WorldWideScience

Sample records for matrix element probabilities

  1. Matrix elements and transition probabilities of interaction of electromagnetic field with a hydrogen-like atom

    International Nuclear Information System (INIS)

    Rajput, B.S.

    1977-01-01

    Using the reduced expansions of second quantized electromagnetic vector potential operator in terms of irreducible representations of Pioncare group in the interaction Hamiltonian, the exact matrix elements of interaction of electromagnetic field with a hydrogenic atom have been derived and the contributions of transitions for different combinations of angular momentum quantum numbers to the transition probabilities of various lines in Lyman-, Balmer-, and Paschen-series have been computed. (author)

  2. Convergence of Transition Probability Matrix in CLVMarkov Models

    Science.gov (United States)

    Permana, D.; Pasaribu, U. S.; Indratno, S. W.; Suprayogi, S.

    2018-04-01

    A transition probability matrix is an arrangement of transition probability from one states to another in a Markov chain model (MCM). One of interesting study on the MCM is its behavior for a long time in the future. The behavior is derived from one property of transition probabilty matrix for n steps. This term is called the convergence of the n-step transition matrix for n move to infinity. Mathematically, the convergence of the transition probability matrix is finding the limit of the transition matrix which is powered by n where n moves to infinity. The convergence form of the transition probability matrix is very interesting as it will bring the matrix to its stationary form. This form is useful for predicting the probability of transitions between states in the future. The method usually used to find the convergence of transition probability matrix is through the process of limiting the distribution. In this paper, the convergence of the transition probability matrix is searched using a simple concept of linear algebra that is by diagonalizing the matrix.This method has a higher level of complexity because it has to perform the process of diagonalization in its matrix. But this way has the advantage of obtaining a common form of power n of the transition probability matrix. This form is useful to see transition matrix before stationary. For example cases are taken from CLV model using MCM called Model of CLV-Markov. There are several models taken by its transition probability matrix to find its convergence form. The result is that the convergence of the matrix of transition probability through diagonalization has similarity with convergence with commonly used distribution of probability limiting method.

  3. A pedagogical derivation of the matrix element method in particle physics data analysis

    Science.gov (United States)

    Sumowidagdo, Suharyo

    2018-03-01

    The matrix element method provides a direct connection between the underlying theory of particle physics processes and detector-level physical observables. I am presenting a pedagogically-oriented derivation of the matrix element method, drawing from elementary concepts in probability theory, statistics, and the process of experimental measurements. The level of treatment should be suitable for beginning research student in phenomenology and experimental high energy physics.

  4. Temperature Analysis and Failure Probability of the Fuel Element in HTR-PM

    International Nuclear Information System (INIS)

    Yang Lin; Liu Bing; Tang Chunhe

    2014-01-01

    Spherical fuel element is applied in the 200-MW High Temperature Reactor-Pebble-bed Modular (HTR-PM). Each spherical fuel element contains approximately 12,000 coated fuel particles in the inner graphite matrix with a diameter of 50mm to form the fuel zone, while the outer shell with a thickness of 5mm is a fuel-free zone made up of the same graphite material. Under high burnup irradiation, the temperature of fuel element rises and the stress will result in the damage of fuel element. The purpose of this study is to analyze the temperature of fuel element and to discuss the stress and failure probability. (author)

  5. Analytic matrix elements with shifted correlated Gaussians

    DEFF Research Database (Denmark)

    Fedorov, D. V.

    2017-01-01

    Matrix elements between shifted correlated Gaussians of various potentials with several form-factors are calculated analytically. Analytic matrix elements are of importance for the correlated Gaussian method in quantum few-body physics.......Matrix elements between shifted correlated Gaussians of various potentials with several form-factors are calculated analytically. Analytic matrix elements are of importance for the correlated Gaussian method in quantum few-body physics....

  6. Integral transport multiregion geometrical shadowing factor for the approximate collision probability matrix calculation of infinite closely packed lattices

    International Nuclear Information System (INIS)

    Jowzani-Moghaddam, A.

    1981-01-01

    An integral transport method of calculating the geometrical shadowing factor in multiregion annular cells for infinite closely packed lattices in cylindrical geometry is developed. This analytical method has been programmed in the TPGS code. This method is based upon a consideration of the properties of the integral transport method for a nonuniform body, which together with Bonalumi's approximations allows the determination of the approximate multiregion collision probability matrix for infinite closely packed lattices with sufficient accuracy. The multiregion geometrical shadowing factors have been calculated for variations in fuel pin annular segment rings in a geometry of annular cells. These shadowing factors can then be used in the calculation of neutron transport from one annulus to another in an infinite lattice. The result of this new geometrical shadowing and collision probability matrix are compared with the Dancoff-Ginsburg correction and the probability matrix using constant shadowing on Yankee fuel elements in an infinite lattice. In these cases the Dancoff-Ginsburg correction factor and collision probability matrix using constant shadowing are in difference by at most 6.2% and 6%, respectively

  7. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  8. Intermediate coupling collision strengths from LS coupled R-matrix elements

    International Nuclear Information System (INIS)

    Clark, R.E.H.

    1978-01-01

    Fine structure collision strength for transitions between two groups of states in intermediate coupling and with inclusion of configuration mixing are obtained from LS coupled reactance matrix elements (R-matrix elements) and a set of mixing coefficients. The LS coupled R-matrix elements are transformed to pair coupling using Wigner 6-j coefficients. From these pair coupled R-matrix elements together with a set of mixing coefficients, R-matrix elements are obtained which include the intermediate coupling and configuration mixing effects. Finally, from the latter R-matrix elements, collision strengths for fine structure transitions are computed (with inclusion of both intermediate coupling and configuration mixing). (Auth.)

  9. Rovibrational matrix elements of the multipole moments

    Indian Academy of Sciences (India)

    Rovibrational matrix elements of the multipole moments ℓ up to rank 10 and of the linear polarizability of the H2 molecule in the condensed phase have been computed taking into account the effect of the intermolecular potential. Comparison with gas phase matrix elements shows that the effect of solid state interactions is ...

  10. Coulomb matrix elements in multi-orbital Hubbard models.

    Science.gov (United States)

    Bünemann, Jörg; Gebhard, Florian

    2017-04-26

    Coulomb matrix elements are needed in all studies in solid-state theory that are based on Hubbard-type multi-orbital models. Due to symmetries, the matrix elements are not independent. We determine a set of independent Coulomb parameters for a d-shell and an f-shell and all point groups with up to 16 elements (O h , O, T d , T h , D 6h , and D 4h ). Furthermore, we express all other matrix elements as a function of the independent Coulomb parameters. Apart from the solution of the general point-group problem we investigate in detail the spherical approximation and first-order corrections to the spherical approximation.

  11. S-matrix elements from T-duality

    International Nuclear Information System (INIS)

    Babaei Velni, Komeil; Garousi, Mohammad R.

    2013-01-01

    Recently it has been speculated that the S-matrix elements satisfy the Ward identity associated with the T-duality. This indicates that a group of S-matrix elements is invariant under the linear T-duality transformations on the external states. If one evaluates one component of such T-dual multiplet, then all other components may be found by the simple use of the linear T-duality. The assumption that fields must be independent of the Killing coordinate, however, may cause, in some cases, the T-dual multiplet not to be gauge invariant. In those cases, the S-matrix elements contain more than one T-dual multiplet which are intertwined by the gauge symmetry. In this paper, we apply the T-dual Ward identity on the S-matrix element of one RR (p−3)-form and two NSNS states on the world volume of a D p -brane to find its corresponding T-dual multiplet. In the case that the RR potential has two transverse indices, the T-dual multiplet is gauge invariant, however, in the case that it has one transverse index the multiplet is not gauge invariant. We find a new T-dual multiplet in this case by imposing the gauge symmetry. We show that the multiplets are reproduced by explicit calculation, and their low energy contact terms at order α ′2 are consistent with the existing couplings in the literature

  12. Lattice results for heavy light matrix elements

    International Nuclear Information System (INIS)

    Soni, A.

    1994-09-01

    Lattice results for heavy light matrix elements are reviewed and some of their implications are very briefly discussed. Despite the fact that in most cases the lattice results for weak matrix elements at the moment have only a modest accuracy of about 20--30% they already have important phenomenological repercussions; e.g. for V td /V ts , x s /x d and B → K*γ

  13. Elements of matrix modeling and computing with Matlab

    CERN Document Server

    White, Robert E

    2006-01-01

    As discrete models and computing have become more common, there is a need to study matrix computation and numerical linear algebra. Encompassing a diverse mathematical core, Elements of Matrix Modeling and Computing with MATLAB examines a variety of applications and their modeling processes, showing you how to develop matrix models and solve algebraic systems. Emphasizing practical skills, it creates a bridge from problems with two and three variables to more realistic problems that have additional variables. Elements of Matrix Modeling and Computing with MATLAB focuses on seven basic applicat

  14. Electromagnetic matrix elements in baryons

    International Nuclear Information System (INIS)

    Lipkin, H.J.; Moinester, M.A.

    1992-01-01

    Some simple symmetry relations between matrix elements of electromagnetic operators are investigated. The implications are discussed for experiments to study hyperon radiative transitions and polarizabilities and form factors. (orig.)

  15. A probability of synthesis of the superheavy element Z = 124

    Energy Technology Data Exchange (ETDEWEB)

    Manjunatha, H.C. [Government College for Women, Department of Physics, Kolar, Karnataka (India); Sridhar, K.N. [Government First Grade College, Department of Physics, Kolar, Karnataka (India)

    2017-10-15

    We have studied the fusion cross section, evaporation residue cross section, compound nucleus formation probability (P{sub CN}) and survival probability (P{sub sur}) of different projectile target combinations to synthesize the superheavy element Z=124. Hence, we have identified the most probable projectile-target combination to synthesize the superheavy element Z = 124. To synthesize the superheavy element Z=124, the most probable projectile target combinations are Kr+Ra, Ni+Cm, Se+Th, Ge+U and Zn+Pu. We hope that our predictions may be a guide for the future experiments in the synthesis of superheavy nuclei Z = 124. (orig.)

  16. Matrix Elements in Fermion Dynamical Symmetry Model

    Institute of Scientific and Technical Information of China (English)

    LIU Guang-Zhou; LIU Wei

    2002-01-01

    In a neutron-proton system, the matrix elements of the generators for SO(8) × SO(8) symmetry areconstructed explicitly, and with these matrix elements the low-lying excitation spectra obtained by diagonalization arepresented. The excitation spectra for SO(7) nuclei Pd and Ru isotopes and SO(6) r-soft rotational nuclei Xe, Ba, andCe isotopes are calculated, and comparison with the experimental results is carried out.

  17. Matrix Elements in Fermion Dynamical Symmetry Model

    Institute of Scientific and Technical Information of China (English)

    LIUGuang-Zhou; LIUWei

    2002-01-01

    In a neutron-proton system,the matrix elements of the generators for SO(8)×SO(8) symmetry are constructed exp;icitly,and with these matrix elements the low-lying excitation spsectra obtained by diagonalization are presented.The excitation spectra for SO(7) nuclei Pd and Ru isotopes and SO(6) r-soft rotational nuclei Xe,Ba,and Ce isotopes are calculated,and comparison with the experimental results is carried out.

  18. Direct calculation of off-diagonal matrix elements

    International Nuclear Information System (INIS)

    Killingbeck, J P; Jolicard, G

    2011-01-01

    Gauss elimination is used in a sequence of calculations which give the squares of the off-diagonal matrix elements of x between quartic oscillator eigenstates, in a modification of the original sum rule approach of Tipping et al to the problem. New and more flexible methods are then devised and tested and are shown to permit the isolation and calculation of individual squared matrix elements of x and x 2 .

  19. Renormalon ambiguities in NRQCD operator matrix elements

    International Nuclear Information System (INIS)

    Bodwin, G.T.; Chen, Y.

    1999-01-01

    We analyze the renormalon ambiguities that appear in factorization formulas in QCD. Our analysis contains a simple argument that the ambiguities in the short-distance coefficients and operator matrix elements are artifacts of dimensional-regularization factorization schemes and are absent in cutoff schemes. We also present a method for computing the renormalon ambiguities in operator matrix elements and apply it to a computation of the ambiguities in the matrix elements that appear in the NRQCD factorization formulas for the annihilation decays of S-wave quarkonia. Our results, combined with those of Braaten and Chen for the short-distance coefficients, provide an explicit demonstration that the ambiguities cancel in the physical decay rates. In addition, we analyze the renormalon ambiguities in the Gremm-Kapustin relation and in various definitions of the heavy-quark mass. copyright 1999 The American Physical Society

  20. The probability that a pair of group elements is autoconjugate

    Indian Academy of Sciences (India)

    [1] Alghamdi A M and Russo F G, A generalization of the probability that the commutator of two group elements is equal to a given element, Bull. Iranian Math. Soc. 38 (2012). 973–986. [2] Blackburn S R, Britnell J R and Wildon M, The probability that a pair of elements of a finite group are conjugate, J. London Math. Soc.

  1. An Explicit Consistent Geometric Stiffness Matrix for the DKT Element

    Directory of Open Access Journals (Sweden)

    Eliseu Lucena Neto

    Full Text Available Abstract A large number of references dealing with the geometric stiffness matrix of the DKT finite element exist in the literature, where nearly all of them adopt an inconsistent form. While such a matrix may be part of the element to treat nonlinear problems in general, it is of crucial importance for linearized buckling analysis. The present work seems to be the first to obtain an explicit expression for this matrix in a consistent way. Numerical results on linear buckling of plates assess the element performance either with the proposed explicit consistent matrix, or with the most commonly used inconsistent matrix.

  2. PREDICTION OF RESERVOIR FLOW RATE OF DEZ DAM BY THE PROBABILITY MATRIX METHOD

    Directory of Open Access Journals (Sweden)

    Mohammad Hashem Kanani

    2012-12-01

    Full Text Available The data collected from the operation of existing storage reservoirs, could offer valuable information for the better allocation and management of fresh water rates for future use to mitigation droughts effect. In this paper the long-term Dez reservoir (IRAN water rate prediction is presented using probability matrix method. Data is analyzed to find the probability matrix of water rates in Dez reservoir based on the previous history of annual water entrance during the past and present years(40 years. The algorithm developed covers both, the overflow and non-overflow conditions in the reservoir. Result of this study shows that in non-overflow conditions the most exigency case is equal to 75%. This means that, if the reservoir is empty (the stored water is less than 100 MCM this year, it would be also empty by 75% next year. The stored water in the reservoir would be less than 300 MCM by 85% next year if the reservoir is empty this year. This percentage decreases to 70% next year if the water of reservoir is less than 300 MCM this year. The percentage also decreases to 5% next year if the reservoir is full this year. In overflow conditions the most exigency case is equal to 75% again. The reservoir volume would be less than 150 MCM by 90% next year, if it is empty this year. This percentage decreases to 70% if its water volume is less than 300 MCM and 55% if the water volume is less than 500 MCM this year. Result shows that too, if the probability matrix of water rates to a reservoir is multiplied by itself repeatedly; it converges to a constant probability matrix, which could be used to predict the long-term water rate of the reservoir. In other words, the probability matrix of series of water rates is changed to a steady probability matrix in the course of time, which could reflect the hydrological behavior of the watershed and could be easily used for the long-term prediction of water storage in the down stream reservoirs.

  3. Matrix elements of the relativistic electron-transition operators

    International Nuclear Information System (INIS)

    Rudzikas, Z.B.; Slepcov, A.A.; Kickin, I.S.

    1976-01-01

    The formulas, which enable us to calculate the electric and magnetic multipole transition probabilities in relativistic approximation under various gauge conditions of the electromagnetic potential, are presented. The numerical values of the coefficients of the one-electron reduced matrix elements of the relativistic operators of the electric and magnetic dipole transitions between the configurations K 0 n 2 l 2 j 2 α 0 J 0 j 2 J--K 0 n 1 l 1 j 1 α 0 'J 0 'j 1 J', where K 0 represents any electronic configuration, having the quantum number of the total angular momentum 0 less than or equal to J 0 less than or equal to 8 (the step is 1 / 2 ), and 1 / 2 less than or equal to j 2 , j 1 less than or equal to 7 / 2 , are given

  4. Theory of the particle matrix elements for Helium atom scattering in surfaces

    International Nuclear Information System (INIS)

    Khater, A.; Toennies, J.P.

    2000-01-01

    Full text.A brief review is presented for the recent development of the theory of the particle transition matrix elements, basic to the cross section for Helium and inert particle scattering at thermal energies in solid surfaces. the Jackson and Mott matrix elements are presented and discussed for surface scattering processes, habitually classified as elastic and inelastic. Modified transition matrix elements, introduced originally to account for the cut-off effects, are presented in a direct and simple manner. the Debye-Waller factor is introduced and discussed. A recent calculation for the particle transition matrix elements is presented for the specular and inelastic transition matrix elements and the corresponding inelastic scattering cross section is compared in detail to experimental data. the specular and inelastic transition matrix elements are found to be intrinsically similar owing to the intermediate role of a proposed virtual particle squeezed state near the surface

  5. Finite size effects of a pion matrix element

    International Nuclear Information System (INIS)

    Guagnelli, M.; Jansen, K.; Palombi, F.; Petronzio, R.; Shindler, A.; Wetzorke, I.

    2004-01-01

    We investigate finite size effects of the pion matrix element of the non-singlet, twist-2 operator corresponding to the average momentum of non-singlet quark densities. Using the quenched approximation, they come out to be surprisingly large when compared to the finite size effects of the pion mass. As a consequence, simulations of corresponding nucleon matrix elements could be affected by finite size effects even stronger which could lead to serious systematic uncertainties in their evaluation

  6. Weak matrix elements on the lattice - Circa 1995

    International Nuclear Information System (INIS)

    Soni, A.

    1995-01-01

    Status of weak matrix elements is reviewed. In particular, e'/e, B → K*γ, B B and B B , are discussed and the overall situation with respect to the lattice effort and some of its phenomenological implications are summarised. For e'/e the need for the relevant matrix elements is stressed in view of the forthcoming improved experiments. For some of the operators, (e.g. O 6 ), even bound on their matrix elements would be very helpful. On B → K degrees γ, a constant behavior of T 2 appears disfavored although dependence of T 2 could, of course, be milder than a simple pole. Improved data is badly needed to settle this important issue firmly, especially in view of its ramification for extractions of V td from B → ργ. On B κ , the preliminary result from JLQCD appears to contradict Sharpe et al. JLQCD data seems to fit very well to linear α dependence and leads to an appreciably lower value of B κ . Four studies of B κ in the open-quotes fullclose quotes (n f = 2) theory indicate very little quenching effects on B κ ; the full theory value seems to be just a little less than the quenched result. Based on expectations from HQET, analysis of B-parameter (B h ell) for the heavy-light mesons via B h ell) = constant + constants'/m h ell is suggested. A summary of an illustrative sample of hadron matrix elements is given and constraints on CKM parameters (e.g. V td /V ts , on the unitarity triangle and on x s /x d , emerging from the lattice calculations along with experimental results are briefly discussed. In quite a few cases, for the first time, some indication of quenching errors on weak matrix elements are now becoming available

  7. Double Beta Decay and Neutrino Masses Accuracy of the Nuclear Matrix Elements

    International Nuclear Information System (INIS)

    Faessler, Amand

    2005-01-01

    The neutrinoless double beta decay is forbidden in the standard model of the electroweak and strong interaction but allowed in most Grand Unified Theories (GUT's). Only if the neutrino is a Majorana particle (identical with its antiparticle) and if it has a mass, the neutrinoless double beta decay is allowed. Apart of one claim that the neutrinoless double beta decay in 76 Ge is measured, one has only upper limits for this transition probability. But even the upper limits allow to give upper limits for the electron Majorana neutrino mass and upper limits for parameters of GUT's and the minimal R-parity violating supersymmetric model. One further can give lower limits for the vector boson mediating mainly the right-handed weak interaction and the heavy mainly right-handed Majorana neutrino in left-right symmetric GUT's. For that one has to assume that the specific mechanism is the leading one for the neutrinoless double beta decay and one has to be able to calculate reliably the corresponding nuclear matrix elements. In the present contribution, one discusses the accuracy of the present status of calculating the nuclear matrix elements and the corresponding limits of GUT's and supersymmetric parameters

  8. HELIOS: transformation laws for multiple-collision probabilities with angular dependence

    International Nuclear Information System (INIS)

    Villarino, E.A.; Stamm'ler, R.J.J.

    1996-01-01

    In the lattice code HELIOS, neutron and gamma transport in a given system is treated by the CCCP (current-coupling collision-probability) method. The system is partitioned into space elements which are coupled by currents. Inside the space elements first-flight probabilities are used to obtain the coefficients of the coupling equation and of the equations for the fluxes. The calculation of these coefficients is expensive in CPU time on two scores: the evaluation of the first-flight probabilities, and the matrix inversion to convert these probabilities into the desired coefficients. If the cross sections of two geometrically equal space elements, or of the same element at an earlier burnup level, differ less than a small fraction, considerable CPU time can be saved by using transformation laws. Previously, such laws were derived for first-flight probabilities; here, they are derived for the multiple-collision coefficients of the CCCP equations. They avoid not only the expensive calculations of the first-flight probabilities, but also the subsequent matrix inversion. Various examples illustrate the savings achieved by using these new transformation laws - or by directly using earlier calculated coefficients, if the cross section differences are negligible. (author)

  9. Disintegration of graphite matrix from the simulative high temperature gas-cooled reactor fuel element by electrochemical method

    International Nuclear Information System (INIS)

    Tian Lifang; Wen Mingfen; Li Linyan; Chen Jing

    2009-01-01

    Electrochemical method with salt as electrolyte has been studied to disintegrate the graphite matrix from the simulative high temperature gas-cooled reactor fuel elements. Ammonium nitrate was experimentally chosen as the appropriate electrolyte. The volume average diameter of disintegrated graphite fragments is about 100 μm and the maximal value is less than 900 μm. After disintegration, the weight of graphite is found to increase by about 20% without the release of a large amount of CO 2 probably owing to the partial oxidation to graphite in electrochemical process. The present work indicates that the improved electrochemical method has the potential to reduce the secondary nuclear waste and is a promising option to disintegrate graphite matrix from high temperature gas-cooled reactor spent fuel elements in the head-end of reprocessing.

  10. Rotational covariance and light-front current matrix elements

    International Nuclear Information System (INIS)

    Keister, B.D.

    1994-01-01

    Light-front current matrix elements for elastic scattering from hadrons with spin 1 or greater must satisfy a nontrivial constraint associated with the requirement of rotational covariance for the current operator. Using a model ρ meson as a prototype for hadronic quark models, this constraint and its implications are studied at both low and high momentum transfers. In the kinematic region appropriate for asymptotic QCD, helicity rules, together with the rotational covariance condition, yield an additional relation between the light-front current matrix elements

  11. Hadron matrix elements of quark operators in the relativistic quark model

    Energy Technology Data Exchange (ETDEWEB)

    Bando, Masako; Toya, Mihoko [Kyoto Univ. (Japan). Dept. of Physics; Sugimoto, Hiroshi

    1979-07-01

    General formulae for evaluating matrix elements of two- and four-quark operators sandwiched by one-hadron states are presented on the basis of the relativistic quark model. Observed hadronic quantities are expressed in terms of those matrix elements of two- and four-quark operators. One observes various type of relativistic expression for the matrix elements which in the non-relativistic case reduce to simple expression of the so-called ''the wave function at the origin /sup +/psi(0)/sup +/''.

  12. Matrix elements of a hyperbolic vector operator under SO(2,1)

    International Nuclear Information System (INIS)

    Zettili, N.; Boukahil, A.

    2003-01-01

    We deal here with the use of Wigner–Eckart type arguments to calculate the matrix elements of a hyperbolic vector operator V-vector by expressing them in terms of reduced matrix elements. In particular, we focus on calculating the matrix elements of this vector operator within the basis of the hyperbolic angular momentum T-vector whose components T-vector 1 , T-vector 2 , T-vector 3 satisfy an SO(2,1) Lie algebra. We show that the commutation rules between the components of V-vector and T-vector can be inferred from the algebra of ordinary angular momentum. We then show that, by analogy to the Wigner–Eckart theorem, we can calculate the matrix elements of V-vector within a representation where T-vector 2 and T-vector 3 are jointly diagonal. (author)

  13. Comparison between phase shift derived and exactly calculated nucleon--nucleon interaction matrix elements

    International Nuclear Information System (INIS)

    Gregersen, A.W.

    1977-01-01

    A comparison is made between matrix elements calculated using the uncoupled channel Sussex approach to second order in DWBA and matrix elements calculated using a square well potential. The square well potential illustrated the problem of the determining parameter independence balanced with the concept of phase shift difference. The super-soft core potential was used to discuss the systematics of the Sussex approach as a function of angular momentum as well as the relation between Sussex generated and effective interaction matrix elements. In the uncoupled channels the original Sussex method of extracting effective interaction matrix elements was found to be satisfactory. In the coupled channels emphasis was placed upon the 3 S 1 -- 3 D 1 coupled channel matrix elements. Comparison is made between exactly calculated matrix elements, and matrix elements derived using an extended formulation of the coupled channel Sussex method. For simplicity the potential used is a nonseparable cut-off oscillator. The eigenphases of this potential can be made to approximate the realistic nucleon--nucleon phase shifts at low energies. By using the cut-off oscillator test potential, the original coupled channel Sussex method of determining parameter independence was shown to be incapable of accurately reproducing the exact cut-off oscillator matrix elements. The extended Sussex method was found to be accurate to within 10 percent. The extended method is based upon more general coupled channel DWBA and a noninfinite oscillator wave function solution to the cut-off oscillator auxiliary potential. A comparison is made in the coupled channels between matrix elements generated using the original Sussex method and the extended method. Tables of matrix elements generated using the original uncoupled channel Sussex method and the extended coupled channel Sussex method are presented for all necessary angular momentum channels

  14. A Taxonomy of Latent Structure Assumptions for Probability Matrix Decomposition Models.

    Science.gov (United States)

    Meulders, Michel; De Boeck, Paul; Van Mechelen, Iven

    2003-01-01

    Proposed a taxonomy of latent structure assumptions for probability matrix decomposition (PMD) that includes the original PMD model and a three-way extension of the multiple classification latent class model. Simulation study results show the usefulness of the taxonomy. (SLD)

  15. Evolution of an array of elements with logistic transition probability

    International Nuclear Information System (INIS)

    Majernik, Vladimir; Surda, Anton

    1996-01-01

    The paper addresses the problem how the state of an array of elements changes if the transition probabilities of its elements is chosen in the form of a logistic map. This problem leads to a special type of a discrete-time Markov which we simulated numerically for the different transition probabilities and the number of elements in the array. We show that the time evolution of the array exhibits a wide scale of behavior depending on the value of the total number of its elements and on the logistic constant a. We point out that this problem can be applied for description of a spin system with a certain type of mean field and of the multispecies ecosystems with an internal noise. (authors)

  16. Survival and compound nucleus probability of super heavy element Z = 117

    Energy Technology Data Exchange (ETDEWEB)

    Manjunatha, H.C. [Government College for Women, Department of Physics, Kolar, Karnataka (India); Sridhar, K.N. [Government First grade College, Department of Physics, Kolar, Karnataka (India)

    2017-05-15

    As a part of a systematic study for predicting the most suitable projectile-target combinations for heavy-ion fusion experiments in the synthesis of {sup 289-297}Ts, we have calculated the transmission probability (T{sub l}), compound nucleus formation probabilities (P{sub CN}) and survival probability (P{sub sur}) of possible projectile-target combinations. We have also studied the fusion cross section, survival cross section and fission cross sections for different projectile-target combination of {sup 289-297}Ts. These theoretical parameters are required before the synthesis of the super heavy element. The calculated probabilities and cross sections show that the production of isotopes of the super heavy element with Z = 117 is strongly dependent on the reaction systems. The most probable reactions to synthetize the super heavy nuclei {sup 289-297}Ts are worked out and listed explicitly. We have also studied the variation of P{sub CN} and P{sub sur} with the mass number of projectile and target nuclei. This work is useful in the synthesis of the super heavy element Z = 117. (orig.)

  17. Gamow-Teller matrix elements from 00 ( p,n) cross section

    International Nuclear Information System (INIS)

    Goodman, C.D.; Goulding, C.A.; Greenfield, M.B.; Rapaport, J.; Bainum, D.E.; Foster, C.C.; Love, W.G.; Petrovich, F.

    1980-01-01

    After simple corrections for distortion effects, 120-MeV, 0 0 (p,n) cross sections are found to be proportional to the squares of the corresponding Fermi and Gamow-Teller matrix elements extracted from β-decay measurements. It is suggested that this proportionality can be used to extract Gamow-Teller matrix elements for transitions inaccessible to β decay

  18. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  19. Rules for matrix element evaluations in JWKB approximation

    International Nuclear Information System (INIS)

    Giler, S.

    1990-01-01

    Using the properties of the so-called fundamental solutions to the one-dimensional Schroedinger equation having Froeman and Froeman form the rules are formulated which allow one to evaluate matrix elements in the JWKB approximation and its generalizations. The rules apply to operators M(x, d/dx), M being polynomial functions of their arguments. The applicability of the rules depends on the properties of the so-called canonical indices introduced in this paper. The canonical indices are global characteristics of underlying Stokes graphs. If sufficiently small in comparison with unity they allow one to apply safely the JWKB approximation within the so-called ε-reduced canonical domains of a given Stokes graph. The Oth canonical index for the nth energy level Stokes graph corresponding to the harmonic oscillator potential is found to be ε CAN = 0.678/(2n+1). If the application of the rules is allowed then approximated matrix elements are obtained in an unambiguous way and with an accuracy controlled by corresponding canonical indices. Several examples of matrix elements are considered to illustrate how the rules should be used. Limitations to the rules are also discussed with the aid of suitably chosen examples. (author)

  20. Rigorous constraints on the matrix elements of the energy–momentum tensor

    Directory of Open Access Journals (Sweden)

    Peter Lowdon

    2017-11-01

    Full Text Available The structure of the matrix elements of the energy–momentum tensor play an important role in determining the properties of the form factors A(q2, B(q2 and C(q2 which appear in the Lorentz covariant decomposition of the matrix elements. In this paper we apply a rigorous frame-independent distributional-matching approach to the matrix elements of the Poincaré generators in order to derive constraints on these form factors as q→0. In contrast to the literature, we explicitly demonstrate that the vanishing of the anomalous gravitomagnetic moment B(0 and the condition A(0=1 are independent of one another, and that these constraints are not related to the specific properties or conservation of the individual Poincaré generators themselves, but are in fact a consequence of the physical on-shell requirement of the states in the matrix elements and the manner in which these states transform under Poincaré transformations.

  1. Analytic vibrational matrix elements for diatomic molecules

    International Nuclear Information System (INIS)

    Bouanich, J.P.; Ogilvie, J.F.; Tipping, R.H.

    1986-01-01

    The vibrational matrix elements and expectation values for a diatomic molecule, including the rotational dependence, are calculated for powers of the reduced displacement in terms of the parameters of the Dunham potential-energy function. (orig.)

  2. Survival and compound nucleus probability of super heavy element Z = 117

    International Nuclear Information System (INIS)

    Manjunatha, H.C.; Sridhar, K.N.

    2017-01-01

    As a part of a systematic study for predicting the most suitable projectile-target combinations for heavy-ion fusion experiments in the synthesis of "2"8"9"-"2"9"7Ts, we have calculated the transmission probability (T_l), compound nucleus formation probabilities (P_C_N) and survival probability (P_s_u_r) of possible projectile-target combinations. We have also studied the fusion cross section, survival cross section and fission cross sections for different projectile-target combination of "2"8"9"-"2"9"7Ts. These theoretical parameters are required before the synthesis of the super heavy element. The calculated probabilities and cross sections show that the production of isotopes of the super heavy element with Z = 117 is strongly dependent on the reaction systems. The most probable reactions to synthetize the super heavy nuclei "2"8"9"-"2"9"7Ts are worked out and listed explicitly. We have also studied the variation of P_C_N and P_s_u_r with the mass number of projectile and target nuclei. This work is useful in the synthesis of the super heavy element Z = 117. (orig.)

  3. The Matrix Element Method at Next-to-Leading Order

    OpenAIRE

    Campbell, John M.; Giele, Walter T.; Williams, Ciaran

    2012-01-01

    This paper presents an extension of the matrix element method to next-to-leading order in perturbation theory. To accomplish this we have developed a method to calculate next-to-leading order weights on an event-by-event basis. This allows for the definition of next-to-leading order likelihoods in exactly the same fashion as at leading order, thus extending the matrix element method to next-to-leading order. A welcome by-product of the method is the straightforward and efficient generation of...

  4. Stochastic Stability for Time-Delay Markovian Jump Systems with Sector-Bounded Nonlinearities and More General Transition Probabilities

    Directory of Open Access Journals (Sweden)

    Dan Ye

    2013-01-01

    Full Text Available This paper is concerned with delay-dependent stochastic stability for time-delay Markovian jump systems (MJSs with sector-bounded nonlinearities and more general transition probabilities. Different from the previous results where the transition probability matrix is completely known, a more general transition probability matrix is considered which includes completely known elements, boundary known elements, and completely unknown ones. In order to get less conservative criterion, the state and transition probability information is used as much as possible to construct the Lyapunov-Krasovskii functional and deal with stability analysis. The delay-dependent sufficient conditions are derived in terms of linear matrix inequalities to guarantee the stability of systems. Finally, numerical examples are exploited to demonstrate the effectiveness of the proposed method.

  5. Glueball Spectrum and Matrix Elements on Anisotropic Lattices

    Energy Technology Data Exchange (ETDEWEB)

    Y. Chen; A. Alexandru; S.J. Dong; T. Draper; I. Horvath; F.X. Lee; K.F. Liu; N. Mathur; C. Morningstar; M. Peardon; S. Tamhankar; B.L. Young; J.B. Zhang

    2006-01-01

    The glueball-to-vacuum matrix elements of local gluonic operators in scalar, tensor, and pseudoscalar channels are investigated numerically on several anisotropic lattices with the spatial lattice spacing ranging from 0.1fm - 0.2fm. These matrix elements are needed to predict the glueball branching ratios in J/{psi} radiative decays which will help identify the glueball states in experiments. Two types of improved local gluonic operators are constructed for a self-consistent check and the finite volume effects are studied. We find that lattice spacing dependence of our results is very weak and the continuum limits are reliably extrapolated, as a result of improvement of the lattice gauge action and local operators. We also give updated glueball masses with various quantum numbers.

  6. Representation of the Coulomb Matrix Elements by Means of Appell Hypergeometric Function F 2

    Science.gov (United States)

    Bentalha, Zine el abidine

    2018-06-01

    Exact analytical representation for the Coulomb matrix elements by means of Appell's double series F 2 is derived. The finite sum obtained for the Appell function F 2 allows us to evaluate explicitly the matrix elements of the two-body Coulomb interaction in the lowest Landau level. An application requiring the matrix elements of Coulomb potential in quantum Hall effect regime is presented.

  7. Nuclear Matrix Elements for the $\\beta\\beta$ Decay of the $^{76}$Ge

    CERN Document Server

    Brown, B A; Horoi, M

    2015-01-01

    The nuclear matrix elements for two-neutrino double-beta (2 n$\\beta\\beta$ ) and zero-neutrino double-beta (0 n$\\beta\\beta$) decay of 76 Ge are evaluated in terms of the configuration interaction (CI), quasiparticle random phase approximation (QRPA) and interacting boson model (IBM) methods. We show that the decomposition of the matrix elements in terms of interemediate states in 74 Ge is dominated by ground state of this nucleus. We consider corrections to the CI results that arise from configurations admixtures involving orbitals out-side of the CI configuration space by using results from QRPA, many-body-perturbation theory, and the connections to related observables. The CI two-neutrino matrix element is reduced due to the inclusion of spin-orbit partners, and to many-body correlations connected with Gamow-Teller beta decay. The CI zero-neutrino matrix element for the heavy neutrino is enhanced due to particle-particle correlations that are connected with the odd-even oscillations in the nuclear masse...

  8. Hadronic matrix elements in the QCD on the lattice

    International Nuclear Information System (INIS)

    Altmeyer, R.

    1995-01-01

    The work describes a lattice simulation of full QCD with dynamical Kogut-Susskind fermions. We evaluated different hadronic matrix elements which are related to the static and low-energy behaviour of hadrons. The analysis was performed on a 16 3 x 24 lattice with a coupling constant of β = 5.35 and a quark mass of m = 0.010. The calculations are based on a set of 85 configurations created by using a Hybrid-Monte-Carlo algorithm. First we evaluated the mass and energy spectrum of the low-lying hadrons using local operators as well as non-local operators. As the complete spectrum of the different pion and ρ meson lattice representations has been calculated we were able to check the restoration of continuum flavor symmetry. Moreover, the determination of energies E of hadron states with non-vanishing momentum vector q made it possible to investigate the lattice dispersion function E( vector q). Another part of the presented work is the determination of mesonic decay constants which parameterise the weak decay of mesons. They are related to hadronic matrix elements of the respective quark currents and through the calculation of these matrix elements we were able to determine the decay constants f π and f ρ . Before doing so, we calculated non-perturbatively renormalization constants for the currents under consideration. The next part is the determination of hadronic coupling constants. These parameterise in an effective low-energy model the interactions of different hadrons. They are related to hadronic matrix elements whose lattice calculation can be dpme bu evaluating 3-point correlation functions. Thus we evaluted the hadronic coupling constants g ρππ and g NNπ . Finally, an investigation of the pion-nucleon σterm was done. The σterm is defined through a hadronic matrix element of a quark-antiquark operator and can thus be evaluated on the lattice via the calculation of a 3-point correlation function. As we determined the connected and the disconnected

  9. Hierarchy of Poisson brackets for elements of a scattering matrix

    International Nuclear Information System (INIS)

    Konopelchenko, B.G.; Dubrovsky, V.G.

    1984-01-01

    The infinite family of Poisson brackets [Ssub(i1k1) (lambda 1 ), Ssub(i2k2) (lambda 2 )]sub(n) (n=0, 1, 2, ...) between the elements of a scattering matrix is calculated for the linear matrix spectral problem. (orig.)

  10. Axial-Current Matrix Elements in Light Nuclei from Lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Savage, Martin [Univ. of Washington, Seattle, WA (United States); Shanahan, Phiala E. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Tiburzi, Brian C. [Univ. of Maryland, College Park, MD (United States); Wagman, Michael L. [Univ. of Washington, Seattle, WA (United States); Winter, Frank T. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Beane, Silas [Univ. of New Hampshire, Durham, NH (United States); Chang, Emmanuel [Univ. of Washington, Seattle, WA (United States); Davoudi, Zohreh; Detmold, William [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Orginos, Konstantinos [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); College of William and Mary, Williamsburg, VA (United States)

    2016-12-01

    I present results from the first lattice QCD calculations of axial-current matrix elements in light nuclei, performed by the NPLQCD collaboration. Precision calculations of these matrix elements, and the subsequent extraction of multi-nucleon axial-current operators, are essential in refining theoretical predictions of the proton-proton fusion cross section, neutrino-nucleus cross sections and $\\beta\\beta$-decay rates of nuclei. In addition, they are expected to shed light on the phenomenological quenching of $g_A$ that is required in nuclear many-body calculations.

  11. The probability that a pair of group elements is autoconjugate

    Indian Academy of Sciences (India)

    Let and ℎ be arbitrary elements of a given finite group . Then and ℎ are said to be autoconjugate if there exists some automorphism of such that ℎ = . In this article, we construct some sharp bounds for the probability that two random elements of are autoconjugate, denoted by P a ( G ) . It is also shown that P ...

