"When Treatment Is More Challenging than the Disease": A Qualitative Study of MDR-TB Patient Retention.

Directory of Open Access Journals (Sweden)

Kalpita S Shringarpure

Full Text Available One-fifth of the patients on multidrug-resistant tuberculosis treatment at the Drug-Resistant-TB (DR-TB Site in Gujarat are lost-to-follow-up(LFU.To understand patients' and providers' perspectives on reasons for LFU and their suggestions to improve retention-in-care.Qualitative study conducted between December 2013-March 2014, including in-depth interviews with LFU patients and DOT-providers, and a focus group discussion with DR-TB site supervisors. A thematic-network analysis approach was utilised.Three sub-themes emerged: (i Struggle with prolonged treatment; (ii Strive against stigma and toward support; (iii Divergent perceptions and practices. Daily injections, pill burden, DOT, migratory work, social problems, prior TB treatment, and adverse drugs effects were reported as major barriers to treatment adherence and retention-in-care by patients and providers. Some providers felt that despite their best efforts, LFU patients remain. Patient movements between private practitioners and traditional healers further influenced LFU.The study points to a need for repeated patient counselling and education, improved co-ordination between various tiers of providers engaged in DR-TB care, collaboration between the public, private and traditional practitioners, and promotion of social and economic support to help patients adhere to MDR-TB treatment and avoid LFU.

Treatment outcomes of MDR-tuberculosis patients in Brazil: a retrospective cohort analysis

Directory of Open Access Journals (Sweden)

Mayara Lisboa Bastos

2017-11-01

Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB is a threat for the global TB epidemic control. Despite existing evidence that individualized treatment of MDR-TB is superior to standardized regimens, the latter are recommended in Brazil, mainly because drug-susceptibility tests (DST are often restricted to first-line drugs in public laboratories. We compared treatment outcomes of MDR-TB patients using standardized versus individualized regimens in Brazil, a high TB-burden, low resistance setting. Methods The 2007–2013 cohort of the national electronic database (SITE-TB, which records all special treatments including drug-resistance, was analysed. Patients classified as MDR-TB in SITE-TB were eligible. Treatment outcomes were classified as successful (cure/treatment completed or unsuccessful (failure/relapse/death/loss to follow-up. The odds for successful treatment according to type of regimen were controlled for demographic and clinical variables. Results Out of 4029 registered patients, we included 1972 recorded from 2010 to 2012, who had more complete outcome data. The overall success proportion was 60%. Success was more likely in non-HIV patients, sputum-negative at baseline, with unilateral disease and without prior DR-TB. Adjusted for these variables, those receiving standardized regimens had 2.7-fold odds of success compared to those receiving individualized treatments when failure/relapse were considered, and 1.4-fold odds of success when death was included as an unsuccessful outcome. When loss to follow-up was added, no difference between types of treatment was observed. Patients who used levofloxacin instead of ofloxacin had 1.5-fold odds of success. Conclusion In this large cohort of MDR-TB patients with a low proportion of successful outcomes, standardized regimens had superior efficacy than individualized regimens, when adjusted for relevant variables. In addition to the limitations of any retrospective observational

E-health systems for management of MDR-TB in resource-poor environments: a decade of experience and recommendations for future work.

Science.gov (United States)

Fraser, Hamish S F; Habib, Ali; Goodrich, Mark; Thomas, David; Blaya, Joaquin A; Fils-Aime, Joseph Reginald; Jazayeri, Darius; Seaton, Michael; Khan, Aamir J; Choi, Sharon S; Kerrison, Foster; Falzon, Dennis; Becerra, Mercedes C

2013-01-01

Multi-drug resistant TB (MDR-TB) is a complex infectious disease that is a growing threat to global health. It requires lengthy treatment with multiple drugs and specialized laboratory testing. To effectively scale up treatment to thousands of patients requires good information systems to support clinical care, reporting, drug forecasting, supply chain management and monitoring. Over the last decade we have developed the PIH-EMR electronic medical record system, and subsequently OpenMRS-TB, to support the treatment of MDR-TB in Peru, Haiti, Pakistan, and other resource-poor environments. We describe here the experience with implementing these systems and evaluating many aspects of their performance, and review other systems for MDR-TB management. We recommend a new approach to information systems to address the barriers to scale up MDR-TB treatment, particularly access to the appropriate drugs and lab data. We propose moving away from fragmented, vertical systems to focus on common platforms, addressing all stages of TB care, support for open data standards and interoperability, care for a wide range of diseases including HIV, integration with mHealth applications, and ability to function in resource-poor environments.

Operational challenges in diagnosing multi-drug resistant TB and initiating treatment in Andhra Pradesh, India.

Directory of Open Access Journals (Sweden)

Sarabjit S Chadha

Full Text Available BACKGROUND: Revised National TB Control Programme (RNTCP, Andhra Pradesh, India. There is limited information on whether MDR-TB suspects are identified, undergo diagnostic assessment and are initiated on treatment according to the programme guidelines. OBJECTIVES: To assess i using the programme definition, the number and proportion of MDR-TB suspects in a large cohort of TB patients on first-line treatment under RNTCP ii the proportion of these MDR-TB suspects who underwent diagnosis for MDR-TB and iii the number and proportion of those diagnosed as MDR-TB who were successfully initiated on treatment. METHODS: A retrospective cohort analysis, by reviewing RNTCP records and reports, was conducted in four districts of Andhra Pradesh, India, among patients registered for first line treatment during October 2008 to December 2009. RESULTS: Among 23,999 TB patients registered for treatment there were 559 (2% MDR-TB suspects (according to programme definition of which 307 (55% underwent diagnosis and amongst these 169 (55% were found to be MDR-TB. Of the MDR-TB patients, 112 (66% were successfully initiated on treatment. Amongst those eligible for MDR-TB services, significant proportions are lost during the diagnostic and treatment initiation pathway due to a variety of operational challenges. The programme needs to urgently address these challenges for effective delivery and utilisation of the MDR-TB services.

Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

Science.gov (United States)

Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

2018-05-31

Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

Risk factors for MDR and XDR-TB in a tertiary referral hospital in India.

Directory of Open Access Journals (Sweden)

V Balaji

Full Text Available BACKGROUND: India has a high burden of drug resistant TB, although there are few data on XDR-TB. Although XDR-TB has existed previously in India, the definition has not been widely applied, and surveillance using second line drug susceptibility testing has not been performed. Our objective was to analyze clinical and demographic risk factors associated with isolation of MDR and XDR TB as compared to susceptible controls, at a tertiary center. METHODOLOGY/FINDINGS: Retrospective chart review based on positive cultures isolated in a high volume mycobacteriology laboratory between 2002 and 2007. 47 XDR, 30 MDR and 117 susceptible controls were examined. Drug resistant cases were less likely to be extrapulmonary, and had received more previous treatment regimens. Significant risk factors for XDR-TB included residence outside the local state (OR 7.43, 3.07-18.0 and care costs subsidized (OR 0.23, 0.097-0.54 in bivariate analysis and previous use of a fluoroquinolone and injectable agent (other than streptomycin (OR 7.00, 95% C.I. 1.14-43.03 and an initial treatment regimen which did not follow national guidelines (OR 5.68, 1.24-25.96 in multivariate analysis. Cavitation and HIV did not influence drug resistance. CONCLUSIONS/SIGNIFICANCE: There is significant selection bias in the sample available. Selection pressure from previous treatment and an inadequate initial regimen increases risk of drug resistance. Local patients and those requiring financial subsidies may be at lower risk of XDR-TB.

Transmission of MDR and XDR tuberculosis in Shanghai, China.

Directory of Open Access Journals (Sweden)

Ming Zhao

Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.

Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

Science.gov (United States)

Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

2010-01-01

Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

Directory of Open Access Journals (Sweden)

Mohd Zakihalani A. Halim

2016-03-01

Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

The Impact of a Line Probe Assay Based Diagnostic Algorithm on Time to Treatment Initiation and Treatment Outcomes for Multidrug Resistant TB Patients in Arkhangelsk Region, Russia.

Science.gov (United States)

Eliseev, Platon; Balantcev, Grigory; Nikishova, Elena; Gaida, Anastasia; Bogdanova, Elena; Enarson, Donald; Ornstein, Tara; Detjen, Anne; Dacombe, Russell; Gospodarevskaya, Elena; Phillips, Patrick P J; Mann, Gillian; Squire, Stephen Bertel; Mariandyshev, Andrei

2016-01-01

In the Arkhangelsk region of Northern Russia, multidrug-resistant (MDR) tuberculosis (TB) rates in new cases are amongst the highest in the world. In 2014, MDR-TB rates reached 31.7% among new cases and 56.9% among retreatment cases. The development of new diagnostic tools allows for faster detection of both TB and MDR-TB and should lead to reduced transmission by earlier initiation of anti-TB therapy. The PROVE-IT (Policy Relevant Outcomes from Validating Evidence on Impact) Russia study aimed to assess the impact of the implementation of line probe assay (LPA) as part of an LPA-based diagnostic algorithm for patients with presumptive MDR-TB focusing on time to treatment initiation with time from first-care seeking visit to the initiation of MDR-TB treatment rather than diagnostic accuracy as the primary outcome, and to assess treatment outcomes. We hypothesized that the implementation of LPA would result in faster time to treatment initiation and better treatment outcomes. A culture-based diagnostic algorithm used prior to LPA implementation was compared to an LPA-based algorithm that replaced BacTAlert and Löwenstein Jensen (LJ) for drug sensitivity testing. A total of 295 MDR-TB patients were included in the study, 163 diagnosed with the culture-based algorithm, 132 with the LPA-based algorithm. Among smear positive patients, the implementation of the LPA-based algorithm was associated with a median decrease in time to MDR-TB treatment initiation of 50 and 66 days compared to the culture-based algorithm (BacTAlert and LJ respectively, ptime to MDR-TB treatment initiation of 78 days when compared to the culture-based algorithm (LJ, ptime to MDR diagnosis and earlier treatment initiation as well as better treatment outcomes for patients with MDR-TB. These findings also highlight the need for further improvements within the health system to reduce both patient and diagnostic delays to truly optimize the impact of new, rapid diagnostics.

Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

Directory of Open Access Journals (Sweden)

Tafsina Haque Aurin

Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

A pilot study of an mHealth application for healthcare workers: poor uptake despite high reported acceptability at a rural South African community-based MDR-TB treatment program.

Directory of Open Access Journals (Sweden)

Krisda H Chaiyachati

Full Text Available As the South African province of KwaZulu-Natal addresses a growing multidrug-resistant tuberculosis (MDR-TB epidemic by shifting care and treatment from trained specialty centers to community hospitals, delivering and monitoring MDR-TB therapy has presented new challenges. In particular, tracking and reporting adverse clinical events have been difficult for mobile healthcare workers (HCWs, trained health professionals who travel daily to patient homes to administer and monitor therapy. We designed and piloted a mobile phone application (Mobilize for mobile HCWs that electronically standardized the recording and tracking of MDR-TB patients on low-cost, functional phones.We assess the acceptability and feasibility of using Mobilize to record and submit adverse events forms weekly during the intensive phase of MDR-TB therapy and evaluate mobile HCW perceptions throughout the pilot period.All five mobile HCWs at one site were trained and provided with phones. Utilizing a mixed-methods evaluation, mobile HCWs' usage patterns were tracked electronically for seven months and analyzed. Qualitative focus groups and questionnaires were designed to understand the impact of mobile phone technology on the work environment.Mobile HCWs submitted nine of 33 (27% expected adverse events forms, conflicting with qualitative results in which mobile HCWs stated that Mobilize improved adverse events communication, helped their daily workflow, and could be successfully expanded to other health interventions. When presented with the conflict between their expressed views and actual practice, mobile HCWs cited forgetfulness and believed patients should take more responsibility for their own care.This pilot experience demonstrated poor uptake by HCWs despite positive responses to using mHealth. Though our results should be interpreted cautiously because of the small number of mobile HCWs and MDR-TB patients in this study, we recommend carefully exploring the motivations

A pilot study of an mHealth application for healthcare workers: poor uptake despite high reported acceptability at a rural South African community-based MDR-TB treatment program.

Science.gov (United States)

Chaiyachati, Krisda H; Loveday, Marian; Lorenz, Stephen; Lesh, Neal; Larkan, Lee-Megan; Cinti, Sandro; Friedland, Gerald H; Haberer, Jessica E

2013-01-01

As the South African province of KwaZulu-Natal addresses a growing multidrug-resistant tuberculosis (MDR-TB) epidemic by shifting care and treatment from trained specialty centers to community hospitals, delivering and monitoring MDR-TB therapy has presented new challenges. In particular, tracking and reporting adverse clinical events have been difficult for mobile healthcare workers (HCWs), trained health professionals who travel daily to patient homes to administer and monitor therapy. We designed and piloted a mobile phone application (Mobilize) for mobile HCWs that electronically standardized the recording and tracking of MDR-TB patients on low-cost, functional phones. We assess the acceptability and feasibility of using Mobilize to record and submit adverse events forms weekly during the intensive phase of MDR-TB therapy and evaluate mobile HCW perceptions throughout the pilot period. All five mobile HCWs at one site were trained and provided with phones. Utilizing a mixed-methods evaluation, mobile HCWs' usage patterns were tracked electronically for seven months and analyzed. Qualitative focus groups and questionnaires were designed to understand the impact of mobile phone technology on the work environment. Mobile HCWs submitted nine of 33 (27%) expected adverse events forms, conflicting with qualitative results in which mobile HCWs stated that Mobilize improved adverse events communication, helped their daily workflow, and could be successfully expanded to other health interventions. When presented with the conflict between their expressed views and actual practice, mobile HCWs cited forgetfulness and believed patients should take more responsibility for their own care. This pilot experience demonstrated poor uptake by HCWs despite positive responses to using mHealth. Though our results should be interpreted cautiously because of the small number of mobile HCWs and MDR-TB patients in this study, we recommend carefully exploring the motivations of HCWs and

Procurement and Supply Management System for MDR-TB in Nigeria: Are the Early Warning Targets for Drug Stock Outs and Over Stock of Drugs Being Achieved?

Science.gov (United States)

Jatau, Bolajoko; Avong, Yohanna; Ogundahunsi, Olumide; Shah, Safieh; Tayler Smith, Katherine; Van den Bergh, Rafael; Zachariah, Rony; van Griensven, Johan; Ekong, Ernest; Dakum, Patrick

2015-01-01

The World Health Organisation (WHO) introduced the twelve early warning indicators for monitoring and evaluating drug Procurement and Supply management (PSM) systems, intended to prevent drug stock-outs and overstocking. Nigeria--one of the high Multi Drug Resistant Tuberculosis (MDR-TB) burden countries, scaled-up treatment in 2012 with the concurrent implementation of a PSM system. We evaluated how well this system functioned using the WHO indicators, including all seven MDR-TB treatment centres in the country that were functional throughout 2013. The quantity of MDR-TB drugs ordered for 2013 matched the annual forecast and all central orders placed during the year were delivered in full and on time. Drug consumption was 81%-106% of the quantity allocated for routine consumption. Timely submission of complete inventory reports ranged from 86-100%, late submissions being 5-15 days late. Forty to 71% of treatment centres placed a drug order when stock was below the minimum level of three months. The proportion of drug orders received at the treatment centres in full and on time ranged from 29-80%, late orders being 1-19 days late. The PSM was found to be performing well in terms of forecasting and procurement of MDR-TB drugs, but there were shortcomings in drug distribution, reporting at treatment centre level and in drug order placements. Despite these gaps, there were no stock outs. These findings indicate that where it matters most, namely ensuring that no drug stock outs affect patient management, the PSM system is effective. Addressing the observed shortcomings will help to strengthen the existing PSM system in anticipation of a growing MDR-TB case burden in the country.

Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

Directory of Open Access Journals (Sweden)

Freddie Bwanga

Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB.

Science.gov (United States)

Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Abdo Arbex, Marcos; Alarcon Arrascue, Edith; Alffenaar, Jan Willem; Caminero, Jose A; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmín; Scardigli, Anna; Akkerman, Onno W; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marín, Félix Antonio; Collahuazo López, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

2016-06-01

No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug- and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution of imipenem/clavulanate versus meropenem/clavulanate added to background regimens to treat MDR- and XDR-TB cases.84 patients treated with imipenem/clavulanate-containing regimens showed a similar median number of antibiotic resistances (8 versus 8) but more fluoroquinolone resistance (79.0% versus 48.9%, pimipenem/clavulanate- and meropenem/clavulanate-containing regimens for a median (interquartile range) of 187 (60-428) versus 85 (49-156) days, respectively.Statistically significant differences were observed on sputum smear and culture conversion rates (79.7% versus 94.8%, p=0.02 and 71.9% versus 94.8%, pimipenem/clavulanate and meropenem/clavulanate were reported in 5.4% and 6.5% of cases only.Our study suggests that meropenem/clavulanate is more effective than imipenem/clavulanate in treating MDR/XDR-TB patients. Copyright ©ERS 2016.

Cycloserine Induced Late Onset Psychosis and Ethambutol Induced Peripheral Neuropathy Associated with MDR-TB Treatment in an Indian Patient- A Rare Case Report.

Science.gov (United States)

Holla, Sadhana; Amberkar, Mohan Babu; Bhandarypanambur, Rajeshkrishna; Kamalkishore, Meenakumari; Janardhanan, Manju

2015-02-01

Adverse reactions and toxicity inevitably accompany all treatment courses for drug-resistant TB. Our case underscores the importance of awareness regarding neuropsychiatric adverse reactions due to MDR-TB therapy and reversible nature of it. Cycloserine induced psychosis is most life threatening complication and sometimes could be fatal. A 42-year-old male on MDR-TB therapy got admitted for his persistent psychotic complaints like hallucinations, delusions and suicidal ideations, despite being treated with quetiapine/olanzapine. Eventually patient was rehabilitated, cycloserine was stopped and psychotic events regressed slowly. Other culprit drugs like ethambutol and levofloxacin causing psychosis was ruled out because there was no relapse of psychotic events despite being continued with these drugs. He also complained of tingling, numbness, swaying, pain and weakness. On examination, he had distal motor weakness in lower limbs, tandem gait positive, altered position sense, and tenderness over toes and positive Romberg's sign with ataxia. He was diagnosed to have drug induced sensorimotor peripheral neuropathy. All these symptoms persisted after stopping cycloserine and patient continued to have neuropathy with ethambutol and ethionamide. Considering the nature of neuropathy which was mild, mixed sensorimotor and resolved completely after 2-3 weeks of stopping, it was more in favour of ethambutol. However, we could not rule out the possibility of ethionamide or (ethionamide + ethambutol) causing neuropathy or both could have accelerated the neurotoxic effects of cycloserine which remained elusive.

Double Standards in Global Health: Medicine, Human Rights Law and Multidrug-Resistant TB Treatment Policy.

Science.gov (United States)

Nicholson, Thomas; Admay, Catherine; Shakow, Aaron; Keshavjee, Salmaan

2016-06-01

The human rights arguments that underpinned the fight against HIV over the last three decades were poised, but ultimately failed, to provide a similar foundation for success against multidrug-resistant TB (MDR-TB) and other diseases of the poor. With more than 1.5 million deaths since 2000 attributed to strains of MDR-TB, and with half a million new, and mostly untreated, MDR-TB cases in the world each year, the stakes could not be higher. The World Health Organization (WHO), whose mandate is to champion the attainment by all peoples of the highest possible level of health, recommended unsound medical treatment for MDR-TB patients in resource-poor settings from 1993-2002. Citing cost considerations, WHO did not recommend the available standard of care that had been successfully used to contain and defeat MDR-TB in rich countries. By acting as a strategic gatekeeper in its technical advisory role to donor agencies and countries, it also facilitated the global implementation of a double standard for TB care in low- and middle-income countries (LMICs), upending important legal and scientific priorities. This raises serious questions about whether the organization violated international human rights standards and those established in its own constitution. While calling for additional analysis and discussion on this topic, the authors propose that policymakers should reject double standards of this kind and instead embrace the challenge of implementing the highest standard of care on a global level.

Efficacy, safety and tolerability of linezolid containing regimens in treating MDR-TB and XDR-TB : systematic review and meta-analysis

NARCIS (Netherlands)

Sotgiu, Giovanni; Centis, Rosella; D'Ambrosio, Lia; Alffenaar, Jan-William C.; Anger, Holly A.; Caminero, Jose A.; Castiglia, Paolo; De Lorenzo, Saverio; Ferrara, Giovanni; Koh, Won-Jung; Schecter, Giesela F.; Shim, Tae S.; Singla, Rupak; Skrahina, Alena; Spanevello, Antonio; Udwadia, Zarir F.; Villar, Miquel; Zampogna, Elisabetta; Zellweger, Jean-Pierre; Zumla, Alimuddin; Migliori, Giovanni Battista

2012-01-01

Linezolid is used off-label to treat multidrug-resistant tuberculosis (MDR-TB) in absence of systematic evidence. We performed a systematic review and meta-analysis on efficacy, safety and tolerability of linezolid-containing regimes based on individual data analysis. 12 studies (11 countries from

Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB

NARCIS (Netherlands)

Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Arbex, Marcos Abdo; Arrascue, Edith Alarcon; Alffenaar, Jan Willem; Caminero, Jose A.; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmin; Scardigli, Anna; Akkerman, Onno W.; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marin, Felix Antonio; Collahuazo Lopez, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug-and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution

HIV, multidrug-resistant TB and depressive symptoms: when three conditions collide.

Science.gov (United States)

Das, Mrinalini; Isaakidis, Petros; Van den Bergh, Rafael; Kumar, Ajay M V; Nagaraja, Sharath Burugina; Valikayath, Asmaa; Jha, Santosh; Jadhav, Bindoo; Ladomirska, Joanna

2014-01-01

Management of multidrug-resistant TB (MDR-TB) patients co-infected with human immunodeficiency virus (HIV) is highly challenging. Such patients are subject to long and potentially toxic treatments and may develop a number of different psychiatric illnesses such as anxiety and depressive disorders. A mental health assessment before MDR-TB treatment initiation may assist in early diagnosis and better management of psychiatric illnesses in patients already having two stigmatising and debilitating diseases. To address limited evidence on the baseline psychiatric conditions of HIV-infected MDR-TB patients, we aimed to document the levels of depressive symptoms at baseline, and any alteration following individualized clinical and psychological support during MDR-TB therapy, using the Patient Health Questionnaire-9 (PHQ-9) tool, among HIV-infected patients. This was a retrospective review of the medical records of an adult (aged >15 years) HIV/MDR-TB cohort registered for care during the period of August 2012 through to March 2014. A total of 45 HIV/MDR-TB patients underwent baseline assessment using the PHQ-9 tool, and seven (16%) were found to have depressive symptoms. Of these, four patients had moderate to severe depressive symptoms. Individualized psychological and clinical support was administered to these patients. Reassessments were carried out for all patients after 3 months of follow-up, except one, who died during the period. Among these 44 patients, three with baseline depressive symptoms still had depressive symptoms. However, improvements were observed in all but one after 3 months of follow-up. Psychiatric illnesses, including depressive symptoms, during MDR-TB treatment demand attention. Routine administration of baseline mental health assessments by trained staff has the potential to assist in determining appropriate measures for the management of depressive symptoms during MDR-TB treatment, and help in improving overall treatment outcomes. We recommend

Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

Directory of Open Access Journals (Sweden)

Richa Kumari

Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

Directory of Open Access Journals (Sweden)

Raj N Yadav

Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

Major Challenges in Clinical Management of TB/HIV Coinfected Patients in Eastern Europe Compared with Western Europe and Latin America

DEFF Research Database (Denmark)

Efsen, Anne Marie W; Schultze, Anna; Post, Frank A

2015-01-01

OBJECTIVES: Rates of TB/HIV coinfection and multi-drug resistant (MDR)-TB are increasing in Eastern Europe (EE). We aimed to study clinical characteristics, factors associated with MDR-TB and predicted activity of empiric anti-TB treatment at time of TB diagnosis among TB/HIV coinfected patients......% of participants in EE compared with 90-96% in other regions (pmanagement of TB/HIV patients in EE requires...... better access to TB diagnostics including DSTs, empiric anti-TB therapy directed at both susceptible and MDR-TB, and more widespread use of cART....

Impact of diabetes on treatment outcomes and long-term survival in multidrug-resistant tuberculosis.

Science.gov (United States)

Kang, Young Ae; Kim, Song Yee; Jo, Kyung-Wook; Kim, Hee Jin; Park, Seung-Kyu; Kim, Tae-Hyung; Kim, Eun Kyung; Lee, Ki Man; Lee, Sung Soon; Park, Jae Seuk; Koh, Won-Jung; Kim, Dae Yun; Shim, Tae Sun

2013-01-01

Few studies have investigated the impact of diabetes mellitus (DM), a globally increasing metabolic disease, on treatment outcomes and long-term survival in patients with multidrug-resistant forms of tuberculosis (MDR-TB). We analyzed outcomes in a large cohort to assess the impact of DM on treatment outcomes of patients with MDR-TB. MDR-TB patients newly diagnosed or retreated between 2000 and 2002 and followed for 8-11 years were retrospectively analyzed with respect to the effect of DM as a comorbidity on their treatment outcome and long-term survival. Of 1,407 patients with MDR-TB, 239 (17.0%) had coexisting DM. The mean age and body mass index were higher in MDR-TB patients with DM [MDR-TBDM(+)] than in those without DM [MDR-TBDM(-)]. Patients with MDR-TB and a comorbidity of DM had a significantly lower treatment success rate than those without a history of DM (36.0 vs. 47.2%, p = 0.002). In addition, DM was the negative predictor for MDR-TB treatment success in multivariate analyses [odds ratio 0.51, 95% confidence interval (CI) 0.26-0.99]. Mean survival times were also lower in MDR-TBDM(+) than in MDR-TBDM(-) patients (102 vs. 114 months, p = 0.001), with DM as a significant predictor of poor long-term survival in multivariate analyses (hazard ratio 1.59, 95% CI 1.01-2.50). Among MDR-TB patients, DM was a relatively common comorbidity. In patients undergoing treatment for MDR-TB and followed for 8-11 years, it was found to be independently associated with an increased risk of both treatment failure and death. Copyright © 2013 S. Karger AG, Basel.

Treatment: Latent TB Infection (LTBI) and TB Disease

Science.gov (United States)

... Adverse Events TB Treatment of Persons Living with HIV TB Treatment and Pregnancy TB Treatment for Children Drug-Resistant TB Research TB Epidemiologic Studies Consortium Research Projects Publications TB Trials Consortium Study ...

Proteins purified from Mycobacterium tuberculosis MDR and Susceptible clinical isolates: Identification by proteomics approach

Directory of Open Access Journals (Sweden)

A R. Hadizadeh Tasbiti

2015-01-01

Conclusion: Such information could be helpful for the development of newer therapeutic agents or of diagnostic markers for better treatment or diagnosis of TB. This study extends the list of the potential determinants of differences in virulence between the two isolates (MDR and susceptible TB and adds to the current understanding of MTB pathogenesis.

Time to initiation of multidrug-resistant tuberculosis treatment and its relation with outcome in a high incidence district in Lima, Peru.

Science.gov (United States)

Otero, L; De Orbegoso, A; Navarro, A F; Ríos, J; Párraga, T; Gotuzzo, E; Seas, C; Van der Stuyft, P

2015-03-01

To determine the time from diagnosis to start of multidrug resistant tuberculosis (MDR TB) treatment in Lima, Peru. We studied new smear-positive TB adults that were started on MDR TB treatment or that were switched to it between June 2008 and December 2011. Time from the first positive smear to MDR-TB treatment was >30 days in 35% (13/37) of patients. Among the 27% (24/88) of patients that switched to MDR-TB treatment, time from the last dose of a drug-susceptible regimen was >30 days. Start of and switching to MDR TB treatment is still delayed. © 2014 John Wiley & Sons Ltd.

Culture and Next-generation sequencing-based drug susceptibility testing unveil high levels of drug-resistant-TB in Djibouti: results from the first national survey.

Science.gov (United States)

Tagliani, Elisa; Hassan, Mohamed Osman; Waberi, Yacine; De Filippo, Maria Rosaria; Falzon, Dennis; Dean, Anna; Zignol, Matteo; Supply, Philip; Abdoulkader, Mohamed Ali; Hassangue, Hawa; Cirillo, Daniela Maria

2017-12-15

Djibouti is a small country in the Horn of Africa with a high TB incidence (378/100,000 in 2015). Multidrug-resistant TB (MDR-TB) and resistance to second-line agents have been previously identified in the country but the extent of the problem has yet to be quantified. A national survey was conducted to estimate the proportion of MDR-TB among a representative sample of TB patients. Sputum was tested using XpertMTB/RIF and samples positive for MTB and resistant to rifampicin underwent first line phenotypic susceptibility testing. The TB supranational reference laboratory in Milan, Italy, undertook external quality assurance, genotypic testing based on whole genome and targeted-deep sequencing and phylogenetic studies. 301 new and 66 previously treated TB cases were enrolled. MDR-TB was detected in 34 patients: 4.7% of new and 31% of previously treated cases. Resistance to pyrazinamide, aminoglycosides and capreomycin was detected in 68%, 18% and 29% of MDR-TB strains respectively, while resistance to fluoroquinolones was not detected. Cluster analysis identified transmission of MDR-TB as a critical factor fostering drug resistance in the country. Levels of MDR-TB in Djibouti are among the highest on the African continent. High prevalence of resistance to pyrazinamide and second-line injectable agents have important implications for treatment regimens.

Ambulatory Multi-Drug Resistant Tuberculosis Treatment Outcomes in a Cohort of HIV-Infected Patients in a Slum Setting in Mumbai, India

Science.gov (United States)

Isaakidis, Petros; Cox, Helen S.; Varghese, Bhanumati; Montaldo, Chiara; Da Silva, Esdras; Mansoor, Homa; Ladomirska, Joanna; Sotgiu, Giovanni; Migliori, Giovanni B.; Pontali, Emanuele; Saranchuk, Peter; Rodrigues, Camilla; Reid, Tony

2011-01-01

Background India carries one quarter of the global burden of multi-drug resistant TB (MDR-TB) and has an estimated 2.5 million people living with HIV. Despite this reality, provision of treatment for MDR-TB is extremely limited, particularly for HIV-infected individuals. Médecins Sans Frontières (MSF) has been treating HIV-infected MDR-TB patients in Mumbai since May 2007. This is the first report of treatment outcomes among HIV-infected MDR-TB patients in India. Methods HIV-infected patients with suspected MDR-TB were referred to the MSF-clinic by public Antiretroviral Therapy (ART) Centers or by a network of community non-governmental organizations. Patients were initiated on either empiric or individualized second-line TB-treatment as per WHO recommendations. MDR-TB treatment was given on an ambulatory basis and under directly observed therapy using a decentralized network of providers. Patients not already receiving ART were started on treatment within two months of initiating MDR-TB treatment. Results Between May 2007 and May 2011, 71 HIV-infected patients were suspected to have MDR-TB, and 58 were initiated on treatment. MDR-TB was confirmed in 45 (78%), of which 18 (40%) were resistant to ofloxacin. Final treatment outcomes were available for 23 patients; 11 (48%) were successfully treated, 4 (17%) died, 6 (26%) defaulted, and 2 (9%) failed treatment. Overall, among 58 patients on treatment, 13 (22%) were successfully treated, 13 (22%) died, 7 (12%) defaulted, two (3%) failed treatment, and 23 (40%) were alive and still on treatment at the end of the observation period. Twenty-six patients (45%) experienced moderate to severe adverse events, requiring modification of the regimen in 12 (20%). Overall, 20 (28%) of the 71 patients with MDR-TB died, including 7 not initiated on treatment. Conclusions Despite high fluoroquinolone resistance and extensive prior second-line treatment, encouraging results are being achieved in an ambulatory MDR-T- program in a

Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

Science.gov (United States)

Agyeman, Akosua Adom; Ofori-Asenso, Richard

2016-06-22

Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

Potential antimicrobial agents for the treatment of multidrug-resistant tuberculosis

NARCIS (Netherlands)

Alsaad, Noor; Wilffert, Bob; van Altena, Richard; de Lange, Wiel C. M.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.

2014-01-01

Treatment of multidrug-resistant (MDR) tuberculosis (TB) is challenging because of the high toxicity of second-line drugs and the longer treatment duration than for drug-susceptible TB patients. In order to speed up novel treatment for MDR-TB, we suggest considering expanding the indications of

Outcomes of multidrug-resistant tuberculosis treatment with early initiation of antiretroviral therapy for HIV co-infected patients in Lesotho.

Directory of Open Access Journals (Sweden)

Hind Satti

Full Text Available BACKGROUND: Although the importance of concurrent treatment for multidrug-resistant tuberculosis (MDR-TB and HIV co-infection has been increasingly recognized, there have been few studies reporting outcomes of MDR-TB and HIV co-treatment. We report final outcomes of comprehensive, integrated MDR-TB and HIV treatment in Lesotho and examine factors associated with death or treatment failure. METHODS: We reviewed clinical charts of all adult patients who initiated MDR-TB treatment in Lesotho between January 2008 and September 2009. We calculated hazard ratios (HR and used multivariable Cox proportional hazards regression to identify predictors of poor outcomes. RESULTS: Of 134 confirmed MDR-TB patients, 83 (62% were cured or completed treatment, 46 (34% died, 3 (2% transferred, 1 (1% defaulted, and 1 (1% failed treatment. Treatment outcomes did not differ significantly by HIV status. Among the 94 (70% patients with HIV co-infection, 53% were already on antiretroviral therapy (ART before MDR-TB treatment initiation, and 43% started ART a median of 16 days after the start of the MDR-TB regimen. Among HIV co-infected patients who died, those who had not started ART before MDR-TB treatment had a shorter median time to death (80 days vs. 138 days, p=0.065. In multivariable analysis, predictors of increased hazard of failure or death were low and severely low body mass index (HR 2.75, 95% confidence interval [CI] 1.27-5.93; HR 5.50, 95% CI 2.38-12.69, and a history of working in South Africa (HR 2.37, 95% CI 1.24-4.52. CONCLUSIONS: Favorable outcomes can be achieved in co-infected patients using a community-based treatment model when both MDR-TB and HIV disease are treated concurrently and treatment is initiated promptly.

Definition of drug resistance of Mycobacterium tuberculosis to antituberculosis drugs in patients with multidrugresistant tuberculosis and TB with extremely drug resistant depending on the case of the disease

Directory of Open Access Journals (Sweden)

Kryzhanovsky D.G.

2014-11-01

Full Text Available There was studied the profile of drug resistance to the main (I line and reserve (II line antituberculosis drugs in patients with MDR and XDR tuberculosis, depending of the case of the disease. According to the randomized retrospective research 200 patients with MDR and XDR tuberculosis, who received treatment in the clinic of hospital Municipal institution «Dnipropetrovsk rigional clinical association «Phthisiology» Dnipropetrovsk regional Council» during the period 2010 – 2012 were involved. Data about patients contained the data on a case of the disease and the results of the test of drug sensitivity to MBT. XDR – TB was revealed in 7.5% of patients with MDR tuberculosis. In patients with MDR tuberculosis as compared with patients with XDR tuberculosis «new cases» were diagnosed in 19.5% against 18.5% (p <0.05. In patients with MDR tuberculosis and with XDR tuberculosis resistance to the antituberculosis drug more commonly developed to S - 88.5%, E - 55% and Z - 24%. The presence of MDR-TB and XDR-TB prevails in patients, who underwent previous courses of treatment with anti-TB drugs in case history as compared with patients with «new cases» of treatment. The development of resistance to anti-TB drugs depends on the availability of these drugs in the previous treatment regimens.

Team approach to manage difficult-to-treat TB cases: Experiences in Europe and beyond

Directory of Open Access Journals (Sweden)

L. D’Ambrosio

2018-03-01

Full Text Available As recommended by the World Health Organization (WHO, optimal management of MDR-TB cases can be ensured by a multi-speciality consultation body known as ‘TB Consilium’. This body usually includes different medical specialities, competences and perspectives (e.g., clinical expertise both for adults and children; surgical, radiological and public health expertise; psychological background and nursing experience, among others, thus lowering the risk of making mistakes – or managing the patients inappropriately, in order to improve their clinical outcomes.At present, several high MDR-TB burden countries in the different WHO regions (and beyond have introduced TB Consilium-like bodies at the national or subnational level to reach consensus on the best treatment approach for their patients affected by TB.In addition, in countries/settings where a formal system of consultation does not exist, specialized staff from MDR-TB reference centres or international organizations usually spend a considerable amount of their working time responding to phone or e-mail clinical queries on how to manage M/XDR-TB cases.The aim of this manuscript is to describe the different experiences with the TB Consilia both at the international level (European Respiratory Society – ERS/WHO TB Consilium and in some of the countries where this experience operates successfully in Europe and beyond. The Consilium experiences are described around the following topics: (1 history, aims and focus; (2 management and funding; (3 technical functioning and structure; (4 results achieved.In addition a comparative analysis of the TB Consilia in the different countries has been performed. Keywords: MDR-TB, XDR-TB, Clinical management, Drug resistance, Prevention, Consilium

Concordance of programmatic and laboratory-based multidrug-resistant tuberculosis treatment outcomes in Peru.

Science.gov (United States)

Alexy, E R; Podewils, L J; Mitnick, C D; Becerra, M C; Laserson, K F; Bonilla, C

2012-01-01

Confirmation of cure for multidrug-resistant tuberculosis (MDR-TB) patients requires laboratory tests for Mycobacterium tuberculosis growth on culture media. Outcome decisions dictate patient management, and inaccuracies place patients at an increased risk of morbidity and mortality, and may contribute to continued transmission of MDR-TB. To examine concordance between programmatic and laboratory-based MDR-TB treatment outcomes. The study population included 1658 MDR-TB patients in Peru treated between 1996 and 2002 with both program and laboratory-based outcomes. Laboratory-based outcomes were assigned according to international standards requiring at least five consecutive negative cultures in the last 12 months of treatment to confirm cure. Compared to the global culture-defined standard classification, only 1.1% of treatment successes, but 54.3% of failures, were misclassified programmatically. Overall, 10.4% of patients identified by a clinician as having a successful treatment outcome still had cultures positive for MDR-TB. Most patients with successful treatment outcomes by strict culture definitions were also classified by clinicians as having successful outcomes. However, many culture-confirmed failures were missed. In light of delays and incomplete access to culture in MDR-TB programs, efforts should be made to improve the accuracy of programmatically determined treatment outcomes.

The relationship between social support, treatment interruption and treatment outcome in patients with multidrug-resistant tuberculosis in China: a mixed-methods study.

Science.gov (United States)

Yin, Jia; Wang, Xiaomeng; Zhou, Lin; Wei, Xiaolin

2018-04-24

Multidrug-resistant tuberculosis (MDR-TB) has been a major threat for successful TB control. We examined the relationship between social support and treatment outcomes in MDR-TB patients and evaluated barriers to social support. Retrospective cohort study with MDR-TB patients enrolled in the Global Fund program between 1 January 2009 and 30 June 2014 in Zhejiang, China. We reviewed all MDR-TB patients' diagnoses and treatment outcomes. In-depth interviews were conducted with 10 community health workers and 10 patients. Pathway analysis was employed to examine the association between social support and treatment outcomes, and the mediating effect of medication adherence on their relationship. Of 218 participants, 144 (66%) were successfully treated and 59 (27%) had poor treatment adherence. Directly observed therapy (DOT) had an indirect positive effect on treatment success, mediating through medication adherence (β.=0.541, p=0.008; β =0.538, p<0.001). Financial support had both a direct (β.=0.769, p<0.001) and an indirect positive effect on treatment success, which was mediated by a self-reported social support scale (β.=0.541, p=0.008; β =0.538, p<0.001). The interviews indicated poor performance of DOT. Patients often suffered from substantial stigma, but were not provided with psychological support. DOT and financial support were effective strategies for improving successful treatment outcomes in MDR-TB patients, but they were delivered not considering patients' perspectives. There is an urgent need for consistent and specific psychological support for MDR-TB patients in their communities. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

Directory of Open Access Journals (Sweden)

U D Gupta

2015-01-01

Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

Community-based management versus traditional hospitalization in treatment of drug-resistant tuberculosis: a systematic review and meta-analysis.

Science.gov (United States)

Williams, Abimbola Onigbanjo; Makinde, Olusesan Ayodeji; Ojo, Mojisola

2016-01-01

Multidrug drug resistant Tuberculosis (MDR-TB) and extensively drug resistant Tuberculosis (XDR-TB) have emerged as significant public health threats worldwide. This systematic review and meta-analysis aimed to investigate the effects of community-based treatment to traditional hospitalization in improving treatment success rates among MDR-TB and XDR-TB patients in the 27 MDR-TB High burden countries (HBC). We searched PubMed, Cochrane, Lancet, Web of Science, International Journal of Tuberculosis and Lung Disease, and Centre for Reviews and Dissemination (CRD) for studies on community-based treatment and traditional hospitalization and MDR-TB and XDR-TB from the 27 MDR-TB HBC. Data on treatment success and failure rates were extracted from retrospective and prospective cohort studies, and a case control study. Sensitivity analysis, subgroup analyses, and meta-regression analysis were used to explore bias and potential sources of heterogeneity. The final sample included 16 studies involving 3344 patients from nine countries; Bangladesh, China, Ethiopia, Kenya, India, South Africa, Philippines, Russia, and Uzbekistan. Based on a random-effects model, we observed a higher treatment success rate in community-based treatment (Point estimate = 0.68, 95 % CI: 0.59 to 0.76, p   18 months, and regimen with drugs >5 reported higher treatment success rate. In the meta-regression model, age of patients, adverse events, treatment duration, and lost to follow up explains some of the heterogeneity of treatment effects between studies. Community-based management improved treatment outcomes. A mix of interventions with DOTS-Plus throughout therapy and treatment duration > 18 months as well as strategies in place for lost to follow up and adverse events should be considered in MDR-TB and XDR-TB interventions, as they influenced positively, treatment success.

Risk factors and timing of default from treatment for non-multidrug-resistant tuberculosis in Moldova.

Science.gov (United States)

Jenkins, H E; Ciobanu, A; Plesca, V; Crudu, V; Galusca, I; Soltan, V; Cohen, T

2013-03-01

The Republic of Moldova, in Eastern Europe, has among the highest reported nationwide proportions of tuberculosis (TB) patients with multidrug-resistant tuberculosis (MDR-TB) worldwide. Default has been associated with increased mortality and amplification of drug resistance, and may contribute to the high MDR-TB rates in Moldova. To assess risk factors and timing of default from treatment for non-MDR-TB from 2007 to 2010. A retrospective analysis of routine surveillance data on all non-MDR-TB patients reported. A total of 14.7% of non-MDR-TB patients defaulted from treatment during the study period. Independent risk factors for default included sociodemographic factors, such as homelessness, living alone, less formal education and spending substantial time outside Moldova in the year prior to diagnosis; and health-related factors such as human immunodeficiency virus co-infection, greater lung pathology and increasing TB drug resistance. Anti-tuberculosis treatment is usually initiated within an institutional setting in Moldova, and the default risk was highest in the month following the phase of hospitalized treatment (among civilians) and after leaving prison (among those diagnosed while incarcerated). Targeted interventions to increase treatment adherence for patients at highest risk of default, and improving the continuity of care for patients transitioning from institutional to community care may substantially reduce risk of default.

[Reflection on Medical Treatment of Multi-drug Resistance Tuberculosis: The Necessity of Chinese Medicine Holistic View].

Science.gov (United States)

Zhang, Lei-lei; Jin, Hua

2015-12-01

Causative factors of multi-drug resistance tuberculosis (MDR-TB) were analyzed from iatrogenic angles, patients themselves, and society. Reviewed was the development of treatment strategies for MDR-TB from directly observed treatment short-course (DOTS) to DOTS-Plus. The history of Chinese medicine (CM) fighting TB and characteristics at the present stage were also analyzed. Authors pointed out that CM pays attention not only to killing pathogens and confirms the necessity of getting rid of pathogens, but also to cascade response caused by pathogens. It also regards the occurrence and development of MDR-TB as a whole by combining patients' conditions, climatic, geographic, psychological, and social factors. Authors believed that therapeutic principles under guidance of CM holistic view are of positive significance and inspiration in treating MDR-TB, and emphasized holistic view as basic strategies for treating MDR-TB, but not a single countermeasure.

Individualized treatment of multidrug-resistant tuberculosis using therapeutic drug monitoring

Directory of Open Access Journals (Sweden)

Mathieu S Bolhuis

2016-01-01

Conclusion: TDM is highly valuable to individualize and optimize treatment of complex MDR-TB patients. TDM is routinely applied in Tuberculosis Center Beatrixoord, and high success rates for treatment of MDR-TB patients have been achieved. DBS and LSS make implementation of TDM feasible, even in low- and middle-income countries.

Impact of drug resistance on the tuberculosis treatment outcome

Directory of Open Access Journals (Sweden)

E. Lesnic

2017-03-01

Full Text Available Background. The standard treatment of a new case of multidrug-resistant tuberculosis (MDR-TB according to WHO recommendations in the Republic of Moldova is performed since 2005 showing a low treatment succes. Actually the treatment success rate increased due to excluding of MDR-TB patients from the general cohort. The major rate of patients with low outcome is represented by the failed and lost to follow-up cases. The purpose of the study was to assess the impact of multidrug-resiatnce and MDR-TB on the tuberculosis treatment outcome. Materials and methods. A retrospective selective, descriptive study targeting social, demographic, economic and epidemiological peculiarities, case-management, diagnostic radiological aspects and microbiological characteristics of 187 patients with pulmonary tuberculosis registered during 2013–2015 distributed in two groups: 1st group (61 patients with established multidrug-resistant strains using conventional cultural methods and the 2nd group (126 patients with MDR-TB. Results. Multidrug-resistance was established more frequently in new cases and MDR-TB in two thirds of retreated patients. No difference was identified in gender and age distribution, social, economical, educational characteristics; case-management assessment identified a similar proportion of patients revealed by general practitioners and specialists, with low rate of screened high risk groups. All patients from the multidrug-resistant group began the standard treatment for drug-responsiveness tuberculosis before drug susceptibility testing and one third of MDR-TB group was treated from the onset with the DOTS-Plus regimen. Highest success rate was identified in the new-case subgroups of both groups and higher rate of died patients was determined in the retreated subgroups. Such a low rate of patients aggrevates the resistance. Conclusions. Early diagnosis, drug responsiveness testing and raising awareness among about treatment compliance will

Diagnosis and interim treatment outcomes from the first cohort of multidrug-resistant tuberculosis patients in Tanzania.

Directory of Open Access Journals (Sweden)

Stellah G Mpagama

Full Text Available Kibong'oto National Tuberculosis Hospital (KNTH, Kilimanjaro, Tanzania.Characterize the diagnostic process and interim treatment outcomes from patients treated for multidrug-resistant tuberculosis (MDR-TB in Tanzania.A retrospective cohort study was performed among all patients treated at KNTH for pulmonary MDR-TB between November 2009 and September 2011.Sixty-one culture-positive MDR-TB patients initiated therapy, 60 (98% with a prior history of TB treatment. Forty-one (67% were male and 9 (14% were HIV infected with a mean CD4 count of 424 (±106 cells/µl. The median time from specimen collection to MDR-TB diagnosis and from diagnosis to initiation of MDR-TB treatment was 138 days (IQR 101-159 and 131 days (IQR 32-233, respectively. Following treatment initiation four (7% patients died (all HIV negative, 3 (5% defaulted, and the remaining 54 (89% completed the intensive phase. Most adverse drug reactions were mild to moderate and did not require discontinuation of treatment. Median time to culture conversion was 2 months (IQR 1-3 and did not vary by HIV status. In 28 isolates available for additional second-line drug susceptibility testing, fluoroquinolone, aminoglycoside and para-aminosalicylic acid resistance was rare yet ethionamide resistance was present in 9 (32%.The majority of MDR-TB patients from this cohort had survived a prolonged referral process, had multiple episodes of prior TB treatment, but did not have advanced AIDS and converted to culture negative early while completing an intensive inpatient regimen without serious adverse event. Further study is required to determine the clinical impact of second-line drug susceptibility testing and the feasibility of alternatives to prolonged hospitalization.

Is Chemoprophylaxis for Child Contacts of Drug-Resistant TB Patients Beneficial? A Systematic Review

Directory of Open Access Journals (Sweden)

C. Padmapriyadarsini

2018-01-01

Full Text Available Background. Preventive therapy for child contacts of multidrug-resistant tuberculosis (MDR-TB patients is poorly studied, and no consensus about the role and the rationale of chemoprophylaxis has been reached. Objective. To conduct systematic review with an aim to determine the effectiveness of TB preventive therapy in reducing the incidence of TB disease in pediatric contacts of MDR-TB patients. Methods. We conducted a literature search for randomized control trials, cohort studies, and case reports of chemoprophylaxis for pediatric contacts of MDR-TB patients in PubMed, EMBASE, Cochrane Databases of Systematic Reviews, metaRegister of Controlled Trials, and other clinical registries through March 2017, using appropriate search strategy. In addition we searched abstracts from international conferences and references of published articles and reviews. Results. Of the 153 references assessed from various databases, seven studies were identified as relevant after adaption of eligibility criteria and assessed for systematic review. Of these, only two studies contributed data for the pooled meta-analysis. Conclusions. Though the available evidences suggest that the chemoprophylaxis for child contacts of MDR-TB patients is beneficial, data to support or reject preventive therapy is very limited. Further clinical research, in Tb endemic settings like India, needs to be performed to prove the beneficial effect of chemoprophylaxis for pediatric contacts of MDR-TB.

Implementing the global plan to stop TB, 2011-2015--optimizing allocations and the Global Fund's contribution: a scenario projections study.

