART between February 2012 and April 2013 and had a LAM test at initiation. In HIV-positive patients with no known TB at ART initiation, we assessed the sensitivity, specificity and positive/negative likelihood ratios of LAM to predict incident TB within 6 months of ART initiation. In addition, in patients with a TB diagnosis and on TB treatment ART initiation, we measured the CD4 response at 6 months on ART. Of the 274 patients without TB at ART initiation, 65% were female with median CD4 count of 213 cells/mm(3). Among the 14 (5.1%) patients who developed active TB, none were urine LAM +ve at baseline. LAM had poor sensitivity (0.0% 95% CI 0.00-23.2) to predict incident TB within 6 months of initiation. We analyzed 22 patients with a confirmed TB diagnosis at initiation separately. Of these, LAM +ve patients (27%) showed lower CD4 gains compared to LAM negative patients (median increase 103 vs 199 cells/mm(3); p = 0.08). LAM has limited value for accurately predicting incident TB in patients with higher CD4 counts after ART initiation. LAM may help identify TB/HIV co-infected patients at ART initiation who respond more slowly to treatment and require targeted interventions to improve treatment outcomes. Larger studies with longer patient follow-up are needed.

  17. Analysis of Factors Influencing Diagnostic Accuracy of T-SPOT.TB for Active Tuberculosis in Clinical Practice.

    Science.gov (United States)

    Zhang, Lifan; Shi, Xiaochun; Zhang, Yueqiu; Zhang, Yao; Huo, Feifei; Zhou, Baotong; Deng, Guohua; Liu, Xiaoqing

    2017-08-10

    T-SPOT.TB didn't perform a perfect diagnosis for active tuberculosis (ATB), and some factors may influence the results. We did this study to evaluate possible factors associated with the sensitivity and specificity of T-SPOT.TB, and the diagnostic parameters under varied conditions. Patients with suspected ATB were enrolled prospectively. Influencing factors of the sensitivity and specificity of T-SPOT.TB were evaluated using logistic regression models. Sensitivity, specificity, predictive values (PV), and likelihood ratios (LR) were calculated with consideration of relevant factors. Of the 865 participants, 205 (23.7%) had ATB, including 58 (28.3%) microbiologically confirmed TB and 147 (71.7%) clinically diagnosed TB. 615 (71.7%) were non-TB. 45 (5.2%) cases were clinically indeterminate and excluded from the final analysis. In multivariate analysis, serous effusion was the only independent risk factor related to lower sensitivity (OR = 0.39, 95% CI: 0.18-0.81) among patients with ATB. Among non-TB patients, age, TB history, immunosuppressive agents/glucocorticoid treatment and lymphocyte count were the independent risk factors related to specificity of T-SPOT.TB. Sensitivity, specificity, PV+, PV-, LR+ and LR- of T-SPOT.TB for diagnosis of ATB were 78.5%, 74.1%, 50.3%, 91.2%, 3.0 and 0.3, respectively. This study suggests that influencing factors of sensitivity and specificity of T-SPOT.TB should be considered for interpretation of T-SPOT.TB results.

  18. Using 15 DHS surveys to study epidemiological correlates of TB courtesy stigma and health-seeking behaviour.

    Science.gov (United States)

    Rood, E J J; Mergenthaler, C; Bakker, M I; Redwood, L; Mitchell, E M H

    2017-11-01

    Tuberculosis (TB) stigma is thought to delay or prevent the decision to seek health care, but the strength of this association and the prevalence of anticipated TB stigma in the general population in most countries is unknown. To examine epidemiological, cultural and sociodemographic factors associated with TB courtesy stigma in 15 surveys across 13 countries, and its link to health seeking for cough in children under five. A multilevel survey weighted logistic regression model was used to analyse how individual characteristics and social contexts affect the occurrence of TB courtesy stigma. The same modelling approach was used to analyse associations between TB courtesy stigma and individual-level predictors of health-seeking behaviour of mothers for children with cough. TB courtesy stigma varies greatly among countries. TB courtesy stigma was negatively correlated with knowledge of TB's curability (adjusted OR [aOR] 0.82; 95%CI 0.78-0.86) and human immunodeficiency virus (HIV) accepting attitudes (proxy for HIV stigma) (aOR 0.15, 95%CI 0.15-0.16). Mothers' health-seeking behaviour for children under five with cough was found to be positively correlated with HIV accepting attitudes (OR 1.16, 95%CI 1.08-1.25), but was marginally affected by TB courtesy stigma (OR 0.99, 95%CI 0.98-1.00). Improving the general awareness of the effectiveness of anti-tuberculosis treatment will help to diminish TB courtesy stigma, and should be prioritised over expanding knowledge of mode of transmission. Efforts to reduce HIV and TB stigma may increase care seeking for childhood TB symptoms.

  19. Influence knowledge and behavior of TB medical personnels’ concordance principle based communications skill at primary healthcare, Medan, Indonesia

    Science.gov (United States)

    Wahyuni, A. S.; Soeroso, N. N.; Alona, I.; Yunanda, Y.; Siregar, I.

    2018-03-01

    Concordance behavior of TB management is a form of collaboration among doctors, personnel, and patients in treating TB. Approvalamong them could be achieved if credibility and policy occur. This study is aimed to analyze the influence of TB medical personnel’s concordance behaviour principle to patient obedience at primary health care in Medan.The design of this study was quasi experimental, focusing on interventional primary health care, which is those who applied concordance behaviour principle to non-interventionalprimary health care. The population is TB patients, starting from 18 years old, TB category I with positive Acid Fast Bacilli Smear Test (AFBST), and taking TB regimens at Medan. Seventy- four patients were selected to be samples. They had undergone interview based on validated concordance principle, knowledge, behavior, and treatment. Data were analyzed using chi- square. The percentage of knowledge, behavior of TB patient to the treatment is higher on interventional primary health care than noninterventional ones. Treatment awareness based on concordance principle is expected to planish DOTS-based TB programs.

  20. Integration of TB-HIV services at an ANC facility in Frances Baard District, Northern Cape, South Africa.

    Science.gov (United States)

    Peters, J A; Heunis, C; Kigozi, G; Osoba, T; van der Walt, M

    2015-03-21

    Integrated tuberculosis-human immunodeficiency virus (TB-HIV) service delivery as part of maternal health services, including antenatal care (ANC), is widely recommended. This study assessed the implementation of collaborative TB-HIV service delivery at a hospital-based ANC service unit. A record review of a random sample of 308 pregnant women attending the ANC service between April 2011 and February 2012 was conducted. Data were extracted from registers and patient case notes. Outcomes included the proportion of women who underwent HIV counselling and testing (HCT), CD4 count testing, antiretroviral treatment (ART), cotrimoxazole preventive treatment (CPT), TB screening and isoniazid preventive treatment (IPT). Analysis measured variations in patient characteristics associated with service delivery. All women underwent HCT; 80% of those who tested HIV-positive were screened for TB. Most (85.9%) of the HIV-positive women received a CD4 count. However, only 12.9% of eligible women received ART prophylaxis onsite, only 35.7% were referred for initiation of ART, only 42.3% commenced IPT and none received CPT or further investigations for TB. HIV-negative women had 2.6 higher odds (95%CI 1.3-5.3) of receiving TB screening than their HIV-positive counterparts. Although the identification of HIV-positive women and TB suspects was adequate, implementation of other TB-HIV collaborative activities was sub-optimal.

  1. The implementation of isoniazid preventive therapy in HIV clinics: the experience from the TB/HIV in Rio (THRio) study.

    Science.gov (United States)

    Durovni, Betina; Cavalcante, Solange C; Saraceni, Valeria; Vellozo, Vitoria; Israel, Giselle; King, Bonnie S; Cohn, Silvia; Efron, Anne; Pacheco, Antonio G; Moulton, Lawrence H; Chaisson, Richard E; Golub, Jonathan E

    2010-11-01

    The TB/HIV in Rio (THRio) study was launched in September 2005 to assess the impact of integrated tuberculosis (TB) and HIV treatment strategies in 29 HIV clinics in Rio de Janeiro, Brazil. THRio is a cluster-randomized trial (CRT) to determine whether routine screening for and treatment of latent TB in HIV clinic patients with access to antiretroviral therapy will reduce TB incidence at the clinic level. THRio is part of the Consortium to Respond Effectively to AIDS/TB Epidemic that is implementing research studies to assess the impact of bold, new public health paradigms for controlling the AIDS/TB epidemic. Twenty-nine public primary HIV clinics were randomly assigned a date to begin implementing TB screening procedures and provision of isoniazid preventive therapy (IPT) for TB/HIV coinfected patients. Final analysis of the CRT is expected in 2011. Starting at date of tuberculin skin test (TST)/IPT implementation at each clinic through August 2010, 1670 HIV-infected patients initiated IPT, of which 215 are still receiving treatment. Of the remaining 1455 patients, 1230 (85%) completed therapy and only 20 (1.2%) patients initiating IPT reported adverse reactions leading to discontinuation of therapy. IPT completion was higher among HIV-infected patients receiving HAART (87%) than those not yet receiving HAART (79%, P effort requires a package of activities including training, advocacy and reorganization of services.

  2. A model of population dynamics of TB in a prison system and application to South Africa.

    Science.gov (United States)

    Witbooi, Peter; Vyambwera, Sibaliwe Maku

    2017-11-29

    Tuberculosis (TB) continues to spread in South African prisons in particular, as prisons are over-capacitated and have poor ventilation. The awaiting trial detainees are not screened on admission and are at high risk of getting infected with TB. We propose a compartmental model to describe the population dynamics of TB disease in prisons. Our model considers the inflow of susceptible, exposed and TB infectives into the prison population. Removal of individuals out of the prison population can be either by death or by being released from prison, as compared to a general population in which removal is only by death. We describe conditions, including non-inflow of infectives into the prison, which will ensure that TB can be eradicated from the prison population. The model is calibrated for the South African prison system, by using data in existing literature. The model can be used to make quantitative projections of TB prevalence and to measure the effect of interventions. Illustrative simulations in this regard are presented. The model can be used for other prison populations too, if data is available to calculate the model parameters. Various simulations generated with our model serve to illustrate how it can be utilized in making future projections of the levels of prevalence of TB, and to quantify the effect of interventions such as screening, treatment or reduction of transmission parameter values through improved living conditions for inmates. This makes it particularly useful as there are various targets set by the World Health Organization and by governments, for reduction of TB prevalence and ultimately its eradication. Towards eradication of TB from a prison system, the theorem on global stability of the disease-free state is a useful indicator.

  3. Frequency of the MDR1 mutant allele associated with multidrug sensitivity in dogs from Brazil

    Directory of Open Access Journals (Sweden)

    Monobe MM

    2015-04-01

    Full Text Available Marina M Monobe,1 João P Araujo Junior,2 Kari V Lunsford,3 Rodrigo C Silva,4 Camilo Bulla41Department of Veterinary Clinics, School of Veterinary Medicine and Animal Science, 2Department of Microbiology and Immunology, Biosciences Institute, Sao Paulo State University (UNESP, Botucatu, Brazil; 3Department of Clinical Sciences and Animal Health Center, 4Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Mississippi, MS, USAAbstract: To date, a 4-bp deletion in the MDR1 gene has been detected in more than ten dog breeds, as well as in mixed breed dogs, in several countries, however information regarding this mutation in dogs from Brazil is lacking. For this reason, 103 Collies, 77 Border Collies, 76 Shetland Sheepdogs, 20 Old English Sheepdogs, 55 German Shepherds, 16 Australian Shepherds, and 53 Whippets from Brazil were screened for the presence of the mutation. The heterozygous mutated genotype, MDR1 (+/−, frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 50.5% (95% CI =41.1%–59.9%, 31.3% (95% CI =8.6%–53.2%, and 15.8% (95% CI =7.7%–23.9%, respectively. Homozygous mutated genotype, MDR1 (−/−, was detected only in Collies 35.9%. The MDR1 allele mutant frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 61.2% (95% CI =54.8%–67.5%, 15.6% (95% CI =3.1%–28.2%, and 7.9% (95% CI =3.7%–12.1%, respectively. Additionally, even free of the mutant allele, the maximum mutant prevalence (MMP in that population, with 95% CI, was 3.8%, 5.2%, 5.4%, and 13.8% for Border Collies, German Shepherds, Whippets, and Old English Sheepdogs, respectively. In this way, this information is important, not only for MDR1 genotype-based breeding programs and international exchange of breeding animals of predisposed breeds, but also for modification of drug therapy for breeds at risk.Keywords: P-glycoprotein, MDR1 mutation, ivermectin, dog, drug

  4. A deadly combination of AIDS, TB and cardiac tumour.

    Science.gov (United States)

    Sahasrabudhe, Tushar Ramesh

    2013-05-22

    Immunocompromised status in AIDS makes differential diagnosis of any symptom very difficult for a clinician. Sharp clinical judgement and plenty of investigations may be needed to reach the diagnosis, as in this case. We hereby present a case of AIDS and active tuberculosis (TB) under treatment. The patient developed acute onset multifocal neurological symptoms following an episode of fever and diarrhoea. The MRI scan revealed numerous large cerebral infarcts. On investigations to evaluate brain infarcts, we made a diagnosis of left atrial cardiac tumour. Association of cardiac tumours with AIDS has only been rarely reported. It is uncertain if these can be opportunistic tumours in AIDS. The patient successfully came out of this deadly combination of diseases, viz AIDS, TB and large brain infarcts due to atrial tumour; with almost complete recovery.

  5. Synchrotron diffraction characterization of nanostructured KY3F10:Tb

    International Nuclear Information System (INIS)

    Ichikawa, Rodrigo U.; Teixeira, Maria I.; Ranieri, Izilda M.; Martinez, Luis G.; Linhares, Horacio M.S.M.D.; Turrillas, Xavier

    2015-01-01

    Nanostructured rare-earth fluorides materials are being intensively studied recently due to their potential applications in high-dose dosimetry. Particularly, nanostructured Tb-doped KY 3 F 10 has shown satisfactory results to be used in this area. In the present work, the structure and microstructure of KY 3 F 10 :Tb was investigated by means of X-ray synchrotron diffraction. One of the samples was analyzed as synthesized and another after a heat treatment. Rietveld refinement of synchrotron diffraction data was applied to obtain cell parameters, atomic positions and atomic displacement factors and the results were compared to values found in literature. X-ray line profile analysis methods were applied to determine mean crystallite sizes and their distribution. (author)

  6. Predictors of tuberculosis (TB) and antiretroviral (ARV) medication non-adherence in public primary care patients in South Africa: a cross sectional study.