  12. Optimization of Coil Element Configurations for a Matrix Gradient Coil.

    Science.gov (United States)

    Kroboth, Stefan; Layton, Kelvin J; Jia, Feng; Littin, Sebastian; Yu, Huijun; Hennig, Jurgen; Zaitsev, Maxim

    2018-01-01

    Recently, matrix gradient coils (also termed multi-coils or multi-coil arrays) were introduced for imaging and B 0 shimming with 24, 48, and even 84 coil elements. However, in imaging applications, providing one amplifier per coil element is not always feasible due to high cost and technical complexity. In this simulation study, we show that an 84-channel matrix gradient coil (head insert for brain imaging) is able to create a wide variety of field shapes even if the number of amplifiers is reduced. An optimization algorithm was implemented that obtains groups of coil elements, such that a desired target field can be created by driving each group with an amplifier. This limits the number of amplifiers to the number of coil element groups. Simulated annealing is used due to the NP-hard combinatorial nature of the given problem. A spherical harmonic basis set up to the full third order within a sphere of 20-cm diameter in the center of the coil was investigated as target fields. We show that the median normalized least squares error for all target fields is below approximately 5% for 12 or more amplifiers. At the same time, the dissipated power stays within reasonable limits. With a relatively small set of amplifiers, switches can be used to sequentially generate spherical harmonics up to third order. The costs associated with a matrix gradient coil can be lowered, which increases the practical utility of matrix gradient coils.

  13. Analytic vibration-rotational matrix elements for diatomic molecules

    International Nuclear Information System (INIS)

    Bouanich, J.P.

    1987-01-01

    The vibration-rotational matrix elements for infrared or Raman transitions vJ → v'J' of diatomic molecules are calculated for powers of the reduced displacement X from parameters of the Dunham potential-energy function. (orig.)

  14. Empirical Coulomb matrix elements and the mass of 22Al

    International Nuclear Information System (INIS)

    Whitehead, R.R.; Watt, A.; Kelvin, D.; Rutherford, H.J.

    1976-01-01

    An attempt has been made to obtain a set of Coulomb matrix elements which fit the known Coulomb energy shifts in the nuclei of mass 18 to 22. The interaction obtained fits the data well with only a few exceptions, one of these being the Coulomb shift of the notorious third 0 + state in 18 Ne. These Coulomb matrix elements are used together with the Chung-Wildenthal interaction to obtain a new prediction for the mass excess of 22 Al. The results indicate that 22 Al should be bound against proton emission. (Auth.)

  15. Single-particle Glauber matrix elements

    International Nuclear Information System (INIS)

    Oset, E.; Strottman, D.

    1983-01-01

    The single-particle matrix elements of the Glauber profile function are tabulated for harmonic oscillator single-particle wave functions. The tables are presented in such a manner as to be applicable if the hadron--nucleon elementary scattering amplitude is specified by either a partial wave expansion or a Gaussian in momentum transfer squared. The table is complete through the 1 g/sub 9/2/ orbital and contains entries for the 3s/sub 1/2/ orbital for use if realistic wave functions are expanded in terms of harmonic oscillator functions

  16. Camera-Model Identification Using Markovian Transition Probability Matrix

    Science.gov (United States)

    Xu, Guanshuo; Gao, Shang; Shi, Yun Qing; Hu, Ruimin; Su, Wei

    Detecting the (brands and) models of digital cameras from given digital images has become a popular research topic in the field of digital forensics. As most of images are JPEG compressed before they are output from cameras, we propose to use an effective image statistical model to characterize the difference JPEG 2-D arrays of Y and Cb components from the JPEG images taken by various camera models. Specifically, the transition probability matrices derived from four different directional Markov processes applied to the image difference JPEG 2-D arrays are used to identify statistical difference caused by image formation pipelines inside different camera models. All elements of the transition probability matrices, after a thresholding technique, are directly used as features for classification purpose. Multi-class support vector machines (SVM) are used as the classification tool. The effectiveness of our proposed statistical model is demonstrated by large-scale experimental results.

  17. QCD event generators with next-to-leading order matrix-elements and parton showers

    International Nuclear Information System (INIS)

    Kurihara, Y.; Fujimoto, J.; Ishikawa, T.; Kato, K.; Kawabata, S.; Munehisa, T.; Tanaka, H.

    2003-01-01

    A new method to construct event-generators based on next-to-leading order QCD matrix-elements and leading-logarithmic parton showers is proposed. Matrix elements of loop diagram as well as those of a tree level can be generated using an automatic system. A soft/collinear singularity is treated using a leading-log subtraction method. Higher order resummation of the soft/collinear correction by the parton shower method is combined with the NLO matrix-element without any double-counting in this method. An example of the event generator for Drell-Yan process is given for demonstrating a validity of this method

  18. Matrix elements of Δ B =0 operators in heavy hadron chiral perturbation theory

    Science.gov (United States)

    Lee, Jong-Wan

    2015-05-01

    We study the light-quark mass and spatial volume dependence of the matrix elements of Δ B =0 four-quark operators relevant for the determination of Vu b and the lifetime ratios of single-b hadrons. To this end, one-loop diagrams are computed in the framework of heavy hadron chiral perturbation theory with partially quenched formalism for three light-quark flavors in the isospin limit; flavor-connected and -disconnected diagrams are carefully analyzed. These calculations include the leading light-quark flavor and heavy-quark spin symmetry breaking effects in the heavy hadron spectrum. Our results can be used in the chiral extrapolation of lattice calculations of the matrix elements to the physical light-quark masses and to infinite volume. To provide insight on such chiral extrapolation, we evaluate the one-loop contributions to the matrix elements containing external Bd, Bs mesons and Λb baryon in the QCD limit, where sea and valence quark masses become equal. In particular, we find that the matrix elements of the λ3 flavor-octet operators with an external Bd meson receive the contributions solely from connected diagrams in which current lattice techniques are capable of precise determination of the matrix elements. Finite volume effects are at most a few percent for typical lattice sizes and pion masses.

  19. The effects of flavour symmetry breaking on hadron matrix elements

    International Nuclear Information System (INIS)

    Cooke, A.N.; Horsley, R.; Pleiter, D.; Zanotti, J.M.

    2012-12-01

    By considering a flavour expansion about the SU(3)-flavour symmetric point, we investigate how flavour-blindness constrains octet baryon matrix elements after SU(3) is broken by the mass difference between the strange and light quarks. We find the expansions to be highly constrained along a mass trajectory where the singlet quark mass is held constant, which proves beneficial for extrapolations of 2+1 flavour lattice data to the physical point. We investigate these effects numerically via a lattice calculation of the flavour-conserving and flavour-changing matrix elements of the vector and axial operators between octet baryon states.

  20. The effects of flavour symmetry breaking on hadron matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Cooke, A.N.; Horsley, R. [Edinburgh Univ. (United Kingdom). School of Physics and Astronomy; Nakamura, Y. [RIKEN Advanced Institute for Computational Science, Kobe (Japan); Pleiter, D. [Juelich Research Centre (Germany); Regensburg Univ. (Germany). Institut fuer Theoretische Physik; Rakow, P.E.L. [Liverpool Univ. (United Kingdom). Theoretical Physics Division; Schierholz, G. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Zanotti, J.M. [Adelaide Univ. (Australia). School of Chemistry and Physics

    2012-12-15

    By considering a flavour expansion about the SU(3)-flavour symmetric point, we investigate how flavour-blindness constrains octet baryon matrix elements after SU(3) is broken by the mass difference between the strange and light quarks. We find the expansions to be highly constrained along a mass trajectory where the singlet quark mass is held constant, which proves beneficial for extrapolations of 2+1 flavour lattice data to the physical point. We investigate these effects numerically via a lattice calculation of the flavour-conserving and flavour-changing matrix elements of the vector and axial operators between octet baryon states.

  1. Gap probabilities for edge intervals in finite Gaussian and Jacobi unitary matrix ensembles

    International Nuclear Information System (INIS)

    Witte, N.S.; Forrester, P.J.

    1999-01-01

    The probabilities for gaps in the eigenvalue spectrum of the finite dimension N x N random matrix Hermite and Jacobi unitary ensembles on some single and disconnected double intervals are found. These are cases where a reflection symmetry exists and the probability factors into two other related probabilities, defined on single intervals. Our investigation uses the system of partial differential equations arising from the Fredholm determinant expression for the gap probability and the differential-recurrence equations satisfied by Hermite and Jacobi orthogonal polynomials. In our study we find second and third order nonlinear ordinary differential equations defining the probabilities in the general N case, specific explicit solutions for N = 1 and N = 2, asymptotic expansions, scaling at the edge of the Hermite spectrum as N →∞ and the Jacobi to Hermite limit both of which make correspondence to other cases reported here or known previously. (authors)

  2. A collocation finite element method with prior matrix condensation

    International Nuclear Information System (INIS)

    Sutcliffe, W.J.

    1977-01-01

    For thin shells with general loading, sixteen degrees of freedom have been used for a previous finite element solution procedure using a Collocation method instead of the usual variational based procedures. Although the number of elements required was relatively small, nevertheless the final matrix for the simultaneous solution of all unknowns could become large for a complex compound structure. The purpose of the present paper is to demonstrate a method of reducing the final matrix size, so allowing solution for large structures with comparatively small computer storage requirements while retaining the accuracy given by high order displacement functions. Collocation points, a number are equilibrium conditions which must be satisfied independently of the overall compatibility of forces and deflections for a complete structure. (Auth.)

  3. Analytic Expression of Arbitrary Matrix Elements for Boson Exponential Quadratic Polynomial Operators

    Institute of Scientific and Technical Information of China (English)

    XU Xiu-Wei; REN Ting-Qi; LIU Shu-Yan; MA Qiu-Ming; LIU Sheng-Dian

    2007-01-01

    Making use of the transformation relation among usual, normal, and antinormal ordering for the multimode boson exponential quadratic polynomial operators (BEQPO's), we present the analytic expression of arbitrary matrix elements for BEQPO's. As a preliminary application, we obtain the exact expressions of partition function about the boson quadratic polynomial system, matrix elements in particle-number, coordinate, and momentum representation, and P representation for the BEQPO's.

  4. Matrix elements of intraband transitions in quantum dot intermediate band solar cells: the influence of quantum dot presence on the extended-state electron wave-functions

    International Nuclear Information System (INIS)

    Nozawa, Tomohiro; Arakawa, Yasuhiko

    2014-01-01

    The intraband transitions which are essential for quantum dot intermediate band solar cells (QD IBSCs) are theoretically investigated by estimating the matrix elements from a ground bound state, which is often regarded as an intermediate band (IB), to conduction band (CB) states for a structure with a quantum dot (QD) embedded in a matrix (a QD/matrix structure). We have found that the QD pushes away the electron envelope functions (probability densities) from the QD region in almost all quantum states above the matrix CB minimum. As a result, the matrix elements of the intraband transitions in the QD/matrix structure are largely reduced, compared to those calculated assuming the envelope functions of free electrons (i.e., plane-wave envelope functions) in a matrix structure as the final states of the intraband transitions. The result indicates the strong influence of the QD itself on the intraband transitions from the IB to the CB states in QD IBSC devices. This work will help in better understanding the problem of the intraband transitions and give new insight, that is, engineering of quantum states is indispensable for the realization of QD IBSCs with high solar energy conversion efficiencies. (paper)

  5. Radiation and penetration matrix elements for magnetic quadrupole transitions between Nilsson states in odd nuclei

    International Nuclear Information System (INIS)

    Feresin, A.P.; Guseva, I.S.

    1984-01-01

    Single-particle matrix elements for magnetic quadrupole gamma radiation in odd deformed nuclei, calculated with the aid of Nilsson-potential wave functions, are presented. Also given are the internal conversion penetration matrix elements, calculated in the same manner. The penetration matrix elements are needed to estimate the nuclear penetration parameter, which determines the deviation of experimental internal conversion coefficients from their standard values given in tables. Matrix elements are given for transitions between all pairs of Nilsson single-particle states with ΔN = 1 and ΔK = 0, 1, and 2 for the nuclear shells with 4< or =N< or =7 and for the two deformation values epsilon = 0.2 and 0.3

  6. Nucleon matrix elements using the variational method in lattice QCD

    International Nuclear Information System (INIS)

    Dragos, J.; Kamleh, W.; Leinweber, D.B.; Zanotti, J.M.; Rakow, P.E.L.; Young, R.D.; Adelaide Univ., SA

    2016-06-01

    The extraction of hadron matrix elements in lattice QCD using the standard two- and threepoint correlator functions demands careful attention to systematic uncertainties. One of the most commonly studied sources of systematic error is contamination from excited states. We apply the variational method to calculate the axial vector current g_A, the scalar current g_S and the quark momentum fraction left angle x right angle of the nucleon and we compare the results to the more commonly used summation and two-exponential fit methods. The results demonstrate that the variational approach offers a more efficient and robust method for the determination of nucleon matrix elements.

  7. Inert matrix fuel in dispersion type fuel elements

    Energy Technology Data Exchange (ETDEWEB)

    Savchenko, A.M. [A.A. Bochvar All-Russia Research Institute of Inorganic Materials (VNIINM) 123060, P.O. Box 369, Rogova Street, 5A, Moscow (Russian Federation)]. E-mail: sav@bochvar.ru; Vatulin, A.V. [A.A. Bochvar All-Russia Research Institute of Inorganic Materials (VNIINM) 123060, P.O. Box 369, Rogova Street, 5A, Moscow (Russian Federation); Morozov, A.V. [A.A. Bochvar All-Russia Research Institute of Inorganic Materials (VNIINM) 123060, P.O. Box 369, Rogova Street, 5A, Moscow (Russian Federation); Sirotin, V.L. [A.A. Bochvar All-Russia Research Institute of Inorganic Materials (VNIINM) 123060, P.O. Box 369, Rogova Street, 5A, Moscow (Russian Federation); Dobrikova, I.V. [A.A. Bochvar All-Russia Research Institute of Inorganic Materials (VNIINM) 123060, P.O. Box 369, Rogova Street, 5A, Moscow (Russian Federation); Kulakov, G.V. [A.A. Bochvar All-Russia Research Institute of Inorganic Materials (VNIINM) 123060, P.O. Box 369, Rogova Street, 5A, Moscow (Russian Federation); Ershov, S.A. [A.A. Bochvar All-Russia Research Institute of Inorganic Materials (VNIINM) 123060, P.O. Box 369, Rogova Street, 5A, Moscow (Russian Federation); Kostomarov, V.P. [A.A. Bochvar All-Russia Research Institute of Inorganic Materials (VNIINM) 123060, P.O. Box 369, Rogova Street, 5A, Moscow (Russian Federation); Stelyuk, Y.I. [A.A. Bochvar All-Russia Research Institute of Inorganic Materials (VNIINM) 123060, P.O. Box 369, Rogova Street, 5A, Moscow (Russian Federation)

    2006-06-30

    The advantages of using inert matrix fuel (IMF) as a dispersion fuel in an aluminium alloy matrix are considered, in particular, low temperatures in the fuel centre, achievable high burn-ups, serviceability in transients and an environmentally friendly process of fuel rod fabrication. Two main versions of IMF are under development at A.A. Bochvar Institute, i.e. heterogeneous or isolated distribution of plutonium. The out-of-pile results on IMF loaded with uranium dioxide as plutonium simulator are presented. Fuel elements with uranium dioxide composition fabricated at A.A. Bochvar Institute are currently under MIR tests (RIAR, Dimitrovgrad). The fuel elements reached a burn-up of 88 MW d kg{sup -1} (equivalent to the burn up of the standard uranium dioxide pelletized fuel) without loss of leak-tightness of the cladding. The feasibility of fabricating IMF of these particular types with plutonium dioxide is considered with a view to in-pile irradiation.

  8. Inert matrix fuel in dispersion type fuel elements

    Science.gov (United States)

    Savchenko, A. M.; Vatulin, A. V.; Morozov, A. V.; Sirotin, V. L.; Dobrikova, I. V.; Kulakov, G. V.; Ershov, S. A.; Kostomarov, V. P.; Stelyuk, Y. I.

    2006-06-01

    The advantages of using inert matrix fuel (IMF) as a dispersion fuel in an aluminium alloy matrix are considered, in particular, low temperatures in the fuel centre, achievable high burn-ups, serviceability in transients and an environmentally friendly process of fuel rod fabrication. Two main versions of IMF are under development at A.A. Bochvar Institute, i.e. heterogeneous or isolated distribution of plutonium. The out-of-pile results on IMF loaded with uranium dioxide as plutonium simulator are presented. Fuel elements with uranium dioxide composition fabricated at A.A. Bochvar Institute are currently under MIR tests (RIAR, Dimitrovgrad). The fuel elements reached a burn-up of 88 MW d kg-1 (equivalent to the burn up of the standard uranium dioxide pelletized fuel) without loss of leak-tightness of the cladding. The feasibility of fabricating IMF of these particular types with plutonium dioxide is considered with a view to in-pile irradiation.

  9. Scattering-matrix elements of coated infinite-length cylinders

    International Nuclear Information System (INIS)

    Manickavasagam, S.; Menguec, M.P.

    1998-01-01

    The angular variations of scattering-matrix elements of coated cylindrical particles are presented. The sensitivity of different elements for a number of physical parameters are discussed, including size parameter, real and imaginary parts of the refractive index of the outer coat, and the inner core. The numerical predictions are presented for typical index-of-refraction values of cotton fibers. These results show that the physical structure of coated cylinders can be determined from carefully conducted light-scattering experiments. copyright 1998 Optical Society of America

  10. Structure of nuclear transition matrix elements for neutrinoless ...

    Indian Academy of Sciences (India)

    Abstract. The structure of nuclear transition matrix elements (NTMEs) required for the study of neutrinoless double- decay within light Majorana neutrino mass mechanism is disassembled in the PHFB model. The NTMEs are calculated using a set of HFB intrinsic wave functions, the reliability of which has been previously ...

  11. Bag-model matrix elements of the parity-violating weak hamiltonian for charmed baryons

    International Nuclear Information System (INIS)

    Ebert, D.; Kallies, W.

    1983-01-01

    Baryon matrix elements of the parity-violating part of the charmchanging weak Hamiltonian might be significant and comparable with those of the parity-conserving one due to large symmetry breaking. Expression for these new matrix elements by using the MIT-bag model are derived and their implications on earlier calculations of nonleptonic charmed-baryon decays are estimated

  12. Hadron matrix elements of quark operators in the relativistic quark model, 2. Model calculation

    Energy Technology Data Exchange (ETDEWEB)

    Arisue, H; Bando, M; Toya, M [Kyoto Univ. (Japan). Dept. of Physics; Sugimoto, H

    1979-11-01

    Phenomenological studies of the matrix elements of two- and four-quark operators are made on the basis of relativistic independent quark model for typical three cases of the potentials: rigid wall, linearly rising and Coulomb-like potentials. The values of the matrix elements of two-quark operators are relatively well reproduced in each case, but those of four-quark operators prove to be too small in the independent particle treatment. It is suggested that the short-range two-quark correlations must be taken into account in order to improve the values of the matrix elements of the four-quark operators.

  13. Measurement of the matrix elements for the decays η'→η π+π- and η'→η π0π0

    Science.gov (United States)

    Ablikim, M.; Achasov, M. N.; Ahmed, S.; Albrecht, M.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Bai, Y.; Bakina, O.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chai, J.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dorjkhaidav, O.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Farinelli, R.; Fava, L.; Fegan, S.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, Y.; Gao, Y. G.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, S.; Gu, Y. T.; Guo, A. Q.; Guo, L. B.; Guo, R. P.; Guo, Y. P.; Haddadi, Z.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, X. Z.; Huang, Z. L.; Hussain, T.; Ikegami Andersson, W.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Jin, Y.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Khan, T.; Khoukaz, A.; Kiese, P.; Kliemt, R.; Koch, L.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuemmel, M.; Kuhlmann, M.; Kupsc, A.; Kühn, W.; Lange, J. S.; Lara, M.; Larin, P.; Lavezzi, L.; Leithoff, H.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, K. J.; Li, Lei; Li, P. L.; Li, P. R.; Li, Q. Y.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, Ke; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Long, Y. F.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Magnoni, A. S.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Meng, Z. X.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Morello, G.; Muchnoi, N. Yu.; Muramatsu, H.; Mustafa, A.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Papenbrock, M.; Patteri, P.; Pelizaeus, M.; Pellegrino, J.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, N.; Qin, X.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Richter, M.; Ripka, M.; Rolo, M.; Rong, G.; Rosner, Ch.; Ruan, X. D.; Sarantsev, A.; Savrié, M.; Schnier, C.; Schoenning, K.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Song, J. J.; Song, W. M.; Song, X. Y.; Sosio, S.; Sowa, C.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, L.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. K.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, G. Y.; Tang, X.; Tapan, I.; Tiemens, M.; Tsednee, B. T.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, Dan; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Y. J.; Xiao, Z. J.; Xie, Y. G.; Xie, Y. H.; Xiong, X. A.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. H.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; You, Z. Y.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhou, Y. X.; Zhu, J.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.; Besiii Collaboration

    2018-01-01

    Based on a sample of 1.31 ×109 J /ψ events collected with the BESIII detector, the matrix elements for the decays η'→η π+π- and η'→η π0π0 are determined using 351,016 η'→(η →γ γ )π+π- and 56,249 η'→(η →γ γ )π0π0 events with background levels less than 1%. Two commonly used representations are used to describe the Dalitz plot density. We find that an assumption of a linear amplitude does not describe the data well. A small deviation of the obtained matrix elements between η'→η π+π- and η'→η π0π0 is probably caused by the mass difference between charged and neutral pions or radiative corrections. No cusp structure in η'→η π0π0 is observed.

  14. Structure of nuclear transition matrix elements for neutrinoless ...

    Indian Academy of Sciences (India)

    Abstract. The structure of nuclear transition matrix elements (NTMEs) required for the study of neutrinoless double-β decay within light Majorana neutrino mass mechanism is disassembled in the PHFB model. The NTMEs are calculated using a set of HFB intrinsic wave functions, the reliability of which has been previously ...

  15. A Literature Study of Matrix Element Influenced to the Result of Analysis Using Absorption Atomic Spectroscopy Method (AAS)

    International Nuclear Information System (INIS)

    Tyas-Djuhariningrum

    2004-01-01

    The gold sample analysis can be deviated more than >10% to those thrue value caused by the matrix element. So that the matrix element character need to be study in order to reduce the deviation. In rock samples, the matrix elements can cause self quenching, self absorption and ionization process, so there is a result analysis error. In the rock geochemical process, the elements of the same group at the periodic system have the tendency to be together because of their same characteristic. In absorption Atomic Spectroscopy analysis, the elements associate can absorb primer energy with similar wave length so that it can cause deviation in the result interpretation. The aim of study is to predict matrix element influences from rock sample with application standard method for reducing deviation. In quantitative way, assessment of primer light intensity that will be absorbed is proportional to the concentration atom in the sample that relationship between photon intensity with concentration in part per million is linier (ppm). These methods for eliminating matrix elements influence consist of three methods : external standard method, internal standard method, and addition standard method. External standard method for all matrix element, internal standard method for elimination matrix element that have similar characteristics, addition standard methods for elimination matrix elements in Au, Pt samples. The third of standard posess here accuracy are about 95-97%. (author)

  16. Matrix elements of u and p for the modified Poeschl-Teller potential

    International Nuclear Information System (INIS)

    Gomez-Camacho, J; Lemus, R; Arias, J M

    2004-01-01

    Closed analytical expressions in terms of a single sum are obtained for the matrix elements of the momentum and the natural variable u tanh(αx) in the basis of the modified Poeschl-Teller (MPT) bound eigenstates. These matrix elements are first expressed in terms of Franck-Condon factors, which thereafter are substituted for analytic expressions. Expansions of the variables p and u in terms of creation and annihilation operators associated with the MPT bound eigenfunctions are also presented

  17. Composition Feature of the Element Tangent Stiffness Matrix of Geometrically Nonlinear 2D Frame Structures

    Directory of Open Access Journals (Sweden)

    Romanas Karkauskas

    2011-04-01

    Full Text Available The expressions of the finite element method tangent stiffness matrix of geometrically nonlinear constructions are not fully presented in publications. The matrixes of small displacements stiffness are usually presented only. To solve various problems of construction analysis or design and to specify the mode of the real deflection of construction, it is necessary to have a fully described tangent matrix analytical expression. This paper presents a technique of tangent stiffness matrix generation using discrete body total potential energy stationary conditions considering geometrically nonlinear 2D frame element taking account of interelement interaction forces only. The obtained vector-function derivative of internal forces considering nodal displacements is the tangent stiffness matrix. The analytical expressions having nodal displacements of matrixes forming the content of the 2D frame construction element tangent stiffness matrix are presented in the article. The suggested methodology has been checked making symbolical calculations in the medium of MatLAB calculation complex. The analytical expression of the stiffness matrix has been obtained.Article in Lithuanian

  18. Matrix elements of Yale potential and level properties of light nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, N; Prakash, O [Delhi Univ. (India). Dept. of Physics and Astrophysics

    1976-07-01

    Shell model calculations using bare and renormalized matrix elements of the Yale potential are reported for the normal-parity states of A = 6-9 nuclei. Renormalization of the two-body matrix elements using second-order perturbation theory is not found to improve the agreements with the experimental data. Inclusion of the energy shifts of ground state rotational bands in /sup 8/Be and /sup 9/Be are, however, found to improve the agreements with the excitation energies of nuclear levels. The need for carrying out more calculations of these nuclei with realistic forces is pointed out.

  19. Quasi-exact evaluation of time domain MFIE MOT matrix elements

    KAUST Repository

    Shi, Yifei; Bagci, Hakan; Shanker, Balasubramaniam; Lu, Mingyu; Michielssen, Eric

    2013-01-01

    A previously proposed quasi-exact scheme for evaluating matrix elements resulting from the marching-on-in-time (MOT) discretization of the time domain electric field integral equation (EFIE) is extended to matrix entries resulting from the discretization of its magnetic field integral equation (MFIE) counterpart. Numerical results demonstrate the accuracy of the scheme as well as the late-time stability of the resulting MOT-MFIE solver. © 2013 IEEE.

  20. Quasi-exact evaluation of time domain MFIE MOT matrix elements

    KAUST Repository

    Shi, Yifei

    2013-07-01

    A previously proposed quasi-exact scheme for evaluating matrix elements resulting from the marching-on-in-time (MOT) discretization of the time domain electric field integral equation (EFIE) is extended to matrix entries resulting from the discretization of its magnetic field integral equation (MFIE) counterpart. Numerical results demonstrate the accuracy of the scheme as well as the late-time stability of the resulting MOT-MFIE solver. © 2013 IEEE.

  1. Relation between the 2{nu}{beta}{beta} and 0{nu}{beta}{beta} nuclear matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Vogel, Petr [Kellogg Radiation Laboratory, Caltech, Pasadena, CA 91125 (United States); Simkovic, Fedor [Department of Nuclear Physics and Biophysics, Comenius University, Mlynska dolina F1, SK-84248 Bratislava (Slovakia)

    2011-12-16

    A formal relation between the GT part of the nuclear matrix elements M{sub GT}{sup 0{nu}} of 0{nu}{beta}{beta} decay and the closure matrix elements M{sub cl}{sup 2{nu}} of 2{nu}{beta}{beta} decay is established. This relation is based on the integral representation of these quantities in terms of their dependence on the distance r between the two nucleons undergoing transformation. We also discuss the difficulties in determining the correct values of the closure 2{nu}{beta}{beta} decay matrix elements.

  2. Kinetic-energy matrix elements for atomic Hylleraas-CI wave functions

    Energy Technology Data Exchange (ETDEWEB)

    Harris, Frank E., E-mail: harris@qtp.ufl.edu [Department of Physics, University of Utah, Salt Lake City, Utah 84112, USA and Quantum Theory Project, University of Florida, P.O. Box 118435, Gainesville, Florida 32611 (United States)

    2016-05-28

    Hylleraas-CI is a superposition-of-configurations method in which each configuration is constructed from a Slater-type orbital (STO) product to which is appended (linearly) at most one interelectron distance r{sub ij}. Computations of the kinetic energy for atoms by this method have been difficult due to the lack of formulas expressing these matrix elements for general angular momentum in terms of overlap and potential-energy integrals. It is shown here that a strategic application of angular-momentum theory, including the use of vector spherical harmonics, enables the reduction of all atomic kinetic-energy integrals to overlap and potential-energy matrix elements. The new formulas are validated by showing that they yield correct results for a large number of integrals published by other investigators.

  3. Probability of misclassifying biological elements in surface waters.

    Science.gov (United States)

    Loga, Małgorzata; Wierzchołowska-Dziedzic, Anna

    2017-11-24

    Measurement uncertainties are inherent to assessment of biological indices of water bodies. The effect of these uncertainties on the probability of misclassification of ecological status is the subject of this paper. Four Monte-Carlo (M-C) models were applied to simulate the occurrence of random errors in the measurements of metrics corresponding to four biological elements of surface waters: macrophytes, phytoplankton, phytobenthos, and benthic macroinvertebrates. Long series of error-prone measurement values of these metrics, generated by M-C models, were used to identify cases in which values of any of the four biological indices lay outside of the "true" water body class, i.e., outside the class assigned from the actual physical measurements. Fraction of such cases in the M-C generated series was used to estimate the probability of misclassification. The method is particularly useful for estimating the probability of misclassification of the ecological status of surface water bodies in the case of short sequences of measurements of biological indices. The results of the Monte-Carlo simulations show a relatively high sensitivity of this probability to measurement errors of the river macrophyte index (MIR) and high robustness to measurement errors of the benthic macroinvertebrate index (MMI). The proposed method of using Monte-Carlo models to estimate the probability of misclassification has significant potential for assessing the uncertainty of water body status reported to the EC by the EU member countries according to WFD. The method can be readily applied also in risk assessment of water management decisions before adopting the status dependent corrective actions.

  4. Proton decay matrix elements from lattice QCD

    International Nuclear Information System (INIS)

    Aoki, Yasumichi; Shintani, Eigo

    2012-01-01

    We report on the calculation of the matrix elements of nucleon to pseudoscalar decay through a three quark operator, a part of the low-energy, four-fermion, baryon-number-violating operator originating from grand unified theories. The direct calculation of the form factors using domain-wall fermions on the lattice, incorporating the u, d and s sea-quarks effects yields the results with all the relevant systematic uncertainties controlled for the first time.

  5. On the estimation of matrix elements for optical transitions in semiconductors

    International Nuclear Information System (INIS)

    Hassan, A.R.

    1992-09-01

    A semi-empirical method is used to calculate the numerical values of the interband momentum matrix elements of the allowed optical transitions in semiconductors. This method is based on the evaluation of the ratio of the two-photon and one-photon absorption coefficients and the compare the result with the corresponding experimental values in a number of semiconductors both for direct and indirect transition processes. The numerical values of the momentum matrix elements are compared with the convenient theoretical calculations available. The result is found to agree fairly well with the corresponding values computed using the k-vector · p-vector perturbation theory. (author). 19 refs, 2 figs, 2 tabs

  6. Modelling of polypropylene fibre-matrix composites using finite element analysis

    Directory of Open Access Journals (Sweden)

    2009-01-01

    Full Text Available Polypropylene (PP fibre-matrix composites previously prepared and studied experimentally were modelled using finite element analysis (FEA in this work. FEA confirmed that fibre content and composition controlled stress distribution in all-PP composites. The stress concentration at the fibre-matrix interface became greater with less fibre content. Variations in fibre composition were more significant in higher stress regions of the composites. When fibre modulus increased, the stress concentration at the fibres decreased and the shear stress at the fibre-matrix interface became more intense. The ratio between matrix modulus and fibre modulus was important, as was the interfacial stress in reducing premature interfacial failure and increasing mechanical properties. The model demonstrated that with low fibre concentration, there were insufficient fibres to distribute the applied stress. Under these conditions the matrix yielded when the applied stress reached the matrix yield stress, resulting in increased fibre axial stress. When the fibre content was high, there was matrix depletion and stress transfer was inefficient. The predictions of the FEA model were consistent with experimental and published data.

  7. On the generalized eigenvalue method for energies and matrix elements in lattice field theory

    Energy Technology Data Exchange (ETDEWEB)

    Blossier, Benoit [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)]|[Paris-XI Univ., 91 - Orsay (France). Lab. de Physique Theorique; Morte, Michele della [CERN, Geneva (Switzerland). Physics Dept.]|[Mainz Univ. (Germany). Inst. fuer Kernphysik; Hippel, Georg von; Sommer, Rainer [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Mendes, Tereza [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)]|[Sao Paulo Univ. (Brazil). IFSC

    2009-02-15

    We discuss the generalized eigenvalue problem for computing energies and matrix elements in lattice gauge theory, including effective theories such as HQET. It is analyzed how the extracted effective energies and matrix elements converge when the time separations are made large. This suggests a particularly efficient application of the method for which we can prove that corrections vanish asymptotically as exp(-(E{sub N+1}-E{sub n}) t). The gap E{sub N+1}-E{sub n} can be made large by increasing the number N of interpolating fields in the correlation matrix. We also show how excited state matrix elements can be extracted such that contaminations from all other states disappear exponentially in time. As a demonstration we present numerical results for the extraction of ground state and excited B-meson masses and decay constants in static approximation and to order 1/m{sub b} in HQET. (orig.)

  8. On the generalized eigenvalue method for energies and matrix elements in lattice field theory

    International Nuclear Information System (INIS)

    Blossier, Benoit; Mendes, Tereza; Sao Paulo Univ.

    2009-02-01

    We discuss the generalized eigenvalue problem for computing energies and matrix elements in lattice gauge theory, including effective theories such as HQET. It is analyzed how the extracted effective energies and matrix elements converge when the time separations are made large. This suggests a particularly efficient application of the method for which we can prove that corrections vanish asymptotically as exp(-(E N+1 -E n ) t). The gap E N+1 -E n can be made large by increasing the number N of interpolating fields in the correlation matrix. We also show how excited state matrix elements can be extracted such that contaminations from all other states disappear exponentially in time. As a demonstration we present numerical results for the extraction of ground state and excited B-meson masses and decay constants in static approximation and to order 1/m b in HQET. (orig.)

  9. Maximum entropy formalism for the analytic continuation of matrix-valued Green's functions

    Science.gov (United States)

    Kraberger, Gernot J.; Triebl, Robert; Zingl, Manuel; Aichhorn, Markus

    2017-10-01

    We present a generalization of the maximum entropy method to the analytic continuation of matrix-valued Green's functions. To treat off-diagonal elements correctly based on Bayesian probability theory, the entropy term has to be extended for spectral functions that are possibly negative in some frequency ranges. In that way, all matrix elements of the Green's function matrix can be analytically continued; we introduce a computationally cheap element-wise method for this purpose. However, this method cannot ensure important constraints on the mathematical properties of the resulting spectral functions, namely positive semidefiniteness and Hermiticity. To improve on this, we present a full matrix formalism, where all matrix elements are treated simultaneously. We show the capabilities of these methods using insulating and metallic dynamical mean-field theory (DMFT) Green's functions as test cases. Finally, we apply the methods to realistic material calculations for LaTiO3, where off-diagonal matrix elements in the Green's function appear due to the distorted crystal structure.

  10. Elements of a function analytic approach to probability.

    Energy Technology Data Exchange (ETDEWEB)

    Ghanem, Roger Georges (University of Southern California, Los Angeles, CA); Red-Horse, John Robert

    2008-02-01

    We first provide a detailed motivation for using probability theory as a mathematical context in which to analyze engineering and scientific systems that possess uncertainties. We then present introductory notes on the function analytic approach to probabilistic analysis, emphasizing the connections to various classical deterministic mathematical analysis elements. Lastly, we describe how to use the approach as a means to augment deterministic analysis methods in a particular Hilbert space context, and thus enable a rigorous framework for commingling deterministic and probabilistic analysis tools in an application setting.

  11. Method of computer algebraic calculation of the matrix elements in the second quantization language

    International Nuclear Information System (INIS)

    Gotoh, Masashi; Mori, Kazuhide; Itoh, Reikichi

    1995-01-01

    An automated method by the algebraic programming language REDUCE3 for specifying the matrix elements expressed in second quantization language is presented and then applied to the case of the matrix elements in the TDHF theory. This program works in a very straightforward way by commuting the electron creation and annihilation operator (a † and a) until these operators have completely vanished from the expression of the matrix element under the appropriate elimination conditions. An improved method using singlet generators of unitary transformations in the place of the electron creation and annihilation operators is also presented. This improvement reduces the time and memory required for the calculation. These methods will make programming in the field of quantum chemistry much easier. 11 refs., 1 tab

  12. Matrix-exponential distributions in applied probability

    CERN Document Server

    Bladt, Mogens

    2017-01-01

    This book contains an in-depth treatment of matrix-exponential (ME) distributions and their sub-class of phase-type (PH) distributions. Loosely speaking, an ME distribution is obtained through replacing the intensity parameter in an exponential distribution by a matrix. The ME distributions can also be identified as the class of non-negative distributions with rational Laplace transforms. If the matrix has the structure of a sub-intensity matrix for a Markov jump process we obtain a PH distribution which allows for nice probabilistic interpretations facilitating the derivation of exact solutions and closed form formulas. The full potential of ME and PH unfolds in their use in stochastic modelling. Several chapters on generic applications, like renewal theory, random walks and regenerative processes, are included together with some specific examples from queueing theory and insurance risk. We emphasize our intention towards applications by including an extensive treatment on statistical methods for PH distribu...

  13. Google matrix analysis of DNA sequences.

    Science.gov (United States)

    Kandiah, Vivek; Shepelyansky, Dima L

    2013-01-01

    For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW). At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.

  14. Google matrix analysis of DNA sequences.

    Directory of Open Access Journals (Sweden)

    Vivek Kandiah

    Full Text Available For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW. At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.

  15. A stochastic method for computing hadronic matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrou, Constantia [Cyprus Univ., Nicosia (Cyprus). Dept. of Physics; The Cyprus Institute, Nicosia (Cyprus). Computational-based Science and Technology Research Center; Dinter, Simon; Drach, Vincent [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC; Jansen, Karl [Cyprus Univ., Nicosia (Cyprus). Dept. of Physics; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC; Hadjiyiannakou, Kyriakos [Cyprus Univ., Nicosia (Cyprus). Dept. of Physics; Renner, Dru B. [Thomas Jefferson National Accelerator Facility, Newport News, VA (United States); Collaboration: European Twisted Mass Collaboration

    2013-02-15

    We present a stochastic method for the calculation of baryon three-point functions that is more versatile compared to the typically used sequential method. We analyze the scaling of the error of the stochastically evaluated three-point function with the lattice volume and find a favorable signal-to-noise ratio suggesting that our stochastic method can be used efficiently at large volumes to compute hadronic matrix elements.

  16. Calculating Relativistic Transition Matrix Elements for Hydrogenic Atoms Using Monte Carlo Methods

    Science.gov (United States)

    Alexander, Steven; Coldwell, R. L.

    2015-03-01

    The nonrelativistic transition matrix elements for hydrogen atoms can be computed exactly and these expressions are given in a number of classic textbooks. The relativistic counterparts of these equations can also be computed exactly but these expressions have been described in only a few places in the literature. In part, this is because the relativistic equations lack the elegant simplicity of the nonrelativistic equations. In this poster I will describe how variational Monte Carlo methods can be used to calculate the energy and properties of relativistic hydrogen atoms and how the wavefunctions for these systems can be used to calculate transition matrix elements.

  17. Rovibrational matrix elements of the multipole moments and of the ...

    Indian Academy of Sciences (India)

    The rovibrational matrix elements of the multipole moments and polarizability of molecules find applications in the study of infrared spectra, intermolecular potential and collision-induced absorption phenomena, especially in homonuclear molecules. Because of its simplicity and fundamental importance, the hydrogen ...

  18. Application of FIRE for the calculation of photon matrix elements

    Indian Academy of Sciences (India)

    to evaluate the two-loop Feynman diagrams for the photon matrix element of the ... sum of scalar Feynman integrals to a linear combination of a few master integrals. .... Then, FIRE is used to express these scalar integrals as a linear combi-.

  19. On the possibility to measure 0νββ-decay nuclear matrix element for 48Ca

    International Nuclear Information System (INIS)

    Rodin, Vadim

    2011-01-01

    As shown in Ref. [2], the Fermi part M F 0ν of the total 0νββ-decay nuclear matrix element M 0ν can be related to the single Fermi transition matrix element between the isobaric analog state (IAS) of the ground state of the initial nucleus and the ground state of the final nucleus. The latter matrix element could be measured in charge-exchange reactions. Here we discuss a possibility of such a measurement for 48 Ca and estimate the cross-section of the reaction 48 Ti(n,p) 48 Sc(IAS).