Directory of Open Access Journals (Sweden)

Eline L Korenromp

Full Text Available BACKGROUND: The Global Plan to Stop TB estimates funding required in low- and middle-income countries to achieve TB control targets set by the Stop TB Partnership within the context of the Millennium Development Goals. We estimate the contribution and impact of Global Fund investments under various scenarios of allocations across interventions and regions. METHODOLOGY/PRINCIPAL FINDINGS: Using Global Plan assumptions on expected cases and mortality, we estimate treatment costs and mortality impact for diagnosis and treatment for drug-sensitive and multidrug-resistant TB (MDR-TB, including antiretroviral treatment (ART during DOTS for HIV-co-infected patients, for four country groups, overall and for the Global Fund investments. In 2015, China and India account for 24% of funding need, Eastern Europe and Central Asia (EECA for 33%, sub-Saharan Africa (SSA for 20%, and other low- and middle-income countries for 24%. Scale-up of MDR-TB treatment, especially in EECA, drives an increasing global TB funding need--an essential investment to contain the mortality burden associated with MDR-TB and future disease costs. Funding needs rise fastest in SSA, reflecting increasing coverage need of improved TB/HIV management, which saves most lives per dollar spent in the short term. The Global Fund is expected to finance 8-12% of Global Plan implementation costs annually. Lives saved through Global Fund TB support within the available funding envelope could increase 37% if allocations shifted from current regional demand patterns to a prioritized scale-up of improved TB/HIV treatment and secondly DOTS, both mainly in Africa--with EECA region, which has disproportionately high per-patient costs, funded from alternative resources. CONCLUSIONS/SIGNIFICANCE: These findings, alongside country funding gaps, domestic funding and implementation capacity and equity considerations, should inform strategies and policies for international donors, national governments and

Molecular epidemiology of TB – Its impact on multidrug-resistant tuberculosis control in China☆

Directory of Open Access Journals (Sweden)

Biao Xu

2015-01-01

Results: In total, 238 bacteriologic confirmed pulmonary TB patients from DQ and 393 from GY diagnosed between 2008 and 2011 were recruited in the study. Of the 631 isolates, 220 (34.9% were resistant to at least one anti-TB drug, including 95 (15.1% simultaneously resistant to isoniazid and rifampicin or MDR, albeit with the similar distribution between DQ and GY (32/238 vs. 63/393; p, 0.378. The MIRU-VNTR genotyping revealed 35 isolates from DQ and 86 from GY exhibited 15 and 32 clustering patterns with four patterns shared between two counties. Compared with GY county, DQ had a significantly lower clustering proportion in MTB isolates susceptible to first-line drugs (25/167 vs. 46/198; p, 0.047 and total drug resistant TB isolates (12/71 vs. 44/149; p, 0.044, but a similar clustering proportion in MDR-TB isolates (8/32 vs. 18/63; p, 0.712. A significant higher clustering proportion was observed in the previously treated patients in both counties, but in the sputum smear-positive patients with cavitaries only in GY. Comparing the previously treated patients between the two counties, the proportion of MDR-TB and clustering proportion exhibited a similar distribution, while the average age of previously treated patients in DQ is significantly older than that in GY. Conclusions: A lower proportion of recent transmissions was observed in the county with long-term DOTS implementation. However, DOTS itself might not have worked enough on blocking the recent transmission of MDR-TB. This observation suggests the urgent needs of implementing the Stop-TB strategies; in particular, accelerating the use of rapid molecularbasedTBdiagnosisand drug susceptibility testing, providing active case findings in a high risk population of MDR-TB and enhancing infection control in high MDR-TB burden countries.

Intensive-phase treatment outcomes among hospitalized multidrug-resistant tuberculosis patients: results from a nationwide cohort in Nigeria.

Directory of Open Access Journals (Sweden)

Olanrewaju Oladimeji

Full Text Available BACKGROUND: Nigeria is faced with a high burden of Human Immunodeficiency Virus (HIV infection and multidrug-resistant tuberculosis (MDR-TB. Treatment outcomes among MDR-TB patients registered across the globe have been poor, partly due to high loss-to-follow-up. To address this challenge, MDR-TB patients in Nigeria are hospitalized during the intensive-phase(IP of treatment (first 6-8 months and are provided with a package of care including standardized MDR-TB treatment regimen, antiretroviral therapy (ART and cotrimoxazole prophylaxis (CPT for HIV-infected patients, nutritional and psychosocial support. In this study, we report the end-IP treatment outcomes among them. METHODS: In this retrospective cohort study, we reviewed the patient records of all bacteriologically-confirmed MDR-TB patients admitted for treatment between July 2010 and October 2012. RESULTS: Of 162 patients, 105(65% were male, median age was 34 years and 28(17% were HIV-infected; all 28 received ART and CPT. Overall, 138(85% were alive and culture negative at the end of IP, 24(15% died and there was no loss-to-follow-up. Mortality was related to low CD4-counts at baseline among HIV-positive patients. The median increase in body mass index among those documented to be underweight was 2.6 kg/m2 (p<0.01 and CD4-counts improved by a median of 52 cells/microL among the HIV-infected patients (p<0.01. CONCLUSIONS: End-IP treatment outcomes were exceptional compared to previously published data from international cohorts, thus confirming the usefulness of a hospitalized model of care. However, less than five percent of all estimated 3600 MDR-TB patients in Nigeria were initiated on treatment during the study period. Given the expected scale-up of MDR-TB care, the hospitalized model is challenging to sustain and the national TB programme is contemplating to move to ambulatory care. Hence, we recommend using both ambulatory and hospitalized approaches, with the latter being reserved

Treatment outcomes of rifabutin-containing regimens for rifabutin-sensitive multidrug-resistant pulmonary tuberculosis

Directory of Open Access Journals (Sweden)

Hyun Lee

2017-12-01

Full Text Available Objectives: The aim of this study was to evaluate whether rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Methods: A retrospective cohort study was performed on 76 patients with rifabutin-sensitive MDR-TB who were treated with or without rifabutin between 2006 and 2011. Results: Overall, 75% (57/76 of patients achieved favorable outcomes, including cure (53/76, 70% and treatment completion (4/76, 5%. In contrast, 25% (19/76 had unfavorable treatment outcomes, which included treatment failure (6/76, 8%, death (2/76, 3%, loss to follow-up (4/76. 5%, and no evaluation due to transfer to other institutions (7/76, 9%. Rifabutin was given to 52 (68% of the 76 patients with rifabutin-sensitive MDR-TB. Although favorable treatment outcomes were more frequent in patients who received rifabutin [81% (42/52] than in those who did not receive rifabutin [63% (15/24], this difference was not statistically significant (P = 0.154. However, in multivariable regression logistic analysis, use of rifabutin was significantly associated with favorable treatment outcomes in patients with rifabutin-sensitive MDR-TB (adjusted odds ratio = 9.80, 95% confidence interval = 1.65–58.37, P = 0.012. Conclusions: These results suggest that the use of rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Keywords: Multidrug-resistant tuberculosis, Extensively drug-resistant tuberculosis, Rifabutin, Treatment outcome

World Health Organization treatment guidelines for drug-resistant tuberculosis, 2016 update.

Science.gov (United States)

Falzon, Dennis; Schünemann, Holger J; Harausz, Elizabeth; González-Angulo, Licé; Lienhardt, Christian; Jaramillo, Ernesto; Weyer, Karin

2017-03-01

Antimicrobial resistance is a major global concern. Tuberculosis (TB) strains resistant to rifampicin and other TB medicines challenge patient survival and public health. The World Health Organization (WHO) has published treatment guidelines for drug-resistant TB since 1997 and last updated them in 2016 based on reviews of aggregated and individual patient data from published and unpublished studies. An international expert panel formulated recommendations following the GRADE approach. The new WHO guidelines recommend a standardised 9-12 months shorter treatment regimen as first choice in patients with multidrug- or rifampicin-resistant TB (MDR/RR-TB) strains not resistant to fluoroquinolones or second-line injectable agents; resistance to these two classes of core second-line medicines is rapidly detectable with molecular diagnostics also approved by WHO in 2016. The composition of longer regimens for patients ineligible for the shorter regimen was modified. A first-ever meta-analysis of individual paediatric patient data allowed treatment recommendations for childhood MDR/RR-TB to be made. Delamanid is now also recommended in patients aged 6-17 years. Partial lung resection is a recommended option in MDR/RR-TB care. The 2016 revision highlighted the continued shortage of high-quality evidence and implementation research, and reiterated the need for clinical trials and best-practice studies to improve MDR/RR-TB patient treatment outcomes and strengthen policy. The content of this work is copyright of the authors or their employers. Design and branding are copyright ©ERS 2017.

Epidemia de tuberculosis multidrogo resistente y extensivamente resistente a drogas (TB MDR/XDR en el Perú: situación y propuestas para su control

Directory of Open Access Journals (Sweden)

Hernán Del Castillo

2009-07-01

Full Text Available En este artículo se describe el estado actual de las epidemias de tuberculosis multidrogo resitente (TB MDR y tuberculosis extensivamente resistente a drogas (TB XDR en el Perú. Se realiza un análisis de nuestra situación con respecto al resto de Latinoamérica, y de la distribución temporo espacial de los casos de TB XDR en Lima. También presentamos nuestra reflexión de lo que está pasando y debe cambiar; lo que se resume en darle la importancia debida a un problema que nos está rebasando y anteponer a nuestros propios intereses, los intereses de la humanidad; por consiguiente no podemos callar, y debemos declarar a la tuberculosis como emergencia sanitaria nacional. Eso constituye una respuesta, esperamos, aún viable para el Perú.

The association between ARV and TB drug resistance on TB treatment outcome among Kazakh TB/HIV patients.

Science.gov (United States)

Mishkin, Kathryn; Alaei, Kamiar; Alikeyeva, Elmira; Paynter, Christopher; Aringazina, Altyn; Alaei, Arash

2018-02-26

TB drug resistance poses a serious threat to the public health of Kazakhstan. This paper presents findings related to TB treatment outcome and drug resistant status among people coinfected with HIV and TB in Kazakhstan. Cohort study using data were provided by the Kazakhstan Ministry of Health's National Tuberculosis Program for 2014 and 2015. Chi-square and logistical regression were performed to understand factors associated with drug resistant TB status and TB treatment outcome. In bivariate analysis, drug resistant status was significantly associated with year of TB diagnosis (p=0.001) viral load (p=0.03). TB treatment outcome was significantly associated with age at diagnosis (p=01), ARV treatment (p <0.0001), and TB drug resistant status (p=0.02). In adjusted analysis, drug resistance was associated with increased odds of successful completion of treatment with successful result compared to treatment failure (OR 6.94, 95% CI: 1.39-34.44) CONCLUSIONS: Our results suggest that being drug resistant is associated with higher odds of completing treatment with successful outcome, even when controlling for receipt of ARV therapy. Copyright © 2018. Published by Elsevier Ltd.

Risk factors and mortality associated with default from multidrug-resistant tuberculosis treatment.

Science.gov (United States)

Franke, Molly F; Appleton, Sasha C; Bayona, Jaime; Arteaga, Fernando; Palacios, Eda; Llaro, Karim; Shin, Sonya S; Becerra, Mercedes C; Murray, Megan B; Mitnick, Carole D

2008-06-15

Completing treatment for multidrug-resistant (MDR) tuberculosis (TB) may be more challenging than completing first-line TB therapy, especially in resource-poor settings. The objectives of this study were to (1) identify risk factors for default from MDR TB therapy (defined as prolonged treatment interruption), (2) quantify mortality among patients who default from treatment, and (3) identify risk factors for death after default from treatment. We performed a retrospective chart review to identify risk factors for default from MDR TB therapy and conducted home visits to assess mortality among patients who defaulted from such therapy. Sixty-seven (10.0%) of 671 patients defaulted from MDR TB therapy. The median time to treatment default was 438 days (interquartile range, 152-710 days), and 27 (40.3%) of the 67 patients who defaulted from treatment had culture-positive sputum at the time of default. Substance use (hazard ratio, 2.96; 95% confidence interval, 1.56-5.62; P = .001), substandard housing conditions (hazard ratio, 1.83; 95% confidence interval, 1.07-3.11; P = .03), later year of enrollment (hazard ratio, 1.62, 95% confidence interval, 1.09-2.41; P = .02), and health district (P = .02) predicted default from therapy in a multivariable analysis. Severe adverse events did not predict default from therapy. Forty-seven (70.1%) of 67 patients who defaulted from therapy were successfully traced; of these, 25 (53.2%) had died. Poor bacteriologic response, default, low education level, and diagnosis with a psychiatric disorder significantly predicted death after default in a multivariable analysis. The proportion of patients who defaulted from MDR TB treatment was relatively low. The large proportion of patients who had culture-positive sputum at the time of treatment default underscores the public health importance of minimizing treatment default. Prognosis for patients who defaulted from therapy was poor. Interventions aimed at preventing treatment default may

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

Direct costs of managing adverse drug reactions during rifampicin-resistant tuberculosis treatment in South Africa.

Science.gov (United States)

Schnippel, K; Firnhaber, C; Berhanu, R; Page-Shipp, L; Sinanovic, E

2018-04-01

To estimate the provider costs of managing adverse drug reactions (ADRs) to standard long-course treatment for multidrug- and rifampicin-resistant tuberculosis (MDR/RR-TB) according to South African guidelines. We parameterised a published Markov health state model for MDR/RR-TB with guidelines-based, bottom-up public-sector provider costing of ADR management. Frequency of ADR occurrence was extracted from the literature. Costs were estimated over 10 years, discounted 3% annually and tested using probabilistic sensitivity analysis. On average, guidelines-based costing of moderate ADRs weighted by the frequency of occurrence was US$135.76 (standard deviation [SD] US$17.18) and the cost of serious ADRs was US$521.29 (SD US$55.99). We estimated that the incremental costs of ADR management were US$380.17 annually per patient initiating MDR/RR-TB treatment. The incremental costs of ADR management for the public health sector in South Africa was US$4.76 million, 8.3% of the estimated cohort costs of MDR/RR-TB treatment ($57.55 million) for the 2015 cohort of 12 527 patients. Management of multiple ADRs and serious ADRs, which are common during the first 6 months of standard, long-course MDR/RR-TB treatment, substantially increases provider treatment costs. These results need to be taken into account when comparing regimen costs, and highlight the urgent need to identify drug regimens with improved safety profiles.

Tuberculosis (TB): Treatment

Science.gov (United States)

... Education & Training Home Conditions Tuberculosis (TB) Tuberculosis: Treatment Tuberculosis: Treatment Make an Appointment Refer a Patient Ask ... or bones is treated longer. NEXT: Preventive Treatment Tuberculosis: Diagnosis Tuberculosis: History Clinical Trials For more than ...

Diabetes and Other Risk Factors for Multi-drug Resistant Tuberculosis in a Mexican Population with Pulmonary Tuberculosis: Case Control Study.

Science.gov (United States)

Gómez-Gómez, Alejandro; Magaña-Aquino, Martin; López-Meza, Salvador; Aranda-Álvarez, Marcelo; Díaz-Ornelas, Dora E; Hernández-Segura, María Guadalupe; Salazar-Lezama, Miguel Ángel; Castellanos-Joya, Martín; Noyola, Daniel E

2015-02-01

Multidrug resistant tuberculosis (MDR-TB) poses problems in treatment, costs and treatment outcomes. It is not known if classically described risk factors for MDR-TB in other countries are the same in Mexico and the frequency of the association between diabetes mellitus (DM) and MDR-TB in our country is not clear. We undertook this study to analyze risk factors associated with the development of MDR-TB, with emphasis on DM. A case-control study in the state of San Luis Potosi (SLP), Mexico was carried out. All pulmonary MDR-TB patients diagnosed in the state of SLP between 1998 and 2013 (36 cases) evaluated at a state pharmacoresistant tuberculosis (TB) clinic and committee; 139 controls were randomly selected from all pulmonary non-multidrug-resistant tuberculosis (non-MDR-TB) cases identified between 2003 and 2008. Cases and controls were diagnosed and treated under programmatic conditions. Age, gender, malnutrition, being a health-care worker, HIV/AIDS status, and drug abuse were not significantly different between MDR-TB and non-MDR-TB patients. Significant differences between MDR-TB and non-MDR-TB patients were DM (47.2 vs. 28.1%; p = 0.028); previous anti-TB treatments (3 vs. 0, respectively; p <0.001), and duration of first anti-TB treatment (8 vs. 6 months, respectively; p <0.001). MDR-TB and DM are associated in 47.2% of MDR TB cases (17/36) in this study. Other recognized factors were not found to be significantly different in MDR-TB compared to non-MDR-TB in this study. Cost-feasible strategies must be implemented in the treatment of DM-TB in order to prevent the selection of MDR-TB. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

Pathways to multidrug-resistant tuberculosis diagnosis and treatment initiation: a qualitative comparison of patients' experiences in the era of rapid molecular diagnostic tests.

Science.gov (United States)

Naidoo, Pren; van Niekerk, Margaret; du Toit, Elizabeth; Beyers, Nulda; Leon, Natalie

2015-10-28

Although new molecular diagnostic tests such as GenoType MTBDRplus and Xpert® MTB/RIF have reduced multidrug-resistant tuberculosis (MDR-TB) treatment initiation times, patients' experiences of diagnosis and treatment initiation are not known. This study aimed to explore and compare MDR-TB patients' experiences of their diagnostic and treatment initiation pathway in GenoType MTBDRplus and Xpert® MTB/RIF-based diagnostic algorithms. The study was undertaken in Cape Town, South Africa where primary health-care services provided free TB diagnosis and treatment. A smear, culture and GenoType MTBDRplus diagnostic algorithm was used in 2010, with Xpert® MTB/RIF phased in from 2011-2013. Participants diagnosed in each algorithm at four facilities were purposively sampled, stratifying by age, gender and MDR-TB risk profiles. We conducted in-depth qualitative interviews using a semi-structured interview guide. Through constant comparative analysis we induced common and divergent themes related to symptom recognition, health-care access, testing for MDR-TB and treatment initiation within and between groups. Data were triangulated with clinical information and health visit data from a structured questionnaire. We identified both enablers and barriers to early MDR-TB diagnosis and treatment. Half the patients had previously been treated for TB; most recognised recurring symptoms and reported early health-seeking. Those who attributed symptoms to other causes delayed health-seeking. Perceptions of poor public sector services were prevalent and may have contributed both to deferred health-seeking and to patient's use of the private sector, contributing to delays. However, once on treatment, most patients expressed satisfaction with public sector care. Two patients in the Xpert® MTB/RIF-based algorithm exemplified its potential to reduce delays, commencing MDR-TB treatment within a week of their first health contact. However, most patients in both algorithms experienced

Resistance to fluoroquinolones and second-line injectable drugs: impact on multidrug-resistant TB outcomes

NARCIS (Netherlands)

Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.

2013-01-01

A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable

Rapid molecular detection of rifampicin resistance facilitates early diagnosis and treatment of multi-drug resistant tuberculosis: case control study.

Directory of Open Access Journals (Sweden)

Philly O'Riordan

2008-09-01

Full Text Available Multi-drug resistant tuberculosis (MDR-TB is a major public health concern since diagnosis is often delayed, increasing the risk of spread to the community and health care workers. Treatment is prolonged, and the total cost of treating a single case is high. Diagnosis has traditionally relied upon clinical suspicion, based on risk factors and culture with sensitivity testing, a process that can take weeks or months. Rapid diagnostic molecular techniques have the potential to shorten the time to commencing appropriate therapy, but have not been put to the test under field conditions.This retrospective case-control study aimed to identify risk factors for MDR-TB, and analyse the impact of testing for rifampicin resistance using RNA polymerase B (rpoB mutations as a surrogate for MDR-TB. Forty two MDR-TB cases and 84 fully sensitive TB controls were matched by date of diagnosis; and factors including demographics, clinical presentation, microbiology findings, management and outcome were analysed using their medical records. Conventionally recognised risk factors for MDR-TB were absent in almost half (43% of the cases, and 15% of cases were asymptomatic. A significant number of MDR-TB cases were identified in new entrants to the country. Using rpoB mutation testing, the time to diagnosis of MDR-TB was dramatically shortened by a median of 6 weeks, allowing patients to be commenced on appropriate therapy a median of 51days earlier than those diagnosed by conventional culture and sensitivity testing.MDR-TB is frequently an unexpected finding, may be asymptomatic, and is particularly prevalent among TB infected new entrants to the country. Molecular resistance testing of all acid fast bacilli positive specimens has the potential to rapidly identify MDR-TB patients and commence them on appropriate therapy significantly earlier than by conventional methods.

Use of Transnational Services to Prevent Treatment Interruption in Tuberculosis-Infected Persons Who Leave the United States.

Science.gov (United States)

Tschampl, Cynthia A; Garnick, Deborah W; Zuroweste, Edward; Razavi, Moaven; Shepard, Donald S

2016-03-01

A major problem resulting from interrupted tuberculosis (TB) treatment is the development of drug-resistant TB, including multidrug-resistant TB (MDR TB), a more deadly and costly-to-treat form of the disease. Global health systems are not equipped to diagnose and treat the current burden of MDR TB. TB-infected foreign visitors and temporary US residents who leave the country during treatment can experience treatment interruption and, thus, are at greater risk for drug-resistant TB. Using epidemiologic and demographic data, we estimated TB incidence among this group, as well as the proportion of patients referred to transnational care-continuity and management services during relocation; each year, ≈2,827 visitors and temporary residents are at risk for TB treatment interruption, 222 (8%) of whom are referred for transnational services. Scale up of transnational services for persons at high risk for treatment interruption is possible and encouraged because of potential health gains and reductions in healthcare costs for the United States and receiving countries.

Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol

OpenAIRE

Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

2016-01-01

Introduction:\\ud Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This eval...

Multidrug-resistant tuberculosis patients’ views of interventions to reduce treatment loss to follow-up

Science.gov (United States)

Tupasi, T.; Garfin, A. M. C. G.; Mangan, J. M.; Orillaza-Chi, R.; Naval, L. C.; Balane, G. I.; Basilio, R.; Golubkov, A.; Joson, E. S.; Lew, W-J.; Lofranco, V.; Mantala, M.; Pancho, S.; Sarol, J. N.; Blumberg, A.; Burt, D.; Kurbatova, E. V.

2017-01-01

SUMMARY SETTING Patients who initiated treatment for multi-drug-resistant tuberculosis (MDR-TB) at 15 Programmatic Management of Drug-resistant Tuberculosis (PMDT) health facilities in the Philippines between July and December 2012. OBJECTIVES To describe patients’ views of current interventions, and suggest changes likely to reduce MDR-TB loss to follow-up. METHODS In-depth interviews were conducted between April and July 2014 with MDR-TB patients who were undergoing treatment, had finished treatment at the time of the interview (controls), or had been lost to follow-up (LTFU). Responses were thematically analyzed. RESULTS Interviews were conducted with 182 patients who were undergoing or had completed treatment and 91 LTFU patients. Views and suggestions could be thematically categorized as approaches to facilitate adherence or address barriers to adherence. The top themes were the need for transportation assistance or improvements to the current transportation assistance program, food assistance, and difficulties patients encountered related to their medications. These themes were addressed by respectively 63%, 60%, and 32% of the participants. CONCLUSIONS A more patient-centered approach is needed to improve MDR-TB treatment adherence. Programs should strive to provide assistance that considers patient preferences, is adequate to cover actual costs or needs, and is delivered in a timely, uninterrupted manner. PMID:28157461

A meta-analysis of drug resistant tuberculosis in Sub-Saharan Africa: how strongly associated with previous treatment and HIV co-infection?

Science.gov (United States)

Berhan, Asres; Berhan, Yifru; Yizengaw, Desalegn

2013-11-01

In Sub-Saharan Africa, the fight against tuberculosis (TB) has encountered a great challenge because of the emergence of drug resistant TB strains and the high prevalence of HIV infection. The aim of this meta-analysis was to determine the association of drug-resistant TB with anti-TB drug treatment history and HIV co-infection. After electronic based literature search in the databases of Medline, HINARI, EMBASE and the Cochrane library, article selection and data extraction were carried out. HIV co-infection and previous history of TB treatment were used as predictors for the occurrence of any anti-TB drug resistant or multiple drug resistant TB (MDR-TB). The risk ratios for each included study and for the pooled sample were computed using the random-effects model. Heterogeneity test, sensitivity analyses and funnel plots were also done. The pooled analysis showed that the risk of developing drug-resistant TB to at least one anti-TB drug was about 3 times higher in individuals who had a previous history of anti-TB treatment than new TB cases. The risk of having MDR-TB in previously anti-TB treated TB cases was more than 5-fold higher than that of new TB cases. Resistance to Ethambutol and Rifampicin was more than fivefold higher among the previously treated with anti-TB drugs. However, HIV infection was not associated with drug-resistant TB. There was a strong association of previous anti-TB treatment with MDR-TB. Primary treatment warrants special emphasis, and screening for anti-TB drugs sensitivity has to be strengthened.

Challenges of using new and repurposed drugs for the treatment of multidrug-resistant tuberculosis in children.

Science.gov (United States)

Schaaf, H Simon; Garcia-Prats, Anthony J; McKenna, Lindsay; Seddon, James A

2018-03-01

New and repurposed antituberculosis drugs are urgently needed to more safely and effectively treat multidrug-resistant (MDR) tuberculosis (TB) in children. Multiple challenges limit timely access to new MDR-TB treatments in children. Areas covered: Diagnosis of MDR-TB in children remains a barrier, with few children with MDR-TB diagnosed and treated. Other barriers to timely access to new and repurposed drugs are discussed, and include delayed initiation of paediatric trials, limited funding for paediatric drug development, fragmented regulatory systems and operational challenges. The status of access to current repurposed and novel drugs is presented. Expert commentary: More timely initiation of paediatric trials is needed and paediatric work should happen and be funded in parallel with each phase of adult trials. Better quality data, increased regulator resources and expertise, harmonization of regulatory requirements across borders/organisations and registration fee waivers would improve registration timelines. Improved diagnosis, recording and reporting will establish better demand. Improved systems for procurement and supply chain management would reduce in-country operational barriers to getting medications to children. The challenges must be addressed to ensure timely and equitable access to new drugs and regimens that are urgently needed for effective, safe and shorter treatment of children with MDR-TB.

Multidrug resistant pulmonary tuberculosis treatment regimens and patient outcomes: an individual patient data meta-analysis of 9,153 patients.

Directory of Open Access Journals (Sweden)

Shama D Ahuja

Full Text Available Treatment of multidrug resistant tuberculosis (MDR-TB is lengthy, toxic, expensive, and has generally poor outcomes. We undertook an individual patient data meta-analysis to assess the impact on outcomes of the type, number, and duration of drugs used to treat MDR-TB.Three recent systematic reviews were used to identify studies reporting treatment outcomes of microbiologically confirmed MDR-TB. Study authors were contacted to solicit individual patient data including clinical characteristics, treatment given, and outcomes. Random effects multivariable logistic meta-regression was used to estimate adjusted odds of treatment success. Adequate treatment and outcome data were provided for 9,153 patients with MDR-TB from 32 observational studies. Treatment success, compared to failure/relapse, was associated with use of: later generation quinolones, (adjusted odds ratio [aOR]: 2.5 [95% CI 1.1-6.0], ofloxacin (aOR: 2.5 [1.6-3.9], ethionamide or prothionamide (aOR: 1.7 [1.3-2.3], use of four or more likely effective drugs in the initial intensive phase (aOR: 2.3 [1.3-3.9], and three or more likely effective drugs in the continuation phase (aOR: 2.7 [1.7-4.1]. Similar results were seen for the association of treatment success compared to failure/relapse or death: later generation quinolones, (aOR: 2.7 [1.7-4.3], ofloxacin (aOR: 2.3 [1.3-3.8], ethionamide or prothionamide (aOR: 1.7 [1.4-2.1], use of four or more likely effective drugs in the initial intensive phase (aOR: 2.7 [1.9-3.9], and three or more likely effective drugs in the continuation phase (aOR: 4.5 [3.4-6.0].In this individual patient data meta-analysis of observational data, improved MDR-TB treatment success and survival were associated with use of certain fluoroquinolones, ethionamide, or prothionamide, and greater total number of effective drugs. However, randomized trials are urgently needed to optimize MDR-TB treatment. Please see later in the article for the Editors' Summary.

Responding to the multidrug-resistant tuberculosis crisis: mainstreaming programmatic management to the Philippine National Tuberculosis Programme.

Science.gov (United States)

Quelapio, M I D; Mira, N R C; Orillaza-Chi, R B; Belen, V; Muñez, N; Belchez, R; Egos, G E; Evangelista, M; Vianzon, R; Tupasi, T E

2010-06-01

The Philippines ranks eighth among 27 priority countries for multidrug-resistant TB (MDR-TB). To describe a model of public-private partnership in MDR-TB management. An exploratory study of integrating MDR-TB management initiated in private-public mix DOTS into the National TB Programme (NTP). Recognising that MDR-TB was a threat to DOTS, the Tropical Disease Foundation initiated MDR-TB management in 1999. An official mandate for the integration of MDR-TB services into the NTP was issued by the Department of Health in 2008. With an increased government budget augmented by support from the Global Fund to Fight AIDS, Tuberculosis and Malaria, 1294 MDR-TB patients were placed on treatment from 1999 to 2008. The treatment success rate improved from 64% in 1999 to 75% in 2005. There are now five MDR-TB treatment centres with 181 treatment sites in Metro Manila, and three culture centres. People trained include 12 master trainers, 31 trainers, 25 treatment centre and 381 treatment site staff. Mainstreaming into the NTP of this unique model of MDR-TB management through a dynamic public-private collaboration can be considered best practice in implementation science of an evidence-based intervention leading to change in health care policy and practice.

tb diagnostics challenges of tb diagnosis and treatment in south africa

African Journals Online (AJOL)

2007-06-01

Jun 1, 2007 ... 45 currently provides treatment to 3 000 patients. Eighty-nine per cent of those accessing ART have symptomatic HIV disease. (WHO clinical stage 3 and 4) with a median CD4 cell count of. 95 cells/µl. More than 50% have a history of prior completed. TB treatment, 15% are on current TB treatment, 11% are.

Chronic airflow obstruction after successful treatment of multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

Anthony L. Byrne

2017-07-01

Full Text Available Cross-sectional studies reveal an association between tuberculosis (TB and chronic airflow obstruction, but cannot adequately address confounding. We hypothesised that treated pulmonary TB is an independent risk factor for chronic airflow obstruction. The Pulmones Post TB cohort study enrolled participants from Lima, Peru, aged 10–70 years with a history of drug-susceptible (DS- or multidrug-resistant (MDR-TB who had completed treatment and were clinically cured. Unexposed participants without TB were randomly selected from the same districts. We assessed respiratory symptoms, relevant environmental exposures, and spirometric lung function pre- and post-bronchodilator. In total, 144 participants with DS-TB, 33 with MDR-TB and 161 unexposed participants were fully evaluated. Compared with unexposed participants, MDR-TB patients had lower lung volumes (adjusted mean difference in forced vital capacity −370 mL, 95% CI −644– −97 and post-bronchodilator airflow obstruction (adjusted OR 4.89, 95% CI 1.27–18.78. Participants who had recovered from DS-TB did not have lower lung volumes than unexposed participants, but were more likely to have a reduced forced expiratory volume in 1 s/forced vital capacity ratio <0.70 (adjusted OR 2.47, 95% CI 1.01–6.03. Individuals successfully treated for TB may experience long-lasting sequelae. Interventions facilitating earlier TB treatment and management of chronic respiratory disease should be explored.

Impact of rapid molecular diagnostic tests on time to treatment initiation and outcomes in patients with multidrug-resistant tuberculosis, Tamil Nadu, India.

Science.gov (United States)

Nair, Dina; Navneethapandian, Pooranaganga D; Tripathy, Jaya Prasad; Harries, Anthony D; Klinton, Joel S; Watson, Basilea; Sivaramakrishnan, Gomathi N; Reddy, Devarajulu S; Murali, Lakshmi; Natrajan, Mohan; Swaminathan, Soumya

2016-09-01

India is replacing culture and drug sensitivity testing (CDST) with rapid molecular tests for diagnosing MDR-TB. We assessed the impact of rapid tests on time to initiation of treatment and outcomes in patients with MDR-TB compared with CDST. A retrospective cohort study involving MDR-TB patients from six districts in Tamil Nadu state, who underwent CDST (2010-2011) and rapid tests (2012-2013). There were 135 patients in the CDST group and 389 in the rapid diagnostic test group. Median time from sputum receipt at the laboratory to initiation of MDR-TB treatment was 130 days (IQR 75-213) in the CDST group and 22 days (IQR 14-38) in the rapid diagnostic test group (p30% in both groups and missing data were higher in CDST (13%) compared with rapid tests (3%). There were significantly higher risks of unfavourable treatment outcomes in males (aRR 1.3, 95% CI 1.1-1.5) and those with treatment initiation delays >30 days (aRR 1.3, 95% CI 1.0-1.6). Rapid molecular diagnostic tests shortened the time to initiate treatment which was associated with reduced unfavourable outcomes in MDR-TB patients. This supports the policy to scale up these tests in India. © The Author 2016. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Pulmonary resection can improve treatment outcome in re-treatment pulmonary tuberculosis and its complications

Directory of Open Access Journals (Sweden)

Ali Rifaat

2014-04-01

Conclusions: Surgery is effective when medical therapy fails to control pulmonary TB and its complications. MDR-TB patients are among those who benefit from pulmonary resection. Postoperative medical therapy is important to improve results and in achieving negative sputum conversion in TB patients including MDR-TB patients.

THE EFFECT OF DIFFERENT TB DRUGS AND ANTIMICROBIAL AGENTS ON THE EFFICIENCY OF TREATMENT OF TUBERCULOSIS PATIENTS WITH MULTIPLE DRUG RESISTANCE

Directory of Open Access Journals (Sweden)

I. A. Vasilyeva

2017-01-01

Full Text Available Objective of the study: to study the effect of specific TB drugs and antimicrobial agents constituting chemotherapy regimens on the efficiency of treatment of tuberculosis patients with various patterns of multiple drug resistance.Subjects and Methods. 412 pulmonary tuberculosis patients with bacillary excretion and various patterns of multiple drug resistance were enrolled into the study (117 patients with MDR TB (non pre-XDR and non-XDR; 120 patients with pre-XDR TB and 175 with XDR TB. Patients in the subgroups were compatible regarding sex and age. The patients were prescribed regimens including 5-6 drugs in accordance with their drug resistance pattern. The time of sputum conversion (by culture versus the year of treatment was selected as a surrogate endpoint. The effect of specific TB drugs and antimicrobial agents on treatment efficiency was assessed through calculation of odds ratio (OR of achieving a surrogate endpoint in the patients receiving and not receiving a certain drug.Results. In the subgroup of pre-XDR TB, the following drugs demonstrated the valid increase of odds of sputum conversion: ethambutol (OR 11.8, pyrazinamide (OR 10.2, moxifloxacin (OR 7.8, capreomicin (OR 4.41. Sputum conversion was achieved in all 11 patients treated with bedaquiline.In the subgroup of XDR TB, the following drugs provided a positive effect on the achievement of sputum conversion: bedaquiline (OR 9.62, linezolid (OR 8.15, cycloserine (OR 7.88, pyrazinamide (OR 7.29, moxifloxacin (OR 7.08, and ethambutol (OR 6.69. Ofloxacin demonstrated a confident negative effect on achieving sputum conversion (95% CI 0.06-0.32. 

Role of Risk Factors in the Incidence of Multidrug-Resistant Tuberculosis

Directory of Open Access Journals (Sweden)

Alya Putri Khairani

2017-09-01

Full Text Available Objective: To determine the risk factors that played roles in the incidence of multidrug-resistant tuberculosis (MDR-TB in such patients. Multidrug-Resistant Tuberculosis is a form of tuberculosis caused by Mycobacterium tuberculosis that is resistant to at least isoniazid and rifampicin. Methods: This was a case control study to compare MDR-TB to non-MDR-TB pulmonary tuberculosis outpatients in Dr. Hasan Sadikin General Hospital, Bandung on August–September 2014. Fifty MDR-TB outpatients were included as the cases and 50 non-MDR-TB outpatients as controls. Data was collected by questionnaires and patient’s registration forms. Bivariate and multivariate analyses were performed using chi-square test and multiple logistic regression test, with p<0.05 considered significant. Results: From bivariate analysis, number of previous tuberculosis treatments, regularity of previous treatment, and burden of cost were significant risk factors for developing MDR-TB (p<0.05; while from multivariate analysis, number of previous TB treatments was the only risk factor that played a significant role in the incidence of MDR-TB (OR 24.128 95% CI 6.771-85,976. Conclusions: Patients and medication factors are risk factors that play roles in the incidence of MDR-TB. The significant risk factor is the number of previous TB treatment.

EDITORIAL Multi-drug-resistant tuberculosis (MDR-TB): Current ...

African Journals Online (AJOL)

A South African Health Systems Trust report indicated that despite a global ... less financial resources performed better. ... Healthcare providers need to be better trained at our various nursing colleges and medical schools on how to manage TB, with regular and intense follow-up in-service training sessions. In addition ...

CHANGES IN THE PREVALENCE OF DRUG RESISTANT TUBERCULOSIS

Directory of Open Access Journals (Sweden)

V. B. Galkin

2017-01-01

Full Text Available The tendency of tuberculosis prevalence reduction observed in the Russian Federation is mostly related to the cases without multiple drug resistance (MDR. In general the number of MDR TB cases still tends to be increasing in the Russian Federation. Confident long-term reduction is registered only in the Central and North-Western Districts with relatively low level of MDR TB prevalence. From 2017 MDR TB patients are expected to prevail in the structure of the sputum positive cases which surely provides negative impact on the treatment efficiency and epidemic trends. The system of dispensary follow-up allows evaluating the annual number of MDT TB cases and following the ways of its increase and reduction. Taking MDR TB sources on and off the register is less intensive compared to the same flows of non-MDR infectious cases. The number of MDR TB sources is increasing mostly due new tuberculosis cases however acquired MDR TB makes significant contribution to the growth of MDR TB sources number. The increase in the ratio of respiratory MDR TB patients with sputum conversion to those died reflects the success in the improvement of the treatment strategy of MDR TB patients.

Multidrug-resistant tuberculosis in Europe, 2010-2011

DEFF Research Database (Denmark)

Günther, Gunar; van Leth, Frank; Alexandru, Sofia

2015-01-01

Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

Integration of TB and ART services fails to improve TB treatment ...

African Journals Online (AJOL)

The median CD4+ count of HIV-positive patients was 152 cells/μl (interquartile range (IQR) 71 - 277) for integrated facilities and 148 cells/μl (IQR 67 - 260) for single-service facilities. There was no statistical difference in the TB treatment outcome profile between integrated and single-service facilities for all TB patients (p=0.

A systematic review of the cost and cost effectiveness of treatment for multidrug-resistant tuberculosis.

Science.gov (United States)

Fitzpatrick, Christopher; Floyd, Katherine

2012-01-01

Around 0.4 million cases of multidrug-resistant tuberculosis (MDR-TB) occur each year. Only a small fraction of these cases are treated according to international guidelines. Evidence relevant to decisions about whether to scale-up treatment for MDR-TB includes cost and cost-effectiveness data. Up to 2010, no systematic review of this evidence has been available. Our objective was to conduct a systematic review of the cost and cost effectiveness of treatment for MDR-TB and synthesize the available data. We searched for papers published or prepared for publication in peer-review journals and grey literature using search terms in five languages: English, French, Portuguese, Russian and Spanish. From an initial set of 420 studies, four were included, from Peru, the Philippines, Estonia and Tomsk Oblast in the Russian Federation. Results on costs, effectiveness and cost effectiveness were extracted. Assessment of the quality of each economic evaluation was guided by two existing checklists around which there is broad consensus. Costs were adjusted to a common year of value (2005) to remove distortions caused by inflation, and calculated in two common currencies: $US and international dollars (I$), to standardize for purchasing power parity. Data from the four identified studies were then synthesized using probabilistic sensitivity analysis, to appraise the likely cost and cost effectiveness of MDR-TB treatment in other settings, relative to WHO benchmarks for assessing whether or not an intervention is cost effective. Best estimates are provided as means, with 5th and 95th percentiles of the distributions. The cost per patient for MDR-TB treatment in Estonia, Peru, the Philippines and Tomsk was $US10 880, $US2423, $US3613 and $US14 657, respectively. Best estimates of the cost per disability-adjusted life-year (DALY) averted were $US598 (I$960), $US163 (I$291), $US143 (I$255) and $US745 (I$1059), respectively. The main influences on costs were (i) the model of care

Association between Multidrug-Resistant Tuberculosis and Risk Factors in China: Applying Partial Least Squares Path Modeling.

Directory of Open Access Journals (Sweden)

Yun-Xia Liu

Full Text Available Multidrug-resistant tuberculosis (MDR-TB resulting from various factors has raised serious public health concerns worldwide. Identifying the ecological risk factors associated with MDR-TB is critical to its prevention and control. This study aimed to explore the association between the development of MDR-TB and the risk factors at the group-level (ecological risk factors in China.Data on MDR-TB in 120 counties were obtained from the National Tuberculosis Information Management System, and data on risk-factor variables were extracted from the Health Statistical Yearbook, provincial databases, and the meteorological bureau of each province (municipality. Partial Least Square Path Modeling was used to detect the associations.The median proportion of MDR-TB in new TB cases was 3.96% (range, 0-39.39%. Six latent factors were extracted from the ecological risk factors, which explained 27.60% of the total variance overall in the prevalence of MDR-TB. Based on the results of PLS-PM, TB prevention, health resources, health services, TB treatment, TB detection, geography and climate factors were all associated with the risk of MDR-TB, but socioeconomic factors were not significant.The development of MDR-TB was influenced by TB prevention, health resources, health services, TB treatment, TB detection, geography and climate factors. Such information may help us to establish appropriate public health intervention strategies to prevent and control MDR-TB and yield benefits to the entire public health system in China.

Provider perspectives on drug-resistant tuberculosis and human immunodeficiency virus care in South Africa: a qualitative case study.

Science.gov (United States)

Daftary, A; Padayatchi, N

2016-11-01

To examine influences on health care workers' (HCWs') capacity to deliver health care for multi- and/or extensively drug-resistant tuberculosis (MDR/XDR-TB) and human immunodeficiency virus (HIV) infection in South Africa. Qualitative data were collected via group and individual interviews with a purposive sample of 17 HCWs at a centralised, tertiary TB facility and analysed using grounded theory. Four themes were identified: 1) personal infection control practices among HCWs may be weakened by a workplace culture comprising low motivation, disparate risk perceptions and practices across workforce hierarchies, physical discomfort, and problems managing patients with treatment-induced hearing loss. 2) Patient-provider interactions are likely stronger among nurses, and in HIV vs. MDR/XDR-TB service delivery, due to greater attention to patient empowerment and support. Stigma associated with MDR/XDR-TB, considered worse than HIV, may be perpetuated within non-specialised facilities less familiar with MDR/XDR-TB. 3) HCWs who struggle with the daily tedium of MDR/XDR-TB treatment supervision are becoming increasingly supportive of treatment literacy and self-administration. 4) Effective integration of HIV and MDR/XDR-TB services may be impeded by administrative restrictions, workplace norms and provider mindsets. Comprehensive, decentralised management of MDR/XDR-TB and HIV coinfection requires the creation of patient-provider trust and treatment literacy in MDR/XDR-TB programmes, and defying workplace norms that could provoke nosocomial TB exposure and fragmented service provision.

Childhood multidrug-resistant tuberculosis in the European Union and European Economic Area: an analysis of tuberculosis surveillance data from 2007 to 2015.

Science.gov (United States)

Ködmön, Csaba; van den Boom, Martin; Zucs, Phillip; van der Werf, Marieke Johanna

2017-11-01

BackgroundConfirming tuberculosis (TB) in children and obtaining information on drug susceptibility is essential to ensure adequate treatment. We assessed whether there are gaps in diagnosis and treatment of multidrug-resistant (MDR) TB in children in the European Union and European Economic Area (EU/EEA), quantified the burden of MDR TB in children and characterised cases. Methods : We analysed surveillance data from 2007 to 2015 for paediatric cases younger than 15 years. Results : In that period, 26 EU/EEA countries reported 18,826 paediatric TB cases of whom 4,129 (21.9%) were laboratory-confirmed. Drug susceptibility testing results were available for 3,378 (17.9%), representing 81.8% of the confirmed cases. The majority (n = 2,967; 87.8%) had drug-sensitive TB, 249 (7.4%) mono-resistant TB, 64 (1.9%) poly-resistant TB, 90 (2.7%) MDR TB and eight (0.2%) had extensively drug-resistant (XDR) TB. MDR TB was more frequently reported among paediatric cases with foreign background (adjusted odds ratio (aOR) = 1.73; 95% confidence interval (95% CI): 1.12-2.67) or previous TB treatment (aOR: 6.42; 95% CI: 3.24-12.75). Successful treatment outcome was reported for 58 of 74 paediatric MDR TB cases with outcome reported from 2007 to 2013; only the group of 5-9 years-olds was significantly associated with unsuccessful treatment outcome (crude odds ratio (cOR) = 11.45; 95% CI: 1.24-106.04). Conclusions : The burden of MDR TB in children in the EU/EEA appears low, but may be underestimated owing to challenges in laboratory confirmation. Diagnostic improvements are needed for early detection and adequate treatment of MDR TB. Children previously treated for TB or of foreign origin may warrant higher attention.

Therapeutic drug monitoring: how to improve drug dosage and patient safety in tuberculosis treatment

Directory of Open Access Journals (Sweden)

Giovanni Sotgiu

2015-03-01

Full Text Available In this article we describe the key role of tuberculosis (TB treatment, the challenges (mainly the emergence of drug resistance, and the opportunities represented by the correct approach to drug dosage, based on the existing control and elimination strategies. In this context, the role and contribution of therapeutic drug monitoring (TDM is discussed in detail. Treatment success in multidrug-resistant (MDR TB cases is low (62%, with 7% failing or relapsing and 9% dying and in extensively drug-resistant (XDR TB cases is even lower (40%, with 22% failing or relapsing and 15% dying. The treatment of drug-resistant TB is also more expensive (exceeding €50 000 for MDR-TB and €160 000 for XDR-TB and more toxic if compared to that prescribed for drug-susceptible TB. Appropriate dosing of first- and second-line anti-TB drugs can improve the patient's prognosis and lower treatment costs. TDM is based on the measurement of drug concentrations in blood samples collected at appropriate times and subsequent dose adjustment according to the target concentration. The ‘dried blood spot’ technique offers additional advantages, providing the rationale for discussions regarding a possible future network of selected, quality-controlled reference laboratories for the processing of dried blood spots of difficult-to-treat patients from reference TB clinics around the world.

Antiretroviral treatment uptake in patients with HIV- associated TB ...

African Journals Online (AJOL)

ART results in a 64 - 95% reduction in mortality risk 5 and is an essential component of care. How soon to start. ART after TB treatment initiation has become clearer from randomised controlled trials. These show that integration of ART and TB treatment in all HIV-associated TB patients regardless of CD4 count significantly.

Management of multidrug-resistant tuberculosis in human immunodeficiency virus patients

Science.gov (United States)

Jamil, K. F.

2018-03-01

Tuberculosis (TB) is a chronic infectious disease mainly caused by Mycobacterium tuberculosis(MTB). 10.4 million new TB cases will appear in 2015 worldwide. There were an estimated 1.4 million TB deaths in 2015, and an additional 0.4 million deaths resulting from TB disease among people living with human immunodeficiency virus (HIV). Multidrug- resistant and extensively drug-resistant tuberculosis (MDR and XDR-TB) are major public health concerns worldwide. 480.000 new cases of MDR-TB will appear in 2015 and an additional 100,000 people with rifampicin-resistant TB (RR-TB) who were also newly eligible for MDR-TB treatment. Their association with HIV infection has contributed to the slowing down of TB incidence decline over the last two decades, therefore representing one important barrier to reach TB elimination. Patients infected with MDR-TB require more expensive treatment regimens than drug-susceptible TB, with poor treatment.Patients with multidrug- resistant tuberculosis do not receive rifampin; drug interactions risk is markedly reduced. However, overlapping toxicities may limit options for co-treatment of HIV and multidrug- resistant tuberculosis.

Predictors of Prolonged TB Treatment in a Dutch Outpatient Setting.

Directory of Open Access Journals (Sweden)

Natasha Van't Boveneind-Vrubleuskaya

Full Text Available Standard treatment duration for drug-susceptible tuberculosis (TB treatment is 6 months. Treatment duration is often extended-and for various different reasons. The aim of this study was to determine the prevalence and to assess risk factors associated with extended TB treatment.A cross-sectional study was conducted. Data including demographic, clinical, radiological and microbiological information from the Netherlands TB Register (NTR of 90 patients with smear and culture positive pulmonary TB of the region Haaglanden, The Netherlands, was eligible for analysis.Treatment was extended to ≥ 200 days by 46 (51% patients. Extended TB treatment was associated with a higher frequency of symptoms, presumed to be due to adverse drug reactions (ADR; OR 2.39 95% CI: 1.01-5.69, drug-induced liver injury (DILI (OR: 13.51; 95% CI: 1.66-109.82 and longer than 2 month smear and culture conversion rate (OR: 11.00; 95% CI: 1.24-97.96 and OR: 8.56; 95% CI: 1.53-47.96. In the multivariable logistic analysis, development of DILI emerged as the single statistically strong risk factor necessitating extension of TB treatment.This finding will need further confirmation in a prospective study, exploring the possible mutual role of pharmacokinetic and pharmacogenetic determinants of DILI among TB patients.