    Science.gov (United States)

    Naidoo, Pamela; Peltzer, Karl; Louw, Julia; Matseke, Gladys; McHunu, Gugu; Tutshana, Bomkazi

    2013-04-26

    Despite the downward trend in the absolute number of tuberculosis (TB) cases since 2006 and the fall in the incidence rates since 2001, the burden of disease caused by TB remains a global health challenge. The co-infection between TB and HIV adds to this disease burden. TB is completely curable through the intake of a strict anti-TB drug treatment regimen which requires an extremely high and consistent level of adherence.The aim of this study was to investigate factors associated with adherence to anti-TB and HIV treatment drugs. A cross-sectional survey method was used. Three study districts (14 primary health care facilities in each) were selected on the basis of the highest TB caseload per clinic. All new TB and new TB retreatment patients were consecutively screened within one month of anti-tuberculosis treatment. The sample comprised of 3107 TB patients who had been on treatment for at least three weeks and a sub-sample of the total sample were on both anti-TB treatment and anti-retro-viral therapy(ART) (N = 757). Data collection tools included: a Socio-Demographic Questionnaire; a Post-Traumatic-Stress-Disorder (PTSD) Screen; a Psychological Distress Scale; the Alcohol Use Disorder Identification Test (AUDIT); and self-report measures of tobacco use, perceived health status and adherence to anti-TB drugs and ART. The majority of the participants (N = 3107) were new TB cases with a 55.9% HIV co-infection rate in this adult male and female sample 18 years and older. Significant predictors of non-adherence common to both anti-TB drugs and to dual therapy (ART and anti-TB drugs) included poverty, having one or more co-morbid health condition, being a high risk for alcohol mis-use and a partner who is HIV positive. An additional predictor for non-adherence to anti-TB drugs was tobacco use. A comprehensive treatment programme addressing poverty, alcohol mis-use, tobacco use and psycho-social counseling is indicated for TB patients (with and without HIV

  7. Culture and drug susceptibility testing among previously treated tuberculosis patients in the Dominican Republic, 2014

    Directory of Open Access Journals (Sweden)

    Katia J. Romero Mercado

    Full Text Available ABSTRACT Multidrug-resistant tuberculosis (MDR-TB is a major public health concern that threatens global progress toward effective TB control. The risk of MDR-TB is increased in patients who have received previous TB treatment. This article describes the performance of culture and drug susceptibility testing (DST in patients registered as previously treated TB patients in the Dominican Republic in 2014, based on operational research that followed a retrospective cohort design and used routine program data. Under the current system of TB culturing and DST, the majority of patients with previously treated TB do not undergo DST, and those who do often experience considerable delay in obtaining their results. The lack of DST and delay in receiving DST results leads to underestimation of the number of MDR-TB cases and hinders the timely initiation of MDR-TB treatment.

  8. Index-TB Guidelines: Guidelines on extrapulmonary tuberculosis for India

    Science.gov (United States)

    Sharma, Surendra K.; Ryan, H.; Khaparde, Sunil; Sachdeva, K. S.; Singh, Achintya D.; Mohan, Alladi; Sarin, Rohit; Paramasivan, C N; Kumar, Prahlad; Nischal, Neeraj; Khatiwada, Saurav; Garner, Paul; Tharyan, Prathap

    2017-01-01

    Extrapulmonary tuberculosis (EPTB) is frequently a diagnostic and therapeutic challenge. It is a common opportunistic infection in people living with HIV/AIDS and other immunocompromised states such as diabetes mellitus and malnutrition. There is a paucity of data from clinical trials in EPTB and most of the information regarding diagnosis and management is extrapolated from pulmonary TB. Further, there are no formal national or international guidelines on EPTB. To address these concerns, Indian EPTB guidelines were developed under the auspices of Central TB Division and Directorate of Health Services, Ministry of Health and Family Welfare, Government of India. The objective was to provide guidance on uniform, evidence-informed practices for suspecting, diagnosing and managing EPTB at all levels of healthcare delivery. The guidelines describe agreed principles relevant to 10 key areas of EPTB which are complementary to the existing country standards of TB care and technical operational guidelines for pulmonary TB. These guidelines provide recommendations on three priority areas for EPTB: (i) use of Xpert MTB/RIF in diagnosis, (ii) use of adjunct corticosteroids in treatment, and (iii) duration of treatment. The guidelines were developed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) criteria, which were evidence based, and due consideration was given to various healthcare settings across India. Further, for those forms of EPTB in which evidence regarding best practice was lacking, clinical practice points were developed by consensus on accumulated knowledge and experience of specialists who participated in the working groups. This would also reflect the needs of healthcare providers and develop a platform for future research. PMID:28862176

  9. Index-TB guidelines: Guidelines on extrapulmonary tuberculosis for India

    Directory of Open Access Journals (Sweden)

    Surendra K Sharma

    2017-01-01

    Full Text Available Extrapulmonary tuberculosis (EPTB is frequently a diagnostic and therapeutic challenge. It is a common opportunistic infection in people living with HIV/AIDS and other immunocompromised states such as diabetes mellitus and malnutrition. There is a paucity of data from clinical trials in EPTB and most of the information regarding diagnosis and management is extrapolated from pulmonary TB. Further, there are no formal national or international guidelines on EPTB. To address these concerns, Indian EPTB guidelines were developed under the auspices of Central TB Division and Directorate of Health Services, Ministry of Health and Family Welfare, Government of India. The objective was to provide guidance on uniform, evidence-informed practices for suspecting, diagnosing and managing EPTB at all levels of healthcare delivery. The guidelines describe agreed principles relevant to 10 key areas of EPTB which are complementary to the existing country standards of TB care and technical operational guidelines for pulmonary TB. These guidelines provide recommendations on three priority areas for EPTB: (i use of Xpert MTB/RIF in diagnosis, (ii use of adjunct corticosteroids in treatment, and (iii duration of treatment. The guidelines were developed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE criteria, which were evidence based, and due consideration was given to various healthcare settings across India. Further, for those forms of EPTB in which evidence regarding best practice was lacking, clinical practice points were developed by consensus on accumulated knowledge and experience of specialists who participated in the working groups. This would also reflect the needs of healthcare providers and develop a platform for future research.

  10. Use of anti-retroviral therapy in tuberculosis patients on second-line anti-TB regimens: a systematic review.

    Directory of Open Access Journals (Sweden)

    Matthew Arentz

    Full Text Available Use of antiretroviral therapy (ART during treatment of drug susceptible tuberculosis (TB improves survival. However, data from HIV infected individuals with drug resistant TB are lacking. Second line TB drugs when combined with ART may increase drug interactions and lead to higher rates of toxicity and greater noncompliance. This systematic review sought to determine the benefit of ART in the setting of second line drug therapy for drug resistant TB.We included individual patient data from studies that evaluated treatment of drug-resistant tuberculosis in HIV-1 infected individuals published between January 1980 and December of 2009. We evaluated the effect of ART on treatment outcomes, time to smear and culture conversion, and adverse events.Ten observational studies, including data from 217 subjects, were analyzed. Patients using ART during TB treatment had increased likelihood of cure (hazard ratio (HR 3.4, 95% CI 1.6-7.4 and decreased likelihood of death (HR 0.4, 95% CI 0.3-0.6 during treatment for drug resistant TB. These associations remained significant in patients with a CD4 less than 200 cells/mm(3 and less than 50 cells/mm(3, and when correcting for drug resistance pattern.We identified only observational studies from which individual patient data could be drawn. Limitations in study design, and heterogeneity in a number of the outcomes of interest had the potential to introduce bias.While there are insufficient data to determine if ART use increases adverse drug interactions when used with second line TB drugs, ART use during treatment of drug resistant TB appears to improve cure rates and decrease risk of death. All individuals with HIV appear to benefit from ART use during treatment for TB.

  11. Drug resistance pattern of M. tuberculosis in category II treatment failure pulmonary tuberculosis patients

    Directory of Open Access Journals (Sweden)

    Fahmida Rahman

    2013-01-01

    Full Text Available This study was designed to determine the extent of drug resistance of M. tuberculosis (MTB isolated from category II treatment failure pulmonary tuberculosis (PTB patients. A total of 100 Ziehl-Neelsen (Z-N smear positive category II failure PTB patients were included in this study. Sputum culture was done in Lowenstein-Jensen (L-J media. Conventional proportion method on Lowenstein-Jensen (L-J media was used to determine the drug susceptibility of M. tuberculosis to isoniazid (INH, rifampicin (RMP, ofloxacin (OFX and kanamycin (KA. Out of 100 sputum samples, a total of 87 samples were positive by culture. Drug susceptibility test (DST revealed that 82 (94.25% isolates were resistant to one or more anti -TB drugs. Resistance to isoniazide (INH, rifampicin (RMP, ofloxacin (OFX and kanamycin (KA was 94.25%, 82.75%, 29.90% and 3.45% respectively. Among these isolates, 79.31% and 3.45% isolates were multi-drug resistant (MDR and extended drug resistant (XDR M. tuberculosis respectively. High rate of anti-tubercular drug resistance was observed among the category II treatment failure TB patients. Ibrahim Med. Coll. J. 2013; 7(1: 9-11

  12. Magnetic properties of ball-milled TbFe2 and TbFe2B

    Indian Academy of Sciences (India)

    Unknown

    1. Introduction. The RFe2 (R = rare earth) Laves phase compounds are known to possess large cubic anisotropy (Clark et al 1972) and highest Curie temperature (TC) of all RT2 compounds. (T = transition metal). RFe2 ... TbFe2 and TbFe2B were prepared by arc melting the high pure elements (Tb and B, 99⋅9% purity; Fe, ...

  13. Host markers in Quantiferon supernatants differentiate active TB from latent TB infection: preliminary report

    Directory of Open Access Journals (Sweden)

    Walzl Gerhard

    2009-05-01

    Full Text Available Abstract Background Interferon gamma release assays, including the QuantiFERON® TB Gold In Tube (QFT have been shown to be accurate in diagnosing Mycobacterium tuberculosis infection. These assays however, do not discriminate between latent TB infection (LTBI and active TB disease. Methods We recruited twenty-three pulmonary TB patients and 34 household contacts from Cape Town, South Africa and performed the QFT test. To investigate the ability of new host markers to differentiate between LTBI and active TB, levels of 29 biomarkers in QFT supernatants were evaluated using a Luminex multiplex cytokine assay. Results Eight out of 29 biomarkers distinguished active TB from LTBI in a pilot study. Baseline levels of epidermal growth factor (EGF soluble CD40 ligand (sCD40L, antigen stimulated levels of EGF, and the background corrected antigen stimulated levels of EGF and macrophage inflammatory protein (MIP-1β were the most informative single markers for differentiation between TB disease and LTBI, with AUCs of 0.88, 0.84, 0.87, 0.90 and 0.79 respectively. The combination of EGF and MIP-1β predicted 96% of active TB cases and 92% of LTBIs. Combinations between EGF, sCD40L, VEGF, TGF-α and IL-1α also showed potential to differentiate between TB infection states. EGF, VEGF, TGF-α and sCD40L levels were higher in TB patients. Conclusion These preliminary data suggest that active TB may be accurately differentiated from LTBI utilizing adaptations of the commercial QFT test that includes measurement of EGF, sCD40L, MIP-1β, VEGF, TGF-α or IL-1α in supernatants from QFT assays. This approach holds promise for development as a rapid diagnostic test for active TB.

  14. The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections.

    Science.gov (United States)

    Busani, Stefano; Roat, Erika; Serafini, Giulia; Mantovani, Elena; Biagioni, Emanuela; Girardis, Massimo

    2017-01-01

    Patients with septic shock by multidrug resistant microorganisms (MDR) are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

  15. The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections

    Directory of Open Access Journals (Sweden)

    Stefano Busani

    2017-01-01

    Full Text Available Patients with septic shock by multidrug resistant microorganisms (MDR are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

  16. 1 Tuberculosis in India: A need of Public Awareness & Education

    African Journals Online (AJOL)

    2015-05-07

    May 7, 2015 ... MDR-TB(Multi-drug resistant tuberculosis) in absolute numbers during 2008 ... treatment units, One TB Hospital, 501 DOT centres, 38 NGOs and 2829 private .... presence of the family member or accompanying person.

  17. HIV-Associated TB: Facts 2013

    Science.gov (United States)

    ... 2012 . Around 75% of these people live in sub-Saharan Africa.  TB is the leading cause of death among ... adopted by policy makers and implemented by all health facilities offering HIV care services.  The number of ...

  18. Thermally stimulated properties in ZnSe:Tb and ZnSe:(Mn, Tb) phosphors

    Science.gov (United States)

    Mishra, A. K.; Mishra, S. K.; Pandey, S. P.; Lakshmi Mishra, Kshama

    2018-02-01

    Thermoluminescence studies were performed of ZnSe:Tb and ZnSe:(Mn, Tb) phosphors. A method of preparation for ZnSe phosphors doped with Tb and (Mn, Tb) has been discussed. The thermoluminescence (TL) properties of these phosphors have been studied from 100 to 370 K temperature after exciting by UV radiation (365 nm) at three uniform heating rates 0.4, 0.6 and 0.9 K/s. The trapping parameters like trap depth, lifetime of electrons and capture cross-section have also been determined using various methods.

  19. Glucose-induced MDR pump resynthesis in respiring yeast cells depends on nutrient level

    Czech Academy of Sciences Publication Activity Database

    Maláč, J.; Sigler, Karel; Gášková, D.

    -, č. 337 (2005), s. 138-141 ISSN 0006-291X R&D Projects: GA ČR GD204/03/H066; GA ČR GP202/04/P110 Grant - others:GA FRVŠ FRVS 555/2005/G3 Institutional research plan: CEZ:AV0Z50200510 Keywords : MDR pumps * yeast * fluorimetric assay Subject RIV: EE - Microbiology, Virology Impact factor: 3.000, year: 2005

  20. Provider perspectives on drug-resistant tuberculosis and human immunodeficiency virus care in South Africa: a qualitative case study.

    Science.gov (United States)

    Daftary, A; Padayatchi, N

    2016-11-01

    To examine influences on health care workers' (HCWs') capacity to deliver health care for multi- and/or extensively drug-resistant tuberculosis (MDR/XDR-TB) and human immunodeficiency virus (HIV) infection in South Africa. Qualitative data were collected via group and individual interviews with a purposive sample of 17 HCWs at a centralised, tertiary TB facility and analysed using grounded theory. Four themes were identified: 1) personal infection control practices among HCWs may be weakened by a workplace culture comprising low motivation, disparate risk perceptions and practices across workforce hierarchies, physical discomfort, and problems managing patients with treatment-induced hearing loss. 2) Patient-provider interactions are likely stronger among nurses, and in HIV vs. MDR/XDR-TB service delivery, due to greater attention to patient empowerment and support. Stigma associated with MDR/XDR-TB, considered worse than HIV, may be perpetuated within non-specialised facilities less familiar with MDR/XDR-TB. 3) HCWs who struggle with the daily tedium of MDR/XDR-TB treatment supervision are becoming increasingly supportive of treatment literacy and self-administration. 4) Effective integration of HIV and MDR/XDR-TB services may be impeded by administrative restrictions, workplace norms and provider mindsets. Comprehensive, decentralised management of MDR/XDR-TB and HIV coinfection requires the creation of patient-provider trust and treatment literacy in MDR/XDR-TB programmes, and defying workplace norms that could provoke nosocomial TB exposure and fragmented service provision.