  20. Measurement of the CKM matrix element |V_ts|²

    CERN Document Server

    Unverdorben, Christopher Gerhard

    This is the first direct measurement of the CKM matrix element |V_ts|, using data collected by the ATLAS detector in 2012 at √s=8 TeV pp-collisions with a total integrated luminosity of 20.3 fb⁻¹. The analysis is based on 112171 reconstructed tt̅ candidate events in the lepton+jets channel, having a purity of 90.0 %. 183 tt̅→WWbs̅ decays are expected (charge conjugation implied), which are available for the extraction of the CKM matrix element |V_ts|². To identify these rare decays, several observables are examined, such as the properties of jets, tracks and of b-quark identification algorithms. Furthermore, the s-quark hadrons K0s are considered, reconstructed by a kinematic fit. The best observables are combined in a multivariate analysis, called "boosted decision trees". The responses from Monte Carlo simulations are used as templates for a fit to data events yielding a significance value of 0.7σ for t→s+W decays. An upper limit of |V_ts|² < 1.74 % at 95 % confidence level is set, includi...

  1. Matrix elements and few-body calculations within the unitary correlation operator method

    International Nuclear Information System (INIS)

    Roth, R.; Hergert, H.; Papakonstantinou, P.

    2005-01-01

    We employ the unitary correlation operator method (UCOM) to construct correlated, low-momentum matrix elements of realistic nucleon-nucleon interactions. The dominant short-range central and tensor correlations induced by the interaction are included explicitly by an unitary transformation. Using correlated momentum-space matrix elements of the Argonne V18 potential, we show that the unitary transformation eliminates the strong off-diagonal contributions caused by the short-range repulsion and the tensor interaction and leaves a correlated interaction dominated by low-momentum contributions. We use correlated harmonic oscillator matrix elements as input for no-core shell model calculations for few-nucleon systems. Compared to the bare interaction, the convergence properties are dramatically improved. The bulk of the binding energy can already be obtained in very small model spaces or even with a single Slater determinant. Residual long-range correlations, not treated explicitly by the unitary transformation, can easily be described in model spaces of moderate size allowing for fast convergence. By varying the range of the tensor correlator we are able to map out the Tjon line and can in turn constrain the optimal correlator ranges. (orig.)

  2. Matrix elements and few-body calculations within the unitary correlation operator method

    International Nuclear Information System (INIS)

    Roth, R.; Hergert, H.; Papakonstantinou, P.; Neff, T.; Feldmeier, H.

    2005-01-01

    We employ the unitary correlation operator method (UCOM) to construct correlated, low-momentum matrix elements of realistic nucleon-nucleon interactions. The dominant short-range central and tensor correlations induced by the interaction are included explicitly by an unitary transformation. Using correlated momentum-space matrix elements of the Argonne V18 potential, we show that the unitary transformation eliminates the strong off-diagonal contributions caused by the short-range repulsion and the tensor interaction and leaves a correlated interaction dominated by low-momentum contributions. We use correlated harmonic oscillator matrix elements as input for no-core shell model calculations for few-nucleon systems. Compared to the bare interaction, the convergence properties are dramatically improved. The bulk of the binding energy can already be obtained in very small model spaces or even with a single Slater determinant. Residual long-range correlations, not treated explicitly by the unitary transformation, can easily be described in model spaces of moderate size allowing for fast convergence. By varying the range of the tensor correlator we are able to map out the Tjon line and can in turn constrain the optimal correlator ranges

  3. Reorientation-effect measurement of the matrix element in 10Be

    Science.gov (United States)

    Orce, J. N.; Drake, T. E.; Djongolov, M. K.; Navrátil, P.; Triambak, S.; Ball, G. C.; Al Falou, H.; Churchman, R.; Cross, D. S.; Finlay, P.; Forssén, C.; Garnsworthy, A. B.; Garrett, P. E.; Hackman, G.; Hayes, A. B.; Kshetri, R.; Lassen, J.; Leach, K. G.; Li, R.; Meissner, J.; Pearson, C. J.; Rand, E. T.; Sarazin, F.; Sjue, S. K. L.; Stoyer, M. A.; Sumithrarachchi, C. S.; Svensson, C. E.; Tardiff, E. R.; Teigelhoefer, A.; Williams, S. J.; Wong, J.; Wu, C. Y.

    2012-10-01

    The highly-efficient and segmented TIGRESS γ-ray spectrometer at TRIUMF has been used to perform a reorientation-effect Coulomb-excitation study of the 21+ state at 3.368 MeV in 10Be. This is the first Coulomb-excitation measurement that enables one to obtain information on diagonal matrix elements for such a high-lying first excited state from γ-ray data. With the availability of accurate lifetime data, a value of -0.110±0.087 eb is determined for the diagonal matrix element, which assuming the rotor model, leads to a negative spectroscopic quadrupole moment of QS(21+)=-0.083±0.066 eb. This result is in agreement with both no-core shell-model calculations performed in this work with the CD-Bonn 2000 two-nucleon potential and large shell-model spaces, and Green's function Monte Carlo predictions with two- plus three-nucleon potentials.

  4. Current matrix element in HAL QCD's wavefunction-equivalent potential method

    Science.gov (United States)

    Watanabe, Kai; Ishii, Noriyoshi

    2018-04-01

    We give a formula to calculate a matrix element of a conserved current in the effective quantum mechanics defined by the wavefunction-equivalent potentials proposed by the HAL QCD collaboration. As a first step, a non-relativistic field theory with two-channel coupling is considered as the original theory, with which a wavefunction-equivalent HAL QCD potential is obtained in a closed analytic form. The external field method is used to derive the formula by demanding that the result should agree with the original theory. With this formula, the matrix element is obtained by sandwiching the effective current operator between the left and right eigenfunctions of the effective Hamiltonian associated with the HAL QCD potential. In addition to the naive one-body current, the effective current operator contains an additional two-body term emerging from the degrees of freedom which has been integrated out.

  5. Study of color-octet matrix elements through J/ψ production in e{sup +}e{sup -} annihilation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yi-Jie; Xu, Guang-Zhi; Zhang, Pan-Pan; Liu, Kui-Yong [Liaoning University, Department of Physics, Shenyang (China); Zhang, Yu-Jie [Beihang University, School of Physics, Beijing (China); CAS Center for Excellence in Particle Physics, Beijing (China)

    2017-09-15

    In this paper, the color-octet long distance matrix elements are studied through the inclusive J/ψ production in e{sup +}e{sup -} annihilation within the framework of non-relativistic QCD factorization. The calculations are up-to next-to-leading order with the radiative and relativistic corrections in the energy region of the B-factory and the near-threshold region of 4.6-5.6 GeV. A constraint of the long distance matrix elements (left angle {sup 1}S{sub 0}{sup 8} right angle, left angle {sup 3}P{sub 0}{sup 8} right angle) is obtained. Through our estimation, the P-wave color-octet matrix element (left angle 0 vertical stroke {sup 3}P{sup 8}{sub 0} vertical stroke 0 right angle) should be of the order of 0.008m{sub c}{sup 2} GeV{sup 3} or less. The constrained region is not compatible with the values of the long distance matrix elements fitted at hadron colliders. (orig.)

  6. Role of shell structure in the 2νββ nuclear matrix elements

    International Nuclear Information System (INIS)

    Nakada, H.

    1998-01-01

    Significance of the nuclear shell structure in the ββ nuclear matrix elements is pointed out. The 2νββ processes are mainly mediated by the low-lying 1 + states. The shell structure also gives rise to concentration or fragmentation of the 2νββ components over intermediate states, depending on nuclide. These roles of the shell structure are numerically confirmed by realistic shell model calculations. Some shell structure effects are suggested for 0νββ matrix elements; dominance of low-lying intermediate states and nucleus-dependence of their spin-parities. (orig.)

  7. Reweighting QCD matrix-element and parton-shower calculations

    Energy Technology Data Exchange (ETDEWEB)

    Bothmann, Enrico; Schumann, Steffen [Universitaet Goettingen, II. Physikalisches Institut, Goettingen (Germany); Schoenherr, Marek [Universitaet Zuerich, Physik-Institut, Zuerich (Switzerland)

    2016-11-15

    We present the implementation and validation of the techniques used to efficiently evaluate parametric and perturbative theoretical uncertainties in matrix-element plus parton-shower simulations within the Sherpa event-generator framework. By tracing the full α{sub s} and PDF dependences, including the parton-shower component, as well as the fixed-order scale uncertainties, we compute variational event weights on-the-fly, thereby greatly reducing the computational costs to obtain theoretical-uncertainty estimates. (orig.)

  8. Finite element model updating of concrete structures based on imprecise probability

    Science.gov (United States)

    Biswal, S.; Ramaswamy, A.

    2017-09-01

    Imprecise probability based methods are developed in this study for the parameter estimation, in finite element model updating for concrete structures, when the measurements are imprecisely defined. Bayesian analysis using Metropolis Hastings algorithm for parameter estimation is generalized to incorporate the imprecision present in the prior distribution, in the likelihood function, and in the measured responses. Three different cases are considered (i) imprecision is present in the prior distribution and in the measurements only, (ii) imprecision is present in the parameters of the finite element model and in the measurement only, and (iii) imprecision is present in the prior distribution, in the parameters of the finite element model, and in the measurements. Procedures are also developed for integrating the imprecision in the parameters of the finite element model, in the finite element software Abaqus. The proposed methods are then verified against reinforced concrete beams and prestressed concrete beams tested in our laboratory as part of this study.

  9. Effects of quenching and partial quenching on penguin matrix elements

    NARCIS (Netherlands)

    Golterman, Maarten; Pallante, Elisabetta

    2001-01-01

    In the calculation of non-leptonic weak decay rates, a "mismatch" arises when the QCD evolution of the relevant weak hamiltonian down to hadronic scales is performed in unquenched QCD, but the hadronic matrix elements are then computed in (partially) quenched lattice QCD. This mismatch arises

  10. A generalized Talmi-Moshinsky transformation for few-body and direct interaction matrix elements

    International Nuclear Information System (INIS)

    Tobocman, W.

    1981-01-01

    A set of basis states for use in evaluating matrix elements of few-body system operators is suggested. These basis states are products of harmonic oscillator wave functions having as arguments a set of Jacobi coordinates for the system. We show that these harmonic oscillator functions can be chosen in a manner that allows such a product to be expanded as a finite sum of the corresponding products for any other set of Jacobi coordinates. This result is a generalization of the Talmi-Moshinsky transformation for two equal-mass particles to a system of any number of particles of arbitrary masses. With the help of our method the multidimensional integral which must be performed to evaluate a few-body matrix element can be transformed into a sum of products of three dimensional integrals. The coefficients in such an expansion are generalized Talmi-Moshinsky coefficients. The method is tested by calculation of a matrix element for knockout scattering for a simple three-body-system. The results indicate that the method is a viable calculational tool. (orig.)

  11. The current matrix elements from HAL QCD method

    Science.gov (United States)

    Watanabe, Kai; Ishii, Noriyoshi

    2018-03-01

    HAL QCD method is a method to construct a potential (HAL QCD potential) that reproduces the NN scattering phase shift faithful to the QCD. The HAL QCD potential is obtained from QCD by eliminating the degrees of freedom of quarks and gluons and leaving only two particular hadrons. Therefor, in the effective quantum mechanics of two nucleons defined by HAL QCD potential, the conserved current consists not only of the nucleon current but also an extra current originating from the potential (two-body current). Though the form of the two-body current is closely related to the potential, it is not straight forward to extract the former from the latter. In this work, we derive the the current matrix element formula in the quantum mechanics defined by the HAL QCD potential. As a first step, we focus on the non-relativistic case. To give an explicit example, we consider a second quantized non-relativistic two-channel coupling model which we refer to as the original model. From the original model, the HAL QCD potential for the open channel is constructed by eliminating the closed channel in the elastic two-particle scattering region. The current matrix element formula is derived by demanding the effective quantum mechanics defined by the HAL QCD potential to respond to the external field in the same way as the original two-channel coupling model.

  12. Probability analysis of WWER-1000 fuel elements behavior under steady-state, transient and accident conditions of reactor operation

    International Nuclear Information System (INIS)

    Tutnov, A.; Alexeev, E.

    2001-01-01

    'PULSAR-2' and 'PULSAR+' codes make it possible to simulate thermo-mechanical and thermo-physical parameters of WWER fuel elements. The probabilistic approach is used instead of traditional deterministic one to carry out a sensitive study of fuel element behavior under steady-state operation mode. Fuel elements initial parameters are given as a density of the probability distributions. Calculations are provided for all possible combinations of initial data as fuel-cladding gap, fuel density and gas pressure. Dividing values of these parameters to intervals final variants for calculations are obtained . Intervals of permissible fuel-cladding gap size have been divided to 10 equal parts, fuel density and gas pressure - to 5 parts. Probability of each variant realization is determined by multiplying the probabilities of separate parameters, because the tolerances of these parameters are distributed independently. Simulation results are turn out in the probabilistic bar charts. The charts present probability distribution of the changes in fuel outer diameter, hoop stress kinetics and fuel temperature versus irradiation time. A normative safety factor is introduced for control of any criterion realization and for determination of a reserve to the criteria failure. A probabilistic analysis of fuel element behavior under Reactivity Initiating Accident (RIA) is also performed and probability fuel element depressurization under hypothetical RIA is presented

  13. Double β-decay nuclear matrix elements and lepton conservation

    International Nuclear Information System (INIS)

    Vergados, J.D.

    1976-01-01

    The nuclear matrix elements involved in the double β-decay of 48 Ca, 130 Te, and 128 Te were calculated using realistic nuclear interactions and shell model nuclear wave functions. The double doorway state is not appreciably mixed in the ground state of the final nuclei. So the ground state transitions contain a small fraction of the sum rule. A lepton nonconservation parameter eta -4 was deduced

  14. Validity of M-3Y force equivalent G-matrix elements for calculations of the nuclear structure in heavy mass region

    International Nuclear Information System (INIS)

    Cheng Lan; Huang Weizhi; Zhou Baosen

    1996-01-01

    Using the matrix elements of M-3Y force as the equivalent G-matrix elements, the spectra of 210 Pb, 206 Pb, 206 Hg and 210 Po are calculated in the framework of the Folded Diagram Method. The results show that such equivalent matrix elements are suitable for microscopic calculations of the nuclear structure in heavy mass region

  15. Validity of the M-3Y force equivalent G-matrix element for the calculations of nuclear structure in the s-d shell

    International Nuclear Information System (INIS)

    Song Hong-qiu; Wang Zixing; Cai Yanhuang; Huang Weizhi

    1987-01-01

    The matrix elements of the M-3Y force are adopted as the equivalent G-matrix elements and the folded diagram method is used to calculate the spectra of 18 O and 18 F. The results show that the matrix elements of the M-3Y force as the equivalent G-matrix elements are suitable for microscopic calculations of the nuclei in the s-d shell

  16. Time-Varying Transition Probability Matrix Estimation and Its Application to Brand Share Analysis.

    Directory of Open Access Journals (Sweden)

    Tomoaki Chiba

    Full Text Available In a product market or stock market, different products or stocks compete for the same consumers or purchasers. We propose a method to estimate the time-varying transition matrix of the product share using a multivariate time series of the product share. The method is based on the assumption that each of the observed time series of shares is a stationary distribution of the underlying Markov processes characterized by transition probability matrices. We estimate transition probability matrices for every observation under natural assumptions. We demonstrate, on a real-world dataset of the share of automobiles, that the proposed method can find intrinsic transition of shares. The resulting transition matrices reveal interesting phenomena, for example, the change in flows between TOYOTA group and GM group for the fiscal year where TOYOTA group's sales beat GM's sales, which is a reasonable scenario.

  17. Time-Varying Transition Probability Matrix Estimation and Its Application to Brand Share Analysis.

    Science.gov (United States)

    Chiba, Tomoaki; Hino, Hideitsu; Akaho, Shotaro; Murata, Noboru

    2017-01-01

    In a product market or stock market, different products or stocks compete for the same consumers or purchasers. We propose a method to estimate the time-varying transition matrix of the product share using a multivariate time series of the product share. The method is based on the assumption that each of the observed time series of shares is a stationary distribution of the underlying Markov processes characterized by transition probability matrices. We estimate transition probability matrices for every observation under natural assumptions. We demonstrate, on a real-world dataset of the share of automobiles, that the proposed method can find intrinsic transition of shares. The resulting transition matrices reveal interesting phenomena, for example, the change in flows between TOYOTA group and GM group for the fiscal year where TOYOTA group's sales beat GM's sales, which is a reasonable scenario.

  18. Neutrino Mass Matrix Textures: A Data-driven Approach

    CERN Document Server

    Bertuzzo, E; Machado, P A N

    2013-01-01

    We analyze the neutrino mass matrix entries and their correlations in a probabilistic fashion, constructing probability distribution functions using the latest results from neutrino oscillation fits. Two cases are considered: the standard three neutrino scenario as well as the inclusion of a new sterile neutrino that potentially explains the reactor and gallium anomalies. We discuss the current limits and future perspectives on the mass matrix elements that can be useful for model building.

  19. 3-Loop massive O(T2F) contributions to the DIS operator matrix element Agg

    International Nuclear Information System (INIS)

    Ablinger, J.; Schneider, C.; Bluemlein, J.; Freitas, A. de; Hasselhuhn, A.; Round, M.; Manteuffel, A. von

    2014-09-01

    Contributions to heavy flavour transition matrix elements in the variable flavour number scheme are considered at 3-loop order. In particular a calculation of the diagrams with two equal masses that contribute to the massive operator matrix element A (3) gg,Q is performed. In the Mellin space result one finds finite nested binomial sums. In x-space these sums correspond to iterated integrals over an alphabet containing also square-root valued letters.

  20. SU(3) techniques for angular momentum projected matrix elements in multi-cluster problems

    International Nuclear Information System (INIS)

    Hecht, K.T.; Zahn, W.

    1978-01-01

    In the theory of integral transforms for the evaluation of the resonating group kernels needed for cluster model calculations, the evaluation of matrix elements in an angular momentum coupled basis has proved to be difficult for cluster problems involving more than two fragments. For multi-cluster wave functions SU(3) coupling and recoupling techniques can furnish a tool for the practical evaluation matrix elements in an angular momentum coupled basis if the several relative motion harmonic oscillator functions in Bargmann space have simple SU(3) coupling properties. The method is illustrated by a three-cluster problem, such as 12 C = α + α + α, involving three 1 S clusters. 2 references

  1. The two-mass contribution to the three-loop pure singlet operator matrix element

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, J.; Schneider, C. [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation (RISC); Bluemlein, J.; Freitas, A. de; Schoenwald, K. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)

    2017-11-15

    We present the two-mass QCD contributions to the pure singlet operator matrix element at three loop order in x-space. These terms are relevant for calculating the structure function F{sub 2}(x,Q{sup 2}) at O(α{sup 3}{sub s}) as well as for the matching relations in the variable flavor number scheme and the heavy quark distribution functions at the same order. The result for the operator matrix element is given in terms of generalized iterated integrals that include square root letters in the alphabet, depending also on the mass ratio through the main argument. Numerical results are presented.

  2. Correlated random-phase approximation from densities and in-medium matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Trippel, Richard; Roth, Robert [Institut fuer Kernphysik, Technische Universitaet Darmstadt (Germany)

    2016-07-01

    The random-phase approximation (RPA) as well as the second RPA (SRPA) are established tools for the study of collective excitations in nuclei. Addressing the well known lack of correlations, we derived a universal framework for a fully correlated RPA based on the use of one- and two-body densities. We apply densities from coupled cluster theory and investigate the impact of correlations. As an alternative approach to correlations we use matrix elements transformed via in-medium similarity renormalization group (IM-SRG) in combination with RPA and SRPA. We find that within SRPA the use of IM-SRG matrix elements leads to the disappearance of instabilities of low-lying states. For the calculations we use normal-ordered two- plus three-body interactions derived from chiral effective field theory. We apply different Hamiltonians to a number of doubly-magic nuclei and calculate electric transition strengths.

  3. X-ray microanalysis of elements present in the matrix of cnidarian nematocysts.

    Science.gov (United States)

    Tardent, P; Zierold, K; Klug, M; Weber, J

    1990-01-01

    The composition and concentration of elements, in particular those of metallic cations, present in the intracapsular matrix and the wall of nematocysts of various cnidarian species have been recorded by means of X-ray microanalysis performed on 100nm thick cryosections. The predominant cation detected in the nematocyst matrix of the hydrozoan Podocoryne carnea (medusa), the scyphozoan Aurelia aurita (scyphopolyp) and the anthozoan Calliactis parasitica (tentacles and acontia) is K(+). Mg(2+) prevails in tentacular cysts of Anthopleura elegantissima, Actinia equina and Anemonia viridis, whereas, the acrorhagial cysts of A. elegantissima and A. equina contain Ca(2+) instead of Mg(2+). The acrorhagial cysts of A. viridis contain Mg(2+) like those of the tentacles. In the tentacular nematocysts of Podocoryne carnea polyps (Hydrozoa) on the other hand ambiguous element contents were found indicating that the cysts of this species has no preference for a particular cation. The high values of sulfur recorded in the matrix and particularly the wall of all the cysts are reflecting the presence of numerous protein disulfide bonds within the structural components (wall, shaft, tubule) of the nematocysts.

  4. Analytical matrix elements of semifinite 2D two centre nuclear potential

    International Nuclear Information System (INIS)

    Niculescu, V. L. R.; Catana, S.; Catana, D.; Babin, V.

    1998-01-01

    In the present work we introduce a new 2D potential which is a symmetric double-well in one variable and with one centre in the other. The factorable potential matrix elements are expressed by analytical formulas. This implies a shorter computational time. (author)

  5. Effects of quenching and partial quenching on QCD penguin matrix elements

    NARCIS (Netherlands)

    Golterman, Maarten; Pallante, Elisabetta

    2002-01-01

    We point out that chiral transformation properties of penguin operators change in the transition from unquenched to (partially) quenched QCD. The way in which this affects the lattice determination of weak matrix elements can be understood in the framework of (partially) quenched chiral perturbation

  6. Calculation of normal tissue complication probability and dose-volume histogram reduction schemes for tissues with a critical element architecture

    International Nuclear Information System (INIS)

    Niemierko, Andrzej; Goitein, Michael

    1991-01-01

    The authors investigate a model of normal tissue complication probability for tissues that may be represented by a critical element architecture. They derive formulas for complication probability that apply to both a partial volume irradiation and to an arbitrary inhomogeneous dose distribution. The dose-volume isoeffect relationship which is a consequence of a critical element architecture is discussed and compared to the empirical power law relationship. A dose-volume histogram reduction scheme for a 'pure' critical element model is derived. In addition, a point-based algorithm which does not require precomputation of a dose-volume histogram is derived. The existing published dose-volume histogram reduction algorithms are analyzed. The authors show that the existing algorithms, developed empirically without an explicit biophysical model, have a close relationship to the critical element model at low levels of complication probability. However, it is also showed that they have aspects which are not compatible with a critical element model and the authors propose a modification to one of them to circumvent its restriction to low complication probabilities. (author). 26 refs.; 7 figs

  7. Three loop massive operator matrix elements and asymptotic Wilson coefficients with two different masses

    Directory of Open Access Journals (Sweden)

    J. Ablinger

    2017-08-01

    Full Text Available Starting at 3-loop order, the massive Wilson coefficients for deep-inelastic scattering and the massive operator matrix elements describing the variable flavor number scheme receive contributions of Feynman diagrams carrying quark lines with two different masses. In the case of the charm and bottom quarks, the usual decoupling of one heavy mass at a time no longer holds, since the ratio of the respective masses, η=mc2/mb2∼1/10, is not small enough. Therefore, the usual variable flavor number scheme (VFNS has to be generalized. The renormalization procedure in the two-mass case is different from the single mass case derived in [1]. We present the moments N=2,4 and 6 for all contributing operator matrix elements, expanding in the ratio η. We calculate the analytic results for general values of the Mellin variable N in the flavor non-singlet case, as well as for transversity and the matrix element Agq(3. We also calculate the two-mass scalar integrals of all topologies contributing to the gluonic operator matrix element Agg. As it turns out, the expansion in η is usually inapplicable for general values of N. We therefore derive the result for general values of the mass ratio. From the single pole terms we derive, now in a two-mass calculation, the corresponding contributions to the 3-loop anomalous dimensions. We introduce a new general class of iterated integrals and study their relations and present special values. The corresponding functions are implemented in computer-algebraic form.

  8. Matrix elements of vibration kinetic energy operator of tetrahedral molecules in non-orthogonal-dependent coordinates

    Science.gov (United States)

    Protasevich, Alexander E.; Nikitin, Andrei V.

    2018-01-01

    In this work, we propose an algorithm for calculating the matrix elements of the kinetic energy operator for tetrahedral molecules. This algorithm uses the dependent six-angle coordinates (6A) and takes into account the full symmetry of molecules. Unlike A.V. Nikitin, M. Rey, and Vl. G. Tyuterev who operate with the kinetic energy operator only in Radau orthogonal coordinates, we consider a general case. The matrix elements are shown to be a sum of products of one-dimensional integrals.

  9. Critically Important Object Security System Element Model

    Directory of Open Access Journals (Sweden)

    I. V. Khomyackov

    2012-03-01

    Full Text Available A stochastic model of critically important object security system element has been developed. The model includes mathematical description of the security system element properties and external influences. The state evolution of the security system element is described by the semi-Markov process with finite states number, the semi-Markov matrix and the initial semi-Markov process states probabilities distribution. External influences are set with the intensity of the Poisson thread.

  10. Analytical Expressions of Matrix Elements of Physical Quantities for Dirac Oscillator

    Institute of Scientific and Technical Information of China (English)

    LI Ning; JU Guo-Xing; REN Zhong-Zhou

    2004-01-01

    The analytical expressions of the matrix elements for physical quantities are obtained for the Dirac oscillator in two and three spatial dimensions. Their behaviour for the case of operator's square is discussed in details. The twodimensional Dirac oscillator has similar behavior to that for three-dimensional one.

  11. Matching NLO parton shower matrix element with exact phase space case of $W\\to l\

    CERN Document Server

    Nanava, G; Was, Z

    2010-01-01

    In practical applications PHOTOS Monte Carlo is often used for simulation of QED effects in decay of intermediate particles and resonances. Generated in such a way that samples of events cover the whole bremsstrahlung phase space. With the help of selection cuts, experimental acceptance can be then taken into account. The program is based on exact multiphoton phase space. To evaluate the program precision it is necessary to control its matrix element. Generally it is obtained using iteration of the universal multidimensional kernel. In some cases it is however obtained from the exact first order matrix element. Then, as a consequence, all terms necessary for non-leading logarithms are taken into account. In the present paper we will focus on the decays W -> l nu and gamma^* -> pi^+ pi^-. The Born level cross sections for both processes approach zero in some points of the phase space. Process dependent, compensating weight is constructed to implement exact matrix element, but it will be recommended for use onl...

  12. Program package for calculating matrix elements of two-cluster structures in nuclei

    International Nuclear Information System (INIS)

    Krivec, R.; Mihailovic, M.V.; Kernforschungszentrum Karlsruhe G.m.b.H.

    1982-01-01

    Matrix elements of operators between Slater determinants of two-cluster structures must be expanded into partial waves for the purpose of angular momentum projection. The expansion coefficients contain integrals over the spherical angles theta and phi. (orig.)

  13. Determinant representations of spin-operator matrix elements in the XX spin chain and their applications

    Science.gov (United States)

    Wu, Ning

    2018-01-01

    For the one-dimensional spin-1/2 XX model with either periodic or open boundary conditions, it is shown by using a fermionic approach that the matrix element of the spin operator Sj- (Sj-Sj'+ ) between two eigenstates with numbers of excitations n and n +1 (n and n ) can be expressed as the determinant of an appropriate (n +1 )×(n +1 ) matrix whose entries involve the coefficients of the canonical transformations diagonalizing the model. In the special case of a homogeneous periodic XX chain, the matrix element of Sj- reduces to a variant of the Cauchy determinant that can be evaluated analytically to yield a factorized expression. The obtained compact representations of these matrix elements are then applied to two physical scenarios: (i) Nonlinear optical response of molecular aggregates, for which the determinant representation of the transition dipole matrix elements between eigenstates provides a convenient way to calculate the third-order nonlinear responses for aggregates from small to large sizes compared with the optical wavelength; and (ii) real-time dynamics of an interacting Dicke model consisting of a single bosonic mode coupled to a one-dimensional XX spin bath. In this setup, full quantum calculation up to N ≤16 spins for vanishing intrabath coupling shows that the decay of the reduced bosonic occupation number approaches a finite plateau value (in the long-time limit) that depends on the ratio between the number of excitations and the total number of spins. Our results can find useful applications in various "system-bath" systems, with the system part inhomogeneously coupled to an interacting XX chain.

  14. Measurement of the CKM matrix element vertical stroke Vts vertical stroke 2

    International Nuclear Information System (INIS)

    Unverdorben, Christopher Gerhard

    2015-03-01

    This is the first direct measurement of the CKM matrix element vertical stroke V ts vertical stroke, using data collected by the ATLAS detector in 2012 at √(s)= 8 TeV pp-collisions with a total integrated luminosity of 20.3 fb -1 . The analysis is based on 112 171 reconstructed t anti t candidate events in the lepton+jets channel, having a purity of 90.0 %. 183 t anti t→W + W - b anti s decays are expected (charge conjugation implied), which are available for the extraction of the CKM matrix element vertical stroke V ts vertical stroke 2 . To identify these rare decays, several observables are examined, such as the properties of jets, tracks and of b-quark identification algorithms. Furthermore, the s-quark hadrons K 0 s are considered, reconstructed by a kinematic fit. The best observables are combined in a multivariate analysis, called ''boosted decision trees''. The responses from Monte Carlo simulations are used as templates for a fit to data events yielding a significance value of 0.7σ for t→s+W decays. An upper limit of vertical stroke V ts vertical stroke 2 <1.74 % at 95 % confidence level is set, including all systematic and statistical uncertainties. So this analysis, using a direct measurement of the CKM matrix element vertical stroke V ts vertical stroke 2 , provides the best direct limit on vertical stroke V ts vertical stroke 2 up to now.

  15. Calculations of hadronic weak matrix elements: A status report

    International Nuclear Information System (INIS)

    Sharpe, S.R.

    1988-01-01

    I review the calculations of hadronic matrix elements of the weak Hamiltonian. My major emphasis is on lattice calculations. I discuss the application to weak decay constants (f/sub K/, f/sub D/, f/sub B/), K 0 /minus/ /bar K/sup 0// and B 0 /minus/ /bar B/sup 0// mixing, K → ππ decays, and the CP violation parameters ε and ε'. I close with speculations on future progress. 57 refs., 4 figs., 2 tabs

  16. Construction of unitary matrices from observable transition probabilities

    International Nuclear Information System (INIS)

    Peres, A.

    1989-01-01

    An ideal measuring apparatus defines an orthonormal basis vertical strokeu m ) in Hilbert space. Another apparatus defines another basis vertical strokeυ μ ). Both apparatuses together allow to measure the transition probabilities P mμ =vertical stroke(u m vertical strokeυ μ )vertical stroke 2 . The problem is: Given all the elements of a doubly stochastic matrix P mμ , find a unitary matrix U mμ such that P mμ =vertical strokeU mμ vertical stroke 2 . The number of unknown nontrivial phases is equal to the number of independent equations to satisfy. The problem can therefore be solved provided that the values of the P mμ satisfy some inequalities. (orig.)

  17. Three loop massive operator matrix elements and asymptotic Wilson coefficients with two different masses

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, J.; Hasselhuhn, A.; Schneider, C. [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation (RISC); Bluemlein, J.; Freitas, A. de [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Wissbrock, F. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation (RISC); IHES, Bures-sur-Yvette (France)

    2017-05-15

    Starting at 3-loop order, the massive Wilson coefficients for deep-inelastic scattering and the massive operator matrix elements describing the variable flavor number scheme receive contributions of Feynman diagrams carrying quark lines with two different masses. In the case of the charm and bottom quarks, the usual decoupling of one heavy mass at a time no longer holds, since the ratio of the respective masses, η=m{sup 2}{sub c}/m{sup 2}{sub b}∝1/10, is not small enough. Therefore, the usual variable flavor number scheme (VFNS) has to be generalized. The renormalization procedure in the two-mass case is different from the single mass case derived earlier (I. Bierenbaum, J: Bluemlein, S. Klein, 2009). We present the moments N=2,4 and 6 for all contributing operator matrix elements, expanding in the ratio η. We calculate the analytic results for general values of the Mellin variable N in the flavor non-singlet case, as well as for transversity and the matrix element A{sup (3)}{sub gq}. We also calculate the two-mass scalar integrals of all topologies contributing to the gluonic operator matrix element A{sub gg}. As it turns out, the expansion in η is usually inapplicable for general values of N. We therefore derive the result for general values of the mass ratio. From the single pole terms we derive, now in a two-mass calculation, the corresponding contributions to the 3-loop anomalous dimensions. We introduce a new general class of iterated integrals and study their relations and present special values. The corresponding functions are implemented in computer-algebraic form.

  18. The scattering matrix element of the three body reactive collision

    International Nuclear Information System (INIS)

    Morsy, M.W.; Hilal, A.A.; El-Sabagh, M.A.

    1980-08-01

    The optical model approximation has been applied to a previously derived set of coupled equations representing the dynamics of the three-body reactive scattering. The Schroedinger equation obtained describing the scattering problem has then been solved by inserting the effective mass approximation. The asymptotic requirements for both the entrance and exit channels, respectively, have been supplied to give the scattering matrix element of the reactive collision. (author)

  19. Calculation of hadronic matrix elements using lattice QCD

    International Nuclear Information System (INIS)

    Gupta, R.

    1993-01-01

    The author gives a brief introduction to the scope of lattice QCD calculations in his effort to extract the fundamental parameters of the standard model. This goal is illustrated by two examples. First the author discusses the extraction of CKM matrix elements from measurements of form factors for semileptonic decays of heavy-light pseudoscalar mesons such as D → Keν. Second, he presents the status of results for the kaon B parameter relevant to CP violation. He concludes the talk with a short outline of his experiences with optimizing QCD codes on the CM5

  20. Calculation of hadronic matrix elements using lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, R.

    1993-08-01

    The author gives a brief introduction to the scope of lattice QCD calculations in his effort to extract the fundamental parameters of the standard model. This goal is illustrated by two examples. First the author discusses the extraction of CKM matrix elements from measurements of form factors for semileptonic decays of heavy-light pseudoscalar mesons such as D {yields} Ke{nu}. Second, he presents the status of results for the kaon B parameter relevant to CP violation. He concludes the talk with a short outline of his experiences with optimizing QCD codes on the CM5.

  1. Second level semi-degenerate fields in W{sub 3} Toda theory: matrix element and differential equation

    Energy Technology Data Exchange (ETDEWEB)

    Belavin, Vladimir [I.E. Tamm Department of Theoretical Physics, P.N. Lebedev Physical Institute,Leninsky Avenue 53, 119991 Moscow (Russian Federation); Department of Quantum Physics, Institute for Information Transmission Problems,Bolshoy Karetny per. 19, 127994 Moscow (Russian Federation); Moscow Institute of Physics and Technology,Dolgoprudnyi, 141700 Moscow region (Russian Federation); Cao, Xiangyu [LPTMS, CNRS (UMR 8626), Université Paris-Saclay,15 rue Georges Clémenceau, 91405 Orsay (France); Estienne, Benoit [LPTHE, CNRS and Université Pierre et Marie Curie, Sorbonne Universités,4 Place Jussieu, 75252 Paris Cedex 05 (France); Santachiara, Raoul [LPTMS, CNRS (UMR 8626), Université Paris-Saclay,15 rue Georges Clémenceau, 91405 Orsay (France)

    2017-03-02

    In a recent study we considered W{sub 3} Toda 4-point functions that involve matrix elements of a primary field with the highest-weight in the adjoint representation of sl{sub 3}. We generalize this result by considering a semi-degenerate primary field, which has one null vector at level two. We obtain a sixth-order Fuchsian differential equation for the conformal blocks. We discuss the presence of multiplicities, the matrix elements and the fusion rules.

  2. Neutrinoless double-β decay matrix elements in large shell-model spaces with the generator-coordinate method

    Science.gov (United States)

    Jiao, C. F.; Engel, J.; Holt, J. D.

    2017-11-01

    We use the generator-coordinate method (GCM) with realistic shell-model interactions to closely approximate full shell-model calculations of the matrix elements for the neutrinoless double-β decay of 48Ca, 76Ge, and 82Se. We work in one major shell for the first isotope, in the f5 /2p g9 /2 space for the second and third, and finally in two major shells for all three. Our coordinates include not only the usual axial deformation parameter β , but also the triaxiality angle γ and neutron-proton pairing amplitudes. In the smaller model spaces our matrix elements agree well with those of full shell-model diagonalization, suggesting that our Hamiltonian-based GCM captures most of the important valence-space correlations. In two major shells, where exact diagonalization is not currently possible, our matrix elements are only slightly different from those in a single shell.

  3. Solution of the inverse scattering problem at fixed energy with non-physical S matrix elements

    International Nuclear Information System (INIS)

    Eberspaecher, M.; Amos, K.; Apagyi, B.

    1999-12-01

    The quantum mechanical inverse elastic scattering problem is solved with the modified Newton-Sabatier method. A set of S matrix elements calculated from a realistic analytic optical model potential serves as input data. It is demonstrated that the quality of the inversion potential can be improved by including non-physical S matrix elements to half, quarter and eighth valued partial waves if the original set does not contain enough information to determine the interaction potential. We demonstrate that results can be very sensitive to the choice of those non-physical S matrix values both with the analytic potential model and in a real application in which the experimental cross section for the symmetrical scattering system of 12 C+ 12 C at E=7.998 MeV is analyzed

  4. Bessel equation as an operator identity's matrix element in quantum mechanics

    International Nuclear Information System (INIS)

    Fan Hongyi; Li Chao

    2004-01-01

    We study the well-known Bessel equation itself in the framework of quantum mechanics. We show that the Bessel equation is a spontaneous result of an operator identity's matrix element in some definite entangled state representations, which is a fresh look. Application of this operator formalism in the Hankel transform of Laplace equation is presented

  5. Lattice calculation of hadronic weak matrix elements: the ΔI = 1/2 rule

    International Nuclear Information System (INIS)

    Bernard, C.

    1984-01-01

    A lattice Monte Carlo technique for calculating the matrix elements of weak operators is described. Emphasis is placed on the ΔI = 1/2 rule, which is such a large effect that the significant errors associated with current lattice methods (statistics, finite size, finite lattice spacing, extrapolations in quark mass, etc.) should not disguise the important qualitative features. A detailed exposition of the analytic bases for the calculation is given, and an attempt is made to avoid the questionable phenomenological assumptions (such as some of those inherent in the Penguin approach) which were necessary when matrix elements could not be calculated. The current state of the calculation-in-progress is described. This work is being done in collaboration with A. Soni, T. Draper, G. Hockney, and M. Rushton

  6. Short-distance matrix elements for $D$-meson mixing for 2+1 lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Chia Cheng [Univ. of Illinois, Champaign, IL (United States)

    2015-01-01

    We study the short-distance hadronic matrix elements for D-meson mixing with partially quenched Nf = 2+1 lattice QCD. We use a large set of the MIMD Lattice Computation Collaboration's gauge configurations with a2 tadpole-improved staggered sea quarks and tadpole-improved Lüscher-Weisz gluons. We use the a2 tadpole-improved action for valence light quarks and the Sheikoleslami-Wohlert action with the Fermilab interpretation for the valence charm quark. Our calculation covers the complete set of five operators needed to constrain new physics models for D-meson mixing. We match our matrix elements to the MS-NDR scheme evaluated at 3 GeV. We report values for the Beneke-Buchalla-Greub-Lenz-Nierste choice of evanescent operators.