Prevalence of multidrug resistance among retreatment pulmonary tuberculosis cases in a tertiary care hospital, Hyderabad, India

Directory of Open Access Journals (Sweden)

Subhakar Kandi

2013-01-01

Full Text Available Background: India is one of the high tuberculosis (TB burden countries in the world. India ranks second in harboring multi drug resistant (MDR-TB cases. About 50,000 of MDR cases are recorded in retreatment pulmonary TB cases. This study was conducted in a tertiary care facility (Government General and Chest Hospital in Hyderabad, India. Objectives: Toassess: Proportion of the TB patients having MDR-TB at the initiation of retreatment regimen; the prevalence of isoniazid (INH resistance in this geographical area. Materials and Methods: An analytical, observational, prospective cohort study of patients attending the out-patient department from December 2010 to March 2011. Results: Sputum samples from 100 patients were subjected to acid fast bacilli (AFB culture and drug sensitivity testing. Of these, 28 (28% were MDR-TB, 42 (42% were non-MDR-TB and 39% being INH resistance. Conclusions: In conclusion, one third of the retreatment pulmonary TB cases attending a tertiary care institute for TB will be MDR-TB at the initiation of treatment and there is a need to include ethambutol in the continuation phase of new TB case treatment in view of high INH resistance.

Tuberculosis Treatment Adherence of Patients in Kosovo

Directory of Open Access Journals (Sweden)

Shaip Krasniqi

2017-01-01

Full Text Available Setting. The poor patient adherence in tuberculosis (TB treatment is considered to be one of the most serious challenges which reflect the decrease of treatment success and emerging of the Multidrug Resistance-TB (MDR-TB. To our knowledge, the data about patients’ adherence to anti-TB treatment in our country are missing. Objective. This study was aimed to investigate the anti-TB treatment adherence rate and to identify factors related to eventual nonadherence among Kosovo TB patients. Design. This study was conducted during 12 months, and the survey was a descriptive study using the standardized questionnaires with total 324 patients. Results. The overall nonadherence for TB patient cohort was 14.5%, 95% CI (0.109–0.188. Age and place of residence are shown to have an effect on treatment adherence. Moreover, the knowledge of the treatment prognosis, daily dosage, side effects, and length of treatment also play a role. This was also reflected in knowledge regarding compliance with regular administration of TB drugs, satisfaction with the treatment, interruption of TB therapy, and the professional monitoring in the administration of TB drugs. Conclusion. The level of nonadherence TB treatment in Kosovar patients is not satisfying, and more health care worker’s commitments need to be addressed for improvement.

Tuberculosis Treatment Adherence of Patients in Kosovo.

Science.gov (United States)

Krasniqi, Shaip; Jakupi, Arianit; Daci, Armond; Tigani, Bahri; Jupolli-Krasniqi, Nora; Pira, Mimoza; Zhjeqi, Valbona; Neziri, Burim

2017-01-01

The poor patient adherence in tuberculosis (TB) treatment is considered to be one of the most serious challenges which reflect the decrease of treatment success and emerging of the Multidrug Resistance-TB (MDR-TB). To our knowledge, the data about patients' adherence to anti-TB treatment in our country are missing. This study was aimed to investigate the anti-TB treatment adherence rate and to identify factors related to eventual nonadherence among Kosovo TB patients. This study was conducted during 12 months, and the survey was a descriptive study using the standardized questionnaires with total 324 patients. The overall nonadherence for TB patient cohort was 14.5%, 95% CI (0.109-0.188). Age and place of residence are shown to have an effect on treatment adherence. Moreover, the knowledge of the treatment prognosis, daily dosage, side effects, and length of treatment also play a role. This was also reflected in knowledge regarding compliance with regular administration of TB drugs, satisfaction with the treatment, interruption of TB therapy, and the professional monitoring in the administration of TB drugs. The level of nonadherence TB treatment in Kosovar patients is not satisfying, and more health care worker's commitments need to be addressed for improvement.

Yield of facility-based verbal screening amongst household contacts of patients with multi-drug resistant tuberculosis in Pakistan

Directory of Open Access Journals (Sweden)

Ejaz Qadeer

2017-05-01

Full Text Available Background: Household contacts of multidrug-resistant tuberculosis (MDR-TB patients are at a high risk of getting infected with TB/MDR-TB, therefore symptomatic or vulnerable individuals should be screened and treated early. Methods: A cross-sectional study was conducted among household contacts of MDR-TB patients in three high-burden TB sites in Pakistan from July 2013 to June 2014. MDR-TB index patients were asked to provide a list of all members of their household and were asked whether any of them had TB symptoms such as productive cough, fever, weight loss and night sweat (“facility-based verbal screening”. Symptomatic contacts were defined as presumptive TB cases and were invited for investigations at the facility. Those who did not come were paid a home-visit. Confirmed TB/MDR-TB patients were registered in the nearest treatment facility. Results: Of 209 MDR-TB index patients, 1467 household contacts were identified and screened, 95 of them children < 5 years. Of these 172 (12% were symptomatic. Most common symptoms were cough 157 (91% and fever 107 (62%. 58 (34% presumptive TB contacts were not investigated. Of total contacts, 56 (3.8% were diagnosed with TB, among them 54(96% with MDR-TB and 2(4% with drug-susceptible-TB. The number needed to screen (NNS to identify a new MDR-TB case among adult household contacts was 27 and among presumptive adult and pediatric TB contacts was three. All 56 confirmed patients were registered for treatment. Conclusion: Screening household contacts of MDR-TB index cases may be considered a feasible and high yield option, in high-burden, low-resource settings within Pakistan. The number of presumptive TB contacts required to screen to identify a new MDR-TB case was unusually low, indicating an effective strategy that could easily be scaled-up. The screening and management of vulnerable adults and children living with patients having TB of any form is a major priority in the combined efforts

Culture and drug susceptibility testing among previously treated tuberculosis patients in the Dominican Republic, 2014

Directory of Open Access Journals (Sweden)

Katia J. Romero Mercado

Full Text Available ABSTRACT Multidrug-resistant tuberculosis (MDR-TB is a major public health concern that threatens global progress toward effective TB control. The risk of MDR-TB is increased in patients who have received previous TB treatment. This article describes the performance of culture and drug susceptibility testing (DST in patients registered as previously treated TB patients in the Dominican Republic in 2014, based on operational research that followed a retrospective cohort design and used routine program data. Under the current system of TB culturing and DST, the majority of patients with previously treated TB do not undergo DST, and those who do often experience considerable delay in obtaining their results. The lack of DST and delay in receiving DST results leads to underestimation of the number of MDR-TB cases and hinders the timely initiation of MDR-TB treatment.

Alcohol, hospital discharge, and socioeconomic risk factors for default from multidrug resistant tuberculosis treatment in rural South Africa: a retrospective cohort study.

Science.gov (United States)

Kendall, Emily A; Theron, Danie; Franke, Molly F; van Helden, Paul; Victor, Thomas C; Murray, Megan B; Warren, Robin M; Jacobson, Karen R

2013-01-01

Default from multidrug-resistant tuberculosis (MDR-TB) treatment remains a major barrier to cure and epidemic control. We sought to identify patient risk factors for default from MDR-TB treatment and high-risk time periods for default in relation to hospitalization and transition to outpatient care. We retrospectively analyzed a cohort of 225 patients who initiated MDR-TB treatment between 2007 through 2010 at a rural TB hospital in the Western Cape Province, South Africa. Fifty percent of patients were cured or completed treatment, 27% defaulted, 14% died, 4% failed treatment, and 5% transferred out. Recent alcohol use was common (63% of patients). In multivariable proportional hazards regression, older age (hazard ratio [HR]= 0.97 [95% confidence interval 0.94-0.99] per year of greater age), formal housing (HR=0.38 [0.19-0.78]), and steady employment (HR=0.41 [0.19-0.90]) were associated with decreased risk of default, while recent alcohol use (HR=2.1 [1.1-4.0]), recent drug use (HR=2.0 [1.0-3.6]), and Coloured (mixed ancestry) ethnicity (HR=2.3 [1.1-5.0]) were associated with increased risk of default (PDefaults occurred throughout the first 18 months of the two-year treatment course but were especially frequent among alcohol users after discharge from the initial four-to-five-month in-hospital phase of treatment, with the highest default rates occurring among alcohol users within two months of discharge. Default rates during the first two months after discharge were also elevated for patients who received care from mobile clinics. Among patients who were not cured or did not complete MDR-TB treatment, the majority defaulted from treatment. Younger, economically-unstable patients and alcohol and drug users were particularly at risk. For alcohol users as well as mobile-clinic patients, the early outpatient treatment phase is a high-risk period for default that could be targeted in efforts to increase treatment completion rates.

Silencage du gene MDR1 et resensibilisation des cellules MCF-7 MDR a la doxorubicine en utilisant les nanoparticules chitosane/MDR1-siARN

Science.gov (United States)

El-Ariss, Mohamad

Cancer is the leading cause of death in Canada and is responsible for about 30% of all deaths in the country.[1] It is estimated that by 2015, one in four Canadians (24% women and 29% men) will die from cancer. In the world and only for 2012, 14 million new cancer cases and 8.2 million deaths from the disease were reported.[2] The worst is yet to come because, according to World Health Organization, the number of new cases is expected to increase by about 70% over the next two decades. The high mortality associated with cancer is partly explained by the acquisition of drug resistance that make patients refractory to chemotherapy. In fact, cancer cells exposed to a cytotoxic agent during chemotherapy, may develop a resistance to this agent as well as various agents sharing structural or functional similarities. These cancer cells are known for multidrug resistance ("Multiple Drug resistant cells"). The development of resistance to chimiodrogues is a major public health problem that presents an obstacle for the development of new cancer treatments. MCF-7 MDR are established cell lines of human breast cancer that have developed resistance to chimiodrogues such as doxorubicin. MCF-7 MDR have the particularity to over-express P-gp protein that is responsible for the detoxification of cells by reflux of chimiodrogues. The purpose of this study was therefore to reduce the expression of P-gp, encoded by the MDR1 gene (also called gene ABCB1) in cancer cells MCF-7, and re-sensitize MCF-7 MDR cells to anti-cancer treatments. In order to modify MDR1 gene expression, we used small RNAi called siRNA that are specific to the MDR1 gene. In total, 4 duplexes of siRNA have been used: siRNA_1, siRNA_1M, siRNA_2 and siRNA_2M. Each of the duplexes strands is consists of 21 nucleic acids and has two protruding nucleic acids (overhangs) at the 3' end. siRNA_1 and siRNA_1M are complementary to the nucleic acid sequence (577-595 nucleic acids ) of the MDR1 gene, whereas siARN_2 and si

Multidrug-resistant tuberculosis treatment failure detection depends on monitoring interval and microbiological method

Science.gov (United States)

White, Richard A.; Lu, Chunling; Rodriguez, Carly A.; Bayona, Jaime; Becerra, Mercedes C.; Burgos, Marcos; Centis, Rosella; Cohen, Theodore; Cox, Helen; D'Ambrosio, Lia; Danilovitz, Manfred; Falzon, Dennis; Gelmanova, Irina Y.; Gler, Maria T.; Grinsdale, Jennifer A.; Holtz, Timothy H.; Keshavjee, Salmaan; Leimane, Vaira; Menzies, Dick; Milstein, Meredith B.; Mishustin, Sergey P.; Pagano, Marcello; Quelapio, Maria I.; Shean, Karen; Shin, Sonya S.; Tolman, Arielle W.; van der Walt, Martha L.; Van Deun, Armand; Viiklepp, Piret

2016-01-01

Debate persists about monitoring method (culture or smear) and interval (monthly or less frequently) during treatment for multidrug-resistant tuberculosis (MDR-TB). We analysed existing data and estimated the effect of monitoring strategies on timing of failure detection. We identified studies reporting microbiological response to MDR-TB treatment and solicited individual patient data from authors. Frailty survival models were used to estimate pooled relative risk of failure detection in the last 12 months of treatment; hazard of failure using monthly culture was the reference. Data were obtained for 5410 patients across 12 observational studies. During the last 12 months of treatment, failure detection occurred in a median of 3 months by monthly culture; failure detection was delayed by 2, 7, and 9 months relying on bimonthly culture, monthly smear and bimonthly smear, respectively. Risk (95% CI) of failure detection delay resulting from monthly smear relative to culture is 0.38 (0.34–0.42) for all patients and 0.33 (0.25–0.42) for HIV-co-infected patients. Failure detection is delayed by reducing the sensitivity and frequency of the monitoring method. Monthly monitoring of sputum cultures from patients receiving MDR-TB treatment is recommended. Expanded laboratory capacity is needed for high-quality culture, and for smear microscopy and rapid molecular tests. PMID:27587552

Risk Factors for Acquisition of Drug Resistance during Multidrug-Resistant Tuberculosis Treatment, Arkhangelsk Oblast, Russia, 2005–2010

Science.gov (United States)

Ershova, Julia; Vlasova, Natalia; Nikishova, Elena; Tarasova, Irina; Eliseev, Platon; Maryandyshev, Andrey O.; Shemyakin, Igor G.; Kurbatova, Ekaterina; Cegielski, J. Peter

2015-01-01

Acquired resistance to antituberculosis drugs decreases effective treatment options and the likelihood of treatment success. We identified risk factors for acquisition of drug resistance during treatment for multidrug-resistant tuberculosis (MDR TB) and evaluated the effect on treatment outcomes. Data were collected prospectively from adults from Arkhangelsk Oblast, Russia, who had pulmonary MDR TB during 2005–2008. Acquisition of resistance to capreomycin and of extensively drug-resistant TB were more likely among patients who received 3 effective drugs (9.4% vs. 0% and 8.6% vs. 0.8%, respectively). Poor outcomes were more likely among patients with acquired capreomycin resistance (100% vs. 25.9%), acquired ofloxacin resistance (83.6% vs. 22.7%), or acquired extensive drug resistance (100% vs. 24.4%). To prevent acquired drug resistance and poor outcomes, baseline susceptibility to first- and second-line drugs should be determined quickly, and treatment should be adjusted to contain >3 effective drugs. PMID:25988954

Knowledge and Attitude about Multidrug-Resistant Tuberculosis among Healthcare Workers in Public Health Centres

Directory of Open Access Journals (Sweden)

Bony Wiem Lestari

2016-12-01

Full Text Available Background: Multidrug-resistant Tuberculosis (MDR-TB is a significant public health problem and poses a threat to global tuberculosis (TB control. In 2015, at least 504 new MDR-TB cases were identified in Indonesia. Treating MDR-TB patients is very challenging. It may take more than two years for MDR-TB treatment. Therefore, it is crucial healthcare workers (HCWs are knowledgeable about MDR-TB. The aim of this study was to measure level of knowledge and attitude regarding MDR-TB among HCWs in public health centres. Methods: A cross-sectional study was conducted at 73 Public Health Centres in Bandung the capital of West Java Province from August until November 2015. The samples were 73 TB nurses and 32 laboratory staff. A self-administered questionnaire was given comprising 27 knowledge questions and 29 attitude questions. Correlation between knowledge and attitude scores was calculated by Pearson correlation test. Results: The majority of study participants were women (82.9%, married (92.4%, nursing staff (65.7% with history of TB training (98.1%. Most of the participants were 40-59 years old (69.5% with working experience in TB programme < 10 years (69.5%. Less than half (38.1% of study participants had good knowledge. In terms of attitude, more than half (53.3% of study participants had a positive attitude towards MDR-TB. Conclusions: The level of knowledge among HCWs about MDR-TB is still at an unacceptable level. Certain educational interventions aim to ensure prompt diagnosis, implement infection control and accurate treatment should be established among those HCWs.

The making of a public health problem: multi-drug resistant tuberculosis in India.

Science.gov (United States)

Engel, Nora C

2013-07-01

This paper examines how actors construct the public problem of multi-drug resistant tuberculosis (MDR-TB) in India. MDR-TB has been framed by the World Health Organization as a pressing, global public health problem. The responses to MDR-TB are complicated as treatment takes longer and is more expensive than routine TB treatment. This is particularly problematic in countries, such as India, with high patient loads, a large and unregulated private sector, weak health systems and potentially high numbers of MDR-TB cases. This paper analyses how actors struggle for control over ownership, causal theories and political responsibility of the public problem of MDR-TB in India. It combines Gusfield's theory on the construction of public problems with insights from literature on the social construction of diseases and on medical social control. It highlights that there are flexible definitions of public problems, which are negotiated among actor groups and which shift over time. The Indian government has shifted its policy in recent years and acknowledged that MDR-TB needs to be dealt with within the TB programme. The study results reveal how the policy shift happened, why debates on the construction of MDR-TB as a public problem in India continue, and why actors with alternative theories than the government do not succeed in their lobbying efforts. Two main arguments are put forward. First, the construction of the public problem of MDR-TB in India is a social and political process. The need for representative data, international influence and politics define what is controllable. Second, the government seems to be anxious to control the definition of India's MDR-TB problem. This impedes an open, critical and transparent discussion on the definition of the public problem of MDR-TB, which is important in responding flexibly to emerging public health challenges.

Primary and secondary anti-tuberculosis drug resistance in Hitossa District of Arsi Zone, Oromia Regional State, Central Ethiopia

Directory of Open Access Journals (Sweden)

Shallo Daba Hamusse

2016-07-01

Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB drugs which is resistant to the major first-line anti-TB drugs, Isoniazid and Rifampicin, has become a major global challenge in tuberculosis (TB control programme. However, its burden at community level is not well known. Thus, the aim of study was to assess the prevalence of primary and secondary resistance to any first line anti-TB drugs and MDR TB in Hitossa District of Oromia Regional State, Central Ethiopia. Methods Population based cross- sectional study was conducted on individuals aged ≥15 years. Those with symptoms suggestive of TB were interviewed and two sputum specimens were collected from each and examined using Lowenstein-Jensen (LJ culture medium. Further, the isolates were confirmed by the Ziehl-Neelsen microscopic examination method. Drug susceptibility test (DST was also conducted on LJ medium using a simplified indirect proportion method. The resistance strains were then determined by percentage of colonies that grew on the critical concentration of Isoniazid, Streptomycin, Rifampicin and Ethambutol. Results The overall resistance of all forms of TB to any first-line anti-TB drug was 21.7 %. Of the total new and previously treated culture positive TB cases, 15.3 and 48.8 % respectively were found to be a resistant to any of the first-line anti-TB drugs. Further, of all forms of TB, the overall resistance of MDR-TB was 4.7 %. However, of the total new TB cases, 2.4 % had primary while 14.3 % had secondary MDR-TB. Resistance to any of the first-line anti-TB drugs (adjusted odd ratio (AOR, 8.1; 95 % CI: 2.26–29.30 and MDR-TB (AOR, 7.1; 95 % CI: 2.6–43.8 was found to be linked with previous history of anti-TB treatment. Conclusions The study has identified a high rate of primary and secondary resistance to any of the first-line anti-TB drugs and MDR-TB in the study area. The resistance may have resulted from sub-optimal performance of directly observed

Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

International Nuclear Information System (INIS)

Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok; Koh, Won-Jung; Kwon, O Jung; Kang, Eun Young; Kim, Seonwoo

2006-01-01

The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

Energy Technology Data Exchange (ETDEWEB)

Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok [Sungkyunkwan University School of Medicine, Department of Radiology and Center for Imaging Science, Samsung Medical Center, Seoul (Korea); Koh, Won-Jung; Kwon, O Jung [Sungkyunkwan University School of Medicine, Division of Pulmonary and Critical Care Medicine, Department of Medicine, Samsung Medical Center, Seoul (Korea); Kang, Eun Young [Korea University Guro Hospital, Department of Diagnostic Radiology, Korea University College of Medicine, Seoul (Korea); Kim, Seonwoo [Sungkyunkwan University School of Medicine, Biostatistics Unit of the Samsung Biomedical Research Institute, Samsung Medical Center, Seoul (Korea)

2006-09-15

The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

Antiretroviral treatment uptake in patients with HIV associated TB ...

African Journals Online (AJOL)

Background. Delivery of integrated care for patients with HIV-associated TB is challenging. We assessed the uptake and timing of antiretroviral treatment (ART) among eligible patients attending a primary care service with co-located ART and TB clinics. Methods. In a retrospective cohort study, all HIV-associated TB patients ...

Multidrug-resistant and extensively drug-resistant tuberculosis: implications for the HIV epidemic and antiretroviral therapy rollout in South Africa.

Science.gov (United States)

Andrews, Jason R; Shah, N Sarita; Gandhi, Neel; Moll, Tony; Friedland, Gerald

2007-12-01

Drug-resistant tuberculosis (TB) is emerging as a major clinical and public health challenge in areas of sub-Saharan Africa where there is a high prevalence of human immunodeficiency virus (HIV) infection. TB drug-resistance surveillance in this region has been limited by laboratory capacity and the public health infrastructure; however, with the maturation of the HIV epidemic, the burden of drug-resistant TB is increasing rapidly. The recent discovery of large numbers of cases of multidrug-resistant (MDR) TB and extensively drug-resistant (XDR) TB in South Africa likely represents an unrecognized and evolving epidemic rather than sporadic, localized outbreaks. The combination of a large population of HIV-infected susceptible hosts with poor TB treatment success rates, a lack of airborne infection control, limited drug-resistance testing, and an overburdened MDR-TB treatment program provides ideal conditions for an MDR-TB and XDR-TB epidemic of unparalleled magnitude. In the present article, we review the history of drug-resistant TB in South Africa, describe its interaction with the HIV epidemic and the resultant consequences, and suggest measures necessary for controlling MDR-TB and XDR-TB in this context. A successful response to the emergence of MDR-TB and XDR-TB will necessitate increased resources for and collaboration between TB and HIV programs.

Is one sputum specimen as good as two during follow-up cultures for monitoring multi drug resistant tuberculosis patients in India?

Directory of Open Access Journals (Sweden)

Sharath Burugina Nagaraja

Full Text Available BACKGROUND: In India, the Revised National Tuberculosis Control Programme (RNTCP has adopted the strategy of examining two specimens during follow-up culture examinations to monitor the treatment response of multi-drug resistant tuberculosis (MDR-TB patients. OBJECTIVES: To determine the incremental yield of the second sputum specimen during follow-up culture examinations among patients with MDR-TB and the effect on case management on changing from two to one specimen follow-up strategy. METHODS: A cross sectional record review of MDR-TB patients registered during 2008-09 under RNTCP was undertaken in three MDR-TB treatment sites of India. RESULTS: Of 1721 pairs of follow-up sputum culture examinations done among 220 MDR-TB patients, 451(26% were positive with either of the two specimens; 29(1.7% were culture positive only on the second specimen indicating the incremental yield. To detect one additional culture positive result on the second specimen, 59 specimens needed to be processed. If we had examined only one specimen, we would have missed 29 culture-positive results. By current RNTCP guidelines, however, a single specimen policy would have altered case management in only 3(0.2% instances, where patients would have missed a one month extension of the intensive phase of MDR-TB treatment. There is no meaningful advantage in using two specimens for the monitoring of MDR-TB patients. A single specimen policy could be safely implemented with negligible clinical effect on MDR-TB patients and favourable resource implications for RNTCP.

A user-friendly mathematical modelling web interface to assist local decision making in the fight against drug-resistant tuberculosis.

Science.gov (United States)

Ragonnet, Romain; Trauer, James M; Denholm, Justin T; Marais, Ben J; McBryde, Emma S

2017-05-30

Multidrug-resistant and rifampicin-resistant tuberculosis (MDR/RR-TB) represent an important challenge for global tuberculosis (TB) control. The high rates of MDR/RR-TB observed among re-treatment cases can arise from diverse pathways: de novo amplification during initial treatment, inappropriate treatment of undiagnosed MDR/RR-TB, relapse despite appropriate treatment, or reinfection with MDR/RR-TB. Mathematical modelling allows quantification of the contribution made by these pathways in different settings. This information provides valuable insights for TB policy-makers, allowing better contextualised solutions. However, mathematical modelling outputs need to consider local data and be easily accessible to decision makers in order to improve their usefulness. We present a user-friendly web-based modelling interface, which can be used by people without technical knowledge. Users can input their own parameter values and produce estimates for their specific setting. This innovative tool provides easy access to mathematical modelling outputs that are highly relevant to national TB control programs. In future, the same approach could be applied to a variety of modelling applications, enhancing local decision making.

Multidrug-resistant pulmonary tuberculosis in Los Altos, Selva and Norte regions, Chiapas, Mexico.

Science.gov (United States)

Sánchez-Pérez, H J; Díaz-Vázquez, A; Nájera-Ortiz, J C; Balandrano, S; Martín-Mateo, M

2010-01-01

To analyse the proportion of multidrug-resistant tuberculosis (MDR-TB) in cultures performed during the period 2000-2002 in Los Altos, Selva and Norte regions, Chiapas, Mexico, and to analyse MDR-TB in terms of clinical and sociodemographic indicators. Cross-sectional study of patients with pulmonary tuberculosis (PTB) from the above regions. Drug susceptibility testing results from two research projects were analysed, as were those of routine sputum samples sent in by health personnel for processing (n = 114). MDR-TB was analysed in terms of the various variables of interest using bivariate tests of association and logistic regression. The proportion of primary MDR-TB was 4.6% (2 of 43), that of secondary MDR-TB was 29.2% (7/24), while among those whose history of treatment was unknown the proportion was 14.3% (3/21). According to the logistic regression model, the variables most highly associated with MDR-TB were as follows: having received anti-tuberculosis treatment previously, cough of >3 years' duration and not being indigenous. The high proportion of MDR cases found in the regions studied shows that it is necessary to significantly improve the control and surveillance of PTB.

Optimal treatment interruptions control of TB transmission model

Science.gov (United States)

Nainggolan, Jonner; Suparwati, Titik; Kawuwung, Westy B.

2018-03-01

A tuberculosis model which incorporates treatment interruptions of infectives is established. Optimal control of individuals infected with active TB is given in the model. It is obtained that the control reproduction numbers is smaller than the reproduction number, this means treatment controls could optimize the decrease in the spread of active TB. For this model, controls on treatment of infection individuals to reduce the actively infected individual populations, by application the Pontryagins Maximum Principle for optimal control. The result further emphasized the importance of controlling disease relapse in reducing the number of actively infected and treatment interruptions individuals with tuberculosis.

Integration of HIV and TB services results in improved TB treatment outcomes and earlier prioritized ART initiation in a large urban HIV clinic in Uganda.

Science.gov (United States)

Hermans, Sabine M; Castelnuovo, Barbara; Katabira, Catherine; Mbidde, Peter; Lange, Joep M A; Hoepelman, Andy I M; Coutinho, Alex; Manabe, Yukari C

2012-06-01

The World Health Organization recommends that treatment of tuberculosis (TB) in HIV-infected patients should be integrated with HIV care. In December 2008, a separate outdoor-integrated TB/HIV clinic was instituted for attendees of a large urban HIV clinic in Uganda. We sought to evaluate associated TB and HIV treatment outcomes. Routinely collected clinical, pharmacy, and laboratory data were merged with TB clinic data for patients initiating TB treatment in 2009 and with TB register data for patients in 2007. TB treatment outcomes and (timing of) antiretroviral therapy (ART) initiation in ART-naive patients [overall and stratified by CD4+ T cell (CD4) count] in 2007 and 2009 were compared. Nosocomial transmission rates could not be assessed. Three hundred forty-six patients were initiated on TB treatment in 2007 and 366 in 2009. Median CD4 counts at TB diagnosis did not differ. TB treatment cure or completion increased from 62% to 68%, death or default decreased from 33% to 25% (P ART-naive TB patients were initiated on ART in 2009 versus 2007 (57% and 66%, P = 0.031), but this decrease was only in patients with CD4 counts >250 cells per cubic millimeter (19% vs. 48%, P = 0.003). More patients were started on ART during TB treatment (94% vs. 78%, P ART initiation. This supports rollout of a fully integrated TB/HIV service delivery model throughout high-prevalence TB and HIV settings.

Multi-drug-resistant tuberculosis in HIV positive patients in Eastern Europe.

Science.gov (United States)

Post, Frank A; Grint, Daniel; Werlinrud, Anne Marie; Panteleev, Alexander; Riekstina, Vieja; Malashenkov, Evgeniy A; Skrahina, Alena; Duiculescu, Dan; Podlekareva, Daria; Karpov, Igor; Bondarenko, Vasiliy; Chentsova, Nelly; Lundgren, Jens; Mocroft, Amanda; Kirk, Ole; Miro, Jose M

2014-03-01

Observational data from Eastern Europe on the management and outcome of multi-drug-resistant tuberculosis (MDR TB) in HIV positive populations remain sparse in the English-language literature. We compared clinical characteristics and outcomes of 55 patients who were diagnosed with HIV and MDR TB in Eastern Europe between 2004 and 2006 to 89 patients whose Mycobacterium tuberculosis isolates were susceptible to isoniazid and rifampicin. Patients with HIV and MDR TB were young and predominantly male with high rates of intravenous drug use, imprisonment and hepatitis C co-infection. Eighty-four per cent of patients with MDR TB had no history of previous TB drug exposure suggesting that the majority of MDR TB resulted from transmission of drug-resistant M. tuberculosis. The use of non-standardized tuberculosis treatment was common, and the use of antiretroviral therapy infrequent. Compared to those with susceptible tuberculosis, patients with MDR TB were less likely to achieve cure or complete tuberculosis treatment (21.8% vs. 62.9%, p < 0.0001), and they were more likely to die (65.5% vs. 27.0%, p < 0.0001). Our study documents suboptimal management and poor outcomes in HIV positive patients with MDR TB. Implementation of WHO guidelines, rapid TB diagnostics and TB drug susceptibility testing for all patients remain a priority in this region. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

TO EVALUATE PREVALENCE OF DIABETES AND HIV IN NEWLY-DIAGNOSED MULTIDRUGRESISTANT TUBERCULOSIS PATIENTS ADMITTED FOR PRETREATMENT EVALUATION IN DOTS PLUS CENTRE, THANJAVUR

Directory of Open Access Journals (Sweden)

Namasivayam Kuppusamy

2017-07-01

Full Text Available BACKGROUND More than 9 million people fall sick with tuberculosis every year in the world. People with weak immune system as a result of disease like diabetes and HIV are at high risk of developing MDR-TB infection. Proper monitoring and evaluation are needed to control MDR-TB in HIV and diabetes patients. The aim of the study is to find the prevalence of diabetes and HIV among MDR-TB patients admitted for pretreatment evaluation in Dots Plus Centre, Thanjavur Medical College, Tamilnadu. MATERIALS AND METHODS The medical records with datas of 96 patients with MDR-TB who are having diabetes and HIV infection were examined. These cases were diagnosed and registered during January 2015 to December 2015. These patients had drug resistant to first line antituberculosis drugs (isoniazid and rifampicin. Duration of diabetes and HIV infection were noted. Age were categorised in to four groups- 20-29 years, 30-39 years, 40-49 years and above 50 years. The potential risk of association of diabetes, HIV or both with MDR-TB was evaluated by univariate conditional logistic regression model. RESULTS Out of 96 newly-diagnosed MDR-TB patients, prevalence of diabetes is about 34.37%, out of which (84.84% were males and (15.15% were females. Out of 34.37%, 38.54% of patients had controlled diabetes, 61.45% patients had uncontrolled diabetes. Nearly, more than half of diabetes patient falls under uncontrolled diabetes. More number of male patients had diabetes with MDR-TB when compared to females. 10.4% of these persons got oral hypoglycaemic agent and 6.3% got insulin as treatment for diabetes. 1% had irregular treatment with poor compliance. Prevalence of HIV is about 4.16% out of which 75% were males and 25% were females. One patient had both diabetes and HIV with MDR tuberculosis. CONCLUSION In our retrospective study, prevalence of diabetes in MDR-TB patients were more common in males than in females, most of them were in the age groups of 40 years and above

Congenital Multidrug-resistant Tuberculosis in a Neonate: A Case Report.

Science.gov (United States)

Lhadon, Tenzin; Jullien, Sophie

2018-04-20

Multidrug-resistant tuberculosis (MDR-TB) is a well-identified raising public health concern worldwide. However, the data available on MDR-TB in children and particularly in the neonate age group are limited. Congenital tuberculosis (TB) is rare, and its diagnosis is challenging because of non-specific manifestations. The choice of anti-tubercular drugs is difficult because of the lack of international consensus as a consequence of the scarcity of evidence-based data on this age group. We hereby present a case from Bhutan of a 23-day-old male neonate with congenital MDR-TB. His mother was diagnosed with disseminated TB, and treatment was commenced 11 days post-partum. Congenital transmission of TB was suspected, as direct postnatal transmission was unlikely and thorough screening of contacts for TB was negative. In this case, the mother's MDR-TB status was revealed only after her newborn's MDR-TB diagnosis.

Patient reported delays in seeking treatment for Tuberculosis (TB among adult and pediatric TB patients and TB patients co-infected with HIV in Lima, Peru: a qualitative study

Directory of Open Access Journals (Sweden)

Valerie A Paz-Soldan

2014-12-01

Full Text Available Abstract: Tuberculosis (TB remains a significant public health challenge worldwide, and particularly in Peru with one of the highest incidence rates in Latin America. TB patient behavior has a direct influence on whether a patient will receive timely diagnosis and successful treatment of their illness. Objectives: The objective was to understand the complex factors that can impact TB patient health seeking behavior. Methods: In-depth interviews were conducted with adult and parents of pediatric patients receiving TB treatment (n=43, within that group a sub-group was also co-infected with HIV (n=11. Results: Almost all of the study participants recognized delays in seeking either their child’s or their own diagnosis of their TB symptoms. The principal reasons for treatment-seeking delays were lack of knowledge and confusion of tuberculosis symptoms, fear and embarrassment of receiving a TB diagnosis, and a patient tendency to self-medicate prior to seeking formal medical attention.Conclusions: Health promotion activities that target patient delays have the potential to improve individual patient outcomes and mitigate the spread of TB at a community level.

Access to free or low-cost tuberculosis treatment for migrants and refugees along the Thailand-Myanmar border in Tak province, Thailand.

Science.gov (United States)

Tschirhart, Naomi; Nosten, Francois; Foster, Angel M

2016-07-07

In Tak province, Thailand migrants and refugees from Myanmar navigate a pluralistic healthcare system to seek Tuberculosis (TB) care from a variety of government and non-governmental providers. This multi-methods qualitative study examined access to TB, TB/HIV and multidrug-resistant tuberculosis (MDR-TB) treatment with an emphasis on barriers to care and enabling factors. In the summer and fall of 2014, we conducted 12 key informant interviews with public health officials and TB treatment providers. We also conducted 11 focus group discussions with migrants and refugees who were receiving TB, TB/HIV and MDR-TB treatment in Tak province as well as non-TB patients. We analyzed these data through thematic analysis using both predetermined and emergent codes. As a second step in the qualitative analysis, we explored the barriers and enabling factors separately for migrants and refugees. We found that refugees face fewer barriers to accessing TB treatment than migrants. For both migrants and refugees, legal status plays an important intermediary role in influencing the population's ability to access care and eligibility for treatment. Our results suggest that there is a large geographical catchment area for migrants who seek TB treatment in Tak province that extends beyond provincial boundaries. Migrant participants described their ability to seek care as linked to the financial and non-financial resources required to travel and undergo treatment. Patients identified language of health services, availability of free or low cost services, and psychosocial support as important health system characteristics that affect accessibility. Access to TB treatment for migrants and refugees occurs at the interface of health system accessibility, population ability and legal status. In Tak province, migrant patients draw upon their social networks and financial resources to navigate a pathway to treatment. We revised a conceptual framework for access to healthcare to incorporate

Emergence of fluoroquinolone resistance among drug resistant tuberculosis patients at a tertiary care facility in Karachi, Pakistan.

Science.gov (United States)

Zaidi, Syed Mohammad Asad; Haseeb, Abdul; Habib, Shifa Salman; Malik, Amyn; Khowaja, Saira; SaifUllah, Nausheen; Rizvi, Nadeem

2017-07-25

Pakistan is classified as one of the high multi-drug resistant tuberculosis (MDR-TB) burden countries. A poorly regulated private sector, over-prescription of antibiotics and self-medication has led to augmented rates of drug-resistance in the country. Pakistan's first national anti-tuberculosis drug resistance survey identified high prevalence of fluoroquinolone resistance among MDR-TB patients. Further institutional evidence of fluoroquinolone drug-resistance can support re-evaluation of treatment regimens as well as invigorate efforts to control antibiotic resistance in the country. In this study, data for drug-susceptibility testing (DST) was retrospectively analyzed for a total of 133 patients receiving MDR-TB treatment at the Chest Department of Jinnah Postgraduate Medical Center, Karachi, Pakistan. Frequency analyses for resistance patterns was carried out and association of fluoroquinolone (ofloxacin) resistance with demographics and past TB treatment category were assessed. Within first-line drugs, resistance to isoniazid was detected in 97.7% of cases, followed by rifampicin (96.9%), pyrazinamide (86.4%), ethambutol (69.2%) and streptomycin (64.6%). Within second-line drugs, ofloxacin resistance was detected in 34.6% of cases. Resistance to ethionamide and amikacin was 2.3% and 1.6%, respectively. Combined resistance of oflaxacin and isoniazid was detected in 33.9% of cases. Age, gender and past TB treatment category were not significantly associated with resistance to ofloxacin. Fluoroquinolone resistance was observed in an alarmingly high proportion of MDR-TB cases. Our results suggest caution in their use for empirical management of MDR-TB cases and recommended treatment regimens for MDR-TB may require re-evaluation. Greater engagement of private providers and stringent pharmacy regulations are urgently required.

Cost-effectiveness of initiating antiretroviral therapy at different points in TB treatment in HIV-TB co-infected ambulatory patients in South Africa

Science.gov (United States)

Naidoo, Kogieleum; Grobler, Anneke C; Deghaye, Nicola; Reddy, Tarylee; Gengiah, Santhanalakshmi; Gray, Andrew; Karim, Salim Abdool

2015-01-01

Objective Initiation of antiretroviral therapy (ART) during tuberculosis (TB) treatment improves survival in TB-HIV co-infected patients. In patients with CD4+ counts benefit of early ART initiation. The purpose of this study was to assess the costs and cost effectiveness of starting ART at various time points during TB treatment in patients with CD4+ counts ≥50cells/mm3. Methods In the SAPiT trial, 642 HIV-TB co-infected patients were randomized to three arms, either receiving ART within 4 weeks of starting TB treatment (early treatment arm; Arm-1), after the intensive phase of TB treatment (late treatment arm; Arm-2), or after completing TB treatment (sequential arm; Arm-3). Direct healthcare costs were measured from a provider perspective using a micro-costing approach. The incremental cost per death averted was calculated using the trial outcomes. Results For patients with CD4+ count≥50cells/mm3, median monthly variable costs per patient were $116, $113 and $102 in Arms-1, -2 and -3, respectively. There were 12 deaths in 177 patients in Arm-1, 8 deaths in 180 patients in the Arm-2 and 19 deaths in 172 patients in Arm-3. While the costs were lower in Arm-3, it had a substantially higher mortality rate. The incremental cost per death averted associated with moving from Arm-3 to Arm-2 was $4199. There was no difference in mortality between Arm-1 and Arm-2, but Arm-1 was slightly more expensive. Conclusions Initiation of ART after the completion of the intensive phase of TB treatment is cost effective for patients with CD4+ counts≥50cells/mm3. PMID:26167618

Multidrug-Resistant Tuberculosis and Its Association with Adrenal Insufficiency: Assessment with the Low-Dose ACTH Stimulation Test

Directory of Open Access Journals (Sweden)

René Rodríguez-Gutiérrez

2016-01-01

Full Text Available Background. Multidrug-resistant tuberculosis (MDR-TB is a major public health care concern that affects the life of millions of people around the world. The association of tuberculosis and adrenal insufficiency is well known; however, it is thought to be less prevalent every time. A spike in TB incidence and a lack of evidence of this association in patients with MDR-TB call for reassessment of an illness (adrenal dysfunction that if not diagnosed could seriously jeopardize patients’ health. Objective. To determine the prevalence of adrenocortical insufficiency in patients with MDR-TB using the low-dose (1 μg ACTH stimulation test at baseline and at 6–12 months of follow-up after antituberculosis treatment and culture conversion. Methods. A total of 48 men or women, aged ≥18 years (HIV-negative patients diagnosed with pulmonary MDR-TB were included in this prospective observational study. Blood samples for serum cortisol were taken at baseline and 30 and 60 minutes after 1 μg ACTH stimulation at our tertiary level university hospital before and after antituberculosis treatment. Results. Forty-seven percent of subjects had primary MDR-TB; 43.8% had type 2 diabetes; none were HIV-positive. We found at enrollment 2 cases (4.2% of adrenal insufficiency taking 500 nmol/L as the standard cutoff point value and 4 cases (8.3% alternatively, using 550 nmol/L. After antituberculosis intensive phase drug-treatment and a negative mycobacterial culture (10.2±3.6 months adrenocortical function was restored in all cases. Conclusions. In patients with MDR-TB, using the low-dose ACTH stimulation test, a low prevalence of mild adrenal insufficiency was observed. After antituberculosis treatment adrenal function was restored in all cases. Given the increasing and worrying epidemic of MDR-TB these findings have important clinical implications that may help clinicians and patients make better decisions when deciding to test for adrenocortical

The impact of HIV status and antiretroviral treatment on TB treatment outcomes of new tuberculosis patients attending co-located TB and ART services in South Africa: a retrospective cohort study.

Science.gov (United States)

Nglazi, Mweete D; Bekker, Linda-Gail; Wood, Robin; Kaplan, Richard

2015-11-19

The implementation of collaborative TB-HIV services is challenging. We, therefore, assessed TB treatment outcomes in relation to HIV infection and antiretroviral therapy (ART) among TB patients attending a primary care service with co-located ART and TB clinics in Cape Town, South Africa. In this retrospective cohort study, all new TB patients aged ≥ 15 years who registered and initiated TB treatment between 1 October 2009 and 30 June 2011 were identified from an electronic database. The effects of HIV-infection and ART on TB treatment outcomes were analysed using a multinomial logistic regression model, in which treatment success was the reference outcome. The 797 new TB patients included in the analysis were categorized as follows: HIV- negative, in 325 patients (40.8 %); HIV-positive on ART, in 339 patients (42.5 %) and HIV-positive not on ART, in 133 patients (16.7 %). Overall, bivariate analyses showed no significant difference in death and default rates between HIV-positive TB patients on ART and HIV-negative patients. Statistically significant higher mortality rates were found among HIV-positive patients not on ART compared to HIV-negative patients (unadjusted odds ratio (OR) 3.25; 95 % confidence interval (CI) 1.53-6.91). When multivariate analyses were conducted, the only significant difference between the patient categories on TB treatment outcomes was that HIV-positive TB patients not on ART had significantly higher mortality rates than HIV-negative patients (adjusted OR 4.12; 95 % CI 1.76-9.66). Among HIV-positive TB patients (n = 472), 28.2 % deemed eligible did not initiate ART in spite of the co-location of TB and ART services. When multivariate analyses were restricted to HIV-positive patients in the cohort, we found that being HIV-positive not on ART was associated with higher mortality (adjusted OR 7.12; 95 % CI 2.95-18.47) and higher default rates (adjusted OR 2.27; 95 % CI 1.15-4.47). There was no significant difference in death and

Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time.

Science.gov (United States)

Dalal, Alpa; Pawaskar, Akshay; Das, Mrinalini; Desai, Ranjan; Prabhudesai, Pralhad; Chhajed, Prashant; Rajan, Sujeet; Reddy, Deepesh; Babu, Sajit; Jayalakshmi, T K; Saranchuk, Peter; Rodrigues, Camilla; Isaakidis, Petros

2015-01-01

While the high burden of multidrug-resistant tuberculosis (MDR-TB) itself is a matter of great concern, the emergence and rise of advanced forms of drug-resistance such as extensively drug-resistant TB (XDR-TB) and extremely drug-resistant TB (XXDR-TB) is more troubling. The aim of this study was to investigate the trends over time of patterns of drug resistance in a sample of MDR-TB patients in greater metropolitan Mumbai, India. This was a retrospective, observational study of drug susceptibility testing (DST) results among MDR-TB patients from eight health care facilities in greater Mumbai between 2005 and 2013. We classified resistance patterns into four categories: MDR-TB, pre-XDR-TB, XDR-TB and XXDR-TB. A total of 340 MDR-TB patients were included in the study. Pre-XDR-TB was the most common form of drug-resistant TB observed overall in this Mumbai population at 56.8% compared to 29.4% for MDR-TB. The proportion of patients with MDR-TB was 39.4% in the period 2005-2007 and 27.8% in 2011-2013, while the proportion of those with XDR-TB and XXDR-TB was changed from 6.1% and 0% respectively to 10.6% and 5.6% during the same time period. During the same periods, the proportions of patients with ofloxacin, moxifloxacin and ethionamide resistance significantly increased from 57.6% to 75.3%, from 60.0% to 69.5% and from 24.2% to 52.5% respectively (pMumbai highlight the need for individualized drug regimens, designed on the basis of DST results involving first- and second-line anti-TB drugs and treatment history of the patient. A drug-resistant TB case-finding strategy based on molecular techniques that identify only rifampicin resistance will lead to initiation of suboptimal treatment regimens for a significant number of patients, which may in turn contribute to amplification of resistance and transmission of strains with increasingly advanced resistance within the community.

Optimizing the Safety of Multidrug-resistant Tuberculosis Therapy in Namibia

NARCIS (Netherlands)

Sagwa, Evans

2017-01-01

Introduction: Multidrug-resistant tuberculosis (MDR-TB), a growing global menace, is seriously undermining the previous successes made in the elimination of TB. MDR-TB treatment takes a long time, is complex, and is frequently associated with the occurrence of adverse drug reactions, some of which

Testing for TB Infection

Science.gov (United States)

... Adverse Events TB Treatment of Persons Living with HIV TB Treatment and Pregnancy TB Treatment for Children Drug-Resistant TB Research TB Epidemiologic Studies Consortium Research Projects Publications TB Trials Consortium Study ...

Multi-drug-resistant tuberculosis in HIV positive patients in Eastern Europe

DEFF Research Database (Denmark)

Post, Frank A; Grint, Daniel; Efsen, Anne Marie Werlinrud

2014-01-01

Observational data from Eastern Europe on the management and outcome of multi-drug-resistant tuberculosis (MDR TB) in HIV positive populations remain sparse in the English-language literature.We compared clinical characteristics and outcomes of 55 patients who were diagnosed with HIV and MDR TB...... in Eastern Europe between 2004 and 2006 to 89 patients whose Mycobacterium tuberculosis isolates were susceptible to isoniazid and rifampicin.Patients with HIV and MDR TB were young and predominantly male with high rates of intravenous drug use, imprisonment and hepatitis C co-infection. Eighty-four per cent...... of patients with MDR TB had no history of previous TB drug exposure suggesting that the majority of MDR TB resulted from transmission of drug-resistant M. tuberculosis. The use of non-standardized tuberculosis treatment was common, and the use of antiretroviral therapy infrequent. Compared to those...

Adverse reactions among patients being treated for multi-drug resistant tuberculosis at Abbassia Chest Hospital

Directory of Open Access Journals (Sweden)

Mohammad A. Tag El Din

2015-10-01

Conclusions: There is a relation between both tobacco smoking and drug addiction, and MDR TB. The most common type of resistance is acquired resistance because of lack of adherence to treatment or inappropriate treatment. The most common co-morbidities associated with MDR TB are diabetes and chronic obstructive lung diseases. The most important predictors of patients’ outcome are sputum conversion, number of previous TB treatment and presence of co-morbidities.

Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

Science.gov (United States)

Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

2016-01-01

Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

Experience with LDR and MDR brachytherapy for cervical cancer

International Nuclear Information System (INIS)

Okawa, Tomohiko; Okawa, Midori-Kita; Kaneyasu, Yuko; Karasawa, Kumiko; Fukuhara, Noboru

1996-01-01

As the brachytherapy dose-rate increases, it is necessary to reduce the total dose or to increase the fraction number with reducing the fraction dose in order not to increase the incidence of the late effect. With the introduction to the Tokyo Women's Medical College, Hospital of a remote afterloading system of Selectron - MDR, delivering dose-rate to point A became approximately twice of that with our classical cesium LDR manual afterloading technique. Material and Methods: Between 1987 to 1993 a total of, previously untreated 74 patients with cervical cancer received MDR brachytherapy using a Selection - MDR. This analysis is therefore of those patients series who underwent radical radioradiotherapy with MDR, 1987-1993, in comparison with the 347 cases who were treated with classical manual LDR afterloading machine, 1969-1986. The treatment was a brachytherapy during external radiotherapy and dos-rate at point A was 160-180 cGy/hour with MDR and 80-90 cGy/hour with LDR. The mean fraction dose was 800-1000 cGy by MDR and 1000-1200 cGy by LDR and fraction number was increased 1-2times in the MDR group with no change of a total dose at point A. Results: The mean age was 63.3 years in the MDR group and 60.2 in the LDR group. In the MDR group, 4 patients were at stage I, 16 stage II, 32 stage III, and 22 stage IV. In the LDR group, 32 were at stage I, 83 stage II, 183 stage III, and 49 stage IV. The medical rate was not significantly different between two groups. The tumor response by manual examination one month after radiotherapy showed no significant difference. The 5-year survival rate for the MDR and LDR groups were 100% : 78% at stage I, 61% : 71% at stage II and 52% : 53% at stage III, with no significant differences. Late complications by severity with grade II-III according to Kottureire's classification were not significantly different in the rectum or bladder. These results suggested that MDR brachytherapy was useful for the patients' QOL as it reduced the

Laboratory-Based Surveillance of Extensively Drug-Resistant Tuberculosis in Eastern China.