  1. Role of Risk Factors in the Incidence of Multidrug-Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Alya Putri Khairani

    2017-09-01

    Full Text Available Objective: To determine the risk factors that played roles in the incidence of multidrug-resistant tuberculosis (MDR-TB in such patients. Multidrug-Resistant Tuberculosis is a form of tuberculosis caused by Mycobacterium tuberculosis that is resistant to at least isoniazid and rifampicin. Methods: This was a case control study to compare MDR-TB to non-MDR-TB pulmonary tuberculosis outpatients in Dr. Hasan Sadikin General Hospital, Bandung on August–September 2014. Fifty MDR-TB outpatients were included as the cases and 50 non-MDR-TB outpatients as controls. Data was collected by questionnaires and patient’s registration forms. Bivariate and multivariate analyses were performed using chi-square test and multiple logistic regression test, with p<0.05 considered significant. Results: From bivariate analysis, number of previous tuberculosis treatments, regularity of previous treatment, and burden of cost were significant risk factors for developing MDR-TB (p<0.05; while from multivariate analysis, number of previous TB treatments was the only risk factor that played a significant role in the incidence of MDR-TB (OR 24.128 95% CI 6.771-85,976. Conclusions: Patients and medication factors are risk factors that play roles in the incidence of MDR-TB. The significant risk factor is the number of previous TB treatment.

  2. Immunomodulation by vitamin D: implications for TB

    OpenAIRE

    Chun, Rene F; Adams, John S; Hewison, Martin

    2011-01-01

    TB remains a major cause of mortality throughout the world. Low vitamin D status has been linked to increased risk of TB and other immune disorders. These observations suggest a role for vitamin D as a modulator of normal human immune function. This article will detail the cellular and molecular mechanisms by which vitamin D regulates the immune system and how vitamin D insufficiency may lead to immune dysregulation. The importance of vitamin D bioavailability as a mechanism for defining the ...

  3. Multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP and lung resistance protein (LRP gene expression in childhood acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Elvis Terci Valera

    Full Text Available CONTEXT: Despite the advances in the cure rate for acute lymphoblastic leukemia, approximately 25% of affected children suffer relapses. Expression of genes for the multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP, and lung resistance protein (LRP may confer the phenotype of resistance to the treatment of neoplasias. OBJECTIVE: To analyze the expression of the MDR-1, MRP and LRP genes in children with a diagnosis of acute lymphoblastic leukemia via the semiquantitative reverse transcription polymerase chain reaction (RT-PCR, and to determine the correlation between expression and event-free survival and clinical and laboratory variables. DESIGN: A retrospective clinical study. SETTING: Laboratory of Pediatric Oncology, Department of Pediatrics, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazil. METHODS: Bone marrow aspirates from 30 children with a diagnosis of acute lymphoblastic leukemia were assessed for the expression of messenger RNA for the MDR-1, MRP and LRP genes by semi-quantitative RT-PCR. RESULTS: In the three groups studied, only the increased expression of LRP was related to worsened event-free survival (p = 0.005. The presence of the common acute lymphoblastic leukemia antigen (CALLA was correlated with increased LRP expression (p = 0.009 and increased risk of relapse or death (p = 0.05. The relative risk of relapse or death was six times higher among children with high LRP expression upon diagnosis (p = 0.05, as confirmed by multivariate analysis of the three genes studied (p = 0.035. DISCUSSION: Cell resistance to drugs is a determinant of the response to chemotherapy and its detection via RT-PCR may be of clinical importance. CONCLUSIONS: Evaluation of the expression of genes for resistance to antineoplastic drugs in childhood acute lymphoblastic leukemia upon diagnosis, and particularly the expression of the LRP gene, may be of clinical relevance, and should be the

  4. Screening of Antibacterial MDR derived from Sponge Associated Fungus of Riung Water, Nusa Tenggara Timur

    Directory of Open Access Journals (Sweden)

    Khoeruddin Wittriansyah

    2016-12-01

    Full Text Available Marine sponge-associated fungi are the sources of bioactive compounds with various pharmacologicals potency. This study aimed to isolate the sponge-associated fungi as the producer of the MDR anti-bacterial compounds.  The associated fungi were isolated from the sponges collected from Riung water, Nusa Tenggara Timur. Five of the best isolates were cultured on MEA to obtain the methanolic extract for further studies.  The antagonistic test was conducted using overlay method towards the MDR Staphylococcus aureus and Escherichia coli. A total of 33 fungi were isolated from 19 sponge specimens. The antagonistic test showed that 19 isolates were active against both S. aureus and E. coli, and 13 of them were merely active against one of the bacteria. However, only five isolates have strong activity against one or both of the bacteria.  The KN-15-3 had the strongest activity against S. aureus (18.75±0.777mm and E. coli (15.10±0.141mm at the concentration of 400 μg.disc-1 so it can be developed further as a source of drug candicate.   Keywords: Fungi symbiont, Sponges, MDR Antibacterial, Staphylococcus aureus,  Escherichia coli.

  5. Analogues of the Frog-skin Antimicrobial Peptide Temporin 1Tb Exhibit a Wider Spectrum of Activity and a Stronger Antibiofilm Potential as Compared to the Parental Peptide

    Science.gov (United States)

    Grassi, Lucia; Maisetta, Giuseppantonio; Maccari, Giuseppe; Esin, Semih; Batoni, Giovanna

    2017-04-01

    The frog skin-derived peptide Temporin 1Tb (TB) has gained increasing attention as novel antimicrobial agent for the treatment of antibiotic-resistant and/or biofilm-mediated infections. Nevertheless, such a peptide possesses a preferential spectrum of action against Gram-positive bacteria. In order to improve the therapeutic potential of TB, the present study evaluated the antibacterial and antibiofilm activities of two TB analogues against medically relevant bacterial species. Of the two analogues, TB_KKG6A has been previously described in the literature, while TB_L1FK is a new analogue designed by us through statistical-based computational strategies. Both TB analogues displayed a faster and stronger bactericidal activity than the parental peptide, especially against Gram-negative bacteria in planktonic form. Differently from the parental peptide, TB_KKG6A and TB_L1FK were able to inhibit the formation of Staphylococcus aureus biofilms by more than 50% at 12 μM, while only TB_KKG6A prevented the formation of Pseudomonas aeruginosa biofilms at 24 μM. A marked antibiofilm activity against preformed biofilms of both bacterial species was observed for the two TB analogues when used in combination with EDTA. Analysis of synergism at the cellular level suggested that the antibiofilm activity exerted by the peptide-EDTA combinations against mature biofilms might be due mainly to a disaggregating effect on the extracellular matrix in the case of S. aureus, and to a direct activity on biofilm-embedded cells in the case of P. aeruginosa. Both analogues displayed a low hemolytic effect at the active concentrations and, overall, TB_L1FK resulted less cytotoxic towards mammalian cells. Collectively, the results obtained demonstrated that subtle changes in the primary sequence of TB may provide TB analogues that, used alone or in combination with adjuvant molecules such as EDTA, exhibit promising features against both planktonic and biofilm cells of medically relevant

  6. The Relationship Between Education, Job, and Family Income with TB Medication Dropouts in Timor-Leste

    Directory of Open Access Journals (Sweden)

    Valente Da Silva

    2016-06-01

    Full Text Available Background:  TB treatment dropout is one causes of treatment failure, which could increase drug resistant cases. Drug resistant cases of TB were reported by the Ministry of Health of East Timor in 2008 (3 cases, 2009 (3 cases, and in 2010 (6 cases. With drug resistant emerging, TB will require longer treatment time. According to the WHO report (2013 the results of pulmonary tuberculosis BTA (+ treatment were reported: Year 2010 the number of failure of treatment was (0.53%; Died of TB (3.53%; Drop out of treatment (4.05%; Outmigration (3.98%; In 2011 cases of treatment failure (0.50% Died of TB (3.36%; Drop out of treatment (3.36%; Outmigration (1.92%; In 2012 cases of treatment failure (1.03%; Died of TB (3.49% Drop out of treatment (4.59% and migration, (2.26%. According to the National Statistics Directorate (NSD in 2011, that the East Timorese people still live mostly 70.4% in the rural areas. While access to health services remains a challenge, since the people of Timor Leste proclaimed the restoration of its independence. Objective: This study aimed to determine whether there is a relationship between the variables of education, family income, and job with cases of TB medication discontinuation. Methods: This study was conducted using descriptive correlation method. The sample was determined by Ridwan & Akdon (2010 formula. The total of samples was 100 people who met the inclusion and exclusion criteria, and selected randomly. This research was conducted in District Manatuto and Liquica Timor-Leste on March 28, 2015. Results: The correlation test showed a strong positive relationship level if r = 0.51 until +1. Analysis of significance value of r xy = 0.671 and p = 0.000 indicates that there is a significant relationship between the variables of education, job and income with variable discontinuation of treatment. Conclusion: Based on the results of research and data analysis, it can be concluded that the results of this study are as

  7. HIV-associated TB syndemic: A growing clinical challenge worldwide

    Directory of Open Access Journals (Sweden)

    Maria Theresa Montales

    2015-12-01

    Full Text Available The association of tuberculosis (TB with human immunodeficiency virus (HIV infection and acquired immune deficiency syndrome (AIDS over the past several years has become an emerging syndemic. Approximately 10% of people living with HIV (PLHIV with latent TB infection will develop active TB disease each year. In this review, we highlight that this phenomenon is not limited to high endemic regions like Afro-Asian nations, but globalization/migration is causing increased case detection even in developed nations such as the United States (US. Active screening should be performed for tuberculosis in PLHIV. A high degree of clinical suspicion for tuberculosis is warranted in PLHIV presenting with fever, cough and unintentional weight loss. HIV-Mycobacterium tuberculosis (MTB coinfection is often paucibacillary, precluding diagnosis by conventional diagnostics and/or smear-microscopy/culture. Improved detection of pulmonary and extrapulmonary tuberculosis is now possible by incorporation of the GeneXPERT MTB/RIF assay (Cepheid Inc, Sunnyvale, USA. The World Health Organization (WHO recommends instituting immediate therapy for Mycobacterium tuberculosis, in conjunction with ongoing or newly introduced antiretroviral therapy (ART. Vigilance is required to detect drug-induced organ injuries, and early-treatment induced immune reconstitution inflammatory syndrome (IRIS. Collaborating MTB and HIV activities in concentrated HIV epidemic settings should become a high public health priority.

  8. The Ontario Universal Typing of Tuberculosis (OUT-TB Surveillance Program – What It Means to You

    Directory of Open Access Journals (Sweden)

    Shelly Bolotin

    2010-01-01

    Full Text Available BACKGROUND: Tuberculosis (TB is a serious disease that is transmitted primarily by the airborne route. Effective disease control and outbreak management requires the timely diagnosis, isolation and treatment of infected individuals with active disease; contact tracing to identify secondary cases likely to benefit from treatment of latent infection; and laboratory identification or confirmation of epidemiologically linked cases. TB genotyping enables the comparison of Mycobacterium tuberculosis complex (MTBC strains and the identification of cases that may or may not be linked. The increased availability of molecular methods for genotyping has allowed for greater discrimination of MTBC strains and greatly enhanced understanding of TB transmission patterns.

  9. Subdivision of the MDR superfamily of medium-chain dehydrogenases/reductases through iterative hidden Markov model refinement

    Directory of Open Access Journals (Sweden)

    Persson Bengt

    2010-10-01

    Full Text Available Abstract Background The Medium-chain Dehydrogenases/Reductases (MDR form a protein superfamily whose size and complexity defeats traditional means of subclassification; it currently has over 15000 members in the databases, the pairwise sequence identity is typically around 25%, there are members from all kingdoms of life, the chain-lengths vary as does the oligomericity, and the members are partaking in a multitude of biological processes. There are profile hidden Markov models (HMMs available for detecting MDR superfamily members, but none for determining which MDR family each protein belongs to. The current torrential influx of new sequence data enables elucidation of more and more protein families, and at an increasingly fine granularity. However, gathering good quality training data usually requires manual attention by experts and has therefore been the rate limiting step for expanding the number of available models. Results We have developed an automated algorithm for HMM refinement that produces stable and reliable models for protein families. This algorithm uses relationships found in data to generate confident seed sets. Using this algorithm we have produced HMMs for 86 distinct MDR families and 34 of their subfamilies which can be used in automated annotation of new sequences. We find that MDR forms with 2 Zn2+ ions in general are dehydrogenases, while MDR forms with no Zn2+ in general are reductases. Furthermore, in Bacteria MDRs without Zn2+ are more frequent than those with Zn2+, while the opposite is true for eukaryotic MDRs, indicating that Zn2+ has been recruited into the MDR superfamily after the initial life kingdom separations. We have also developed a web site http://mdr-enzymes.org that provides textual and numeric search against various characterised MDR family properties, as well as sequence scan functions for reliable classification of novel MDR sequences. Conclusions Our method of refinement can be readily applied to

  10. Effect of pO2 on antitumor drug cytotoxicity on MDR and non-MDR variants selected from the LoVo metastatic colon carcinoma cell line.

    Science.gov (United States)

    Lelong-Rebel, Isabelle; Brisson, Christine; Fabre, Michel; Bergerat, Jean-Pierre; Rebel, Gérard

    2008-01-01

    Two chemosensitive cell lines, LoVo-fusoid (LoVo-f) and LoVo-small cells (LoVo-sc) were derived from the original LoVo cell line. These two variants and the multidrug-resistant (MDR) cell line LoVo-Dox were screened for various properties. In non-permeabilized cells, only LoVo-sc showed mucin-2 staining whereas labelling was positive in all permeabilized cell lines. As shown by electron microscopy screening and by relative resistance to trypsin detachment, only LoVo-sc cells showed strong mucus secretion. All three cell lines displayed strong staining for P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP) and lung-resistance-related protein (LRP) in different locations according to the drug resistance state. The three cell lines showed intracellular labelling of LRP and MRP. The sensitive cells showed P-gp in a large perinuclear ring and in the cytoplasm, but little (LoVo-sc cells) or no staining (LoVo-f cells) was shown at the plasma membrane level. For the Lovo-Dox cells, P-gp was located in the plasma membrane, in cellular anchorages and in the cytoplasm as well. Cell resistance against antineoplastic agents often results from mobilization of various factors, the modulation of which is linked to the culture conditions. As most of the protocols utilize cells growing in (air + 5-10% CO2) atmosphere e.g. 20% O2, balance of the respective participants in the MDR multi-modal mechanism may not be representative of the in vivo situation and may lead to erratic pharmacological response. Indeed, cells within solid tumours were exposed to low pO2, most of them being under hypoxic condition (0.1-5% O2). In the absence of anticancer drugs, all LoVo cell lines grew notably faster at 20% O2 than at 5% O2. Moreover, respective sensitivities of both non-MDR variants to doxorubicin were altered according the pO2. Whatever the pO2 was, virtually none of the antioxidants tested affected the cytotoxic activity of doxorubicin for the three cell lines. By contrast

  11. Association between MDR1 gene polymorphisms and the risk of Crohn's disease in a cohort of Algerian pediatric patients.

    Science.gov (United States)

    Bouzidi, Amira; Mesbah-Amroun, Hamida; Boukercha, Aziza; Benhassine, Fadila; Belboueb, Réda; Berkouk, Karima; Messadi, Wassila; Touil-Boukoffa, Chafia

    2016-12-01

    The multi-drug resistance gene (MDR1) has raised increasing interest as a susceptibility gene for Crohn's disease (CD). The role of MDR1 single-nucleotide polymorphisms (SNPs) in the predisposition and behavior of CD in the pediatric population is still elusive. Here, we investigated whether SNPs in MDR1 are associated with CD in Algerian pediatric patients. A case-control study was conducted enrolling 47 pediatric CD patients and 100 controls. All subjects were genotyped for the most common MDR1 SNPs (C3434T, C1236T, and G2677A/T) using PCR-RFLP method. We also explored the association between polymorphisms and clinical sub-phenotypes. We have detected no significant association of C3435T SNP and pediatric CD. However, we observed a significantly higher frequency of the risk alleles, 1236T and 2677T/A among the CD patients compared to controls. Moreover, the risk allele 1236T was associated to a higher risk for resective surgery. Our data suggest that the C1236T and G2677A/T SNPs in the MDR1 gene are associated with CD and the C1236T risk allele with a more severe course of disease in Algerian pediatric patients. Further analysis using larger patients group and functional studies would be interesting to elucidate the role of MDR1 gene in pediatric CD.Pediatric Research (2016); doi:10.1038/pr.2016.163.