  7. Comparison of Material Behavior of Matrix Graphite for HTGR Fuel Elements upon Irradiation: A literature Survey

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Young-Woo; Yeo, Seunghwan; Cho, Moon Sung [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2015-05-15

    The fuel elements for the HTGRs (i.e., spherical fuel element in pebble-bed type core design and fuel compact in prismatic core design) consists of coated fuel particles dispersed and bonded in a closely packed array within a carbonaceous matrix. This matrix is generally made by mixing fully graphitized natural and needle- or pitchcoke originated powders admixed with a binder material (pitch or phenolic resin), The resulting resinated graphite powder mixture, when compacted, may influence a number of material properties as well as its behavior under neutron irradiation during reactor operation. In the fabrication routes of these two different fuel element forms, different consolidation methods are employed; a quasi-isostatic pressing method is generally adopted to make pebbles while fuel compacts are fabricated by uni-axial pressing mode. The result showed that the hardness values obtained from the two directions showed an anisotropic behavior: The values obtained from the perpendicular section showed much higher micro hardness (176.6±10.5MPa in average) than from the parallel section ((125.6±MPa in average). This anisotropic behavior was concluded to be related to the microstructure of the matrix graphite. This may imply that the uni-axial pressing method to make compacts influence the microstructure of the matrix and hence the material properties of the matrix graphite.

  8. Some applications of the fractional Poisson probability distribution

    International Nuclear Information System (INIS)

    Laskin, Nick

    2009-01-01

    Physical and mathematical applications of the recently invented fractional Poisson probability distribution have been presented. As a physical application, a new family of quantum coherent states has been introduced and studied. As mathematical applications, we have developed the fractional generalization of Bell polynomials, Bell numbers, and Stirling numbers of the second kind. The appearance of fractional Bell polynomials is natural if one evaluates the diagonal matrix element of the evolution operator in the basis of newly introduced quantum coherent states. Fractional Stirling numbers of the second kind have been introduced and applied to evaluate the skewness and kurtosis of the fractional Poisson probability distribution function. A representation of the Bernoulli numbers in terms of fractional Stirling numbers of the second kind has been found. In the limit case when the fractional Poisson probability distribution becomes the Poisson probability distribution, all of the above listed developments and implementations turn into the well-known results of the quantum optics and the theory of combinatorial numbers.

  9. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  10. Weak matrix elements efforts on the lattice: Status and prospects

    International Nuclear Information System (INIS)

    Soni, A.

    1995-01-01

    Lattice approach to weak matrix elements is reviewed. Recent progress in treating heavy quarks on the lattice is briefly discussed. Illustrative sample of results obtained so far is given. Among them I elaborate on B K , line-integral B and B → K* γ . Experimental implications especially with regard to constraints on the Standard Model (i.e. Wolfenstein) parameters, V td measurements and expectations for B s -bar B s , oscillations are briefly discussed

  11. LIBS detection of heavy metal elements in liquid solutions by using wood pellet as sample matrix

    International Nuclear Information System (INIS)

    Wen Guanhong; Sun Duixiong; Su Maogen; Dong Chenzhong

    2013-01-01

    Laser-induced breakdown spectroscopy (LIBS) has been applied to the analysis of heavy metals in liquid sample. A new approach was presented to improve the detection limit and minimize the sample matrix effects, in which dried wood pellets absorbed the given amounts of Cr standard solutions and then were baked because they have stronger and rapid absorption properties for liquid samples as well as simple elemental compositions. In this work, we have taken a typical heavy metal Cr element as an example, and investigated the spectral feasibility of Cr solutions and dried wood pellets before and after absorbing Cr solutions at the same experimental conditions, respectively. The results were demonstrated to successfully produce a superior analytical response for heavy metal elements by using wood pellet as sample matrix according to obtained LOD of 0.07 ppm for Cr element in solutions. (author)

  12. LIBS Detection of Heavy Metal Elements in Liquid Solutions by Using Wood Pellet as Sample Matrix

    International Nuclear Information System (INIS)

    Wen Guanhong; Sun Duixiong; Su Maogen; Dong Chenzhong

    2014-01-01

    Laser-induced breakdown spectroscopy (LIBS) has been applied to the analysis of heavy metals in liquid samples. A new approach was presented to lower the limit of detection (LOD) and minimize the sample matrix effects, in which dried wood pellets absorbed the given amounts of Cr standard solutions and then were baked because they have stronger and rapid absorption properties for liquid samples as well as simple elemental compositions. In this work, we have taken a typical heavy metal Cr element as an example, and investigated the spectral feasibility of Cr solutions and dried wood pellets before and after absorbing Cr solutions at the same experimental conditions. The results were demonstrated to successfully produce a superior analytical response for heavy metal elements by using wood pellet as sample matrix according to the obtained LOD of 0.07 ppm for Cr element in solutions

  13. Development of a diffuse element matrix in 'planar' technology. A particular application: logical gate with coupled emitter

    International Nuclear Information System (INIS)

    Rousseau, P.

    1968-01-01

    In a first part, after a brief recall concerning 'planar' technology we discuss the various parasitic elements associated with integrated circuits components. Mathematical formulae of these elements are derived. In a second part, we present a matrix of 22 transistors and 12 resistors which has been realized. This matrix enables the integration of the major part of nuclear circuits. Some of the obtained circuits are shown, particularly an emitter coupled logic gate which presents good electrical behaviour. (author) [fr

  14. Calculation of the Cholesky factor directly from the stiffness matrix of the structural element

    International Nuclear Information System (INIS)

    Prates, C.L.M.; Soriano, H.L.

    1978-01-01

    The analysis of the structures of nuclear power plants requires the evaluation of the internal forces. This is attained by the solution of a system of equations. This solution takes most of the computing time and memory. One of the ways it can be achieved is based on the Cholesky factor. The structural matrix of the coeficients is transformed into an upper triangular matrix by the Cholesky decomposition. Cholesky factor can be obtained directly from the stiffness matrix of the structural element. The result can thus be obtained in a more precise and quick way. (Author)

  15. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  16. Generating matrix elements of the hamiltonian of the algebraic version of resonating group method on intrinsic wave functions with various oscillator lengths

    International Nuclear Information System (INIS)

    Badalov, S.A.; Filippov, G.F.

    1986-01-01

    The receipts to calculate the generating matrix elements of the algebraic version of resonating group method (RGM) are given for two- and three-cluster nucleon systems, the center of mass motion being separeted exactly. For the Hamiltonian with Gaussian nucleon-nucleon potential dependence the generating matrix elements of the RGM algebraic version can be written down explictly if matrix elements of the corresponding system on wave functions of the Brink cluster model are known

  17. Two-loop massive operator matrix elements for polarized and unpolarized deep-inelastic scattering

    Energy Technology Data Exchange (ETDEWEB)

    Bierenbaum, I.; Bluemlein, J.; Klein, S.

    2007-06-15

    The O({alpha}{sup 2}{sub s}) massive operator matrix elements for unpolarized and polarized heavy flavor production at asymptotic values Q{sup 2} >> m{sup 2} are calculated in Mellin space without applying the integration-by-parts method. (orig.)

  18. Diagrammatic technique for calculating matrix elements of collective operators in superradiance

    International Nuclear Information System (INIS)

    Lee, C.T.

    1975-01-01

    Adopting the so-called ''genealogical construction,'' one can express the eigenstates of collective operators corresponding to a specified mode for an N-atom system in terms of those for an (N-1) -atom system. Using these Dicke states as bases and using the Wigner-Eckart theorem, a matrix element of a collective operator of an arbitrary mode can be written as the product of an m-dependent factor and an m-independent reduced matrix element (RME). A set of recursion formulas for the RME is obtained. A graphical representation of the RME on the branching diagram for binary irreducible representations of permutation groups is then introduced. This gives a simple and systematic way of calculating the RME. This method is especially useful when the cooperation number r is close to N/2, where almost exact asymptotic expressions can be obtained easily. The result shows explicitly the geometry dependence of superradiance and the relative importance of r-conserving and r-nonconserving processes. This clears up the chief difficulty encountered in the Dicke-Schwendimann approach to the problem of N two-level atoms, spread over large regions, interacting with a multimode radiation field

  19. Closed form for two-photon free-free transition matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Karule, Erna E-mail: karule@latnet.lv

    2000-08-01

    Two-photon free-free transitions happen in the multiphoton ionization with more than one excess photon and in Bremsstrahlung. Up to now, the configuration space free-free transition amplitudes have not been written in closed form. We propose a modified Coulomb Green's function (CGF) Sturm ian expansion which allows one to obtain expressions for two-photon radial transition matrix elements in the closed form which are easy to continue analytically to calculate free-free transitions in H.

  20. Semiclassical S-matrix for black holes

    CERN Document Server

    Bezrukov, Fedor; Sibiryakov, Sergey

    2015-01-01

    We propose a semiclassical method to calculate S-matrix elements for two-stage gravitational transitions involving matter collapse into a black hole and evaporation of the latter. The method consistently incorporates back-reaction of the collapsing and emitted quanta on the metric. We illustrate the method in several toy models describing spherical self-gravitating shells in asymptotically flat and AdS space-times. We find that electrically neutral shells reflect via the above collapse-evaporation process with probability exp(-B), where B is the Bekenstein-Hawking entropy of the intermediate black hole. This is consistent with interpretation of exp(B) as the number of black hole states. The same expression for the probability is obtained in the case of charged shells if one takes into account instability of the Cauchy horizon of the intermediate Reissner-Nordstrom black hole. Our semiclassical method opens a new systematic approach to the gravitational S-matrix in the non-perturbative regime.

  1. Single top quark production and Vtb CKM matrix element measurement in high energy e+e- collisions

    International Nuclear Information System (INIS)

    Dokholyan, N.V.; Jikia, G.V.

    1993-01-01

    The new method of determination of CKM mixing matrix element V tb has been proposed. It has been shown, that at the future colliders one will measure the tb-mixing element with the accuracy 12 - 28%. 16 refs., 6 figs., 1 tab

  2. Measurements of the CKM matrix element V(cb)

    CERN Document Server

    Di Ciaccio, L

    1996-01-01

    A review of the measurements of the element V ch of the CabibboKobayashi-Maskawa matrix is presented. The experimental results discussed here are based on the selection of the decays B -t D' lv and on the study of the differential decay rate as a function of the momentum transfer from the B to D' particle. This method allows to measure IV chi with a reduced model dependence. This review describes mainly the most recent analyses which have been performed by the LEP Collaborations. The IVcbl determination based on the inclusive semileptonic decay width of the B hadrons is also shortly presented. The results obtained with these two methods are averaged and prospects for the future are discussed

  3. Structure of the two-neutrino double-β decay matrix elements within perturbation theory

    Science.gov (United States)

    Štefánik, Dušan; Šimkovic, Fedor; Faessler, Amand

    2015-06-01

    The two-neutrino double-β Gamow-Teller and Fermi transitions are studied within an exactly solvable model, which allows a violation of both spin-isospin SU(4) and isospin SU(2) symmetries, and is expressed with generators of the SO(8) group. It is found that this model reproduces the main features of realistic calculation within the quasiparticle random-phase approximation with isospin symmetry restoration concerning the dependence of the two-neutrino double-β decay matrix elements on isovector and isoscalar particle-particle interactions. By using perturbation theory an explicit dependence of the two-neutrino double-β decay matrix elements on the like-nucleon pairing, particle-particle T =0 and T =1 , and particle-hole proton-neutron interactions is obtained. It is found that double-β decay matrix elements do not depend on the mean field part of Hamiltonian and that they are governed by a weak violation of both SU(2) and SU(4) symmetries by the particle-particle interaction of Hamiltonian. It is pointed out that there is a dominance of two-neutrino double-β decay transition through a single state of intermediate nucleus. The energy position of this state relative to energies of initial and final ground states is given by a combination of strengths of residual interactions. Further, energy-weighted Fermi and Gamow-Teller sum rules connecting Δ Z =2 nuclei are discussed. It is proposed that these sum rules can be used to study the residual interactions of the nuclear Hamiltonian, which are relevant for charge-changing nuclear transitions.

  4. Two-loop operator matrix elements for massive fermionic local twist-2 operators in QED

    International Nuclear Information System (INIS)

    Bluemlein, J.; Freitas, A. de; Universidad Simon Bolivar, Caracas; Neerven, W.L. van

    2011-11-01

    We describe the calculation of the two--loop massive operator matrix elements with massive external fermions in QED. We investigate the factorization of the O(α 2 ) initial state corrections to e + e - annihilation into a virtual boson for large cms energies s >>m 2 e into massive operator matrix elements and the massless Wilson coefficients of the Drell-Yan process adapting the color coefficients to the case of QED, as proposed by F. A. Berends et. al. (Nucl. Phys. B 297 (1988)429). Our calculations show explicitly that the representation proposed there works at one-loop order and up to terms linear in ln (s/m 2 e ) at two-loop order. However, the two-loop constant part contains a few structural terms, which have not been obtained in previous direct calculations. (orig.)

  5. Probability elements of the mathematical theory

    CERN Document Server

    Heathcote, C R

    2000-01-01

    Designed for students studying mathematical statistics and probability after completing a course in calculus and real variables, this text deals with basic notions of probability spaces, random variables, distribution functions and generating functions, as well as joint distributions and the convergence properties of sequences of random variables. Includes worked examples and over 250 exercises with solutions.

  6. Energy and energy gradient matrix elements with N-particle explicitly correlated complex Gaussian basis functions with L =1

    Science.gov (United States)

    Bubin, Sergiy; Adamowicz, Ludwik

    2008-03-01

    In this work we consider explicitly correlated complex Gaussian basis functions for expanding the wave function of an N-particle system with the L =1 total orbital angular momentum. We derive analytical expressions for various matrix elements with these basis functions including the overlap, kinetic energy, and potential energy (Coulomb interaction) matrix elements, as well as matrix elements of other quantities. The derivatives of the overlap, kinetic, and potential energy integrals with respect to the Gaussian exponential parameters are also derived and used to calculate the energy gradient. All the derivations are performed using the formalism of the matrix differential calculus that facilitates a way of expressing the integrals in an elegant matrix form, which is convenient for the theoretical analysis and the computer implementation. The new method is tested in calculations of two systems: the lowest P state of the beryllium atom and the bound P state of the positronium molecule (with the negative parity). Both calculations yielded new, lowest-to-date, variational upper bounds, while the number of basis functions used was significantly smaller than in previous studies. It was possible to accomplish this due to the use of the analytic energy gradient in the minimization of the variational energy.

  7. Energy and energy gradient matrix elements with N-particle explicitly correlated complex Gaussian basis functions with L=1.

    Science.gov (United States)

    Bubin, Sergiy; Adamowicz, Ludwik

    2008-03-21

    In this work we consider explicitly correlated complex Gaussian basis functions for expanding the wave function of an N-particle system with the L=1 total orbital angular momentum. We derive analytical expressions for various matrix elements with these basis functions including the overlap, kinetic energy, and potential energy (Coulomb interaction) matrix elements, as well as matrix elements of other quantities. The derivatives of the overlap, kinetic, and potential energy integrals with respect to the Gaussian exponential parameters are also derived and used to calculate the energy gradient. All the derivations are performed using the formalism of the matrix differential calculus that facilitates a way of expressing the integrals in an elegant matrix form, which is convenient for the theoretical analysis and the computer implementation. The new method is tested in calculations of two systems: the lowest P state of the beryllium atom and the bound P state of the positronium molecule (with the negative parity). Both calculations yielded new, lowest-to-date, variational upper bounds, while the number of basis functions used was significantly smaller than in previous studies. It was possible to accomplish this due to the use of the analytic energy gradient in the minimization of the variational energy.

  8. Three loop contributions to the matrix elements in the variable flavor number scheme

    Energy Technology Data Exchange (ETDEWEB)

    Bluemlein, Johannes; Hasselhuhn, Alexander [DESY (Germany); Schneider, Carsten [RISC, JKU Linz (Austria)

    2012-07-01

    The variable flavor number scheme may be used to describe parton distributions in the transition region in which one heavy quark gradually becomes a light flavor. We present first three-loop results to the massive operator matrix elements A{sub gg} and A{sub gq} for the contributions due to bubble topologies {proportional_to}T{sub F}{sup 2} n{sub f} at general values of the Mellin variable N. The calculation has been performed using higher transcendental functions and by applying modern summation technologies encoded in the package Sigma. These massive operator matrix elements describe the universal contributions in the matching of different flavor sectors, which are the logarithmic and constant contributions in the ratio of m{sup 2}{sub H}/Q{sup 2}, with Q{sup 2} the virtuality and m{sub H} the respective heavy quark mass. The framework allows to derive heavy quark parton distributions which are of relevance for calculating specific processes at hadron-hadron colliders.

  9. Extending the Matrix Element Method beyond the Born approximation: calculating event weights at next-to-leading order accuracy

    International Nuclear Information System (INIS)

    Martini, Till; Uwer, Peter

    2015-01-01

    In this article we illustrate how event weights for jet events can be calculated efficiently at next-to-leading order (NLO) accuracy in QCD. This is a crucial prerequisite for the application of the Matrix Element Method in NLO. We modify the recombination procedure used in jet algorithms, to allow a factorisation of the phase space for the real corrections into resolved and unresolved regions. Using an appropriate infrared regulator the latter can be integrated numerically. As illustration, we reproduce differential distributions at NLO for two sample processes. As further application and proof of concept, we apply the Matrix Element Method in NLO accuracy to the mass determination of top quarks produced in e"+e"− annihilation. This analysis is relevant for a future Linear Collider. We observe a significant shift in the extracted mass depending on whether the Matrix Element Method is used in leading or next-to-leading order.

  10. Something different - caching applied to calculation of impedance matrix elements

    CSIR Research Space (South Africa)

    Lysko, AA

    2012-09-01

    Full Text Available of the multipliers, the approximating functions are used any required parameters, such as input impedance or gain pattern etc. The method is relatively straightforward but, especially for small to medium matrices, requires spending time on filling... of the computing the impedance matrix for the method of moments, or a similar method, such as boundary element method (BEM) [22], with the help of the flowchart shown in Figure 1. Input Parameters (a) Search the cached data for a match (b) A match found...

  11. Energy diffusion in strongly driven quantum chaotic systems: the role of correlations of the matrix elements

    International Nuclear Information System (INIS)

    Elyutin, P V; Rubtsov, A N

    2008-01-01

    The energy evolution of a quantum chaotic system under the perturbation that harmonically depends on time is studied for the case of large perturbation, in which the rate of transition calculated from the Fermi golden rule (FGR) is about or exceeds the frequency of perturbation. For this case, the models of the Hamiltonian with random non-correlated matrix elements demonstrate that the energy evolution retains its diffusive character, but the rate of diffusion increases slower than the square of the magnitude of perturbation, thus destroying the quantum-classical correspondence for the energy diffusion and the energy absorption in the classical limit ℎ → 0. The numerical calculation carried out for a model built from the first principles (the quantum analog of the Pullen-Edmonds oscillator) demonstrates that the evolving energy distribution, apart from the diffusive component, contains a ballistic one with the energy dispersion that is proportional to the square of time. This component originates from the chains of matrix elements with correlated signs and vanishes if the signs of matrix elements are randomized. The presence of the ballistic component formally extends the applicability of the FGR to the non-perturbative domain and restores the quantum-classical correspondence

  12. IMPACT OF MATRIX INVERSION ON THE COMPLEXITY OF THE FINITE ELEMENT METHOD

    Directory of Open Access Journals (Sweden)

    M. Sybis

    2016-04-01

    Full Text Available Purpose. The development of a wide construction market and a desire to design innovative architectural building constructions has resulted in the need to create complex numerical models of objects having increasingly higher computational complexity. The purpose of this work is to show that choosing a proper method for solving the set of equations can improve the calculation time (reduce the complexity by a few levels of magnitude. Methodology. The article presents an analysis of the impact of matrix inversion algorithm on the deflection calculation in the beam, using the finite element method (FEM. Based on the literature analysis, common methods of calculating set of equations were determined. From the found solutions the Gaussian elimination, LU and Cholesky decomposition methods have been implemented to determine the effect of the matrix inversion algorithm used for solving the equations set on the number of computational operations performed. In addition, each of the implemented method has been further optimized thereby reducing the number of necessary arithmetic operations. Findings. These optimizations have been performed on the use of certain properties of the matrix, such as symmetry or significant number of zero elements in the matrix. The results of the analysis are presented for the division of the beam to 5, 50, 100 and 200 nodes, for which the deflection has been calculated. Originality. The main achievement of this work is that it shows the impact of the used methodology on the complexity of solving the problem (or equivalently, time needed to obtain results. Practical value. The difference between the best (the less complex and the worst (the most complex is in the row of few orders of magnitude. This result shows that choosing wrong methodology may enlarge time needed to perform calculation significantly.

  13. Study of the Matrix Effect on the Plasma Characterization of Heavy Elements in Soil Sediments

    Directory of Open Access Journals (Sweden)

    Tawfik W.

    2007-01-01

    Full Text Available Laser-induced breakdown spectroscopy (LIBS has been applied to perform a study of the matrix effect on the plasma characterization of soil sediment targets. The plasma is generated by focusing a pulsed Nd: YAG laser on the target in air at atmospheric pressure. The plasma emission spectrum was detected using a portable Echelle spectrometer (Mechelle 7500 — Multichannel Instruments, Stockholm, Sweden with intensified CCD camera. Spectroscopic analysis of plasma evolution of laser produced plasmas has been characterized in terms of their spectra, and electron temperature. Four heavy elements V, Pb, Mn and Co were determined in the obtained spectra. The LTE and optically thin plasma conditions were verified for the produced plasma. The electron temperature and density were determined using the emission intensity and stark broadening, respectively, of the spectral lines of the heavy elements in the soil sediments. The electron temperature does not change with concentration. For environmental applications, the obtained results showed the capability of the proposed LIBS setup with the portable Mechelle 7500 spectrometer to be applied in-situ for real-time measurements of the variation of the matrix elemental composition of soil sediments by following up only a single element as a marker for the composition of the soil sediment without need of analysis of the other elements.

  14. Controlling inclusive cross sections in parton shower + matrix element merging

    Energy Technology Data Exchange (ETDEWEB)

    Plaetzer, Simon

    2012-11-15

    We propose an extension of matrix element plus parton shower merging at tree level to preserve inclusive cross sections obtained from the merged and showered sample. Implementing this constraint generates approximate next-to-leading order (NLO) contributions similar to the LoopSim approach. We then show how full NLO, or in principle even higher order, corrections can be added consistently, including constraints on inclusive cross sections to account for yet missing parton shower accuracy at higher logarithmic order. We also show how NLO accuracy below the merging scale can be obtained.

  15. Controlling inclusive cross sections in parton shower + matrix element merging

    International Nuclear Information System (INIS)

    Plaetzer, Simon

    2012-11-01

    We propose an extension of matrix element plus parton shower merging at tree level to preserve inclusive cross sections obtained from the merged and showered sample. Implementing this constraint generates approximate next-to-leading order (NLO) contributions similar to the LoopSim approach. We then show how full NLO, or in principle even higher order, corrections can be added consistently, including constraints on inclusive cross sections to account for yet missing parton shower accuracy at higher logarithmic order. We also show how NLO accuracy below the merging scale can be obtained.

  16. Extending the Matrix Element Method beyond the Born approximation: calculating event weights at next-to-leading order accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Martini, Till; Uwer, Peter [Humboldt-Universität zu Berlin, Institut für Physik,Newtonstraße 15, 12489 Berlin (Germany)

    2015-09-14

    In this article we illustrate how event weights for jet events can be calculated efficiently at next-to-leading order (NLO) accuracy in QCD. This is a crucial prerequisite for the application of the Matrix Element Method in NLO. We modify the recombination procedure used in jet algorithms, to allow a factorisation of the phase space for the real corrections into resolved and unresolved regions. Using an appropriate infrared regulator the latter can be integrated numerically. As illustration, we reproduce differential distributions at NLO for two sample processes. As further application and proof of concept, we apply the Matrix Element Method in NLO accuracy to the mass determination of top quarks produced in e{sup +}e{sup −} annihilation. This analysis is relevant for a future Linear Collider. We observe a significant shift in the extracted mass depending on whether the Matrix Element Method is used in leading or next-to-leading order.

  17. Analysis of smart beams with piezoelectric elements using impedance matrix and inverse Laplace transform

    International Nuclear Information System (INIS)

    Li, Guo-Qing; Miao, Xing-Yuan; Hu, Yuan-Tai; Wang, Ji

    2013-01-01

    A comprehensive study on smart beams with piezoelectric elements using an impedance matrix and the inverse Laplace transform is presented. Based on the authors’ previous work, the dynamics of some elements in beam-like smart structures are represented by impedance matrix equations, including a piezoelectric stack, a piezoelectric bimorph, an elastic straight beam or a circular curved beam. A further transform is applied to the impedance matrix to obtain a set of implicit transfer function matrices. Apart from the analytical solutions to the matrices of smart beams, one computation procedure is proposed to obtained the impedance matrices and transfer function matrices using FEA. By these means the dynamic solution of the elements in the frequency domain is transformed to that in Laplacian s-domain and then inversely transformed to time domain. The connections between the elements and boundary conditions of the smart structures are investigated in detail, and one integrated system equation is finally obtained using the symbolic operation of TF matrices. A procedure is proposed for dynamic analysis and control analysis of the smart beam system using mode superposition and a numerical inverse Laplace transform. The first example is given to demonstrate building transfer function associated impedance matrices using both FEA and analytical solutions. The second example is to verify the ability of control analysis using a suspended beam with PZT patches under close-loop control. The third example is designed for dynamic analysis of beams with a piezoelectric stack and a piezoelectric bimorph under various excitations. The last example of one smart beam with a PPF controller shows the applicability to the control analysis of complex systems using the proposed method. All results show good agreement with the other results in the previous literature. The advantages of the proposed methods are also discussed at the end of this paper. (paper)

  18. Massive 3-loop ladder diagrams for quarkonic local operator matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, Jakob; Schneider, Carsten [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation; Bluemlein, Johannes; Hasselhuhn, Alexander; Wissbrock, Fabian [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Klein, Sebastian [Technische Hochschule Aachen (Germany). Inst. fuer Theoretische Physik

    2012-06-15

    3-loop diagrams of the ladder-type, which emerge for local quarkonic twist-2 operator matrix elements, are computed directly for general values of the Mellin variable N using Appell-function representations and applying modern summation technologies provided by the package Sigma and the method of hyperlogarithms. In some of the diagrams generalized harmonic sums with {xi} element of {l_brace}1,1/2,2{r_brace} emerge beyond the usual nested harmonic sums. As the asymptotic representation of the corresponding integrals shows, the generalized sums conspire giving well behaved expressions for large values of N. These diagrams contribute to the 3-loop heavy flavor Wilson coefficients of the structure functions in deep-inelastic scattering in the region Q{sup 2} >> m{sup 2}.

  19. Massive 3-loop ladder diagrams for quarkonic local operator matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, Jakob [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstrasse 69, A-4040 Linz (Austria); Bluemlein, Johannes, E-mail: johannes.bluemlein@desy.de [Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Hasselhuhn, Alexander [Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Klein, Sebastian [Research Institut fuer Theoretische Physik E, RWTH Aachen University, D-52056 Aachen (Germany); Schneider, Carsten [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstrasse 69, A-4040 Linz (Austria); Wissbrock, Fabian [Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany)

    2012-11-01

    3-loop diagrams of the ladder-type, which emerge for local quarkonic twist-2 operator matrix elements, are computed directly for general values of the Mellin variable N using Appell-function representations and applying modern summation technologies provided by the package Sigma and the method of hyperlogarithms. In some of the diagrams generalized harmonic sums with {xi} Element-Of {l_brace}1,1/2,2{r_brace} emerge beyond the usual nested harmonic sums. As the asymptotic representation of the corresponding integrals shows, the generalized sums conspire giving well behaved expressions for large values of N. These diagrams contribute to the 3-loop heavy flavor Wilson coefficients of the structure functions in deep-inelastic scattering in the region Q{sup 2} Much-Greater-Than m{sup 2}.

  20. Non-equilibrium random matrix theory. Transition probabilities

    International Nuclear Information System (INIS)

    Pedro, Francisco Gil; Westphal, Alexander

    2016-06-01

    In this letter we present an analytic method for calculating the transition probability between two random Gaussian matrices with given eigenvalue spectra in the context of Dyson Brownian motion. We show that in the Coulomb gas language, in large N limit, memory of the initial state is preserved in the form of a universal linear potential acting on the eigenvalues. We compute the likelihood of any given transition as a function of time, showing that as memory of the initial state is lost, transition probabilities converge to those of the static ensemble.

  1. Non-equilibrium random matrix theory. Transition probabilities

    Energy Technology Data Exchange (ETDEWEB)

    Pedro, Francisco Gil [Univ. Autonoma de Madrid (Spain). Dept. de Fisica Teorica; Westphal, Alexander [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany). Gruppe Theorie

    2016-06-15

    In this letter we present an analytic method for calculating the transition probability between two random Gaussian matrices with given eigenvalue spectra in the context of Dyson Brownian motion. We show that in the Coulomb gas language, in large N limit, memory of the initial state is preserved in the form of a universal linear potential acting on the eigenvalues. We compute the likelihood of any given transition as a function of time, showing that as memory of the initial state is lost, transition probabilities converge to those of the static ensemble.

  2. Fuzzy vulnerability matrix

    International Nuclear Information System (INIS)

    Baron, Jorge H.; Rivera, S.S.

    2000-01-01

    The so-called vulnerability matrix is used in the evaluation part of the probabilistic safety assessment for a nuclear power plant, during the containment event trees calculations. This matrix is established from what is knows as Numerical Categories for Engineering Judgement. This matrix is usually established with numerical values obtained with traditional arithmetic using the set theory. The representation of this matrix with fuzzy numbers is much more adequate, due to the fact that the Numerical Categories for Engineering Judgement are better represented with linguistic variables, such as 'highly probable', 'probable', 'impossible', etc. In the present paper a methodology to obtain a Fuzzy Vulnerability Matrix is presented, starting from the recommendations on the Numerical Categories for Engineering Judgement. (author)

  3. 3-Loop massive O(T{sub 2}{sup F}) contributions to the DIS operator matrix element A{sub gg}

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, J.; Schneider, C. [Johannes Kepler Univ., Linz (Austria). Inst. for Symbolic Computation (RISC); Bluemlein, J.; Freitas, A. de [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Hasselhuhn, A.; Round, M. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Johannes Kepler Univ., Linz (Austria). Inst. for Symbolic Computation (RISC); Manteuffel, A. von [Mainz Univ. (Germany). PRISMA Cluster of Excellence

    2014-09-15

    Contributions to heavy flavour transition matrix elements in the variable flavour number scheme are considered at 3-loop order. In particular a calculation of the diagrams with two equal masses that contribute to the massive operator matrix element A{sup (3)}{sub gg,Q} is performed. In the Mellin space result one finds finite nested binomial sums. In x-space these sums correspond to iterated integrals over an alphabet containing also square-root valued letters.

  4. Effect of the Heat Treatment on the Graphite Matrix of Fuel Element for HTGR

    International Nuclear Information System (INIS)

    Lee, Chungyong; Lee, Seungjae; Suh, Jungmin; Jo, Youngho; Lee, Youngwoo; Cho, Moonsung

    2013-01-01

    In this paper, the cylinder-formed fuel element for the block type reactor is focused on, which consists of the large part of graphite matrix. One of the most important properties of the graphite matrix is the mechanical strength for the high reliability because the graphite matrix should be enabled to protect the TRISO particles from the irradiation environment and the impact from the outside. In this study, the three kinds of candidate graphites and Phenol as a binder were chosen and mixed with each other, formed and heated for the compressive strength test. The objective of this research is to optimize the kinds and composition of the mixed graphite and the forming process by evaluating the compressive strength before/after heat treatment (carbonization of binder). In this study, the effect of heat treatment on graphite matrix was studied in terms of the density and the compressive strength. The size (diameter and length) of pellet is increased by heat treatment. Due to additional weight reduction and swelling (length and diameter) of samples the density of graphite pellet is decreased from about 2.0 to about 1.7g/cm 3 . From the mechanical test results, the compressive strength of graphite pellets was related to the various conditions such as the contents of binder, the kinds of graphite and the heat treatment. Both the green pellet and the heat treated pellet, the compressive strength of G+S+P pellets is relatively higher than that of R+S+P pellets. To optimize fuel element matrix, the effect of Phenol and other binders, graphite composition and the heat treatment on the mechanical properties will be deeply investigated for further study

  5. Heavy flavor operator matrix elements at O({alpha}{sub s}{sup 3})

    Energy Technology Data Exchange (ETDEWEB)

    Bierenbaum, Isabella; Buemlein, Johannes; Klein, Sebastian

    2008-12-15

    The heavy quark effects in deep.inelastic scattering in the asymptotic regime Q{sup 2}>>m{sup 2} can be described by heavy flavor operator matrix elements. Complete analytic expressions for these objects are currently known to NLO. We present first results for fixed moments at NNLO. This involves a recalculation of fixed moments of the corresponding NNLO anomalous dimensions, which we thereby confirm. (orig.)

  6. Matrix elements of N-particle explicitly correlated Gaussian basis functions with complex exponential parameters.

    Science.gov (United States)

    Bubin, Sergiy; Adamowicz, Ludwik

    2006-06-14

    In this work we present analytical expressions for Hamiltonian matrix elements with spherically symmetric, explicitly correlated Gaussian basis functions with complex exponential parameters for an arbitrary number of particles. The expressions are derived using the formalism of matrix differential calculus. In addition, we present expressions for the energy gradient that includes derivatives of the Hamiltonian integrals with respect to the exponential parameters. The gradient is used in the variational optimization of the parameters. All the expressions are presented in the matrix form suitable for both numerical implementation and theoretical analysis. The energy and gradient formulas have been programmed and used to calculate ground and excited states of the He atom using an approach that does not involve the Born-Oppenheimer approximation.

  7. Matrix elements of N-particle explicitly correlated Gaussian basis functions with complex exponential parameters

    Science.gov (United States)

    Bubin, Sergiy; Adamowicz, Ludwik

    2006-06-01

    In this work we present analytical expressions for Hamiltonian matrix elements with spherically symmetric, explicitly correlated Gaussian basis functions with complex exponential parameters for an arbitrary number of particles. The expressions are derived using the formalism of matrix differential calculus. In addition, we present expressions for the energy gradient that includes derivatives of the Hamiltonian integrals with respect to the exponential parameters. The gradient is used in the variational optimization of the parameters. All the expressions are presented in the matrix form suitable for both numerical implementation and theoretical analysis. The energy and gradient formulas have been programed and used to calculate ground and excited states of the He atom using an approach that does not involve the Born-Oppenheimer approximation.

  8. Overcoming Matrix Effects in a Complex Sample: Analysis of Multiple Elements in Multivitamins by Atomic Absorption Spectroscopy

    Science.gov (United States)

    Arnold, Randy J.; Arndt, Brett; Blaser, Emilia; Blosser, Chris; Caulton, Dana; Chung, Won Sog; Fiorenza, Garrett; Heath, Wyatt; Jacobs, Alex; Kahng, Eunice; Koh, Eun; Le, Thao; Mandla, Kyle; McCory, Chelsey; Newman, Laura; Pithadia, Amit; Reckelhoff, Anna; Rheinhardt, Joseph; Skljarevski, Sonja; Stuart, Jordyn; Taylor, Cassie; Thomas, Scott; Tse, Kyle; Wall, Rachel; Warkentien, Chad

    2011-01-01

    A multivitamin tablet and liquid are analyzed for the elements calcium, magnesium, iron, zinc, copper, and manganese using atomic absorption spectrometry. Linear calibration and standard addition are used for all elements except calcium, allowing for an estimate of the matrix effects encountered for this complex sample. Sample preparation using…

  9. Milling Behavior of Matrix Graphite Powders with Different Binder Materials in HTGR Fuel Element Fabrication: I. Variation in Particle Size Distribution

    International Nuclear Information System (INIS)

    Lee, Young Woo; Cho, Moon Sung

    2011-01-01

    The fuel element for HTGR is manufactured by mixing coated fuel particles with matrix graphite powder and forming into either pebble type or cylindrical type compacts depending on their use in different HTGR cores. The coated fuel particle, the so-called TRISO particle, consists of 500-μm spherical UO 2 particles coated with the low density buffer Pyrolytic Carbon (PyC) layer, the inner and outer high density PyC layer and SiC layer sandwiched between the two inner and outer PyC layers. The coated TRISO particles are mixed with a matrix graphite powder properly prepared and pressed into a spherical shape or a cylindrical compact finally heat-treated at about 1900 .deg. C. These fuel elements can have different sizes and forms of compact. The basic steps for manufacturing a fuel element include preparation of graphite matrix powder, overcoating the fuel particles, mixing the fuel particles with a matrix powder, carbonizing green compact, and the final high-temperature heat treatment of the carbonized fuel compact. In order to develop a fuel compact fabrication technology, it is important to develop a technology to prepare the matrix graphite powder (MGP) with proper characteristics, which has a strong influence on further steps and the material properties of fuel element. In this work, the milling behavior of matrix graphite powder mixture with different binder materials and their contents was investigated by analyzing the change in particle size distribution with different milling time

  10. Efficient improvement of virtual crack extension method by a derivative of the finite element stiffness matrix

    International Nuclear Information System (INIS)

    Ishikawa, H.; Nakano, S.; Yuuki, R.; Chung, N.Y.

    1991-01-01

    In the virtual crack extension method, the stress intensity factor, K, is obtained from the converged value of the energy release rate by the difference of the finite element stiffness matrix when some crack extension are taken. Instead of the numerical difference of the finite element stiffness, a new method to use a direct dirivative of the finite element stiffness matrix with respect to crack length is proposed. By the present method, the results of some example problems, such as uniform tension problems of a square plate with a center crack and a rectangular plate with an internal slant crack, are obtained with high accuracy and good efficiency. Comparing with analytical results, the present values of the stress intensity factors of the problems are obtained with the error that is less than 0.6%. This shows the numerical assurance of the usefulness of the present method. A personal computer program for the analysis is developed

  11. Number-conserving random phase approximation with analytically integrated matrix elements

    International Nuclear Information System (INIS)

    Kyotoku, M.; Schmid, K.W.; Gruemmer, F.; Faessler, A.

    1990-01-01

    In the present paper a number conserving random phase approximation is derived as a special case of the recently developed random phase approximation in general symmetry projected quasiparticle mean fields. All the occurring integrals induced by the number projection are performed analytically after writing the various overlap and energy matrices in the random phase approximation equation as polynomials in the gauge angle. In the limit of a large number of particles the well-known pairing vibration matrix elements are recovered. We also present a new analytically number projected variational equation for the number conserving pairing problem

  12. Improved determination of hadron matrix elements using the variational method

    International Nuclear Information System (INIS)

    Dragos, J.; Kamleh, W.; Leinweber, D.B.; Zanotti, J.M.; Rakow, P.E.L.; Young, R.D.; Adelaide Univ.

    2015-11-01

    The extraction of hadron form factors in lattice QCD using the standard two- and three-point correlator functions has its limitations. One of the most commonly studied sources of systematic error is excited state contamination, which occurs when correlators are contaminated with results from higher energy excitations. We apply the variational method to calculate the axial vector current g A and compare the results to the more commonly used summation and two-exponential fit methods. The results demonstrate that the variational approach offers a more efficient and robust method for the determination of nucleon matrix elements.

  13. Matrix Elements of One- and Two-Body Operators in the Unitary Group Approach (I)-Formalism

    Institute of Scientific and Technical Information of China (English)

    DAI Lian-Rong; PAN Feng

    2001-01-01

    The tensor algebraic method is used to derive general one- and two-body operator matrix elements within the Un representations, which are useful in the unitary group approach to the configuration interaction problems of quantum many-body systems.