Science.gov (United States)

Huang, Yu; Wu, Qingqing; Xu, Shuiyang; Zhong, Jieming; Chen, Songhua; Xu, Jinghang; Zhu, Liping; He, Haibo; Wang, Xiaomeng

2017-03-01

With 25% of the global burden, China has the highest incidence of drug-resistant tuberculosis (TB) in the world. However, surveillance data on extensively drug-resistant TB (XDR-TB) from China are scant. To estimate the prevalence of XDR-TB in Zhejiang, Eastern China, 30 of 90 TB treatment centers in Zhejiang were recruited. Patients with suspected TB who reported to the clinics for diagnosis were requested to undergo a smear sputum test. Positive sputum samples were tested for drug susceptibility. Data on anti-TB drug resistance from 1999 to 2008 were also collected to assess drug resistance trends. A total of 931 cases were recruited for drug susceptibility testing (DST). Among these, 23.6% (95% confidence interval [CI], 18.8-24.4) were resistant to any of the following drugs: isoniazid, rifampin, streptomycin, and ethambutol. Multidrug resistant (MDR) strains were identified in 5.1% of all cases (95% CI, 3.61-6.49). Among MDR-TB cases, 6.4% were XDR (95% CI, 1.7-18.6) and 8.9% (95% CI, 7.0-10.8) of all cases were resistant to either isoniazid or rifampin (but not both). Among MDR-TB cases, 23.4% (95% CI, 12.8-38.4) were resistant to either fluoroquinolones or a second-line anti-TB injectable drug, but not both. From 1999 to 2014, the percentage of MDR cases decreased significantly, from 8.6% to 5.1% (p = 0.00). The Global Fund to Fight TB program showed signs of success in Eastern China. However, drug-resistant TB, MDR-TB, and XDR-TB still pose a challenge for TB control in Eastern China. High-quality directly observed treatment, short-course, and universal DST for TB cases to determine appropriate treatment regimens are urgently needed to prevent acquired drug resistance.

[Cluster of multidrug-resistant tuberculosis cases in a school of the district of Ica, Peru].

Science.gov (United States)

Torres, Julio; Sardón, Victoria; Soto, Mirtha G; Anicama, Rolado; Arroyo-Hernández, Hugo; Munayco, César V

2011-01-01

We describe the evolution and features of a cluster of Multidrug-resistant tuberculosis (MDR TB) cases that occurred in 2001, in a school located in a sub-urban area of the district of Ica, Peru. We identified 15 students related before becoming infected with tuberculosis. The mean age of the cluster was 15 years. A total of 12 students were MDR-TB cases and 7 were drug-resistant to 5 first-line drugs (RHEZS). Five out of the 15 cases received at least 3 different anti-tuberculosis treatment schemes. The average treatment duration was 37 months (minimum 21 and maximum 59 months). A total of 13 cases recovered and 2 died. This study describes a cluster of MDR -TB cases in an educational facility, which due to the epidemiological link and time presentation, is probably an outbreak of MDR TB with a satisfactory outcome after prolonged treatment.

Viral hepatitis and HIV-associated tuberculosis: Risk factors and TB treatment outcomes in Thailand

Directory of Open Access Journals (Sweden)

Likanonsakul Sirirat

2008-07-01

Full Text Available Abstract Background The occurrence of tuberculosis (TB, human immunodeficiency virus (HIV, and viral hepatitis infections in the same patient poses unique clinical and public health challenges, because medications to treat TB and HIV are hepatotoxic. We conducted an observational study to evaluate risk factors for HBsAg and/or anti-HCV reactivity and to assess differences in adverse events and TB treatment outcomes among HIV-infected TB patients. Methods Patients were evaluated at the beginning, during, and at the end of TB treatment. Blood samples were tested for aspartate aminotransferase (AST, alanine aminotransferase (ALT, total bilirubin (BR, complete blood count, and CD4+ T lymphocyte cell count. TB treatment outcomes were assessed at the end of TB treatment according to international guidelines. Results Of 769 enrolled patients, 752 (98% had serologic testing performed for viral hepatitis: 70 (9% were reactive for HBsAg, 237 (31% for anti-HCV, and 472 (63% non-reactive for both markers. At the beginning of TB treatment, 18 (26% patients with HBsAg reactivity had elevated liver function tests compared with 69 (15% patients non-reactive to any viral marker (p = 0.02. At the end of TB treatment, 493 (64% were successfully treated. Factors independently associated with HBsAg reactivity included being a man who had sex with men (adjusted odds ratio [AOR], 2.1; 95% confidence interval [CI], 1.1–4.3 and having low TB knowledge (AOR, 1.8; CI, 1.0–3.0. Factors most strongly associated with anti-HCV reactivity were having injection drug use history (AOR, 12.8; CI, 7.0–23.2 and living in Bangkok (AOR, 15.8; CI, 9.4–26.5. The rate of clinical hepatitis and death during TB treatment was similar in patients HBsAg reactive, anti-HCV reactive, both HBsAg and anti-HCV reactive, and non-reactive to any viral marker. Conclusion Among HIV-infected TB patients living in Thailand, markers of viral hepatitis infection, particularly hepatitis C virus

Editorial: Carpe diem ('Seize the day'): Building on the findings of the ...

African Journals Online (AJOL)

Editorial: Carpe diem ('Seize the day'): Building on the findings of the 2015 World Health Organization evaluation of the multidrugresistant tuberculosis (MDR-TB) programme to make the most of shortened MDR-TB treatment in South Africa.

Multidrug resistant tuberculosis versus non-tuberculous mycobacterial infections: a CT-scan challenge

International Nuclear Information System (INIS)

Kahkouee, Shahram; Esmi, Elham; Moghadam, Azadeh; Karam, Mehrdad Bakhshayesh; Mosadegh, Leila; Salek, Solmaz; Tabarsi, Payam

2013-01-01

Introduction: clinical, laboratory and imaging findings in patients with multidrug resistant tuberculosis (MDR-TB) and non-tuberculosis mycobacterium (NTM) are similar, and the majority of these patients present with positive smear for Acid Fast Bacilli (ADB) and no response to first line anti-TB treatment, so sputum culture and PCR are necessary, especially in NTM. Objective: In this study we evaluate more details of imaging findings to help earlier diagnosis of pathogens. Materials and methods: 66 patients with positive smear for AFB and no response to first line anti-TB drugs were divided into two groups by PCR and culture: MDR-TB (43 patients) and NTM (23 patients). Age, sex, history of anti-TB treatment, smoking and CT-scan findings (parenchymal, pleural and mediastinal variables) by details and lobar distribution were analyzed. Results: mean age of NTM patients was slightly higher (52 versus 45) and there is no significant difference in sex and smoking. In MDR-TB group, history of anti-TB treatment and evidence of chronic pulmonary disease such as calcified and fibrodestructed parenchyma, volume loss and pleural thickening were higher significantly. Cavities in MDR-TB were thick wall in the background of consolidation, while NTM cavities were more thin-walled with adjacent satellite nodules in same segment or lobe. Prevalence of bronchiectasis was similar in both groups, while bronchiectasis in MDR-TB group was in fibrobronchiectatic background in upper lobes, and in NTM group the distribution was more uniform with slightly middle lobes predominance. Prevalence and distribution of nodular infiltrations were similar more in Tree in Buds and scattered pattern. Calcified or non-calcified lymph nodes and also pleural changes were more frequent in MDR-TB but prevalence of lymphadenopathy was mildly higher in NTM. (author)

Multidrug resistant tuberculosis versus non-tuberculous mycobacterial infections: a CT-scan challenge

Energy Technology Data Exchange (ETDEWEB)

Kahkouee, Shahram; Esmi, Elham; Moghadam, Azadeh; Karam, Mehrdad Bakhshayesh; Mosadegh, Leila; Salek, Solmaz; Tabarsi, Payam, E-mail: bestlala@yahoo.com [Chronic Respiratory Disease Research Center, NRITLD, Masih Daneshvari Hospital, Shahid Beheshti University of Medical Science, Tehran (Iran, Islamic Republic of)

2013-03-15

Introduction: clinical, laboratory and imaging findings in patients with multidrug resistant tuberculosis (MDR-TB) and non-tuberculosis mycobacterium (NTM) are similar, and the majority of these patients present with positive smear for Acid Fast Bacilli (ADB) and no response to first line anti-TB treatment, so sputum culture and PCR are necessary, especially in NTM. Objective: In this study we evaluate more details of imaging findings to help earlier diagnosis of pathogens. Materials and methods: 66 patients with positive smear for AFB and no response to first line anti-TB drugs were divided into two groups by PCR and culture: MDR-TB (43 patients) and NTM (23 patients). Age, sex, history of anti-TB treatment, smoking and CT-scan findings (parenchymal, pleural and mediastinal variables) by details and lobar distribution were analyzed. Results: mean age of NTM patients was slightly higher (52 versus 45) and there is no significant difference in sex and smoking. In MDR-TB group, history of anti-TB treatment and evidence of chronic pulmonary disease such as calcified and fibrodestructed parenchyma, volume loss and pleural thickening were higher significantly. Cavities in MDR-TB were thick wall in the background of consolidation, while NTM cavities were more thin-walled with adjacent satellite nodules in same segment or lobe. Prevalence of bronchiectasis was similar in both groups, while bronchiectasis in MDR-TB group was in fibrobronchiectatic background in upper lobes, and in NTM group the distribution was more uniform with slightly middle lobes predominance. Prevalence and distribution of nodular infiltrations were similar more in Tree in Buds and scattered pattern. Calcified or non-calcified lymph nodes and also pleural changes were more frequent in MDR-TB but prevalence of lymphadenopathy was mildly higher in NTM. (author)

Access to and affordability of healthcare for TB patients in China: issues and challenges.

Science.gov (United States)

Tang, Shenglan; Wang, Lixia; Wang, Hong; Chin, Daniel P

2016-01-29

This paper introduces the background, aim and objectives of the project entitled "China-the Gates Foundation Collaboration on TB Control in China" that has been underway for many years. It also summarizes the key findings of the nine papers included in this special issue, which used data from the baseline survey of Phase II of the project. Data were collected from the survey of TB and MDR-TB patients, from designated hospitals, health insurance agencies and the routine health information systems, as well as key informant interviews and focus group discussions with relevant key stakeholders. Key issues discussed in this series of papers include the uses of TB services and anti-TB medicines and their determining factors related to socio-economic and health systems development; expenditures on TB care and the financial burden incurred on TB patients; and the impact of health insurance schemes implemented in China on financial protection.

Resistance patterns and trends of extensively drug-resistant tuberculosis: 5-year experience

Directory of Open Access Journals (Sweden)

Amresh Kumar Singh

2013-12-01

Full Text Available Objective:Extensively drug-resistant tuberculosis (XDR-TB strains were emerged when multidrug-resistant TB (MDR- TB was inadequately treated. Inadequate treatment of MDR-TB cases may result in additional resistance especially non-XDR-TB and then XDR-TB. The aim of this study was to know the prevalence, resistance patterns and trends of the XDR-TB strains among the MDR-TB at a tertiary care hospital in Lucknow, India Methods: A total of 430 Mycobacterium isolates were underwent NAP test and TB MPT64 Ag test for the identification of Mycobacterium tuberculosis complex (MTBC. Drug-susceptibility test (DST was performed over MTBC for the first line drugs by 1% proportion method (Bactec and for the second-line drugs by 1% proportion method (Lowenstein- Jensen media. The XDR-TB status was further confirmed by line probe assay (GenoType® MTBDRsl assay. Results: Among the 430 isolates of mycobacterium, 365 (84.9% were MTBC and 139 (38.1% were MDR-TB respectively. Further 97 MDR-TB from “highly suspected drug resistant-TB (DR-TB” cases among MDR-TB were tested with second line drugs in which 15 (15.5% XDR-TB and 82 (84.5% were non-XDR-TB. Regarding XDR-TB status, using the 1% proportion method a 100% agreement was seen with the GenoType® MTBDRsl assay. Resistance patterns of XDR-TB were as; 10/15 (66.7% as isoniazid + rifampicin + ciprofloxacin + amikacin resistance and 5/15 (33.3% as isoniazid + rifampicin + ciprofloxacin + amikacin + kanamycin resistance. Conclusion:The prevalence of XDR-TB was 15.5% among MDR-TB. Hence laboratory testing of “highly suspected drug resistant-TB” isolates should be done for both first and second line drugs simultaneously especially in developing countries.J Microbiol Infect Dis 2013;3(4: 169-175

Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism

Directory of Open Access Journals (Sweden)

Em Sutrisna

2015-06-01

Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.

High Rate of Hypothyroidism in Multidrug-Resistant Tuberculosis Patients Co-Infected with HIV in Mumbai, India

Science.gov (United States)

Andries, Aristomo; Isaakidis, Petros; Das, Mrinalini; Khan, Samsuddin; Paryani, Roma; Desai, Chitranjan; Dalal, Alpa; Mansoor, Homa; Verma, Reena; Fernandes, Dolorosa; Sotgiu, Giovanni; Migliori, Giovanni B.; Saranchuk, Peter

2013-01-01

Background Adverse events (AEs) among HIV-infected patients with multidrug-resistant tuberculosis (MDR-TB) receiving anti-TB and antiretroviral treatments (ART) are under-researched and underreported. Hypothyroidism is a common AE associated with ethionamide, p-aminosalicylic acid (PAS), and stavudine. The aim of this study was to determine the frequency of and risk factors associated with hypothyroidism in HIV/MDR-TB co-infected patients. Methods This was a prospective, observational cohort study, using routine laboratory data in a Médecins Sans Frontières (MSF) clinic in collaboration with Sewri TB Hospital, Mumbai, India. Hypothyroidism was defined as a thyroid stimulating hormone (TSH) result >10 mIU/L at least once during treatment. Patients having a baseline result and one additional result after 3 months were eligible for enrolment. Results Between October 2006 and March 2013, 116 patients were enrolled, 69 of whom were included. The median (IQR) age was 38 years (34-43) and 61% were male. By March 2013, 37/69 (54%) had hypothyroidism after at least 90 days of treatment. Age, gender, CD4 counts and stavudine-based ART were not associated with the occurrence of hypothyroidism in multivariate models. The co-administration of PAS and ethionamide was found to double the risk of hypothyroidism (RR: 1.93, 95% CI: 1.06-3.54). Discussion High rate of hypothyroidism was recorded in a Mumbai cohort of MDR-TB/HIV co-infected patients on treatment. This is a treatable and reversible AE, however, it may go undiagnosed in the absence of regular monitoring. Care providers should not wait for clinical symptoms, as this risks compromising treatment adherence. Simple, affordable and reliable point-of-care tools for measuring TSH are needed, especially in high MDR-TB burden countries. Our findings suggest the need for TSH screening at baseline, three months, six months, and every six months thereafter for HIV-infected patients on MDR-TB treatment regimens containing PAS and

Regional Lymphotropic Therapy in Combination with Low Level Laser Therapy for Treating Multi-Drug-Resistant Tuberculosis

Directory of Open Access Journals (Sweden)

Oksana Dogorova

2016-03-01

Full Text Available With the growing incidence of Multi-Drug-Resistant Tuberculosis (MDR-TB in newly identified patients, novel multimodality treatment methods are needed, aimed at reducing the time to sputum conversion and cavity healing, which would be applicable in MDR cases. Our experimental treatment consisted of the following: 1 chemotherapy based on the drug sensitivity profile, 2 local laser irradiation therapy for 25 days, and lymphotropic administration of isoniazid (to subcutaneous tissue in alternating locations: underarm area; fifth intercostal space along the sterna border; subclavian area where the first rib meets the sternum in a daily dose of 10mg/kg 5 times a week. This treatment was significantly more effective in newly detected destructive MDR-TB versus the standard Category IV regimen for MDR-TB in terms of reduced time for sputum culture conversion and cavity healing, estimated to be 6 months after initiation of treatment.

Major challenges in clinical management of TB/HIV co-infected patients in Eastern Europe compared with Western Europe and Latin America

DEFF Research Database (Denmark)

Efsen, Anne Marie; Schultze, Anna; Post, Frank

2014-01-01

identified in logistic regression models. RESULTS: Significant differences were observed between EE (n=844), WE (n=152), SE (n=164) and LA (n=253) for use of combination antiretroviral therapy (cART) at TB diagnosis (17%, 40%, 44% and 35%, pdefinite TB diagnosis (culture and/or PCR positive......, Isoniazid, Pyrazinamide, Ethambutol (RHZE)], the corresponding proportions would have been 64% vs. 86-97%, respectively (Figure 1b). CONCLUSIONS: In EE, TB/HIV patients had poorer exposure to cART, less often a definitive TB diagnosis and more often MDR-TB compared to other parts of Europe and LA. Initial...

Aggressive regimens for multidrug-resistant tuberculosis decrease all-cause mortality.

Directory of Open Access Journals (Sweden)

Carole D Mitnick

Full Text Available A better understanding of the composition of optimal treatment regimens for multidrug-resistant tuberculosis (MDR-TB is essential for expanding universal access to effective treatment and for developing new therapies for MDR-TB. Analysis of observational data may inform the definition of an optimized regimen.This study assessed the impact of an aggressive regimen-one containing at least five likely effective drugs, including a fluoroquinolone and injectable-on treatment outcomes in a large MDR-TB patient cohort.This was a retrospective cohort study of patients treated in a national outpatient program in Peru between 1999 and 2002. We examined the association between receiving an aggressive regimen and the rate of death.In total, 669 patients were treated with individualized regimens for laboratory-confirmed MDR-TB. Isolates were resistant to a mean of 5.4 (SD 1.7 drugs. Cure or completion was achieved in 66.1% (442 of patients; death occurred in 20.8% (139. Patients who received an aggressive regimen were less likely to die (crude hazard ratio [HR]: 0.62; 95% CI: 0.44,0.89, compared to those who did not receive such a regimen. This association held in analyses adjusted for comorbidities and indicators of severity (adjusted HR: 0.63; 95% CI: 0.43,0.93.The aggressive regimen is a robust predictor of MDR-TB treatment outcome. TB policy makers and program directors should consider this standard as they design and implement regimens for patients with drug-resistant disease. Furthermore, the aggressive regimen should be considered the standard background regimen when designing randomized trials of treatment for drug-resistant TB.

The Potential Impact of Up-Front Drug Sensitivity Testing on India's Epidemic of Multi-Drug Resistant Tuberculosis.

Directory of Open Access Journals (Sweden)

Kuldeep Singh Sachdeva

Full Text Available In India as elsewhere, multi-drug resistance (MDR poses a serious challenge in the control of tuberculosis (TB. The End TB strategy, recently approved by the world health assembly, aims to reduce TB deaths by 95% and new cases by 90% between 2015 and 2035. A key pillar of this approach is early diagnosis of tuberculosis, including use of higher-sensitivity diagnostic testing and universal rapid drug susceptibility testing (DST. Despite limitations of current laboratory assays, universal access to rapid DST could become more feasible with the advent of new and emerging technologies. Here we use a mathematical model of TB transmission, calibrated to the TB epidemic in India, to explore the potential impact of a major national scale-up of rapid DST. To inform key parameters in a clinical setting, we take GeneXpert as an example of a technology that could enable such scale-up. We draw from a recent multi-centric demonstration study conducted in India that involved upfront Xpert MTB/RIF testing of all TB suspects.We find that widespread, public-sector deployment of high-sensitivity diagnostic testing and universal DST appropriately linked with treatment could substantially impact MDR-TB in India. Achieving 75% access over 3 years amongst all cases being diagnosed for TB in the public sector alone could avert over 180,000 cases of MDR-TB (95% CI 44187 - 317077 cases between 2015 and 2025. Sufficiently wide deployment of Xpert could, moreover, turn an increasing MDR epidemic into a diminishing one. Synergistic effects were observed with assumptions of simultaneously improving MDR-TB treatment outcomes. Our results illustrate the potential impact of new and emerging technologies that enable widespread, timely DST, and the important effect that universal rapid DST in the public sector can have on the MDR-TB epidemic in India.

Treatment outcome of tb/hiv positive and negative smear positive ...

African Journals Online (AJOL)

Background: In our previous study we found that half of the patients treated at the Nylon District Hospital tuberculosis (TB) treatment centre were seropositive. HIV does not only fuel the number of tuberculosis (TB) cases worldwide but it is also at least in part, responsible for the non-achievement of the 85% cure rate target.

Screening and rapid molecular diagnosis of tuberculosis in prisons in Russia and Eastern Europe: a cost-effectiveness analysis.

Directory of Open Access Journals (Sweden)

Daniel E Winetsky

Full Text Available Prisons of the former Soviet Union (FSU have high rates of multidrug-resistant tuberculosis (MDR-TB and are thought to drive general population tuberculosis (TB epidemics. Effective prison case detection, though employing more expensive technologies, may reduce long-term treatment costs and slow MDR-TB transmission.We developed a dynamic transmission model of TB and drug resistance matched to the epidemiology and costs in FSU prisons. We evaluated eight strategies for TB screening and diagnosis involving, alone or in combination, self-referral, symptom screening, mass miniature radiography (MMR, and sputum PCR with probes for rifampin resistance (Xpert MTB/RIF. Over a 10-y horizon, we projected costs, quality-adjusted life years (QALYs, and TB and MDR-TB prevalence. Using sputum PCR as an annual primary screening tool among the general prison population most effectively reduced overall TB prevalence (from 2.78% to 2.31% and MDR-TB prevalence (from 0.74% to 0.63%, and cost US$543/QALY for additional QALYs gained compared to MMR screening with sputum PCR reserved for rapid detection of MDR-TB. Adding sputum PCR to the currently used strategy of annual MMR screening was cost-saving over 10 y compared to MMR screening alone, but produced only a modest reduction in MDR-TB prevalence (from 0.74% to 0.69% and had minimal effect on overall TB prevalence (from 2.78% to 2.74%. Strategies based on symptom screening alone were less effective and more expensive than MMR-based strategies. Study limitations included scarce primary TB time-series data in FSU prisons and uncertainties regarding screening test characteristics.In prisons of the FSU, annual screening of the general inmate population with sputum PCR most effectively reduces TB and MDR-TB prevalence, doing so cost-effectively. If this approach is not feasible, the current strategy of annual MMR is both more effective and less expensive than strategies using self-referral or symptom screening alone

La resistencia a múltiples fármacos: una amenaza para el control de la tuberculosis Multiple drug resistance: a threat for tuberculosis control

Directory of Open Access Journals (Sweden)

Ernesto Montoro Cardoso

2004-07-01

Full Text Available Drug-resistant tuberculosis (TB was reported soon after the introduction of streptomycin, although it did not receive major attention until recently. It was not considered a major issue in the industrialized world until outbreaks of multidrug-resistant TB (MDR-TB were reported among HIV infected people. Administration of standard short-course chemotherapy (SSCC with first-line drugs under directly observed therapy (DOT is the cornerstone of modern TB control. Unfortunately, data available on the treatment outcome of MDR-TB cases under routine programmatic conditions suggest that patients with MDR-TB respond poorly to SSCC with first-line drugs. Since 1994, the World Health Organization and the International Union Against Tuberculosis and Lung Disease (IUATLD have conducted anti-TB drug resistance surveys through a network of subregional laboratories and researchers. Drug resistance was present in almost all settings surveyed, and prevalence varied widely across regions. High prevalence of MDR-TB is widespread in the Russian Federation and areas of the former Soviet Union (Estonia, Kazakhstan, Latvia, and Lithuania as well as Israel, Liaoning and Henan Provinces in China, and Ecuador. The Global Project has surveyed areas representing over one third of notified TB cases. However, enormous gaps still exist in the most crucial areas. The most effective strategy to prevent the emergence of drug resistance is through implementation of the directly observed treatment short (DOTS strategy. Effective implementation of the DOTS strategy saves lives through decreased TB transmission, decreased risk of emergence of drug- resistance, and decreased risk for individual TB patients of treatment failure, TB relapse, and death. The World Bank recognizes the DOTS strategy as one of the most cost-effective health interventions, and recommends that effective TB treatment be a part of the essential clinical services package available in primary health care settings

Fixed Dose Combination for TB treatment

Directory of Open Access Journals (Sweden)

Tjandra Y. Aditama

2003-06-01

Full Text Available According to the World Health Organization, a third of the world’s population is infected with tuberculosis. The disease is responsible for nearly 2 million deaths each year and over 8 million were developing active diseases. Moreover, according to WHO (2000, tuberculosis deaths are estimated to increase to 35 million between 2000-2020. The majority of tuberculosis patients worldwide are still treated with single drugs, or with 2-drug fixed-dose combinations (FDCs. To improve tuberculosis treatment, 2- and 3-drug FDCs were recommended by the World Health Organization (WHO as part of the DOTS strategy. Since 1999 a 4-drug FDC was included on the WHO Model List of Essential Drugs. Today, FDCs are important tools to further improve the quality of care for people with TB, and accelerate DOTS expansion to reach the global TB control targets. Fixed dose combination TB drugs could simplifies both treatment and management of drug supply, and may prevent the emergence of drug resistance .Prevention of drug resistance is just one of the potential benefits of the use of FDCs. FDCs simplify administration of drugs by reducing the number of pills a patient takes each day and decreasing the risk of incorrect prescriptions. Most tuberculosis patients need only take 3–4 FDCs tablets per day during the intensive phase of treatment, instead of the 15–16 tablets per day that is common with single-drug formulations It is much simpler to explain to patients that they need to take four tablets of the same type and colour, rather than a mixture of tablets of different shapes, colours and sizes. Also, the chance of taking an incomplete combination of drugs is eliminated, since the four essential drugs are combined into one tablet. FDCs are also simpler for care-givers as they minimize the risk of confusion. Finally, drug procurement, in all its components (stock management, shipping, distribution, is simplified by FDCs. Adverse reactions to drugs are not more

Convergence of a diabetes mellitus, protein energy malnutrition, and TB epidemic: the neglected elderly population.

Science.gov (United States)

Menon, Sonia; Rossi, Rodolfo; Nshimyumukiza, Leon; Wusiman, Aibibula; Zdraveska, Natasha; Eldin, Manal Shams

2016-07-26

On a global scale, nearly two billion persons are infected with Mycobacterium tuberculosis. From this vast reservoir of latent tuberculosis (TB) infection, a substantial number will develop active TB during their lifetime, with some being able to transmit TB or Multi-drug- resistant (MDR) TB to others. There is clinical evidence pointing to a higher prevalence of infectious diseases including TB among individuals with Diabetes Mellitus (DM). Furthermore, ageing and diabetes mellitus may further aggravate protein-energy malnutrition (PEM), which in turn impairs T-lymphocyte mediated immunologic defenses, thereby increasing the risk of developing active TB and compromising TB treatment. This article aims to a) highlight synergistic mechanisms associated with immunosenescence, DM and PEM in relation to the development of active TB and b) identify nutritional, clinical and epidemiological research gaps. To explore the synergistic relationship between ageing, DM, tuberculosis and PEM, a comprehensive review was undertaken. The MEDLINE and the Google Scholar databases were searched for articles published from 1990 to March 2015, using different MESH keywords in various combinations. Ageing and DM act synergistically to reduce levels of interferon gamma (IFN- γ), thereby increasing susceptibility to TB, for which cell mediated immunity (CMI) plays an instrumental role. These processes can set in motion a vicious nutritional cycle which can predispose to PEM, further impairing the CMI and consequently limiting host defenses. This ultimately transforms the latent TB infection into active disease. A clinical diagnostic algorithm and clinical guidelines need to be established for this population. Given the increase in ageing population with DM and PEM, especially in resource-poor settings, these synergistic tripartite interactions must be examined if a burgeoning TB epidemic is to be averted. Implementation of a comprehensive, all-encompassing approach to curb transmission

Initiation and adherence to TB treatment in a Pakistani community influenced more by perceptions than by knowledge of tuberculosis

Directory of Open Access Journals (Sweden)

Mubashir Zafar

2013-01-01

Full Text Available Background: The tuberculosis (TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. Aims: To investigate knowledge about TB, perceptions of (access to TB treatment, and adherence to treatment among a Pakistani population. Setting and Design: Descriptive cross-sectional study. Materials and Methods: A total of 175 participants were selected nonrandomly, 100 were TB patient and 75 were non-TB patient in proportion to the total number of participants in each ward of hospital. Statistical Analysis: Analysis of attitudes and perceptions toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types done by frequency counts and percentages. Regression analysis and logistic regression analysis were performed to test whether differences in age, gender, and education level led to different knowledge scores and different attitudes and preferences toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types. All statistical analyses were performed using Statistical Package for Social Sciences (SPSS 16.0. Result: TB knowledge can be considered fairly well among this community. Respondents′ perceptions suggest that stigma may influence TB patients′ decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Conclusion: Most of the subjects were unaware of TB that seems to be due to their illiteracy and those who knew had got the knowledge from media, but the majority of the patients who were on directly observed treatment, short-course (DOTS were found to be satisfied.

Psychological distress and its effect on tuberculosis treatment outcomes in Ethiopia

Directory of Open Access Journals (Sweden)

Habteyes Hailu Tola

2015-11-01

Full Text Available Background: Psychological distress is the major comorbidity among tuberculosis (TB patients. However, its magnitude, associated factors, and effect on treatment outcome have not been adequately studied in low-income countries. Objective: This study aimed to determine the magnitude of psychological distress and its effect on treatment outcome among TB patients on treatment. Design: A follow-up study was conducted in Addis Ababa, Ethiopia, from May to December 2014. Patients (N=330 diagnosed with all types of TB who had been on treatment for 1–2 months were enrolled consecutively from 15 randomly selected health centers and one TB specialized hospital. Data on sociodemographic variables and economic status were collected using a structured questionnaire. The presence of psychological distress was assessed at baseline (within 1–2 months after treatment initiation and end point (6 months after treatment initiation using the 10-item Kessler (K-10 scale. Alcohol use and tobacco smoking history were assessed using WHO Alcohol Use Disorder Identification Test and Australian Smoking Assessment Checklist, respectively. The current WHO TB treatment outcome definition was used to differentiate the end result of each patient at completion of the treatment. Results: The overall psychological distress was 67.6% at 1–2 months and 48.5% at 6 months after treatment initiation. Multiple logistic regression analysis revealed that past TB treatment history [adjusted odds ratio (AOR: 3.76; 95% confidence interval (CI: 1.67–8.45], being on anti-TB and anti-HIV treatments (AOR: 5.35; 95% CI: 1.83–15.65, being unmarried (AOR: 4.29; 95% CI: 2.45–7.53, having alcohol use disorder (AOR: 2.95; 95% CI: 1.25–6.99, and having low economic status (AOR: 4.41; 95% CI: 2.44–7.97 were significantly associated with psychological distress at baseline. However, at 6 months after treatment initiation, only being a multidrug-resistant tuberculosis (MDR-TB patient (AOR: 3

Overview of drug-resistant tuberculosis worldwide

Directory of Open Access Journals (Sweden)

Ali A Velayati

2016-01-01

Full Text Available Even in the 21st century, we are losing the battle against eradication of tuberculosis (TB. In 2015, 9.6 million people were estimated to have fallen ill with TB, of which 1.5 million people died. This is the real situation despite the well-structured treatment programs and availability of effective treatment options since the 1950s. The high mortality rate has been associated with other risk factors, such as the HIV epidemic, underlying diseases, and decline of socioeconomic standards. Furthermore, the problem of drug resistance that was recognized in the early days of the chemotherapeutic era raises serious concerns. Although resistance to a single agent is the most common type, resistance to multiple agents is less frequent but of greater concern. The World Health Organization estimated approximately 5% of all new TB cases involved multidrug-resistant (MDR-TB. The estimation for MDR-TB is 3.3% for new cases, and 20.5% for previously treated cases. Failure to identify and appropriately treat MDR-TB patients has led to more dangerous forms of resistant TB. Based on World Health Organization reports, 5% of global TB cases are now considered to be extensively drug resistant (XDR, defined as MDR with additional resistance to both fluoroquinolones and at least one second-line injectable drug. XDR-TB had been reported by 105 countries by 2015. An estimated 9.7% of people with MDR-TB have XDR-TB. More recently, another dangerous form of TB bacillus was identified, which was named totally drug resistant (TDR-TB or extremely drug resistant TB. These strains were resistant to all first- and second-line anti-TB drugs. Collectively, it is accepted that 2% of MDR-TB strains turn to be TDR-TB. This number, however, may not reflect the real situation, as many laboratories in endemic TB countries do not have proper facilities and updated protocols to detect the XDR or TDR-TB strains. Nevertheless, existing data emphasize the need for additional control

Poor Outcomes in a Cohort of HIV-Infected Adolescents Undergoing Treatment for Multidrug-Resistant Tuberculosis in Mumbai, India

Science.gov (United States)

Isaakidis, Petros; Paryani, Roma; Khan, Samsuddin; Mansoor, Homa; Manglani, Mamta; Valiyakath, Asmaa; Saranchuk, Peter; Furin, Jennifer

2013-01-01

Background Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB) in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10–19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF) project in Mumbai, India. Methods A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. Results The median age was 16 (IQR 14–18) years and 54% were female. Five (46%) adolescents had pulmonary TB (PTB), two (18%) extrapulmonary disease (EPTB) and four (36%) had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8–250.5). By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5%) patients: one was cured and three were still on treatment with negative culture results. Seven patients (64%) had poor outcomes: four (36.5%) died and three (27%) defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100%) on-treatment experienced adverse events (AEs): two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. Conclusions Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial

Poor outcomes in a cohort of HIV-infected adolescents undergoing treatment for multidrug-resistant tuberculosis in Mumbai, India.

Directory of Open Access Journals (Sweden)

Petros Isaakidis

Full Text Available BACKGROUND: Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10-19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF project in Mumbai, India. METHODS: A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. RESULTS: The median age was 16 (IQR 14-18 years and 54% were female. Five (46% adolescents had pulmonary TB (PTB, two (18% extrapulmonary disease (EPTB and four (36% had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8-250.5. By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5% patients: one was cured and three were still on treatment with negative culture results. Seven patients (64% had poor outcomes: four (36.5% died and three (27% defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100% on-treatment experienced adverse events (AEs: two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. CONCLUSIONS: Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial

Poor outcomes in a cohort of HIV-infected adolescents undergoing treatment for multidrug-resistant tuberculosis in Mumbai, India.

Science.gov (United States)

Isaakidis, Petros; Paryani, Roma; Khan, Samsuddin; Mansoor, Homa; Manglani, Mamta; Valiyakath, Asmaa; Saranchuk, Peter; Furin, Jennifer

2013-01-01

Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB) in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10-19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF) project in Mumbai, India. A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. The median age was 16 (IQR 14-18) years and 54% were female. Five (46%) adolescents had pulmonary TB (PTB), two (18%) extrapulmonary disease (EPTB) and four (36%) had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8-250.5). By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5%) patients: one was cured and three were still on treatment with negative culture results. Seven patients (64%) had poor outcomes: four (36.5%) died and three (27%) defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100%) on-treatment experienced adverse events (AEs): two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial support for co-infected adolescents

First and second line drug resistance among treatment naïve pulmonary tuberculosis patients in a district under Revised National Tuberculosis Control Programme (RNTCP in New Delhi

Directory of Open Access Journals (Sweden)

Vithal Prasad Myneedu

2015-12-01

Full Text Available There is limited information of level of drug resistance to first-line and second line anti-tuberculosis agents in treatment naïve pulmonary tuberculosis (PTB patients from the Indian region. Therefore, the present prospective study was conducted to determine the antimicrobial susceptibility to first-line and second line anti-TB drug resistance in such patients. Sputum samples from consecutive treatment naïve PTB cases registered in Lala Ram Sarup (LRS district, under RNTCP containing 12 Directly Observed Treatment Centre’s (DOTS, were enrolled using cluster sampling technology. A total of 453 samples were received from July 2011 to June 2012. All samples were cultured on solid medium followed by drug susceptibility to first and second line anti-tubercular drugs as per RNTCP guidelines. Primary multi-drug resistance (MDR was found to be 18/453; (4.0%. Extensively drug resistance (XDR was found in one strain (0.2%, which was found to be resistant to other antibiotics. Data of drug resistant tuberculosis among treatment naïve TB patients are lacking in India. The presence of XDR-TB and high MDR-TB in small population studied, calls for conducting systematic multi-centric surveillance across the country.

The fourth national anti-tuberculosis drug resistance survey in Viet Nam.

Science.gov (United States)

Nhung, N V; Hoa, N B; Sy, D N; Hennig, C M; Dean, A S

2015-06-01

Viet Nam's Fourth National Anti-Tuberculosis Drug Resistance Survey was conducted in 2011. To determine the prevalence of resistance to the four main first-line anti-tuberculosis drugs in Viet Nam. Eighty clusters were selected using a probability proportion to size approach. Drug susceptibility testing (DST) against the four main first-line anti-tuberculosis drugs was performed. A total of 1629 smear-positive tuberculosis (TB) patients were eligible for culture. Of these, DST results were available for 1312 patients, including 1105 new TB cases, 195 previously treated TB cases and 12 cases with an unknown treatment history. The proportion of cases with resistance to any drug was 32.7% (95%CI 29.1-36.5) among new cases and 54.2% (95%CI 44.3-63.7) among previously treated cases. The proportion of multidrug-resistant TB (MDR-TB) cases was 4.0% (95%CI 2.5-5.4) in new cases and 23.3 (95%CI 16.7-29.9) in previously treated cases. The fourth drug resistance survey in Viet Nam found that the proportion of MDR-TB among new and previously treated cases was not significantly different from that in the 2005 survey. The National TB Programme should prioritise the detection and treatment of MDR-TB to reduce transmission of MDR-TB in the community.

Tuberculosis treatment and Smoking, Armenia, 2014–2016

Directory of Open Access Journals (Sweden)

Dikran Raffi Balian

2017-08-01

Full Text Available Introduction: Tuberculosis and tobacco prove to be increasingly apparent world problems. Armenia is a developing country which is facing issues related to the high rates of tobacco consumption. Moreover, it is among the list of high multi-drug resistant (MDR Tuberculosis TB burden countries. Treatment success rate in Armenia for sputum smear-positive cases never reached World Health Organization's (WHO target of 85% in last 15 years. Data from different studies completed across the world suggests that there is an association between smoking and negative treatment outcomes. Methods: This retrospective study was designed to investigate aforementioned associations between TB treatment outcomes and smoking status of TB patients. Data for the study were derived from the national data available in the electronic database of the Armenian National TB Center. Results: Based on inclusion and exclusion criteria 992 TB patients registered in 2014 were enrolled in this study. All of them are were TB patients in which 387 were smokers and 605 were non-smokers. Notably, adjusted analysis showed that individuals who smoked during TB treatment had 1.61 higher odds of having unsuccessful TB treatment outcome. Additionally, consistent with the literature, statistically significant association was identified between TB treatment outcome and other well factors such as sputum smear status (OR=2.24, p<0.01, HIV status (OR,=1.87, p<0.01 of patients, etc. Conclusions: The smoking, HIV positive status, positive sputum smear microscopy test were identified as an important factors associated with the unsuccessful TB treatment outcome in Armenia. It highlights the necessity of having specific restrictions and campaign programs to reduce smoking rates among TB patients in order to improve current TB treatment and care services throughout Armenia. Keywords: Tuberculosis, Smoking, Treatment outcome, Treatment success

Comparative efficacy and safety of treatment options for MDR and XDR Acinetobacter baumannii infections: a systematic review and network meta-analysis.

Science.gov (United States)

Kengkla, Kirati; Kongpakwattana, Khachen; Saokaew, Surasak; Apisarnthanarak, Anucha; Chaiyakunapruk, Nathorn

2018-01-01

To comprehensively compare and rank the efficacy and safety of available treatment options for patients with MDR and XDR Acinetobacter baumannii (AB) infection. We searched PubMed, Embase and the Cochrane register of trials systematically for studies that examined treatment options for patients with MDR- and XDR-AB infections until April 2016. Network meta-analysis (NMA) was performed to estimate the risk ratio (RR) and 95% CI from both direct and indirect evidence. Primary outcomes were clinical cure and microbiological cure. Secondary outcomes were all-cause mortality and nephrotoxic and non-nephrotoxic adverse events. A total of 29 studies with 2529 patients (median age 60 years; 65% male; median APACHE II score 19.0) were included. Although there were no statistically significant differences between treatment options, triple therapy with colistin, sulbactam and tigecycline had the highest clinical cure rate. Colistin in combination with sulbactam was associated with a significantly higher microbiological cure rate compared with colistin in combination with tigecycline (RR 1.23; 95% CI 1.03-1.47) and colistin monotherapy (RR 1.21; 95% CI 1.06-1.38). No significant differences in all-cause mortality were noted between treatment options. Tigecycline-based therapy also appeared less effective for achieving a microbiological cure and is not appropriate for treating bloodstream MDR- and XDR-AB infections. Combination therapy of colistin with sulbactam demonstrates superiority in terms of microbiological cure with a safety profile similar to that of colistin monotherapy. Thus, our findings support the use of this combination as a treatment for MDR- and XDR-AB infections. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

TB or not TB?: a case of isolated testicular TB with scrotal involvement.

LENUS (Irish Health Repository)

Bhargava, A

2009-06-01

Despite the genitourinary tract being the most common site affected by extrapulmonary TB, isolated testicular TB remains a rare clinical entity. In patients with co-morbidities such as hepatic impairment, treatment proves a challenge, as first-line hepatotoxic pharmaceuticals are contraindicated. Here, we report a case of isolated testicular TB with scrotal involvement, on a background of hepatic dysfunction.

Direct Application of the INNO-LiPA Rif.TB Line-Probe Assay for Rapid Identification of Mycobacterium tuberculosis Complex Strains and Detection of Rifampin Resistance in 360 Smear-Positive Respiratory Specimens from an Area of High Incidence of Multidrug-Resistant Tuberculosis

Science.gov (United States)

Viveiros, Miguel; Leandro, Clara; Rodrigues, Liliana; Almeida, Josefina; Bettencourt, Rosário; Couto, Isabel; Carrilho, Lurdes; Diogo, José; Fonseca, Ana; Lito, Luís; Lopes, João; Pacheco, Teresa; Pessanha, Mariana; Quirim, Judite; Sancho, Luísa; Salfinger, Max; Amaral, Leonard

2005-01-01

The INNO-LiPA Rif.TB assay for the identification of Mycobacterium tuberculosis complex strains and the detection of rifampin (RIF) resistance has been evaluated with 360 smear-positive respiratory specimens from an area of high incidence of multidrug-resistant tuberculosis (MDR-TB). The sensitivity when compared to conventional identification/culture methods was 82.2%, and the specificity was 66.7%; the sensitivity and specificity were 100.0% and 96.9%, respectively, for the detection of RIF resistance. This assay has the potential to provide rapid information that is essential for the effective management of MDR-TB. PMID:16145166

Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Perú Cluster of multidrug-resistant tuberculosis cases in a school of the district of Ica, Perú

Directory of Open Access Journals (Sweden)

Julio Torres

2011-09-01

Full Text Available Se describe la evolución y las características de los casos de un conglomerado de tuberculosis multidrogorresistente (MDR ocurrido el año 2001, en un centro educativo localizado en una zona urbano marginal del distrito de Ica, Perú. Se identificó 15 escolares que estuvieron relacionados entre ellos antes de enfermar de tuberculosis. El promedio de edad fue 15 años. Doce casos fueron MDR y siete fueron resistentes a las cinco drogas de primera línea (RHEZS, cinco de los casos recibieron tres diferentes esquemas de tratamiento antituberculoso; el tiempo promedio de tratamiento antituberculoso fue de 37 meses (mínimo 21 y máximo 59 meses. Trece casos curaron y dos fallecieron. El presente estudio documenta un conglomerado de casos de TB-MDR en un centro educativo que, por los vínculos epidemiológicos y la simultaneidad en que aparecieron, podría tratarse de un probable brote de TB-MDR, con un desenlace satisfactorio luego de un tratamiento prolongado.We describe the evolution and features of a cluster of Multidrug-resistant tuberculosis (MDR TB cases that occurred in 2001, in a school located in a sub-urban area of the district of Ica, Peru. We identified 15 students related before becoming infected with tuberculosis. The mean age of the cluster was 15 years. A total of 12 students were MDR-TB cases and 7 were drug-resistant to 5 first-line drugs (RHEZS. Five out of the 15 cases received at least 3 different anti-tuberculosis treatment schemes. The average treatment duration was 37 months (minimum 21 and maximum 59 months. A total of 13 cases recovered and 2 died. This study describes a cluster of MDR -TB cases in an educational facility, which due to the epidemiological link and time presentation, is probably an outbreak of MDR TB with a satisfactory outcome after prolonged treatment.

Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

Directory of Open Access Journals (Sweden)

Buddhasukh Duang

2004-04-01

Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.

Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

International Nuclear Information System (INIS)

Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang

2004-01-01

Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents

Predictors of death among drug-resistant tuberculosis patients in Kuala Lumpur, Malaysia: A retrospective cohort study from 2009 to 2013.

Science.gov (United States)

Mohd Shariff, Noorsuzana; Shah, Shamsul Azhar; Kamaludin, Fadzilah

2016-09-01

The emergence of drug-resistant tuberculosis (TB) is a major public health threat. However, little is known about the predictors of death in drug-resistant TB in Malaysia. This study aimed to determine the predictors of death in drug-resistant TB patients, including multidrug-resistant TB (MDR-TB), in Kuala Lumpur, Malaysia. This study adopted a retrospective cohort study design and involved laboratory-confirmed drug-resistant TB patients (n=426) from January 2009 to June 2013. A Cox regression model and Kaplan-Meier curves were used to model the outcome measure. Data were analysed by using SPSS v.20.0 for Windows. In this study, 15.3% (n=65) of the patients died. Among the study patients, 70.9% were monoresistant TB cases, 9.4% were poly-resistant TB and 19.7% were MDR-TB. MDR-TB [adjusted hazard ratio (aHR)=2.23, 95% confidence interval (CI) 1.26-3.95], ethnicity [Malay (aHR=5.95, 95% CI 2.30-15.41), Chinese (aHR=4.01, 95% CI 1.38-11.66) and Indian (aHR=3.76, 95% CI 1.19-11.85)], coronary heart disease (aHR=6.82, 95% CI 2.16-21.50), drug abuse (aHR=3.79, 95% CI 2.07-6.93) and treatment non-compliance (aHR=1.81, 95% CI 1.01-3.27) were independent predictors of poorer survival in the multivariate Cox regression analysis. This study suggests that MDR-TB, local ethnicity, coronary heart disease, history of drug abuse and treatment non-compliance are factors predicting poor survival in drug-resistant TB patients. More emphasis should be given to the management of drug-resistant TB patients with these characteristics to achieve better treatment outcomes. Copyright © 2016 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Emerging epidemic of drug resistant tuberculosis in vulnerable ...

African Journals Online (AJOL)

the incidence of TB/MDR-TB in domestic interactions of MDR-TB patients1. Domestic contacts of MDR-TB suggest more recurrent threat of developing active TB and MDR-TB but such studies are rare19. Homelessness is a miserable condition, incorporating several liabilities that strikingly intensify the risk of being diseased, ...

Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

Science.gov (United States)

Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

2017-01-01

Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

Multidrug-resistant tuberculosis: The problem and some priorities in controlling it

Directory of Open Access Journals (Sweden)

Sven Hoffner

2016-01-01

Full Text Available Multidrug-resistant tuberculosis (MDR-TB, and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB.

Multidrug-resistant tuberculosis: The problem and some priorities in controlling it.

Science.gov (United States)

Hoffner, Sven

2016-12-01

Multidrug-resistant tuberculosis (MDR-TB), and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB. Copyright © 2016.

Effectiveness of a novel cellular therapy to treat multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

Aliaksandr Skrahin

2016-08-01

Full Text Available Introduction: We urgently need novel treatments for multidrug-resistant tuberculosis (MDR-TB. Autologous mesenchymal stromal cell (MSC infusion is one such possibility due to its potential to repair damaged lung tissue and boost immune responses. We aimed to assess the effectiveness of MSC to improve outcomes among MDR-TB patients. Methods: We analyzed outcomes for 108 Belarussian MDR-TB patients receiving chemotherapy. Thirty-six patients (“cases” also had MSCs extracted, cultured and re-infused (average time from chemotherapy start to infusion was 49 days; another 36 patients were “study controls”. We identified another control group: 36 patients from the Belarussian surveillance database (“surveillance controls” 1:1 matched to cases. Results: Of the cases, 81% had successful outcomes versus 42% of surveillance controls and 39% of study controls. Successful outcome odds were 6.5 (95% Confidence Interval: 1.2–36.2, p=0.032 times greater for cases than surveillance controls (age-adjusted. Radiological improvement was more likely in cases than study controls. Culture analysis prior to infusion demonstrated a poorer initial prognosis in cases, yet despite this they had better outcomes than the control groups. Conclusion: MSC treatment could vastly improve outcomes for MDR-TB patients. Our findings could revolutionize therapy options and have strong implications for future directions of MDR-TB therapy research. Keywords: Mesenchymal stromal cells, Extensively drug resistant, Outcomes, Treatment

Hearing loss in children treated for multidrug-resistant tuberculosis.