  12. [Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

    Science.gov (United States)

    Wielandt, Ana María; Vollrath, Valeska; Chianale, José

    2004-09-01

    There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

  13. Investing to end epidemics: the role of the Global Fund to control TB by 2030.

    Science.gov (United States)

    Kunii, Osamu; Yassin, Mohammed A; Wandwalo, Eliud

    2016-03-01

    The Global Fund to fight AIDS, Tuberculosis and Malaria provides over three-quarters of all international financing towards TB programs with US$4.7 billion disbursed, supporting provision of treatment for 13.2 million patients with smear-positive TB and 210 000 patients with multidrug-resistant TB in over 100 countries since 2002. In 2013, the Global Fund launched a new funding model that, among others, is advancing strategic investments to maximize impact, addressing 'missing' TB cases, enhancing a synergistic response to TB/HIV dual epidemics, and building resilient and sustainable systems for health. A new Global Fund Strategy is under development through consultation with various stakeholders, with which the Global Fund will work to play a more catalytic role and foster innovations to end the TB epidemic. © The Author 2016. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. PROFIL PENDERITA TB PARU KLINIS YANG TIDAK BEROBAT DI PELAYANAN KESEHATAN, DI INDONESIA TAHUN 2010

    Directory of Open Access Journals (Sweden)

    Gurendro Putro

    2013-03-01

    Full Text Available ABSTRACT Background: Further analysis of the results of health research foundation in 2010 in this report on the profile penderira clinical pulmonary TB disease is not treated in the health service. The data analyzed is the result of basic health research in clinical pulmonary TB patients who do not seek treatment in health care. Methods: This analysis is the deepening of research on the basic health questionnaire B18 RKD1 ORT question by finding that respondent characteristics of age, gender, education level and job type, and location of residen ce and social situation eskonomi. It is also seen in disease prevention behavior Pulmonary TB and state family room and bedroom sufferers. Results: Having done the analysis, there are 4966 clinical pulmonary TB patients and who do not seek treatment at health care as many as 2842 patients (57.7%. So th at the data analyzed is as much as 2842 people. From the test results of Chi sqaure analysis variables associated with pulmonary TB prevention behaviors are age (p = 0.001, education level (p = 0.001, occupation (p = 0.001, residence ofrespondents (p = 0.001, socioeconomic (p = 0.001, and housing conditions (p = 0.001. Conclusions: Health workers are health care workers provide counseling on the importance of treatment for patients with pulmonary tuberculosis clinical and laboratory examinations do know the existence of BTA +. Also expected clinical pulmonary TB patients do not spit everywhere. Key words: profile, clinic TB case, don't therapy in health services ABSTRAK Latar Belakang: Analisis lanjut hasil riset kesehatan dasar 201 0 dalam laporan ini tentang profil penderira penyakit TB Paru klinis yang tidak berobat di pelayanan kesehatan. Data yang dianalisis merupakan hasil dari riset kesehatan dasar pada penderita TB Paru klinis yang tidak berobat di pelayanan kesehatan. Metode: Analisis ini merupakan pendalaman dari hasil riset kesehatan dasar pada kuesioner RKD 1 O. RT pertanyaan B 18 dengan

  15. Quality of life of pulmonary TB patients after intensive phase treatmentin the health centers of Medan city, Indonesia

    Science.gov (United States)

    Wahyuni, A. S.; Soeroso, N.; Harahap, J.; Amelia, R.; Alona, I.

    2018-03-01

    Tuberculosis (TB) is one of the chronic diseases that has become a long major health problem in the world, as well as in Indonesia. TB treatment takes a long time (6-9 months) to cover both intensive and advanced phases. TB patients experience significant disruptions in their social life, exposed to stigma and discrimination. The purpose of this study was to determine the quality of life of TB patients after two months of TB intensive treatment phase. We conducted a quantitative study through cross-sectional design. This research recruited 100 TB patients aged > 18 years old and Category I with AFB(+) result. We involved patients from 7 Health Centers in Medan City. We utilised SF 36 instrument to assess the patients quality of lifein the interview. To analyse the collected data, we performed Independent t-analysis. The result of this study was that the quality of life of TB patients who had undergone initial treatment phase wasina low category with a score of 63.9. The two best-measured aspects of quality of life among the eight dimensions assessed in the instrument were pain and physical function.

  16. Non-adherence to anti-TB drugs among TB/HIV co-infected patients ...

    African Journals Online (AJOL)

    Non-adherence to anti-TB drugs among TB/HIV co-infected patients in Mbarara Hospital ... and its associated factors have not been studied in these patients in Uganda. ... Methods: A cross-sectional study with qualitative and quantitative data ...

  17. The establishment of bonds between professional and patient in TB treatment: the performance of primary health care services in a city in the interior of São Paulo.

    Science.gov (United States)

    Ponce, Maria Amélia Zanon; Vendramini, Silvia Helena Figueiredo; dos Santos, Marilene Rocha; Santos, Maria de Lourdes Sperli Geraldes; Scatena, Lúcia Marina; Villa, Tereza Cristina Scatena

    2011-01-01

    This study evaluated the performance of health care services implementing TB control actions in relation to the establishment of bonds between health professionals and patients in São José do Rio Preto, SP, Brazil from the perspective of patients, health professionals, and managers. A total of 108 patients, 37 health professionals and 15 managers were interviewed through a questionnaire containing 10 indicators of bond-establishment based on the instruments of the Primary Care Assessment Tool, adapted to evaluate tuberculosis control in Brazil. The three groups of actors considered the establishment of bonds satisfactory, though opinions of patients and managers differed in almost all indicators. This fact indicates that the view of managers is still predominantly focused on bureaucratic and administrative aspects, which shows the need for managers to integrate more management and care actions.

  18. Association between Multidrug-Resistant Tuberculosis and Risk Factors in China: Applying Partial Least Squares Path Modeling.

    Directory of Open Access Journals (Sweden)

    Yun-Xia Liu

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB resulting from various factors has raised serious public health concerns worldwide. Identifying the ecological risk factors associated with MDR-TB is critical to its prevention and control. This study aimed to explore the association between the development of MDR-TB and the risk factors at the group-level (ecological risk factors in China.Data on MDR-TB in 120 counties were obtained from the National Tuberculosis Information Management System, and data on risk-factor variables were extracted from the Health Statistical Yearbook, provincial databases, and the meteorological bureau of each province (municipality. Partial Least Square Path Modeling was used to detect the associations.The median proportion of MDR-TB in new TB cases was 3.96% (range, 0-39.39%. Six latent factors were extracted from the ecological risk factors, which explained 27.60% of the total variance overall in the prevalence of MDR-TB. Based on the results of PLS-PM, TB prevention, health resources, health services, TB treatment, TB detection, geography and climate factors were all associated with the risk of MDR-TB, but socioeconomic factors were not significant.The development of MDR-TB was influenced by TB prevention, health resources, health services, TB treatment, TB detection, geography and climate factors. Such information may help us to establish appropriate public health intervention strategies to prevent and control MDR-TB and yield benefits to the entire public health system in China.

  19. Factors Associated with Treatment Success among Pulmonary ...

    African Journals Online (AJOL)

    TNHJOURNALPH

    Treatment Success Determinants in PTB and HIV Co-infection- Oladimeji 0, et al. INTRODUCTION. Tuberculosis (TB) is a chronic infectious disease caused by the bacillus, Mycobacterium ..... account for 23% of total notified-TB cases in.

  20. TB-HIV co-infection among pregnant women in Karnataka, South India: A case series.

    Science.gov (United States)

    Suresh, Shastri; Sharath, Burugina N; Anita, Shet; Lalitha, Ravindra; Prasad, Tripathy J; Rewari, Bharat B

    2016-01-01

    Tuberculosis (TB) is a significant contributor to mortality in HIV-infected patients. Concurrent TB infection is also a significant contributing factor to maternal mortality in human immunodeficiency virus (HIV)-infected pregnant women. Studies addressing the outcomes of TB and HIV co-infection among pregnant women are generally infrequent. Although limited, the records maintained by the Revised National Tuberculosis Control Programme (RNTCP) and the National AIDS Control Programme (NACP) in Karnataka State, Southern India provide information about the numbers of pregnant women who are co-infected with TB and HIV and their pregnancy outcomes. We reviewed the data and conducted this study to understand how TB-HIV co-infection influences the outcomes of pregnancy in this setting. We sought to determine the incidence and treatment and delivery outcomes of TB-HIV co-infected pregnant women in programmatic settings in Karnataka State in southern India. The study participants were all the HIV-infected pregnant women who were screened for tuberculosis under the NACP from 2008 to 2012. For the purposes of this study, the program staff in the field gathered the data regarding on treatment and delivery outcomes of pregnant women. A total of seventeen pregnant women with TB-HIV co-infection were identified among 3,165,729 pregnant women (for an incidence of 5.4 per million pregnancies). The median age of these pregnant women was 24 years, and majority were primiparous women with WHO HIV stage III disease and were on a stavudine-based ART regimen. The maternal mortality rates were 18% before delivery and 24% after delivery. The abortion rate was 24%, and the neonatal mortality rate was 10%. The anti-tuberculosis treatment and anti-retroviral treatment outcome mortality rates were 30% and 53%, respectively. Although the incidence of TB among the HIV-infected pregnant women was marginally less than that among the non-HIV-infected women, the delivery outcomes were relatively

  1. Diallylthiosulfinate (Allicin), a Volatile Antimicrobial from Garlic (Allium sativum), Kills Human Lung Pathogenic Bacteria, Including MDR Strains, as a Vapor.

    Science.gov (United States)

    Reiter, Jana; Levina, Natalja; van der Linden, Mark; Gruhlke, Martin; Martin, Christian; Slusarenko, Alan J

    2017-10-12

    Garlic ( Allium sativum ) has potent antimicrobial activity due to allicin (diallylthiosulfinate) synthesized by enzyme catalysis in damaged garlic tissues. Allicin gives crushed garlic its characteristic odor and its volatility makes it potentially useful for combating lung infections. Allicin was synthesized (>98% pure) by oxidation of diallyl disulfide by H₂O₂ using formic acid as a catalyst and the growth inhibitory effect of allicin vapor and allicin in solution to clinical isolates of lung pathogenic bacteria from the genera Pseudomonas , Streptococcus , and Staphylococcus , including multi-drug resistant (MDR) strains, was demonstrated. Minimal inhibitory (MIC) and minimal bactericidal concentrations (MBC) were determined and compared to clinical antibiotics using standard European Committee on Antimicrobial Susceptibility Testing (EUCAST) procedures. The cytotoxicity of allicin to human lung and colon epithelial and murine fibroblast cells was tested in vitro and shown to be ameliorated by glutathione (GSH). Similarly, the sensitivity of rat precision-cut lung slices (PCLS) to allicin was decreased by raising the [GSH] to the approximate blood plasma level of 1 mM. Because allicin inhibited bacterial growth as a vapor, it could be used to combat bacterial lung infections via direct inhalation. Since there are no volatile antibiotics available to treat pulmonary infections, allicin, particularly at sublethal doses in combination with oral antibiotics, could make a valuable addition to currently available treatments.

  2. Diallylthiosulfinate (Allicin, a Volatile Antimicrobial from Garlic (Allium sativum, Kills Human Lung Pathogenic Bacteria, Including MDR Strains, as a Vapor

    Directory of Open Access Journals (Sweden)

    Jana Reiter

    2017-10-01

    Full Text Available Garlic (Allium sativum has potent antimicrobial activity due to allicin (diallylthiosulfinate synthesized by enzyme catalysis in damaged garlic tissues. Allicin gives crushed garlic its characteristic odor and its volatility makes it potentially useful for combating lung infections. Allicin was synthesized (>98% pure by oxidation of diallyl disulfide by H2O2 using formic acid as a catalyst and the growth inhibitory effect of allicin vapor and allicin in solution to clinical isolates of lung pathogenic bacteria from the genera Pseudomonas, Streptococcus, and Staphylococcus, including multi-drug resistant (MDR strains, was demonstrated. Minimal inhibitory (MIC and minimal bactericidal concentrations (MBC were determined and compared to clinical antibiotics using standard European Committee on Antimicrobial Susceptibility Testing (EUCAST procedures. The cytotoxicity of allicin to human lung and colon epithelial and murine fibroblast cells was tested in vitro and shown to be ameliorated by glutathione (GSH. Similarly, the sensitivity of rat precision-cut lung slices (PCLS to allicin was decreased by raising the [GSH] to the approximate blood plasma level of 1 mM. Because allicin inhibited bacterial growth as a vapor, it could be used to combat bacterial lung infections via direct inhalation. Since there are no volatile antibiotics available to treat pulmonary infections, allicin, particularly at sublethal doses in combination with oral antibiotics, could make a valuable addition to currently available treatments.

  3. Magnetic properties of TbTiGe

    International Nuclear Information System (INIS)

    Prokes, K.; Tegus, O.; Brueck, E.; Gortenmulder, T.J.; Boer, F.R. de; Buschow, K.H.J.

    2001-01-01

    We have studied the magnetic properties of the compound TbTiGe by means of neutron diffraction in the temperature range 1.7-310 K. We also report on magnetization measurements made at different temperatures and fields. The compound TbTiGe adopts the tetragonal CeFeSi-structure type and orders antiferromagnetically at T N =286 K. The structure is collinear antiferromagnetic in the whole temperature range below T N , with the magnetic moments aligned along the tetragonal c-axis. The uncommon shape of the temperature dependence of the magnetization observed in our sample is attributed to small amounts of the ferromagnetic low-temperature modification of TbTiGe

  4. Multi-quasiparticle excitations in 145Tb

    International Nuclear Information System (INIS)

    Zheng Yong; Zhou Xiaohong; Zhang Yuhu; Liu Minliang; Guo Yingxiang; Lei Xiangguo; Kusakari, H.; Sugawara, M.

    2004-01-01

    High-spin states in 145 Tb have been populated using the 118 Sn( 32 S, 1p4n) reaction at a beam energy of 165 MeV. The level scheme of 145 Tb has been established for the first time. The level scheme shows characteristics of spherical or slightly oblate nucleus. Based on the systematic trends of the level structure in the neighboring N=80 isotones, the level structure in 145 Tb below 2 MeV excitation is well explained by coupling an h 11/2 valence proton to the even-even 144 Gd core. Above 2 MeV excitation, most of the yrast levels are interpreted with multi-quasiparticle shell-model configurations. (authors)

  5. Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.