  14. The nuclear reaction matrix

    International Nuclear Information System (INIS)

    Krenciglowa, E.M.; Kung, C.L.; Kuo, T.T.S.; Osnes, E.; and Department of Physics, State University of New York at Stony Brook, Stony Brook, New York 11794)

    1976-01-01

    Different definitions of the reaction matrix G appropriate to the calculation of nuclear structure are reviewed and discussed. Qualitative physical arguments are presented in support of a two-step calculation of the G-matrix for finite nuclei. In the first step the high-energy excitations are included using orthogonalized plane-wave intermediate states, and in the second step the low-energy excitations are added in, using harmonic oscillator intermediate states. Accurate calculations of G-matrix elements for nuclear structure calculations in the Aapprox. =18 region are performed following this procedure and treating the Pauli exclusion operator Q 2 /sub p/ by the method of Tsai and Kuo. The treatment of Q 2 /sub p/, the effect of the intermediate-state spectrum and the energy dependence of the reaction matrix are investigated in detail. The present matrix elements are compared with various matrix elements given in the literature. In particular, close agreement is obtained with the matrix elements calculated by Kuo and Brown using approximate methods

  15. Two-loop massive fermionic operator matrix elements and intial state QED corrections to e{sup +}e{sup -}{yields}{gamma}{sup *}/Z{sup *}

    Energy Technology Data Exchange (ETDEWEB)

    Bluemlein, J. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Freitas, A. de [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)]|[Universidad Simon Bolivar, Caracas (Venezuela). Dept. de Fisica; Neerven, W. van [Leiden Univ. (Netherlands). Lorentz Institute

    2008-12-15

    We describe the calculation of the two-loop massive operator matrix elements for massive external fermions. These matrix elements are needed for the calculation of the O({alpha}{sup 2}) initial state radiative corrections to e{sup +}e{sup -} annihilation into a neutral virtual gauge boson, based on the renormalization group technique. (orig.)

  16. The matrix element for radiative Bhabha scattering in the forward direction

    International Nuclear Information System (INIS)

    Kleiss, R.

    1993-09-01

    We present an approximation to the matrix element for the process e + e - →e + e - γ, appropriate to the situation where one or both of the fermions are scattered over very small angles. The leading terms in the situation where all scattering angles are small contains not only terms quadratic in the electron mass, but also quartic and even sextic terms must be included. Special attention is devoted to the numerical stability of the resultant expression. Its relation to several existing formulae is discussed. (orig.)

  17. Patience of matrix games

    DEFF Research Database (Denmark)

    Hansen, Kristoffer Arnsfelt; Ibsen-Jensen, Rasmus; Podolskii, Vladimir V.

    2013-01-01

    For matrix games we study how small nonzero probability must be used in optimal strategies. We show that for image win–lose–draw games (i.e. image matrix games) nonzero probabilities smaller than image are never needed. We also construct an explicit image win–lose game such that the unique optimal...

  18. The mineral chemistry and origin of inclusion matrix and meteorite matrix in the Allende CV3 chondrite

    International Nuclear Information System (INIS)

    Kornacki, A.S.; Wood, J.A.; Harvard Univ., Cambridge, MA

    1984-01-01

    The two textural varieties of olivine-rich Allende inclusions consist primarily of a porous, fine-grained mafic constituent that differs from the opaque meteorite matrix of CV3 chondrites by being relatively depleted in sulfides, metal grains, and carbonaceous material. Olivine is the most abundant mineral in Allende inclusion matrix; clinopyroxene, nepheline, sodalite, and Ti-Al-pyroxene occur in lesser amounts. Olivine in unrimmed olivine aggregates is ferrous and has a narrow compositional range. Olivine in rimmed olivine aggregates is, on average, more magnesian, with a wider compositional range. Olivine grains in the granular rims of Type 1B inclusions are zoned, with magnesian cores and ferrous rinds. Ferrous olivines in both varieties of inclusions commonly contain significant amounts of Al 2 O 3 , CaO and TiO 2 , refractory elements that probably occur in submicroscopic inclusions of Ca, Al, Ti-rich glass. Defocussed beam analyses of Allende matrix materials are discussed. (author)

  19. Separation of soft and collinear infrared limits of QCD squared matrix elements

    CERN Document Server

    Nagy, Zoltan; Trócsányi, Z L; Trocsanyi, Zoltan; Somogyi, Gabor; Trocsanyi, Zoltan

    2007-01-01

    We present a simple way of separating the overlap between the soft and collinear factorization formulae of QCD squared matrix elements. We check its validity explicitly for single and double unresolved emissions of tree-level processes. The new method makes possible the definition of helicity-dependent subtraction terms for regularizing the real contributions in computing radiative corrections to QCD jet cross sections. This implies application of Monte Carlo helicity summation in computing higher order corrections.

  20. Plasma-related matrix effects in inductively coupled plasma--atomic emission spectrometry by group I and group II matrix-elements

    International Nuclear Information System (INIS)

    Chan, George C.-Y.; Chan, W.-T.

    2003-01-01

    The effects of Na, K, Ca and Ba matrices on the plasma excitation conditions in inductively coupled plasma-atomic emission spectrometry (ICP-AES) were studied. Normalized relative intensity was used to indicate the extent of the plasma-related matrix effects. The group I matrices have no effects on the plasma excitation conditions. In contrast, the group II matrices depress the normalized relative intensities of some spectral lines. Specifically, the Group II matrices have no effects on the normalized relative intensity of atomic lines of low upper energy level (soft lines), but reduce the normalized relative intensity of some ionic lines and atomic lines of high energy level (hard lines). The Group II matrices seem to shift the Saha balance of the analytes only; no shift in the Boltzmann balance was observed experimentally. Moreover, for some ionic lines with sum of ionization and excitation potentials close to the ionization potential of argon (15.75 eV), the matrix effect is smaller than other ionic lines of the same element. The reduced matrix effects may be attributed qualitatively to charge transfer excitation mechanism of these ionic lines. Charge transfer reaction renders ionic emission lines from the quasi-resonant levels similar in characteristics of atomic lines. The contribution of charge transfer relative to excitation by other non-specific excitation mechanisms (via Saha balance and Boltzmann balance) determines the degree of atomic behavior of a quasi-resonant level. A significant conclusion of this study is that plasma-related matrix effect depends strongly on the excitation mechanism of a spectral line. Since, in general, more than one excitation mechanism may contribute to the overall excitation of an emission line, the observed matrix effects reflect the sum of the effects due to individual excitation mechanisms. Excitation mechanisms, in addition to the often-used total excitation energy, should be considered in matrix effect studies

  1. Neutrinoless Double Beta Decay Matrix Elements in Light Nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Pastore, S.; Carlson, J.; Cirigliano, V.; Dekens, W.; Mereghetti, E.; Wiringa, R. B.

    2018-01-17

    We present the first ab initio calculations of neutrinoless double-β decay matrix elements in A=6-12 nuclei using variational Monte Carlo wave functions obtained from the Argonne v18 two-nucleon potential and Illinois-7 three-nucleon interaction. We study both light Majorana neutrino exchange and potentials arising from a large class of multi-TeV mechanisms of lepton-number violation. Our results provide benchmarks to be used in testing many-body methods that can be extended to the heavy nuclei of experimental interest. In light nuclei we also study the impact of two-body short-range correlations and the use of different forms for the transition operators, such as those corresponding to different orders in chiral effective theory.

  2. Basic Finite Element Method

    International Nuclear Information System (INIS)

    Lee, Byeong Hae

    1992-02-01

    This book gives descriptions of basic finite element method, which includes basic finite element method and data, black box, writing of data, definition of VECTOR, definition of matrix, matrix and multiplication of matrix, addition of matrix, and unit matrix, conception of hardness matrix like spring power and displacement, governed equation of an elastic body, finite element method, Fortran method and programming such as composition of computer, order of programming and data card and Fortran card, finite element program and application of nonelastic problem.

  3. Matrix product formula for Macdonald polynomials

    Science.gov (United States)

    Cantini, Luigi; de Gier, Jan; Wheeler, Michael

    2015-09-01

    We derive a matrix product formula for symmetric Macdonald polynomials. Our results are obtained by constructing polynomial solutions of deformed Knizhnik-Zamolodchikov equations, which arise by considering representations of the Zamolodchikov-Faddeev and Yang-Baxter algebras in terms of t-deformed bosonic operators. These solutions are generalized probabilities for particle configurations of the multi-species asymmetric exclusion process, and form a basis of the ring of polynomials in n variables whose elements are indexed by compositions. For weakly increasing compositions (anti-dominant weights), these basis elements coincide with non-symmetric Macdonald polynomials. Our formulas imply a natural combinatorial interpretation in terms of solvable lattice models. They also imply that normalizations of stationary states of multi-species exclusion processes are obtained as Macdonald polynomials at q = 1.

  4. Matrix product formula for Macdonald polynomials

    International Nuclear Information System (INIS)

    Cantini, Luigi; Gier, Jan de; Michael Wheeler

    2015-01-01

    We derive a matrix product formula for symmetric Macdonald polynomials. Our results are obtained by constructing polynomial solutions of deformed Knizhnik–Zamolodchikov equations, which arise by considering representations of the Zamolodchikov–Faddeev and Yang–Baxter algebras in terms of t-deformed bosonic operators. These solutions are generalized probabilities for particle configurations of the multi-species asymmetric exclusion process, and form a basis of the ring of polynomials in n variables whose elements are indexed by compositions. For weakly increasing compositions (anti-dominant weights), these basis elements coincide with non-symmetric Macdonald polynomials. Our formulas imply a natural combinatorial interpretation in terms of solvable lattice models. They also imply that normalizations of stationary states of multi-species exclusion processes are obtained as Macdonald polynomials at q = 1. (paper)

  5. Dimensional Behavior of Matrix Graphite Compacts during Heat Treatments for HTGR Fuel Element Fabrication

    International Nuclear Information System (INIS)

    Lee, Young-Woo; Yeo, Seunghwan; Cho, Moon Sung

    2015-01-01

    The carbonization is a process step where the binder that is incorporated during the matrix graphite powder preparation step is evaporated and the residue of the binder is carbonized during the heat treatment at about 1073 K. This carbonization step is followed by the final high temperature heat treatment where the carbonized compacts are heat treated at 2073-2173 K in vacuum for a relatively short time (about 2 hrs). In order to develop a fuel compact fabrication technology, and for fuel matrix graphite to meet the required material properties, it is essential to investigate the relationship among the process parameters of the matrix graphite powder preparation, the fabrication parameters of fuel element green compact and the heat treatments conditions, which has a strong influence on the further steps and the material properties of fuel element. In this work, the dimensional changes of green compacts during the carbonization and final heat treatment are evaluated when compacts have different densities from different pressing conditions and different final heat treatment temperatures are employed, keeping other process parameters constant, such as the binder content, carbonization time, temperature and atmosphere (two hours ant 1073K and N2 atmosphere). In this work, the dimensional variations of green compacts during the carbonization and final heat treatment are evaluated when compacts have different densities from different pressing conditions and different final heat treatment temperatures are employed

  6. Anatomy of double beta decay nuclear matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Vogel, Petr, E-mail: pxv@caltech.ed [Kellogg Radiation Laboratory 106-38 Caltech. Pasadena, CA 91125 (United States)

    2009-06-01

    The necessary ingredients for a realistic evaluation of the 0vbetabeta nuclear matrix elements are reviewed. It is argued that the short range nucleon correlations, nucleon finite size, and higher order nuclear currents need to be included in the calculation, even though a consensus on the best way to treat all of these effects has not been reached. Another positive development is the realization that the two alternative and complementary methods, the Quasiparticle Random Phase Approximation and the Nuclear Shell Model, agree on many aspects of the calculation, in particular on the competition, or cancelation, between the contribution of nuclear pairing on one hand, and the other pieces of interaction that result in admixtures of broken pairs or higher seniority states on the other hand. The relatively short range (r <= 2-3 fm) of the effective 0vbetabeta operator found in both methods is a consequence of that competition.

  7. The matrix elements of the potential energy operator between the Sp(2,R) basis generating functions. Near-magic nuclei

    International Nuclear Information System (INIS)

    Filippov, G.F.; Ovcharenko, V.I.; Teryoshin, Yu.V.

    1980-01-01

    For near-magnetic nuclei, the matrix elements of the central exchange nucleon-nucleon interaction potential energy operator between the generating functions of the total basis of the Sn are obtained. The basis states are highest weigt vectorsp(2,R) irreducible representatio of the SO(3) irredicible representation and in addition, have a definite O(A-1) symmetry. The Sp(2,R) basis generating matrix elements simplify essentially the problem of calculating the spectrum of collective excitations of the atomic nucleus over an intrinsic function of definite O(A-1) symmetry

  8. Matching of singly- and doubly-unresolved limits of tree-level QCD squared matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Somogyi, Gabor [University of Debrecen and Institute of Nuclear Research of the Hungarian Academy of Sciences, H-4001 Debrecen, PO Box 51 (Hungary); Trocsanyi, Zoltan [University of Debrecen and Institute of Nuclear Research of the Hungarian Academy of Sciences, H-4001 Debrecen, PO Box 51 (Hungary); Duca, Vittorio Del [Istituto Nazionale di Fisica Nucleare, Sez. di Torino, via P. Giuria, 1 - 10125 Torino (Italy)

    2005-06-01

    We describe how to disentangle the singly- and doubly-unresolved (soft and/or collinear) limits of tree-level QCD squared matrix elements. Using the factorization formulae presented in this paper, we outline a viable general subtraction scheme for computing next-to-next-to-leading order corrections for electron-positron annihilation into jets.

  9. Off-diagonal helicity density matrix elements for vector mesons produced at LEP

    International Nuclear Information System (INIS)

    Anselmino, M.; Bertini, M.; Quintairos, P.

    1997-05-01

    Final state q q-bar interactions may give origin to non zero values of the off-diagonal element ρ 1 of the helicity density matrix of vector mesons produced in e + e - annihilations, as confirmed by recent OPAL data on φ and D * 's. Predictions are given for ρ1,-1 of several mesons produced at large z and small PT, collinear with the parent jet; the values obtained for θ and D * are in agreement with data. (author)

  10. On- and off-resonance radiation-atom-coupling matrix elements involving extended atomic wave functions

    Science.gov (United States)

    Komninos, Yannis; Mercouris, Theodoros; Nicolaides, Cleanthes A.

    2014-01-01

    In continuation of our earlier works, we present results concerning the computation of matrix elements of the multipolar Hamiltonian (MPH) between extended wave functions that are obtained numerically. The choice of the MPH is discussed in connection with the broader issue of the form of radiation-atom (or -molecule) interaction that is appropriate for the systematic solution of various problems of matter-radiation interaction. We derive analytic formulas, in terms of the sine-integral function and spherical Bessel functions of various orders, for the cumulative radial integrals that were obtained and calculated by Komninos, Mercouris, and Nicolaides [Phys. Rev. A 71, 023410 (2005), 10.1103/PhysRevA.71.023410]. This development allows the much faster and more accurate computation of such matrix elements, a fact that enhances the efficiency with which the time-dependent Schrödinger equation is solved nonperturbatively, in the framework of the state-specific expansion approach. The formulas are applicable to the general case where a pair of orbitals with angular parts |ℓ1,m1> and |ℓ2,m2> are coupled radiatively. As a test case, we calculate the matrix elements of the electric field and of the paramagnetic operators for on- and off-resonance transitions, between hydrogenic circular states of high angular momentum, whose quantum numbers are chosen so as to satisfy electric dipole and electric quadrupole selection rules. Because of the nature of their wave function (they are nodeless and the large centrifugal barrier keeps their overwhelming part at large distances from the nucleus), the validity of the electric dipole approximation in various applications where the off-resonance couplings must be considered becomes precarious. For example, for the transition from the circular state with n = 20 to that with n = 21, for which ≈400 a.u., the dipole approximation starts to fail already at XUV wavelengths (λ <125nm).

  11. Kaon matrix elements and CP violation from quenched lattice QCD: The 3-flavor case

    International Nuclear Information System (INIS)

    Blum, T.; Wingate, M.; Chen, P.; Christ, N.; Cristian, C.; Fleming, G.; Mawhinney, R.; Siegert, G.; Wu, L.; Zhestkov, Y.; Dawson, C.; Soni, A.; Ohta, S.; Vranas, P.

    2003-01-01

    We report the results of a calculation of the K→ππ matrix elements relevant for the ΔI=1/2 rule and ε ' /ε in quenched lattice QCD using domain wall fermions at a fixed lattice spacing a -1 ∼2 GeV. Working in the three-quark effective theory, where only the u, d, and s quarks enter and which is known perturbatively to next-to-leading order, we calculate the lattice K→π and K→|0> matrix elements of dimension six, four-fermion operators. Through lowest order chiral perturbation theory these yield K→ππ matrix elements, which we then normalize to continuum values through a nonperturbative renormalization technique. For the ratio of isospin amplitudes vertical bar A 0 vertical bar/vertical bar A 2 vertical bar we find a value of 25.3±1.8 (statistical error only) compared to the experimental value of 22.2, with individual isospin amplitudes 10%-20% below the experimental values. For ε ' /ε, using known central values for standard model parameters, we calculate (-4.0±2.3)x10 -4 (statistical error only) compared to the current experimental average of (17.2±1.8)x10 -4 . Because we find a large cancellation between the I=0 and I=2 contributions to ε ' /ε, the result may be very sensitive to the approximations employed. Among these are the use of quenched QCD, lowest order chiral perturbation theory, and continuum perturbation theory below 1.3 GeV. We also calculate the kaon B parameter B K and find B K,MS (2 GeV)=0.532(11). Although currently unable to give a reliable systematic error, we have control over statistical errors and more simulations will yield information about the effects of the approximations on this first-principles determination of these important quantities

  12. Precision Measurement of the Neutron Twist-3 Matrix Element dn2: Probing Color Forces

    Energy Technology Data Exchange (ETDEWEB)

    Posik, Matthew; Flay, David; Parno, Diana; Allada, Kalyan; Armstrong, Whitney; Averett, Todd; Benmokhtar, Fatiha; Bertozzi, William; Camsonne, Alexandre; Canan, Mustafa; Cates, Gordon; Chen, Chunhua; Chen, Jian-Ping; Choi, Seonho; Chudakov, Eugene; Cusanno, Francesco; Dalton, Mark; Deconinck, Wouter; De Jager, Cornelis; Deng, Xiaoyan; Deur, Alexandre; Dutta, Chiranjib; El Fassi, Lamiaa; Franklin, Gregg; Friend, Megan; Gao, Haiyan; Garibaldi, Franco; Gilad, Shalev; Gilman, Ronald; Glamazdin, Oleksandr; Golge, Serkan; Gomez, Javier; Guo, Lei; Hansen, Jens-Ole; Higinbotham, Douglas; Holmstrom, Timothy; Huang, J; Hyde, Charles; Ibrahim Abdalla, Hassan; Jiang, Xiaodong; Jin, Ge; Katich, Joseph; Kelleher, Aidan; Kolarkar, Ameya; Korsch, Wolfgang; Kumbartzki, Gerfried; LeRose, John; Lindgren, Richard; Liyanage, Nilanga; Long, Elena; Lukhanin, Oleksandr; Mamyan, Vahe; McNulty, Dustin; Meziani, Zein-Eddine; Michaels, Robert; Mihovilovic, Miha; Moffit, Bryan; Muangma, Navaphon; Nanda, Sirish; Narayan, Amrendra; Nelyubin, Vladimir; Norum, Blaine; Nuruzzaman, nfn; Oh, Yongseok; Peng, Jen-chieh; Qian, Xin; Qiang, Yi; Rakhman, Abdurahim; Riordan, Seamus; Saha, Arunava; Sawatzky, Bradley; Hashemi Shabestari, Mitra; Shahinyan, Albert; Sirca, Simon; Solvignon-Slifer, Patricia; Subedi, Ramesh; Sulkosky, Vincent; Tobias, William; Troth, Wolfgang; Wang, Diancheng; Wang, Y; Wojtsekhowski, Bogdan; Yan, X; Yao, Huan; Ye, Yunxiu; Ye, Zhihong; Yuan, Lulin; Zhan, X; Zhang, Y; Zhang, Y -W; Zhao, Bo; Zheng, Xiaochao

    2014-07-01

    Double-spin asymmetries and absolute cross sections were measured at large Bjorken x (0.25 lte x lte 0.90), in both the deep-inelastic and resonance regions, by scattering longitudinally polarized electrons at beam energies of 4.7 and 5.9 GeV from a transversely and longitudinally polarized 3He target. In this dedicated experiment, the spin structure function g2 on 3He was determined with precision at large x, and the neutron twist-three matrix element dn2 was measured at ?Q2? of 3.21 and 4.32 GeV2/c2, with an absolute precision of about 10?5. Our results are found to be in agreement with lattice QCD calculations and resolve the disagreement found with previous data at ?Q2?= 5 GeV2/c2. Combining dn2 and a newly extracted twist-four matrix element, fn2, the average neutron color electric and magnetic forces were extracted and found to be of opposite sign and about 60 MeV/fm in magnitude.

  13. Measurement of single top quark production at D0 using a matrix element method

    International Nuclear Information System (INIS)

    Mitrevski, Jovan Pavle

    2007-01-01

    Until now, the top quark has only been observed produced in pairs, by the strong force. According to the standard model, it can also be produced singly, via an electroweak interaction. Top quarks produced this way provide powerful ways to test the charged-current electroweak interactions of the top quark, to measure |V tb |, and to search for physics beyond the standard model. This thesis describes the application of the matrix element analysis technique to the search for single top quark production with the D0 detector using 0.9 fb -1 of Run II data. From a comparison of the matrix element discriminants between data and the background model, assuming a Standard Model s-channel to t-channel cross section ratio of σ s /σ t = 0.44, we measure the single top quark production cross section: σ(p(bar p) → tb + X, tqb + X) = 4.8 -1.4 +1.6 pb. This result has a p-value of 0.08%, corresponding to a 3.2 standard deviation Gaussian equivalent significance

  14. Propensity, Probability, and Quantum Theory

    Science.gov (United States)

    Ballentine, Leslie E.

    2016-08-01

    Quantum mechanics and probability theory share one peculiarity. Both have well established mathematical formalisms, yet both are subject to controversy about the meaning and interpretation of their basic concepts. Since probability plays a fundamental role in QM, the conceptual problems of one theory can affect the other. We first classify the interpretations of probability into three major classes: (a) inferential probability, (b) ensemble probability, and (c) propensity. Class (a) is the basis of inductive logic; (b) deals with the frequencies of events in repeatable experiments; (c) describes a form of causality that is weaker than determinism. An important, but neglected, paper by P. Humphreys demonstrated that propensity must differ mathematically, as well as conceptually, from probability, but he did not develop a theory of propensity. Such a theory is developed in this paper. Propensity theory shares many, but not all, of the axioms of probability theory. As a consequence, propensity supports the Law of Large Numbers from probability theory, but does not support Bayes theorem. Although there are particular problems within QM to which any of the classes of probability may be applied, it is argued that the intrinsic quantum probabilities (calculated from a state vector or density matrix) are most naturally interpreted as quantum propensities. This does not alter the familiar statistical interpretation of QM. But the interpretation of quantum states as representing knowledge is untenable. Examples show that a density matrix fails to represent knowledge.

  15. Fabrication of synthetic diffractive elements using advanced matrix laser lithography

    International Nuclear Information System (INIS)

    Škeren, M; Svoboda, J; Kveton, M; Fiala, P

    2013-01-01

    In this paper we present a matrix laser writing device based on a demagnified projection of a micro-structure from a computer driven spatial light modulator. The device is capable of writing completely aperiodic micro-structures with resolution higher than 200 000 DPI. An optical system is combined with ultra high precision piezoelectric stages with an elementary step ∼ 4 nm. The device operates in a normal environment, which significantly decreases the costs compared to competitive technologies. Simultaneously, large areas can be exposed up to 100 cm2. The capabilities of the constructed device will be demonstrated on particular elements fabricated for real applications. The optical document security is the first interesting field, where the synthetic image holograms are often combined with sophisticated aperiodic micro-structures. The proposed technology can easily write simple micro-gratings creating the color and kinetic visual effects, but also the diffractive cryptograms, waveguide couplers, and other structures recently used in the field of optical security. A general beam shaping elements and special photonic micro-structures are another important applications which will be discussed in this paper.

  16. Fabrication of synthetic diffractive elements using advanced matrix laser lithography

    Science.gov (United States)

    Škereň, M.; Svoboda, J.; Květoň, M.; Fiala, P.

    2013-02-01

    In this paper we present a matrix laser writing device based on a demagnified projection of a micro-structure from a computer driven spatial light modulator. The device is capable of writing completely aperiodic micro-structures with resolution higher than 200 000 DPI. An optical system is combined with ultra high precision piezoelectric stages with an elementary step ~ 4 nm. The device operates in a normal environment, which significantly decreases the costs compared to competitive technologies. Simultaneously, large areas can be exposed up to 100 cm2. The capabilities of the constructed device will be demonstrated on particular elements fabricated for real applications. The optical document security is the first interesting field, where the synthetic image holograms are often combined with sophisticated aperiodic micro-structures. The proposed technology can easily write simple micro-gratings creating the color and kinetic visual effects, but also the diffractive cryptograms, waveguide couplers, and other structures recently used in the field of optical security. A general beam shaping elements and special photonic micro-structures are another important applications which will be discussed in this paper.

  17. Continuous Modeling Technique of Fiber Pullout from a Cement Matrix with Different Interface Mechanical Properties Using Finite Element Program

    Directory of Open Access Journals (Sweden)

    Leandro Ferreira Friedrich

    Full Text Available Abstract Fiber-matrix interface performance has a great influence on the mechanical properties of fiber reinforced composite. This influence is mainly presented during fiber pullout from the matrix. As fiber pullout process consists of fiber debonding stage and pullout stage which involve complex contact problem, numerical modeling is a best way to investigate the interface influence. Although many numerical research works have been conducted, practical and effective technique suitable for continuous modeling of fiber pullout process is still scarce. The reason is in that numerical divergence frequently happens, leading to the modeling interruption. By interacting the popular finite element program ANSYS with the MATLAB, we proposed continuous modeling technique and realized modeling of fiber pullout from cement matrix with desired interface mechanical performance. For debonding process, we used interface elements with cohesive surface traction and exponential failure behavior. For pullout process, we switched interface elements to spring elements with variable stiffness, which is related to the interface shear stress as a function of the interface slip displacement. For both processes, the results obtained are very good in comparison with other numerical or analytical models and experimental tests. We suggest using the present technique to model toughening achieved by randomly distributed fibers.

  18. Lepton mixing matrix element U13 and new assignments of universal texture for quark and lepton mass matrices

    International Nuclear Information System (INIS)

    Matsuda, Koichi; Nishiura, Hiroyuki

    2004-01-01

    We reanalyze the mass matrix model of quarks and leptons that gives a unified description of quark and lepton mass matrices with the same texture form. By investigating possible types of assignment for the texture components of the lepton mass matrix, we find that a different assignment for neutrinos than for charged leptons can also lead to consistent values of the Maki-Nakagawa-Sakata-Pontecorv (MNSP) lepton mixing matrix. We also find that the predicted value for the lepton mixing matrix element U 13 of the model depends on the assignment. A proper assignment will be discriminated by future experimental data for U 13

  19. Measurement of the Top Quark Mass at D0 Run II with the Matrix Element Method in the Lepton+Jets Final State

    Energy Technology Data Exchange (ETDEWEB)

    Schieferdecker, Philipp [Ludwig Maximilian Univ. of Munich (Germany)

    2005-08-05

    The mass of the top quark is a fundamental parameter of the Standard Model. Its precise knowledge yields valuable insights into unresolved phenomena in and beyond the Standard Model. A measurement of the top quark mass with the matrix element method in the lepton+jets final state in D0 Run II is presented. Events are selected requiring an isolated energetic charged lepton (electron or muon), significant missing transverse energy, and exactly four calorimeter jets. For each event, the probabilities to originate from the signal and background processes are calculated based on the measured kinematics, the object resolutions and the respective matrix elements. The jet energy scale is known to be the dominant source of systematic uncertainty. The reference scale for the mass measurement is derived from Monte Carlo events. The matrix element likelihood is defined as a function of both, m{sub top} and jet energy scale JES, where the latter represents a scale factor with respect to the reference scale. The top mass is obtained from a two-dimensional correlated fit, and the likelihood yields both the statistical and jet energy scale uncertainty. Using a dataset of 320 pb-1 of D0 Run II data, the mass of the top quark is measured to be: m$ℓ+jets\\atop{top}$ = 169.5 ± 4.4(stat. + JES)$+1.7\\atop{-1.6}$(syst.) GeV; m$e+jets\\atop{top}$ = 168.8 ± 6.0(stat. + JES)$+1.9\\atop{-1.9}$(syst.) GeV; m$μ+jets\\atop{top}$ = 172.3 ± 9.6(stat.+JES)$+3.4\\atop{-3.3}$(syst.) GeV. The jet energy scale measurement in the ℓ+jets sample yields JES = 1.034 ± 0.034, suggesting good consistency of the data with the simulation. The measurement forecasts significant improvements to the total top mass uncertainty during Run II before the startup of the LHC, as the data sample will grow by a factor of ten and D0's tracking capabilities will be employed in jet energy reconstruction and flavor identification.

  20. K-M matrix elements and decays of the B meson to J/Psi

    International Nuclear Information System (INIS)

    Wilson, Richard

    2002-01-01

    This talk discusses some of the last work on B meson decays of the CLEO collaboration, which work is, in fact, improvements in precision of much earlier work of the same collaboration. New theoretical developments have enabled us to present much improved numbers on the matrix elements Vcb, and Vub. Also some recent work on the decay of B mesons to J/Psi plus other particles will be briefly presented

  1. Matrix elements of the potential energy operator for the six nucleon system between the generating invariants

    International Nuclear Information System (INIS)

    Filippov, G.F.; Lopez Trujillo, A.; Rybkin, I.Yu.

    1993-01-01

    The matrix elements of the potential energy operator (which includes central, spin-orbit and tensor components) are calculated between the generating invariants of the cluster basis describing α + d and t+h configurations of the six-nucleon system. (author). 12 refs

  2. Generalized hypervirial and Blanchard's recurrence relations for radial matrix elements

    International Nuclear Information System (INIS)

    Dong Shihai; Chen Changyuan; Lozada-Cassou, M

    2005-01-01

    Based on the Hamiltonian identity, we propose a generalized expression of the second hypervirial for an arbitrary central potential wavefunction in arbitrary dimensions D. We demonstrate that the new proposed second hypervirial formula is very powerful in deriving the general Blanchard's and Kramers' recurrence relations among the radial matrix elements. As their useful and important applications, we derive all general Blanchard's and Kramers' recurrence relations and some identities for the Coulomb-like potential, harmonic oscillator and Kratzer oscillator. The recurrence relation and identity between the exponential functions and the powers of the radial function are established for the Morse potential. The corresponding general Blanchard's and Kramers' recurrence relations in 2D are also briefly studied

  3. Measurement of the top quark mass in the dilepton final state using the matrix element method

    Energy Technology Data Exchange (ETDEWEB)

    Grohsjean, Alexander [Ludwig Maximilian Univ., Munich (Germany)

    2008-12-15

    The top quark, discovered in 1995 by the CDF and D0 experiments at the Fermilab Tevatron Collider, is the heaviest known fundamental particle. The precise knowledge of its mass yields important constraints on the mass of the yet-unobserved Higgs boson and allows to probe for physics beyond the Standard Model. The first measurement of the top quark mass in the dilepton channel with the Matrix Element method at the D0 experiment is presented. After a short description of the experimental environment and the reconstruction chain from hits in the detector to physical objects, a detailed review of the Matrix Element method is given. The Matrix Element method is based on the likelihood to observe a given event under the assumption of the quantity to be measured, e.g. the mass of the top quark. The method has undergone significant modifications and improvements compared to previous measurements in the lepton+jets channel: the two undetected neutrinos require a new reconstruction scheme for the four-momenta of the final state particles, the small event sample demands the modeling of additional jets in the signal likelihood, and a new likelihood is designed to account for the main source of background containing tauonic Z decay. The Matrix Element method is validated on Monte Carlo simulated events at the generator level. For the measurement, calibration curves are derived from events that are run through the full D0 detector simulation. The analysis makes use of the Run II data set recorded between April 2002 and May 2008 corresponding to an integrated luminosity of 2.8 fb-1. A total of 107 t$\\bar{t}$ candidate events with one electron and one muon in the final state are selected. Applying the Matrix Element method to this data set, the top quark mass is measured to be mtopRun IIa = 170.6 ± 6.1(stat.)-1.5+2.1(syst.)GeV; mtopRun IIb = 174.1 ± 4.4(stat.)-1.8+2.5(syst.)GeV; m

  4. Matrix elements for the anti B→Xsγ decay at NNLO

    International Nuclear Information System (INIS)

    Schutzmeier, Thomas Paul

    2009-01-01

    In the context of the indirect search for non-standard physics in the flavour sector of the Standard Model (SM), one of the most interesting processes is the rare inclusive anti B→ X s γ decay. On the one hand, being a flavour-changing neutral current, this B decay is sensitive to new physics, as it is loop-suppressed in the SM. On the other hand, it is only mildly affected by non-perturbative effects, and thus allows for precise theoretical predictions in the framework of renormalization-group improved perturbation theory. Accurate measurements as well as precise theoretical predictions with a good control over both perturbative and non-perturbative contributions have to be provided in order to derive stringent constraints on the parameter space of physics beyond the SM. On the experimental side, an outstanding accuracy in the measurement of the anti B→X s γ decay rate has been achieved, which is mainly due the specialized experiments BaBar and Belle at the so-called B factories. To match the small experimental uncertainty, higher order computations within an effective low-energy theory of the SM are mandatory. In fact, next-to-next-to-leading order (NNLO) QCD corrections are required to provide a prediction for the decay rate with the same precision as the measurement. The NNLO evaluation of the anti B→X s γ decay rate has been pursued by various groups over the last decade. The project was completed to a large extent and a first estimate at this level of perturbation theory was obtained in 2006. This prediction, however, lacks important contributions from yet unknown matrix elements, that were estimated from results which are only partially known to date. In this work, we provide a framework for the systematic study of the missing matrix elements at the NNLO. As main results of this thesis, we determine fermionic corrections to the charm quark mass dependent matrix elements of four-quark operators in the effective theory at NNLO. For the first time, the

  5. Focusing on a Probability Element: Parameter Selection of Message Importance Measure in Big Data

    OpenAIRE

    She, Rui; Liu, Shanyun; Dong, Yunquan; Fan, Pingyi

    2017-01-01

    Message importance measure (MIM) is applicable to characterize the importance of information in the scenario of big data, similar to entropy in information theory. In fact, MIM with a variable parameter can make an effect on the characterization of distribution. Furthermore, by choosing an appropriate parameter of MIM,it is possible to emphasize the message importance of a certain probability element in a distribution. Therefore, parametric MIM can play a vital role in anomaly detection of bi...

  6. Monte Carlo simulation of γ and fission transfer-induced probabilities using extended -matrix theory: Application to the 237U∗ system

    Directory of Open Access Journals (Sweden)

    Bouland Olivier

    2017-01-01

    Full Text Available This paper deals with simultaneous neutron-induced average partial cross sections and surrogate-like probability simulations over several excitation and de-excitation channels of the compound nucleus. Present calculations, based on one-dimensional fission barrier extended -matrix theory using Monte Carlo samplings of both first and second well resonance parameters, avoid the surrogate-reaction method historically taken for surrogate data analyses that proved to be very poor in terms of extrapolated neutron-induced capture cross sections. Present theoretical approach is portrayed and subsequent results can be compared for the first time with experimental γ-decay probabilities; thanks to brand new simultaneous 238U(3He,4Heγ and 238U(3He,4He f surrogate measurements. Future integration of our strategy in standard neutron cross section data evaluation remains tied to the developments made in terms of direct reaction population probability calculations.

  7. A new Eulerian-Lagrangian finite element simulator for solute transport in discrete fracture-matrix systems

    Energy Technology Data Exchange (ETDEWEB)

    Birkholzer, J.; Karasaki, K. [Lawrence Berkeley National Lab., CA (United States). Earth Sciences Div.

    1996-07-01

    Fracture network simulators have extensively been used in the past for obtaining a better understanding of flow and transport processes in fractured rock. However, most of these models do not account for fluid or solute exchange between the fractures and the porous matrix, although diffusion into the matrix pores can have a major impact on the spreading of contaminants. In the present paper a new finite element code TRIPOLY is introduced which combines a powerful fracture network simulator with an efficient method to account for the diffusive interaction between the fractures and the adjacent matrix blocks. The fracture network simulator used in TRIPOLY features a mixed Lagrangian-Eulerian solution scheme for the transport in fractures, combined with an adaptive gridding technique to account for sharp concentration fronts. The fracture-matrix interaction is calculated with an efficient method which has been successfully used in the past for dual-porosity models. Discrete fractures and matrix blocks are treated as two different systems, and the interaction is modeled by introducing sink/source terms in both systems. It is assumed that diffusive transport in the matrix can be approximated as a one-dimensional process, perpendicular to the adjacent fracture surfaces. A direct solution scheme is employed to solve the coupled fracture and matrix equations. The newly developed combination of the fracture network simulator and the fracture-matrix interaction module allows for detailed studies of spreading processes in fractured porous rock. The authors present a sample application which demonstrate the codes ability of handling large-scale fracture-matrix systems comprising individual fractures and matrix blocks of arbitrary size and shape.

  8. First unitarity-independent determination of the CKM matrix elements $V_{td}$, $V_{ts}$, and ${V_{tb}$ and the implications for unitarity

    OpenAIRE

    Swain, John; Taylor, Lucas

    1997-01-01

    The magnitudes of the CKM matrix elements $V_{td}$, $V_{ts}$, and $V_{tb}$ are determined for the first time without any assumptions of unitarity. The implications for the unitarity of the CKM matrix as a whole are discussed.

  9. The Direct Effect of Toroidal Magnetic Fields on Stellar Oscillations: An Analytical Expression for the General Matrix Element

    Energy Technology Data Exchange (ETDEWEB)

    Kiefer, René; Schad, Ariane; Roth, Markus [Kiepenheuer-Institut für Sonnenphysik, Schöneckstraße 6, D-79104 Freiburg (Germany)

    2017-09-10

    Where is the solar dynamo located and what is its modus operandi? These are still open questions in solar physics. Helio- and asteroseismology can help answer them by enabling us to study solar and stellar internal structures through global oscillations. The properties of solar and stellar acoustic modes are changing with the level of magnetic activity. However, until now, the inference on subsurface magnetic fields with seismic measures has been very limited. The aim of this paper is to develop a formalism to calculate the effect of large-scale toroidal magnetic fields on solar and stellar global oscillation eigenfunctions and eigenfrequencies. If the Lorentz force is added to the equilibrium equation of motion, stellar eigenmodes can couple. In quasi-degenerate perturbation theory, this coupling, also known as the direct effect, can be quantified by the general matrix element. We present the analytical expression of the matrix element for a superposition of subsurface zonal toroidal magnetic field configurations. The matrix element is important for forward calculations of perturbed solar and stellar eigenfunctions and frequency perturbations. The results presented here will help to ascertain solar and stellar large-scale subsurface magnetic fields, and their geometric configuration, strength, and change over the course of activity cycles.

  10. Computationally efficient analytic representations of relativistic bound-bound, bound-unbound and unbound-unbound transition matrix elements of hydrogenic atoms

    International Nuclear Information System (INIS)

    Soldatov, A.; Seke, J.; Adam, G.; Polak, M.