Science.gov (United States)

Seddon, James A; Thee, Stephanie; Jacobs, Kayleen; Ebrahim, Adam; Hesseling, Anneke C; Schaaf, H Simon

2013-04-01

The aminoglycosides and polypeptides are vital drugs for the management of multidrug-resistant (MDR) tuberculosis (TB). Both classes of drug cause hearing loss. We aimed to determine the extent of hearing loss in children treated for MDR-TB. In this retrospective study, children (Hearing was assessed and classified using audiometry and otoacoustic emissions. Ninety-four children were included (median age: 43 months). Of 93 tested, 28 (30%) were HIV-infected. Twenty-three (24%) children had hearing loss. Culture-confirmed, as opposed to presumed, diagnosis of TB was a risk factor for hearing loss (OR: 4.12; 95% CI: 1.13-15.0; p = 0.02). Seven of 11 (64%) children classified as having hearing loss using audiometry had progression of hearing loss after finishing the injectable drug. Hearing loss is common in children treated for MDR-TB. Alternative drugs are required for the treatment of paediatric MDR-TB. Copyright © 2012 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Factors Associated with Mortality among Patients on TB Treatment in the Southern Region of Zimbabwe, 2013

Science.gov (United States)

Sandy, Charles; Masuka, Nyasha; Hazangwe, Patrick; Choto, Regis C.; Mutasa-Apollo, Tsitsi; Nkomo, Brilliant; Sibanda, Edwin; Mugurungi, Owen; Siziba, Nicholas

2017-01-01

Background. In 2013, the tuberculosis (TB) mortality rate was highest in southern Zimbabwe at 16%. We therefore sought to determine factors associated with mortality among registered TB patients in this region. Methodology. This was a retrospective record review of registered patients receiving anti-TB treatment in 2013. Results. Of 1,971 registered TB patients, 1,653 (84%) were new cases compared with 314 (16%) retreatment cases. There were 1,538 (78%) TB/human immunodeficiency virus (HIV) coinfected patients, of whom 1,399 (91%) were on antiretroviral therapy (ART) with median pre-ART CD4 count of 133 cells/uL (IQR, 46–282). Overall, 428 (22%) TB patients died. Factors associated with increased mortality included being ≥65 years old [adjusted relative risk (ARR) = 2.48 (95% CI 1.35–4.55)], a retreatment TB case [ARR = 1.34 (95% CI, 1.10–1.63)], and being HIV-positive [ARR = 1.87 (95% CI, 1.44–2.42)] whilst ART initiation was protective [ARR = 0.25 (95% CI, 0.22–0.29)]. Cumulative mortality rates were 10%, 14%, and 21% at one, two, and six months, respectively, after starting TB treatment. Conclusion. There was high mortality especially in the first two months of anti-TB treatment, with risk factors being recurrent TB and being HIV-infected, despite a high uptake of ART. PMID:28352474

Factors Associated with Mortality among Patients on TB Treatment in the Southern Region of Zimbabwe, 2013

Directory of Open Access Journals (Sweden)

Kudakwashe C. Takarinda

2017-01-01

Full Text Available Background. In 2013, the tuberculosis (TB mortality rate was highest in southern Zimbabwe at 16%. We therefore sought to determine factors associated with mortality among registered TB patients in this region. Methodology. This was a retrospective record review of registered patients receiving anti-TB treatment in 2013. Results. Of 1,971 registered TB patients, 1,653 (84% were new cases compared with 314 (16% retreatment cases. There were 1,538 (78% TB/human immunodeficiency virus (HIV coinfected patients, of whom 1,399 (91% were on antiretroviral therapy (ART with median pre-ART CD4 count of 133 cells/uL (IQR, 46–282. Overall, 428 (22% TB patients died. Factors associated with increased mortality included being ≥65 years old [adjusted relative risk (ARR = 2.48 (95% CI 1.35–4.55], a retreatment TB case [ARR = 1.34 (95% CI, 1.10–1.63], and being HIV-positive [ARR = 1.87 (95% CI, 1.44–2.42] whilst ART initiation was protective [ARR = 0.25 (95% CI, 0.22–0.29]. Cumulative mortality rates were 10%, 14%, and 21% at one, two, and six months, respectively, after starting TB treatment. Conclusion. There was high mortality especially in the first two months of anti-TB treatment, with risk factors being recurrent TB and being HIV-infected, despite a high uptake of ART.

[Multidrug-resistant tuberculosis: challenges of a global emergence].

Science.gov (United States)

Comolet, T

2015-10-01

Drug-resistant tuberculosis, in particular Multi-Drug Resistant (MDR-TB) is an increasing global concern and a major burden for some developing countries, especially the BRICS. It is assumed that every year roughly 350 000 new MDR-TB cases occur in the world, on average in 20.5% of TB patients that have been previously treated but also in 3.5% of persons that have never been on TB treatment before. The global distribution of cases is very heterogeneous and is now better understood thanks to a growing number of specific surveys and routine surveillance systems: incidence is much higher in southern Africa and in all countries formerly part of the USSR. Countries with weak health systems and previously inefficient TB control programs are highly vulnerable to MDR epidemics because program failures do help creating, maintaining and spreading resistances. Global response is slowly rolled out and diagnosis capacities are on the rise (mostly with genotypic methods) but adequate and successful treatment and care is still limited to a minority of global cases. From a public health perspective the MDR-TB growing epidemics will not be controlled merely by the introduction of few new antibiotics because it is also linked to patient's compliance and adequate case management supported by efficient TB program. In depth quality improvement will only be achieved after previous errors are thoroughly analyzed and boldly corrected.

A study of multidrug-resistant tuberculosis in risk groups in the city of Santos, São Paulo, Brazil

Directory of Open Access Journals (Sweden)

Andréa Gobetti Vieira Coelho

2012-09-01

Full Text Available Monitoring the extent of and trends in multidrug-resistant tuberculosis (MDR-TB is a priority of the Brazilian National Tuberculosis Control Programme. The current study aimed to estimate the incidence of MDR-TB, describe the profile of TB drug resistance in risk groups and examine whether screening for MDR-TB adhered to the recommended guidelines. A descriptive study that examined diagnosed cases of pulmonary TB was conducted in the city of Santos, Brazil, between 2000-2004. Of the 2,176 pulmonary TB cases studied, 671 (30.8% met the criteria for drug sensitivity testing and, of these cases, 31.7% (213/671 were tested. Among the tested cases, 9.4% were resistant to one anti-TB drug and 15% were MDR. MDR was observed in 11.6% of 86 new TB cases and 17.3% of 127 previously treated cases. The average annual incidence of MDR-TB was 1.9 per 100,000 inhabitants-years. The extent of known MDR-TB in the city of Santos is high, though likely to be underestimated. Our study therefore indicates an inadequate adherence to the guidelines for MDR-TB screening and suggests the necessity of alternative strategies of MDR-TB surveillance.

Nanotechnology-Based Approach in Tuberculosis Treatment

Directory of Open Access Journals (Sweden)

Mohammad Nasiruddin

2017-01-01

Full Text Available Tuberculosis, commonly known as TB, is the second most fatal infectious disease after AIDS, caused by bacterium called Mycobacterium tuberculosis. Prolonged treatment, high pill burden, low compliance, and stiff administration schedules are factors that are responsible for emergence of MDR and XDR cases of tuberculosis. Till date, only BCG vaccine is available which is ineffective against adult pulmonary TB, which is the most common form of disease. Various unique antibodies have been developed to overcome drug resistance, reduce the treatment regimen, and elevate the compliance to treatment. Therefore, we need an effective and robust system to subdue technological drawbacks and improve the effectiveness of therapeutic drugs which still remains a major challenge for pharmaceutical technology. Nanoparticle-based ideology has shown convincing treatment and promising outcomes for chronic infectious diseases. Different types of nanocarriers have been evaluated as promising drug delivery systems for various administration routes. Controlled and sustained release of drugs is one of the advantages of nanoparticle-based antituberculosis drugs over free drug. It also reduces the dosage frequency and resolves the difficulty of low poor compliance. This paper reviews various nanotechnology-based therapies which can be used for the treatment of TB.

Risk Factors for Multidrug-resistant Tuberculosis

Directory of Open Access Journals (Sweden)

Cleopas Martin Rumende

2018-04-01

Diabetes mellitus has been a well-known risk factor for TB in the past. The global convergence of the accelerating type 2 DM pandemic, high TB prevalence and drug-resistant TB during the past couple of decades has become a serious challenge to clinicians worldwide. Over the past few years, some studies have shown that the treatment failure rate is higher in TB patients with DM as comorbidity. Moreover, there is significant association between DM an MDR-TB. There is higher chance of TB bacilli persistence to be present in sputum of pulmonary TB patient with DM than TB-only patient after 5 months treatment, and this persistence made it necessary for more longer treatment. Presence of DM in TB patients cause a longer period for sputum conversion, therefore it may become a major cause of poor treatment outcome in TB patients. Previous studies showed that a major mechanism for the emergence of drugs resistance in TB bacilli is random mutation in the bacterial genome and the pressure of selection by anti-TB drugs. Pulmonary TB in diabetic patients usually show higher mycobacterial loads at the initiation of treatment, hence they may have higher chance of bacillary mutation and the emergence of MDR-TB with the presenting of higher bacterial loads, longer treatment is needed to clear the bacteria. Therefore, it is not suprising that a higher chance of MDR-TB patients could be find in those patients. A pharmacokinetic study noted that plasma levels of rifampicin were 53% lower in TB patients with diabetes, which might affect treatment outcomes. Inadequate immune respons of the host may also be important in this negative effect of diabetes. Depressed production of IFN-γ in diabetic patients is related to decreasing immune response to TB infection. Reduction of IL-12 response to mycobacterial stimulation in leukocytes from TB with diabetic patients suggest a compromise of innate immune response.

Treatment results of patients with multiple and extensive drug resistance registered in 2012 in the Russian Federation and in the world

Directory of Open Access Journals (Sweden)

S. A. Sterlikov

2016-01-01

Full Text Available The chemotherapy results have been analyzed in tuberculosis patients suffering from multiple drug resistance registered for treatment in the Russian Federation in 2011-2012 compared with the treatment outcomes of MDR patients registered for treatment in the world, BRICS and countries of the former Soviet Union in 2011. Treatment outcomes of XDR TB patients have been analyzed for the first time. Chemotherapy efficiency in MDR TB patients in the Russian Federation in the cohort of 2011 made 37.1%, and in the cohort of 2012 made 39.1%, which significantly lower than in the world in general (47.5%, in BRICS and countries of the former Soviet Union; this low treatment efficiency is mostly due to treatment failures (18.3% and those died (19.1%. The treatment efficiency of XDR TB patients registered for treatment in the Russian Federation in 2012 made 26.2% versus 22.0% in the cohort of 2011. Considering the significant financial costs spent on the treatment, the chemotherapy efficiency of M/XDR TB patients in the Russian Federation is too low to improve the epidemic situation and some additional measures are to be taken for its improvement.

Ursolic and oleanolic acids as antimicrobial and immunomodulatory compounds for tuberculosis treatment.

Science.gov (United States)

Jiménez-Arellanes, Adelina; Luna-Herrera, Julieta; Cornejo-Garrido, Jorge; López-García, Sonia; Castro-Mussot, María Eugenia; Meckes-Fischer, Mariana; Mata-Espinosa, Dulce; Marquina, Brenda; Torres, Javier; Hernández-Pando, Rogelio

2013-10-07

New alternatives for the treatment of Tuberculosis (TB) are urgently needed and medicinal plants represent a potential option. Chamaedora tepejilote and Lantana hispida are medicinal plants from Mexico and their hexanic extracts have shown antimycobacterial activity. Bioguided investigation of these extracts showed that the active compounds were ursolic acid (UA) and oleanolic acid (OA). The activity of UA and OA against Mycobacterium tuberculosis H37Rv, four monoresistant strains, and two drug-resistant clinical isolates were determined by MABA test. The intracellular activity of UA and OA against M. tuberculosis H37Rv and a MDR clinical isolate were evaluated in a macrophage cell line. Finally, the antitubercular activity of UA and OA was tested in BALB/c mice infected with M. tuberculosis H37Rv or a MDR strain, by determining pulmonary bacilli loads, tissue damage by automated histomorphometry, and expression of IFN-γ, TNF-α, and iNOS by quantitative RT-PCR. The in vitro assay showed that the UA/OA mixture has synergistic activity. The intracellular activity of these compounds against M. tuberculosis H37Rv and a MDR clinical isolate in a macrophage cell line showed that both compounds, alone and in combination, were active against intracellular mycobacteria even at low doses. Moreover, when both compounds were used to treat BALB/c mice with TB induced by H37Rv or MDR bacilli, a significant reduction of bacterial loads and pneumonia were observed compared to the control. Interestingly, animals treated with UA and OA showed a higher expression of IFN-γ and TNF-α in their lungs, than control animals. UA and OA showed antimicrobial activity plus an immune-stimulatory effect that permitted the control of experimental pulmonary TB.

Effect of Introducing Xpert MTB/RIF to Test and Treat Individuals at Risk of Multidrug-Resistant Tuberculosis in Kazakhstan: A Prospective Cohort Study.

Science.gov (United States)

van Kampen, Sanne Christine; Tursynbayeva, Aigul; Koptleuova, Aliya; Murzakhmetova, Zauresh; Murzabekova, Zauresh; Bigalieva, Lyazzat; Aubakirova, Moldir; Pak, Svetlana; van den Hof, Susan

2015-01-01

Xpert MTB/RIF (Xpert) was piloted in Kazakhstan to detect tuberculosis (TB) and rifampicin resistance (RR-)TB among individuals at risk of multidrug-resistant (MDR-) TB. This study assessed the performance of Xpert compared to conventional diagnostic methods, RR-TB case detection among various risk groups, treatment initiation and time to diagnosis and treatment. Eligible individuals were tested with Xpert, smear microscopy, culture and drug-susceptibility testing (DST) at the national TB reference laboratory and three provincial laboratories. Data was collected prospectively from August 2012 to May 2013 from routine laboratory and treatment registers. A total of 5,611 Xpert tests were performed mostly targeting contacts of MDR-TB patients, 'other' presumptive MDR-TB patients, and retreatment cases (26%, 24% and 22%, respectively). Compared to phenotypic DST, the positive predictive value of Xpert to detect RR-TB was 93.1% and 96.4% and the negative predictive value was 94.6% and 92.7% using solid and liquid culture media, respectively. RR-TB detection was highest among (former) prisoners, retreatment cases, people living with HIV/AIDS (PLWHA), and TB patients with positive smears after intensive phase of treatment (59%, 58%, 54% and 53% among TB positives, respectively). 88.9% of RR-TB patients were registered to have started second-line TB treatment. Median time to diagnosis with Xpert was 0.0 days (IQR 0.0-1.0), time from diagnosis to start of first-line treatment 3.0 days (IQR 1.0-7.0), and to start of second-line treatment 7.0 days (IQR 4.0-16). Compared to conventional culture and DST, Xpert had a shorter result turn-around-time and excellent concordance to detect RR-TB. Time from sputum collection to start of second-line treatment was reduced to one week. The yield of Xpert could be maximized by increasing referrals from penitentiary and HIV centers to TB centers.

Effect of Introducing Xpert MTB/RIF to Test and Treat Individuals at Risk of Multidrug-Resistant Tuberculosis in Kazakhstan: A Prospective Cohort Study.

Directory of Open Access Journals (Sweden)

Sanne Christine van Kampen

Full Text Available Xpert MTB/RIF (Xpert was piloted in Kazakhstan to detect tuberculosis (TB and rifampicin resistance (RR-TB among individuals at risk of multidrug-resistant (MDR- TB. This study assessed the performance of Xpert compared to conventional diagnostic methods, RR-TB case detection among various risk groups, treatment initiation and time to diagnosis and treatment.Eligible individuals were tested with Xpert, smear microscopy, culture and drug-susceptibility testing (DST at the national TB reference laboratory and three provincial laboratories. Data was collected prospectively from August 2012 to May 2013 from routine laboratory and treatment registers.A total of 5,611 Xpert tests were performed mostly targeting contacts of MDR-TB patients, 'other' presumptive MDR-TB patients, and retreatment cases (26%, 24% and 22%, respectively. Compared to phenotypic DST, the positive predictive value of Xpert to detect RR-TB was 93.1% and 96.4% and the negative predictive value was 94.6% and 92.7% using solid and liquid culture media, respectively. RR-TB detection was highest among (former prisoners, retreatment cases, people living with HIV/AIDS (PLWHA, and TB patients with positive smears after intensive phase of treatment (59%, 58%, 54% and 53% among TB positives, respectively. 88.9% of RR-TB patients were registered to have started second-line TB treatment. Median time to diagnosis with Xpert was 0.0 days (IQR 0.0-1.0, time from diagnosis to start of first-line treatment 3.0 days (IQR 1.0-7.0, and to start of second-line treatment 7.0 days (IQR 4.0-16.Compared to conventional culture and DST, Xpert had a shorter result turn-around-time and excellent concordance to detect RR-TB. Time from sputum collection to start of second-line treatment was reduced to one week. The yield of Xpert could be maximized by increasing referrals from penitentiary and HIV centers to TB centers.

Drug resistant tuberculosis in Saudi Arabia: an analysis of surveillance data 2014-2015.

Science.gov (United States)

Al Ammari, Maha; Al Turaiki, Abdulrahman; Al Essa, Mohammed; Kashkary, Abdulhameed M; Eltigani, Sara A; Ahmed, Anwar E

2018-01-01

There is limited data that investigates the national rates of drug-resistant tuberculosis (TB) in Saudi Arabia.This study aimed to estimate the rates of multi-drug-resistant tuberculosis (MDR-TB), rifampicin-resistant tuberculosis (RR-TB), and monoresistance (MR) in Saudi Arabia. A retrospective cohort study was conducted on all TB cases reported to the National TB Control and Prevention Program (NTCPP) registry at the Saudi Ministry of Health between January 1, 2014 and December 31, 2015. A total of 2098 TB patients with positive TB cultures were included in the study. Subgroup analyses and multivariate binary logistic regression models were performed with IBM SPSS 23.0. Of the total TB cases, 4.4% (95% CI: 3.59%-5.40%) were found to have MDR-TB. The rates of MR were 3.8% (95% CI: 2.99%-4.67%) for ethambutol, 5.4% (95% CI: 4.50%-6.49%) for pyrazinamide, 10.2% (95% CI: 5.89%-11.52%) for isoniazid, 11% (95% CI: 9.70%-12.43%) for streptomycin, and 5.9% (95% CI: 4.90%-6.96%) for rifampicin. The high rates of MDR and RR-TB were found among the younger age group, female gender, and those who had a previous history of TB. We also discovered that renal failure tends to increase the risk of rifampicin resistance. National TB data in Saudi Arabia shows that the rate of MDR-TB was similar to the global rate reported by the World Health Organization (WHO). It is a relatively high rate as compared to Western countries. The proportion of MDR/RR-TB patients tends to be higher in the younger age group, female gender, and in patients with a previous history of TB treatment. Effective strategies for prevention of all multi-drug-resistant TB cases are warranted.

In vitro screening of snake venom against multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

Sujay Kumar Bhunia

2015-12-01

Full Text Available The re-emergence of multidrug-resistant tuberculosis (MDR-TB has brought to light the importance of screening effective novel drugs. In the present study, in vitro activities of different snake (Naja naja, Bungarus fasciatus, Daboia russelli russelli, Naja kaouthia venoms have been investigated against clinical isolate of MDR-TB strains. The treatment with all the venoms inhibited the mycobacterial growth for at least a week in common and two of them (Naja naja and Naja kaouthia showed significantly longer inhibition up to two weeks against the MDR-TB strain with single dose and a repetition of those two venoms exhibited inhibition up to more than four weeks.

Five years retrospective cohort analysis of treatment outcomes of TB ...

African Journals Online (AJOL)

Background: Human immunodeficiency virus (HIV) associated tuberculosis (TB) remains a major global public health challenge, with an estimated 1.4 million patients worldwide. Co-infection with HIV leads to challenges in the diagnosis and treatment of patients. Objectives: The aim of this study was to assess treatment ...

The impact of drug resistance on the risk of tuberculosis infection and disease in child household contacts: a cross sectional study.

Science.gov (United States)

Golla, Vera; Snow, Kathryn; Mandalakas, Anna M; Schaaf, H Simon; Du Preez, Karen; Hesseling, Anneke C; Seddon, James A

2017-08-29

The relative fitness of organisms causing drug-susceptible (DS) and multidrug-resistant (MDR) tuberculosis (TB) is unclear. We compared the risk of TB infection and TB disease in young child household contacts of adults with confirmed DS-TB and MDR-TB. In this cross-sectional analysis we included data from two community-based contact cohort investigation studies conducted in parallel in Cape Town, South Africa. Children <5 years of age with household exposure to an infectious TB case were included between August 2008 to June 2011. Children completed investigation for TB infection (tuberculin skin test) and TB disease (symptom evaluation, chest radiograph, bacteriology) in both studies using standard approaches. The impact of MDR-TB exposure on each covariate of TB infection and TB disease was assessed using univariable and multivariable logistic regression. Of 538 children included, 312 had DS-TB and 226 had MDR-TB exposure. 107 children with DS-TB exposure had TB infection (34.3%) vs. 101 (44.7%) of children with MDR-TB exposure (adjusted Odds Ratio [aOR]: 2.05; 95% confidence interval [CI]: 1.34-3.12). A total of 15 (6.6%) MDR-TB vs. 27 (8.7%) DS-TB child contacts had TB disease at enrolment (aOR: 0.43; 95% CI: 0.19-0.97). Our results suggest a higher risk of TB infection in child contacts with household MDR-TB vs. DS-TB exposure, but a lower risk of TB disease. Although potentially affected by residual confounding or selection bias, our results are consistent with the hypothesis of impaired virulence in MDR-TB strains in this setting.

Multidrug-resistant tuberculosis in pregnancy

International Nuclear Information System (INIS)

Dhingra, V.K.; Arora, V.K.; Rajpal, S.

2007-01-01

This is a case report of 26 years old pregnant woman with multidrug-resistant tuberculosis (MDR TB), treated at outpatient department of New Delhi Tuberculosis (NDTB) Centre, India with second line agents. Before presentation at NDTB Centre, she had been treated with first line drugs for approximately one and-a-half-year, including category II re-treatment DOTS regimen under RNTCP. Patient conceived twice during her anti-TB treatment. The first one was during her category II treatment, when put on second line drugs. We describe congenital abnormalities documented in her second child exposed in-utero to second line anti-tubercular drugs with a brief review of treatment of MDR TB in pregnancy. (author)

Evaluation of GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing of multi-drug resistance tuberculosis in Northern India

Directory of Open Access Journals (Sweden)

Anand Kumar Maurya

2013-01-01

Full Text Available Background: The problem of multi-drug resistance tuberculosis (MDR-TB is growing in several hotspots throughout the world. Rapid and accurate diagnosis of MDR-TB is crucial to facilitate early treatment and to reduce its spread in the community. The aim of the present study was to evaluate the new, novel GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing (DST of MDR-TB cases in Northern India. Materials and Methods: A total of 550 specimens were collected from highly suspected drug resistant from pulmonary and extra-pulmonary TB cases. All the specimens were processed by Ziehl- Neelsen staining, culture, differentiation by the GenoType® CM assay, first line DST using BacT/ALERT 3D system and GenoType® MTBDRplus assay. The concordance of the GenoType® MTBDRplus assay was calculated in comparison with conventional DST results. Results: Overall the sensitivity for detection of rifampicin, isoniazid and MDR-TB resistance by GenoType® MTBDRplus assay was 98.0%, 98.4% and 98.2% respectively. Out of 55 MDR-TB strains, 45 (81.8%, 52 (94.5% and 17 (30.9% strains showed mutation in rpoB, katG and inhA genes respectively (P < 0.05. The most prominent mutations in rpoB, katG and inhA genes were; 37 (67.3% in S531L, 52 (94.5% in S315T1 and 11 (20% in C15T regions respectively (P < 0.05. Conclusions: Our study demonstrated a high concordance between the GenoType® MTBDRplus assay resistance patterns and those were observed by conventional DST with good sensitivity, specificity with short turnaround times and to control new cases of MDR-TB in countries with a high prevalence of MDR-TB.

Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol.

Science.gov (United States)

Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

2016-10-17

Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This evaluation is innovative as it combines patient and health system costs, as well as operational modelling in assessing the impact. An economic evaluation nested in a clinical trial with 2 arms will be performed at 4 facilities. The primary outcome measure is incremental cost to the health system of the study regimen compared with the control regimen. Secondary outcome measures are mean incremental costs incurred by patients by treatment outcome; patient costs by category (direct medical costs, transport, food and accommodation costs, and cost of guardians/accompanying persons and lost time); health systems cost by category and drugs; and costs related to serious adverse events. The study has been evaluated and approved by the Ethics Advisory Group of the International Union Against Tuberculosis and Lung Disease; South African Medical Research Ethics Committee; Wits Health Consortium Protocol Review Committee; University of the Witwatersrand Human Research Ethics Committee; University of Kwazulu-Natal Biomedical Research Ethics Committee; St Peter TB Specialized Hospital Ethical Review Committee; AHRI-ALERT Ethical Review Committee, and all participants will provide written informed consent. The results of the economic evaluation will be published in a peer-reviewed journal. ISRCTN78372190. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

High rates of ofloxacin resistance in Mycobacterium tuberculosis among both new and previously treated patients in Tamil Nadu, South India.

Science.gov (United States)

Selvakumar, N; Kumar, Vanaja; Balaji, S; Prabuseenivasan, S; Radhakrishnan, R; Sekar, Gomathi; Chandrasekaran, V; Kannan, T; Thomas, Aleyamma; Arunagiri, S; Dewan, Puneet; Swaminathan, Soumya

2015-01-01

Periodic drug resistance surveillance provides useful information on trends of drug resistance and effectiveness of tuberculosis (TB) control measures. The present study determines the prevalence of drug resistance among new sputum smear positive (NSP) and previously treated (PT) pulmonary TB patients, diagnosed at public sector designated microscopy centers (DMCs) in the state of Tamil Nadu, India. In this single-stage cluster-sampling prevalence survey, 70 of 700 DMCs were randomly selected using a probability-proportional to size method. A cluster size of 24 for NSP and a varying size of 0 to 99 for PT cases were fixed for each selected DMC. Culture and drug susceptibility testing was done on Lowenstein-Jensen medium using the economic variant of proportion sensitivity test for isoniazid (INH), rifampicin (RMP), ofloxacin (OFX) and kanamycin (KAN). Human Immunodeficiency Virus (HIV) status was collected from patient records. From June 2011 to August 2012, 1524 NSP and 901 PT patients were enrolled. Any RMP resistance and any INH resistance were observed in 2.6% and 15.1%, and in 10.4% and 30% respectively in NSP and PT cases. Among PT patients, multi drug resistant TB (MDR-TB) was highest in the treatment failure (35%) group, followed by relapse (13%) and treatment after default (10%) groups. Extensively drug resistant TB (XDRTB) was seen in 4.3% of MDR-TB cases. Any OFX resistance was seen in 10.4% of NSP, 13.9% of PT and 29% of PT MDR-TB patients. The HIV status of the patient had no impact on drug resistance levels. RMP resistance was present in 2.6% of new and 15.1% of previously treated patients in Tamil Nadu. Rates of OFX resistance were high among NSP and PT patients, especially among those with MDR-TB, a matter of concern for development of new treatment regimens for TB.

TB treatment initiation and adherence in a South African community influenced more by perceptions than by knowledge of tuberculosis

Directory of Open Access Journals (Sweden)

Møller Valerie

2010-02-01

Full Text Available Abstract Background Tuberculosis (TB is a global health concern. Inadequate case finding and case holding has been cited as major barrier to the control of TB. The TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. The Eastern Cape is known as a province with high TB incidence, prevalence and with one of the worst cure rates of South Africa. Its inhabitants can be considered lay experts when it comes to TB. Therefore, we investigated knowledge, perceptions of (access to TB treatment and adherence to treatment among an Eastern Cape population. Methods An area-stratified sampling design was applied. A total of 1020 households were selected randomly in proportion to the total number of households in each neighbourhood. Results TB knowledge can be considered fairly good among this community. Respondents' perceptions suggest that stigma may influence TB patients' decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Regression analyses revealed that in this population young and old, men and women and the lower and higher educated share the same attitudes and perceptions. Our findings are therefore likely to reflect the actual situation of TB patients in this population. Conclusions The lay experts' perceptions suggests that stigma appears to effect case holding and case finding. Future interventions should be directed at improving attitudes and perceptions to potentially reduce stigma. This requires a patient-centered approach to empower TB patients and active involvement in the development and implementation of stigma reduction programs.

Optimization of TB/HIV co-treatment in Ethiopian patients

OpenAIRE

Degu, Wondwossen Amogne

2015-01-01

Tuberculosis (TB) and HIV infection act with deadly synergy. HIV is the most important risk factor for latent TB reactivation and active TB progression following exposure or reinfection while TB accelerates HIV progression. TB is the most frequent cause of morbidity and mortality in HIV infection. Anti-TB therapy (ATT) must precede initiation of combination Antiretroviral Therapy (cART), TB being the most immediate threat. Undoubtedly cART benefits; however, important clinical ...

Use of Lot Quality Assurance Sampling to Ascertain Levels of Drug Resistant Tuberculosis in Western Kenya.

Directory of Open Access Journals (Sweden)

Julia Jezmir

Full Text Available To classify the prevalence of multi-drug resistant tuberculosis (MDR-TB in two different geographic settings in western Kenya using the Lot Quality Assurance Sampling (LQAS methodology.The prevalence of drug resistance was classified among treatment-naïve smear positive TB patients in two settings, one rural and one urban. These regions were classified as having high or low prevalence of MDR-TB according to a static, two-way LQAS sampling plan selected to classify high resistance regions at greater than 5% resistance and low resistance regions at less than 1% resistance.This study classified both the urban and rural settings as having low levels of TB drug resistance. Out of the 105 patients screened in each setting, two patients were diagnosed with MDR-TB in the urban setting and one patient was diagnosed with MDR-TB in the rural setting. An additional 27 patients were diagnosed with a variety of mono- and poly- resistant strains.Further drug resistance surveillance using LQAS may help identify the levels and geographical distribution of drug resistance in Kenya and may have applications in other countries in the African Region facing similar resource constraints.

Use of Lot Quality Assurance Sampling to Ascertain Levels of Drug Resistant Tuberculosis in Western Kenya.

Science.gov (United States)

Jezmir, Julia; Cohen, Ted; Zignol, Matteo; Nyakan, Edwin; Hedt-Gauthier, Bethany L; Gardner, Adrian; Kamle, Lydia; Injera, Wilfred; Carter, E Jane

2016-01-01

To classify the prevalence of multi-drug resistant tuberculosis (MDR-TB) in two different geographic settings in western Kenya using the Lot Quality Assurance Sampling (LQAS) methodology. The prevalence of drug resistance was classified among treatment-naïve smear positive TB patients in two settings, one rural and one urban. These regions were classified as having high or low prevalence of MDR-TB according to a static, two-way LQAS sampling plan selected to classify high resistance regions at greater than 5% resistance and low resistance regions at less than 1% resistance. This study classified both the urban and rural settings as having low levels of TB drug resistance. Out of the 105 patients screened in each setting, two patients were diagnosed with MDR-TB in the urban setting and one patient was diagnosed with MDR-TB in the rural setting. An additional 27 patients were diagnosed with a variety of mono- and poly- resistant strains. Further drug resistance surveillance using LQAS may help identify the levels and geographical distribution of drug resistance in Kenya and may have applications in other countries in the African Region facing similar resource constraints.

Lay beliefs of TB and TB/HIV co-infection in Addis Ababa, Ethiopia: a qualitative study

Directory of Open Access Journals (Sweden)

Frich Jan C

2011-08-01

Full Text Available Abstract Background Knowledge about lay beliefs of etiology, transmission and treatment of TB, and lay perceptions of the relationship between TB and HIV is important for understanding patients' health seeking behavior and adherence to treatment. We conducted a study to explore lay beliefs about TB and TB/HIV co-infection in Addis Ababa, Ethiopia. Findings We conducted a qualitative study using in-depth interviews with 15 TB/HIV co-infected patients and 9 health professionals and focus group discussions with 14 co-infected patients in Addis-Ababa, Ethiopia. We found that a predominant lay belief was that TB was caused by exposure to cold. Excessive sun exposure, exposure to mud, smoking, alcohol, khat and inadequate food intake were also reported as causes for TB. Such beliefs initially led to self-treatment. The majority of patients were aware of an association between TB and HIV. Some reported that TB could transform into HIV, while others said that the body could be weakened by HIV and become more susceptible to illnesses such as TB. Some patients classified TB as either HIV-related or non-HIV-related, and weight loss was a hallmark for HIV-related TB. The majority of patients believed that people in the community knew that there was an association between TB and HIV, and some feared that this would predispose them to HIV-related stigma. Conclusion There is a need for culturally sensitive information and educational efforts to address misperceptions about TB and HIV. Health professionals should provide information about causes and treatment of TB and HIV to co-infected patients.

Converging risk factors but no association between HIV infection and multidrug-resistant tuberculosis in Kazakhstan.

Science.gov (United States)

van den Hof, S; Tursynbayeva, A; Abildaev, T; Adenov, M; Pak, S; Bekembayeva, G; Ismailov, S

2013-04-01

Kazakhstan is a country with a low HIV/AIDS (human immunodeficiency virus/acquired immune-deficiency syndrome) burden, but a high prevalence of multidrug-resistant tuberculosis (MDR-TB). We describe the epidemiology of multidrug resistance and HIV among TB patients, using the 2007-2011 national electronic TB register. HIV test results were available for 97.2% of TB patients. HIV prevalence among TB patients increased from 0.6% in 2007 to 1.5% in 2011. Overall, 41.6% of patients had a positive smear at diagnosis, 38.6% a positive culture and 51.7% either a positive smear or culture. Drug susceptibility testing (DST) results were available for 92.7% of culture-positive cases. Socio-economic factors independently associated with both HIV and MDR-TB were urban residency, drug use, homelessness and a history of incarceration. In adjusted analysis, HIV positivity was not associated with MDR-TB (OR 1.0, 95%CI 0.86-1.2). Overall, among TB patients with DST and HIV test results available, 65.0% were positive for neither HIV nor MDR-TB, 33.5% only for MDR-TB, 0.9% only for HIV and 0.6% for both HIV and MDR-TB. Among injection drug users, 12.5% were positive for HIV and MDR-TB. We showed increasing HIV prevalence among TB patients in Kazakhstan. HIV was not an independent risk factor for MDR-TB, but risk factors were largely overlapping and we did identify subgroups at particular risk of HIV-MDR-TB co-infection, notably drug users. Enhanced efforts are necessary to provide care to these socially vulnerable populations.

Repurposing and Revival of the Drugs: A New Approach to Combat the Drug Resistant Tuberculosis

Directory of Open Access Journals (Sweden)

Divakar Sharma

2017-12-01

Full Text Available Emergence of drug resistant tuberculosis like multi drug resistant tuberculosis (MDR-TB, extensively drug-resistant tuberculosis (XDR-TB and totally drug resistant tuberculosis (TDR-TB has created a new challenge to fight against these bad bugs of Mycobacterium tuberculosis. Repurposing and revival of the drugs are the new trends/options to combat these worsen situations of tuberculosis in the antibiotics resistance era or in the situation of global emergency. Bactericidal and synergistic effect of repurposed/revived drugs along with the latest drugs bedaquiline and delamanid used in the treatment of MDR-TB, XDR-TB, and TDR-TB might be the choice for future promising combinatorial chemotherapy against these bad bugs.

Therapeutic vaccines for tuberculosis-A systematic review

NARCIS (Netherlands)

Gröschel, Matthias I.; Prabowo, Satria A.; Cardona, Pere-Joan; Stanford, John L.; van der Werf, Tjip S.

2014-01-01

For eradication of tuberculosis (TB) by 2050, the declared aim of the Stop TB Partnership, novel treatment strategies are indispensable. The emerging epidemic of multi-drug resistant (MDR) TB has fuelled the debate about TB vaccines, as increasing numbers of patients can no longer be cured by

Multidrug-resistant tuberculosis in Lithuania – Still a long way ahead

Directory of Open Access Journals (Sweden)

Greta Musteikienė

2016-01-01

Full Text Available Despite the recent advances in the diagnosis of tuberculosis, treatment of the disease, for the most part, remains the same as it was half a century ago. In recent years only two new anti-tuberculosis drugs have been approved by the European Medicines Agency and Food and Drug Administration. Though the prevalence of this disease is slowly decreasing all over Europe, new challenges appear. One of them is multidrug-resistant tuberculosis (MDR-TB. This problem is especially prominent in Lithuania, which is one of the 27 high MDR-TB burden countries in the world and falls behind neighboring countries in terms of the prevalence of the disease. The objective of this paper was to review the situation of tuberculosis and MDR-TB in Lithuania, and current available methods of treatment, control and diagnosis of this disease.

TB treatment in a chronic complex emergency: treatment outcomes and experiences in Somalia.

Science.gov (United States)

Liddle, Karin Fischer; Elema, Riekje; Thi, Sein Sein; Greig, Jane; Venis, Sarah

2013-11-01

Médecins Sans Frontières (MSF) provides TB treatment in Galkayo and Marere in Somalia. MSF international supervisory staff withdrew in 2008 owing to insecurity but maintained daily communication with Somali staff. In this paper, we aimed to assess the feasibility of treating TB in a complex emergency setting and describe the programme adaptations implemented to facilitate acceptable treatment outcomes. Routinely collected treatment data from 2005-2012 were retrospectively analysed. In multivariate analyses, factors associated with successful outcome (cure or completion versus failure, death and default) were assessed, including the presence of international supervisory staff. Informal interviews were conducted with Somali staff regarding programmatic factors affecting patient management and perceived reasons for default. In total, 6167 patients were admitted (34.8% female; median age 24.0 years [IQR 13.0-38.0 years]). Treatment success was 79% (programme range 69-87%). Presence of international staff did not improve outcomes (adjusted OR 0.85, 95% CI 0.66-1.09; p=0.27). Perceived reasons for default included being away from family, nomadic group, insecurity, travel cost, need to return to grazing land or feeling better. Despite the challenges, a high percentage of patients were successfully treated. Treatment outcomes were not adversely affected by withdrawal of international supervisory staff.

Diabetes is Associated with Severe Adverse Events in Multidrug-Resistant Tuberculosis.

Science.gov (United States)

Muñoz-Torrico, Marcela; Caminero-Luna, José; Migliori, Giovanni Battista; D'Ambrosio, Lia; Carrillo-Alduenda, José Luis; Villareal-Velarde, Héctor; Torres-Cruz, Alfredo; Flores-Vergara, Héctor; Martínez-Mendoza, Dina; García-Sancho, Cecilia; Centis, Rosella; Salazar-Lezama, Miguel Ángel; Pérez-Padilla, Rogelio

2017-05-01

Diabetes mellitus (DM), a very common disease in Mexico, is a well-known risk factor for tuberculosis (TB). However, it is not known by which extent DM predisposes to adverse events (AE) to anti-TB drugs and/or to worse outcomes in patients with multidrug-resistant (MDR-TB) and extensively drug-resistant TB (XDR-TB). The main objective of this study was to describe the outcomes of TB treatment, the impact of DM and the prevalence of AE in a cohort of patients with MDR-/XDR pulmonary TB treated at the national TB referral centre in Mexico City. Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%), 11 with pre-XDR-TB (12.2%) and 6 (6.7%) with XDR-TB, including 49 (54.4%) with DM, and 3 with Human Immunodeficiency Virus (HIV) co-infection (3.3%). In 98% of patients, diagnosis was made by culture and drug susceptibility testing, while in a single case the diagnosis was made by a molecular test. The presence of DM was associated with an increased risk of serious drug-related AEs, such as nephrotoxicity (Odds Ratio [OR]=6.5; 95% Confidence Interval [95% CI]: 1.9-21.8) and hypothyroidism (OR=8.8; 95% CI: 1.8-54.2), but not for a worse outcome. Our data suggest that DM does not impact second-line TB treatment outcomes, but patients with DM have a higher risk of developing serious AEs to drug-resistant TB treatment, such as nephrotoxicity and hypothyroidism. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Tuberculosis in South Asia: a tide in the affairs of men.

Science.gov (United States)

Basnyat, Buddha; Caws, Maxine; Udwadia, Zarir

2018-01-01

Tuberculosis (TB) remains the most common cause of infectious disease deaths worldwide. What is perhaps less appreciated is that the caseload of tuberculosis patients in South Asia is staggering.South Asia has almost 40% of the global TB burden with 4,028,165 cases in 2015. This region also has a disproportionate share of TB deaths (681,975 deaths, 38% of the global burden). Worldwide just 12.5% of TB cases are in HIV positive individuals, but much research and investment has focused on HIV-associated TB. Only 3.5% of patients with tuberculosis in South Asia have HIV co-infection. Not surprisingly with such a huge burden of disease, this region has an estimated 184,336 multi drug resistant (MDR) cases among notified TB cases which accounts for a third of global MDR burden. Crucially, at least 70% of the estimated MDR cases remain untreated in this region and MDR treatment success ranged from only 46% for India to 88% for Sri Lanka in the 2012 cohort that received treatment. This region represents many of the drivers of the modern TB epidemic: rapid urbanization and high density populations with dramatically rising incidence of diabetes, a burgeoning and largely unregulated private sector with escalating drug resistance and high air pollution both outdoor and household. From bacterial biochemistry to policy implementation, we suggest ways in which South Asia can seize the opportunity lead global TB elimination by demonstrating feasibility in some of the world's most densely populated cities and remotest reaches of the Himalayas. Clearly political will is essential, but we cannot defeat TB without understanding how to eliminate it in South Asia.

Rapid diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis using a molecular-based diagnostic algorithm.

Science.gov (United States)

Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

2014-10-01

There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Integration of HIV and TB Services Results in Improved TB Treatment Outcomes and Earlier Prioritized ART Initiation in a Large Urban HIV Clinic in Uganda

NARCIS (Netherlands)

Hermans, Sabine M.; Castelnuovo, Barbara; Katabira, Catherine; Mbidde, Peter; Lange, Joep M. A.; Hoepelman, Andy I. M.; Coutinho, Alex; Manabe, Yukari C.

2012-01-01

Background: The World Health Organization recommends that treatment of tuberculosis (TB) in HIV-infected patients should be integrated with HIV care. In December 2008, a separate outdoor-integrated TB/HIV clinic was instituted for attendees of a large urban HIV clinic in Uganda. We sought to

Prevalence of Multidrug-Resistant Tuberculosis and Associated Factors in Ethiopia: A Systematic Review

OpenAIRE

Asgedom, Solomon Weldegebreal; Teweldemedhin, Mebrahtu; Gebreyesus, Hailay

2018-01-01

Background. Multidrug-resistant tuberculosis (MDR-TB) has continued to be a challenge for tuberculosis (TB) control globally. Ethiopia is one of the countries with high MDR-TB burden. Objective. The main purpose of this study was to determine the prevalence of MDR-TB and associated factors in Ethiopia. Methods. A systematic review of the literatures on prevalence of MDR-TB and associated factors was conducted in the country. Results. In our electronic search, 546 citations were depicted. Amon...

Tuberculosis and HIV co-infection in Vietnam.

Science.gov (United States)

Trinh, Q M; Nguyen, H L; Do, T N; Nguyen, V N; Nguyen, B H; Nguyen, T V A; Sintchenko, V; Marais, B J

2016-05-01

Tuberculosis (TB) and human immunodeficiency virus (HIV) infection are leading causes of disease and death in Vietnam, but TB/HIV disease trends and the profile of co-infected patients are poorly described. We examined national TB and HIV notification data to provide a geographic overview and describe relevant disease trends within Vietnam. We also compared the demographic and clinical profiles of TB patients with and without HIV infection. During the past 10 years (2005-2014) cumulative HIV case numbers and deaths increased to 298,151 and 71,332 respectively, but access to antiretroviral therapy (ART) improved and new infections and deaths declined. From 2011-2014 routine HIV testing of TB patients increased from 58.9% to 72.5% and of all TB patients diagnosed with HIV in 2014, 2,803 (72.4%) received ART. The number of multidrug resistant (MDR)-TB cases enrolled for treatment increased almost 3-fold (578 to 1,532) from 2011-2014. The rate of HIV co-infection in MDR and non-MDR TB cases (51/1,532; 3.3% vs 3,774/100,555; 3.8%; OR 0.77, 95% CI 0.7-1.2) was similar in 2014. The care of TB/HIV co-infected patients have shown sustained improvement in Vietnam. Rising numbers of MDR-TB cases is a concern, but this is not "driven" by HIV co-infection. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Understanding Market Size and Reporting Gaps for Paediatric TB in Indonesia, Nigeria and Pakistan: Supporting Improved Treatment of Childhood TB in the Advent of New Medicines.

Science.gov (United States)

Coghlan, Renia; Gardiner, Elizabeth; Amanullah, Farhana; Ihekweazu, Chikwe; Triasih, Rina; Grzemska, Malgorzata; Sismanidis, Charalambos

2015-01-01

We sought to understand gaps in reporting childhood TB cases among public and private sector health facilities (dubbed "non-NTP" facilities) outside the network of national TB control programmes, and the resulting impact of under-reporting on estimates of paediatric disease burden and market demand for new medicines. Exploratory assessments were carried out in Indonesia, Nigeria and Pakistan, reaching a range of facility types in two selected areas of each country. Record reviews and interviews of healthcare providers were carried out to assess numbers of unreported paediatric TB cases, diagnostic pathways followed and treatment regimens prescribed. A total of 985 unreported diagnosed paediatric TB cases were identified over a three month period in 2013 in Indonesia from 64 facilities, 463 in Pakistan from 35 facilities and 24 in Nigeria from 20 facilities. These represent an absolute additional annualised yield to 2013 notifications reported to WHO of 15% for Indonesia, 2% for Nigeria and 7% for Pakistan. Only 12% of all facilities provided age and sex-disaggregated data. Findings highlight the challenges of confirming childhood TB. Diagnosis patterns in Nigeria highlight a very low suspicion for childhood TB. Providers note the need for paediatric medicines aligned to WHO recommendations. This study emphasises the impact of incomplete reporting on the estimation of disease burden and potential market size of paediatric TB medicines. Further studies on "hubs" (facilities treating large numbers of childhood TB cases) will improve our understanding of the epidemic, support introduction efforts for new treatments and better measure markets for new paediatric medicines.

A cross-sectional study of tuberculosis drug resistance among previously treated patients in a tertiary hospital in Accra, Ghana: public health implications of standardized regimens.

Science.gov (United States)

Forson, Audrey; Kwara, Awewura; Kudzawu, Samuel; Omari, Michael; Otu, Jacob; Gehre, Florian; de Jong, Bouke; Antonio, Martin

2018-04-02

Mycobacterium tuberculosis drug resistance is a major challenge to the use of standardized regimens for tuberculosis (TB) therapy, especially among previously treated patients. We aimed to investigate the frequency and pattern of drug resistance among previously treated patients with smear-positive pulmonary tuberculosis at the Korle-Bu Teaching Hospital Chest Clinic, Accra. This was a cross-sectional survey of mycobacterial isolates from previously treated patients referred to the Chest Clinic Laboratory between October 2010 and October 2013. The Bactec MGIT 960 system for mycobactrerial culture and drug sensitivity testing (DST) was used for sputum culture of AFB smear-positive patients with relapse, treatment failure, failure of smear conversion, or default. Descriptive statistics were used to summarize patient characteristics, and frequency and patterns of drug resistance. A total of 112 isolates were studied out of 155 from previously treated patients. Twenty contaminated (12.9%) and 23 non-viable isolates (14.8%) were excluded. Of the 112 studied isolates, 53 (47.3%) were pan-sensitive to all first-line drugs tested Any resistance (mono and poly resistance) to isoniazid was found in 44 isolates (39.3%) and any resistance to streptomycin in 43 (38.4%). Thirty-one (27.7%) were MDR-TB. Eleven (35.5%) out of 31 MDR-TB isolates were pre-XDR. MDR-TB isolates were more likely than non-MDR isolates to have streptomycin and ethambutol resistance. The main findings of this study were the high prevalence of MDR-TB and streptomycin resistance among previously treated TB patients, as well as a high prevalence of pre-XDR-TB among the MDR-TB patients, which suggest that first-line and second-line DST is essential to aid the design of effective regimens for these groups of patients in Ghana.

Extensively and Pre-Extensively Drug Resistant Tuberculosis in Clinical Isolates of Multi-Drug Resistant Tuberculosis Using Classical Second Line Drugs (Levofloxacin and Amikacin)

International Nuclear Information System (INIS)

Mirza, I. A.; Khan, F. A.; Khan, K. A.; Satti, L.; Ghafoor, T.; Fayyaz, M.

2015-01-01

Objective:To find out the frequency of Extensively Drug Resistant (XDR) and pre-XDR tuberculosis in clinical isolates of Multi-Drug Resistant (MDR) Tuberculosis (TB) by determining the susceptibilities against Levofloxacin and Amikacin (classical second line antituberculosis drugs). Study Design: A descriptive cross-sectional study. Place and Duration of Study: Microbiology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from September 2011 to August 2013. Methodology: Amikacin (AK) and Levofloxacin (LEVO) were obtained in chemically pure form from Sigma (Taufkirchen, Germany). The breakpoint concentration used for AK was 1.0 micro g/ml and for LEVO 2.0 micro g/ml. Mycobacterial Growth Indicator Tube (MGIT) 960 system was used to carry out drug susceptibility testing as per recommended protocol. Results: A total of 3 MDR-TB isolates (3 percentage) turned out to be XDR-TB based upon simultaneous resistance to injectable second line antituberculosis drug AK and one of the fluoro-quinolones (LEVO). A total of 24 MDR-TB isolates (24 percentage) were found to be pre-XDR based upon resistance to LEVO alone. Treatment status record of patients with XDR and pre-XDRTB isolates revealed that majority of patients had received fluoroquinolones (FQs) during the course of treatment. Conclusion: XDR-TB has started to emerge in MDR-TB isolates in our set up. The worrying sign is the high frequency of pre-XDR tuberculosis. Urgent steps need to be taken to stem the tide of pre-XDR-TB in our population. It is thus recommended to develop facilities to carry out drug susceptibility testing to monitor the status of pre-XDR and XDR-TB in our population. (author)

Outbreak of multidrug-resistant tuberculosis in two secondary schools.

Science.gov (United States)

Miravet Sorribes, Luis; Arnedo Pena, Alberto; Bellido Blasco, Juan B; Romeu García, María Angeles; Gil Fortuño, María; García Sidro, Patricia; Cortés Miró, Pascual

2016-02-01

To describe an outbreak of multidrug-resistant tuberculosis (MDR-TB) in two schools This was a prospective, observational study of an outbreak of MDR-TB in 2 schools located in the towns of Onda and Nules, in the Spanish province of Castellon, from the moment of detection in November 2008 until November 2014, including patient follow-up and contact tracing. Five cases of MDR-TB were diagnosed. Overall attack rate was 0.9%, and among the contacts traced, 66 had latent tuberculous infection, with an infection rate of 14.4%. Molecular characterization of the 5M. tuberculosis isolates was performed by restriction fragment length polymorphism (RFLP) analysis of the IS6110 sequence. In all 5 patients, cultures were negative at 4-month follow-up, showing the efficacy of the treatment given. No recurrence has been reported to date. In the context of globalization and the increased prevalence of MDR-TB, outbreaks such as the one presented here are only to be expected. Contact tracing, strict follow-up of confirmed cases, the availability of fast diagnostic techniques to avoid treatment delay, and chemoprophylaxis, together with the molecular characterization of strains, are still essential. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

Questions and Answers about TB

Science.gov (United States)

... disease. Introduction Testing and Treatment TB Disease Glossary Introduction Introduction What is TB? Why is TB still ... chest x-ray is made by exposing a film to x-rays that pass through the chest. ...