    Directory of Open Access Journals (Sweden)

    Adrien Molinas

    Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation

  6. Socio-demographic and AIDS-related factors associated with tuberculosis stigma in southern Thailand: a quantitative, cross-sectional study of stigma among patients with TB and healthy community members

    Directory of Open Access Journals (Sweden)

    Strauss Ronald P

    2011-08-01

    Full Text Available Abstract Background Tuberculosis (TB remains one of the most important infectious diseases worldwide. A comprehensive approach towards disease control that addresses social factors including stigma is now advocated. Patients with TB report fears of isolation and rejection that may lead to delays in seeking care and could affect treatment adherence. Qualitative studies have identified socio-demographic, TB knowledge, and clinical determinants of TB stigma, but only one prior study has quantified these associations using formally developed and validated stigma scales. The purpose of this study was to measure TB stigma and identify factors associated with TB stigma among patients and healthy community members. Methods A cross-sectional study was performed in southern Thailand among two different groups of participants: 480 patients with TB and 300 healthy community members. Data were collected on socio-demographic characteristics, TB knowledge, and clinical factors. Scales measuring perceived TB stigma, experienced/felt TB stigma, and perceived AIDS stigma were administered to patients with TB. Community members responded to a community TB stigma and community AIDS stigma scale, which contained the same items as the perceived stigma scales given to patients. Stigma scores could range from zero to 30, 33, or 36 depending on the scale. Three separate multivariable linear regressions were performed among patients with TB (perceived and experience/felt stigma and community members (community stigma to determine which factors were associated with higher mean TB stigma scores. Results Only low level of education, belief that TB increases the chance of getting AIDS, and AIDS stigma were associated with higher TB stigma scores in all three analyses. Co-infection with HIV was associated with higher TB stigma among patients. All differences in mean stigma scores between index and referent levels of each factor were less than two points, except for

  7. Anti-Inflammatory and Antimicrobial Actions of Vitamin D in Combating TB/HIV

    Directory of Open Access Journals (Sweden)

    Anna K. Coussens

    2014-01-01

    Full Text Available Tuberculosis (TB disease activation is now believed to arise due to a lack of inflammatory homeostatic control at either end of the spectrum of inflammation: either due to immunosuppression (decreased antimicrobial activity or due to immune activation (excess/aberrant inflammation. Vitamin D metabolites can increase antimicrobial activity in innate immune cells, which, in the context of HIV-1 coinfection, have insufficient T cell-mediated help to combat Mycobacterium tuberculosis (MTB infection. Moreover, maintaining vitamin D sufficiency prior to MTB infection enhances the innate antimicrobial response to T cell-mediated interferon-γ. Conversely, vitamin D can act to inhibit expression and secretion of a broad range of inflammatory mediators and matrix degrading enzymes driving immunopathology during active TB and antiretroviral- (ARV- mediated immune reconstitution inflammatory syndrome (IRIS. Adjunct vitamin D therapy during treatment of active TB may therefore reduce lung pathology and TB morbidity, accelerate resolution of cavitation and thereby decrease the chance of transmission, improve lung function following therapy, prevent relapse, and prevent IRIS in those initiating ARVs. Future clinical trials of vitamin D for TB prevention and treatment must be designed to detect the most appropriate primary endpoint, which in some cases should be anti-inflammatory and not antimicrobial.

  8. Trèlat's beads as oral manifestations in patients with HIV/TB

    Directory of Open Access Journals (Sweden)

    Elcio Magdalena Giovani

    2016-07-01

    Full Text Available Tuberculosis (TB is a contagious infectious disease caused by Mycobacterium tuberculosis (Koch's bacillus. Co-infection with human immunodeficiency virus (HIV and TB has reached a significant importance as a public health problem and this association has been recognized as the most significant event that changed “the balance between man and Koch's bacillus” in the last century, and has a large contribution to the risk for disease spreading. Tuberculosis has two main standard categories of clinical manifestations: primary and secondary. Primary TB is responsible for the initial infection with lungs being the involved organ. Oral lesions are observed as a secondary TB clinical manifestation with most frequent sites being hard and soft palate, tongue, lips, gums, tonsils, and salivary glands. A case of classical TB lesions in the oral cavity is reported, and the importance of a correct diagnosis through careful history taking is emphasized. Treatment selection needs to be done assertively, with great determination and building a link between patient and treatment protocol, in order to promote patient's adherence.

  9. TB case detection in Tajikistan – analysis of existing obstacles

    Directory of Open Access Journals (Sweden)

    Alexei Korobitsyn

    2013-10-01

    Full Text Available Background: Tajikistan National TB Control ProgramObjective: (1 To identify the main obstacles to increasing TB Detection in Tajikistan. (2 To identify interventions that improve TB detection.Methods: Review of the available original research data, health normative base, health systems performance and national economic data, following WHO framework for detection of TB cases, which is based on three scenarios of why incident cases of TB may not be notified.Results: Data analysis revealed that some aspects of TB case detection are more problematic than others and that there are gaps in the knowledge of specific obstacles to TB case detection. The phenomenon of “initial default” in Tajikistan has been documented; however, it needs to be studied further. The laboratory services detect infectious TB cases effectively; however, referrals of appropriate suspects for TB diagnosis may lag behind. The knowledge about TB in the general population has improved. Yet, the problem of TB related stigma persists, thus being an obstacle for effective TB detection. High economic cost of health services driven by under-the-table payments was identified as another barrier for access to health services.Conclusion: Health system strengthening should become a primary intervention to improve case detection in Tajikistan. More research on reasons contributing to the failure to register TB cases, as well as factors underlying stigma is needed.

  10. Yield of facility-based verbal screening amongst household contacts of patients with multi-drug resistant tuberculosis in Pakistan

    Directory of Open Access Journals (Sweden)

    Ejaz Qadeer

    2017-05-01

    Full Text Available Background: Household contacts of multidrug-resistant tuberculosis (MDR-TB patients are at a high risk of getting infected with TB/MDR-TB, therefore symptomatic or vulnerable individuals should be screened and treated early. Methods: A cross-sectional study was conducted among household contacts of MDR-TB patients in three high-burden TB sites in Pakistan from July 2013 to June 2014. MDR-TB index patients were asked to provide a list of all members of their household and were asked whether any of them had TB symptoms such as productive cough, fever, weight loss and night sweat (“facility-based verbal screening”. Symptomatic contacts were defined as presumptive TB cases and were invited for investigations at the facility. Those who did not come were paid a home-visit. Confirmed TB/MDR-TB patients were registered in the nearest treatment facility. Results: Of 209 MDR-TB index patients, 1467 household contacts were identified and screened, 95 of them children < 5 years. Of these 172 (12% were symptomatic. Most common symptoms were cough 157 (91% and fever 107 (62%. 58 (34% presumptive TB contacts were not investigated. Of total contacts, 56 (3.8% were diagnosed with TB, among them 54(96% with MDR-TB and 2(4% with drug-susceptible-TB. The number needed to screen (NNS to identify a new MDR-TB case among adult household contacts was 27 and among presumptive adult and pediatric TB contacts was three. All 56 confirmed patients were registered for treatment. Conclusion: Screening household contacts of MDR-TB index cases may be considered a feasible and high yield option, in high-burden, low-resource settings within Pakistan. The number of presumptive TB contacts required to screen to identify a new MDR-TB case was unusually low, indicating an effective strategy that could easily be scaled-up. The screening and management of vulnerable adults and children living with patients having TB of any form is a major priority in the combined efforts

  11. A Nursing Management Model to Increase Medication Adherence and Nutritional Status of Patients with Pulmonary TB

    Directory of Open Access Journals (Sweden)

    Eka Mishbahatul Mar’ah Has

    2015-04-01

    Full Text Available Introduction: High dropout rate, inadequate treatment, and resistance to medication, still become an obstacle in the treatment of pulmonary TB. Pulmonary TB patient care management at home can be done actively through telenursing. N-SMSI (Ners-Short Message Service Intervention is one of community nursing intervention, in which community nurses send short messages to remind patients to take medication and nutrition. The aim of this study was to analyze the effect of nursing management model N-SMSI to increased medication adherence and nutritional status of patients with pulmonary TB. Method: This study was used prospective design. The populations were new pulmonary TB patient at intensive phase, at Puskesmas Pegirian Surabaya. Samples were taken by purposive sampling technique; consist of 30 people, divided into treatment and control groups. The independent variable was N-SMSI. The dependent variables were medication adherence collected by using questionnaire and nutritional status by using measurement of body weight (kg. The data were then analyzed by using Wilcoxon Signed Rank Test, Mann Whitney, and Independent t-test with α ≤ 0.05 Result: The results of wilcoxon signed rank test had showed difference in the nutritional status of the treatment group before and after intervention, with p = 0.001. It’s similar with the control group, with p = 0.002. Mann whitney test results had showed no signifi cant difference in nutritional status between treatment and control group, as indicated by the value of p=0.589. While independent t-test had showed difference in compliance between treatment and control group, with p=0.031. Conslusion: N-SMSI can improve medication adherence of patient with Pulmonary TB. This model can be developed by nurse as alternative methods to improve medication adherence in patients with Pulmonary TB. Further research should modify nursing management model which can improve the nutritional status of patient with Pulmonary

  12. Multidrug-resistant and extensively drug-resistant tuberculosis: implications for the HIV epidemic and antiretroviral therapy rollout in South Africa.

    Science.gov (United States)

    Andrews, Jason R; Shah, N Sarita; Gandhi, Neel; Moll, Tony; Friedland, Gerald

    2007-12-01

    Drug-resistant tuberculosis (TB) is emerging as a major clinical and public health challenge in areas of sub-Saharan Africa where there is a high prevalence of human immunodeficiency virus (HIV) infection. TB drug-resistance surveillance in this region has been limited by laboratory capacity and the public health infrastructure; however, with the maturation of the HIV epidemic, the burden of drug-resistant TB is increasing rapidly. The recent discovery of large numbers of cases of multidrug-resistant (MDR) TB and extensively drug-resistant (XDR) TB in South Africa likely represents an unrecognized and evolving epidemic rather than sporadic, localized outbreaks. The combination of a large population of HIV-infected susceptible hosts with poor TB treatment success rates, a lack of airborne infection control, limited drug-resistance testing, and an overburdened MDR-TB treatment program provides ideal conditions for an MDR-TB and XDR-TB epidemic of unparalleled magnitude. In the present article, we review the history of drug-resistant TB in South Africa, describe its interaction with the HIV epidemic and the resultant consequences, and suggest measures necessary for controlling MDR-TB and XDR-TB in this context. A successful response to the emergence of MDR-TB and XDR-TB will necessitate increased resources for and collaboration between TB and HIV programs.

  13. Role of hypoxia-inducible factor-α in hepatitis-B-virus X protein-mediated MDR1 activation

    International Nuclear Information System (INIS)

    Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook

    2007-01-01

    The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1α (HIF-1α) and induced the nuclear translocation of C/EBPβ. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1α siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1α activation, and suggest HIF-1α for the therapeutic target of HBV-mediated chemoresistance

  14. Tuberculosis: The Connection between TB and HIV (the AIDS Virus)

    Science.gov (United States)

    ... Regimen for Latent TB Infection-Patient Education Brochure Posters Mantoux Tuberculin Skin Test Wall Chart World TB ... site? Adobe PDF file Microsoft PowerPoint file Microsoft Word file Microsoft Excel file Audio/Video file Apple ...

  15. Combination of TB lymphadenitis and metastatic LAP in breast cancer

    Directory of Open Access Journals (Sweden)

    Abdolhassan Talaiezadeh

    2015-06-01

    Full Text Available Tuberculosis (TB may present as pulmonary and extra-pulmonary. TB lymphadenitis is the most common presentation of extra-pulmonary TB. TB lymphadenitis should be taken into account in the differential diagnosis of different disorders such as metastatic lymphadenopathy. The reported patient was a 65-year-old lady with breast cancer and conglomerated and matted axillary lymphadenopathy who received chemotherapy. She presented with more extensive axillary LAP contrary to our expectation. Modified radical mastectomy was done and pathology analysis reported TB lymphadenitis associated with metastatic LAP. Under cover of anti-TB therapy adjuvant chemoradiation therapy was started. Accordingly, we recommend TB be ruled out in every patient who needs chemotherapy in the endemic region because chemotherapy may cause the extension of TB in the body.

  16. Tuberculosis: Learn the Signs and Symptoms of TB Disease

    Science.gov (United States)

    ... this? Submit What's this? Submit Button Past Emails Tuberculosis (TB) Disease: Symptoms and Risk Factors Language: English ( ... Español (Spanish) Recommend on Facebook Tweet Share Compartir Tuberculosis (TB) is a disease caused by bacteria that ...

  17. The multi-step process of building TB/HIV collaboration in Cambodia

    Directory of Open Access Journals (Sweden)

    Eang Mao

    2012-10-01

    Full Text Available Abstract Tuberculosis and HIV/AIDS have synergistic health impacts in terms of disease development and progression. Therefore, collaborative TB and HIV/AIDS activities are a logical health systems response. However, the establishment of these activities presents a challenge for countries that have strong vertical disease programs that differ in their implementation philosophies. Here, we review the process by which TB/HIV collaboration was established in Cambodia. A cycle of overlapping and mutually reinforcing initiatives – local research; piloted implementation with multiple options; and several rounds of policy formulation guided by a cross-functional Technical Working Group – was used to drive nationwide introduction of a full set of TB/HIV collaborative activities. Senior Ministry of Health officials and partner organizations brought early attention to TB/HIV. Both national programs implemented initial screening and testing interventions, even in the absence of a detailed, overarching framework. The use of multiple options for HIV testing identified which programmatic options worked best, and early implementation and pilots determined what unanswered questions required further research. Local conduct of this research – on co-treatment timing and TB symptom screening – speeded adoption of the results into policy guidance, and clarified the relative roles of the two programs. Roll-out is continuing, and results for a variety of key indicators, including screening PLHIV for TB, and testing TB patients for HIV, are at 70-80% and climbing. This experience in Cambodia illustrates the influence of health research on policy, and demonstrates that clear policy guidance, the pursuit of incremental advances, and the use of different approaches to generate evidence can overcome structural barriers to change and bring direct benefits to patients.

  18. Investigation of Susceptibility of Mycobacterium tuberculosis Complex Strains Isolated from Clinical Samples Against the First and Second-Line Anti-tuberculosis Drugs by the Sensititre MycoTB Plate Method

    Directory of Open Access Journals (Sweden)

    Figen KAYSERİLİ ORHAN

    2018-03-01

    Full Text Available Introduction: Phenotypic methods for drug susceptibility testing of Mycobacterium tuberculosis complex (MTC to second-line drugs are not yet standardized. The Sensititre MycoTB Plate is a microtiter plate containing lyophilized antibiotics and configured for determination of MIC to first and second-line anti-tuberculosis drugs. The purpose of this study is to detect the susceptibility rates of MTC strains isolated from patients’ specimens for first and second-line anti-tuberculosis drugs. Materials and Methods: This study included 50 MTC strains isolated from various clinical specimens. Out of the 50 strains, 38 were isolated from sputum, three from cerebrospinal fluid, three from bronchoalveolar lavage, and six from other samples in this study. The susceptibility of strains to anti-tuberculosis drugs were determined by the Sensititre MycoTB Plate Method. Thawed isolates were subcultured, and dilutions were inoculated into MycoTB wells. The results were read at days 7, 14 and 21. Results: At the end of study, out of 50 MTC isolates, 7 (14% showed resistance to Isoniazid (INH, 5 (10% to streptomycin (SM, 4 (8% to ethambutol (EMB, 4 (8% to ethionamide (ETH, 3 (6% to rifampicin (RIF, 3 (6% to rifabutin (RFB, 2 (4% to kanamycin (KAN, 2 (4% to ofloxacin (OFL, 2 (4% to P-aminosalicyclic acid (PAS, 1 (2% to moxiflocacin (MOX, and 1 (2% to cycloserine (CYC. All strains were found sensitive to amikacin while 2 strains (4% were identified as multidrug-resistant tuberculosis (MDR-TB. Thirty-five strains (70% were sensitive to all drugs. Extensively drug resistant tuberculosis (XDR-TB was not determined in this study. Conclusion: This is the first study that tests second line anti-tuberculosis drugs in our location and provides us valuable data regarding MDR-TB and XDR-TB rates. The Sensititre MycoTB Plate Method is a fast, reliable and practical method and can be used to determine the susceptibility of first and second-line anti-tuberculosis drugs.