    2008-01-01

    Full text: A closed analytic form for relativistic transition matrix elements between bound-bound, bound-unbound and unbound-unbound relativistic eigenstates of hydrogenic atoms by using the plane-wave expansion for the electromagnetic-field vector potential was derived in a form convenient for large-scale numerical calculations in QED. By applying the obtained formulae, these transition matrix elements can be evaluated analytically and numerically. These exact matrix elements, which to our knowledge have not been calculated as yet, are of great importance in the analysis of various atom-field interaction processes where retardation effects cannot be ignored. The ultimate goal of the ongoing research is to develop a general universal calculation technique for Seke's approximation and renormalization method in QED, for which the usage of the plane vector expansion for the vector potential is a preferable choice. However, our primary interest lies in the Lamb-shift calculation. Our nearest objective is to carry out the plain-style relativistic calculations of the Lamb shift of the energy levels of hydrogen-like atoms and ions from first principles in the second and higher perturbative orders, using the corresponding convenient as well as novel expressions for the magnitude in question as they stand, i.e. without any additional approximations. Due to that there is no way to achieve all the above-declared goals without recourse to large-scale laborious and time-consuming high-precision numerical calculations, having the transition matrix elements of all possible types in an analytic, convenient for their efficient numerical evaluation form, would be highly advantageous and even unavoidable, especially for calculations of various QED effects in higher perturbative orders be it, equally, in traditional or novel approach. (author)

  11. Minimizing matrix effect by femtosecond laser ablation and ionization in elemental determination.

    Science.gov (United States)

    Zhang, Bochao; He, Miaohong; Hang, Wei; Huang, Benli

    2013-05-07

    Matrix effect is unavoidable in direct solid analysis, which usually is a leading cause of the nonstoichiometric effect in quantitative analysis. In this research, experiments were carried out to study the overall characteristics of atomization and ionization in laser-solid interaction. Both nanosecond (ns) and femtosecond (fs) lasers were applied in a buffer-gas-assisted ionization source coupled with an orthogonal time-of-flight mass spectrometer. Twenty-nine solid standards of ten different matrices, including six metals and four dielectrics, were analyzed. The results indicate that the fs-laser mode offers more stable relative sensitivity coefficients (RSCs) with irradiance higher than 7 × 10(13) W·cm(-2), which could be more reliable in the determination of element composition of solids. The matrix effect is reduced by half when the fs-laser is employed, owing to the fact that the fs-laser ablation and ionization (fs-LAI) incurs an almost heat-free ablation process and creates a dense plasma for the stable ionization.

  12. Search for rare processes with a Z+bb signature at the LHC, with the matrix element method

    CERN Document Server

    Beluffi, Camille; Lemaitre, Vincent

    This thesis presents a detailed study of the final state with the Z boson decaying into two leptons, produced in the CMS detector at the LHC. In order to tag this topology, sophisticated b jet tagging algorithms have been used, and the calibration of one of them, the Jet Probability (JP) tagger is exposed. A study of the tagger degradation at high energy has been done and led to a small gain of performance. This investigation is followed by the search for the associated production of the standard model (SM) Higgs boson with a Z boson and decaying into two b quarks (ZH channel), using the Matrix Element Method (MEM) and two b-taggers: JP and Combined Secondary Vertex (CSV). The MEM is an advanced tool that produces an event-by-event discriminating variable, called weight. To apply it, several sets of transfer function have been produced. The final results give an observed limit on the ZH production cross section with the H → bb branching ratio of 5.46xσSM when using the CSV tagger and 4.89xσSM when using t...

  13. A new program for calculating matrix elements of one-particle operators in jj-coupling

    International Nuclear Information System (INIS)

    Pyper, N.C.; Grant, I.P.; Beatham, N.

    1978-01-01

    The aim of this paper is to calculate the matrix elements of one-particle tensor operators occurring in atomic and nuclear theory between configuration state functions representing states containing any number of open shells in jj-coupling. The program calculates the angular part of these matrix elements. The program is essentially a new version of RDMEJJ, written by J.J. Chang. The aims of this version are to eliminate inconsistencies from RDMEJJ, to modify its input requirements for consistency with MCP75, and to modify its output so that it can be stored in a discfile for access by other compatible programs. The program assumes that the configurational states are built from a common orthonormal set of basis orbitals. The number of electrons in a shell having j>=9/2 is restricted to be not greater than 2 by the available CFP routines . The present version allows up to 40 orbitals and 50 configurational states with <=10 open shells; these numbers can be changed by recompiling with modified COMMON/DIMENSION statements. The user should ensure that the CPC library subprograms AAGD, ACRI incorporate all current updates and have been converted to use double precision floating point arithmetic. (Auth.)

  14. Critique of `Elements of Quantum Probability'

    NARCIS (Netherlands)

    Gill, R.D.

    1998-01-01

    We analyse the thesis of Kummerer and Maassen that classical probability is unable to model the the stochastic nature of the Aspect experiment in which violation of Bells inequality was experimentally demonstrated According to these authors the experiment shows the need to introduce the extension

  15. Matching Matrix Elements and Parton Showers with HERWIG and PYTHIA

    CERN Document Server

    Mrenna, S; Mrenna, Stephen; Richardson, Peter

    2004-01-01

    We report on our exploration of matching matrix element calculations with the parton-shower models contained in the event generators HERWIG and Pythia. We describe results for e+e- collisions and for the hadroproduction of W bosons and Drell--Yan pairs. We compare methods based on (1) a strict implementation of ideas proposed by Catani, et al., (2) a generalization based on using the internal Sudakov form factors of HERWIG and Pythia, and (3) a simpler proposal of M. Mangano. Where appropriate, we show the dependence on various choices of scales and clustering that do not affect the soft and collinear limits of the predictions, but have phenomenological implications. Finally, we comment on how to use these results to state systematic errors on the theoretical predictions.

  16. Quenching of the Gamow-Teller matrix element in closed LS-shell-plus-one nuclei

    International Nuclear Information System (INIS)

    Towner, I.S.

    1989-06-01

    It is evident that nuclear Gamow-Teller matrix elements determined from β-decay and charge-exchange reactions are significantly quenched compared to simple shell-model estimates based on one-body operators and free-nucleon coupling constants. Here we discuss the theoretical origins of this quenching giving examples from light nuclei near LS-closed shells, such as 16 0 and 40 Ca. (Author) 12 refs., 2 tabs

  17. An exploratory study of matrix elements of triangle I=3/2 K→ππ decays at next-to-leading order in the chiral expansion

    International Nuclear Information System (INIS)

    Boucaud, P.; Gimenez, V.; Lin, C.J.D.; Washington Univ., Seattle, WA; Lubicz, V.; Martinelli, G.; Papinutto, M.; Sachrajda, C.T.

    2004-12-01

    We present the first direct evaluation of ΔI=3/2 K → ππ matrix elements with the aim of determining all the low-energy constants at NLO in the chiral expansion. Our numerical investigation demonstrates that it is indeed possible to determine the K → ππ matrix elements directly for the masses and momenta used in the simulation with good precision. In this range however, we find that the matrix elements do not satisfy the predictions of NLO chiral perturbation theory. For the chiral extrapolation we therefore use a hybrid procedure which combines the observed polynomial behaviour in masses and momenta of our lattice results, with NLO chiral perturbation theory at lower masses. In this way we find stable results for the quenched matrix elements of the electroweak penguin operators ( I=2 left angle ππ vertical stroke O 8 vertical stroke K 0 right angle =(0.68±0.09) GeV 3 and I=2 left angle ππ vertical stroke O 7 vertical stroke K 0 right angle =(0.12±0.02) GeV 3 ), but not for the matrix elements of O 4 (for which there are too many low-energy constants at NLO for a reliable extrapolation). For all three operators we find that the effect of including the NLO corrections is significant (typically about 30%). We present a detailed discussion of the status of the prospects for the reduction of the systematic uncertainties. (orig.)

  18. Study of electron-molecule collision via finite-element method and r-matrix propagation technique: Exact exchange

    International Nuclear Information System (INIS)

    Abdolsalami, F.; Abdolsalami, M.; Perez, L.; Gomez, P.

    1995-01-01

    The authors have applied the finite-element method to electron-molecule collision with the exchange effect implemented rigorously. All the calculations are done in the body-frame within the fixed-nuclei approximation, where the exact treatment of exchange as a nonlocal effect results in a set of coupled integro-differential equations. The method is applied to e-H 2 and e-N 2 scatterings and the cross sections obtained are in very good agreement with the corresponding results the authors have generated from the linear-algebraic approach. This confirms the significant difference observed between their results generated by linear-algebraic method and the previously published e-N 2 cross sections. Their studies show that the finite-element method is clearly superior to the linear-algebraic approach in both memory usage and CPU time especially for large systems such as e-N 2 . The system coefficient matrix obtained from the finite-element method is often sparse and smaller in size by a factor of 12 to 16, compared to the linear-algebraic technique. Moreover, the CPU time required to obtain stable results with the finite-element method is significantly smaller than the linear-algebraic approach for one incident electron energy. The usage of computer resources in the finite-element method can even be reduced much further when (1) scattering calculations involving multiple electron energies are performed in one computer run and (2) exchange, which is a short range effect, is approximated by a sparse matrix. 17 refs., 7 figs., 5 tabs

  19. A Measurement of the Top Quark Mass in 1.96 TeV Proton-Antiproton Collisions Using a Novel Matrix Element Method

    International Nuclear Information System (INIS)

    CDF Collaboration; Freeman, John; Freeman, John

    2007-01-01

    A measurement of the top quark mass in t(bar t) → l + jets candidate events, obtained from p(bar p) collisions at √s = 1.96 TeV at the Fermilab Tevatron using the CDF II detector, is presented. The measurement approach is that of a matrix element method. For each candidate event, a two dimensional likelihood is calculated in the top pole mass and a constant scale factor, 'JES', where JES multiplies the input particle jet momenta and is designed to account for the systematic uncertainty of the jet momentum reconstruction. As with all matrix element techniques, the method involves an integration using the Standard Model matrix element for t(bar t) production and decay. However, the technique presented is unique in that the matrix element is modified to compensate for kinematic assumptions which are made to reduce computation time. Background events are dealt with through use of an event observable which distinguishes signal from background, as well as through a cut on the value of an event's maximum likelihood. Results are based on a 955 pb -1 data sample, using events with a high-p T lepton and exactly four high-energy jets, at least one of which is tagged as coming from a b quark; 149 events pass all the selection requirements. They find M meas = 169.8 ± 2.3(stat.) ± 1.4(syst.) GeV/c 2

  20. A Measurement of the Top Quark Mass in 1.96 TeV Proton-Antiproton Collisions Using a Novel Matrix Element Method

    Energy Technology Data Exchange (ETDEWEB)

    Freeman, John [Univ. of California, Berkeley, CA (United States)

    2007-01-01

    A measurement of the top quark mass in t$\\bar{t}$ → l + jets candidate events, obtained from p$\\bar{p}$ collisions at √s = 1.96 TeV at the Fermilab Tevatron using the CDF II detector, is presented. The measurement approach is that of a matrix element method. For each candidate event, a two dimensional likelihood is calculated in the top pole mass and a constant scale factor, 'JES', where JES multiplies the input particle jet momenta and is designed to account for the systematic uncertainty of the jet momentum reconstruction. As with all matrix element techniques, the method involves an integration using the Standard Model matrix element for t$\\bar{t}$ production and decay. However, the technique presented is unique in that the matrix element is modified to compensate for kinematic assumptions which are made to reduce computation time. Background events are dealt with through use of an event observable which distinguishes signal from background, as well as through a cut on the value of an event's maximum likelihood. Results are based on a 955 pb-1 data sample, using events with a high-pT lepton and exactly four high-energy jets, at least one of which is tagged as coming from a b quark; 149 events pass all the selection requirements. They find Mmeas = 169.8 ± 2.3(stat.) ± 1.4(syst.) GeV/c2.

  1. Controlling excited-state contamination in nucleon matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Boram; Gupta, Rajan; Bhattacharya, Tanmoy; Engelhardt, Michael; Green, Jeremy; Joó, Bálint; Lin, Huey-Wen; Negele, John; Orginos, Kostas; Pochinsky, Andrew; Richards, David; Syritsyn, Sergey; Winter, Frank

    2016-06-01

    We present a detailed analysis of methods to reduce statistical errors and excited-state contamination in the calculation of matrix elements of quark bilinear operators in nucleon states. All the calculations were done on a 2+1 flavor ensemble with lattices of size $32^3 \\times 64$ generated using the rational hybrid Monte Carlo algorithm at $a=0.081$~fm and with $M_\\pi=312$~MeV. The statistical precision of the data is improved using the all-mode-averaging method. We compare two methods for reducing excited-state contamination: a variational analysis and a two-state fit to data at multiple values of the source-sink separation $t_{\\rm sep}$. We show that both methods can be tuned to significantly reduce excited-state contamination and discuss their relative advantages and cost-effectiveness. A detailed analysis of the size of source smearing used in the calculation of quark propagators and the range of values of $t_{\\rm sep}$ needed to demonstrate convergence of the isovector charges of the nucleon to the $t_{\\rm sep} \\to \\infty $ estimates is presented.

  2. Matrix-type multiple reciprocity boundary element method for solving three-dimensional two-group neutron diffusion equations

    International Nuclear Information System (INIS)

    Itagaki, Masafumi; Sahashi, Naoki.

    1997-01-01

    The multiple reciprocity boundary element method has been applied to three-dimensional two-group neutron diffusion problems. A matrix-type boundary integral equation has been derived to solve the first and the second group neutron diffusion equations simultaneously. The matrix-type fundamental solutions used here satisfy the equation which has a point source term and is adjoint to the neutron diffusion equations. A multiple reciprocity method has been employed to transform the matrix-type domain integral related to the fission source into an equivalent boundary one. The higher order fundamental solutions required for this formulation are composed of a series of two types of analytic functions. The eigenvalue itself is also calculated using only boundary integrals. Three-dimensional test calculations indicate that the present method provides stable and accurate solutions for criticality problems. (author)

  3. Study on the fabrication of Al matrix composites strengthened by combined in-situ alumina particle and in-situ alloying elements

    International Nuclear Information System (INIS)

    Huang Zanjun; Yang Bin; Cui Hua; Zhang Jishan

    2003-01-01

    A new idea to fabricate aluminum matrix composites strengthened by combined in-situ particle strengthening and in-situ alloying has been proposed. Following the concept of in-situ alloying and in-situ particle strengthening, aluminum matrix composites reinforced by Cu and α-Al 2 O 3 particulate (material I) and the same matrix reinforced by Cu, Si alloying elements and α-Al 2 O 3 particulate (material II) have been obtained. SEM observation, EDS and XRD analysis show that the alloy elements Cu and Si exist in the two materials, respectively. In-situ Al 2 O 3 particulates are generally spherical and their mean size is less than 0.5 μm. TEM observation shows that the in-situ α-Al 2 O 3 particulates have a good cohesion with the matrix. The reaction mechanism of the Al 2 O 3 particulate obtained by this method was studied. Thermodynamic considerations are given to the in-situ reactions and the distribution characteristic of in-situ the α-Al 2 O 3 particulate in the process of solidification is also discussed

  4. Use of heterogeneous finite elements generated by collision probability solutions to calculate a pool reactor core

    International Nuclear Information System (INIS)

    Calabrese, C.R.; Grant, C.R.

    1990-01-01

    This work presents comparisons between measured fluxes obtained by activation of Manganese foils in the light water, enriched uranium research pool reactor RA-2 MTR (Materials Testing Reactors) fuel element) and fluxes calculated by the finite element method FEM using DELFIN code, and describes the heterogeneus finite elements by a set of solutions of the transport equations for several different configurations obtained using the collision probability code HUEMUL. The agreement between calculated and measured fluxes is good, and the advantage of using FEM is showed because to obtain the flux distribution with same detail using an usual diffusion calculation it would be necessary 12000 mesh points against the 2000 points that FEM uses, hence the processing time is reduced in a factor ten. An interesting alternative to use in MTR fuel management is presented. (Author) [es

  5. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

    Science.gov (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

    2018-02-19

    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

  6. An experimental determination of the parameters describing the K/sup + / to pi /sup +/ pi /sup 0/ pi /sup 0/ decay matrix element

    CERN Document Server

    Braun, H; Erriquez, O; Martyn, H U; Renton, P B; Romano, F; Vilain, P; Waldren, D

    1976-01-01

    The matrix element of the three pion decay mode of the kaon is expressed in terms of Mandelstam variables. An analysis of the Dalitz plot density distribution gives information on the parameters of the expression. From an analysis of the decays of stopping K/sup +/ mesons involving neutral pions in the CERN heavy-liquid bubble chamber filled with a propane ethane mixture, it is concluded that the energy dependence of the decay matrix element is compatible with a linear behaviour. (3 refs).

  7. Finite element implementation and numerical issues of strain gradient plasticity with application to metal matrix composites

    DEFF Research Database (Denmark)

    Frederiksson, Per; Gudmundson, Peter; Mikkelsen, Lars Pilgaard

    2009-01-01

    A framework of finite element equations for strain gradient plasticity is presented. The theoretical framework requires plastic strain degrees of freedom in addition to displacements and a plane strain version is implemented into a commercial finite element code. A couple of different elements...... of quadrilateral type are examined and a few numerical issues are addressed related to these elements as well as to strain gradient plasticity theories in general. Numerical results are presented for an idealized cell model of a metal matrix composite under shear loading. It is shown that strengthening due...... to fiber size is captured but strengthening due to fiber shape is not. A few modelling aspects of this problem are discussed as well. An analytic solution is also presented which illustrates similarities to other theories....

  8. Classical-limit S-matrix for heavy ion scattering

    International Nuclear Information System (INIS)

    Donangelo, R.J.

    1977-01-01

    An integral representation for the classical limit of the quantum mechanical S-matrix is developed and applied to heavy-ion Coulomb excitation and Coulomb-nuclear interference. The method combines the quantum principle of superposition with exact classical dynamics to describe the projectile-target system. A detailed consideration of the classical trajectories and of the dimensionless parameters that characterize the system is carried out. The results are compared, where possible, to exact quantum mechanical calculations and to conventional semiclassical calculations. It is found that in the case of backscattering the classical limit S-matrix method is able to almost exactly reproduce the quantum-mechanical S-matrix elements, and therefore the transition probabilities, even for projectiles as light as protons. The results also suggest that this approach should be a better approximation for heavy-ion multiple Coulomb excitation than earlier semiclassical methods, due to a more accurate description of the classical orbits in the electromagnetic field of the target nucleus. Calculations using this method indicate that the rotational excitation probabilities in the Coulomb-nuclear interference region should be very sensitive to the details of the potential at the surface of the nucleus, suggesting that heavy-ion rotational excitation could constitute a sensitive probe of the nuclear potential in this region. The application to other problems as well as the present limits of applicability of the formalism are also discussed

  9. RESEARCH ABSORBING STATES OF THE SYSTEM USING MARKOV CHAINS AND FUNDAMENTAL MATRIX

    Directory of Open Access Journals (Sweden)

    Тетяна Мефодіївна ОЛЕХ

    2016-02-01

    Full Text Available The article discusses the use Markov chains to research models that reflect the essential properties of systems, including methods of measuring the parameters of projects and assess their effectiveness. In the study carried out by its decomposition system for certain discrete state and create a diagram of transitions between these states. Specificity displays various objects Markov homogeneous chains with discrete states and discrete time determined by the method of calculation of transition probabilities. A model of success criteria for absorbing state system that is universal for all projects. A breakdown of passages to the matrix submatrices. The variation elements under matrix Q n with growth linked to the definition of important quantitative characteristics of absorbing circuits: 1 the probability of achieving the status of absorbing any given; 2 the mean number of steps needed to achieve the absorbing state; 3 the mean time that the system spends in each state to hit irreversible system in absorbing state. Built fundamental matrix that allowed calculating the different characteristics of the system. Considered fundamental matrix for supposedly modeled absorbing Markov chain, which gives the forecast for the behavior of the system in the future regardless of the absolute value of the time elapsed from the starting point. This property illustrates the fundamental matrix Markov process that characterizes it as a process without aftereffect.

  10. Bounds on the Cabibbo-Kobayashi-Maskawa matrix elements vertical strokeVtdvertical stroke and vertical strokeVtsvertical stroke from experiments on B0-anti B0 mixings

    International Nuclear Information System (INIS)

    Ali, A.; Eijk, B. van; Have, I. ten

    1987-01-01

    We present a theoretical analysis of the process panti p → μ ± μ ± X, μ ± X', μ + μ - X' due to heavy flavour production and decays, based on perturbative quantum chromodynamics, QCD. We find reasonable agreement for the inclusive rates and distributions between the UA1 measurement and our calculations, with the exception of the dimuon ratio R(±±/+--), which is found typically a factor ≅ 1.8 smaller than the UA1 data. We interpret this excess in terms of B s 0 -anti B s 0 mixing and obtain a lower bound on the mixing probability, ρ s > 0.14. In the standard model this implies a lower bound on the Cabibbo-Kobayashi-Maskawa matrix element vertical strokeV ts vertical stroke given the top quark mass. The lower bound on vertical strokeV ts vertical stroke and the upper bound on vertical strokeV td vertical stroke, obtained from the (upper bound) B d 0 -anti B d 0 mixing probability, ρ d , from e + e - experiments are worked out. (orig.)

  11. Spin Density Matrix Elements in exclusive production of ω mesons at Hermes

    Directory of Open Access Journals (Sweden)

    Marianski B.

    2014-03-01

    Full Text Available Spin density matrix elements have been determined for exclusive ω meson production on hydrogen and deuterium targets, in the kinematic region of 1.0 < Q2 < 10.0 GeV2, 3.0 < W < 6.3 GeV and –t' < 0.2 GeV2. The data, from which SDMEs are determined, were accumulated with the HERMES forward spectrometer during the running period of 1996 to 2007 using the 27.6 GeV electron or positron beam of HERA. A sizable contribution of unnatural parity exchange amplitudes is found for exclusive ω meson production.

  12. Nucleon distribution apmlitudes and proton decay matrix elements on the lattice

    Energy Technology Data Exchange (ETDEWEB)

    Braun, Vladimir M.; Goeckeler, Meinulf [Regensburg Univ. (Germany). Inst. fuer Theoretische Physik; Horsley, Roger [Edinburgh Univ. (GB). School of Physics] (and others)

    2008-11-15

    Baryon distribution amplitudes (DAs) are crucial for the theory of hard exclusive reactions. We present a calculation of the first few moments of the leading-twist nucleon DA within lattice QCD. In addition we deal with the normalization of the next-to-leading (twist-four) DAs. The matrix elements determining the latter quantities are also responsible for proton decay in Grand Unified Theories. Our lattice evaluation makes use of gauge field configurations generated with two flavors of clover fermions. The relevant operators are renormalized nonperturbatively with the final results given in the MS scheme. We find that the deviation of the leading-twist nucleon DA from its asymptotic form is less pronounced than sometimes claimed in the literature. (orig.)

  13. Massive 3-loop ladder diagrams for quarkonic local operator matrix elements

    International Nuclear Information System (INIS)

    Ablinger, Jakob; Blümlein, Johannes; Hasselhuhn, Alexander; Klein, Sebastian; Schneider, Carsten; Wißbrock, Fabian

    2012-01-01

    3-loop diagrams of the ladder-type, which emerge for local quarkonic twist-2 operator matrix elements, are computed directly for general values of the Mellin variable N using Appell-function representations and applying modern summation technologies provided by the package Sigma and the method of hyperlogarithms. In some of the diagrams generalized harmonic sums with ξ∈{1,1/2,2} emerge beyond the usual nested harmonic sums. As the asymptotic representation of the corresponding integrals shows, the generalized sums conspire giving well behaved expressions for large values of N. These diagrams contribute to the 3-loop heavy flavor Wilson coefficients of the structure functions in deep-inelastic scattering in the region Q 2 ≫m 2 .

  14. Optical transition probabilities in electron-vibration-rotation spectra of diatomic molecules

    International Nuclear Information System (INIS)

    Kuznetsova, L.A.; Kuz'menko, N.E.; Kuzyakov, Yu.Ya.; Plastinin, Yu.A.

    1974-01-01

    The present review systematizes the data on the absolute probabilities of electron transitions in diatomic molecules, which have been published since the beginning of 1961 and up to the end of 1973, and those on the relative transition probabilities, which have been published since the beginning of 1966 till the end of 1973. The review discussed the theoretical relationships underlying the experimental techniques of determining the absolute transition probabilities. Modifications of the techniques under discussion are not specially examined; the details of interest can be found, however, in the references cited. The factual material-, such as the values of the absolute probabilities of electron transitions, the dependences of the electron transition moments on the internuclear distance and the values of the Franck-Condon factors,- is presented in tables 1, 2 and 4, respectively, embracing all the relevant works known to the present authors. Along with a complete systematization of the transition probability data, the authors have attempted a critical analysis of the available data in order to select the most reliable results. The recommended values of the squared matrix elements of the electron transition dipole moments are given in table 3. The last chaper of the work compares the results of calculations of the Franck-Condon factors obtained with the different milecular potentials [ru

  15. The transition probabilities of the reciprocity model

    NARCIS (Netherlands)

    Snijders, T.A.B.

    1999-01-01

    The reciprocity model is a continuous-time Markov chain model used for modeling longitudinal network data. A new explicit expression is derived for its transition probability matrix. This expression can be checked relatively easily. Some properties of the transition probabilities are given, as well

  16. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  17. Nucleon scalar matrix elements with N{sub f}=2+1+1 twisted mass fermions

    Energy Technology Data Exchange (ETDEWEB)

    Dinter, Simon; Drach, Vincent; Jansen, Karl [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC

    2011-12-15

    We investigate scalar matrix elements of the nucleon using N{sub f}=2+1+1 flavors of maximally twisted mass fermions at a fixed value of the lattice spacing of a{approx}0.078 fm. We compute disconnected contributions to the relevant three-point functions using an efficient noise reduction technique. Using these methods together with an only multiplicative renormalization applicable for twisted mass fermions, allows us to obtain accurate results in the light and strange sector. (orig.)

  18. High-Energy Anomaly in the Angle-Resolved Photoemission Spectra of Nd2-xCexCuO4: Evidence for a Matrix Element Effect

    Science.gov (United States)

    Rienks, E. D. L.; ńrrälä, M.; Lindroos, M.; Roth, F.; Tabis, W.; Yu, G.; Greven, M.; Fink, J.

    2014-09-01

    We use polarization-dependent angle-resolved photoemission spectroscopy (ARPES) to study the high-energy anomaly (HEA) in the dispersion of Nd2-xCexCuO4, x =0.123. We find that at particular photon energies the anomalous, waterfall-like dispersion gives way to a broad, continuous band. This suggests that the HEA is a matrix element effect: it arises due to a suppression of the intensity of the broadened quasiparticle band in a narrow momentum range. We confirm this interpretation experimentally, by showing that the HEA appears when the matrix element is suppressed deliberately by changing the light polarization. Calculations of the matrix element using atomic wave functions and simulation of the ARPES intensity with one-step model calculations provide further evidence for this scenario. The possibility to detect the full quasiparticle dispersion further allows us to extract the high-energy self-energy function near the center and at the edge of the Brillouin zone.

  19. High-energy anomaly in the angle-resolved photoemission spectra of Nd(2-x)Ce(x)CuO₄: evidence for a matrix element effect.

    Science.gov (United States)

    Rienks, E D L; Ärrälä, M; Lindroos, M; Roth, F; Tabis, W; Yu, G; Greven, M; Fink, J

    2014-09-26

    We use polarization-dependent angle-resolved photoemission spectroscopy (ARPES) to study the high-energy anomaly (HEA) in the dispersion of Nd(2-x)Ce(x)CuO₄, x=0.123. We find that at particular photon energies the anomalous, waterfall-like dispersion gives way to a broad, continuous band. This suggests that the HEA is a matrix element effect: it arises due to a suppression of the intensity of the broadened quasiparticle band in a narrow momentum range. We confirm this interpretation experimentally, by showing that the HEA appears when the matrix element is suppressed deliberately by changing the light polarization. Calculations of the matrix element using atomic wave functions and simulation of the ARPES intensity with one-step model calculations provide further evidence for this scenario. The possibility to detect the full quasiparticle dispersion further allows us to extract the high-energy self-energy function near the center and at the edge of the Brillouin zone.

  20. Three-loop contributions to the gluonic massive operator matrix elements at general values of N

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, Jakob; Hasselhuhn, Alexander [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Bluemlein, Johannes; Raab, Clemens [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); De Freitas, Abilio; Round, Mark; Schneider, Carsten; Wissbrock, Fabian [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation; Klein, Sebastian [RWTH Aachen Univ. (Germany). Inst. fuer Theoretische Physik E

    2012-12-15

    Recent results on the calculation of 3-loop massive operator matrix elements in case of one and two heavy quark masses are reported. They concern the O(n{sub f}T{sup 2}{sub F}C{sub F,A}) and O(T{sup 2}{sub F}C{sub F,A}) gluonic corrections, two-mass quarkonic moments, and ladder- and Benz-topologies. We also discuss technical aspects of the calculations.

  1. Neutrino mass matrix: Inverted hierarchy and CP violation

    International Nuclear Information System (INIS)

    Frigerio, Michele; Smirnov, Alexei Yu.

    2003-01-01

    We reconstruct the neutrino mass matrix in the flavor basis, in the case of an inverted mass hierarchy (ordering), using all available experimental data on neutrino masses and oscillations. We analyze the dependence of the matrix elements m αβ on the CP violating Dirac δ and Majorana ρ and σ phases, for different values of the absolute mass scale. We find that the present data admit various structures of the mass matrix: (i) hierarchical structures with a set of small (zero) elements; (ii) structures with equalities among various groups of elements: e-row and/or μτ-block elements, diagonal and/or off-diagonal elements; (iii) 'democratic' structure. We find the values of phases for which these structures are realized. The mass matrix elements can anticorrelate with flavor: inverted partial or complete flavor alignment is possible. For various structures of the mass matrix we identify the possible underlying symmetry. We find that the mass matrix can be reconstructed completely only in particular cases, provided that the absolute scale of the mass is measured. Generally, the freedom related to the Majorana phase σ will not be removed, thus admitting various types of mass matrix

  2. First determination of the quark mixing matrix element $V_{tb}$ from electroweak corrections to Z decays and implications for CKM matrix unitarity

    CERN Document Server

    Swain, J D

    1999-01-01

    We present a new method for the determination of the Cabibbo- Kobayashi-Maskawa quark mixing matrix element V/sub tb/ from electroweak loop corrections, in particular those affecting the process Z to bb. From a combined analysis of results from the LEP, SLC, Tevatron, and neutrino scattering experiments we determine V /sub tb/=0.77/sub -0.24//sup +18/. We comment briefly on the implications of this measurement for the mass of the top quark and Higgs boson, alpha /sub s/, and CKM unitarity. (19 refs).

  3. An experimentalist's guide to the matrix element in angle resolved photoemission

    International Nuclear Information System (INIS)

    Moser, Simon

    2017-01-01

    Highlights: • An introduction to the art of angle resolved photoemission is presented. • Matrix element effects are described by a nearly free electron final state model. • ARPES spectral weight of a Bloch band can be calculated from the Fourier transform of its Wannier orbital. • Experimental handedness and improper polarization introduce dichroism. • Instructive showcases from modern ARPES are discussed in detail. - Abstract: Angle resolved photoemission spectroscopy (ARPES) is commonly known as a powerful probe of the one-electron removal spectral function in ordered solid state. With increasing efficiency of light sources and spectrometers, experiments over a wide range of emission angles become more and more common. Consequently, the angular variation of ARPES spectral weight – often times termed “matrix element effect” – enters as an additional source of information. In this tutorial, we develop a simple but instructive free electron final state approach based on the three-step model to describe the intensity distribution in ARPES. We find a compact expression showing that the ARPES spectral weight of a given Bloch band is essentially determined by the momentum distribution (the Fourier transform) of its associated Wannier orbital – times a polarization dependent pre-factor. While the former is giving direct information on the symmetry and shape of the electronic wave function, the latter can give rise to surprising geometric effects. We discuss a variety of modern and instructive experimental showcases for which this simplistic formalism works astonishingly well and discuss the limits of this approach.

  4. An experimentalist's guide to the matrix element in angle resolved photoemission

    Energy Technology Data Exchange (ETDEWEB)

    Moser, Simon, E-mail: skmoser@lbl.gov [Advanced Light Source (ALS), Berkeley, CA 94720 (United States); Institute of Physics (IPHYS), Ecole Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)

    2017-01-15

    Highlights: • An introduction to the art of angle resolved photoemission is presented. • Matrix element effects are described by a nearly free electron final state model. • ARPES spectral weight of a Bloch band can be calculated from the Fourier transform of its Wannier orbital. • Experimental handedness and improper polarization introduce dichroism. • Instructive showcases from modern ARPES are discussed in detail. - Abstract: Angle resolved photoemission spectroscopy (ARPES) is commonly known as a powerful probe of the one-electron removal spectral function in ordered solid state. With increasing efficiency of light sources and spectrometers, experiments over a wide range of emission angles become more and more common. Consequently, the angular variation of ARPES spectral weight – often times termed “matrix element effect” – enters as an additional source of information. In this tutorial, we develop a simple but instructive free electron final state approach based on the three-step model to describe the intensity distribution in ARPES. We find a compact expression showing that the ARPES spectral weight of a given Bloch band is essentially determined by the momentum distribution (the Fourier transform) of its associated Wannier orbital – times a polarization dependent pre-factor. While the former is giving direct information on the symmetry and shape of the electronic wave function, the latter can give rise to surprising geometric effects. We discuss a variety of modern and instructive experimental showcases for which this simplistic formalism works astonishingly well and discuss the limits of this approach.

  5. Form of multicomponent Fickian diffusion coefficients matrix

    International Nuclear Information System (INIS)

    Wambui Mutoru, J.; Firoozabadi, Abbas

    2011-01-01

    Highlights: → Irreversible thermodynamics establishes form of multicomponent diffusion coefficients. → Phenomenological coefficients and thermodynamic factors affect sign of diffusion coefficients. → Negative diagonal elements of diffusion coefficients matrix can occur in non-ideal mixtures. → Eigenvalues of the matrix of Fickian diffusion coefficients may not be all real. - Abstract: The form of multicomponent Fickian diffusion coefficients matrix in thermodynamically stable mixtures is established based on the form of phenomenological coefficients and thermodynamic factors. While phenomenological coefficients form a symmetric positive definite matrix, the determinant of thermodynamic factors matrix is positive. As a result, the Fickian diffusion coefficients matrix has a positive determinant, but its elements - including diagonal elements - can be negative. Comprehensive survey of reported diffusion coefficients data for ternary and quaternary mixtures, confirms that invariably the determinant of the Fickian diffusion coefficients matrix is positive.

  6. Elimination of matrix effect in quantitative analysis of elements using x-ray fluorescence

    International Nuclear Information System (INIS)

    Sampaio, R.V.

    1973-07-01

    The emission-transmission method of Leroux and Mahmud, an experimental technique for compensating matrix effects in photon excited X-ray fluorescence analysis, was used to determine the concentration of lead and antimony in pellets of galalith. The effect of interfering elements was studied by adding various concentrations of mercury and tin to the respective pellets. To illustrate possible environmental applications, a number of pellets was prepared from leaves of almond trees located in different regions of Rio de Janeiro. Lead concentrations were determined for the dried leaf material and showed values ranging from 50 to 145 parts per million [pt

  7. Multi-Target Angle Tracking Algorithm for Bistatic Multiple-Input Multiple-Output (MIMO Radar Based on the Elements of the Covariance Matrix

    Directory of Open Access Journals (Sweden)

    Zhengyan Zhang

    2018-03-01

    Full Text Available In this paper, we consider the problem of tracking the direction of arrivals (DOA and the direction of departure (DOD of multiple targets for bistatic multiple-input multiple-output (MIMO radar. A high-precision tracking algorithm for target angle is proposed. First, the linear relationship between the covariance matrix difference and the angle difference of the adjacent moment was obtained through three approximate relations. Then, the proposed algorithm obtained the relationship between the elements in the covariance matrix difference. On this basis, the performance of the algorithm was improved by averaging the covariance matrix element. Finally, the least square method was used to estimate the DOD and DOA. The algorithm realized the automatic correlation of the angle and provided better performance when compared with the adaptive asymmetric joint diagonalization (AAJD algorithm. The simulation results demonstrated the effectiveness of the proposed algorithm. The algorithm provides the technical support for the practical application of MIMO radar.

  8. Multi-Target Angle Tracking Algorithm for Bistatic Multiple-Input Multiple-Output (MIMO) Radar Based on the Elements of the Covariance Matrix.

    Science.gov (United States)

    Zhang, Zhengyan; Zhang, Jianyun; Zhou, Qingsong; Li, Xiaobo

    2018-03-07

    In this paper, we consider the problem of tracking the direction of arrivals (DOA) and the direction of departure (DOD) of multiple targets for bistatic multiple-input multiple-output (MIMO) radar. A high-precision tracking algorithm for target angle is proposed. First, the linear relationship between the covariance matrix difference and the angle difference of the adjacent moment was obtained through three approximate relations. Then, the proposed algorithm obtained the relationship between the elements in the covariance matrix difference. On this basis, the performance of the algorithm was improved by averaging the covariance matrix element. Finally, the least square method was used to estimate the DOD and DOA. The algorithm realized the automatic correlation of the angle and provided better performance when compared with the adaptive asymmetric joint diagonalization (AAJD) algorithm. The simulation results demonstrated the effectiveness of the proposed algorithm. The algorithm provides the technical support for the practical application of MIMO radar.

  9. Phenomenology of the CKM matrix

    International Nuclear Information System (INIS)

    Nir, Y.

    1989-01-01

    The way in which an exact determination of the CKM matrix elements tests the standard Model is demonstrated by a two-generation example. The determination of matrix elements from meson semileptonic decays is explained, with an emphasis on the respective reliability of quark level and meson level calculations. The assumptions involved in the use of loop processes are described. Finally, the state of the art of the knowledge of the CKM matrix is presented. 19 refs., 2 figs

  10. Matrix effect studies with empirical formulations in maize saplings

    International Nuclear Information System (INIS)

    Bansal, Meenakshi; Deep, Kanan; Mittal, Raj

    2012-01-01

    In X-ray fluorescence, the earlier derived matrix effects from fundamental relations of intensities of analyte/matrix elements with basic atomic and experimental setup parameters and tested on synthetic known samples were found empirically related to analyte/matrix elemental amounts. The present study involves the application of these relations on potassium and calcium macronutrients of maize saplings treated with different fertilizers. The novelty of work involves a determination of an element in the presence of its secondary excitation rather than avoiding the secondary fluorescence. Therefore, the possible utility of this process is in studying the absorption for some intermediate samples in a lot of a category of samples with close Z interfering constituents (just like Ca and K). Once the absorption and enhancement terms are fitted to elemental amounts and fitted coefficients are determined, with the absorption terms from the fit and an enhancer element amount known from its selective excitation, the next iterative elemental amount can be directly evaluated from the relations. - Highlights: ► Empirical formulation for matrix corrections in terms of amounts of analyte and matrix element. ► The study applied on K and Ca nutrients of maize, rice and potato organic materials. ► The formulation provides matrix terms from amounts of analyte/matrix elements and vice versa.

  11. A Data Matrix Method for Improving the Quantification of Element Percentages of SEM/EDX Analysis

    Science.gov (United States)

    Lane, John

    2009-01-01

    A simple 2D M N matrix involving sample preparation enables the microanalyst to peer below the noise floor of element percentages reported by the SEM/EDX (scanning electron microscopy/ energy dispersive x-ray) analysis, thus yielding more meaningful data. Using the example of a 2 3 sample set, there are M = 2 concentration levels of the original mix under test: 10 percent ilmenite (90 percent silica) and 20 percent ilmenite (80 percent silica). For each of these M samples, N = 3 separate SEM/EDX samples were drawn. In this test, ilmenite is the element of interest. By plotting the linear trend of the M sample s known concentration versus the average of the N samples, a much higher resolution of elemental analysis can be performed. The resulting trend also shows how the noise is affecting the data, and at what point (of smaller concentrations) is it impractical to try to extract any further useful data.

  12. Micromechanics of deformation of metallic-glass-matrix composites from in situ synchrotron strain measurements and finite element modeling

    International Nuclear Information System (INIS)

    Ott, R.T.; Sansoz, F.; Molinari, J.F.; Almer, J.; Ramesh, K.T.; Hufunagel, T.C.

    2005-01-01

    In situ X-ray scattering and finite element modeling (FEM) were used to examine the micromechanics of deformation of in situ formed metallic-glass-matrix composites consisting of Ta-rich particles dispersed in an amorphous matrix. The strain measurements show that under uniaxial compression the second-phase particles yield at an applied stress of approx. 325 MPa. After yielding, the particles do not strain harden significantly; we show that this is due to an increasingly hydrostatic stress state arising from the lateral constraint on deformation of the particles imposed by the elastic matrix. Shear band initiation in the matrix is not due to the difference in elastic properties between the matrix and the particles. Rather, the development of a plastic misfit strain causes stress concentrations around the particles, resulting in localized yielding of the matrix by shear band formation at an applied stress of approx. 1450 MPa, considerably lower than the macroscopic yield stress of the composite (approx. 1725 MPa). Shear bands do not propagate at the lower stress because the yield criterion of the matrix is only satisfied in the region immediately around the particles. At the higher stresses, the yield criterion is satisfied in large regions of the matrix, allowing extensive shear band propagation and significant macroscopic plastic deformation. However, the presence of the particles makes the stress state highly inhomogeneous, which may partially explain why fracture is suppressed in the composite, allowing the development of large plastic strains

  13. Relativistic atomic matrix elements of rq for arbitrary states in the quantum-defect approximation

    International Nuclear Information System (INIS)

    Owono Owono, L.C.; Owona Angue, M.L.C.; Kwato Njock, M.G.; Oumarou, B.