High variability of TB, HIV, hepatitis C treatment and opioid substitution therapy among prisoners in Germany.

Science.gov (United States)

Müller, Jana; Schmidt, Daniel; Kollan, Christian; Lehmann, Marc; Bremer, Viviane; Zimmermann, Ruth

2017-10-25

In Germany, medical care of prisoners is completely separated from extramural health care. The extent and quality of medical care among prisoners in Germany are therefore largely unknown. We performed a secondary data analysis of pharmacy sales data for tuberculosis (TB), HIV, hepatitis C (HCV) and opioid substitution treatment (OST) delivered to prisons in 11 federal states (FS) in Germany between 01/2012 and 03/2013. The aims of this study were to assess (i) the treatment availability for the selected diseases and OST in German prisons, (ii) the proportion of prisoners treated per FS and overall for TB, HIV, HCV and OST during the study period. Substances unique to or typically used for the treatment of each disease were defined as marker substances with defined daily doses (DDD). For each marker substance we assessed the cumulative number of DDD, the average daily number of DDD (DDD d ) and average treatment prevalence per day in percent (adTP). Accordingly, the DDD d represents one person treated per day and the adTP means the proportion of prisoners treated per day. We compared the adTP of the diseases with previously measured prevalences. We obtained data from pharmacies supplying prisons in 11 of 16 German FS. Of the included prisons, 41% were supplied with medicines for TB, 71% for HIV and 58% for HCV and OST. Twice as many delivered marker substances for TB were indicated for the continuation phase and chemoprevention than the intensive phase. The HIV adTP ranged from 0.06% to 0.94%, HCV adTP ranged from 0.03% to 0.59% and OST adTP ranged from 0% to 7.90%. The overall adTP for the respective treatment was 0.39% for HIV, 0.12% for HCV and 2.18% for OST. According to our findings treatment rates for TB were consistent with the expected TB prevalence, at least in Berlin. HIV treatment seems to be offered to an adequate proportion of estimated infected prisoners. In contrast, the HCV treatment prevalence was low. High variation among FS in provision of all

Expanded polyfunctional T cell response to mycobacterial antigens in TB disease and contraction post-treatment.

Directory of Open Access Journals (Sweden)

James M Young

2010-06-01

Full Text Available T cells producing multiple factors have been shown to be required for protection from disease progression in HIV but we have recently shown this not to be the case in TB. Subjects with active disease had a greater proportion of polyfunctional cells responding to ESAT-6/CFP-10 stimulation than their infected but non-diseased household contacts (HHC. We therefore wanted to assess this profile in subjects who had successfully completed standard TB chemotherapy.We performed a cross-sectional study using PBMC from TB cases (pre- and post-treatment and HHC. Samples were stimulated overnight with TB antigens (ESAT-6/CFP-10 and PPD and their CD4+ and CD8+ T cells were assessed for production of CD107a, IFN-gamma, IL-2 and TNF-alpha and the complexity of the responses was determined using SPICE and PESTLE software.We found that an increase in complexity (i.e., production of more than 1 factor simultaneously of the T cell profile was associated with TB disease and that this was significantly reduced following TB treatment. This implies that T cells are able to respond adequately to TB antigens with active disease (at least initially but the ability of this response to protect the host from disease progression is hampered, presumably due to immune evasion strategies by the bacteria. These findings have implications for the development of new diagnostics and vaccine strategies.

Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco.

Science.gov (United States)

Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El

2013-01-01

Tuberculosis (TB) is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR) and extensively drug resistant (XDR) TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid. For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases) and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing. Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%). Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu), accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC) with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T). The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in

The START Study to evaluate the effectiveness of a combination intervention package to enhance antiretroviral therapy uptake and retention during TB treatment among TB/HIV patients in Lesotho: rationale and design of a mixed-methods, cluster-randomized trial

Directory of Open Access Journals (Sweden)

Andrea A. Howard

2016-06-01

Full Text Available Background: Initiating antiretroviral therapy (ART early during tuberculosis (TB treatment increases survival; however, implementation is suboptimal. Implementation science studies are needed to identify interventions to address this evidence-to-program gap. Objective: The Start TB Patients on ART and Retain on Treatment (START Study is a mixed-methods, cluster-randomized trial aimed at evaluating the effectiveness, cost-effectiveness, and acceptability of a combination intervention package (CIP to improve early ART initiation, retention, and TB treatment success among TB/HIV patients in Berea District, Lesotho. Design: Twelve health facilities were randomized to receive the CIP or standard of care after stratification by facility type (hospital or health center. The CIP includes nurse training and mentorship, using a clinical algorithm; transport reimbursement and health education by village health workers (VHW for patients and treatment supporters; and adherence support using text messaging and VHW. Routine data were abstracted for all newly registered TB/HIV patients; anticipated sample size was 1,200 individuals. A measurement cohort of TB/HIV patients initiating ART was recruited; the target enrollment was 384 individuals, each to be followed for the duration of TB treatment (6–9 months. Inclusion criteria were HIV-infected; on TB treatment; initiated ART within 2 months of TB treatment initiation; age ≥18; English- or Sesotho-speaking; and capable of informed consent. The exclusion criterion was multidrug-resistant TB. Three groups of key informants were recruited from intervention clinics: early ART initiators; non/late ART initiators; and health care workers. Primary outcomes include ART initiation, retention, and TB treatment success. Secondary outcomes include time to ART initiation, adherence, change in CD4+ count, sputum smear conversion, cost-effectiveness, and acceptability. Follow-up and data abstraction are complete

TB control programmes: the challenges for Africa.

Science.gov (United States)

Harries, T

1996-11-01

Governmental neglect of tuberculosis (TB), inadequately managed and inaccurately designed TB control programs, population growth, and the HIV epidemic account for the resurgence of TB in sub-Saharan Africa. The World Health Organization and the International Union against TB and Lung Disease have developed a TB control strategy that aims to reduce mortality, morbidity, and transmission of TB. It aims for an 85% cure rate among detected new cases of smear-positive TB and a 70% rate of detecting existing smear-positive TB cases. The strategy involves the provision of short-course chemotherapy (SCC) to all identified smear-positive TB cases through directly observed treatment (DOTS). SCC treatment regimens for smear-positive pulmonary TB recommended for sub-Saharan African countries are: initial phase = daily administration over 2 months of streptomycin, rifampicin, isoniazid, and pyrazinamide; continuation phase = 3 doses over 4 months of isoniazid and rifampicin or daily administration of thiacetazone and isoniazid or of ethambutol and isoniazid. A TB control policy must be implemented to bring about effective TB control. The essential elements of this policy include political commitment, case detection through passive case-finding, SCC, a regular supply of essential drugs, and a monitoring and evaluation system. Political commitment involves establishing a National TB Control Program to be integrated into the existing health structure. Increased awareness of TB in the community and among health workers and a reference laboratory are needed to make case finding successful. A distribution and logistics system is needed to ensure uninterrupted intake of drugs throughout treatment. These regimens have been very successful and cost-effective but pose several disadvantages (e.g., heavy workload of recommended 3 sputum smear tests). A simplified approach involves 1 initial sputum smear for 6 months; 6-months, intermittent rifampicin-based therapy, 100% DOTS throughout

Effectiveness and safety of imipenem/clavulanate and linezolid to treat multidrug and extensively drug-resistant tuberculosis at a referral hospital in Brazil

Directory of Open Access Journals (Sweden)

M.A. Arbex

2016-11-01

Full Text Available Evidence on effectiveness, safety, and tolerability of imipenem/clavulanate (IC and linezolid containing regimens to treat multidrug-resistant (MDR- and extensively drug-resistant tuberculosis (XDR-TB is scarce. The aim of this observational study is to evaluate the therapeutic contribution of IC and linezolid to manage MDR/XDR-TB cases at the reference centre of São Paulo state, Brazil. Twelve patients (9 males, 1 HIV positive in antiretroviral treatment, 4 MDR, 8 XDR were treated with IC, 11 of them within linezolid-containing regimens. They all were previously treated with treatment failure, for a median (IQR, interquartile range of 4.5 (2–6.5 times, having a severe resistance pattern (median number of resistances: 7 (5–8 and being sputum smear and culture positive. IC and linezolid were prescribed at the dose of 1000 mg/day and 600 mg/day, respectively. The overall exposure was (median (IQR 419 (375.5–658 days for IC and 678 (392–720 days for linezolid. All of them converted their sputum (time to sputum conversion; 60 (37.5–90 days and culture (75 (60–135 days, and 7 were cured while 5 are still on treatment with a gradually improving clinical picture.While no adverse events were reported for IC, 2 minor side effects, only, were attributed to linezolid (17%; in both cases the drug was re-started without further problems. Our study suggests that IC and linezolid-containing regimens can be used safely and with satisfactory outcomes in reference centres to treat MDR/XDR-TB patients. Keywords: MDR-TB, XDR-TB, Imipenem, Linezolid, Effectiveness, Safety, Tolerability

Supporting clinical management of the difficult-to-treat TB cases: the ERS-WHO TB Consilium

Directory of Open Access Journals (Sweden)

Lia D’Ambrosio

2015-03-01

The primary objective of the ERS/WHO TB Consilium is to provide clinical consultation for drug-resistant TB and other difficult-to-treat TB cases, including co-infection with HIV and paediatric cases. Through technical guidance to clinicians managing complex TB cases, the main contribution and outcome of the initiative will be a public health response aimed at achieving correct treatment of affected patients and preventing further development of drug resistance. The Consilum's secondary objective is to ensure monitoring and evaluation of clinical practices on the ground (diagnosis, treatment and prevention.

1 Tuberculosis in India: A need of Public Awareness & Education

African Journals Online (AJOL)

2015-05-07

May 7, 2015 ... MDR-TB(Multi-drug resistant tuberculosis) in absolute numbers during 2008 ... treatment units, One TB Hospital, 501 DOT centres, 38 NGOs and 2829 private .... presence of the family member or accompanying person.

Determination of in vitro synergy between linezolid and other antimicrobial agents against Mycobacterium tuberculosis isolates.

Science.gov (United States)

Zou, Lin; Liu, Min; Wang, Yufeng; Lu, Jie; Pang, Yu

2015-12-01

In this study, our objective was to explore the potential in vitro synergy between linezolid (LZD) and six other anti-TB drugs in Mycobacterium tuberculosis strains, especially multidrug-resistant tuberculosis (MDR-TB) strains. Among the different combinations, the LZD-clarithromycin (CLA) combination showed the best synergism, which was observed in 85% (34/40) of 40 isolates. In addition, one (2.5%) and twenty-one (52.5%) of 40 isolates showed synergism for the LZD-levofloxcin (LEV) and LZD-moxifloxacin (MOX) combinations, respectively, and the difference in the proportion of synergy between these two combinations was significantly different (P synergy against non-MDR group seemed higher than that against MDR group in each combination, while the significant difference was only observed in the LZD-EMB combination (P = 0.046). In conclusion, our findings demonstrate that LZD shows the synergistic activity against both non-MDR and MDR M. tuberculosis strains when in combination with CLA, EMB, MOX, amikacin and clofazimine, indicating that LZD may be considered as a promising component involving the regimen for the treatment of MDR-TB. Copyright © 2015 Elsevier Ltd. All rights reserved.

Soluble Urokinase Plasminogen Activator Receptor Levels in Tuberculosis Patients at High Risk for Multidrug Resistance

Directory of Open Access Journals (Sweden)

Tri Yudani Mardining Raras

2012-01-01

Full Text Available The soluble urokinase plasminogen activator receptor (suPAR has been shown to be a strong prognostic biomarker for tuberculosis (TB. In the present study, the profiles of plasma suPAR levels in pulmonary TB patients at high risk for multidrug resistance were analyzed and compared with those in multidrug resistant (MDR-TB patients. Forty patients were prospectively included, consisting of 10 MDR-TB patients and 30 TB patients at high risk for MDR, underwent clinical assesment. Plasma suPAR levels were measured using ELISA (SUPARnostic, Denmark and bacterial cultures were performed in addition to drug susceptibility tests. All patients of suspected MDR-TB group demonstrated significantly higher suPAR levels compared with the healthy TB-negative group (1.79 ng/mL. Among the three groups at high risk for MDR-TB, only the relapse group (7.87 ng/mL demonstrated suPAR levels comparable with those of MDR-TB patients (7.67 ng/mL. suPAR levels in the two-month negative acid-fast bacilli conversion group (9.29 ng/mL were higher than positive control, whereas levels in the group consisting of therapy failure patients (5.32 ng/mL were lower. Our results strongly suggest that suPAR levels enable rapid screening of suspected MDR-TB patients, but cannot differentiate between groups.

Serum vitamin d level and susceptibility to multidrug-resistant tuberculosis among household contacts

Science.gov (United States)

Herlina, N.; Sinaga, B. Y. M.; Siagian, P.; Mutiara, E.

2018-03-01

Low levels of vitamin D is a predisposing factor for Multidrug-resistant tuberculosis. Family members in contact with the patient are also at risk of infection. Currently, there is no study that compares vitamin D levels between MDR-TB patients and household contact. This study aims to identify the association between level vitamin D within MDR-TB occurrence. This was a case-control study, with the number of samples in each group (MDR-TB) patients and household contactswere40 people. Each member of each group was checked for vitamin D levels using enzyme-linked immunosorbent assay (ELISA) technique. Statistical analysis was by using Chi-Square analysis using SPSS. Mean levels of vitamin D in MDR-TB patients were 32.21, household contact 31.7. There was anosignificant association between vitamin D levels and MDR-TB occurrence (p=1.0).No significant associationbetween vitamin D level with theMDR-TB occurrence.

MDR1 siRNA loaded hyaluronic acid-based CD44 targeted nanoparticle systems circumvent paclitaxel resistance in ovarian cancer

Science.gov (United States)

Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng

2015-02-01

Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.

Sequential analysis as a tool for detection of amikacin ototoxicity in the treatment of multidrug-resistant tuberculosis.

Science.gov (United States)

Vasconcelos, Karla Anacleto de; Frota, Silvana Maria Monte Coelho; Ruffino-Netto, Antonio; Kritski, Afrânio Lineu

2018-04-01

To investigate early detection of amikacin-induced ototoxicity in a population treated for multidrug-resistant tuberculosis (MDR-TB), by means of three different tests: pure-tone audiometry (PTA); high-frequency audiometry (HFA); and distortion-product otoacoustic emission (DPOAE) testing. This was a longitudinal prospective cohort study involving patients aged 18-69 years with a diagnosis of MDR-TB who had to receive amikacin for six months as part of their antituberculosis drug regimen for the first time. Hearing was assessed before treatment initiation and at two and six months after treatment initiation. Sequential statistics were used to analyze the results. We included 61 patients, but the final population consisted of 10 patients (7 men and 3 women) because of sequential analysis. Comparison of the test results obtained at two and six months after treatment initiation with those obtained at baseline revealed that HFA at two months and PTA at six months detected hearing threshold shifts consistent with ototoxicity. However, DPOAE testing did not detect such shifts. The statistical method used in this study makes it possible to conclude that, over the six-month period, amikacin-associated hearing threshold shifts were detected by HFA and PTA, and that DPOAE testing was not efficient in detecting such shifts.

From MDR to MXR

DEFF Research Database (Denmark)

Litman, Thomas; Druley, T E; Stein, W D

2001-01-01

The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....

Association between HIV/AIDS and multi-drug resistance tuberculosis: a systematic review and meta-analysis.

Directory of Open Access Journals (Sweden)

Yonatan Moges Mesfin

Full Text Available BACKGROUND: Human immunodeficiency virus (HIV, multi-drug resistant tuberculosis (MDR is emerging as major challenge facing tuberculosis control programs worldwide particularly in Asia and Africa. Findings from different studies on associations of HIV co-infection and drug resistance among patients with TB have been contradictory (discordant. Some institution based studies found strongly increased risks for multi-drug resistant TB (MDR TB among patients co-infected with TB and HIV, whereas other studies found no increased risk (it remains less clear in community based studies. The aim was to conduct a systematic review and meta-analysis of the association between multi-drug resistant tuberculosis and HIV infection. METHODS AND FINDINGS: Systematic review of the published literature of observational studies was conducted. Original studies were identified using databases of Medline/Pubmed, Google Scholar and HINARI. The descriptions of original studies were made using frequency and forest plot. Publication bias was assessed using Funnel plot graphically and Egger weighted and Begg rank regression tests statistically. Heterogeneity across studies was checked using Cochrane Q test statistic and I(2. Pool risk estimates of MDR-TB and sub-grouping analysis were computed to analyze associations with HIV. Random effects of the meta-analysis of all 24 observational studies showed that HIV is associated with a marginal increased risk of multi-drug resistant tuberculosis (estimated Pooled OR 1.24; 95%, 1.04-1.43. Subgroup analyses showed that effect estimates were higher (Pooled OR 2.28; 95%, 1.52-3.04 for primary multi-drug resistance tuberculosis and moderate association between HIV/AIDS and MDR-TB among population based studies and no significant association in institution settings. CONCLUSIONS: This study demonstrated that there is association between MDR-TB and HIV. Capacity for diagnosis of MDR-TB and initiating and scale up of antiretroviral

Multidrug Resistance Among New Tuberculosis Cases Detecting Local Variation Through Lot Quality-assurance Sampling

NARCIS (Netherlands)

Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

2012-01-01

Background: Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper

Aids Brief

African Journals Online (AJOL)

A mathematical model also suggested that approximately 1% of patients taking TB treatment would develop multidrug-resistant. TB (MDR-TB), even with perfect adherence. The investigators believe that this is due to differences in the way drugs are processed between individual patients, meaning that some individuals do ...

The Burden of Drug-Resistant Tuberculosis in Papua New Guinea: Results of a Large Population-Based Survey.

Directory of Open Access Journals (Sweden)

Paul Aia

Full Text Available Reliable estimates of the burden of multidrug-resistant tuberculosis (MDR-TB are crucial for effective control and prevention of tuberculosis (TB. Papua New Guinea (PNG is a high TB burden country with limited information on the magnitude of the MDR-TB problem.A cross-sectional study was conducted in four PNG provinces: Madang, Morobe, National Capital District and Western Province. Patient sputum samples were tested for rifampicin resistance by the Xpert MTB/RIF assay and those showing the presence of resistance underwent phenotypic susceptibility testing to first- and second-line anti-TB drugs including streptomycin, isoniazid, rifampicin, ethambutol, pyrazinamide, ofloxacin, amikacin, kanamycin and capreomycin.Among 1,182 TB patients enrolled in the study, MDR-TB was detected in 20 new (2.7%; 95% confidence intervals [CI] 1.1-4.3% and 24 previously treated (19.1%; 95%CI: 8.5-29.8% TB cases. No case of extensively drug-resistant TB (XDR-TB was detected. Thirty percent (6/20 of new and 33.3% (8/24 of previously treated cases with MDR-TB were detected in a single cluster in Western Province.In PNG the proportion of MDR-TB in new cases is slightly lower than the regional average of 4.4% (95%CI: 2.6-6.3%. A large proportion of MDR-TB cases were identified from a single hospital in Western Province, suggesting that the prevalence of MDR-TB across the country is heterogeneous. Future surveys should further explore this finding. The survey also helped strengthening the use of smear microscopy and Xpert MTB/RIF testing as diagnostic tools for TB in the country.

Treatment practices in pulmonary tuberculosis by private sector physicians of Meerut, Uttar Pradesh.

Science.gov (United States)

Yadav, A; Garg, S K; Chopra, H; Bajpai, S K; Bano, T; Jain, S; Kumar, A

2012-01-01

Majority of the qualified medical practitioners in the country are in the private sector and more than half of patients with tuberculosis (TB) seek treatment from them. The present study was conducted with the objective of assessing the treatment modalities in pulmonary tuberculosis by the private physicians in Meerut City, Uttar Pradesh, India. A cross-sectional study was carried out covering all the private physicians (graduates and postgraduates in Medicine and Chest Diseases) registered under the Indian Medical Association, Meerut Branch (n = 154). The physicians were interviewed by a pre-designed and pre-tested questionnaire about the treatment modalities practiced by them. Only 43.5% private physicians had attended any Revised National Tuberculosis Control Programme (RNTCP) training in the past five years. Only 33.1% of them were aware of the International Standards of Tuberculosis Care (ISTC). Fifty-three different regimens were used to treat the patients. Majority of physicians (76%) prescribed daily regimens while 24% administered both daily and intermittent treatment. None of the private physicians prescribed exclusive intermittent regimen. Eighty-seven different treatment regimens were used for the treatment of multidrug-resistant TB (MDR-TB) with none of them prescribing standard treatment under RNTCP. As majority of private practitioners do not follow RNTCP guidelines for treating TB, there is an urgent need for their continued education in this area.

Possible impact of the standardized Category IV regimen on multidrug-resistant tuberculosis patients in Mumbai.

Science.gov (United States)

Udwadia, Zarir F; Mullerpattan, Jai Bharat; Shah, Kushal D; Rodrigues, Camilla S

2016-01-01

Treatment of multidrug-resistant tuberculosis (MDR-TB) in the Programmatic Management of Drug-resistant TB program involves a standard regimen with a 6-month intensive phase and an 18-month continuation phase. However, the local drug resistance patterns in high MDR regions such as Mumbai may not be adequately reflected in the design of the regimen for that particular area. The study was carried out at a private Tertiary Level Hospital in Mumbai in a mycobacteriology laboratory equipped to perform the second-line drug susceptibility testing (DST). We attempted to analyze the impact of prescribing the standardized Category IV regimen to all patients receiving a DST at our mycobacteriology laboratory. All samples confirmed to be MDR-TB and tested for the second-line drugs at Hinduja Hospital's Mycobacteriology Laboratory in the year 2012 were analyzed. A total of 1539 samples were analyzed. Of these, 464 (30.14%) were MDR-TB, 867 (56.33%) were MDR with fluoroquinolone resistance, and 198 (12.8%) were extensively drug-resistant TB. The average number of susceptible drugs per sample was 3.07 ± 1.29 (assuming 100% cycloserine susceptibility). Taking 4 effective drugs to be the cut or an effective regimen, the number of patients receiving 4 or more effective drugs from the standardized directly observed treatment, short-course plus regimen would be 516 (33.5%) while 66.5% of cases would receive 3 or less effective drugs. Our study shows that a high proportion of patients will have resistance to a number of the first- and second-line drugs. Local epidemiology must be factored in to avoid amplification of resistance.

Prevalence and molecular characterization of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates from Southern China.

Science.gov (United States)

Pang, Yu; Zhu, Damian; Zheng, Huiwen; Shen, Jing; Hu, Yan; Liu, Jie; Zhao, Yanlin

2017-11-06

Pyrazinamide (PZA) plays a unique role in the treatment for multidrug-resistant tuberculosis (MDR-TB) in both first- and second-line regimens. The aim of this study was to investigate the prevalence and molecular characterization of PZA resistance among MDR-TB isolates collected in Chongqing municipality. A total of 133 MDR-TB isolates were collected from the smear-positive tuberculosis patients who were registered at local TB dispensaries of Chongqing. PZA susceptibility testing was determined with a Bactec MGIT 960 system. In addition, the genes conferring for PZA resistance were screened by DNA sequencing. Of these 133 MDR-TB isolates, 83 (62.4%) were determined as PZA-resistant by MGIT 960. In addition, streptomycin- (83.1% vs. 56.0%, P < 0.01), ofloxacin- (51.8% vs. 18.0%, P < 0.01), kanamycin- (22.9% vs. 2.0%, P < 0.01), amikacin- (18.1% vs. 2.0%, P = 0.01), capromycin-resistance (12.0% vs. 2.0%, P = 0.05), were more frequently observed among PZA-resistant isolates compared with PZA-susceptible isolates. Sequence analysis revealed that 73 out of 83 (88.0%) MDR strains harbored a mutation located in the pncA gene, including 55 (75.3%, 55/73) of single nucleotide substitutions and 18 (24.7%, 18/73) of frameshift mutation, while no genetic mutation associated with PZA resistance was found in the rpsA gene. The pncA expression of strains harboring substitution from A to G at position -11 in the promoter region of pncA was significantly lower than that of H37Rv (P < 0.01). In conclusion, our data have demonstrated that the analysis of the pncA gene rather than rpsA gene provides rapid and accurate information regarding PZA susceptibility for MDR-TB isolates in Chongqing. In addition, loss of pncA expression caused by promoter mutation confers PZA resistance in MDR-TB isolates.

Risk factors associated with multidrug resistant tuberculosis among ...

African Journals Online (AJOL)

Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...

Economic support to patients in HIV and TB grants in rounds 7 and 10 from the global fund to fight AIDS, tuberculosis and malaria.

Directory of Open Access Journals (Sweden)

Linda M Richter

Full Text Available People with TB and/or HIV frequently experience severe economic barriers to health care, including out-of-pocket expenses related to diagnosis and treatment, as well as indirect costs due to loss of income. These barriers can both aggravate economic hardship and prevent or delay diagnosis, treatment and successful outcome, leading to increased transmission, morbidity and mortality. WHO, UNAIDS and the ILO argue that economic support of various kinds is essential to enable vulnerable people to protect themselves from infection, avoid delayed diagnosis and treatment, overcome barriers to adherence, and avert destitution. This paper analyses successful country proposals to the Global Fund to Fight AIDS, Tuberculosis and Malaria that include economic support in Rounds 7 and 10; 36 and 20 HIV and TB grants in Round 7 and 32 and 26, respectively, in Round 10. Of these, up to 84 percent included direct or indirect economic support for beneficiaries, although the amount constituted a very small proportion of the total grant. In TB grants, the objectives of economic support were generally clearly stated, and focused on mechanisms to improve treatment uptake and adherence, and the case was most clearly made for MDR-TB patients. In HIV grants, the objectives were much broader in scope, including mitigation of adverse economic and social effects of HIV and its treatment on both patients and families. The analysis shows that economic support is on the radar for countries developing Global Fund proposals, and a wide range of economic support activities are in place. In order to move forward in this area, the wealth of country experience that exists needs to be collated, assessed and disseminated. In addition to trials, operational research and programme evaluations, more precise guidance to countries is needed to inform evidence-based decision about activities that are cost-effective, affordable and feasible.

Time to ART Initiation among Patients Treated for Rifampicin-Resistant Tuberculosis in Khayelitsha, South Africa: Impact on Mortality and Treatment Success.

Science.gov (United States)

Daniels, Johnny Flippie; Khogali, Mohammed; Mohr, Erika; Cox, Vivian; Moyo, Sizulu; Edginton, Mary; Hinderaker, Sven Gudmund; Meintjes, Graeme; Hughes, Jennifer; De Azevedo, Virginia; van Cutsem, Gilles; Cox, Helen Suzanne

2015-01-01

Khayelitsha, South Africa, with high burdens of rifampicin-resistant tuberculosis (RR-TB) and HIV co-infection. To describe time to antiretroviral treatment (ART) initiation among HIV-infected RR-TB patients initiating RR-TB treatment and to assess the association between time to ART initiation and treatment outcomes. A retrospective cohort study of patients with RR-TB and HIV co-infection not on ART at RR-TB treatment initiation. Of the 696 RR-TB and HIV-infected patients initiated on RR-TB treatment between 2009 and 2013, 303 (44%) were not on ART when RR-TB treatment was initiated. The median CD4 cell count was 126 cells/mm3. Overall 257 (85%) patients started ART during RR-TB treatment, 33 (11%) within 2 weeks, 152 (50%) between 2-8 weeks and 72 (24%) after 8 weeks. Of the 46 (15%) who never started ART, 10 (21%) died or stopped RR-TB treatment within 4 weeks and 16 (37%) had at least 4 months of RR-TB treatment. Treatment success and mortality during treatment did not vary by time to ART initiation: treatment success was 41%, 43%, and 50% among patients who started ART within 2 weeks, between 2-8 weeks, and after 8 weeks (p = 0.62), while mortality was 21%, 13% and 15% respectively (p = 0.57). Mortality was associated with never receiving ART (adjusted hazard ratio (aHR) 6.0, CI 2.1-18.1), CD4 count ≤100 (aHR 2.1, CI 1.0-4.5), and multidrug-resistant tuberculosis (MDR-TB) with second-line resistance (aHR 2.5, CI 1.1-5.4). Despite wide variation in time to ART initiation among RR-TB patients, no differences in mortality or treatment success were observed. However, a significant proportion of patients did not initiate ART despite receiving >4 months of RR-TB treatment. Programmatic priorities should focus on ensuring all patients with RR-TB/HIV co-infection initiate ART regardless of CD4 count, with special attention for patients with CD4 counts ≤ 100 to initiate ART as soon as possible after RR-TB treatment initiation.

Factors associated with linkage to HIV care and TB treatment at community-based HIV testing services in Cape Town, South Africa.

Science.gov (United States)

Meehan, Sue-Ann; Sloot, Rosa; Draper, Heather R; Naidoo, Pren; Burger, Ronelle; Beyers, Nulda

2018-01-01

Diagnosing HIV and/or TB is not sufficient; linkage to care and treatment is conditional to reduce the burden of disease. This study aimed to determine factors associated with linkage to HIV care and TB treatment at community-based services in Cape Town, South Africa. This retrospective cohort study utilized routinely collected data from clients who utilized stand-alone (fixed site not attached to a health facility) and mobile HIV testing services in eight communities in the City of Cape Town Metropolitan district, between January 2008 and June 2012. Clients were included in the analysis if they were ≥12 years and had a known HIV status. Generalized estimating equations (GEE) logistic regression models were used to assess the association between determinants (sex, age, HIV testing service and co-infection status) and self-reported linkage to HIV care and/or TB treatment. Linkage to HIV care was 3 738/5 929 (63.1%). Linkage to HIV care was associated with the type of HIV testing service. Clients diagnosed with HIV at mobile services had a significantly reduced odds of linking to HIV care (aOR 0.7 (CI 95%: 0.6-0.8), p<0.001. Linkage to TB treatment was 210/275 (76.4%). Linkage to TB treatment was not associated with sex and service type, but was associated with age. Clients in older age groups were less likely to link to TB treatment compared to clients in the age group 12-24 years (all, p-value<0.05). A large proportion of clients diagnosed with HIV at mobile services did not link to care. Almost a quarter of clients diagnosed with TB did not link to treatment. Integrated community-based HIV and TB testing services are efficient in diagnosing HIV and TB, but strategies to improve linkage to care are required to control these epidemics.

Five years retrospective cohort analysis of treatment outcomes of TB ...

African Journals Online (AJOL)

Background: Human immunodeficiency virus (HIV) associated tuberculosis (TB) remains a major global public health chal- lenge, with an estimated 1.4 .... completed treatment and who is smear negative at the end of 6th or 7th month of treat- ..... the course of management of the dual disease entity. Conclusion. This study ...

TextTB: A Mixed Method Pilot Study Evaluating Acceptance, Feasibility, and Exploring Initial Efficacy of a Text Messaging Intervention to Support TB Treatment Adherence

Directory of Open Access Journals (Sweden)

Sarah Iribarren

2013-01-01

Full Text Available Objective. To assess a text messaging intervention to promote tuberculosis (TB treatment adherence. Methods. A mixed-methods pilot study was conducted within a public pulmonary-specialized hospital in Argentina. Patients newly diagnosed with TB who were 18 or older, and had mobile phone access were recruited and randomized to usual care plus either medication calendar (n=19 or text messaging intervention (n=18 for the first two months of treatment. Primary outcomes were feasibility and acceptability; secondary outcomes explored initial efficacy. Results. Feasibility was evidenced by high access to mobile phones, familiarity with texting, most phones limited to basic features, a low rate of participant refusal, and many describing suboptimal TB understanding. Acceptability was evidenced by participants indicating feeling cared for, supported, responsible for their treatment, and many self-reporting adherence without a reminder. Participants in the texting group self-reported adherence on average 77% of the days whereas only 53% in calendar group returned diaries. Exploring initial efficacy, microscopy testing was low and treatment outcomes were similar in both groups. Conclusion. The texting intervention was well accepted and feasible with greater reporting of adherence using text messaging than the diary. Further evaluation of the texting intervention is warranted.

Treatment of Mycobacterium tuberculosis-Infected Macrophages with Poly(Lactic-Co-Glycolic Acid) Microparticles Drives NFκB and Autophagy Dependent Bacillary Killing.

LENUS (Irish Health Repository)

Lawlor, Ciaran

2016-01-01

The emergence of multiple-drug-resistant tuberculosis (MDR-TB) has pushed our available repertoire of anti-TB therapies to the limit of effectiveness. This has increased the urgency to develop novel treatment modalities, and inhalable microparticle (MP) formulations are a promising option to target the site of infection. We have engineered poly(lactic-co-glycolic acid) (PLGA) MPs which can carry a payload of anti-TB agents, and are successfully taken up by human alveolar macrophages. Even without a drug cargo, MPs can be potent immunogens; yet little is known about how they influence macrophage function in the setting of Mycobacterium tuberculosis (Mtb) infection. To address this issue we infected THP-1 macrophages with Mtb H37Ra or H37Rv and treated with MPs. In controlled experiments we saw a reproducible reduction in bacillary viability when THP-1 macrophages were treated with drug-free MPs. NFκB activity was increased in MP-treated macrophages, although cytokine secretion was unaltered. Confocal microscopy of immortalized murine bone marrow-derived macrophages expressing GFP-tagged LC3 demonstrated induction of autophagy. Inhibition of caspases did not influence the MP-induced restriction of bacillary growth, however, blockade of NFκB or autophagy with pharmacological inhibitors reversed this MP effect on macrophage function. These data support harnessing inhaled PLGA MP-drug delivery systems as an immunotherapeutic in addition to serving as a vehicle for targeted drug delivery. Such "added value" could be exploited in the generation of inhaled vaccines as well as inhaled MDR-TB therapeutics when used as an adjunct to existing treatments.

Determination of plasma concentrations of levofloxacin by high performance liquid chromatography for use at a multidrug-resistant tuberculosis hospital in Tanzania.

Science.gov (United States)

Ebers, Andrew; Stroup, Suzanne; Mpagama, Stellah; Kisonga, Riziki; Lekule, Isaack; Liu, Jie; Heysell, Scott

2017-01-01

Therapeutic drug monitoring may improve multidrug-resistant tuberculosis (MDR-TB) treatment outcomes. Levofloxacin demonstrates significant individual pharmacokinetic variability. Thus, we sought to develop and validate a high-performance liquid chromatography (HPLC) method with ultraviolet (UV) detection for levofloxacin in patients on MDR-TB treatment. The HPLC-UV method is based on a solid phase extraction (SPE) and a direct injection into the HPLC system. The limit of quantification was 0.25 μg/mL, and the assay was linear over the concentration range of 0.25-15 μg/mL (y = 0.5668x-0.0603, R2 = 0.9992) for the determination of levofloxacin in plasma. The HPLC-UV methodology achieved excellent accuracy and reproducibility along a clinically meaningful range. The intra-assay RSD% of low, medium, and high quality control samples (QC) were 1.93, 2.44, and 1.90, respectively, while the inter-assay RSD% were 3.74, 5.65, and 3.30, respectively. The mean recovery was 96.84%. This method was then utilized to measure levofloxacin concentrations from patients' plasma samples from a retrospective cohort of consecutive enrolled subjects treated for MDR-TB at the national TB hospital in Tanzania during 5/3/2013-8/31/2015. Plasma was collected at 2 hours after levofloxacin administration, the time of estimated peak concentration (eCmax) treatment. Forty-one MDR-TB patients had plasma available and 39 had traceable programmatic outcomes. Only 13 (32%) patients had any plasma concentration that reached the lower range of the expected literature derived Cmax with the median eCmax being 5.86 (3.33-9.08 μg/ml). Using Classification and Regression Tree analysis, an eCmax ≥7.55 μg/mL was identified as the threshold which best predicted cure. Analyzing this CART derived threshold on treatment outcome, the time to sputum culture conversion was 38.3 ± 22.7 days vs. 47.8 ± 26.5 days (p = 0.27) and a greater proportion were cured, in 10 out of 15 (66.7%) vs. 6 out of 18 (33.3%) (p

Infection caused by Mycobacterium tuberculosis.

Science.gov (United States)

Peloquin, C A; Berning, S E

1994-01-01

To update readers on the clinical management of infections caused by Mycobacterium tuberculosis, to provide a general description of the organism, culture and susceptibility testing, and clinical manifestations of the disease, and to provide several aspects of the treatment of the disease, including historical perspective, current approaches, and research opportunities for the future. The current medical literature, including abstracts presented at recent international meetings, is reviewed. References were identified through MEDLINE, MEDLARS II, Current Contents, and published meeting abstracts. Data regarding the epidemiology, clinical manifestations, culture and susceptibility testing, and treatment of tuberculosis are cited. Specific attention has been focused on the clinical management of patients with noncontagious infection and potentially contagious active disease (TB) caused by M. tuberculosis. Information contributing to the discussion of the topics selected by the authors is reviewed. Data supporting and disputing specific conclusions are presented. The incidence of TB is increasing in the US, despite the fact that available technologies are capable of controlling the vast majority of existing cases. Fueling the fire is the problem of coinfection with HIV and M. tuberculosis. Very few drugs are available for the treatment of TB, and few of these approach the potency of isoniazid and rifampin. Preventive therapy of patients exposed to multiple-drug-resistant M. tuberculosis (MDR-TB) is controversial and of unknown efficacy. Treatment of active disease caused by MDR-TB requires up to four times longer, is associated with increased toxicity, and is far less successful than the treatment of drug-susceptible TB. Strategies for the management of such cases are presented. The rising incidence of TB in the US reflects a breakdown in the healthcare systems responsible for controlling the disease, which reflects the past budgetary reductions. Although TB control

Multimodal transfer of MDR by exosomes in human osteosarcoma.

Science.gov (United States)

Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola

2016-07-01

Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.

SUSCEPTIBILITY OF RIFAMPICIN-ISONIAZID RESISTANT MYCOBACTERIUM TUBERCULOSIS ISOLATES AGAINST LEVOFLOXACIN

Directory of Open Access Journals (Sweden)

A. H. Kurniawan

2016-01-01

Full Text Available Background: Tuberculosis (TB is a high burden disease in Indonesia with multidrug-resistant (MDR TB incidence started to increase. Treatment success of MDR-TB globally was low in number than it was targeted which was especially caused by fluoroquinolone resistance. One of the fluoroquinolone is levofloxacin, an antibiotic that has been widely used irrationally as antimicrobial treatment. Therefore, this study investigated the sensitivity and MBC of MDR Mycobacterium tuberculosis isolates against Levofloxacin. Method: The susceptibility test for MDR-Mycobacterium tuberculosis on levofloxacin by standard method with levofloxacin were on concentrations 0,5 μg/ml, 1 μg/ml, and 2 μg/ml. Sample of 8 strains MDR-Mycobacterium tuberculosis were cultured with each concentrations on Middlebrook 7H9 for 1 week incubation. Next, each of the incubated concentration was subcultured on solid media Middlebrook 7H10 for 3 weeks incubation. Colonized agar plates after 3 weeks incubation were confirmed with acid-fast stain. Results: On MB 7H10 with levofloxacin concentration 2 μg/ml showed bactericidal effect 100% by no MDR Mycobacterium tuberculosis colony grew (0/8 while the MB 7H10 with levofloxacin concentration 1 μg/ml and 0,5 μg/ml showed the bactericidal effect 37,5% and 25% respectively. The colonized agar plate implied that the MDR Mycobacterium tuberculosis with levofloxacin concentration 1 μg/ml (5/8 and 0,5 μg/ml (6/8 grew well. Conclusion: Levofloxacin concentration 2 μg/ml was susceptible on MDR Mycobacterium tuberculosis. The concentration 2 μg/ml of levofloxacin could be considered as MBC.

Drug-resistance patterns of Mycobacterium tuberculosis strains and associated risk factors among multi drug-resistant tuberculosis suspected patients from Ethiopia.

Science.gov (United States)

Mesfin, Eyob Abera; Beyene, Dereje; Tesfaye, Abreham; Admasu, Addisu; Addise, Desalegn; Amare, Miskir; Dagne, Biniyam; Yaregal, Zelalem; Tesfaye, Ephrem; Tessema, Belay

2018-01-01

Multidrug drug-resistant tuberculosis (MDR-TB) is a major health problem and seriously threatens TB control and prevention efforts globally. Ethiopia is among the 30th highest TB burden countries for MDR-TB with 14% prevalence among previously treated cases. The focus of this study was on determining drug resistance patterns of Mycobacterium tuberculosis among MDR-TB suspected cases and associated risk factors. A cross-sectional study was conducted in Addis Ababa from June 2015 to December 2016. Sputum samples and socio-demographic data were collected from 358 MDR-TB suspected cases. Samples were analyzed using Ziehl-Neelsen technique, GeneXpert MTB/RIF assay, and culture using Lowenstein-Jensen and Mycobacterial growth indicator tube. Data were analyzed using SPSS version 23. A total of 226 the study participants were culture positive for Mycobacterium tuberculosis, among them, 133 (58.8%) participants were males. Moreover, 162 (71.7%) had been previously treated for tuberculosis, while 128 (56.6%) were TB/HIV co-infected. A majority [122 (54%)] of the isolates were resistant to any first-line anti-TB drugs. Among the resistant isolates, 110 (48.7%) were determined to be resistant to isoniazid, 94 (41.6%) to streptomycin, 89 (39.4%) to rifampicin, 72 (31.9%) to ethambutol, and 70 (30.9%) to pyrazinamide. The prevalence of MDR-TB was 89 (39.4%), of which 52/89 (58.4%) isolates were resistance to all five first-line drugs. Risk factors such as TB/HIV co-infection (AOR = 5.59, p = 0.00), cigarette smoking (AOR = 3.52, p = 0.045), alcohol drinking (AOR = 5.14, p = 0.001) hospital admission (AOR = 3.49, p = 0.005) and visiting (AOR = 3.34, p = 0.044) were significantly associated with MDR-TB. The prevalence of MDR-TB in the study population was of a significantly high level among previously treated patients and age group of 25-34. TB/HIV coinfection, smoking of cigarette, alcohol drinking, hospital admission and health facility visiting were identified as risk factors

A study on demographic characteristics of drug resistant Mycobacterium tuberculosis isolates in Belarus

Directory of Open Access Journals (Sweden)

L Surkova

2012-01-01

Conclusion: As Belarus is a high-burden MDR-TB country and treatment of drug-resistant TB is long and complicated, the findings of this study provided useful information to deliver effective community-based disease control measures and a proposed plane for the effective management of drug-resistant TB at the national level.

The Tuberculosis Cascade of Care in India’s Public Sector: A Systematic Review and Meta-analysis

Science.gov (United States)

Satyanarayana, Srinath; Pai, Madhukar; Thomas, Beena E.; Chadha, Vineet K.; Swaminathan, Soumya; Mayer, Kenneth H.

2016-01-01

Background India has 23% of the global burden of active tuberculosis (TB) patients and 27% of the world’s “missing” patients, which includes those who may not have received effective TB care and could potentially spread TB to others. The “cascade of care” is a useful model for visualizing deficiencies in case detection and retention in care, in order to prioritize interventions. Methods and Findings The care cascade constructed in this paper focuses on the Revised National TB Control Programme (RNTCP), which treats about half of India’s TB patients. We define the TB cascade as including the following patient populations: total prevalent active TB patients in India, TB patients who reach and undergo evaluation at RNTCP diagnostic facilities, patients successfully diagnosed with TB, patients who start treatment, patients retained to treatment completion, and patients who achieve 1-y recurrence-free survival. We estimate each step of the cascade for 2013 using data from two World Health Organization (WHO) reports (2014–2015), one WHO dataset (2015), and three RNTCP reports (2014–2016). In addition, we conduct three targeted systematic reviews of the scientific literature to identify 39 unique articles published from 2000–2015 that provide additional data on five indicators that help estimate different steps of the TB cascade. We construct separate care cascades for the overall population of patients with active TB and for patients with specific forms of TB—including new smear-positive, new smear-negative, retreatment smear-positive, and multidrug-resistant (MDR) TB. The WHO estimated that there were 2,700,000 (95%CI: 1,800,000–3,800,000) prevalent TB patients in India in 2013. Of these patients, we estimate that 1,938,027 (72%) TB patients were evaluated at RNTCP facilities; 1,629,906 (60%) were successfully diagnosed; 1,417,838 (53%) got registered for treatment; 1,221,764 (45%) completed treatment; and 1,049,237 (95%CI: 1,008,775–1

Understanding social context on TB cases

Science.gov (United States)

Ariyanto, Y.; Wati, D. M.

2017-01-01

Tuberculosis (TB) nowadays still becomes one of the world’s deadliest communicable disease. More than half were in South-East Asia and Western Pacific Regions, including Indonesia. As developing country, Indonesia remains classic problems in overcoming TB, that is discontinuation on treatment. Most of discontinuation on treatment among TB patients are affected by diagnostic delay that caused by patient delay. These phenomena occur in many areas, rural to suburb, coastal to plantation, and so on, and they are related with social context among community that could be social capital for each community to deal with TB. Jember as one of county in East Java is known as plantation area. It also has a high prevalence of TB. This study focused on understanding about social context among community, especially on plantation area. This cross-sectional study involved in three districts of Jember, those are Tanggul, Pakusari, and Kalisat. The data were obtained directly from the TB patients, local community, and Primary Health Care (PHC) where the patients recorded. Spatial analysis and social network analysis (SNA) were applied to obtain health seeking behavior pattern among the TB patients coincide the community. Most of TB patients had already chosen health professionals to lead the treatment, although some of them remained to choose self-medication. Meanwhile, SNA showed that religious leader was considered as main part of countermeasures of TB. But they didn’t ever become central figures. So it can be concluded that there are other parts among community who can contribute due to combatting on TB.

Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

Science.gov (United States)

Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

2016-05-01

For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

Multidrug Resistant Tuberculosis involving the Clavicle, Spine and Ribs

Directory of Open Access Journals (Sweden)

H Krishnan

2011-03-01

Full Text Available This report describes an unusual case of multidrug resistant tuberculosis (MDR-TB, involving the right clavicle and multicentric aytpical spine involvement without any neurological deficit. The female patient presented with acute onset of right clavicular pain associated with a one-month history of lower backache with constitutional symptoms. The clavicular lesion and MRI spine findings were highly suggestive of TB. Anti TB drugs (ATD were started empirically as Sabah, Malaysia the patient’s home, is an endemic area for TB. Despite, 2 months of ATD administration, the patient did not respond well clinically and developed left sided chest wall abscesses arising from the left 3rd and 6th ribs. She was then treated for MDR-TB infection and has responded well to this treatment.

Experimental platform utilising melting curve technology for detection of mutations in Mycobacterium tuberculosis isolates.

Science.gov (United States)

Broda, Agnieszka; Nikolayevskyy, Vlad; Casali, Nicki; Khan, Huma; Bowker, Richard; Blackwell, Gemma; Patel, Bhakti; Hume, James; Hussain, Waqar; Drobniewski, Francis

2018-04-20

Tuberculosis (TB) remains one of the most deadly infections with approximately a quarter of cases not being identified and/or treated mainly due to a lack of resources. Rapid detection of TB or drug-resistant TB enables timely adequate treatment and is a cornerstone of effective TB management. We evaluated the analytical performance of a single-tube assay for multidrug-resistant TB (MDR-TB) on an experimental platform utilising RT-PCR and melting curve analysis that could potentially be operated as a point-of-care (PoC) test in resource-constrained settings with a high burden of TB. Firstly, we developed and evaluated the prototype MDR-TB assay using specimens extracted from well-characterised TB isolates with a variety of distinct rifampicin and isoniazid resistance conferring mutations and nontuberculous Mycobacteria (NTM) strains. Secondly, we validated the experimental platform using 98 clinical sputum samples from pulmonary TB patients collected in high MDR-TB settings. The sensitivity of the platform for TB detection in clinical specimens was 75% for smear-negative and 92.6% for smear-positive sputum samples. The sensitivity of detection for rifampicin and isoniazid resistance was 88.9 and 96.0% and specificity was 87.5 and 100%, respectively. Observed limitations in sensitivity and specificity could be resolved by adjusting the sample preparation methodology and melting curve recognition algorithm. Overall technology could be considered a promising PoC methodology especially in resource-constrained settings based on its combined accuracy, convenience, simplicity, speed, and cost characteristics.

ECG-triggered MDR-CT for the detection of pulmonary metastases

International Nuclear Information System (INIS)

Pauls, S.; Wahl, J.; Aschoff, A.J.; Brambs, H.J.; Fleiter, T.R.

2003-01-01

Purpose: Comparison of multidetector-row CT (MDR-CT) of the chest with and without ECG triggering for the detection of pulmonary metastases. Materials and Methods: Fifty patients with malignant tumors underwent CT of the chest. The unenhanced phase was performed with ECG-triggered MDR-CT and the contrast-enhanced phase with helical MDR-CT. The ECG-triggered and standard helical scans were interpreted in separate sessions, with the analysis determining the number and demarcation of the intrapulmonary nodules and the delineation of the mediastinal structure (rated 1 = excellent to 5 = poor). Results: ECG-MDR-CT images detected 38% more pulmonary nodules than MDR-CT. The detection rate for tumors [de

29. The social determinants of tuberculosis and their association ...

African Journals Online (AJOL)

Esem

Challenges with diagnosis of TB in children have contributed to under reporting of cases and hence the burden of childhood TB in Zambia remains undefined[7]. The advent of MDR-TB and Extensively drug resistant. (XDR) TB may retard the progress in TB control [8]. Nonetheless, few MDR TB cases have been reported in.