  19. Mdr1a plays a crucial role in regulating the analgesic effect and toxicity of aconitine by altering its pharmacokinetic characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Lijun; Wu, Jinjun; Zhao, Min; Song, Wenjie; Qi, Xiaoxiao; Wang, Ying [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); Lu, Linlin [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078 (China); Liu, Zhongqiu, E-mail: liuzq@gzucm.edu.cn [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078 (China)

    2017-04-01

    Aconitine (AC) is the primary bioactive/toxic alkaloid in plants of the Aconitum species. Our previous study demonstrated that Mdr1 was involved in efflux of AC. However, the mechanism by which Mdr1 regulates the efficacy/toxicity of AC in vivo remains unclear. The present study aimed to determine the effects of Mdr1a on the efficacy/toxicity and pharmacokinetics of AC in wild-type and Mdr1a{sup −/−} FVB mice. After oral administration of AC, significantly higher analgesic effect was observed in Mdr1a{sup −/−} mice (49% to 105%) compared to wild-type mice (P < 0.05). The levels of s100-β protein and creatine kinase, which indicate cerebral and myocardial damage, respectively, were also significantly increased (P < 0.05) in Mdr1a{sup −/−} mice. Histopathological examination revealed that the Mdr1a{sup −/−} mice suffered from evident cerebral and myocardial damages, but the wild-type mice did not. These findings suggested that Mdr1a deficiency significantly promoted the analgesic effect of AC and exacerbated its toxicity. Pharmacokinetic experiments showed that T{sub 1/2} of AC in the Mdr1a{sup −/−} mice was significantly higher (from 87% to 300%) than that in wild-type mice (P < 0.05). The distribution of AC in the brain of Mdr1a{sup −/−} mice was 2- to 32-fold higher than that in the brains of wild-type mice (P < 0.05). Toxic reactions were more severe in Mdr1a{sup −/−} mice compared to wild-type mice. In conclusion, Mdr1a deficiency significantly enhanced the analgesic effect of AC and exacerbated its toxicity by upregulating its distribution to the brain and decreasing its plasma elimination rate. Thus, Mdr1a dysfunction may cause severe AC poisoning. - Highlights: • The efficacy and toxicity of aconitine were significantly enhanced in Mdr1a{sup −/−} mice. • The distribution of aconitine to the brain was remarkably increased in Mdr1a{sup −/−} mice. • The elimination rate of aconitine was significantly decreased in Mdr1a

  20. ANALISIS HUBUNGAN PENGGUNAAN OBAT FDC/KOMBIPAK PADA PENDERITA YANG DI DIAGNOSIS TB PARU BERDASARKAN KARAKTERISTIK

    Directory of Open Access Journals (Sweden)

    Suharmiati Suharmiati

    2012-11-01

    Full Text Available Background: Tuberculosis was an infectious disease and remains a public health problem in the world, including Indonesia. Based on the WHO report in 2009, Indonesia was included into the group of high-burden countries, ranks third after India and China. Indonesia in 1993/1994 began using alloys Anti Tuberculosis (TB called Kombipak. Although this alloy has a high effectiveness in the treatment of pulmonary TB smear positive but low recovery rates for allegedly due to low adherence to medical treatment regularly and the number of drugs taken too much. Therefore created a new drug which has basically the same alloy with Kombipak/the FOG (Fixed Dose Combination which can reduce the risk of compliance in treatment and Multi Drug Resistance. Due to the TB treatment. Methods: this study analyzed the use of drugs Kombipak/FDC in patients diagnosed with pulmonary tuberculosis based on the characteristics. This research is a secondary data analysis of Health Survey Research Association (Riskesdas in 2010 in the form of a structured questionnaire is a questionnaire for households and a questionnaire to individuals aged 15 years and over. Data analyzed by univariate and bivariate analysis using chi square and biner logistic regression. Results: This study found 1278 TB patients who TB diagnosis in the past 12 months from total sample of 177.926 people. The results showed pulmonary tuberculosis patients who get Kombipak/FDC was 83, 1% and most of the respondents treated in the health centers. TB patient who got treatment completed for 6 months or more was 55,8% and mostly treated in government hospitals or health centers. The results showed that low education TB patients had a tendency to use kombipak/FDC for > 6 months 0.659 times compared to those having higher education (p < 0.05. In conclusion, there was a significant correlation between the use Kombipak/FDC for > 6 months with the education level of respondents. It is suggested the active roleof health

  1. Exploration of Fungal Association From Hard Coral Against Pathogen MDR Staphylococcus haemolyticus

    Science.gov (United States)

    Cristianawati, O.; Radjasa, O. K.; Sabdono, A.; Trianto, A.; Sabdaningsih, A.; Sibero, M. T.; Nuryadi, H.

    2017-02-01

    Staphylococcus haemolyticus are opportunistic bacteria and as the second leading cause of nosocomial infections. It is a disease causing septicemia, peritonitis, otitis, and urinary tract infections and infections of the eye. It also a phenotype resistant to multiple antibiotics commercial. There is now an urgency to find an alternative antibiotics to combat this bacteria. It has been widely reported that many bioactive marine natural products from marine invertebrate have striking similarities to metabolites of their associated microorganisms including fungi. Hard coral associated microorganisms are among of the most interesting and promising marine natural product sources, which produce with various biological activities. The proposed work focused on the discovery of bioactive compounds and also estimated the phylogenetic diversity from fungal association of hard coral against pathogen MDR Staphylococcus haemolyticus. A total of 32 fungal association, FHP 7 which were isolated from Favia sp. capable of inhibiting the growth MDR. Molecular identification based on 18S rRNA gene sequences revealed that the active fungal association belonged 100% to the members from one of the genera Trichoderma longibrachiatum. Accession Number LC185084.1.

  2. Exploring workplace TB interventions with foreign-born Latino workers.

    Science.gov (United States)

    Eggerth, Donald E; Keller, Brenna M; Flynn, Michael A

    2018-05-15

    Persons born outside the United States are more likely to be diagnosed with tuberculosis disease (TB) than native-born individuals. Foreign-born Latinos at risk of TB may be difficult to reach with public health interventions due to cultural and institutional barriers. Workplaces employing large concentrations of foreign-born Latinos may be useful locations for TB interventions targeting this high-risk population. This study used a two-phase approach to investigate the feasibility of workplace TB interventions. The first phase investigated employer knowledge of TB and receptiveness to allowing TB interventions in their businesses through 5 structured interviews. The second phase investigated foreign-born workers' knowledge of TB and their receptiveness to receiving TB interventions in their places of employment through 12 focus groups stratified by gender and education. Phase 1: Only 1 of the 5 employers interviewed had a high level of knowledge about TB, and three had no knowledge other than that TB was a disease that involved coughing. They were receptive to workplace TB interventions, but were concerned about lost productivity and customers finding out if an employee had TB. Phase 2: There was no observed differences in responses between gender and between the bottom two education groups, so the final analysis took place between a gender-combined lower education group and higher education group. The higher education group tended to have knowledge that was more accurate and to view TB as a disease associated with poverty. The lower education group tended to have more misconceptions about TB and more often expressed concern that their employers would not support worksite interventions. The results from both phases indicate that more TB education is needed among both foreign-born Latino workers and their employers. Obstacles to implementing workplace TB interventions include knowledge, potential productivity loss, employer liability, and perceived customer response

  3. Diagnosis of active TB using aptamers

    CSIR Research Space (South Africa)

    Khati, M

    2013-08-01

    Full Text Available of the disease. We have shown in a proof-of-concept case-controlled study that the aptamer-based diagnostic tool was able to accurately detect all cases of active TB from sputum samples of patients, including smear-negative culture positive and samples from...

  4. Multi-drug-resistant tuberculosis in HIV positive patients in Eastern Europe

    DEFF Research Database (Denmark)

    Post, Frank A; Grint, Daniel; Efsen, Anne Marie Werlinrud

    2014-01-01

    Observational data from Eastern Europe on the management and outcome of multi-drug-resistant tuberculosis (MDR TB) in HIV positive populations remain sparse in the English-language literature.We compared clinical characteristics and outcomes of 55 patients who were diagnosed with HIV and MDR TB...... in Eastern Europe between 2004 and 2006 to 89 patients whose Mycobacterium tuberculosis isolates were susceptible to isoniazid and rifampicin.Patients with HIV and MDR TB were young and predominantly male with high rates of intravenous drug use, imprisonment and hepatitis C co-infection. Eighty-four per cent...... of patients with MDR TB had no history of previous TB drug exposure suggesting that the majority of MDR TB resulted from transmission of drug-resistant M. tuberculosis. The use of non-standardized tuberculosis treatment was common, and the use of antiretroviral therapy infrequent. Compared to those...

  5. Risk factors associated with default among new pulmonary TB patients and social support in six Russian regions.

    Science.gov (United States)

    Jakubowiak, W M; Bogorodskaya, E M; Borisov, S E; Borisov, E S; Danilova, I D; Danilova, D I; Kourbatova, E V; Kourbatova, E K

    2007-01-01

    Tuberculosis (TB) services in six Russian regions in which social support programmes for TB patients were implemented. To identify risk factors for default and to evaluate possible impact of social support. Retrospective study of new pulmonary smear-positive and smear-negative TB patients registered during the second and third quarters of the 2003. Data were analysed in a case-control study including default patients as cases and successfully treated patients as controls, using multivariate logistic regression modelling. A total of 1805 cases of pulmonary TB were enrolled. Default rates in the regions were 2.3-6.3%. On multivariate analysis, risk factors independently associated with default outcome included: unemployment (OR 4.44; 95%CI 2.23-8.86), alcohol abuse (OR 1.99; 95%CI 1.04-3.81), and homelessness (OR 3.49; 95%CI 1.25-9.77). Social support reduced the default outcome (OR 0.13; 95%CI 0.06-0.28), controlling for age, sex, region, residence and acid-fast bacilli (AFB) smear of sputum. Unemployment, alcohol abuse and homelessness were associated with increased default outcome among new TB patients, while social support for TB patients reduced default. Further prospective randomised studies are necessary to evaluate the impact and to determine the most cost-effective social support for improving treatment outcomes of TB in patients in Russia, especially among populations at risk of default.

  6. Relationship of Personal- Social and Therapeutic Factors with Medication Compliance in TB Patients in Ahwaz

    Directory of Open Access Journals (Sweden)

    S Jahani

    2012-01-01

    Full Text Available Introduction: Despite the implementation of DOTS strategy, TB remains one of the ten leading causes of death in developing countries. Compliance with treatment is affected by social, cultural, and economic factors, and patients’ knowledge and attitude as well. The aim of this study was to determine the relationship between compliance with treatment and personal, social and therapeutic factors in TB patients in Ahwaz. Methods: This cross-sectional descriptive study was conducted on 167 TB patients. Subjects were selected based on target. The data were collected using a questionnaire, and by observation, sputum analysis, and Kvzart Ponce urine test. The validity of the questionnaire was tested by the method of content validity, and its internal consistency and reliability was tested by Cronbach's alpha coefficient. Data analyzed by SpSS. Results: Among all subjects, 52.7% of patients showed complete compliance and 35.2% and 12% of them showed partial and poor compliance, respectively. There was a significant relationship between treatment compliance and gender(p=0.009, quality of monthly income(p=0.007, and addiction(p=0.001. The quality of treatment compliance was not significantly related to age, marital status, educational level, ethnicity, and medical complications. Conclusion: The findings showed that Incomplete treatment of TB is much worse than not treating it, because the lack of precision in the administration and consumption of anti-tuberculosis drugs, leads to the emergence of resistant TB. Paying attention to the factors decreasing treatment compliance and trying to eliminate them may lead to better treatment and lower incidence and prevalence of tuberculosis in the community.

  7. Assessment of the Diagnostic Potential of Clinotech TB Screen Test ...

    African Journals Online (AJOL)

    The Clinotech TB Screen test, a 3rd generation multi-antigen rapid chromatographic immunoassay for detection of IgG antibodies in serum against recombinant protein antigens 38kDa, 16kDa and 6kDa, was assessed for its diagnostic potential for diagnosis of active pulmonary TB in routine TB control programme in Abia ...

  8. Detection of circulating Mycobacterium tuberculosis-specific DNA by droplet digital PCR for vaccine evaluation in challenged monkeys and TB diagnosis.

    Science.gov (United States)

    Song, Neng; Tan, Yang; Zhang, Lingyun; Luo, Wei; Guan, Qing; Yan, Ming-Zhe; Zuo, Ruiqi; Liu, Weixiang; Luo, Feng-Ling; Zhang, Xiao-Lian

    2018-04-24

    Mycobacterium tuberculosis (M. tb) is emerging as a more serious pathogen due to the increased multidrug-resistant TB and co-infection of human immunodeficiency virus (HIV). The development of an effective and sensitive detection method is urgently needed for bacterial load evaluation in vaccine development, early TB diagnosis, and TB treatment. Droplet digital polymerase chain reaction (ddPCR) is a newly developed sensitive PCR method for the absolute quantification of nucleic acid concentrations. Here, we used ddPCR to quantify the circulating virulent M. tb-specific CFP10 (10-kDa culture filtrate protein, Rv3874) and Rv1768 DNA copy numbers in the blood samples from Bacille Calmette-Guerin (BCG)-vaccinated and/or virulent M. tb H37Rv-challenged rhesus monkeys. We found that ddPCR was more sensitive compared to real-time fluorescence quantitative PCR (qPCR), as the detection limits of CFP10 were 1.2 copies/μl for ddPCR, but 15.8 copies/μl for qPCR. We demonstrated that ddPCR could detect CFP10 and Rv1768 DNA after 3 weeks of infection and at least two weeks earlier than qPCR in M.tb H37Rv-challenged rhesus monkey models. DdPCR could also successfully quantify CFP10 and Rv1768 DNA copy numbers in clinical TB patients' blood samples (active pulmonary TB, extrapulmonary TB (EPTB), and infant TB). To our knowledge, this study is the first to demonstrate that ddPCR is an effective and sensitive method of measuring the circulating CFP10 and Rv1768 DNA for vaccine development, bacterial load evaluation in vivo, and early TB (including EPTB and infant TB) diagnosis as well.

  9. Therapeutic vaccines for tuberculosis-A systematic review

    NARCIS (Netherlands)

    Gröschel, Matthias I.; Prabowo, Satria A.; Cardona, Pere-Joan; Stanford, John L.; van der Werf, Tjip S.