    2004-01-01

    Recurrence relations used in the calculation of matrix elements of r q for arbitrary q and states of the relativistic one-electron atom with a point-like ionic core are obtained with Dirac and quasirelativistic effective radial Hamiltonians. The phenomenological and supersymmetry-inspired quantum-defect approaches introduced in previous works to model the electron-core interactions are employed. The formulas worked out on the basis of a hypervirial inspired method may be viewed as a generalization to off-diagonal cases of our recently reported results on the evaluation of expectation values of r q

  14. Application of tungsten-fibre-reinforced copper matrix composites to a high-heat-flux component: A design study by dual scale finite element analysis

    International Nuclear Information System (INIS)

    Jeong-Ha You

    2006-01-01

    According to the European Power Plant Conceptual Study, actively cooled tungsten mono-block is one of the divertor design options for fusion reactors. In this study the coolant tube acts as a heat sink and the tungsten block as plasma-facing armour. A key material issue here is how to achieve high temperature strength and high heat conductivity of the heat sink tube simultaneously. Copper matrix composite reinforced with continuous strong fibres has been considered as a candidate material for heat sink of high-heat-flux components. Refractory tungsten wire is a promising reinforcement material due to its high strength, winding flexibility and good interfacial wetting with copper. We studied the applicability of tungsten-fibre-reinforced copper matrix composite heat sink tubes for the tungsten mono-block divertor by means of dual-scale finite element analysis. Thermo-elasto-plastic micro-mechanics homogenisation technique was applied. A heat flux of 15 MW/m 2 with cooling water temperature of 320 o C was considered. Effective stress-free temperature was assumed to be 500 o C. Between the tungsten block and the composite heat sink tube interlayer (1 mm thick) of soft Cu was inserted. The finite element analysis yields the following results: The predicted maximum temperature at steady state is 1223 o C at the surface and 562 o C at the interface between tube and copper layer. On the macroscopic scale, residual stress is generated during fabrication due to differences in thermal expansion coefficients of the materials. Strong compressive stress occurs in the tungsten block around the tube while weak tensile stress is present in the interlayer. The local and global probability of brittle failure of the tungsten block was also estimated using the probabilistic failure theories. The thermal stresses are significantly decreased upon subsequent heat flux loading. Resolving the composite stress on microscopic scale yields a maximum fibre axial stress of 3000 MPa after

  15. Fossil Signatures Using Elemental Abundance Distributions and Bayesian Probabilistic Classification

    Science.gov (United States)

    Hoover, Richard B.; Storrie-Lombardi, Michael C.

    2004-01-01

    Elemental abundances (C6, N7, O8, Na11, Mg12, Al3, P15, S16, Cl17, K19, Ca20, Ti22, Mn25, Fe26, and Ni28) were obtained for a set of terrestrial fossils and the rock matrix surrounding them. Principal Component Analysis extracted five factors accounting for the 92.5% of the data variance, i.e. information content, of the elemental abundance data. Hierarchical Cluster Analysis provided unsupervised sample classification distinguishing fossil from matrix samples on the basis of either raw abundances or PCA input that agreed strongly with visual classification. A stochastic, non-linear Artificial Neural Network produced a Bayesian probability of correct sample classification. The results provide a quantitative probabilistic methodology for discriminating terrestrial fossils from the surrounding rock matrix using chemical information. To demonstrate the applicability of these techniques to the assessment of meteoritic samples or in situ extraterrestrial exploration, we present preliminary data on samples of the Orgueil meteorite. In both systems an elemental signature produces target classification decisions remarkably consistent with morphological classification by a human expert using only structural (visual) information. We discuss the possibility of implementing a complexity analysis metric capable of automating certain image analysis and pattern recognition abilities of the human eye using low magnification optical microscopy images and discuss the extension of this technique across multiple scales.

  16. Matrix calculus

    CERN Document Server

    Bodewig, E

    1959-01-01

    Matrix Calculus, Second Revised and Enlarged Edition focuses on systematic calculation with the building blocks of a matrix and rows and columns, shunning the use of individual elements. The publication first offers information on vectors, matrices, further applications, measures of the magnitude of a matrix, and forms. The text then examines eigenvalues and exact solutions, including the characteristic equation, eigenrows, extremum properties of the eigenvalues, bounds for the eigenvalues, elementary divisors, and bounds for the determinant. The text ponders on approximate solutions, as well

  17. Extinction probabilities and stationary distributions of mobile genetic elements in prokaryotes: The birth-death-diversification model.

    Science.gov (United States)

    Drakos, Nicole E; Wahl, Lindi M

    2015-12-01

    Theoretical approaches are essential to our understanding of the complex dynamics of mobile genetic elements (MGEs) within genomes. Recently, the birth-death-diversification model was developed to describe the dynamics of mobile promoters (MPs), a particular class of MGEs in prokaryotes. A unique feature of this model is that genetic diversification of elements was included. To explore the implications of diversification on the longterm fate of MGE lineages, in this contribution we analyze the extinction probabilities, extinction times and equilibrium solutions of the birth-death-diversification model. We find that diversification increases both the survival and growth rate of MGE families, but the strength of this effect depends on the rate of horizontal gene transfer (HGT). We also find that the distribution of MGE families per genome is not necessarily monotonically decreasing, as observed for MPs, but may have a peak in the distribution that is related to the HGT rate. For MPs specifically, we find that new families have a high extinction probability, and predict that the number of MPs is increasing, albeit at a very slow rate. Additionally, we develop an extension of the birth-death-diversification model which allows MGEs in different regions of the genome, for example coding and non-coding, to be described by different rates. This extension may offer a potential explanation as to why the majority of MPs are located in non-promoter regions of the genome. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Generic Cospark of a Matrix Can Be Computed in Polynomial Time

    OpenAIRE

    Zhong, Sichen; Zhao, Yue

    2017-01-01

    The cospark of a matrix is the cardinality of the sparsest vector in the column space of the matrix. Computing the cospark of a matrix is well known to be an NP hard problem. Given the sparsity pattern (i.e., the locations of the non-zero entries) of a matrix, if the non-zero entries are drawn from independently distributed continuous probability distributions, we prove that the cospark of the matrix equals, with probability one, to a particular number termed the generic cospark of the matrix...

  19. Eigenstates and radiative transition probabilities for Tm3+(4f12) in phosphate and tellurite glasses

    International Nuclear Information System (INIS)

    Spector, N.; Reisfeld, R.; Boehm, L.

    1977-01-01

    Electronic wavefunctions of Tm 3+ in intermediate coupling were obtained and used to calculate the Usup((lambda)) matrix elements between all possible states of the 4f 12 configuration. The Judd-Ofelt intensity parameters Ωsub(lambda) obtained for Tm 3+ in phosphate and tellurite glasses were used in conjunction with the Usup((lambda))'s to calculate the forced electric dipole line strengths. The total electric and magnetic radiative transition probabilities are calculated. The entire theoretical spectrum involving the ground and excited levels (from 129 nm to 16447 nm) is given. (Auth.)

  20. Radiochemical separation and ICP-AES determination of some common metallic elements in ThO2 matrix

    International Nuclear Information System (INIS)

    Adya, V.C.; Hon, N.S.; Bangia, T.R.; Sastry, M.D.; Iyer, R.H.

    1997-01-01

    Radioactive tracer and also ICP-AES studies have been carried out to determine Al, Cd, Ca, Cr, Co, Cu, Mn, Mo and Pd in ThO 2 matrix after chemical separation. Di-2-ethyl-hexyl phosphoric acid/xylene/HNO 3 extraction system was used for quantitative separation of thorium. The recovery of elements as determined by tracers and ICP-AES was found to be quantitative within experimental error. (author). 3 refs., 1 tab

  1. Nonorthogonal orbital based N-body reduced density matrices and their applications to valence bond theory. I. Hamiltonian matrix elements between internally contracted excited valence bond wave functions

    Science.gov (United States)

    Chen, Zhenhua; Chen, Xun; Wu, Wei

    2013-04-01

    In this series, the n-body reduced density matrix (n-RDM) approach for nonorthogonal orbitals and their applications to ab initio valence bond (VB) methods are presented. As the first paper of this series, Hamiltonian matrix elements between internally contracted VB wave functions are explicitly provided by means of nonorthogonal orbital based RDM approach. To this end, a more generalized Wick's theorem, called enhanced Wick's theorem, is presented both in arithmetical and in graphical forms, by which the deduction of expressions for the matrix elements between internally contracted VB wave functions is dramatically simplified, and the matrix elements are finally expressed in terms of tensor contractions of electronic integrals and n-RDMs of the reference VB self-consistent field wave function. A string-based algorithm is developed for the purpose of evaluating n-RDMs in an efficient way. Using the techniques presented in this paper, one is able to develop new methods and efficient algorithms for nonorthogonal orbital based many-electron theory much easier than by use of the first quantized formulism.

  2. Neutron-proton matrix element ratios of 21+ states in 58,60,62,64Ni

    International Nuclear Information System (INIS)

    Antalik, R.

    1989-01-01

    The neutron-proton matrix element ratios (η) for 2 1 + states of even Ni isotopes are investigated within the framework of the shell model quasiparticle random-phase approximation. The special attention is devoted to the dependence of η ratios on the radial neutron and proton ground-state density-distribution differences (Δ np ). This dependence is found to be about 0.5Δ np . The theoretical η ratios are 14-23% greater than the hydrodynamical limit. The theoretical Δ np dependence of η ratios enable us to understand the empirical η ratio results. 20 refs.; 2 figs.; 2 tabs

  3. HELAC-Onia: an automatic matrix element generator for heavy quarkonium physics

    CERN Document Server

    Shao, Hua-Sheng

    2013-01-01

    By the virtues of the Dyson-Schwinger equations, we upgrade the published code \\mtt{HELAC} to be capable to calculate the heavy quarkonium helicity amplitudes in the framework of NRQCD factorization, which we dub \\mtt{HELAC-Onia}. We rewrote the original \\mtt{HELAC} to make the new program be able to calculate helicity amplitudes of multi P-wave quarkonium states production at hadron colliders and electron-positron colliders by including new P-wave off-shell currents. Therefore, besides the high efficiencies in computation of multi-leg processes within the Standard Model, \\mtt{HELAC-Onia} is also sufficiently numerical stable in dealing with P-wave quarkonia (e.g. $h_{c,b},\\chi_{c,b}$) and P-wave color-octet intermediate states. To the best of our knowledge, it is a first general-purpose automatic quarkonium matrix elements generator based on recursion relations on the market.

  4. Matrix elements for the anti B{yields}X{sub s}{gamma} decay at NNLO

    Energy Technology Data Exchange (ETDEWEB)

    Schutzmeier, Thomas Paul

    2009-12-17

    In the context of the indirect search for non-standard physics in the flavour sector of the Standard Model (SM), one of the most interesting processes is the rare inclusive anti B{yields} X{sub s}{gamma} decay. On the one hand, being a flavour-changing neutral current, this B decay is sensitive to new physics, as it is loop-suppressed in the SM. On the other hand, it is only mildly affected by non-perturbative effects, and thus allows for precise theoretical predictions in the framework of renormalization-group improved perturbation theory. Accurate measurements as well as precise theoretical predictions with a good control over both perturbative and non-perturbative contributions have to be provided in order to derive stringent constraints on the parameter space of physics beyond the SM. On the experimental side, an outstanding accuracy in the measurement of the anti B{yields}X{sub s}{gamma} decay rate has been achieved, which is mainly due the specialized experiments BaBar and Belle at the so-called B factories. To match the small experimental uncertainty, higher order computations within an effective low-energy theory of the SM are mandatory. In fact, next-to-next-to-leading order (NNLO) QCD corrections are required to provide a prediction for the decay rate with the same precision as the measurement. The NNLO evaluation of the anti B{yields}X{sub s}{gamma} decay rate has been pursued by various groups over the last decade. The project was completed to a large extent and a first estimate at this level of perturbation theory was obtained in 2006. This prediction, however, lacks important contributions from yet unknown matrix elements, that were estimated from results which are only partially known to date. In this work, we provide a framework for the systematic study of the missing matrix elements at the NNLO. As main results of this thesis, we determine fermionic corrections to the charm quark mass dependent matrix elements of four-quark operators in the

  5. Matrix elements of four-quark operators relevant to life time difference ΔΓBs from QCD sum rules

    International Nuclear Information System (INIS)

    Huang, C.S.; Zhang Ailin; Zhu, S.L.

    2001-01-01

    We extract the matrix elements of four-quark operators O L,S relevant to the B s and anti B s life time difference from QCD sum rules. We find that the vacuum saturation approximation works reasonably well, i.e., within 10%. We discuss the implications of our results and compare them with a recent lattice QCD determination. (orig.)

  6. Phenomenological renormalization of free nucleon-nucleon interaction. [Sussex matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Prakash, M; Waghmare, Y R [Indian Inst. of Tech., Kanpur. Dept. of Physics; Mehrotra, I [Allahabad Univ. (India). Dept. of Physics

    1976-08-01

    Low-lying spectra of /sup 6/Li, /sup 18/F, /sup 18/O, /sup 42/Sc, /sup 42/Ca, /sup 58/Ni and /sup 92/Zr are studied with Sussex matrix elements (SME) and their central, spin-orbit and tensor components. It is observed that major contribution to level energies comes from the central part, while the tensor part provides the finer details of spectra, particularly for T = 0 levels. The spin-orbit part does not make any appreciable contribution to level energies. A phenomenological renormalization fo the SME is carried out to improve the agreement with the experimental results. It turns out that some of the low-lying T = 0 levels can be satisfactorily described if the SME in the /sup 3/S/sub 1/ relative state are made (1+..cap alpha..) times their bare interaction value, where ..cap alpha.. is a constant to be determined from a comparison with experimental level energies. Similarly, for T = 1 levels, better agreement with the experimental results is obtained if a delta-function-plus-quadrupole interaction is added to the SME.

  7. Refractive index inversion based on Mueller matrix method

    Science.gov (United States)

    Fan, Huaxi; Wu, Wenyuan; Huang, Yanhua; Li, Zhaozhao

    2016-03-01

    Based on Stokes vector and Jones vector, the correlation between Mueller matrix elements and refractive index was studied with the result simplified, and through Mueller matrix way, the expression of refractive index inversion was deduced. The Mueller matrix elements, under different incident angle, are simulated through the expression of specular reflection so as to analyze the influence of the angle of incidence and refractive index on it, which is verified through the measure of the Mueller matrix elements of polished metal surface. Research shows that, under the condition of specular reflection, the result of Mueller matrix inversion is consistent with the experiment and can be used as an index of refraction of inversion method, and it provides a new way for target detection and recognition technology.

  8. The estimation of collision probabilities in complicated geometries

    International Nuclear Information System (INIS)

    Roth, M.J.

    1969-04-01

    This paper demonstrates how collision probabilities in complicated geometries may be estimated. It is assumed that the reactor core may be divided into a number of cells each with simple geometry so that a collision probability matrix can be calculated for each cell by standard methods. It is then shown how these may be joined together. (author)

  9. Hierarchical Decompositions for the Computation of High-Dimensional Multivariate Normal Probabilities

    KAUST Repository

    Genton, Marc G.

    2017-09-07

    We present a hierarchical decomposition scheme for computing the n-dimensional integral of multivariate normal probabilities that appear frequently in statistics. The scheme exploits the fact that the formally dense covariance matrix can be approximated by a matrix with a hierarchical low rank structure. It allows the reduction of the computational complexity per Monte Carlo sample from O(n2) to O(mn+knlog(n/m)), where k is the numerical rank of off-diagonal matrix blocks and m is the size of small diagonal blocks in the matrix that are not well-approximated by low rank factorizations and treated as dense submatrices. This hierarchical decomposition leads to substantial efficiencies in multivariate normal probability computations and allows integrations in thousands of dimensions to be practical on modern workstations.

  10. Hierarchical Decompositions for the Computation of High-Dimensional Multivariate Normal Probabilities

    KAUST Repository

    Genton, Marc G.; Keyes, David E.; Turkiyyah, George

    2017-01-01

    We present a hierarchical decomposition scheme for computing the n-dimensional integral of multivariate normal probabilities that appear frequently in statistics. The scheme exploits the fact that the formally dense covariance matrix can be approximated by a matrix with a hierarchical low rank structure. It allows the reduction of the computational complexity per Monte Carlo sample from O(n2) to O(mn+knlog(n/m)), where k is the numerical rank of off-diagonal matrix blocks and m is the size of small diagonal blocks in the matrix that are not well-approximated by low rank factorizations and treated as dense submatrices. This hierarchical decomposition leads to substantial efficiencies in multivariate normal probability computations and allows integrations in thousands of dimensions to be practical on modern workstations.

  11. Probability Distribution for Flowing Interval Spacing

    International Nuclear Information System (INIS)

    Kuzio, S.

    2001-01-01

    The purpose of this analysis is to develop a probability distribution for flowing interval spacing. A flowing interval is defined as a fractured zone that transmits flow in the Saturated Zone (SZ), as identified through borehole flow meter surveys (Figure 1). This analysis uses the term ''flowing interval spacing'' as opposed to fractured spacing, which is typically used in the literature. The term fracture spacing was not used in this analysis because the data used identify a zone (or a flowing interval) that contains fluid-conducting fractures but does not distinguish how many or which fractures comprise the flowing interval. The flowing interval spacing is measured between the midpoints of each flowing interval. Fracture spacing within the SZ is defined as the spacing between fractures, with no regard to which fractures are carrying flow. The Development Plan associated with this analysis is entitled, ''Probability Distribution for Flowing Interval Spacing'', (CRWMS M and O 2000a). The parameter from this analysis may be used in the TSPA SR/LA Saturated Zone Flow and Transport Work Direction and Planning Documents: (1) ''Abstraction of Matrix Diffusion for SZ Flow and Transport Analyses'' (CRWMS M and O 1999a) and (2) ''Incorporation of Heterogeneity in SZ Flow and Transport Analyses'', (CRWMS M and O 1999b). A limitation of this analysis is that the probability distribution of flowing interval spacing may underestimate the effect of incorporating matrix diffusion processes in the SZ transport model because of the possible overestimation of the flowing interval spacing. Larger flowing interval spacing results in a decrease in the matrix diffusion processes. This analysis may overestimate the flowing interval spacing because the number of fractures that contribute to a flowing interval cannot be determined from the data. Because each flowing interval probably has more than one fracture contributing to a flowing interval, the true flowing interval spacing could be

  12. The O({alpha}{sup 3}{sub s}n{sub f}T{sup 2}{sub F}C{sub A,F}) contributions to the gluonic massive operator matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Bluemlein, Johannes; Hasselhuhn, Alexander [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Klein, Sebastian [Technische Hochschule Aachen (Germany). Inst. fuer Theoretische Physik E; Schneider, Carsten [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation

    2012-05-15

    The O({alpha}{sub s}{sup 3}n{sub f}T{sub F}{sup 2}C{sub A,F}) terms to the massive gluonic operator matrix elements are calculated for general values of the Mellin variable N. These twist-2 matrix elements occur as transition functions in the variable flavor number scheme at NNLO. The calculation uses sum-representations in generalized hypergeometric series turning into harmonic sums. The analytic continuation to complex values of N is provided.

  13. Adinkras from ordered quartets of BC4 Coxeter group elements and regarding another Gadget’s 1,358,954,496 matrix elements

    Science.gov (United States)

    Gates, S. James; Kang, Lucas; Kessler, David S.; Korotkikh, Vadim

    2018-04-01

    A Gadget, more precisely a scalar Gadget, is defined as a mathematical calculation acting over a domain of one or more adinkra graphs and whose range is a real number. A 2010 work on the subject of automorphisms of adinkra graphs, implied the existence of multiple numbers of Gadgets depending on the number of colors under consideration. For four colors, this number is two. In this work, we verify the existence of a second such Gadget and calculate (both analytically and via explicit computer-enabled algorithms) its 1,358,954,496 matrix elements over 36,864 minimal valise adinkras related to the Coxeter Group BC4.

  14. Matrix-based system reliability method and applications to bridge networks

    International Nuclear Information System (INIS)

    Kang, W.-H.; Song Junho; Gardoni, Paolo

    2008-01-01

    Using a matrix-based system reliability (MSR) method, one can estimate the probabilities of complex system events by simple matrix calculations. Unlike existing system reliability methods whose complexity depends highly on that of the system event, the MSR method describes any general system event in a simple matrix form and therefore provides a more convenient way of handling the system event and estimating its probability. Even in the case where one has incomplete information on the component probabilities and/or the statistical dependence thereof, the matrix-based framework enables us to estimate the narrowest bounds on the system failure probability by linear programming. This paper presents the MSR method and applies it to a transportation network consisting of bridge structures. The seismic failure probabilities of bridges are estimated by use of the predictive fragility curves developed by a Bayesian methodology based on experimental data and existing deterministic models of the seismic capacity and demand. Using the MSR method, the probability of disconnection between each city/county and a critical facility is estimated. The probability mass function of the number of failed bridges is computed as well. In order to quantify the relative importance of bridges, the MSR method is used to compute the conditional probabilities of bridge failures given that there is at least one city disconnected from the critical facility. The bounds on the probability of disconnection are also obtained for cases with incomplete information

  15. Study of electron-molecule collisions via the finite-element method and R-matrix propagation technique: Model exchange

    International Nuclear Information System (INIS)

    Abdolsalami, F.; Abdolsalami, M.; Gomez, P.

    1994-01-01

    We have applied the finite-element method to electron-molecule collisions. All the calculations are done in the body frame within the fixed-nuclei approximation. A model potential, which is added to the static and polarization potential, has been used to represent the exchange effect. The method is applied to electron-H 2 scattering and the eigenphase sums and the cross sections obtained are in very good agreement with the corresponding results from the linear-algebraic approach. Finite-element calculations of the R matrix in the region where the static and exchange interactions are strong, however, has about one-half to one-fourth of the memory requirement of the linear-algebraic technique

  16. Wigner Function:from Ensemble Average of Density Operator to Its One Matrix Element in Entangled Pure States

    Institute of Scientific and Technical Information of China (English)

    FAN Hong-Yi

    2002-01-01

    We show that the Wigner function W = Tr(△ρ) (an ensemble average of the density operator ρ, △ is theWigner operator) can be expressed as a matrix element of ρ in the entangled pure states. In doing so, converting fromquantum master equations to time-evolution equation of the Wigner functions seems direct and concise. The entangledstates are defined in the enlarged Fock space with a fictitious freedom.

  17. The transition matrix element Agq(N) of the variable flavor number scheme at O(α3s)

    International Nuclear Information System (INIS)

    Ablinger, J.; Hasselhuhn, A.; Schneider, C.; Manteuffel, A. von

    2014-01-01

    We calculate the massive operator matrix element A (3) gq (N) to 3-loop order in Quantum Chromodynamics at general values of the Mellin variable N. This is the first complete transition function needed in the variable flavor number scheme obtained at O(α 3 s ). A fist independent recalculation is performed for the contributions ∝ N F of the 3-loop anomalous dimension γ (2) gq (N).

  18. The transition matrix element Agq(N) of the variable flavor number scheme at O(αs3)

    International Nuclear Information System (INIS)

    Ablinger, J.; Blümlein, J.; De Freitas, A.; Hasselhuhn, A.; Manteuffel, A. von; Round, M.; Schneider, C.; Wißbrock, F.

    2014-01-01

    We calculate the massive unpolarized operator matrix element A gq (3) (N) to 3-loop order in Quantum Chromodynamics at general values of the Mellin variable N. This is the first complete transition function needed in the variable flavor number scheme obtained at O(α s 3 ). A first independent recalculation is performed for the contributions ∝N F of the 3-loop anomalous dimension γ gq (2) (N)

  19. The deviation matrix of a continuous-time Markov chain

    NARCIS (Netherlands)

    Coolen-Schrijner, P.; van Doorn, E.A.

    2001-01-01

    The deviation matrix of an ergodic, continuous-time Markov chain with transition probability matrix $P(.)$ and ergodic matrix $\\Pi$ is the matrix $D \\equiv \\int_0^{\\infty} (P(t)-\\Pi)dt$. We give conditions for $D$ to exist and discuss properties and a representation of $D$. The deviation matrix of a

  20. The deviation matrix of a continuous-time Markov chain

    NARCIS (Netherlands)

    Coolen-Schrijner, Pauline; van Doorn, Erik A.

    2002-01-01

    he deviation matrix of an ergodic, continuous-time Markov chain with transition probability matrix $P(.)$ and ergodic matrix $\\Pi$ is the matrix $D \\equiv \\int_0^{\\infty} (P(t)-\\Pi)dt$. We give conditions for $D$ to exist and discuss properties and a representation of $D$. The deviation matrix of a

  1. Simulation of sparse matrix array designs

    Science.gov (United States)

    Boehm, Rainer; Heckel, Thomas

    2018-04-01

    Matrix phased array probes are becoming more prominently used in industrial applications. The main drawbacks, using probes incorporating a very large number of transducer elements, are needed for an appropriate cabling and an ultrasonic device offering many parallel channels. Matrix arrays designed for extended functionality feature at least 64 or more elements. Typical arrangements are square matrices, e.g., 8 by 8 or 11 by 11 or rectangular matrixes, e.g., 8 by 16 or 10 by 12 to fit a 128-channel phased array system. In some phased array systems, the number of simultaneous active elements is limited to a certain number, e.g., 32 or 64. Those setups do not allow running the probe with all elements active, which may cause a significant change in the directivity pattern of the resulting sound beam. When only a subset of elements can be used during a single acquisition, different strategies may be applied to collect enough data for rebuilding the missing information from the echo signal. Omission of certain elements may be one approach, overlay of subsequent shots with different active areas may be another one. This paper presents the influence of a decreased number of active elements on the sound field and their distribution on the array. Solutions using subsets with different element activity patterns on matrix arrays and their advantages and disadvantages concerning the sound field are evaluated using semi-analytical simulation tools. Sound field criteria are discussed, which are significant for non-destructive testing results and for the system setup.

  2. An approximate method for calculating electron-phonon matrix element of a disordered transition metal and relevant comments on superconductivity

    International Nuclear Information System (INIS)

    Zhang, L.

    1981-08-01

    A method based on the tight-binding approximation is developed to calculate the electron-phonon matrix element for the disordered transition metals. With the method as a basis the experimental Tsub(c) data of the amorphous transition metal superconductors are re-analysed. Some comments on the superconductivity of the disordered materials are given

  3. Multiphonon K/sup π/+ states in even-even deformed nuclei. II. Calculation of matrix elements of a general Hamiltonian

    International Nuclear Information System (INIS)

    Silvestre-Brac, B.; Piepenbring, R.

    1978-01-01

    Matrix elements of a general Hamiltonian H in a subspace spanned by collective K/sup π/+ deformed phonons are derived with the help of recursion formulas. Various approximations are discussed both in the fermion space and in the boson space. Careful comparisons are made in the framework of a simple solvable model

  4. New approach to nonleptonic weak interactions. I. Derivation of asymptotic selection rules for the two-particle weak ground-state-hadron matrix elements

    International Nuclear Information System (INIS)

    Tanuma, T.; Oneda, S.; Terasaki, K.

    1984-01-01

    A new approach to nonleptonic weak interactions is presented. It is argued that the presence and violation of the Vertical BarΔIVertical Bar = 1/2 rule as well as those of the quark-line selection rules can be explained in a unified way, along with other fundamental physical quantities [such as the value of g/sub A/(0) and the smallness of the isoscalar nucleon magnetic moments], in terms of a single dynamical asymptotic ansatz imposed at the level of observable hadrons. The ansatz prescribes a way in which asymptotic flavor SU(N) symmetry is secured levelwise for a certain class of chiral algebras in the standard QCD model. It yields severe asymptotic constraints upon the two-particle hadronic matrix elements of nonleptonic weak Hamiltonians as well as QCD currents and their charges. It produces for weak matrix elements the asymptotic Vertical BarΔIVertical Bar = 1/2 rule and its charm counterpart for the ground-state hadrons, while for strong matrix elements quark-line-like approximate selection rules. However, for the less important weak two-particle vertices involving higher excited states, the Vertical BarΔIVertical Bar = 1/2 rule and its charm counterpart are in general violated, providing us with an explicit source of the violation of these selection rules in physical processes

  5. Impact of band structure and transition matrix elements on polarization properties of the photoluminescence of semipolar and nonpolar InGaN quantum wells

    Energy Technology Data Exchange (ETDEWEB)

    Schade, L.; Schwarz, U.T. [Department of Microsystems Engineering, University of Freiburg, Georges-Koehler-Allee 103, 79108 Freiburg (Germany); Fraunhofer Institute for Applied Solid State Physics (IAF), Tullastrasse 72, 79108 Freiburg (Germany); Wernicke, T. [Institute of Solid State Physics, Technical University, Hardenbergstrasse 36, 10623 Berlin (Germany); Weyers, M. [Ferdinand-Braun-Institut fuer Hoechstfrequenztechnik, Gustav-Kirchhoff-Strasse 4, 12489 Berlin (Germany); Kneissl, M. [Institute of Solid State Physics, Technical University, Hardenbergstrasse 36, 10623 Berlin (Germany); Ferdinand-Braun-Institut fuer Hoechstfrequenztechnik, Gustav-Kirchhoff-Strasse 4, 12489 Berlin (Germany)

    2011-03-15

    Partial or full linear polarization is characteristic for the spontaneous emission of light from semipolar and nonpolar InGaN quantum wells. This property is an implication of the crystalline anisotropy as a basic property of the wurtzite structure. The influence of this anisotropy on the band structure and the transition matrix elements was calculated by a k.p-method for arbitrary quantum well orientations with respect to the c-axis; results are shown here in detail. Optical polarization is a direct consequence of a broken symmetry, mainly affecting the transition matrix elements from the conduction to the valence bands. Furthermore, the strain of the InGaN quantum well strongly depends on the crystal orientation of the substrate, resulting in a valence band mixing. The composition of the eigenfunctions has emerged to be most important for the polarization dependence of strained semipolar and nonpolar InGaN QW. The matrix elements, in combination with the thermal occupation of the bands, determine the polarization of the spontaneously emitted light. Our photoluminescence measurements of nonpolar QW match well with this model. However, in contrast to calculations with standard band parameters, the two topmost subbands show a larger separation in the emitted energy. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  6. Saliency Detection via Absorbing Markov Chain With Learnt Transition Probability.

    Science.gov (United States)

    Lihe Zhang; Jianwu Ai; Bowen Jiang; Huchuan Lu; Xiukui Li

    2018-02-01

    In this paper, we propose a bottom-up saliency model based on absorbing Markov chain (AMC). First, a sparsely connected graph is constructed to capture the local context information of each node. All image boundary nodes and other nodes are, respectively, treated as the absorbing nodes and transient nodes in the absorbing Markov chain. Then, the expected number of times from each transient node to all other transient nodes can be used to represent the saliency value of this node. The absorbed time depends on the weights on the path and their spatial coordinates, which are completely encoded in the transition probability matrix. Considering the importance of this matrix, we adopt different hierarchies of deep features extracted from fully convolutional networks and learn a transition probability matrix, which is called learnt transition probability matrix. Although the performance is significantly promoted, salient objects are not uniformly highlighted very well. To solve this problem, an angular embedding technique is investigated to refine the saliency results. Based on pairwise local orderings, which are produced by the saliency maps of AMC and boundary maps, we rearrange the global orderings (saliency value) of all nodes. Extensive experiments demonstrate that the proposed algorithm outperforms the state-of-the-art methods on six publicly available benchmark data sets.

  7. The O({alpha}{sub s}{sup 3}n{sub f}T{sub F}{sup 2}C{sub A,F}) contributions to the gluonic massive operator matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Bluemlein, Johannes, E-mail: johannes.bluemlein@desy.de [Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Hasselhuhn, Alexander [Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Klein, Sebastian [Institute for Theoretical Physics E, RWTH Aachen University, D-52056 Aachen (Germany); Schneider, Carsten [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstrasse 69, A-4040 Linz (Austria)

    2013-01-11

    The O({alpha}{sub s}{sup 3}n{sub f}T{sub F}{sup 2}C{sub A,F}) terms to the massive gluonic operator matrix elements are calculated for general values of the Mellin variable N using a new summation technique. These twist-2 matrix elements occur as transition functions in the variable flavor number scheme at NNLO. The calculation uses sum-representations in generalized hypergeometric series turning into harmonic sums. The analytic continuation to complex values of N is provided.

  8. The O(αs3TF2) contributions to the gluonic operator matrix element

    International Nuclear Information System (INIS)

    Ablinger, J.; Blümlein, J.; De Freitas, A.; Hasselhuhn, A.; Manteuffel, A. von; Round, M.; Schneider, C.

    2014-01-01

    The O(α s 3 T F 2 C F (C A )) contributions to the transition matrix element A gg,Q relevant for the variable flavor number scheme at 3-loop order are calculated. The corresponding graphs contain two massive fermion lines of equal mass leading to terms given by inverse binomially weighted sums beyond the usual harmonic sums. In x-space two root-valued letters contribute in the iterated integrals in addition to those forming the harmonic polylogarithms. We outline technical details needed in the calculation of graphs of this type, which are as well of importance in the case of two different internal massive lines

  9. Integrated optic vector-matrix multiplier

    Science.gov (United States)

    Watts, Michael R [Albuquerque, NM

    2011-09-27

    A vector-matrix multiplier is disclosed which uses N different wavelengths of light that are modulated with amplitudes representing elements of an N.times.1 vector and combined to form an input wavelength-division multiplexed (WDM) light stream. The input WDM light stream is split into N streamlets from which each wavelength of the light is individually coupled out and modulated for a second time using an input signal representing elements of an M.times.N matrix, and is then coupled into an output waveguide for each streamlet to form an output WDM light stream which is detected to generate a product of the vector and matrix. The vector-matrix multiplier can be formed as an integrated optical circuit using either waveguide amplitude modulators or ring resonator amplitude modulators.

  10. Phylogeny based discovery of regulatory elements

    Directory of Open Access Journals (Sweden)

    Cohen Barak A

    2006-05-01

    Full Text Available Abstract Background Algorithms that locate evolutionarily conserved sequences have become powerful tools for finding functional DNA elements, including transcription factor binding sites; however, most methods do not take advantage of an explicit model for the constrained evolution of functional DNA sequences. Results We developed a probabilistic framework that combines an HKY85 model, which assigns probabilities to different base substitutions between species, and weight matrix models of transcription factor binding sites, which describe the probabilities of observing particular nucleotides at specific positions in the binding site. The method incorporates the phylogenies of the species under consideration and takes into account the position specific variation of transcription factor binding sites. Using our framework we assessed the suitability of alignments of genomic sequences from commonly used species as substrates for comparative genomic approaches to regulatory motif finding. We then applied this technique to Saccharomyces cerevisiae and related species by examining all possible six base pair DNA sequences (hexamers and identifying sequences that are conserved in a significant number of promoters. By combining similar conserved hexamers we reconstructed known cis-regulatory motifs and made predictions of previously unidentified motifs. We tested one prediction experimentally, finding it to be a regulatory element involved in the transcriptional response to glucose. Conclusion The experimental validation of a regulatory element prediction missed by other large-scale motif finding studies demonstrates that our approach is a useful addition to the current suite of tools for finding regulatory motifs.

  11. Dynamic Matrix Rank

    DEFF Research Database (Denmark)

    Frandsen, Gudmund Skovbjerg; Frandsen, Peter Frands

    2009-01-01

    We consider maintaining information about the rank of a matrix under changes of the entries. For n×n matrices, we show an upper bound of O(n1.575) arithmetic operations and a lower bound of Ω(n) arithmetic operations per element change. The upper bound is valid when changing up to O(n0.575) entries...... in a single column of the matrix. We also give an algorithm that maintains the rank using O(n2) arithmetic operations per rank one update. These bounds appear to be the first nontrivial bounds for the problem. The upper bounds are valid for arbitrary fields, whereas the lower bound is valid for algebraically...... closed fields. The upper bound for element updates uses fast rectangular matrix multiplication, and the lower bound involves further development of an earlier technique for proving lower bounds for dynamic computation of rational functions....

  12. Extraction of the CKM matrix element Vus from the hyperon semileptonic decays

    International Nuclear Information System (INIS)

    Sharma, N.; Dahiya, H.; Chatley, P.K.

    2010-01-01

    The chiral constituent quark model with configuration mixing (χCQM config ), which is successful in explaining the weak vector and axial-vector form factors for the strangeness-changing as well as strangeness-nonchanging hyperon semileptonic decays at Q 2 =0, has been extended to determine the CKM matrix element V us for the strangeness-changing decays. The implications of the effect of the SU(3) symmetry breaking, Q 2 -dependence and radiative corrections on the form factors and V us have also been investigated. It is found that the results with SU(3) symmetry breaking show considerable improvement over the SU(3) symmetric results when compared with the existing experimental data. The inclusion of the Q 2 -dependence and radiative corrections in form factors have only a small effect on the prediction of V us as is expected from the theory. (orig.)

  13. Multivariate Matrix-Exponential Distributions

    DEFF Research Database (Denmark)

    Bladt, Mogens; Nielsen, Bo Friis

    2010-01-01

    be written as linear combinations of the elements in the exponential of a matrix. For this reason we shall refer to multivariate distributions with rational Laplace transform as multivariate matrix-exponential distributions (MVME). The marginal distributions of an MVME are univariate matrix......-exponential distributions. We prove a characterization that states that a distribution is an MVME distribution if and only if all non-negative, non-null linear combinations of the coordinates have a univariate matrix-exponential distribution. This theorem is analog to a well-known characterization theorem...

  14. Investigations on thermal properties, stress and deformation of Al/SiC metal matrix composite based on finite element method

    Directory of Open Access Journals (Sweden)

    K. A. Ramesh Kumar

    2014-09-01

    Full Text Available AlSiC is a metal matrix composite which comprises of aluminium matrix with silicon carbide particles. It is characterized by high thermal conductivity (180-200 W/m K, and its thermal expansion are attuned to match other important materials that finds enormous demand in industrial sectors. Although its application is very common, the physics behind the Al-SiC formation, functionality and behaviors are intricate owing to the temperature gradient of hundreds of degrees, over the volume, occurring on a time scale of a few seconds, involving multiple phases. In this study, various physical, metallurgical and numerical aspects such as equation of continuum for thermal, stress and deformation using finite element (FE matrix formulation, temperature dependent material properties, are analyzed. Modelling and simulation studies of Al/SiC composites are a preliminary attempt to view this research work from computational point of view.

  15. Neutral kaon mixing beyond the Standard Model with nf=2+1 chiral fermions. Part 1: bare matrix elements and physical results

    International Nuclear Information System (INIS)

    Garron, Nicolas; Hudspith, Renwick J.; Lytle, Andrew T.

    2016-01-01

    We compute the hadronic matrix elements of the four-quark operators relevant for K 0 −K̄ 0 mixing beyond the Standard Model. Our results are from lattice QCD simulations with n f =2+1 flavours of domain-wall fermion, which exhibit continuum-like chiral-flavour symmetry. The simulations are performed at two different values of the lattice spacing (a∼0.08 and a∼0.11 fm) and with lightest unitary pion mass ∼300 MeV. For the first time, the full set of relevant four-quark operators is renormalised non-perturbatively through RI-SMOM schemes; a detailed description of the renormalisation procedure is presented in a companion paper. We argue that the intermediate renormalisation scheme is responsible for the discrepancies found by different collaborations. We also study different normalisations and determine the matrix elements of the relevant four-quark operators with a precision of ∼5% or better.