Changing patterns and trends of multidrug-resistant tuberculosis at referral centre in Northern India: A 4-year experience

Directory of Open Access Journals (Sweden)

A K Maurya

2013-01-01

Full Text Available Purpose: India has a high burden of drug-resistant tuberculosis (TB, although there is little data on multidrug-resistant tuberculosis (MDR-TB. Although MDR-TB has existed for long time in India, very few diagnostic laboratories are well-equipped to test drug sensitivity. The objectives of this study were to determine the prevalence of MDR-TB, first-line drug resistance patterns and its changing trends in northern India in the 4 years. Materials and Methods: This was a prospective study from July 2007 to December 2010. Microscopy, culture by Bactec460 and p-nitro-α-acetylamino-β-hydroxypropiophenone (NAP test was performed to isolate and identify Mycobacterium tuberculosis (M. tb complex (MTBC. Drug sensitivity testing (DST was performed by 1% proportional method (Bactec460 for four drugs: Rifampicin, isoniazid, ethambutol and streptomycin. Various clinical and demographical profiles were evaluated to analyse risk factors for development of drug resistance. Results: We found the overall prevalence rate of MDR-TB to be 38.8%, increasing from 36.4% in 2007 to 40.8% in 2010. we found that the prevalence of MDR-TB in new and previously treated cases was 29.1% and 43.3% ( P < 0.05; CI 95%. The increasing trend of MDR-TB was more likely in pulmonary TB when compared with extra-pulmonary TB ( P < 0.05; CI 95%. Conclusions: we found a high prevalence (38.8% of MDR-TB both in new cases (29.1% and previously treated cases (43.3%.This study strongly highlights the need to make strategies for testing, surveillance, monitoring and management of such drug-resistant cases.

Culture and drug sensitivity testing among patients with pulmonary tuberculosis in Mexico: national data for 2009–2013

Directory of Open Access Journals (Sweden)

Ivonne Orejel

Full Text Available ABSTRACT This study documented the number and results of mycobacterial culture and drug sensitivity testing (CDST in Mexico from 2009–2013 and assessed whether states with a higher risk of multidrug-resistant tuberculosis (MDR-TB performed more CDST and had more cultures showing MDR-TB. Data for this longitudinal, descriptive, operational research study came from the electronic records of 31 state public health laboratories in Mexico. The total number of CDSTs was 6 470, increasing from 2 143 in the first 2 years to 4 327 in the latter 3 years. There was a significant increase in the proportion of cultures showing sensitivity to all drugs, from 53.1% to 60.9% in 2011–2013 (P < 0.001 and a significant decrease in the proportion showing MDR-TB, from 28.2% in 2009 to 19.8% in 2013 (P < 0.001. Cases of extensively drug resistant tuberculosis were < 1% per year. In the 12 states with higher risk for MDR-TB, significantly more CDSTs (2 382 test were done in 2011–2013 than in the other 19 states (1 945 tests. Also, for each year the proportion of cultures showing MDR-TB was significantly higher in high risk MDR-TB states than in lower risk ones (P < 0.001. During the 5-year study period, CDST was scaled up in Mexico, particularly in high-risk MDR-TB states where a higher proportion of cultures showed MDR-TB. Scale up and wider coverage of CDST should continue.

HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-glycoprotein.

Directory of Open Access Journals (Sweden)

Jianfang Chen

Full Text Available Multidrug resistance (MDR is one of the major reasons chemotherapy-based treatments fail. Hypoxia is generally associated with tumor chemoresistance. However, the correlation between the heterodimeric hypoxia-inducible factor-1 (HIF-1 and the multidrug resistance (MDR1 gene/transporter P-glycoprotein (P-gp remains unclear. This study aims to explore the molecular mechanisms of reversing colon cancer MDR by focusing on the target gene HIF-1α.A chemotherapeutic sensitivity assay was used to observe the efficiency of MDR reversal in LoVo multicellular spheroids (MCS. The apoptotic level induced by different drugs was examined by flow cytometry (FCM. Binding of HIF-1α to the MDR1 gene promoter was evaluated by Chromatin immunoprecipitation (ChIP. The relationship between HIF-1α/P-gp expression and sensitivity to chemotherapy was analyzed.The sensitivity of LoVo MCS to all four chemotherapy drugs was decreased to varying degrees under hypoxic conditions. After silencing the HIF-1α gene, the sensitivities of LoVo MCS to all four chemotherapy drugs were restored. The apoptotic levels that all the drugs induced were all decreased to various extents in the hypoxic group. After silencing HIF-1α, the apoptosis level induced by all four chemotherapy drugs increased. The expression of HIF-1α and P-gp was significantly enhanced in LoVo MCS after treatment with hypoxia. Inhibiting HIF-1α significantly decreased the expression of MDR1/P-gp mRNA or protein in both the LoVo monolayers and LoVo MCS. The ChIP assay showed that HIF-1α was bound to the MDR1 gene promoter. Advanced colon carcinoma patients with expression of both HIF-1α and P-gp were more resistant to chemotherapy than that with non expression.HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-gp. The expression of HIF-1α and MDR1/P-gp can be used as a predictive marker for chemotherapy resistance in colon cancer.

Primary drug-resistant tuberculosis in Hanoi, Viet Nam: present status and risk factors.

Directory of Open Access Journals (Sweden)

Nguyen Thi Le Hang

Full Text Available INTRODUCTION: Resistance of Mycobacterium tuberculosis (MTB to anti-tuberculosis (TB drugs presents a serious challenge to TB control worldwide. We investigated the status of drug resistance, including multidrug-resistant (MDR TB, and possible risk factors among newly diagnosed TB patients in Hanoi, the capital of Viet Nam. METHODS: Clinical and epidemiological information was collected from 506 newly diagnosed patients with sputum smear- and culture-positive TB, and 489 (96.6% MTB isolates were subjected to conventional drug susceptibility testing, spoligotyping, and 15-locus variable numbers of tandem repeats typing. Adjusted odds ratios (aORs were calculated to analyze the risk factors for primary drug resistance. RESULTS: Of 489 isolates, 298 (60.9% were sensitive to all drugs tested. Resistance to isoniazid, rifampicin, streptomycin, ethambutol, and MDR accounted for 28.2%, 4.9%, 28.2%, 2.9%, and 4.5%, respectively. Of 24 isolates with rifampicin resistance, 22 (91.7% were MDR and also resistant to streptomycin, except one case. Factors associated with isoniazid resistance included living in old urban areas, presence of the Beijing genotype, and clustered strains [aOR = 2.23, 95% confidence interval (CI 1.15-4.35; 1.91, 1.18-3.10; and 1.69, 1.06-2.69, respectively. The Beijing genotype was also associated with streptomycin resistance (aOR = 2.10, 95% CI 1.29-3.40. Human immunodeficiency virus (HIV coinfection was associated with rifampicin resistance and MDR (aOR = 5.42, 95% CI 2.07-14.14; 6.23, 2.34-16.58, respectively. CONCLUSION: Isoniazid and streptomycin resistance was observed in more than a quarter of TB patients without treatment history in Hanoi. Transmission of isoniazid-resistant TB among younger people should be carefully monitored in urban areas, where Beijing strains and HIV coinfection are prevalent. Choosing an optimal treatment regimen on the basis of the results of drug susceptibility tests and monitoring of treatment

Factors Associated with Treatment Failure among Smear Positive TB Patients in Khorasan-e-Razavi and Sistan-Baluchistan Provinces, Iran

Directory of Open Access Journals (Sweden)

Hekmatollah Khoubfekr, Narges Khanjani, Yunes Jahani, Mahmoud Moosazadeh

2016-12-01

Full Text Available Introduction: Tuberculosis (TB treatment failure is one of the major problems of the health sector in developing countries. Poor treatment of patients leads to drug resistance, relapse, death, and ultimately prevents TB control programs. This study was conducted to determine the factors affecting tuberculosis treatment failure in Khorasan and Sistan- Balochistan regions which have a high prevalence of TB. Methods: In this case - control study 270 patients with tuberculosis (90 cases, 180 controls were analyzed. New TB patients registered with failure to treatment according to the national protocol between March 2008 - March 2012 were chosen as cases and new TB patients with negative sputum smear in the same time frame were enrolled as control group. Demographic data and clinical treatment outcomes were collected through interviews and file records. Multivariate logistic regression analysis was used to determine the predictors of treatment failure in SPSS 19. Results: Independent factors and predictors of failure treatment included illiteracy, a three plus positive sputum smear, positive sputum smear at end of the second month, non-implementation of the Directly Observed Treatment Short strategy by healthcare staff, history of addiction and history of diabetes. Conclusion: Intervention programs for early detection and control of diabetes, drug control programs, giving priority to providing DOTS by health care workers, more individual care and attention to patients with initial smear p + 3 or those that remain sputum positive at the end of the second month or those who are less educated is necessary. J Microbiol Infect Dis 2016;6(4: 172-178

Levels of microRNA miR-16 and miR-155 are altered in serum of patients with tuberculosis and associate with responses to therapy.

Science.gov (United States)

Wagh, Vishal; Urhekar, Anant; Modi, Deepak

2017-01-01

Identification of blood biomarkers that can be useful for predicting Mycobacterium tuberculosis (M.TB) infection, effect of therapy and Multi Drug Resistant (MDR) TB infected individuals is clinically useful for combating tuberculosis epidemic. In this study, we have evaluated the levels of selected miRNAs in serum of TB and MDR TB patients. In addition, we have studied their levels in serum of patients post-therapy. The levels of 4-miRNAs (miR-16, miR-29a, miR-125b and miR-155) were measured in 30 newly diagnosed TB patients, 19 Multi Drug Resistant (MDR) TB patients, 10 patients who completed TB therapy and were TB negative. 30 healthy individuals were recruited as controls. The levels of the miRNAs were estimated by qRT-PCR. Of the four miRNAs studied, the levels of miR-16 were significantly elevated and miR-155 were significantly reduced in serum of TB patients as compared to uninfected controls. The Receiver Operating Characteristic (ROC) curve of miR-16 and miR-155 exhibited a significant distinguishing efficiency with an AUC value of 1 (95% CI, 1 to 1) and 0.967 (95% CI, 0.92-1.04) respectively. Following the therapy, the levels of miR-16 and miR-155 returned to those observed in healthy subjects. In patients with MDR TB, miR-155 was lower as compared to healthy controls and TB treated group but higher as compared to TB naïve patients. miR-16 levels were lowest in serum of MDR TB patients compared to TB naïve, TB treated group and healthy controls. In conclusion, miR-16 and miR-155 in serum may act as surrogate biomarker for studying TB infection, progression of therapy and MDR TB. Copyright © 2016 Elsevier Ltd. All rights reserved.

HIV screening among TB patients and co-trimoxazole preventive therapy for TB/HIV patients in Addis Ababa: facility based descriptive study.

Science.gov (United States)

Denegetu, Amenu Wesen; Dolamo, Bethabile Lovely

2014-01-01

Collaborative TB/HIV management is essential to ensure that HIV positive TB patients are identified and treated appropriately, and to prevent tuberculosis (TB) in HIV positive patients. The purpose of this study was to assess HIV case finding among TB patients and Co-trimoxazole Preventive Therapy (CPT) for HIV/TB patients in Addis Ababa. A descriptive cross-sectional, facility-based survey was conducted between June and July 2011. Data was collected by interviewing 834 TB patients from ten health facilities in Addis Ababa. Both descriptive and inferential statistics were used to summarize and analyze findings. The proportion of TB patients who (self reported) were offered for HIV test, tested for HIV and tested HIV positive during their anti-TB treatment follow-up were; 87.4%, 69.4% and 20.2%; respectively. Eighty seven HIV positive patients were identified, who knew their status before diagnosed for the current TB disease, bringing the cumulative prevalence of HIV among TB patients to 24.5%. Hence, the proportion of TB patients who knew their HIV status becomes 79.9%. The study revealed that 43.6% of those newly identified HIV positives during anti-TB treatment follow-up were actually treated with CPT. However, the commutative proportion of HIV positive TB patients who were ever treated with CPT was 54.4%; both those treated before the current TB disease and during anti-TB treatment follow-up. HIV case finding among TB patients and provision of CPT for TB/HIV co-infected patients needs boosting. Hence, routine offering of HIV test and provision of CPT for PLHIV should be strengthened in-line with the national guidelines.

Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

Science.gov (United States)

Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

2017-10-01

ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

Multidrug resistant tuberculosis in prisons located in former Soviet countries: A systematic review.

Directory of Open Access Journals (Sweden)

Maxwell Droznin

Full Text Available A systematic literature review was performed to investigate the occurrence of multidrug-resistant tuberculosis (MDR TB in prisons located in countries formerly part of the Soviet Union.A systematic search of published studies reporting MDR TB occurrence in prisons located in former Soviet countries was conducted by probing PubMed and Cumulative Index Nursing and Allied Health Literature for articles that met predetermined inclusion criteria.Seventeen studies were identified for systematic review. Studies were conducted in six different countries. Overall, prevalence of MDR TB among prisoners varied greatly between studies. Our findings suggest a high prevalence of MDR TB in prisons of Post-Soviet states with percentages as high as 16 times more than the worldwide prevalence estimated by the WHO in 2014.All studies suggested a high prevalence of MDR TB in prison populations in Post-Soviet states.

Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog

Directory of Open Access Journals (Sweden)

Rosa Gagliardi B.

2013-08-01

Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.

Multidrug-resistant tuberculosis in Moldova and the Former Yugoslav Republic of Macedonia: The importance of health system governance

Directory of Open Access Journals (Sweden)

R. Gregory Thomas-Reilly

2016-04-01

Full Text Available Aim: Multidrug-resistant tuberculosis (MDR-TB arises where treatment is interrupted or inadequate, when patients are treated inappropriately, or when an individual has impaired immune function, which can lead to a rapid progression from infection with an MDR-strain to disease. This study examines the role of health systems in amplifying or preventing the development of MDR-TB. Methods: We present two comparative studies, which were undertaken in The Former Yugoslav Republic of Macedonia (TFYR Macedonia and Moldova. Results: The findings reveal several health systems-level factors that contribute to the different rates of MDR-TB observed in these two countries, including: pre-existing burden of disease; organization of the health system, with the existence of parallel systems; power dynamics among policy makers and disease programmes; and the accountability & effectiveness of programme oversight. Conclusions: The findings do not offer a universal template for health system reform but do identify specific factors that may be contributing to the epidemic and are worthy of further attention in the two countries.

Proteomic analysis of drug-resistant Mycobacterium tuberculosis by one-dimensional gel electrophoresis and charge chromatography.

Science.gov (United States)

Yari, Shamsi; Hadizadeh Tasbiti, Alireza; Ghanei, Mostafa; Shokrgozar, Mohammad Ali; Fateh, Abolfazl; Mahdian, Reza; Yari, Fatemeh; Bahrmand, Ahmadreza

2017-01-01

Multidrug-resistant tuberculosis (MDR-TB) is a form of TB caused by Mycobacterium tuberculosis (M. tuberculosis) that do not respond to, at least, isoniazid and rifampicin, the two most powerful, first-line (or standard) anti-TB drugs. Novel intervention strategies for eliminating this disease were based on finding proteins that can be used for designing new drugs or new and reliable kits for diagnosis. The aim of this study was to compare the protein profiles of MDR-TB with sensitive isolates. Proteomic analysis of M. tuberculosis MDR-TB and sensitive isolates was obtained with ion exchange chromatography coupled with MALDI-TOF-TOF (matrix-assisted laser desorption/ionization) in order to identify individual proteins that have different expression in MDR-TB to be used as a drug target or diagnostic marker for designing valuable TB vaccines or TB rapid tests. We identified eight proteins in MDR-TB isolates, and analyses showed that these proteins are absent in M. tuberculosis-sensitive isolates: (Rv2140c, Rv0009, Rv1932, Rv0251c, Rv2558, Rv1284, Rv3699 and MMP major membrane proteins). These data will provide valuable clues in further investigation for suitable TB rapid tests or drug targets against drug-resistant and sensitive M. tuberculosis isolates.

The risk of global epidemic replacement with drug-resistant Mycobacterium tuberculosis strains

Directory of Open Access Journals (Sweden)

Emma S. McBryde

2017-03-01

Results and conclusions: The ability of MDR-TB to dominate DS-TB was highly sensitive to the relative transmissibility of the resistant strain; however, MDR-TB could dominate even when its transmissibility was modestly reduced (to between 50% and 100% as transmissible as the DS-TB strain. This model suggests that it may take decades or more for strain replacement to occur. It was also found that while the amplification of resistance is the early cause of MDR-TB, this will rapidly give way to person-to-person transmission.

Investigation of Susceptibility of Mycobacterium tuberculosis Complex Strains Isolated from Clinical Samples Against the First and Second-Line Anti-tuberculosis Drugs by the Sensititre MycoTB Plate Method

Directory of Open Access Journals (Sweden)

Figen KAYSERİLİ ORHAN

2018-03-01

Full Text Available Introduction: Phenotypic methods for drug susceptibility testing of Mycobacterium tuberculosis complex (MTC to second-line drugs are not yet standardized. The Sensititre MycoTB Plate is a microtiter plate containing lyophilized antibiotics and configured for determination of MIC to first and second-line anti-tuberculosis drugs. The purpose of this study is to detect the susceptibility rates of MTC strains isolated from patients’ specimens for first and second-line anti-tuberculosis drugs. Materials and Methods: This study included 50 MTC strains isolated from various clinical specimens. Out of the 50 strains, 38 were isolated from sputum, three from cerebrospinal fluid, three from bronchoalveolar lavage, and six from other samples in this study. The susceptibility of strains to anti-tuberculosis drugs were determined by the Sensititre MycoTB Plate Method. Thawed isolates were subcultured, and dilutions were inoculated into MycoTB wells. The results were read at days 7, 14 and 21. Results: At the end of study, out of 50 MTC isolates, 7 (14% showed resistance to Isoniazid (INH, 5 (10% to streptomycin (SM, 4 (8% to ethambutol (EMB, 4 (8% to ethionamide (ETH, 3 (6% to rifampicin (RIF, 3 (6% to rifabutin (RFB, 2 (4% to kanamycin (KAN, 2 (4% to ofloxacin (OFL, 2 (4% to P-aminosalicyclic acid (PAS, 1 (2% to moxiflocacin (MOX, and 1 (2% to cycloserine (CYC. All strains were found sensitive to amikacin while 2 strains (4% were identified as multidrug-resistant tuberculosis (MDR-TB. Thirty-five strains (70% were sensitive to all drugs. Extensively drug resistant tuberculosis (XDR-TB was not determined in this study. Conclusion: This is the first study that tests second line anti-tuberculosis drugs in our location and provides us valuable data regarding MDR-TB and XDR-TB rates. The Sensititre MycoTB Plate Method is a fast, reliable and practical method and can be used to determine the susceptibility of first and second-line anti-tuberculosis drugs.

Accelerated approach of discovering plant derived drug leads for treatment of TB

CSIR Research Space (South Africa)

Naidoo, D

2010-06-01

Full Text Available dedicated and comprehensive plant electronic database of a total of 566 plants that are reportedly used for the treatment of tuberculosis. The extracts of these plants are part of the CSIR database of extracts. TB drug lead research is ongoing, and active...

A randomized controlled study comparing community based with health facility based direct observation of treatment models on patients' satisfaction and TB treatment outcome in Nigeria.

Science.gov (United States)

Adewole, Olanisun O; Oladele, T; Osunkoya, Arinola H; Erhabor, Greg E; Adewole, Temitayo O; Adeola, Oluwaseun; Obembe, Olufemi; Ota, Martin O C

2015-12-01

Directly observed treatment short-course (DOTS) strategy is an effective mode of treating TB. We aimed to study the cost effectiveness and patients' satisfaction with home based direct observation of treatment (DOT), an innovative approach to community-based DOT (CBDOT) and hospital based DOT (HBDOT). A randomized controlled trial involving 150 newly diagnosed pulmonary TB patients in four TB clinics in Ile Ife , Nigeria, was done. They were randomly assigned to receive treatment with anti TB drugs for the intensive phase administered at home by a TB worker (CBDOT) or at the hospital (HBDOT). Outcome measures were treatment completion/default rates, cost effectiveness and patients' satisfaction with care using a 13 item patients satisfaction questionnaire (PS-13) at 2 months. This trial was registered with pactr.org: number PACTR 201503001058381. At the end of intensive phase, 15/75 (20%) and 2/75 (3%) of patients in the HBDOT and CBDOT, respectively had defaulted from treatment, p= 0.01. Of those with pretreatment positive sputum smear, 97% (68/70) on CBDOT and 54/67 (81%) on HBDOT were sputum negative for AFB at the end of 2 months of treatment, p=0.01. The CBDOT method was associated with a higher patient satisfaction score compared with HBDOT (OR 3.1; 95% CI 1.25-7.70), p=0.001.The total cost for patients was higher in HBDOT (US$159.38) compared with the CBDOT (US$89.52). The incremental cost effectiveness ratio was US$410 per patient who completed the intensive phase treatment with CBDOT. CBDOT is a cost effective approach associated with better compliance to treatment and better patient satisfaction compared to HBDOT. © The Author 2015. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Coinfection: A Case Report

Directory of Open Access Journals (Sweden)

Huldah I. Nwokeukwu

2013-01-01

Full Text Available Background. Tuberculosis is a major public health problem, and its control has been facing a lot of challenges with emergence of HIV. The occurrence of multidrug-resistant strain has also propounded the problem especially in children where diagnosis is difficult to make. Multidrug-resistant tuberculosis (MDR-TB is in vitro resistant to isoniazid (H and rifampicin (R. Paediatric multi-drug resistant tuberculosis with HIV coinfection is rare, and there is no documented report from Nigeria. Objective. To report a case of paediatric MDR-TB in Nigeria about it. Methods. The case note of the patient was retrieved, and relevant data were extracted and summarized. Results. A 9-year-old female HIV-positive pupil with a year history of recurrent cough, 3 months history of recurrent fever, and generalized weight loss was diagnosed and treated for tuberculosis but failed after retreatment. She was later diagnosed with MDR-TB and is presently on DOT-Plus regimen. Conclusion. Paediatric MDR-TB with HIV co-infection is rare. Early diagnosis and treatment is important to prevent spread of the disease. The use of Isoniazid preventive therapy is recommended for children who come in contact with patients with active tuberculosis and also for HIV patients without active tuberculosis.

Inhibition of ABCB1 (MDR1 expression by an siRNA nanoparticulate delivery system to overcome drug resistance in osteosarcoma.

Directory of Open Access Journals (Sweden)

Michiro Susa

2010-05-01

Full Text Available The use of neo-adjuvant chemotherapy in treating osteosarcoma has improved patients' average 5 year survival rate from 20% to 70% in the past 30 years. However, for patients who progress after chemotherapy, its effectiveness diminishes due to the emergence of multi-drug resistance (MDR after prolonged therapy.In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure resulting from MDR, we designed and evaluated a novel drug delivery system for MDR1 siRNA delivery. Novel biocompatible, lipid-modified dextran-based polymeric nanoparticles were used as the platform for MDR1 siRNA delivery; and the efficacy of combination therapy with this system was evaluated. In this study, multi-drug resistant osteosarcoma cell lines (KHOS(R2 and U-2OS(R2 were treated with the MDR1 siRNA nanocarriers and MDR1 protein (P-gp expression, drug retention, and immunofluoresence were analyzed. Combination therapy of the MDR1 siRNA loaded nanocarriers with increasing concentrations of doxorubicin was also analyzed. We observed that MDR1 siRNA loaded dextran nanoparticles efficiently suppresses P-gp expression in the drug resistant osteosarcoma cell lines. The results also demonstrated that this approach may be capable of reversing drug resistance by increasing the amount of drug accumulation in MDR cell lines.Lipid-modified dextran-based polymeric nanoparticles are a promising platform for siRNA delivery. Nanocarriers loaded with MDR1 siRNA are a potential treatment strategy for reversing MDR in osteosarcoma.

Changes of Tc-99m sestamibi uptake in P-glycoprotein expressing leukaemia cells treated in vivo with antisense oligodeoxynucleotide complementary to mdr1 mRNA

International Nuclear Information System (INIS)

Kinuya, S.; Yokoyama, K; Fukuoka, M.; Michigishi, T.; Tonami, N.; Shiba, K.; Mori, H.; Watanabe, N.; Shuke, N.

2006-01-01

We examined the feasibility of Tc-99m sestamibi to monitor changes of mRNA expression of MDRl/P-glycoprotein (Pgp) following antisense oligodeoxynucleotide (AS-ODN) treatment in vivo. Three days after the intraperitoneal inoculation of murine leukaemia P388/R cells expressing MDR1/P-gp in CDFI mice, 15-mer phosphorothioate ASODN to the initiation codon of mouse mdr1 mRNA was administered intraperitoneally at 10 mg/kg daily for 3 or 4 days. Cells collected from ascites were suspended in medium for Tc-99m sestamibi uptake studies. To know the duration of antisense effects, cells were harvested 2 days later after the 3-day treatment. AS-ODN treatment increased Tc-99m sestamibi uptake. Effects of 3-day treatment and 4-day treatment were the same. Treatment effects were not detected when uptake was observed 2 days after 3-day treatment. Based on the results it was concluded that in vivo treatment with AS-ODN specific to the coding portion of mdr1 mRNA increased Tc-99m sestamibi uptake in leukaemia cells possessing MDR function. (author)

MDR1 P-glycoprotein transports endogenous opioid peptides

NARCIS (Netherlands)

Oude Elferink, R. P.; Zadina, J.

2001-01-01

MDR1 P-glycoprotein is generally regarded as an efflux pump for amphipathic toxic compounds. The question remains, however, whether certain endogenous compounds are also substrates for this transporter. Certain peptides have been shown to interact with MDR1 Pgp as well and we have therefore

Towards understanding the drivers of policy change: a case study of infection control policies for multi-drug resistant tuberculosis in South Africa.

Science.gov (United States)

Saidi, Trust; Salie, Faatiema; Douglas, Tania S

2017-05-30

Explaining policy change is one of the central tasks of contemporary policy analysis. In this article, we examine the changes in infection control policies for multi-drug resistant tuberculosis (MDR-TB) in South Africa from the time the country made the transition to democracy in 1994, until 2015. We focus on MDR-TB infection control and refer to decentralised management as a form of infection control. Using Kingdon's theoretical framework of policy streams, we explore the temporal ordering of policy framework changes. We also consider the role of research in motivating policy changes. Policy documents addressing MDR-TB in South Africa over the period 1994 to 2014 were extracted. Literature on MDR-TB infection control in South Africa was extracted from PubMed using key search terms. The documents were analysed to identify the changes that occurred and the factors driving them. During the period under study, five different policy frameworks were implemented. The policies were meant to address the overwhelming challenge of MDR-TB in South Africa, contextualised by high prevalence of HIV infection, that threatened to undermine public health programmes and the success of antiretroviral therapy rollouts. Policy changes in MDR-TB infection control were supported by research evidence and driven by the high incidence and complexity of the disease, increasing levels of dissatisfaction among patients, challenges of physical, human and financial resources in public hospitals, and the ideologies of the political leadership. Activists and people living with HIV played an important role in highlighting the importance of MDR-TB as well as exerting pressure on policymakers, while the mass media drew public attention to infection control as both a cause of and a solution to MDR-TB. The critical factors for policy change for infection control of MDR-TB in South Africa were rooted in the socioeconomic and political environment, were supported by extensive research, and can be framed

Multidrug resistance among new tuberculosis cases: detecting local variation through lot quality-assurance sampling.

Science.gov (United States)

Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

2012-03-01

Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper investigates the utility of applying lot quality-assurance sampling to identify geographic heterogeneity in the proportion of new cases with multidrug resistance. We simulated the performance of lot quality-assurance sampling by applying these classification-based approaches to data collected in the most recent TB drug-resistance surveys in Ukraine, Vietnam, and Tanzania. We explored 3 classification systems- two-way static, three-way static, and three-way truncated sequential sampling-at 2 sets of thresholds: low MDR TB = 2%, high MDR TB = 10%, and low MDR TB = 5%, high MDR TB = 20%. The lot quality-assurance sampling systems identified local variability in the prevalence of multidrug resistance in both high-resistance (Ukraine) and low-resistance settings (Vietnam). In Tanzania, prevalence was uniformly low, and the lot quality-assurance sampling approach did not reveal variability. The three-way classification systems provide additional information, but sample sizes may not be obtainable in some settings. New rapid drug-sensitivity testing methods may allow truncated sequential sampling designs and early stopping within static designs, producing even greater efficiency gains. Lot quality-assurance sampling study designs may offer an efficient approach for collecting critical information on local variability in the burden of multidrug-resistant TB. Before this methodology is adopted, programs must determine appropriate classification thresholds, the most useful classification system, and appropriate weighting if unbiased national estimates are also desired.

MDR1 haplotypes conferring an increased expression of intestinal CYP3A4 rather than MDR1 in female living-donor liver transplant patients.

Science.gov (United States)

Hosohata, Keiko; Masuda, Satohiro; Yonezawa, Atsushi; Katsura, Toshiya; Oike, Fumitaka; Ogura, Yasuhiro; Takada, Yasutsugu; Egawa, Hiroto; Uemoto, Shinji; Inui, Ken-Ichi

2009-07-01

This study investigated whether haplotypes in the multidrug resistance 1 (MDR1) gene had effects on mRNA expression levels of MDR1 and cytochrome P450 (CYP) 3A4, and on the pharmacokinetics of tacrolimus in living-donor liver transplant (LDLT) patients, considering the gender difference. Haplotype analysis of MDR1 with G2677T/A and C3435T was performed in 63 de novo Japanese LDLT patients (17 to 55 years; 44.4% women). The expression levels of MDR1 and CYP3A4 mRNAs in jejunal biopsy specimens were quantified by real-time PCR. Intestinal CYP3A4 mRNA expression levels (amol/microg total RNA) showed significantly higher values in women carrying the 2677TT-3435TT haplotype (median, 10.7; range, 5.92-15.2) than those with 2677GG-3435CC (3.03; range 1.38-4.68) and 2677GT-3435CT (median, 4.31; range, 0.07-9.42) (P = 0.022), but not in men (P = 0.81). However, MDR1 haplotype did not influence mRNA expression levels of MDR1 nor the concentration/dose ratio [(ng/mL)/(mg/day)] of oral tacrolimus for the postoperative 7 days, irrespective of gender. MDR1 haplotype may have a minor association with the tacrolimus pharmacokinetics after LDLT, but could be a good predictor of the inter-individual variation of intestinal expression of CYP3A4 in women.

Tuberculosis in Kazakhstan: analysis of risk determinants in national surveillance data

Science.gov (United States)

2012-01-01

Background Development of tuberculosis (TB) is determined by various risk factors and the interactions of temporal and spatial distributions. The aim of this study was to identify the most salient risk factors for TB disease as well as multidrug resistant TB (MDR-TB) at the oblast (provincial) level in Kazakhstan. Methods Correlational and descriptive analyses were conducted at the oblast and national level using data provided by the country’s National Institute of Geography (NIG) and the National Tuberculosis Program (NTP). Reported incident case notification rates (CNRs) and prevalence vary by oblast, thus the study investigated which determinants contributed to this regional variation and compared burdens among oblasts. Results The results showed that while tuberculosis CNRs decreased over the study period, MDR-TB conversely increased. Two oblasts -Atyrauskaya and Mangystauskaya - presented especially significant anomalies with large decreases in TB incident CNRs coupled with comparatively large increases in MDR-TB incident CNRs. Conclusion Understanding the distribution of TB and MDR-TB cases and associated risk factors, especially the “unknown risk factor” categorization points to the need for future research. PMID:23075260

0 Editorial November

African Journals Online (AJOL)

Damary

; adding a single new drug to a ... In 2000, the WHO-based Stop TB Partnership's. Green Light Committee (GLC) was created to increase ... MDR TB will undoubtedly fail in the long term (2). While new strategies for containing MDR TB are.

Assessment of trends of ofloxacin resistance in Mycobacterium tuberculosis

Directory of Open Access Journals (Sweden)

J S Verma

2011-01-01

Full Text Available Purpose: Ofloxacin (OFX is one of the potent fluoroquinolone (FQ recommended to treat MDR-TB. Over a decade, the preexposure of this drug for the treatment of other bacterial infections has resulted in acquisition of FQ resistance among Mycobacterium tuberculosis strains. Considering this possibility, a study was undertaken in a tertiary care center in the capital city (India to assess the drug resistance trends of OFX among susceptible and multidrug resistant (MDR strains of M. tuberculosis. Materials and Methods: A total of 102 M. tuberculosis isolates (47 susceptible to first-line drugs and 55 MDR isolates were screened for susceptibility testing of OFX with a critical concentration of 2 μg/ml by Lowenstein Jensen (LJ proportion method. Results: The results showed 40 (85.1% isolates among 47 susceptible isolates and 34 (61.8% isolates among 55 MDR isolates, were found to be susceptible to OFX. Fisher′s exact test showed significant P-value (0.0136 demonstrating 1.377 fold (95% confidence interval increased risk to become resistant to OFX than susceptible isolates. These finding shows decreased OFX susceptibility is not only limited to MDR isolates but also increasingly seen in susceptible strains as a result of drug abuse. Conclusions: Our finding were not alarming, but highlights the general risk of acquiring resistance to OFX, jeopardizing the potential for these drugs to be used as second-line anti-TB agents in the management of drug-resistant TB and creating incurable TB strains .

Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)

International Nuclear Information System (INIS)

Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.

2002-01-01

Full text: Cellular resistance or Multidrug Resistance (MDR) to cytotoxic agents is the major cause of treatment failure in many human cancers. P-glycoprotein (Pgp), a Mr 17,0000 transmembrane protein and Multi Resistance Protein (MRP) are two proteins that are over expressed and confer resistance to a large number of chemotherapeutic agents by enhancing their extracellular transport. P-glycoprotein is expressed at a relative high level in treated and untreated human malignant tumours, including renal, colonic, adrenal, hepatocellular carcinoma and a considerable percentage of breast carcinomas. 99m Tc-Sestamibi, a lipophilic cationic complex is a transport substrate for Pgp. In clinical studies of human neoplasms it was found that tumour uptake and clearance of this tracer correlate with Pgp expression and may be used for the phenotypic assessment of MDR. However, new tracers with better substrate specificity for Pgp and other drug transporters would greatly assist in optimising chemotherapeutic treatment and improving patient management by predicting tumour response to therapy and to assist in the development of antagonists, which may reverse or halt MDR. The aim of this project is therefore to develop PET and SPECT radiopharmaceuticals with improved affinity and selectivity for Pgp and MRP for the clinical evaluation of MDR in cancer patients. To optimise cellular transport characteristics, a number of chemical families that have been found to be substrates of Pgp and other drug efflux pumps, will be investigated. In the first instance, a series of drugs based on the flavonol natural product, Quercetin will be developed, screened for MDR and radiolabelled with PET and SPECT isotopes. Quercetin and related flavonol derivatives have been selected for this project because of their moderate to good affinity for Pgp. With the assistance of molecular modeling and in vitro studies, structural modification will be undertaken to improve the specificity and affinity for

Activity of moxifloxacin and linezolid against Mycobacterium tuberculosis in combination with potentiator drugs verapamil, timcodar, colistin and SQ109.

Science.gov (United States)

de Knegt, Gerjo J; van der Meijden, Aart; de Vogel, Corné P; Aarnoutse, Rob E; de Steenwinkel, Jurriaan E M

2017-03-01

Current treatment for tuberculosis (TB) is complicated by the emergence of multidrug resistant TB (MDR-TB). As a result, there is an urgent need for new powerful anti-TB regimens and novel strategies. In this study, we aimed to potentiate a moxifloxacin + linezolid backbone as treatment for MDR-TB with the efflux pump inhibitors verapamil and timcodar as well as with drugs that act on mycobacterial cell wall stability such as colistin and SQ109. Using a time-kill kinetics assay, the activities of moxifloxacin, linezolid, verapamil, timcodar, colistin and SQ109 as single drugs against Mycobacterium tuberculosis were evaluated. In addition, the activity of the moxifloxacin + linezolid backbone in combination with one of the potentiator drugs was assessed. As little as 0.125 mg/L moxifloxacin achieved 99% killing of M. tuberculosis after 6 days of exposure. Linezolid showed moderate killing but 99% killing was not achieved. Verapamil, timcodar and colistin only resulted in killing with the highest concentrations tested but 99% killing was not achieved. SQ109 resulted in complete elimination after 1 day of exposure to 256 mg/L and in 99% elimination after 6 days of exposure to 1 mg/L. Furthermore, colistin added to the moxifloxacin + linezolid backbone resulted in increased elimination, whereas verapamil, timcodar and SQ109 showed no added value to the backbone. This finding that colistin potentiates the activity of the moxifloxacin + linezolid backbone against M. tuberculosis suggests its potential role in further studies on the applicability of a moxifloxacin + linezolid treatment of MDR-TB. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

One of the possible mechanisms for the inhibition effect of Tb(III) on peroxidase activity in horseradish (Armoracia rusticana) treated with Tb(III).

Science.gov (United States)

Guo, Shaofen; Cao, Rui; Lu, Aihua; Zhou, Qing; Lu, Tianhong; Ding, Xiaolan; Li, Chaojun; Huang, Xiaohua

2008-05-01

One of the possible mechanisms for the inhibition effect of Tb(III) on peroxidase activity in horseradish (Armoracia rusticana) treated with Tb(III) was investigated using some biophysical and biochemical methods. Firstly, it was found that a large amount of Tb(III) can be distributed on the cell wall, that some Tb(III) can enter into the horseradish cell, indicating that peroxidase was mainly distributed on cell wall, and thus that Tb(III) would interact with horseradish peroxidase (HRP) in the plant. In addition, peroxidase bioactivity was decreased in the presence of Tb(III). Secondly, a new peroxidase-containing Tb(III) complex (Tb-HRP) was obtained from horseradish after treatment with Tb(III); the molecular mass of Tb-HRP is near 44 kDa and the pI is about 8.80. Thirdly, the electrocatalytic activity of Tb-HRP is much lower than that of HRP obtained from horseradish without treatment with Tb(III). The decrease in the activity of Tb-HRP is due to the destruction (unfolding) of the conformation in Tb-HRP. The planarity of the heme active center in the Tb-HRP molecule was increased and the extent of exposure of Fe(III) in heme was decreased, leading to inhibition of the electron transfer. The microstructure change in Tb-HRP might be the result of the inhibition effect of Tb(III) on peroxidase activity in horseradish.

Consequences of tuberculosis among asylum seekers for health care workers in Germany.

Science.gov (United States)

Diel, Roland; Loddenkemper, Robert; Nienhaus, Albert

2016-01-01

Immigrants have been contributing to the incidence of tuberculosis (TB) in Germany for many years. The current wave of migration of asylum seekers to Germany may increase that figure. Healthcare workers (HCW) who look after refugees not only in hospitals and medical practices but also in aid projects may be exposed to cases of TB. The incremental TB cases arising from imported TB as well as from TB cases that developed later in refugees were calculated in a Markov model over a period of 5 years. Infectious and non-infectious susceptible TB and multidrug-resistant TB (MDR-TB) cases were determined separately. In addition, the total amount of latent TB in contact persons and the risk of infection by HCW were estimated. Due to uncertainty of future refugee flows to Europe, different scenarios were considered in univariate and multivariate sensitivity analysis. Assuming a decrease in immigration by half each year to the bottom line of 2014, and in light of the current number of 800,000 asylum seekers, we calculated an additional 10,090 TB cases by the end of the fifth year (5976 cases of infectious pulmonary TB and 143 cases of pulmonary MDR-TB). In case of an unchanging influx of asylum seekers over the 5-year period, 19,031 TB cases would arise, 377 of which infectious MDR-TB. Eighty -seven ensuing TB cases would develop in HCW in the same period, 3 of which MDR-TB cases. Although the total number of TB cases in HCW expected to ensue from the current influx of asylum seekers is rather small, the 3 MDR-TB cases we calculated have to be taken seriously. We consider it essential to increase awareness of protective measures such as respiratory masks and, in the event of documented exposure, of supply-oriented occupational health screening.

Surveillance of extensively drug-resistant tuberculosis in Europe, 2003-2007.

NARCIS (Netherlands)

Devaux, I.; Manissero, D.; Fernandez de la Hoz, K.; Kremer, K.; Soolingen, D. van

2010-01-01

This paper describes the results of second-line drug (SLD) susceptibility tests among multidrug-resistant tuberculosis (MDR TB) cases reported in 20 European countries aiming to identify extensively drug-resistant tuberculosis (XDR TB) cases. A project on molecular surveillance of MDR TB cases was

Social franchising of TB care through private GPs in Myanmar: an assessment of treatment results, access, equity and financial protection.

Science.gov (United States)

Lönnroth, Knut; Aung, Tin; Maung, Win; Kluge, Hans; Uplekar, Mukund

2007-05-01

This article assesses whether social franchising of tuberculosis (TB) services in Myanmar has succeeded in providing quality treatment while ensuring equity in access and financial protection for poor patients. Newly diagnosed TB patients receiving treatment from private general practitioners (GPs) belonging to the franchise were identified. They were interviewed about social conditions, health seeking and health care costs at the time of starting treatment and again after 6 months follow-up. Routine data were used to ascertain clinical outcomes as well as to monitor trends in case notification. The franchisees contributed 2097 (21%) of the total 9951 total new sputum smear-positive pulmonary cases notified to the national TB programme in the study townships. The treatment success rate for new smear-positive cases was 84%, close to the World Health Organization target of 85% and similar to the treatment success of 81% in the national TB programme in Myanmar. People from the lower socio-economic groups represented 68% of the TB patients who access care in the franchise. Financial burden related to direct and indirect health care costs for tuberculosis was high, especially among the poor. Patients belonging to lower socio-economic groups incurred on average costs equivalent to 68% of annual per capita household income, with a median of 28%. However, 83% of all costs were incurred before starting treatment in the franchise, while 'shopping' for care. During treatment in the franchise, the cost of care was relatively low, corresponding to a median proportion of annual per capita income of 3% for people from lower socio-economic groups. This study shows that highly subsidized TB care delivered through a social franchise scheme in the private sector in Myanmar helped reach the poor with quality services, while partly protecting them from high health care expenditure. Extended outreach to others parts of the private sector may reduce diagnostic delay and patient costs

Providing an address for delivery of nanoencapsulated TB drugs

CSIR Research Space (South Africa)

Lemmer, Yolandy

2010-06-01

Full Text Available compliance and drug resistance pose a great challenge to TB treatment programs worldwide. To improve the current inadequate therapeutic management of TB, a polymeric anti-TB nanodrug delivery system, for anti-TB drugs, was developed that could enable entry...

TTFields alone and in combination with chemotherapeutic agents effectively reduce the viability of MDR cell sub-lines that over-express ABC transporters

International Nuclear Information System (INIS)

Schneiderman, Rosa S; Shmueli, Esther; Kirson, Eilon D; Palti, Yoram

2010-01-01

Exposure of cancer cells to chemotherapeutic agents may result in reduced sensitivity to structurally unrelated agents, a phenomenon known as multidrug resistance, MDR. The purpose of this study is to investigate cell growth inhibition of wild type and the corresponding MDR cells by Tumor Treating Fields - TTFields, a new cancer treatment modality that is free of systemic toxicity. The TTFields were applied alone and in combination with paclitaxel and doxorubicin. Three pairs of wild type/MDR cell lines, having resistivity resulting from over-expression of ABC transporters, were studied: a clonal derivative (C11) of parental Chinese hamster ovary AA8 cells and their emetine-resistant sub-line Emt R1 ; human breast cancer cells MCF-7 and their mitoxantrone-resistant sub lines MCF-7/Mx and human breast cancer cells MDA-MB-231 and their doxorubicin resistant MDA-MB-231/Dox cells. TTFields were applied for 72 hours with and without the chemotherapeutic agents. The numbers of viable cells in the treated cultures and the untreated control groups were determined using the XTT assay. Student t-test was applied to asses the significance of the differences between results obtained for each of the three cell pairs. TTFields caused a similar reduction in the number of viable cells of wild type and MDR cells. Treatments by TTFields/drug combinations resulted in a similar increased reduction in cell survival of wild type and MDR cells. TTFields had no effect on intracellular doxorubicin accumulation in both wild type and MDR cells. The results indicate that TTFields alone and in combination with paclitaxel and doxorubicin effectively reduce the viability of both wild type and MDR cell sub-lines and thus can potentially be used as an effective treatment of drug resistant tumors

Abandono do tratamento de tuberculose em co-infectados TB/HIV Abandono del tratamiento de la tuberculosis en coinfectados TB/HIV Abandonment of tuberculosis treatment among patinets co-infected with TB/HIV

Directory of Open Access Journals (Sweden)

Ivaneide Leal Ataide Rodrigues

2010-06-01

ísica, organización del proceso de trabajo y acceso mostraron relevancia para la no adhesión. Los resultados apuntan a la necesidad de alterar las prácticas desarrolladas en los Servicios.This study aimed at analyzing the reasons that patients co-infected with tuberculosis and HIV leave the treatment of tuberculosis and to know the conduct of the health team toward that abandonment. The study, using a qualitative approach, performed semi-structured interviews on 45 professionals working at a referral health center in Pará state. Two units emerged based on the thematic analysis: patient-associated factors that make TB treatment adherence difficult; and service-associated factors that contribute to treatment abandonment. It was found that, in terms of the patients, that their low socioeconomic condition was the most common factor that led to abandonment. Other factors that led to this outcome included the adverse drug effects, the use of illegal drugs, and poor personal motivation. Regarding the service, issues related to the physical structure, working process organization and accessibility were also relevant to their non-adherence. Results show there is a need to change the practices performed at the health care services.

The Importance of Implementation Strategy in Scaling Up Xpert MTB/RIF for Diagnosis of Tuberculosis in the Indian Health-Care System: A Transmission Model

Science.gov (United States)

Salje, Henrik; Andrews, Jason R.; Deo, Sarang; Satyanarayana, Srinath; Sun, Amanda Y.; Pai, Madhukar; Dowdy, David W.

2014-01-01

Background India has announced a goal of universal access to quality tuberculosis (TB) diagnosis and treatment. A number of novel diagnostics could help meet this important goal. The rollout of one such diagnostic, Xpert MTB/RIF (Xpert) is being considered, but if Xpert is used mainly for people with HIV or high risk of multidrug-resistant TB (MDR-TB) in the public sector, population-level impact may be limited. Methods and Findings We developed a model of TB transmission, care-seeking behavior, and diagnostic/treatment practices in India and explored the impact of six different rollout strategies. Providing Xpert to 40% of public-sector patients with HIV or prior TB treatment (similar to current national strategy) reduced TB incidence by 0.2% (95% uncertainty range [UR]: −1.4%, 1.7%) and MDR-TB incidence by 2.4% (95% UR: −5.2%, 9.1%) relative to existing practice but required 2,500 additional MDR-TB treatments and 60 four-module GeneXpert systems at maximum capacity. Further including 20% of unselected symptomatic individuals in the public sector required 700 systems and reduced incidence by 2.1% (95% UR: 0.5%, 3.9%); a similar approach involving qualified private providers (providers who have received at least some training in allopathic or non-allopathic medicine) reduced incidence by 6.0% (95% UR: 3.9%, 7.9%) with similar resource outlay, but only if high treatment success was assured. Engaging 20% of all private-sector providers (qualified and informal [providers with no formal medical training]) had the greatest impact (14.1% reduction, 95% UR: 10.6%, 16.9%), but required >2,200 systems and reliable treatment referral. Improving referrals from informal providers for smear-based diagnosis in the public sector (without Xpert rollout) had substantially greater impact (6.3% reduction) than Xpert scale-up within the public sector. These findings are subject to substantial uncertainty regarding private-sector treatment patterns, patient care-seeking behavior

[Duties of physicians or other healthcare workers connected with diagnosis, treatment, dissemination of information, assessment and registration of TB patients].

Science.gov (United States)

Zielonka, Tadeusz M

2015-01-01

Effective laws provide a series of duties to be performed by physicians and other medical personnel associated with TB. Every TB case and death resulting from TB as well as any case of undesirable result of BCG test requires notification and filling in of a special form. The physician has a duty to inform TB patients their legal guardians, close relatives or friends about the need to undergo sanitary and diagnostic procedure, treatment or vaccination, as well as on how to prevent disease from spreading. Persons failing to comply with the relevant numerous legal requirements in this respect are subject to a fine.TB patients can use special sick benefits extending up to 270 days. There is a requirement to use appropriate codes to define TB irrespective of LCD-10 classification.

Directory of Open Access Journals (Sweden)

Pola Becerril-Montes

2013-04-01

Full Text Available The resistance of 139 Mycobacterium tuberculosis (MTB isolates from the city of Monterrey, Northeast Mexico, to first and second-line anti-TB drugs was analysed. A total of 73 isolates were susceptible and 66 were resistant to anti-TB drugs. Monoresistance to streptomycin, isoniazid (INH and ethambutol was observed in 29 cases. Resistance to INH was found in 52 cases and in 29 cases INH resistance was combined with resistance to two or three drugs. A total of 24 isolates were multidrug-resistant (MDR resistant to at least INH and rifampicin and 11 MDR cases were resistant to five drugs. The proportion of MDR-TB among new TB cases in our target population was 0.72% (1/139 cases. The proportion of MDR-TB among previously treated cases was 25.18% (35/139 cases. The 13 polyresistant and 24 MDR isolates were assayed against the following seven second-line drugs: amikacin (AMK, kanamycin (KAN, capreomycin (CAP, clofazimine (CLF, ethionamide (ETH, ofloxacin (OFL and cycloserine (CLS. Resistance to CLF, OFL or CLS was not observed. Resistance was detected to ETH (10.80% and to AMK (2.70%, KAN (2.70% and CAP (2.70%. One isolate of MDR with primary resistance was also resistant to three second-line drugs. Monterrey has a high prevalence of MDR-TB among previously treated cases and extensively drug-resistant-MTB strains may soon appear.