    2014-01-01

    For eradication of tuberculosis (TB) by 2050, the declared aim of the Stop TB Partnership, novel treatment strategies are indispensable. The emerging epidemic of multi-drug resistant (MDR) TB has fuelled the debate about TB vaccines, as increasing numbers of patients can no longer be cured by

  10. Genetic polymorphisms in MDR1 and CYP3A4 genes in Asians and the influence of MDR1 haplotypes on cyclosporin disposition in heart transplant recipients.

    Science.gov (United States)

    Chowbay, Balram; Cumaraswamy, Sivathasan; Cheung, Yin Bun; Zhou, Qingyu; Lee, Edmund J D

    2003-02-01

    Intestinal cytochrome P450 3A4 (CYP3A4) and P-glycoprotein (P-gp) both play a vital role in the metabolism of oral cyclosporine (CsA). We investigated the genetic polymorphisms in CYP3A4(promoter region and exons 5, 7 and 9) and MDR1 (exons 12, 21 and 26) genes and the impact of these polymorphisms on the pharmacokinetics of oral CsA in stable heart transplant patients (n = 14). CYP3A4 polymorphisms were rare in the Asian population and transplant patients. Haplotype analysis revealed 12 haplotypes in the Chinese, eight in the Malays and 10 in the Indians. T-T-T was the most common haplotype in all ethnic groups. The frequency of the homozygous mutant genotype at all three loci (TT-TT-TT) was highest in the Indians (31%) compared to 19% and 15% in the Chinese and Malays, respectively. In heart transplant patients, CsA exposure (AUC(0-4 h), AUC(0-12 h) and C(max)) was high in patients with the T-T-T haplotypes compared to those with C-G-C haplotypes. These findings suggest that haplotypes rather than genotypes influence CsA disposition in transplant patients.

  11. Primary and secondary anti-tuberculosis drug resistance in Hitossa District of Arsi Zone, Oromia Regional State, Central Ethiopia

    Directory of Open Access Journals (Sweden)

    Shallo Daba Hamusse

    2016-07-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB drugs which is resistant to the major first-line anti-TB drugs, Isoniazid and Rifampicin, has become a major global challenge in tuberculosis (TB control programme. However, its burden at community level is not well known. Thus, the aim of study was to assess the prevalence of primary and secondary resistance to any first line anti-TB drugs and MDR TB in Hitossa District of Oromia Regional State, Central Ethiopia. Methods Population based cross- sectional study was conducted on individuals aged ≥15 years. Those with symptoms suggestive of TB were interviewed and two sputum specimens were collected from each and examined using Lowenstein-Jensen (LJ culture medium. Further, the isolates were confirmed by the Ziehl-Neelsen microscopic examination method. Drug susceptibility test (DST was also conducted on LJ medium using a simplified indirect proportion method. The resistance strains were then determined by percentage of colonies that grew on the critical concentration of Isoniazid, Streptomycin, Rifampicin and Ethambutol. Results The overall resistance of all forms of TB to any first-line anti-TB drug was 21.7 %. Of the total new and previously treated culture positive TB cases, 15.3 and 48.8 % respectively were found to be a resistant to any of the first-line anti-TB drugs. Further, of all forms of TB, the overall resistance of MDR-TB was 4.7 %. However, of the total new TB cases, 2.4 % had primary while 14.3 % had secondary MDR-TB. Resistance to any of the first-line anti-TB drugs (adjusted odd ratio (AOR, 8.1; 95 % CI: 2.26–29.30 and MDR-TB (AOR, 7.1; 95 % CI: 2.6–43.8 was found to be linked with previous history of anti-TB treatment. Conclusions The study has identified a high rate of primary and secondary resistance to any of the first-line anti-TB drugs and MDR-TB in the study area. The resistance may have resulted from sub-optimal performance of directly observed

  12. Efforts to reduce the disparity between permanent residents and temporary migrants: Stop TB experiences in Shanghai, China.

    Science.gov (United States)

    Lu, Hui; Chen, Jing; Wang, Wei; Wu, Laiwa; Shen, Xin; Yuan, Zhengan; Yan, Fei

    2015-08-01

    Eight of 17 districts of Shanghai have offered transportation and living allowances subsidies to patients with tuberculosis (TB) among the migrant population. The study aimed to assess the impact of the subsidising initiative on the treatment success rate (TSR) and identify the social determinants of treatment outcomes. The participants included 7072 residents and 5703 migrants who were registered in the TB Information Management System with smear-positive pulmonary TB from January 2006 to December 2010. The Cochran-Armitage test was employed to test the trends of TSR and logistic regressions to identify the factors associated with treatment outcome. Without subsidies, migrant TB cases had lower odds of successful treatment [OR = 0.20 (95% CI 0.18-0.23)] than resident cases. Subsidisation was associated with a 65% increased odds ratio of success [1.65 (1.40-1.95)] among migrant cases. The TSR has stabilised at 87% for both permanent residents and temporary migrants since 2009. Living in districts with a population density ≥20,000/km(2) was associated with a low odds ratio [0.42 (0.26-0.68)] among resident cases, whereas among migrant cases those living in districts out of central downtown had a higher odds ratio of treatment success [peripheral downtown: 1.73 (1.36-2.20), suburban: 1.69 (1.16-2.46)]. The TB cases in districts with 2.0-2.9 TB specialists/100 cases had a higher odds ratio [2.99 (1.91-4.69)] of successful treatment than cases from districts with fewer specialists. Besides free medical services, transport and living allowance subsidies to migrant patients with TB improved the treatment outcome significantly. © 2015 John Wiley & Sons Ltd.

  13. Lattice damage induced by Tb-implanted AlN crystalline films

    International Nuclear Information System (INIS)

    Lu Fei; Hu Hui; Rizzi, A.

    2002-01-01

    AlN films with thickness from 100 to 1000 nm were grown on SiC substrate by MBE. AlN crystalline films were doped by implantation with 160 keV Tb ions to fluences of 5x10 14 , 1.5x10 15 , 3x10 15 and 6x10 15 ions/cm 2 , respectively. The damage profiles in AlN films induced by Tb implantation were investigated using RBS/channeling technique. A procedure developed by Feldman and Rodgers was used to extract damage profile by considering the dechanneling mechanism of multiple. The comparison of the extracted profile with TRIM prediction shows a significant difference in the shape and in the position of damage profile. The damage profile in AlN film is similar as Tb distribution. The RBS/channeling of Tb-implanted AlN film before and after 950 deg. C annealing treatments show a good consistency, which indicate that high temperature annealing cannot result in a significant change in both crystal damage and in Tb distribution

  14. Anaplasia and drug selection-independent overexpression of the multidrug resistance gene, MDR1, in Wilms' tumor.

    Science.gov (United States)

    Re, G G; Willingham, M C; el Bahtimi, R; Brownlee, N A; Hazen-Martin, D J; Garvin, A J

    1997-02-01

    One reason for the failure of chemotherapy is the overexpression of the multidrug resistance gene, MDR1. The product of this gene is the multidrug transporter P-glycoprotein, an ATP-dependent pump that extrudes drugs from the cytoplasm. Some tumors inherently express P-glycoprotein, whereas others acquire the ability to do so after exposure to certain chemotherapeutic agents, often by the mechanism of gene amplification. Classical Wilms' tumors (nephroblastoma) typically respond to therapy and have a good prognosis. On the contrary, anaplastic Wilms' tumors are generally refractory to chemotherapy. These anaplastic variants are rare (4.5% of all Wilms' tumors reported in the United States), aggressive, and often fatal forms of tumor, which are commonly thought to result from the progression of classical Wilms' tumors. To investigate the basis for this differential response to therapy, we examined a number of classical and anaplastic Wilms' tumors for the expression of the MDR1 gene by immunohistochemical and mRNA analysis. Classical Wilms' tumors consistently did not express P-glycoprotein except in areas of tubular differentiation, as in normal kidney. Similarly, two of three anaplastic tumors failed to show P-glycoprotein expression. In contrast, cultured cells derived from a third anaplastic tumor, W4, exhibited strong P-glycoprotein expression and were drug resistant in vitro. Southern analysis revealed that W4 cells contained a single copy of the MDR1 gene per haploid genome similar to normal cells, demonstrating that the overexpression of MDR1 was not caused by gene amplification. Transcriptional activation of the MDR1 gene would be in keeping with the concept that p53 might act as a transcriptional repressor of the MDR1 gene.

  15. Management of TB in the private sector in Khartoum, Sudan: quality ...

    African Journals Online (AJOL)

    Introduction Sudan has a large and growing private health sector. No survey was done in Sudan to show the extent of the use of private health care services by the population. Also precise data on tuberculosis (TB) diagnosis and treatment in the private sector are not available. Material and methods. A facility-based ...

  16. South African plants as a source of drugs to treat infectious diseases - TB, malaria and HIV.

    CSIR Research Space (South Africa)

    Pillay, P

    2008-11-01

    Full Text Available and the South African National Biodiversity Institute (SANBI) established a database of 566 plant taxa that are reportedly used for the treatment of TB and 623 taxa associated with malaria and/or fever. A process of prioritization using selection criteria led...

  17. The making of a public health problem: multi-drug resistant tuberculosis in India.

    Science.gov (United States)

    Engel, Nora C

    2013-07-01

    This paper examines how actors construct the public problem of multi-drug resistant tuberculosis (MDR-TB) in India. MDR-TB has been framed by the World Health Organization as a pressing, global public health problem. The responses to MDR-TB are complicated as treatment takes longer and is more expensive than routine TB treatment. This is particularly problematic in countries, such as India, with high patient loads, a large and unregulated private sector, weak health systems and potentially high numbers of MDR-TB cases. This paper analyses how actors struggle for control over ownership, causal theories and political responsibility of the public problem of MDR-TB in India. It combines Gusfield's theory on the construction of public problems with insights from literature on the social construction of diseases and on medical social control. It highlights that there are flexible definitions of public problems, which are negotiated among actor groups and which shift over time. The Indian government has shifted its policy in recent years and acknowledged that MDR-TB needs to be dealt with within the TB programme. The study results reveal how the policy shift happened, why debates on the construction of MDR-TB as a public problem in India continue, and why actors with alternative theories than the government do not succeed in their lobbying efforts. Two main arguments are put forward. First, the construction of the public problem of MDR-TB in India is a social and political process. The need for representative data, international influence and politics define what is controllable. Second, the government seems to be anxious to control the definition of India's MDR-TB problem. This impedes an open, critical and transparent discussion on the definition of the public problem of MDR-TB, which is important in responding flexibly to emerging public health challenges.

  18. Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines

    OpenAIRE

    NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho

    2007-01-01

    Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...

  19. Multi-drug-resistant tuberculosis in HIV positive patients in Eastern Europe.

    Science.gov (United States)

    Post, Frank A; Grint, Daniel; Werlinrud, Anne Marie; Panteleev, Alexander; Riekstina, Vieja; Malashenkov, Evgeniy A; Skrahina, Alena; Duiculescu, Dan; Podlekareva, Daria; Karpov, Igor; Bondarenko, Vasiliy; Chentsova, Nelly; Lundgren, Jens; Mocroft, Amanda; Kirk, Ole; Miro, Jose M

    2014-03-01

    Observational data from Eastern Europe on the management and outcome of multi-drug-resistant tuberculosis (MDR TB) in HIV positive populations remain sparse in the English-language literature. We compared clinical characteristics and outcomes of 55 patients who were diagnosed with HIV and MDR TB in Eastern Europe between 2004 and 2006 to 89 patients whose Mycobacterium tuberculosis isolates were susceptible to isoniazid and rifampicin. Patients with HIV and MDR TB were young and predominantly male with high rates of intravenous drug use, imprisonment and hepatitis C co-infection. Eighty-four per cent of patients with MDR TB had no history of previous TB drug exposure suggesting that the majority of MDR TB resulted from transmission of drug-resistant M. tuberculosis. The use of non-standardized tuberculosis treatment was common, and the use of antiretroviral therapy infrequent. Compared to those with susceptible tuberculosis, patients with MDR TB were less likely to achieve cure or complete tuberculosis treatment (21.8% vs. 62.9%, p < 0.0001), and they were more likely to die (65.5% vs. 27.0%, p < 0.0001). Our study documents suboptimal management and poor outcomes in HIV positive patients with MDR TB. Implementation of WHO guidelines, rapid TB diagnostics and TB drug susceptibility testing for all patients remain a priority in this region. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  20. Adverse reactions among patients being treated for multi-drug resistant tuberculosis at Abbassia Chest Hospital

    Directory of Open Access Journals (Sweden)

    Mohammad A. Tag El Din

    2015-10-01

    Conclusions: There is a relation between both tobacco smoking and drug addiction, and MDR TB. The most common type of resistance is acquired resistance because of lack of adherence to treatment or inappropriate treatment. The most common co-morbidities associated with MDR TB are diabetes and chronic obstructive lung diseases. The most important predictors of patients’ outcome are sputum conversion, number of previous TB treatment and presence of co-morbidities.

  1. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Svenningsen, Katrine; Almind Knudsen, Lina

    2015-01-01

    AIM: To evaluate ATP-binding cassette (ABC) transporters in colonic pathophysiology as they had recently been related to colorectal cancer (CRC) development. METHODS: Literature search was conducted on PubMed using combinations of the following terms: ABC transporters, ATP binding cassette...... with glucocorticoids. The evidence for the involvement of ABCC2 and ABCG2 in colonic pathophysiology was weak. CONCLUSION: ABCB1, diet, and gut microbes mutually interact in colonic inflammation, a well-known risk factor for CRC. Further insight may be translated into preventive and treatment strategies....... transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1...

  2. Obstructive lung disease as a complication in post pulmonary TB

    Science.gov (United States)

    Tarigan, A. P.; Pandia, P.; Eyanoer, P.; Tina, D.; Pratama, R.; Fresia, A.; Tamara; Silvanna

    2018-03-01

    The case of post TB is a problem that arises in the community. Pulmonary tuberculosis (TB) can affect lung function. Therefore, we evaluated impaired pulmonary function in subjects with diagnosed prior pulmonary TB. A Case Series study, pulmonary function test was performed in subjects with a history of pulmonary tuberculosis; aged ≥18 years were included. Exclusion criteria was a subject who had asthma, obesity, abnormal thorax and smoking history. We measured FEV1 and FVC to evaluate pulmonary function. Airflow obstruction was FEV1/FVC%pulmonary TB, 5 subjects (23%) had airflow obstruction with FEV1/FVC% value pulmonary TB.

  3. Relevance and acceptability of using the Quantiferon gold test (QGIT) to screen CD4 blood draws for latent TB infection among PLHIV in South Africa: formative qualitative research findings from the TEKO trial.