A population-based study of first and second-line drug-resistant tuberculosis in a high-burden area of the Mexico/United States border

Directory of Open Access Journals (Sweden)

Pola Becerril-Montes

2013-04-01

Full Text Available The resistance of 139 Mycobacterium tuberculosis (MTB isolates from the city of Monterrey, Northeast Mexico, to first and second-line anti-TB drugs was analysed. A total of 73 isolates were susceptible and 66 were resistant to anti-TB drugs. Monoresistance to streptomycin, isoniazid (INH and ethambutol was observed in 29 cases. Resistance to INH was found in 52 cases and in 29 cases INH resistance was combined with resistance to two or three drugs. A total of 24 isolates were multidrug-resistant (MDR resistant to at least INH and rifampicin and 11 MDR cases were resistant to five drugs. The proportion of MDR-TB among new TB cases in our target population was 0.72% (1/139 cases. The proportion of MDR-TB among previously treated cases was 25.18% (35/139 cases. The 13 polyresistant and 24 MDR isolates were assayed against the following seven second-line drugs: amikacin (AMK, kanamycin (KAN, capreomycin (CAP, clofazimine (CLF, ethionamide (ETH, ofloxacin (OFL and cycloserine (CLS. Resistance to CLF, OFL or CLS was not observed. Resistance was detected to ETH (10.80% and to AMK (2.70%, KAN (2.70% and CAP (2.70%. One isolate of MDR with primary resistance was also resistant to three second-line drugs. Monterrey has a high prevalence of MDR-TB among previously treated cases and extensively drug-resistant-MTB strains may soon appear.

Specificity of drug transport mediated by CaMDR1: a major facilitator ...

Indian Academy of Sciences (India)

Unknown

CaMDR1 encodes a major facilitator superfamily (MFS) protein in Candida albicans whose expression has been linked to .... by plaque assay and the integration of CaMDR1 at the ... with recombinant virus, vAcCaMDR1 and cells infected.

Accelerating TB notification from the private health sector in Delhi, India.

Science.gov (United States)

Kundu, Debashish; Chopra, Kamal; Khanna, Ashwani; Babbar, Neeti; Padmini, T J

2016-01-01

In India, almost half of all patients with tuberculosis (TB) seek care in the private sector as the first point of care. The national programme is unable to support such TB patients and facilitate effective treatment, as there is no information on TB and Multi or Extensively Drug Resistant TB (M/XDR-TB) diagnosis and treatment in private sector. To improve this situation, Government of India declared TB a notifiable disease for establishing TB surveillance system, to extend supportive mechanism for TB treatment adherence and standardised practices in the private sector. But TB notification from the private sector is a challenge and still a lot needs to be done to accelerate TB notification. Delhi State TB Control Programme had taken initiatives for improving notification of TB cases from the private sector in 2014. Key steps taken were to constitute a state level TB notification committee to oversee the progress of TB notification efforts in the state and direct 'one to one' sensitisation of private practitioners (PPs) (in single PP's clinic, corporate hospitals and laboratories) by the state notification teams with the help of available tools for sensitising the PP on TB notification - TB Notification Government Order, Guidance Tool for TB Notification and Standards of TB Care in India. As a result of focussed state level interventions, without much external support, there was an accelerated notification of TB cases from the private sector. TB notification cases from the private sector rose from 341 (in 2013) to 4049 (by the end of March 2015). Active state level initiatives have led to increase in TB case notification. Copyright © 2016 Tuberculosis Association of India. Published by Elsevier B.V. All rights reserved.

Genetic diversity of multidrug-resistant tuberculosis in a resource-limited region of China

Directory of Open Access Journals (Sweden)

Dan Zhang

2014-12-01

Conclusions: Beijing genotype was the predominant genotype among the isolates from MDR-TB cases in Chongqing. The re-treated MDR-TB cases were more likely to be attributed to Beijing genotype infection. The 10-locus VNTR set demonstrated a good discrimination power for genotyping MDR M. tuberculosis isolates circulating in Chongqing Municipality.

The role of antiretroviral therapy in reducing TB incidence and mortality in high HIV-TB burden countries

Directory of Open Access Journals (Sweden)

Anthony D Harries

2016-03-01

Full Text Available With the adoption of the new Sustainable Development Goals in 2016, all countries have committed to end the tuberculosis (TB epidemic by 2030, defined as dramatic reductions in TB incidence and mortality combined with zero TB-induced catastrophic costs for families. This paper explores how antiretroviral therapy (ART in high HIV-TB burden countries may help in reducing TB incidence and mortality and thus contribute to the ambitious goal of ending TB. ART in people living with HIV has a potent TB preventive effect, with this being most apparent in those with the most advanced immunodeficiency. Early ART also significantly reduces the risk of TB, and with new World Health Organization guidance released in 2015 about initiating ART in all persons living with HIV irrespective of CD4 count, there is the potential for enormous benefit at the population level. Already, several countries with high HIVTB burdens have seen dramatic declines in TB case notification rates since ART scale up started in 2004. In patients already diagnosed with HIV-associated TB, mortality can be significantly decreased by ART, especially if started within 2–8 weeks of anti-TB treatment. The benefits of ART on TB incidence and TB mortality can be further augmented respectively by the addition of isoniazid preventive therapy and cotrimoxazole preventive therapy. These interventions must be effectively implemented and scaled up in order to end the TB epidemic by 2030.

Sensitivity Pattern of Second Line Anti-Tuberculosis Drugs against Clinical Isolates of Multidrug Resistant Mycobacterium Tuberculosis

International Nuclear Information System (INIS)

Ghafoor, T.; Ikram, A.; Abbasi, S. A.; Zaman, G.; Ayyub, M.; Palomino, J. C.; Vandamme, P.; Martin, A.

2015-01-01

Objective:To determine the current sensitivity pattern of second line anti-tuberculosis drugs against clinical isolates of Multidrug Resistant Mycobacterium tuberculosis (MDR-TB). Study Design: A cross-sectional study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from November 2011 to April 2013. Methodology: Samples received during the study period were processed on BACTEC MGIT 960 system for Mycobacterium tuberculosis (MTB) culture followed by first line drugs susceptibility testing of culture proven MTB isolates. On the basis of resistance to rifampicin and isoniazid, 100 clinical isolates of MDR-TB were further subjected to susceptibility testing against amikacin (AMK), capreomycin (CAP), ofloxacin (OFL) and ethionamide (ETH) as per standard BACTEC MGIT 960 instructions. Results: Out of 100 MDR-TB isolates, 62% were from male patients and 38% from female patients. 97% were sensitive to AMK, 53% to OFL, 87% to CAP; and 87% were sensitive to ETH. Conclusion: The majority of the MDR-TB isolates showed excellent sensitivity against AMK, CAP and ETH. However, sensitivity of MDR-TB isolates against fluoroquinolones like OFL was not encouraging. (author)

Listening to Those at the Frontline: Patient and Healthcare Personnel Perspectives on Tuberculosis Treatment Barriers and Facilitators in High TB Burden Regions of Argentina

Directory of Open Access Journals (Sweden)

Sarah J. Iribarren

2014-01-01

Full Text Available Purpose. In Argentina, tuberculosis (TB control measures have not achieved key treatment targets. The purpose of this study was to identify modes of treatment delivery and explore patient and healthcare personnel perceptions of barriers and facilitators to treatment success. Methods. We used semistructured group and individual interviews for this descriptive qualitative study. Eight high burden municipalities were purposively selected. Patients in treatment for active TB (n=16, multidisciplinary TB team members (n=26, and TB program directors (n=12 at local, municipal, regional, and national levels were interviewed. Interviews were recorded, transcribed verbatim, and analyzed using thematic analysis. Results. Modes of treatment delivery varied across municipalities and types of healthcare facility and were highly negotiated with patients. Self-administration of treatment was common in hospital-based and some community clinics. Barriers to TB treatment success were concentrated at the system level. This level relied heavily on individual personal commitment, and many system facilitators were operating in isolation or in limited settings. Conclusions. We outline experiences and perspectives of the facilitating and challenging factors at the individual, structural, social, and organizational levels. Establishing strong patient-healthcare personnel relationships, responding to patient needs, capitalizing on community resources, and maximizing established decentralized system could mitigate some of the barriers.

1.Evaluation of the quality of fixed dose combination anti ...

African Journals Online (AJOL)

46987.2

serious implications on treatment outcomes for TB hence the moderately high rate of multi drug resistance (MDR) cases that were recorded in the. 9 country. Another study was done in Botswana in 1999 that involved quantitative analysis of 13 FDC anti TB samples and the results obtained showed that 31%. (4/13) of the ...

In Vitro Evaluation of Linezolid and Meropenem Against Clinical Isolates of Multi Drug Resistant Tuberculosis By Mycobacterial Growth Indicator Tube (MGIT) 960

International Nuclear Information System (INIS)

Mirza, I. A.; Satti, L.; Khan, F. A.; Khan, K. A.

2015-01-01

Objective: To evaluate the in vitro effectiveness of multiple breakpoint concentrations of newer antituberculosis agents (Linezolid and Meropenem) against Multi Drug-Resistant Tuberculosis (MDR-TB) isolates. Study Design: Adescriptive cross-sectional study. Place and Duration of Study: Microbiology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from September 2011 to August 2013. Methodology: Atotal of 100 MDR-TB isolates recovered during the study period were subjected to susceptibility testing against multiple breakpoint concentrations of Linezolid (LZD) and Meropenem (MER). The breakpoint concentration used for LZD were 0.5, 1.0 and 2.0 micro g/ml, while for MER were 4.0, 8.0 and 16 micro g/ml. Mycobacterial Growth Indicator Tube (MGIT) 960 system was used to carry out drug susceptibility testing as per recommended protocol. Results: At break point concentration of 0.5 micro g/ml, 80 out of 100 (80%) MDR-TB isolates were susceptible to LZD while at breakpoint concentration of 1.0 micro g/ml and 2.0 micro g/ml, 96/100, (96%) of MDR-TB isolates were susceptible. For MER, at breakpoint concentrations of 4.0 micro g/ml no MDR-TB isolate was susceptible, while at 8.0 micro g/ml 3/100, (3%) and at 16.0 micro g/ml 11/100, (11%) of MDR-TB isolates were susceptible. Conclusion: LZD was found to have excellent in vitroefficacy as 96% of MDR-TB isolates were susceptible at breakpoint concentration of 1.0 micro g/ml or more. In case of MER it was found that in vitrosusceptibility improved as the break point concentrations were increased. (author)

Surgical face masks worn by patients with multidrug-resistant tuberculosis: impact on infectivity of air on a hospital ward.

Science.gov (United States)

Dharmadhikari, Ashwin S; Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A; van der Walt, Martie; Nardell, Edward A

2012-05-15

Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68-85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31-51%), representing a 56% (95% CI, 33-70.5%) decreased risk of TB transmission when patients used masks. Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients.

Nitrofuranyl Methyl Piperazines as New Anti-TB Agents: Identification, Validation, Medicinal Chemistry, and PK Studies

Science.gov (United States)

2015-01-01

Whole-cell screening of 20,000 drug-like small molecules led to the identification of nitrofuranyl methylpiperazines as potent anti-TB agents. In the present study, validation followed by medicinal chemistry has been used to explore the structure–activity relationship. Ten compounds demonstrated potent MIC in the range of 0.17–0.0072 μM against H37Rv Mycobacterium tuberculosis (MTB) and were further investigated against nonreplicating and resistant (RifR and MDR) strains of MTB. These compounds were also tested for cytotoxicity. Among the 10 tested compounds, five showed submicromolar to nanomolar potency against nonreplicating and resistant (RifR and MDR) strains of MTB along with a good safety index. Based on their overall in vitro profiles, the solubility and pharmacokinetic properties of five potent compounds were studied, and two analogues, 14f and 16g, were found to have comparatively better solubility than others tested and acceptable pharmacokinetic properties. This study presents the rediscovery of a nitrofuranyl class of compounds with improved aqueous solubility and acceptable oral PK properties, opening a new direction for further development. PMID:26487909

Genotypic analysis of multidrug-resistant tuberculosis isolates from extra pulmonary tuberculosis cases in tertiary care centers in Northern India

Directory of Open Access Journals (Sweden)

Anand K Maurya

2016-01-01

Conclusion: The prevalence (13.4% of MDR-TB among EPTB was high, and the most prominent mutations in rpoB, katG, and inhA genes were S531L (67.3%, S315T1 (94.5%, and C15T (20%, respectively. Beijing stains are significantly associated with MDR-TB among EPTB in this region. We found that the transmission of prominent mutations contributes to an unexpected increase in primary resistance, including MDR-TB cases in Northern India.

Community-based directly observed treatment for TB patients to improve HIV services: a cross-sectional study in a South African province.

Science.gov (United States)

Howell, Embry M; Kigozi, N Gladys; Heunis, J Christo

2018-04-07

There is uncertainty about how directly observed treatment (DOT) support for tuberculosis (TB) can be delivered most effectively and how DOT support can simultaneously be used to strengthen human immunodeficiency virus (HIV) prevention and control among TB patients. This study describes how DOT support by community health workers (CHWs) was used in four municipalities in the Free State province - a high TB/HIV burden, poorly-resourced setting - to provide HIV outreach, referrals, and health education for TB patients. The study was part of a larger cross-sectional study of HIV counselling and testing (HCT) among 1101 randomly-selected TB patients registered at 40 primary health care (PHC) facilities (clinics and community health centres) across small town/rural and large town/urban settings. Univariate analysis of percentages, chi-square tests and t-tests for difference in means were used to describe differences between the types of TB treatment support and patient characteristics, as well as the types of - and patient satisfaction with - HIV information and referrals received from various types of treatment supporters including home-based DOT supporters, clinic-based DOT supporters or support from family/friends/employers. Multivariate logistic regression was used to predict the likelihood of not having receiving home-based DOT and of never having received HIV counselling. The independent variables include poverty-related health and socio-economic risk factors for poor outcomes. Statistical significance is shown using a 95% confidence interval and a 0.05 p-value. Despite the fact that DOT support for all TB patients was the goal of South African health policy at the time (2012), most TB patients were not receiving formal DOT support. Only 155 (14.1%) were receiving home-based DOT, while 114 (10.4%) received clinic-based DOT. TB patients receiving home-based DOT reported higher rates of HIV counselling than other patients. Public health providers should train DOT

A experiência brasileira de controlo da multidroga-resistência

Directory of Open Access Journals (Sweden)

Fernando Augusto Fiuza de Melo

2010-01-01

Full Text Available Resumo: Neste artigo de revisão, o autor faz uma revisão de como evoluiu a abordagem da tuberculose multirresistente (MDR no Brasil, desde a introdução da rifampi-cina associada a isoniazida e a pirazinamida (RHZ. Mostra que o país foi um dos primeiros no mundo a aplicar o esquema RHZ dentro de um sistema de tratamento com um esquema de primeira linha, outro específico para as formas meningoencefálicas, para retratamento para recidivas ou retorno com tuberculose ativa após abandono, e um esquema de reserva. O sistema era de aplicação nacional com garantia de forne-cimento gratuito das drogas e autoadministrado. Avalia a evolução da resistência aos medicamentos, a emer-gência da resistência múltipla e como foi organizado o controlo desta forma da doença. Abstract: In this article the author reviews the evolution of the approach to multidrug-resistant tuberculosis (MDR-TB in Brazil following the introduction of rifampicin associated to isoniazid and pyrazinamide (RHZ. It shows Brazil was one of the world’s first countries to use the RHZ regimen within a treatment system, with a first line regimen, another one specific for meningo-encephalic forms, for re-treatment of recurrences or of patients who returned with active tuberculosis after abandoning treatment, and a reserve regimen. The system was applied nationwide with guaranteed cost-free provision of medication, and self-administered. The author evaluates the growth of drug resistance, the emergence of multidrug-resistance and how management of this form of the disease has been organised. Palavras-chave: Tuberculose multirresistente a múl-tiplos medicamentos (TB-MDR, tuberculose super-resistente (TB-XDR, Key-words: Multidrug-resistant tuberculosis (MDR-TB, extensively drug-resistant, tuberculosis (XDR-TB

Cochleo-vestibular clinical findings among drug resistant Tuberculosis Patients on therapy-a pilot study

Directory of Open Access Journals (Sweden)

Ramma Lebogang

2012-01-01

Full Text Available Abstracts Background To investigate the Cochleo-vestibular clinical and audiometric findings in Multi and Extreme Drug Resistance(MDR and XDR tuberculosis(TB patients on treatment and make recommendations. Methods A cross-sectional study of adult MDR and XDR-TB patients was conducted in a general hospital in Cape-Town-South-Africa. Ethical approval was secured and all consenting patients administered with pretested and validated questionnaire under the guidance of International Classification of Functioning, Disability and Health(ICF Checklist-version-2.1a. Audiometric evaluation included: Otoscopy, Diagnostic Audiometry and Tympanometry. The data analyses were done with SPSS version 16, Chi-square and StatCalc-7. Results Fifty-three adults, ages 18-60 (mean-33 years comprising 26 males and 27 females participated in the study. Hospital stay duration varied from 1-18 months (mean-6 months and all were on anti-Koch's second line drugs (regimen 2. MDR TB group were 45(85% and XDR 8(15%. Vertigo was the most common vestibular symptoms, 24(45% whereas, tinnitus 23(42% and hearing loss 13(25% were most frequent auditory complaints. Bilateral sensorineural hearing losses of varying degrees were confirmed in 23(47%. There was no association between gender and age with hearing loss [χ2 (P = 0.16, ά = 0.05 and (p = 0.13, ά = 0.05]. Furthermore, MDR and XTR TB groups [20/42 Vs 3/8; Z = 0.46 and P = 0.64], showed no difference in pattern of the hearing losses. Conclusions A multi-disciplinary close surveillance of MDR and XDR TB patients on therapy is imperative. Finally, researches into therapeutic trials on antidotes and potent safer substitutes for aminoglycosides in the management are recommended.

Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

Directory of Open Access Journals (Sweden)

Zakham F

2013-11-01

Full Text Available Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN, Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laboratoire de Microbiologie, Hygiène et Virologie, Faculté des Sciences et Techniques, Mohammedia, MoroccoBackground: Tuberculosis (TB is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR and extensively drug resistant (XDR TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid.Methods: For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing.Results: Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%. Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a

Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins

NARCIS (Netherlands)

Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.

1997-01-01

The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes

Bakteri Simbion Gastropoda Pleuroploca trapesium Dari Perairan Ternate, Sebagai Alternatif Antibakteri MDR (Bacterial Symbiont Gastropoda Pleuroploca trapezium from Ternate, as Alternative Antibacterial MDR

Directory of Open Access Journals (Sweden)

Delianis Pringgenies

2014-03-01

The bacteria resistant to some antibiotics are known as multi drug resistant (MDR. To overcome the problem, it is needed to search for a new antibiotic compounds more effectively and efficiently. This study aims to identify potential from symbionts of Pleuroploca trapezium as a source of antibacteria MDR and identifying the bacteria that were active against the MDR. Samples were collected from Ternate, Maluku. Isolation of symbiotic bacteria, screening for bacteria which producing secondary metabolites as anti-MDR bacteria, antibacterial test, isolation of clinical pathogenic bacteria of MDR. Conducting anti-bacterial sensitivity test,  sensitivity test for antibacterial,  DNA exctraction, DNA amplification based on PCR method, DNA sequencing.  Result of 16S r-DNA sequence was then analyzed and edited using GENETYX program and followed by 16S rDNA sequence analysis. Screening of bacteria associated with P. trapezium resulted in 19 isolates with 5 active bacteria. Based on the size of the zone forming and the consistency of zone, so the best isolate is TPT 4.7. The identification shows that TPT 4.7 has a close relationship with the Paracoccus sp. MBIC4019 with homologi of 95%, which shows the relationship at the genus level. Its suggest that these results are very promising as a new antibacterial material. Keywords: antibacterial, symbiotic bacteria, Pleuroploca trapezium, multi drugs resistant

Whole genome sequencing reveals complex evolution patterns of multidrug-resistant Mycobacterium tuberculosis Beijing strains in patients.

Directory of Open Access Journals (Sweden)

Matthias Merker

Full Text Available Multidrug-resistant (MDR Mycobacterium tuberculosis complex (MTBC strains represent a major threat for tuberculosis (TB control. Treatment of MDR-TB patients is long and less effective, resulting in a significant number of treatment failures. The development of further resistances leads to extensively drug-resistant (XDR variants. However, data on the individual reasons for treatment failure, e.g. an induced mutational burst, and on the evolution of bacteria in the patient are only sparsely available. To address this question, we investigated the intra-patient evolution of serial MTBC isolates obtained from three MDR-TB patients undergoing longitudinal treatment, finally leading to XDR-TB. Sequential isolates displayed identical IS6110 fingerprint patterns, suggesting the absence of exogenous re-infection. We utilized whole genome sequencing (WGS to screen for variations in three isolates from Patient A and four isolates from Patient B and C, respectively. Acquired polymorphisms were subsequently validated in up to 15 serial isolates by Sanger sequencing. We determined eight (Patient A and nine (Patient B polymorphisms, which occurred in a stepwise manner during the course of the therapy and were linked to resistance or a potential compensatory mechanism. For both patients, our analysis revealed the long-term co-existence of clonal subpopulations that displayed different drug resistance allele combinations. Out of these, the most resistant clone was fixed in the population. In contrast, baseline and follow-up isolates of Patient C were distinguished each by eleven unique polymorphisms, indicating an exogenous re-infection with an XDR strain not detected by IS6110 RFLP typing. Our study demonstrates that intra-patient microevolution of MDR-MTBC strains under longitudinal treatment is more complex than previously anticipated. However, a mutator phenotype was not detected. The presence of different subpopulations might confound phenotypic and

Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

Directory of Open Access Journals (Sweden)

Strazzullo Viviana

2006-12-01

Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

Tracking and Treating Mobile Populations. The TB Net System. Migrant Clinicians Network Monograph Series. = El Sistema de Red para la TB.

Science.gov (United States)

Migrant Clinicians Network, Inc., Austin, TX.

A comprehensive tracking and referral network that helps provide continuity of care for mobile populations with active tuberculosis (TB) or TB infection is considered essential for effective treatment of TB. However, the interstate referral system that exists between state health departments has been highly inefficient for serving migrant…

Should all suspected tuberculosis cases in high income countries be tested with GeneXpert?

Science.gov (United States)

Vella, Venanzio; Broda, Agnieszka; Drobniewski, Francis

2018-05-01

In countries with a low incidence of multidrug-resistant tuberculosis (MDR-TB), universal testing with GeneXpert might not be always cost-effective. This study provides hospital managers in low MDR-TB incidence countries with criteria on when decentralised universal GeneXpert testing would make sense. The alternatives taken into consideration include: universal microbiological culture and drug susceptibility testing (DST) only (comparator); as above but with concurrent centralized GeneXpert in a referral laboratory vs a decentralized GeneXpert system in every hospital to test smear-positive cases only; as above but testing all samples with GeneXpert regardless of smear status. The parameters were from the national TB statistics for England and from a systematic review. Decentralised GeneXpert to test any suspected TB case was the most cost-effective option when 6% or more TB patients belonged to the high-risk group, defined as previous TB diagnosis and or being born in countries with a high MDR-TB incidence. Hospital managers in England and other low MDR-TB incidence countries could use these findings to decide when to invest in GeneXpert or other molecular diagnostics with similar performance criteria for TB diagnostics. Copyright © 2017 Elsevier Ltd. All rights reserved.

MDR and XDR-TB: Revolutionising our approach to facility design for long-term care facilities improved infrastructure and services for South Africa

CSIR Research Space (South Africa)

Parsons, SA

2008-11-01

Full Text Available of hospital design solutions to accommodate M(X)DR-TB patients and methodologies adopted to fast track the provision of much needed beds in the various high burden provinces in South Africa. TB Healthcare facilities: the South African Tuberculosis Strategic... categories: 20th Congress of the International Federation of Hospital Engineering, 19-22 October 2008, Barcelona, Spain 11 Risk Management As discussed earlier the key design issues in reducing the opportunities for patient-to-patient and patient...

Does the integration of TB medical services in the general hospital improve the quality of TB care? Evidence from a case study in China.

Science.gov (United States)

Sun, Qiang; Yin, Jia; Yin, Xiao; Zou, Guanyang; Liang, Mingli; Zhong, Jieming; Walley, John; Wei, Xiaolin

2013-06-01

Moving the clinical services from tuberculosis (TB) dispensary to the integrated county hospital (called integrated approach) has been practiced in China; however, it is unknown the quality of TB care in the integrated approach and in the dispensary approach. A total of 202 new TB patients were investigated using structured questionnaires in three counties implementing the integrated approach and one county implementing the dispensary approach. The quality of TB care is measured based on success rate of treatment, medical expenditure, health system delay and second-line drug use. The integrated approach showed a high success treatment rate. The medical expenditure in the integrated approach was USD 432, significantly lower than that in the dispensary approach (Z = -5.771, P < 0.001). The integrated approach had a shorter health system delay (5 days) than the dispensary approach (32 days). Twenty-six percent of patients in integrated hospitals were prescribed with second-line TB drugs, significantly lower than that in the TB dispensary (47%, χ(2) = 7.452, P = 0.006). However, the medical expenditure, use of second-line anti-TB drug and liver-protection drugs indeed varied greatly across the three integrated hospitals. The integrated approach showed better quality of TB care, but the performance of the integrated hospitals varied greatly. A method to standardize TB treatment and management of this approach is urgent.

Epigenetic mechanisms involved in differential MDR1 mRNA expression between gastric and colon cancer cell lines and rationales for clinical chemotherapy

Directory of Open Access Journals (Sweden)

Kim Kyung-Jong

2008-08-01

Full Text Available Abstract Background The membrane transporters such as P-glycoprotein (Pgp, the MDR1 gene product, are one of causes of treatment failure in cancer patients. In this study, the epigenetic mechanisms involved in differential MDR1 mRNA expression were compared between 10 gastric and 9 colon cancer cell lines. Methods The MDR1 mRNA levels were determined using PCR and real-time PCR assays after reverse transcription. Cytotoxicity was performed using the MTT assay. Methylation status was explored by quantification PCR-based methylation and bisulfite DNA sequencing analyses. Results The MDR1 mRNA levels obtained by 35 cycles of RT-PCR in gastric cancer cells were just comparable to those obtained by 22 cycles of RT-PCR in colon cancer cells. Real-time RT-PCR analysis revealed that MDR1 mRNA was not detected in the 10 gastric cancer cell lines but variable MDR1 mRNA levels in 7 of 9 colon cancer cell lines except the SNU-C5 and HT-29 cells. MTT assay showed that Pgp inhibitors such as cyclosporine A, verapamil and PSC833 sensitized Colo320HSR (colon, highest MDR1 expression but not SNU-668 (gastric, highest and SNU-C5 (gastric, no expression to paclitaxel. Quantification PCR-based methylation analysis revealed that 90% of gastric cancer cells, and 33% of colon cancer cells were methylated, which were completely matched with the results obtained by bisulfite DNA sequencing analysis. 5-aza-2'-deoxcytidine (5AC, a DNA methyltransferase inhibitor increased the MDR1 mRNA levels in 60% of gastric cells, and in 11% of colon cancer cells. Trichostatin A (TSA, histone deacetylase inhibitor increased the MDR1 mRNA levels in 70% of gastric cancer cells and 55% of colon cancer cells. The combined treatment of 5AC with TSA increased the MDR1 mRNA levels additively in 20% of gastric cancer cells, but synergistically in 40% of gastric and 11% of colon cancer cells. Conclusion These results indicate that the MDR1 mRNA levels in gastric cancer cells are significantly

Tuberculosis infection and disease in children living in households of Filipino patients with tuberculosis: a preliminary report.

Science.gov (United States)

Salazar-Vergara, R M L; Sia, I G; Tupasi, T E; Alcañeses, M R; Orillaza, R B; Co, V; Quelapio, M I D; Beltran, G; Legaspi, J D; Rostrata, M P C; Tecson, M E B; Corpuz, M L S B

2003-12-01

DOTS Clinic with a DOTS-Plus pilot project for the management of multidrug-resistant tuberculosis (MDR-TB) in a high burden country. To determine the prevalence of tuberculosis (TB) infection and disease among pediatric household contacts of patients with pulmonary TB (PTB). Cross-sectional study. One hundred and fifty-three children aged 0-15 years in the households of 62 bacteriologically confirmed PTB patients, including 44 with MDR-TB, were studied. BCG scars were noted, and tuberculin skin test (TST), screening chest radiography, and sputum or gastric aspirate smear and culture for Mycobacterium tuberculosis in those with radiographic findings suggestive of PTB were done. For children in this study, the prevalences of latent TB infection (LTBI), radiographically diagnosed pulmonary TB, and bacillary pulmonary TB were 69.2%, 3.3%, and 0.65%, respectively. Only age > or = 5 years was found to be a significant predictor of LTBI (OR 3.17, 95%CI 1.43-7.01). Contact investigation for active case-finding and early treatment of TB in children from households of patients with active PTB is essential for TB control. Further study on a more precise definition of TB infection and strategies for control in this population will be pursued.

The search for the mdr1-1Δ mutation of the MDR1 gene in four canine breeds in Uruguay (preliminary study

Directory of Open Access Journals (Sweden)

Rosa Gagliardi B.

2015-01-01

Full Text Available Objective. The objective of this study is to analyze the frequency of mdr1-1Δ mutation in German Shepherd, Doberman, Border Collie and Greyhound dog breeds in Uruguay. Materials and methods. A total of 95 animals from the four breeds mentioned above were studied. DNA was isolated from blood using potassium acetate with a subsequent degradation from RNA with RNAsaH. The concentration and quality of the DNA obtained was evaluated with a Nanodrop, ND-1000 spectrophotometer. To determine the presence or absence of the mdr1-1Δ mutation, DNA samples were sent to Gene Seek, Neogen Corporation of Chicago, United States, for genotyping. Results. In all 95 animals studied, the mdr1-1Δ mutation was not present. Conclusions. Based on the preliminary results obtained, other elements that may cause adverse drug reactions must be considered: unidentified mutations in other regions of the MDR1 gene; mutations in other genes involved in the transport of drugs from the same subfamily or another; mutations in enzymes involved in drug metabolism (e.g. Cytochrome P450. Moreover, especially with Border Collies and Greyhounds, it is advisable to increase the number of animals in the study.

Significance of MDR1 and multiple drug resistance in refractory human epileptic brain

Directory of Open Access Journals (Sweden)

Dini Gabriele

2004-10-01

Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.

Tuberculosis report among injection drug users and their partners in Kazakhstan.

Science.gov (United States)

Hermosilla, S; El-Bassel, N; Aifah, A; Terlikbayeva, A; Zhumadilov, Z; Berikkhanova, K; Darisheva, M; Gilbert, L; Schluger, N; Galea, S

2015-05-01

Tuberculosis (TB) is a major threat to global public health. Kazakhstan has the second highest percentage of multidrug-resistant tuberculosis (MDR-TB) cases among incident tuberculosis cases in the world (WHO 2013). A high burden of MDR-TB suggests TB prevention, control, and treatment programs are failing. This study provides an epidemiologic profile of TB among injection drug users (IDUs), a high-risk and chronically underserved population, in Kazakhstan. Cross-sectional study. The authors studied the characteristics and risk environment of IDUs with self-reported previous active TB and their primary sexual partners in Almaty, Kazakhstan. 728 individuals (364 couples) participated in a couple-based study in 2009. 16.75% of participants reported at least one positive TB test (x-ray) in their lifetime. In a multivariable logistic regression adjusting for couple-based sampling, persons with positive TB test were significantly more likely to be older (odds ratio (OR) 7.26, 95% confidence interval (CI): 1.73, 30.43), male (OR 5.53, 95% CI: 2.74, 11.16), have a shorter duration of injection drug use (OR 0.17, 95% CI: 0.04, 0.65), have received high social support from their significant other (OR 2.13, 95% CI: 1.03, 4.40) and more likely (non-significantly) to have been incarcerated (OR 7.03, 95% CI: 0.64, 77.30). Older men with a history of incarceration and recent injection drug use were more likely to have positive TB test in Kazakhstan. Social network support, while potentially positive for many aspects of population health, may increase risk of TB among IDUs in this context. Public health policies that target high-risk populations and their at-risk networks may be necessary to stem the rise of MDR-TB in Central Asia. Copyright © 2015 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

Use of a molecular diagnostic test in AFB smear positive tuberculosis suspects greatly reduces time to detection of multidrug resistant tuberculosis.

Directory of Open Access Journals (Sweden)

Nestani Tukvadze

Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.

The impact of being homeless on the unsuccessful outcome of treatment of pulmonary TB in São Paulo State, Brazil.

Science.gov (United States)

Ranzani, Otavio T; Carvalho, Carlos R R; Waldman, Eliseu A; Rodrigues, Laura C

2016-03-23

Tuberculosis (TB) is a major public health problem requiring complex treatment, the success of which depends on biological, social, and institutional factors. São Paulo State (SPS), in Brazil, has a high TB burden. Because of high socioeconomic heterogeneity and chaotic urbanisation, homelessness might play an important role in the TB burden in SPS. Our aim was to determine the association between homelessness and outcome of treatment of pulmonary TB (PTB) in SPS. A historical cohort from the routine SPS TB database for 2009-2013 was analysed. The study population was newly diagnosed adult patients with PTB. Homelessness was ascertained at notification or when treatment started. Our outcome was unsuccessful outcome of treatment. We used logistic regression to adjust for potential confounders and multiple imputation for missing data. We analysed 61,817 patients; 1726 (2.8 %, 95%CI 2.7-2.9 %) were homeless. Homeless patients were concentrated in bigger cities, were more frequently middle-aged males, had black/brown skin colour, and had received less education (P homeless patients (43.2 % vs 14.4 %, 30.2 % vs. 9.4 %, P homeless, of whom 17.3 % were HIV positive compared with 8.5 % among the not homeless population (P homeless (91.6 % vs. 84.8 %, P homeless and 17.5 % among the not homeless (OR = 6.32, 95%CI 5.73-6.97, P homelessness remained strongly associated with lower treatment success (aOR = 4.96, 95 % CI 4.27-5.76, P homelessness: among HIV-infected patients, the aOR was 2.45 (95%CI 1.90-3.16, Pinteraction homelessness, alcohol and drug use was almost 20 %. Confirming our hypothesis, homelessness led to a marked reduction in the successful treatment of newly diagnosed pulmonary tuberculosis. Homelessness and associated conditions were important contributors to lack of treatment success in pulmonary tuberculosis in São Paulo. A multifaceted intervention must be implemented to target this vulnerable population.

Culture and drug sensitivity testing among patients with pulmonary tuberculosis in Mexico: national data for 2009-2013.

Science.gov (United States)

Orejel, Ivonne; Castellanos, Martin; Marín, Diana; Mendoza, Alberto; Harries, Anthony D

2016-01-01

This study documented the number and results of mycobacterial culture and drug sensitivity testing (CDST) in Mexico from 2009-2013 and assessed whether states with a higher risk of multidrug-resistant tuberculosis (MDR-TB) performed more CDST and had more cultures showing MDR-TB. Data for this longitudinal, descriptive, operational research study came from the electronic records of 31 state public health laboratories in Mexico. The total number of CDSTs was 6 470, increasing from 2 143 in the first 2 years to 4 327 in the latter 3 years. There was a significant increase in the proportion of cultures showing sensitivity to all drugs, from 53.1% to 60.9% in 2011-2013 (P tuberculosis were Mexico, particularly in high-risk MDR-TB states where a higher proportion of cultures showed MDR-TB. Scale up and wider coverage of CDST should continue.

Surgical Face Masks Worn by Patients with Multidrug-Resistant Tuberculosis

Science.gov (United States)

Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A.; van der Walt, Martie; Nardell, Edward A.

2012-01-01

Rationale: Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. Objectives: We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Methods: Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Measurements and Main Results: Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68–85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31–51%), representing a 56% (95% CI, 33–70.5%) decreased risk of TB transmission when patients used masks. Conclusions: Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients. PMID:22323300

CT screening before treatment of latent tuberculous infection for the diagnosis of clinical TB among contacts

International Nuclear Information System (INIS)

Yoshiyama, Takashi; Ogata, Hideo

2008-01-01

The objective of this study was to evaluate the value of CT scan for the detection of tuberculous diseases among persons who are suspected to be infected at the contact examination. The settings of this study was to Fukujuji Hospital, Japan. Retrospective review of the medical records of 22 persons who were normal with plain chest X-ray at an outbreak at a private school, with which total 46 tuberculosis (TB) cases and 93 infected persons were detected by either symptomatic visits or contact examinations done mainly at public health centers. Among the 44 persons who visited Fukujuji Hospital, 4 persons were symptomatic visits, 3 persons were detected as TB cases by the contact examination at public health centers and 3 persons visited Fukujuji Hospital for the purpose of contact examination before examinations at the public health centers. Eight of these 10 persons were with abnormal chest plain X-ray findings and the remaining two persons were normal with plain chest X-ray findings (group A). Among the 34 persons who were referred to Fukujuji Hospital from public health centers as the infected person without diseases, one person showed abnormal chest plain X-ray and 33 persons showed normal chest plain X-ray (group B). Group A persons were examined in June and Group B persons were examined in July. The 2 persons in the group A were with abnormal CT findings. They were not diagnosed as TB by the CT findings but followed up after sputum examinations. Both of them were diagnosed as TB by the positive TB culture. Among the 33 persons in the group B, 20 persons were tested with CT scan at the examination done before starting treatment of latent tuberuclous infection and six of these 20 persons were with abnormal findings and were judged as TB diseases. In the case of outbreak with many TB cases and infected persons, CT should be considered for the detection of TB cases among contacts. (author)

TB Terms

Science.gov (United States)

... sputum can also be used to do a culture. TB blood test – a test that uses a blood sample to find out if you are infected with TB bacteria. The test measures the response to TB proteins when they are mixed with a small amount of blood. Examples of these TB blood tests include QuantiFERON ® -TB ...

Why healthcare workers are sick of TB

Directory of Open Access Journals (Sweden)

Arne von Delft

2015-03-01

Full Text Available Dr Thato Mosidi never expected to be diagnosed with tuberculosis (TB, despite widely prevalent exposure and very limited infection control measures. The life-threatening diagnosis of primary extensively drug-resistant TB (XDR-TB came as an even greater shock. The inconvenient truth is that, rather than being protected, Dr Mosidi and thousands of her healthcare colleagues are at an increased risk of TB and especially drug-resistant TB. In this viewpoint paper we debunk the widely held false belief that healthcare workers are somehow immune to TB disease (TB-proof and explore some of the key factors contributing to the pervasive stigmatization and subsequent non-disclosure of occupational TB. Our front-line workers are some of the first to suffer the consequences of a progressively more resistant and fatal TB epidemic, and urgent interventions are needed to ensure the safety and continued availability of these precious healthcare resources. These include the rapid development and scale-up of improved diagnostic and treatment options, strengthened infection control measures, and focused interventions to tackle stigma and discrimination in all its forms. We call our colleagues to action to protect themselves and those they care for.

Cost-effectiveness of adding bedaquiline to drug regimens for the treatment of multidrug-resistant tuberculosis in the UK.

Directory of Open Access Journals (Sweden)

Lara J Wolfson

Full Text Available To evaluate the cost-effectiveness of adding bedaquiline to a background regimen (BR of drugs for multidrug-resistant tuberculosis (MDR-TB in the United Kingdom (UK.A cohort-based Markov model was developed to estimate the incremental cost-effectiveness ratio of bedaquiline plus BR (BBR versus BR alone (BR in the treatment of MDR-TB, over a 10-year time horizon. A National Health Service (NHS and personal social services perspective was considered. Cost-effectiveness was evaluated in terms of Quality-Adjusted Life Years (QALYs and Disability-Adjusted Life Years (DALYs. Data were sourced from a phase II, placebo-controlled trial, NHS reference costs, and the literature; the US list price of bedaquiline was used and converted to pounds (£18,800. Costs and effectiveness were discounted at a rate of 3.5% per annum. Probabilistic and deterministic sensitivity analysis was conducted.The total discounted cost per patient (pp on BBR was £106,487, compared with £117,922 for BR. The total discounted QALYs pp were 5.16 for BBR and 4.01 for BR. The addition of bedaquiline to a BR resulted in a cost-saving of £11,434 and an additional 1.14 QALYs pp over a 10-year period, and is therefore considered to be the dominant (less costly and more effective strategy over BR. BBR remained dominant in the majority of sensitivity analyses, with a 81% probability of being dominant versus BR in the probabilistic analysis.In the UK, bedaquiline is likely to be cost-effective and cost-saving, compared with the current MDR-TB standard of care under a range of scenarios. Cost-savings over a 10-year period were realized from reductions in length of hospitalization, which offset the bedaquiline drug costs. The cost-benefit conclusions held after several sensitivity analyses, thus validating assumptions made, and suggesting that the results would hold even if the actual price of bedaquiline in the UK were higher than in the US.

Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

International Nuclear Information System (INIS)

Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

1990-01-01

The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

Rapid molecular diagnostics for multi-drug resistant tuberculosis in India.

Science.gov (United States)

Ramachandran, Rajeswari; Muniyandi, M

2018-03-01

Rapid molecular diagnostic methods help in the detection of TB and Rifampicin resistance. These methods detect TB early, are accurate and play a crucial role in reducing the burden of drug resistant tuberculosis. Areas covered: This review analyses rapid molecular diagnostic tools used in the diagnosis of MDR-TB in India, such as the Line Probe Assay and GeneXpert. We have discussed the burden of MDR-TB and the impact of recent diagnostic tools on case detection and treatment outcomes. This review also discusses the costs involved in establishing these new techniques in India. Expert commentary: Molecular methods have considerable advantages for the programmatic management of drug resistant TB. These include speed, standardization of testing, potentially high throughput and reduced laboratory biosafety requirements. There is a desperate need for India to adopt modern, rapid, molecular tools with point-of-care tests being currently evaluated. New molecular diagnostic tests appear to be cost effective and also help in detecting missing cases. There is enough evidence to support the scaling up of these new tools in India.

Challenges of TB diagnosis and treatment in South Africa | Wood ...

African Journals Online (AJOL)

It is estimated that 2 billion of the world\\'s population are latently infected with Mycobacterium tuberculosis (Mtb) with a resultant 8 - 9 million cases of active tuberculosis (TB) and 1.6 million deaths annually.1 The tools used for diagnosis of TB have remained largely unchanged since the 1880s when sputum microscopy, Mtb ...

Kinetics of the QuantiFERON-TB Gold In-Tube test during treatment of patients with sputum smear-positive tuberculosis in relation to initial TST result and severity of disease

DEFF Research Database (Denmark)

Idh, Jonna; Abate, Ebba; Westman, Anna

2010-01-01

. Smear-positive TB patients (n = 71) were recruited at Gondar University Hospital, Ethiopia. The TST, QFN, CD4+ cell count and clinical symptoms (TB score) were assessed and followed up during treatment. From baseline to 7 months after treatment, there was a significant decrease in QFN reactivity (93.......8% to 62.5% in HIV-negative/TB; 70.3% to 33.3% in HIV-positive/TB patients) down to a level comparable to a control group of blood donors (51.2%). The agreement between TST and QFN was poor in TB patients compared to healthy controls. A negative TST correlated to more advanced TB in contrast to a negative...

Effectiveness and safety of imipenem/clavulanate and linezolid to treat multidrug and extensively drug-resistant tuberculosis at a referral hospital in Brazil.

Science.gov (United States)

Arbex, M A; Bonini, E H; Kawakame Pirolla, G; D'Ambrosio, L; Centis, R; Migliori, G B

Evidence on effectiveness, safety, and tolerability of imipenem/clavulanate (IC) and linezolid containing regimens to treat multidrug-resistant (MDR-) and extensively drug-resistant tuberculosis (XDR-TB) is scarce. The aim of this observational study is to evaluate the therapeutic contribution of IC and linezolid to manage MDR/XDR-TB cases at the reference centre of São Paulo state, Brazil. Twelve patients (9 males, 1 HIV positive in antiretroviral treatment, 4 MDR, 8 XDR) were treated with IC, 11 of them within linezolid-containing regimens. They all were previously treated with treatment failure, for a median (IQR, interquartile range) of 4.5 (2-6.5) times, having a severe resistance pattern (median number of resistances: 7 (5-8)) and being sputum smear and culture positive. IC and linezolid were prescribed at the dose of 1000mg/day and 600mg/day, respectively. The overall exposure was (median (IQR)) 419 (375.5-658) days for IC and 678 (392-720) days for linezolid. All of them converted their sputum (time to sputum conversion; 60 (37.5-90) days) and culture (75 (60-135) days), and 7 were cured while 5 are still on treatment with a gradually improving clinical picture. While no adverse events were reported for IC, 2 minor side effects, only, were attributed to linezolid (17%); in both cases the drug was re-started without further problems. Our study suggests that IC and linezolid-containing regimens can be used safely and with satisfactory outcomes in reference centres to treat MDR/XDR-TB patients. Copyright © 2016 Sociedade Portuguesa de Pneumologia. Published by Elsevier España, S.L.U. All rights reserved.

Patient satisfaction with HIV and TB treatment in a public programme in rural KwaZulu-Natal: evidence from patient-exit interviews

Science.gov (United States)

2014-01-01

Background Patient satisfaction is a determinant of treatment uptake, adherence and retention, and an important health systems outcome. Queues, health worker-patient contact time, staff attitudes, and facility cleanliness may affect patient satisfaction. We quantified dimensions of patient satisfaction among HIV and TB patients in a rural sub-district of KwaZulu-Natal, South Africa, and identified underlying satisfaction factors that explained the data. Methods We conducted patient-exit interviews with 300 HIV and 300 TB patients who were randomly selected using a two-stage cluster random sampling approach with primary sampling units (primary healthcare clinics) selected with probability-proportional-to-size sampling. We performed factor analysis to investigate underlying patient satisfaction factors. We compared the satisfaction with HIV and TB services and examined the relationships between patient satisfaction and patients’ socio-demographic characteristics in multivariable regression. Results Almost all patients (95% HIV, 97% TB) reported to be globally satisfied with the healthcare services received on the day of the interview. However, patient satisfaction with specific concrete aspects of the health services was substantially lower: 52% of HIV and 40% of TB patients agreed that some staff did not treat patients with sufficient respect (p = 0.02 for difference between the two patient groups); 65% of HIV and 40% of TB patients agreed that health worker queues were too long (p patient satisfaction variables could be reduced to a few underlying factors that align broadly with concepts previously identified in the literature as affecting access to healthcare. Increases in health systems resources for HIV and TB, but also improvements in facility maintenance, staff attitudes and communication, are likely to substantially improve HIV and TB patients’ satisfaction with the care they receive in public-sector treatment programmes in rural communities in South

Use of GenoType® MTBDRplus assay to assess drug resistance and mutation patterns of multidrug-resistant tuberculosis isolates in northern India

Directory of Open Access Journals (Sweden)

A K Maurya

2013-01-01

Full Text Available Purpose: The emergence and spread of multidrug-resistant tuberculosis (MDR-TB is a major public health problem. The diagnosis of MDR-TB is of paramount importance in establishing appropriate clinical management and infection control measures. The aim of this study was to evaluate drug resistance and mutational patterns in clinical isolates MDR-TB by GenoType® MTBDRplus assay. Material and Methods: A total of 350 non-repeated sputum specimens were collected from highly suspected drug-resistant pulmonary tuberculosis (PTB cases; which were processed by microscopy, culture, differentiation and first line drug susceptibility testing (DST using BacT/ALERT 3D system. Results: Among a total of 125 mycobacterium tuberculosis complex (MTBC strains, readable results were obtained from 120 (96% strains by GenoType® MTBDRplus assay. Only 45 MDR-TB isolates were analysed for the performance, frequency and mutational patterns by GenoType® MTBDRplus assay. The sensitivity of the GenoType® MDRTBplus assay for detecting individual resistance to rifampicin (RIF, isoniazid (INH and multidrug resistance was found to be 95.8%, 96.3% and 97.7%, respectively. Mutation in codon S531L of the rpoB gene and codon S315T1 of katG genes were dominated in MDR-TB strains, respectively (P < 0.05. Conclusions: The GenoType® MTBDRplus assay is highly sensitive with short turnaround times and a rapid test for the detection of the most common mutations conferring resistance in MDR-TB strains that can readily be included in a routine laboratory workflow.

ANALYSIS OF MUTATIONS OF TUBERCULOUS MYCOBACTERIA DEFINING DRUG RESISTANCE IN HIV POSITIVE AND HIV NEGATIVE TUBERCULOSIS PATIENTS WITHOUT PRIOR HISTORY OF TREATMENT IN SVERDLOVSK REGION

Directory of Open Access Journals (Sweden)

G. V. Panov

2017-01-01

Full Text Available Goal of the study: to identify profile of mutations of tuberculous mycobacteria responsible for resistance to anti-tuberculosis drugs in HIV positive and HIV negative tuberculosis patients without prior history of treatment.Materials and methods. 165 strains of tuberculous mycobacteria from HIV positive patients and 166 strains of tuberculous mycobacteria from HIV negative patients were studied in Sverdlovsk Region (TB Dispensary, Yekaterinburg. Mutations in genes were identified using microchips of TB-BIOCHIP® and TB-BIOCHIP®-2 in compliance with the manufacturer's guidelines (OOO Biochip-IMB, Moscow.Results. It was observed that 85/165 (51.52% strains isolated from HIV positive tuberculosis patients and 58/166 (34.94% strains isolated from tuberculosis patients not associated with HIV possessed MDR genotype (p < 0.01. The majority of MDR strains had mutations in the 531th codon of rpoB (Ser→Leu and 315th codon of katG (Ser→Thr (64/85, 75.29% and 38/58, 65.52% respective the groups, resulting in the high level of resistance to rifampicin and isoniazid. Each group also had approximately equal ratio (11/165, 6.67% and 12/166, 7.23% respective the groups of strains with genomic mutations defining the resistance to isoniazid, rifampicin and fluoruquinolones. No confident difference was found in mutation patterns of genome of tuberculous mycobacteria isolated from HIV positive and HIV negative tuberculosis patients. 

FAM-MDR: a flexible family-based multifactor dimensionality reduction technique to detect epistasis using related individuals.