    Science.gov (United States)

    Kerrigan, Deanna; Tudor, Carrie; Motlhaoleng, Katlego; Lebina, Limakatso; Qomfu, Cokiswa; Variava, Ebrahim; Chon, Sandy; Martinson, Neil; Golub, Jonathan E

    2018-04-16

    Tuberculosis (TB) is the leading cause of mortality among people living with HIV (PLHIV), despite the availability of effective preventive therapy. The TEKO trial is assessing the impact of using a blood test, Quantiferon-TB Gold In-Tube Test (QGIT), to screen for latent TB compared to the Tuberculin Screening Test (TST) among PLHIV in South Africa. Fifty-six qualitative interviews were conducted with PLHIV and clinical providers participating in the TEKO trial. We explored TB screening, diagnosis, and treatment guidelines and processes and the use of the QGIT to screen for latent TB infection at the time of CD4 blood draw. Thematic content analysis was conducted. Considerable variability in TB screening procedures was documented due to lack of personnel and clarity regarding current national TB guidelines for PLHIV. Few clinics had started using the TST per national guidelines and many patients had never heard of isoniazid preventive therapy (IPT). Nearly all participants supported the idea of latent TB screening using routine blood drawn for CD4 counts. Findings indicate that screening for latent TB infection using QGIT from blood drawn for CD4 counts among PLHIV is an acceptable approach to increase latent TB detection given the challenges associated with ensuring systematic latent TB screening in overburdened public clinics. The results presented here were from formative research related to the TEKO trial (Identifier NCT02119130 , registered 10 April 2014).

  4. Training social workers to enhance patient-centered care for drug-resistant TB-HIV in South Africa.

    Science.gov (United States)

    Zelnick, J R; Seepamore, B; Daftary, A; Amico, K R; Bhengu, X; Friedland, G; Padayatchi, N; Naidoo, K; O'Donnell, M R

    2018-03-21

    KwaZulu-Natal, South Africa, is the epicenter of an epidemic of drug-resistant tuberculosis (DR-TB) and human immunodeficiency virus (HIV) co-infection, characterized by low rates of medication adherence and retention in care. Social workers may have a unique role to play in improving DR-TB-HIV outcomes. We designed, implemented and evaluated a model-based pilot training course on patient-centered care, treatment literacy in DR-TB and HIV coinfection, patient support group facilitation, and self-care. Ten social workers participated in a 1-day training course. Post-training questionnaire scores showed significant overall gains ( P = 0.003). A brief training intervention may be a useful and feasible way to engage social workers in patient-centered care for DR-TB and HIV coinfection.

  5. Consensus statement: Management of drug-induced liver injury in HIV-positive patients treated for TB

    Directory of Open Access Journals (Sweden)

    E Jong

    2013-09-01

    Full Text Available Drug-induced liver injury (DILI in HIV/tuberculosis (TB co-infected patients is a common problem in the South African setting, and re-introduction of anti-TB drugs can be challenging for the healthcare worker. Although international guidelines on the re-introduction of TB treatment are available, the definition of DILI is not uniform, management of antiretroviral therapy (ART in HIV co-infection is not mentioned, and the guidance on management is not uniform and lacks a practical approach. In this consensus statement, we summarise important aspects of DILI and provide practical guidance for healthcare workers for different patient groups and healthcare settings on the re-introduction of anti-TB drugs and ART in HIV/TB co-infected individuals presenting with DILI.

  6. Technology and tuberculosis control: the OUT-TB Web experience.

    Science.gov (United States)

    Guthrie, Jennifer L; Alexander, David C; Marchand-Austin, Alex; Lam, Karen; Whelan, Michael; Lee, Brenda; Furness, Colin; Rea, Elizabeth; Stuart, Rebecca; Lechner, Julia; Varia, Monali; McLean, Jennifer; Jamieson, Frances B

    2017-04-01

    Develop a tool to disseminate integrated laboratory, clinical, and demographic case data necessary for improved contact tracing and outbreak detection of tuberculosis (TB). In 2007, the Public Health Ontario Laboratories implemented a universal genotyping program to monitor the spread of TB strains within Ontario. Ontario Universal Typing of TB (OUT-TB) Web utilizes geographic information system (GIS) technology with a relational database platform, allowing TB control staff to visualize genotyping matches and microbiological data within the context of relevant epidemiological and demographic data. OUT-TB Web is currently available to the 8 health units responsible for >85% of Ontario's TB cases and is a valuable tool for TB case investigation. Users identified key features to implement for application enhancements, including an e-mail alert function, customizable heat maps for visualizing TB and drug-resistant cases, socioeconomic map layers, a dashboard providing TB surveillance metrics, and a feature for animating the geographic spread of strains over time. OUT-TB Web has proven to be an award-winning application and a useful tool. Developed and enhanced using regular user feedback, future versions will include additional data sources, enhanced map and line-list filter capabilities, and development of a mobile app. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  7. Pharmacological modification of multi-drug resistance (MDR) in vitro detected by a novel fluorometric microculture cytotoxicity assay. Reversal of resistance and selective cytotoxic actions of cyclosporin A and verapamil on MDR leukemia T-cells.

    Science.gov (United States)

    Larsson, R; Nygren, P

    1990-07-15

    A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).

  8. Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects.

    Science.gov (United States)

    Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko

    2002-04-01

    The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.

  9. Initial default among sputum-positive pulmonary TB patients at a referral hospital in Uttarakhand, India.

    Science.gov (United States)

    Mehra, Darshan; Kaushik, Rajeev M; Kaushik, Reshma; Rawat, Jagdish; Kakkar, Rajesh

    2013-09-01

    Initial default is a serious issue which can enhance the transmission of TB. We determined the magnitude of and the causative factors for initial default among sputum-positive pulmonary TB (PTB) patients. In this prospective study, 2310 patients attending a referral hospital in Uttarakhand state, north India, with presumptive TB were investigated and 555 patients with sputum-positive PTB were followed-up for initiation of anti-TB treatment (ATT) during 2010-2012. The patients not confirmed as having started ATT were considered initial defaulters. Initial default was seen in 120 (21.6%) patients comprising 22 (18.3%) defaulters during diagnosis and 98 (81.6%) defaulters after referral for directly observed treatment, short-course (DOTS). The initial default rate was significantly higher among patients from rural areas than urban areas, illiterate patients than literate patients and smokeless tobacco-users than non-users (pdefault among patients referred for DOTS were limited trust in DOTS (n = 44, 44.8%), adverse effects of previous ATT (n = 41, 41.8%), dissatisfaction with health services (n = 38, 38.7%), local deaths while taking DOTS (n = 28, 28.5%), advice by others against DOTS (n = 25, 25.5%), disbelief in the diagnosis (n = 18, 18.3%) and patient death before starting treatment (n = 4, 4.0%). A high initial default rate was seen among patients with PTB. There is an urgent need to promote public awareness to lower the initial default rate.

  10. Childhood multidrug-resistant tuberculosis in the European Union and European Economic Area: an analysis of tuberculosis surveillance data from 2007 to 2015.

    Science.gov (United States)

    Ködmön, Csaba; van den Boom, Martin; Zucs, Phillip; van der Werf, Marieke Johanna

    2017-11-01

    BackgroundConfirming tuberculosis (TB) in children and obtaining information on drug susceptibility is essential to ensure adequate treatment. We assessed whether there are gaps in diagnosis and treatment of multidrug-resistant (MDR) TB in children in the European Union and European Economic Area (EU/EEA), quantified the burden of MDR TB in children and characterised cases. Methods : We analysed surveillance data from 2007 to 2015 for paediatric cases younger than 15 years. Results : In that period, 26 EU/EEA countries reported 18,826 paediatric TB cases of whom 4,129 (21.9%) were laboratory-confirmed. Drug susceptibility testing results were available for 3,378 (17.9%), representing 81.8% of the confirmed cases. The majority (n = 2,967; 87.8%) had drug-sensitive TB, 249 (7.4%) mono-resistant TB, 64 (1.9%) poly-resistant TB, 90 (2.7%) MDR TB and eight (0.2%) had extensively drug-resistant (XDR) TB. MDR TB was more frequently reported among paediatric cases with foreign background (adjusted odds ratio (aOR) = 1.73; 95% confidence interval (95% CI): 1.12-2.67) or previous TB treatment (aOR: 6.42; 95% CI: 3.24-12.75). Successful treatment outcome was reported for 58 of 74 paediatric MDR TB cases with outcome reported from 2007 to 2013; only the group of 5-9 years-olds was significantly associated with unsuccessful treatment outcome (crude odds ratio (cOR) = 11.45; 95% CI: 1.24-106.04). Conclusions : The burden of MDR TB in children in the EU/EEA appears low, but may be underestimated owing to challenges in laboratory confirmation. Diagnostic improvements are needed for early detection and adequate treatment of MDR TB. Children previously treated for TB or of foreign origin may warrant higher attention.

  11. Emerging drugs and alternative possibilities in the treatment of tuberculosis

    NARCIS (Netherlands)

    Hofman, S.; Segers, M.M.; Ghimire, S.; Bolhuis, M.S.; Sturkenboom, M.G.; Soolingen, D. van; Alffenaar, J.W.

    2016-01-01

    INTRODUCTION: Tuberculosis (TB) remains a global health problem. Drug resistance, treatment duration, complexity, and adverse drug reactions associated with anti-TB regimens are associated with treatment failure, prolonged infectiousness and relapse. With the current set of anti-TB drugs the goal to

  12. Emerging drugs and alternative possibilities in the treatment of tuberculosis

    NARCIS (Netherlands)

    Hofman, S.; Segers, M. M.; Ghimire, S.; Bolhuis, M. S.; Sturkenboom, M. G. G.; Van Soolingen, D.; Alffenaar, J. W. C.

    2016-01-01

    Introduction: Tuberculosis (TB) remains a global health problem. Drug resistance, treatment duration, complexity, and adverse drug reactions associated with anti-TB regimens are associated with treatment failure, prolonged infectiousness and relapse. With the current set of anti-TB drugs the goal to

  13. Treatment of Latent Tuberculosis Infection

    OpenAIRE

    Tang, Patrick; Johnston, James

    2017-01-01

    Opinion statement The treatment of latent tuberculosis infection (LTBI) is an essential component of tuberculosis (TB) elimination in regions that have a low incidence of TB. However, the decision to treat individuals with LTBI must consider the limitations of current diagnostic tests for LTBI, the risk of developing active TB disease, the potential adverse effects from chemoprophylactic therapy, and the importance of treatment adherence. When an individual has been diagnosed with LTBI and ac...

  14. Transmission of MDR MRSA between primates, their environment and personnel at a United States primate centre.

    Science.gov (United States)

    Soge, Olusegun O; No, David; Michael, Karen E; Dankoff, Jennifer; Lane, Jennifer; Vogel, Keith; Smedley, Jeremy; Roberts, Marilyn C

    2016-10-01

    MDR MRSA isolates cultured from primates, their facility and primate personnel from the Washington National Primate Research Center were characterized to determine whether they were epidemiologically related to each other and if they represented common local human-associated MRSA strains. Human and primate nasal and composite environmental samples were collected, enriched and selected on medium supplemented with oxacillin and polymyxin B. Isolates were biochemically verified as Staphylococcus aureus and screened for the mecA gene. Selected isolates were characterized using SCCmec typing, MLST and WGS. Nasal cultures were performed on 596 primates and 105 (17.6%) were MRSA positive. Two of 79 (2.5%) personnel and two of 56 (3.6%) composite primate environmental facility samples were MRSA positive. Three MRSA isolates from primates, one MRSA from personnel, two environmental MRSA and one primate MSSA were ST188 and were the same strain type by conventional typing methods. ST188 isolates were related to a 2007 ST188 human isolate from Hong Kong. Both MRSA isolates from out-of-state primates had a novel MLST type, ST3268, and an unrelated group. All isolates carried ≥1 other antibiotic resistance gene(s), including tet(38), the only tet gene identified. ST188 is very rare in North America and has almost exclusively been identified in people from Pan-Asia, while ST3268 is a newly reported MRSA type. The data suggest that the primate MDR MRSA was unlikely to come from primate centre employees. Captive primates are likely to be an unappreciated source of MRSA. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. High Field Magnetization of Tb Single Crystals

    DEFF Research Database (Denmark)

    Roeland, L. W.; Cock, G. J.; Lindgård, Per-Anker

    1975-01-01

    Hamiltonian including isotropic exchange interactions, effective single-ion anisotropy and magnetoelastic contributions. The parameters of this Hamiltonian were determined by fitting the theoretical results for the spin wave dispersion and energy gap as a function of temperature and magnetic field to existing...... data on Tb. The conduction-electron polarization at zero field and temperature is (0.33+or-0.05) mu B/ion, and the susceptibility is greater than the Pauli susceptibility calculated from the band-structure....

  16. Radiorespirometry in TB diagnosis and drug discovery

    International Nuclear Information System (INIS)

    Ray Mukti, K.; Kulkarni, Savita; Rajan, M.G.R.

    2015-01-01

    Tuberculosis remains a major health problem worldwide and especially in India with 1.9 million new cases and 0.35 million deaths per year. Early and rapid diagnosis of pulmonary tuberculosis is mandatory for controlling the transmission of the disease. Conventional test like sputum AFB is not sensitive and gold standard culture test is time consuming. Our laboratory has standardized a Radiorespirometry technique for primary diagnosis which offers advantage of both less turnaround time and sensitivity. Radiorespirometry is a true radiotracer technique that detects the presence of live microorganism in a biological sample. In this method, bacteria (or clinical sample) is inoculated into a medium supplemented with radiolabelled ( 14 C) carbon compounds. Only metabolically active organism present in the sample will metabolize the carbon source and produce radiolabelled carbon dioxide ( 14 CO 2 ) . This 14 CO 2 can be efficiently trapped in an alkaline-scintillant matrix and counted in a liquid scintillation counter. The whole thing is suitably assembled in a regular scintillation vial. We used radiorespirometry in a retrospective study using culture positive sputum samples (which was detected positive by culture in 3-8 weeks time) and it detected presence of TB bacilli in 1 to 3 weeks. Further, series of Phenyl acrylamide derivatives synthesized against RecA of mycobacteria were evaluated for anti-TB properties using radiorespirometry. More than 90% of the compounds exhibited anti-TB properties with MIC 3.25 to 25 μg/ml. Structure activity relationship of these compound was studied to understand the anti-TB pharmacophores. Interesting results obtained using radiorespirometry will be discussed. (author)

  17. Magnetostriction of Tb-Dy-Fe crystals

    International Nuclear Information System (INIS)

    Mei Wu; Okane, T.; Umeda, T.

    1998-01-01

    left angle 111 right angle -oriented twin free Tb-Dy-Fe single crystals, left angle 112 right angle - and left angle 110 right angle -oriented twinned ''single'' Tb-Dy-Fe crystals were prepared using floating zone melting crystal growth methods. Magnetostrictive performances of the crystals were investigated. Better low-field properties were observed in the left angle 110 right angle twinned crystals than in the left angle 112 right angle crystals. The highest properties were achieved in the left angle 111 right angle twin free single crystals. Even though there were still oxidized particles in the present left angle 111 right angle single crystals, a large magnetostrictive jump of 1700 ppm and a very low saturation magnetic field of 500 Oe were obtained. To understand magnetization and magnetostriction of different Tb-Dy-Fe crystals, theoretical modeling was carried out based on a simplified domain rotation model. Magnetization moment rotation paths of different domains were simulated and hence the resultant magnetostriction was obtained, which could adequately account for the experimental results of different crystals. The limitation of the domain rotation model was also discussed. (orig.)

  18. Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

    Science.gov (United States)

    Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

    2015-08-01

    The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

  19. Isolation, Identification And Screening Antibacterial Activity from Marine Sponge-Associated Fungi Against Multidrug-Resistant (MDR) Escherichia coli

    Science.gov (United States)<