  16. Elements of probability and statistics an introduction to probability with De Finetti’s approach and to Bayesian statistics

    CERN Document Server

    Biagini, Francesca

    2016-01-01

    This book provides an introduction to elementary probability and to Bayesian statistics using de Finetti's subjectivist approach. One of the features of this approach is that it does not require the introduction of sample space – a non-intrinsic concept that makes the treatment of elementary probability unnecessarily complicate – but introduces as fundamental the concept of random numbers directly related to their interpretation in applications. Events become a particular case of random numbers and probability a particular case of expectation when it is applied to events. The subjective evaluation of expectation and of conditional expectation is based on an economic choice of an acceptable bet or penalty. The properties of expectation and conditional expectation are derived by applying a coherence criterion that the evaluation has to follow. The book is suitable for all introductory courses in probability and statistics for students in Mathematics, Informatics, Engineering, and Physics.

  17. Numerical Methods Application for Reinforced Concrete Elements-Theoretical Approach for Direct Stiffness Matrix Method

    Directory of Open Access Journals (Sweden)

    Sergiu Ciprian Catinas

    2015-07-01

    Full Text Available A detailed theoretical and practical investigation of the reinforced concrete elements is due to recent techniques and method that are implemented in the construction market. More over a theoretical study is a demand for a better and faster approach nowadays due to rapid development of the calculus technique. The paper above will present a study for implementing in a static calculus the direct stiffness matrix method in order capable to address phenomena related to different stages of loading, rapid change of cross section area and physical properties. The method is a demand due to the fact that in our days the FEM (Finite Element Method is the only alternative to such a calculus and FEM are considered as expensive methods from the time and calculus resources point of view. The main goal in such a method is to create the moment-curvature diagram in the cross section that is analyzed. The paper above will express some of the most important techniques and new ideas as well in order to create the moment curvature graphic in the cross sections considered.

  18. Differential cross sections and spin density matrix elements for the reaction gamma p -> p omega

    Energy Technology Data Exchange (ETDEWEB)

    M. Williams, D. Applegate, M. Bellis, C.A. Meyer

    2009-12-01

    High-statistics differential cross sections and spin density matrix elements for the reaction gamma p -> p omega have been measured using the CLAS at Jefferson Lab for center-of-mass (CM) energies from threshold up to 2.84 GeV. Results are reported in 112 10-MeV wide CM energy bins, each subdivided into cos(theta_CM) bins of width 0.1. These are the most precise and extensive omega photoproduction measurements to date. A number of prominent structures are clearly present in the data. Many of these have not previously been observed due to limited statistics in earlier measurements.

  19. Off-diagonal helicity density matrix elements for vector mesons produced in polarized e+e- processes

    International Nuclear Information System (INIS)

    Anselmino, M.; Murgia, F.; Quintairos, P.

    1999-04-01

    Final state q q-bar interactions give origin to non zero values of the off-diagonal element ρ 1,-1 of the helicity density matrix of vector mesons produced in e + e - annihilations, as confirmed by recent OPAL data on φ, D * and K * 's. New predictions are given for ρ 1,-1 of several mesons produced at large x E and small p T - i.e. collinear with the parent jet - in the annihilation of polarized 3 + and 3 - , the results depend strongly on the elementary dynamics and allow further non trivial tests of the standard model. (author)

  20. Hadronic matrix elements in lattice QCD

    International Nuclear Information System (INIS)

    Jaeger, Benjamin

    2014-01-01

    The lattice formulation of Quantum ChromoDynamics (QCD) has become a reliable tool providing an ab initio calculation of low-energy quantities. Despite numerous successes, systematic uncertainties, such as discretisation effects, finite-size effects, and contaminations from excited states, are inherent in any lattice calculation. Simulations with controlled systematic uncertainties and close to the physical pion mass have become state-of-the-art. We present such a calculation for various hadronic matrix elements using non-perturbatively O(a)-improved Wilson fermions with two dynamical light quark flavours. The main topics covered in this thesis are the axial charge of the nucleon, the electro-magnetic form factors of the nucleon, and the leading hadronic contributions to the anomalous magnetic moment of the muon. Lattice simulations typically tend to underestimate the axial charge of the nucleon by 5-10%. We show that including excited state contaminations using the summed operator insertion method leads to agreement with the experimentally determined value. Further studies of systematic uncertainties reveal only small discretisation effects. For the electro-magnetic form factors of the nucleon, we see a similar contamination from excited states as for the axial charge. The electro-magnetic radii, extracted from a dipole fit to the momentum dependence of the form factors, show no indication of finite-size or cutoff effects. If we include excited states using the summed operator insertion method, we achieve better agreement with the radii from phenomenology. The anomalous magnetic moment of the muon can be measured and predicted to very high precision. The theoretical prediction of the anomalous magnetic moment receives contribution from strong, weak, and electro-magnetic interactions, where the hadronic contributions dominate the uncertainties. A persistent 3σ tension between the experimental determination and the theoretical calculation is found, which is

  1. The SBIRT program matrix: a conceptual framework for program implementation and evaluation.

    Science.gov (United States)

    Del Boca, Frances K; McRee, Bonnie; Vendetti, Janice; Damon, Donna

    2017-02-01

    Screening, Brief Intervention and Referral to Treatment (SBIRT) is a comprehensive, integrated, public health approach to the delivery of services to those at risk for the adverse consequences of alcohol and other drug use, and for those with probable substance use disorders. Research on successful SBIRT implementation has lagged behind studies of efficacy and effectiveness. This paper (1) outlines a conceptual framework, the SBIRT Program Matrix, to guide implementation research and program evaluation and (2) specifies potential implementation outcomes. Overview and narrative description of the SBIRT Program Matrix. The SBIRT Program Matrix has five components, each of which includes multiple elements: SBIRT services; performance sites; provider attributes; patient/client populations; and management structure and activities. Implementation outcomes include program adoption, acceptability, appropriateness, feasibility, fidelity, costs, penetration, sustainability, service provision and grant compliance. The Screening, Brief Intervention and Referral to Treatment Program Matrix provides a template for identifying, classifying and organizing the naturally occurring commonalities and variations within and across SBIRT programs, and for investigating which variables are associated with implementation success and, ultimately, with treatment outcomes and other impacts. © 2017 Society for the Study of Addiction.

  2. Calculating massive 3-loop graphs for operator matrix elements by the method of hyperlogarithms

    International Nuclear Information System (INIS)

    Ablinger, Jakob; Schneider, Carsten; Bluemlein, Johannes; Raab, Clemens; Wissbrock, Fabian

    2014-02-01

    We calculate convergent 3-loop Feynman diagrams containing a single massive loop equipped with twist τ=2 local operator insertions corresponding to spin N. They contribute to the massive operator matrix elements in QCD describing the massive Wilson coefficients for deep-inelastic scattering at large virtualities. Diagrams of this kind can be computed using an extended version to the method of hyperlogarithms, originally being designed for massless Feynman diagrams without operators. The method is applied to Benz- and V-type graphs, belonging to the genuine 3-loop topologies. In case of the V-type graphs with five massive propagators new types of nested sums and iterated integrals emerge. The sums are given in terms of finite binomially and inverse binomially weighted generalized cyclotomic sums, while the 1-dimensionally iterated integrals are based on a set of ∝30 square-root valued letters. We also derive the asymptotic representations of the nested sums and present the solution for N element of C. Integrals with a power-like divergence in N-space∝a N , a element of R, a>1, for large values of N emerge. They still possess a representation in x-space, which is given in terms of root-valued iterated integrals in the present case. The method of hyperlogarithms is also used to calculate higher moments for crossed box graphs with different operator insertions.

  3. Calculating massive 3-loop graphs for operator matrix elements by the method of hyperlogarithms

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, Jakob; Schneider, Carsten [Johannes Kepler Univ., Linz (Austria). Reserach Inst. for Symbolic Computation (RISC); Bluemlein, Johannes; Raab, Clemens [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Wissbrock, Fabian [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Johannes Kepler Univ., Linz (Austria). Reserach Inst. for Symbolic Computation (RISC)

    2014-02-15

    We calculate convergent 3-loop Feynman diagrams containing a single massive loop equipped with twist τ=2 local operator insertions corresponding to spin N. They contribute to the massive operator matrix elements in QCD describing the massive Wilson coefficients for deep-inelastic scattering at large virtualities. Diagrams of this kind can be computed using an extended version to the method of hyperlogarithms, originally being designed for massless Feynman diagrams without operators. The method is applied to Benz- and V-type graphs, belonging to the genuine 3-loop topologies. In case of the V-type graphs with five massive propagators new types of nested sums and iterated integrals emerge. The sums are given in terms of finite binomially and inverse binomially weighted generalized cyclotomic sums, while the 1-dimensionally iterated integrals are based on a set of ∝30 square-root valued letters. We also derive the asymptotic representations of the nested sums and present the solution for N element of C. Integrals with a power-like divergence in N-space∝a{sup N}, a element of R, a>1, for large values of N emerge. They still possess a representation in x-space, which is given in terms of root-valued iterated integrals in the present case. The method of hyperlogarithms is also used to calculate higher moments for crossed box graphs with different operator insertions.

  4. Grassmann integral and Balian–Brézin decomposition in Hartree–Fock–Bogoliubov matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Mizusaki, Takahiro, E-mail: mizusaki@isc.senshu-u.ac.jp [Institute of Natural Sciences, Senshu University, 3-8-1 Kanda-Jinbocho, Chiyoda-ku, Tokyo 101-8425 (Japan); Oi, Makito [Institute of Natural Sciences, Senshu University, 3-8-1 Kanda-Jinbocho, Chiyoda-ku, Tokyo 101-8425 (Japan); Chen, Fang-Qi [Department of Physics and Astronomy, Shanghai Jiao Tong University, Shanghai 200240 (China); Sun, Yang [Department of Physics and Astronomy, Shanghai Jiao Tong University, Shanghai 200240 (China); Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou 730000 (China)

    2013-08-09

    We present a new formula to calculate matrix elements of a general unitary operator with respect to Hartree–Fock–Bogoliubov states allowing multiple quasi-particle excitations. The Balian–Brézin decomposition of the unitary operator [R. Balian, E. Brézin, Il Nuovo Cimento B 64 (1969) 37] is employed in the derivation. We found that this decomposition is extremely suitable for an application of Fermion coherent state and Grassmann integrals in the quasi-particle basis. The resultant formula is compactly expressed in terms of the Pfaffian, and shows the similar bipartite structure to the formula that we have previously derived in the bare-particles basis [T. Mizusaki, M. Oi, Phys. Lett. B 715 (2012) 219].

  5. The use of cation exchange matrix separation coupled with ICP-MS to directly determine platinum group element (PGE) and other trace element emissions from passenger cars equipped with diesel particulate filters (DPF)

    Energy Technology Data Exchange (ETDEWEB)

    Cairns, Warren R.L.; Cozzi, Giulio [Institute for the Dynamics of Environmental Processes-CNR, Venice (Italy); De Boni, Antonella; Gabrieli, Jacopo [University of Venice, Department of Environmental Science, Venice (Italy); Asti, Massimo; Merlone Borla, Edoardo; Parussa, Flavio [Centro Ricerche Fiat, Orbassano (Italy); Moretto, Ezio [FIAT Powertrain Technologies S.p.A, Turin (Italy); Cescon, Paolo; Barbante, Carlo [University of Venice, Department of Environmental Science, Venice (Italy); Institute for the Dynamics of Environmental Processes-CNR, Venice (Italy); Boutron, Claude [Laboratoire de Glaciologie et Geophysique de l' Environnement, UMR CNRS 5183, B.P. 96, Saint Martin d' Heres Cedex (France)

    2011-03-15

    Inductively coupled plasma-mass spectrometry coupled with cation exchange matrix separation has been optimised for the direct determination of platinum group element (PGE) and trace element emissions from a diesel engine car. After matrix separation method detection limits of 1.6 ng g{sup -1} for Pd, 0.4 ng g{sup -1} for Rh and 4.3 ng g{sup -1} for Pt were achieved, the method was validated against the certified reference material BCR 723, urban road dust. The test vehicle was fitted with new and aged catalytic converters with and without diesel particulate filters (DPF). Samples were collected after three consecutive New European Driving Cycle (NEDC) of the particulate and ''soluble'' phases using a home-made sampler optimised for trace element analysis. Emission factors for the PGEs ranged from 0.021 ng km{sup -1} for Rh to 70.5 ng km{sup -1} for Pt; when a DPF was fitted, the emission factors for the PGEs actually used in the catalysts dropped by up to 97% (for Pt). Trace element emission factors were found to drop by a maximum of 92% for Ni to a minimum of 18% for Y when a DPF was fitted; a new DPF was also found to cause a reduction of up to 86% in the emission of particulate matter. (orig.)

  6. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  7. Classical versus quantum structure of the scattering probability matrix: Chaotic waveguides

    Czech Academy of Sciences Publication Activity Database

    Luna-Acosta, G. A.; Méndez-Bermúdez, J. A.; Šeba, Petr; Pichugin, K. N.

    2002-01-01

    Roč. 65, č. 4 (2002), 046605/1-046605/8 ISSN 1063-651X Grant - others:CONACYT(MX) 26163-E Institutional research plan: CEZ:AV0Z1010914 Keywords : scattering matrix * waveguids Subject RIV: BE - Theoretical Physics Impact factor: 2.397, year: 2002

  8. Development of a diffuse element matrix in 'planar' technology. A particular application: logical gate with coupled emitter; Etude et realisation d'une matrice d'elements diffuses selon la technologie 'planar'. Application particuliere: porte logique a emetteurs couples

    Energy Technology Data Exchange (ETDEWEB)

    Rousseau, P [Commissariat a l' Energie Atomique, 38 - Grenoble (France). Centre d' Etudes Nucleaires

    1967-06-01

    In a first part, after a brief recall concerning 'planar' technology we discuss the various parasitic elements associated with integrated circuits components. Mathematical formulae of these elements are derived. In a second part, we present a matrix of 22 transistors and 12 resistors which has been realized. This matrix enables the integration of the major part of nuclear circuits. Some of the obtained circuits are shown, particularly an emitter coupled logic gate which presents good electrical behaviour. (author) [French] Dans uns premiere partie, apres un bref rappel de la technologie 'planar' nous etudions les divers elements parasites associes a tout composant d'un circuit integre. Un developpement sommaire des expressions mathematiques de ces elements est propose. Dans une seconde partie nous presentons la matrice de 22 transistors et 12 resistances que nous avons realisee. Cette matrice repond aux principaux besoins de l'electronique nucleaire. Nous proposons ensuite quelques exemples de circuits realises a partir de cette matrice dont notamment une porte logique a emetteurs couples de performances tres interessantes. (auteur)

  9. Stability of wavelet frames with matrix dilations

    DEFF Research Database (Denmark)

    Christensen, Ole; Sun, Wenchang

    2006-01-01

    (j,k) are perturbed. As a special case of our result, we obtain that if {Tau(A(j), A(j)Bn)psi} (j is an element of Z, n is an element of Zd) is a frame for an expansive matrix A and an invertible matrix B, then {Tau(A'(j), A(j)B lambda(n))psi}(j is an element of Z,) (n is an element of) (Zd) is a frame if vertical...... bar vertical bar A(-j)A'(j) - I vertical bar vertical bar(2) lambda(n) - n vertical bar vertical bar infinity 0....

  10. Determination of several trace elements in silicate rocks by an XRF method with background and matrix corrections

    International Nuclear Information System (INIS)

    Pascual, J.

    1987-01-01

    An X-ray fluorescence method for determining trace elements in silicate rock samples was studied. The procedure focused on the application of the pertinent matrix corrections. Either the Compton peak or the reciprocal of the mass absorption coefficient of the sample was used as internal standard for this purpose. X-ray tubes with W or Cr anodes were employed, and the W Lβ and Cr Kα Compton intensities scattered by the sample were measured. The mass absorption coefficients at both sides of the absorption edge for Fe (1.658 and 1.936 A) were calculated. The elements Zr, Y, Rb, Zn, Ni, Cr and V were determined in 15 international reference rocks covering wide ranges of concentration. Relative mean errors were in many cases less than 10%. (author)

  11. Search for a standard model Higgs boson produced in association with a top-quark pair and decaying to bottom quarks using a matrix element method

    CERN Document Server

    Khachatryan, Vardan; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hartl, Christian; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kiesenhofer, Wolfgang; Knünz, Valentin; Krammer, Manfred; Krätschmer, Ilse; Liko, Dietrich; Mikulec, Ivan; Rabady, Dinyar; Rahbaran, Babak; Rohringer, Herbert; Schöfbeck, Robert; Strauss, Josef; Treberer-Treberspurg, Wolfgang; Waltenberger, Wolfgang; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Alderweireldt, Sara; Bansal, Sunil; Cornelis, Tom; De Wolf, Eddi A; Janssen, Xavier; Knutsson, Albert; Lauwers, Jasper; Luyckx, Sten; Ochesanu, Silvia; Rougny, Romain; Van De Klundert, Merijn; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Van Spilbeeck, Alex; Blekman, Freya; Blyweert, Stijn; D'Hondt, Jorgen; Daci, Nadir; Heracleous, Natalie; Keaveney, James; Lowette, Steven; Maes, Michael; Olbrechts, Annik; Python, Quentin; Strom, Derek; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Onsem, Gerrit Patrick; Villella, Ilaria; Caillol, Cécile; Clerbaux, Barbara; De Lentdecker, Gilles; Dobur, Didar; Favart, Laurent; Gay, Arnaud; Grebenyuk, Anastasia; Léonard, Alexandre; Mohammadi, Abdollah; Perniè, Luca; Randle-conde, Aidan; Reis, Thomas; Seva, Tomislav; Thomas, Laurent; Vander Velde, Catherine; Vanlaer, Pascal; Wang, Jian; Zenoni, Florian; Adler, Volker; Beernaert, Kelly; Benucci, Leonardo; Cimmino, Anna; Costantini, Silvia; Crucy, Shannon; Fagot, Alexis; Garcia, Guillaume; Mccartin, Joseph; Ocampo Rios, Alberto Andres; Poyraz, Deniz; Ryckbosch, Dirk; Salva Diblen, Sinem; Sigamani, Michael; Strobbe, Nadja; Thyssen, Filip; Tytgat, Michael; Yazgan, Efe; Zaganidis, Nicolas; Basegmez, Suzan; Beluffi, Camille; Bruno, Giacomo; Castello, Roberto; Caudron, Adrien; Ceard, Ludivine; Da Silveira, Gustavo Gil; Delaere, Christophe; Du Pree, Tristan; Favart, Denis; Forthomme, Laurent; Giammanco, Andrea; Hollar, Jonathan; Jafari, Abideh; Jez, Pavel; Komm, Matthias; Lemaitre, Vincent; Nuttens, Claude; Pagano, Davide; Perrini, Lucia; Pin, Arnaud; Piotrzkowski, Krzysztof; Popov, Andrey; Quertenmont, Loic; Selvaggi, Michele; Vidal Marono, Miguel; Vizan Garcia, Jesus Manuel; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Hammad, Gregory Habib; Aldá Júnior, Walter Luiz; Alves, Gilvan; Brito, Lucas; Correa Martins Junior, Marcos; Dos Reis Martins, Thiago; Molina, Jorge; Mora Herrera, Clemencia; Pol, Maria Elena; Rebello Teles, Patricia; Carvalho, Wagner; Chinellato, Jose; Custódio, Analu; Melo Da Costa, Eliza; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Malbouisson, Helena; Matos Figueiredo, Diego; Mundim, Luiz; Nogima, Helio; Prado Da Silva, Wanda Lucia; Santaolalla, Javier; Santoro, Alberto; Sznajder, Andre; Tonelli Manganote, Edmilson José; Vilela Pereira, Antonio; Bernardes, Cesar Augusto; Dogra, Sunil; Tomei, Thiago; De Moraes Gregores, Eduardo; Mercadante, Pedro G; Novaes, Sergio F; Padula, Sandra; Aleksandrov, Aleksandar; Genchev, Vladimir; Hadjiiska, Roumyana; Iaydjiev, Plamen; Marinov, Andrey; Piperov, Stefan; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Vutova, Mariana; Dimitrov, Anton; Glushkov, Ivan; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Chen, Mingshui; Cheng, Tongguang; Du, Ran; Jiang, Chun-Hua; Plestina, Roko; Romeo, Francesco; Tao, Junquan; Wang, Zheng; Asawatangtrakuldee, Chayanit; Ban, Yong; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Wang, Dayong; Xu, Zijun; Zhang, Fengwangdong; Zhang, Linlin; Zou, Wei; Avila, Carlos; Cabrera, Andrés; Chaparro Sierra, Luisa Fernanda; Florez, Carlos; Gomez, Juan Pablo; Gomez Moreno, Bernardo; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Kadija, Kreso; Luetic, Jelena; Mekterovic, Darko; Sudic, Lucija; Attikis, Alexandros; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Rykaczewski, Hans; Bodlak, Martin; Finger, Miroslav; Finger Jr, Michael; Assran, Yasser; Ellithi Kamel, Ali; Mahmoud, Mohammed; Radi, Amr; Kadastik, Mario; Murumaa, Marion; Raidal, Martti; Tiko, Andres; Eerola, Paula; Voutilainen, Mikko; Härkönen, Jaakko; Karimäki, Veikko; Kinnunen, Ritva; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Peltola, Timo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Wendland, Lauri; Talvitie, Joonas; Tuuva, Tuure; Besancon, Marc; Couderc, Fabrice; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Favaro, Carlotta; Ferri, Federico; Ganjour, Serguei; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Rander, John; Rosowsky, André; Titov, Maksym; Baffioni, Stephanie; Beaudette, Florian; Busson, Philippe; Chapon, Emilien; Charlot, Claude; Dahms, Torsten; Dobrzynski, Ludwik; Filipovic, Nicolas; Florent, Alice; Granier de Cassagnac, Raphael; Mastrolorenzo, Luca; Miné, Philippe; Naranjo, Ivo Nicolas; Nguyen, Matthew; Ochando, Christophe; Ortona, Giacomo; Paganini, Pascal; Regnard, Simon; Salerno, Roberto; Sauvan, Jean-Baptiste; Sirois, Yves; Veelken, Christian; Yilmaz, Yetkin; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Aubin, Alexandre; Bloch, Daniel; Brom, Jean-Marie; Chabert, Eric Christian; Chanon, Nicolas; Collard, Caroline; Conte, Eric; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Goetzmann, Christophe; Le Bihan, Anne-Catherine; Skovpen, Kirill; Van Hove, Pierre; Gadrat, Sébastien; Beauceron, Stephanie; Beaupere, Nicolas; Bernet, Colin; Boudoul, Gaelle; Bouvier, Elvire; Brochet, Sébastien; Carrillo Montoya, Camilo Andres; Chasserat, Julien; Chierici, Roberto; Contardo, Didier; Courbon, Benoit; Depasse, Pierre; El Mamouni, Houmani; Fan, Jiawei; Fay, Jean; Gascon, Susan; Gouzevitch, Maxime; Ille, Bernard; Kurca, Tibor; Lethuillier, Morgan; Mirabito, Laurent; Pequegnot, Anne-Laure; Perries, Stephane; Ruiz Alvarez, José David; Sabes, David; Sgandurra, Louis; Sordini, Viola; Vander Donckt, Muriel; Verdier, Patrice; Viret, Sébastien; Xiao, Hong; Tsamalaidze, Zviad; Autermann, Christian; Beranek, Sarah; Bontenackels, Michael; Edelhoff, Matthias; Feld, Lutz; Heister, Arno; Klein, Katja; Lipinski, Martin; Ostapchuk, Andrey; Preuten, Marius; Raupach, Frank; Sammet, Jan; Schael, Stefan; Schulte, Jan-Frederik; Weber, Hendrik; Wittmer, Bruno; Zhukov, Valery; Ata, Metin; Brodski, Michael; Dietz-Laursonn, Erik; Duchardt, Deborah; Erdmann, Martin; Fischer, Robert; Güth, Andreas; Hebbeker, Thomas; Heidemann, Carsten; Hoepfner, Kerstin; Klingebiel, Dennis; Knutzen, Simon; Kreuzer, Peter; Merschmeyer, Markus; Meyer, Arnd; Millet, Philipp; Olschewski, Mark; Padeken, Klaas; Papacz, Paul; Reithler, Hans; Schmitz, Stefan Antonius; Sonnenschein, Lars; Teyssier, Daniel; Thüer, Sebastian; Cherepanov, Vladimir; Erdogan, Yusuf; Flügge, Günter; Geenen, Heiko; Geisler, Matthias; Haj Ahmad, Wael; Hoehle, Felix; Kargoll, Bastian; Kress, Thomas; Kuessel, Yvonne; Künsken, Andreas; Lingemann, Joschka; Nowack, Andreas; Nugent, Ian Michael; Pistone, Claudia; Pooth, Oliver; Stahl, Achim; Aldaya Martin, Maria; Asin, Ivan; Bartosik, Nazar; Behr, Joerg; Behrens, Ulf; Bell, Alan James; Bethani, Agni; Borras, Kerstin; Burgmeier, Armin; Cakir, Altan; Calligaris, Luigi; Campbell, Alan; Choudhury, Somnath; Costanza, Francesco; Diez Pardos, Carmen; Dolinska, Ganna; Dooling, Samantha; Dorland, Tyler; Eckerlin, Guenter; Eckstein, Doris; Eichhorn, Thomas; Flucke, Gero; Garay Garcia, Jasone; Geiser, Achim; Gizhko, Andrii; Gunnellini, Paolo; Hauk, Johannes; Hempel, Maria; Jung, Hannes; Kalogeropoulos, Alexis; Karacheban, Olena; Kasemann, Matthias; Katsas, Panagiotis; Kieseler, Jan; Kleinwort, Claus; Korol, Ievgen; Krücker, Dirk; Lange, Wolfgang; Leonard, Jessica; Lipka, Katerina; Lobanov, Artur; Lohmann, Wolfgang; Lutz, Benjamin; Mankel, Rainer; Marfin, Ihar; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mittag, Gregor; Mnich, Joachim; Mussgiller, Andreas; Naumann-Emme, Sebastian; Nayak, Aruna; Ntomari, Eleni; Perrey, Hanno; Pitzl, Daniel; Placakyte, Ringaile; Raspereza, Alexei; Ribeiro Cipriano, Pedro M; Roland, Benoit; Ron, Elias; Sahin, Mehmet Özgür; Salfeld-Nebgen, Jakob; Saxena, Pooja; Schoerner-Sadenius, Thomas; Schröder, Matthias; Seitz, Claudia; Spannagel, Simon; Vargas Trevino, Andrea Del Rocio; Walsh, Roberval; Wissing, Christoph; Blobel, Volker; Centis Vignali, Matteo; Draeger, Arne-Rasmus; Erfle, Joachim; Garutti, Erika; Goebel, Kristin; Görner, Martin; Haller, Johannes; Hoffmann, Malte; Höing, Rebekka Sophie; Junkes, Alexandra; Kirschenmann, Henning; Klanner, Robert; Kogler, Roman; Lapsien, Tobias; Lenz, Teresa; Marchesini, Ivan; Marconi, Daniele; Nowatschin, Dominik; Ott, Jochen; Peiffer, Thomas; Perieanu, Adrian; Pietsch, Niklas; Poehlsen, Jennifer; Pöhlsen, Thomas; Rathjens, Denis; Sander, Christian; Schettler, Hannes; Schleper, Peter; Schlieckau, Eike; Schmidt, Alexander; Seidel, Markus; Sola, Valentina; Stadie, Hartmut; Steinbrück, Georg; Troendle, Daniel; Usai, Emanuele; Vanelderen, Lukas; Vanhoefer, Annika; Akbiyik, Melike; Barth, Christian; Baus, Colin; Berger, Joram; Böser, Christian; Butz, Erik; Chwalek, Thorsten; De Boer, Wim; Descroix, Alexis; Dierlamm, Alexander; Feindt, Michael; Frensch, Felix; Giffels, Manuel; Gilbert, Andrew; Hartmann, Frank; Hauth, Thomas; Husemann, Ulrich; Katkov, Igor; Kornmayer, Andreas; Lobelle Pardo, Patricia; Mozer, Matthias Ulrich; Müller, Thomas; Müller, Thomas; Nürnberg, Andreas; Quast, Gunter; Rabbertz, Klaus; Röcker, Steffen; Simonis, Hans-Jürgen; Stober, Fred-Markus Helmut; Ulrich, Ralf; Wagner-Kuhr, Jeannine; Wayand, Stefan; Weiler, Thomas; Wöhrmann, Clemens; Wolf, Roger; Anagnostou, Georgios; Daskalakis, Georgios; Geralis, Theodoros; Giakoumopoulou, Viktoria Athina; Kyriakis, Aristotelis; Loukas, Demetrios; Markou, Athanasios; Markou, Christos; Psallidas, Andreas; Topsis-Giotis, Iasonas; Agapitos, Antonis; Kesisoglou, Stilianos; Panagiotou, Apostolos; Saoulidou, Niki; Stiliaris, Efstathios; Tziaferi, Eirini; Aslanoglou, Xenofon; Evangelou, Ioannis; Flouris, Giannis; Foudas, Costas; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Paradas, Evangelos; Strologas, John; Bencze, Gyorgy; Hajdu, Csaba; Hidas, Pàl; Horvath, Dezso; Sikler, Ferenc; Veszpremi, Viktor; Vesztergombi, Gyorgy; Zsigmond, Anna Julia; Beni, Noemi; Czellar, Sandor; Karancsi, János; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Makovec, Alajos; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Swain, Sanjay Kumar; Beri, Suman Bala; Bhatnagar, Vipin; Gupta, Ruchi; Bhawandeep, Bhawandeep; Kalsi, Amandeep Kaur; Kaur, Manjit; Kumar, Ramandeep; Mittal, Monika; Nishu, Nishu; Singh, Jasbir; Kumar, Ashok; Kumar, Arun; Ahuja, Sudha; Bhardwaj, Ashutosh; Choudhary, Brajesh C; Kumar, Ajay; Malhotra, Shivali; Naimuddin, Md; Ranjan, Kirti; Sharma, Varun; Banerjee, Sunanda; Bhattacharya, Satyaki; Chatterjee, Kalyanmoy; Dutta, Suchandra; Gomber, Bhawna; Jain, Sandhya; Jain, Shilpi; Khurana, Raman; Modak, Atanu; Mukherjee, Swagata; Roy, Debarati; Sarkar, Subir; Sharan, Manoj; Abdulsalam, Abdulla; Dutta, Dipanwita; Kumar, Vineet; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Topkar, Anita; Aziz, Tariq; Banerjee, Sudeshna; Bhowmik, Sandeep; Chatterjee, Rajdeep Mohan; Dewanjee, Ram Krishna; Dugad, Shashikant; Ganguly, Sanmay; Ghosh, Saranya; Guchait, Monoranjan; Gurtu, Atul; Kole, Gouranga; Kumar, Sanjeev; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Parida, Bibhuti; Sudhakar, Katta; Wickramage, Nadeesha; Sharma, Seema; Bakhshiansohi, Hamed; Behnamian, Hadi; Etesami, Seyed Mohsen; Fahim, Ali; Goldouzian, Reza; Khakzad, Mohsen; Mohammadi Najafabadi, Mojtaba; Naseri, Mohsen; Paktinat Mehdiabadi, Saeid; Rezaei Hosseinabadi, Ferdos; Safarzadeh, Batool; Zeinali, Maryam; Felcini, Marta; Grunewald, Martin; Abbrescia, Marcello; Calabria, Cesare; Chhibra, Simranjit Singh; Colaleo, Anna; Creanza, Donato; Cristella, Leonardo; De Filippis, Nicola; De Palma, Mauro; Fiore, Luigi; Iaselli, Giuseppe; Maggi, Giorgio; Maggi, Marcello; My, Salvatore; Nuzzo, Salvatore; Pompili, Alexis; Pugliese, Gabriella; Radogna, Raffaella; Selvaggi, Giovanna; Sharma, Archana; Silvestris, Lucia; Venditti, Rosamaria; Verwilligen, Piet; Abbiendi, Giovanni; Benvenuti, Alberto; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Brigliadori, Luca; Campanini, Renato; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Grandi, Claudio; Guiducci, Luigi; Marcellini, Stefano; Masetti, Gianni; Montanari, Alessandro; Navarria, Francesco; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gian Piero; Tosi, Nicolò; Travaglini, Riccardo; Albergo, Sebastiano; Cappello, Gigi; Chiorboli, Massimiliano; Costa, Salvatore; Giordano, Ferdinando; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Gallo, Elisabetta; Gonzi, Sandro; Gori, Valentina; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Benussi, Luigi; Bianco, Stefano; Fabbri, Franco; Piccolo, Davide; Ferretti, Roberta; Ferro, Fabrizio; Lo Vetere, Maurizio; Robutti, Enrico; Tosi, Silvano; Dinardo, Mauro Emanuele; Fiorendi, Sara; Gennai, Simone; Gerosa, Raffaele; Ghezzi, Alessio; Govoni, Pietro; Lucchini, Marco Toliman; Malvezzi, Sandra; Manzoni, Riccardo Andrea; Martelli, Arabella; Marzocchi, Badder; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Ragazzi, Stefano; Redaelli, Nicola; Tabarelli de Fatis, Tommaso; Buontempo, Salvatore; Cavallo, Nicola; Di Guida, Salvatore; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Meola, Sabino; Merola, Mario; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bisello, Dario; Carlin, Roberto; Checchia, Paolo; Dall'Osso, Martino; Dorigo, Tommaso; Dosselli, Umberto; Fanzago, Federica; Gasparini, Fabrizio; Gasparini, Ugo; Gonella, Franco; Gozzelino, Andrea; Lacaprara, Stefano; Margoni, Martino; Meneguzzo, Anna Teresa; Pazzini, Jacopo; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Tosi, Mia; Zotto, Pierluigi; Zucchetta, Alberto; Zumerle, Gianni; Gabusi, Michele; Ratti, Sergio P; Re, Valerio; Riccardi, Cristina; Salvini, Paola; Vitulo, Paolo; Biasini, Maurizio; Bilei, Gian Mario; Ciangottini, Diego; Fanò, Livio; Lariccia, Paolo; Mantovani, Giancarlo; Menichelli, Mauro; Saha, Anirban; Santocchia, Attilio; Spiezia, Aniello; Androsov, Konstantin; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Broccolo, Giuseppe; Castaldi, Rino; Ciocci, Maria Agnese; Dell'Orso, Roberto; Donato, Silvio; Fedi, Giacomo; Fiori, Francesco; Foà, Lorenzo; Giassi, Alessandro; Grippo, Maria Teresa; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Moon, Chang-Seong; Palla, Fabrizio; Rizzi, Andrea; Savoy-Navarro, Aurore; Serban, Alin Titus; Spagnolo, Paolo; Squillacioti, Paola; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Vernieri, Caterina; Barone, Luciano; Cavallari, Francesca; D'imperio, Giulia; Del Re, Daniele; Diemoz, Marcella; Jorda, Clara; Longo, Egidio; Margaroli, Fabrizio; Meridiani, Paolo; Micheli, Francesco; Organtini, Giovanni; Paramatti, Riccardo; Rahatlou, Shahram; Rovelli, Chiara; Santanastasio, Francesco; Soffi, Livia; Traczyk, Piotr; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Bellan, Riccardo; Biino, Cristina; Cartiglia, Nicolo; Casasso, Stefano; Costa, Marco; Covarelli, Roberto; Degano, Alessandro; Demaria, Natale; Finco, Linda; Mariotti, Chiara; Maselli, Silvia; Migliore, Ernesto; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pacher, Luca; Pastrone, Nadia; Pelliccioni, Mario; Pinna Angioni, Gian Luca; Potenza, Alberto; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Solano, Ada; Staiano, Amedeo; Tamponi, Umberto; Belforte, Stefano; Candelise, Vieri; Casarsa, Massimo; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; La Licata, Chiara; Marone, Matteo; Schizzi, Andrea; Umer, Tomo; Zanetti, Anna; Chang, Sunghyun; Kropivnitskaya, Anna; Nam, Soon-Kwon; Kim, Dong Hee; Kim, Gui Nyun; Kim, Min Suk; Kong, Dae Jung; Lee, Sangeun; Oh, Young Do; Park, Hyangkyu; Sakharov, Alexandre; Son, Dong-Chul; Kim, Tae Jeong; Ryu, Min Sang; Kim, Jae Yool; Moon, Dong Ho; Song, Sanghyeon; Choi, Suyong; Gyun, Dooyeon; Hong, Byung-Sik; Jo, Mihee; Kim, Hyunchul; Kim, Yongsun; Lee, Byounghoon; Lee, Kyong Sei; Park, Sung Keun; Roh, Youn; Yoo, Hwi Dong; Choi, Minkyoo; Kim, Ji Hyun; Park, Inkyu; Ryu, Geonmo; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Kim, Donghyun; Kwon, Eunhyang; Lee, Jongseok; Yu, Intae; Juodagalvis, Andrius; Komaragiri, Jyothsna Rani; Md Ali, Mohd Adli Bin; Wan Abdullah, Wan Ahmad Tajuddin; Casimiro Linares, Edgar; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Heredia-de La Cruz, Ivan; Hernandez-Almada, Alberto; Lopez-Fernandez, Ricardo; Sánchez Hernández, Alberto; Carrillo Moreno, Salvador; Vazquez Valencia, Fabiola; Pedraza, Isabel; Salazar Ibarguen, Humberto Antonio; Morelos Pineda, Antonio; Krofcheck, David; Butler, Philip H; Reucroft, Steve; Ahmad, Ashfaq; Ahmad, Muhammad; Hassan, Qamar; Hoorani, Hafeez R; Khan, Wajid Ali; Khurshid, Taimoor; Shoaib, Muhammad; Bialkowska, Helena; Bluj, Michal; Boimska, Bożena; Frueboes, Tomasz; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Zalewski, Piotr; Brona, Grzegorz; Bunkowski, Karol; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Misiura, Maciej; Olszewski, Michał; Bargassa, Pedrame; Beirão Da Cruz E Silva, Cristóvão; Di Francesco, Agostino; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Lloret Iglesias, Lara; Nguyen, Federico; Rodrigues Antunes, Joao; Seixas, Joao; Toldaiev, Oleksii; Vadruccio, Daniele; Varela, Joao; Vischia, Pietro; Bunin, Pavel; Gavrilenko, Mikhail; Golutvin, Igor; Kamenev, Alexey; Karjavin, Vladimir; Konoplyanikov, Viktor; Kozlov, Guennady; Lanev, Alexander; Malakhov, Alexander; Matveev, Viktor; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Savina, Maria; Shmatov, Sergey; Shulha, Siarhei; Smirnov, Vitaly; Zarubin, Anatoli; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Kuznetsova, Ekaterina; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Vorobyev, Andrey; Andreev, Yuri; Dermenev, Alexander; Gninenko, Sergei; Golubev, Nikolai; Kirsanov, Mikhail; Krasnikov, Nikolai; Pashenkov, Anatoli; Tlisov, Danila; Toropin, Alexander; Epshteyn, Vladimir; Gavrilov, Vladimir; Lychkovskaya, Natalia; Popov, Vladimir; Pozdnyakov, Ivan; Safronov, Grigory; Semenov, Sergey; Spiridonov, Alexander; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Mesyats, Gennady; Rusakov, Sergey V; Vinogradov, Alexey; Belyaev, Andrey; Boos, Edouard; Bunichev, Viacheslav; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Klyukhin, Vyacheslav; Kodolova, Olga; Lokhtin, Igor; Obraztsov, Stepan; Petrushanko, Sergey; Savrin, Viktor; Azhgirey, Igor; Bayshev, Igor; Bitioukov, Sergei; Kachanov, Vassili; Kalinin, Alexey; Konstantinov, Dmitri; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Sobol, Andrei; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Ekmedzic, Marko; Milosevic, Jovan; Rekovic, Vladimir; Alcaraz Maestre, Juan; Battilana, Carlo; Calvo, Enrique; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Delgado Peris, Antonio; Domínguez Vázquez, Daniel; Escalante Del Valle, Alberto; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M; Josa, Maria Isabel; Navarro De Martino, Eduardo; Pérez-Calero Yzquierdo, Antonio María; Puerta Pelayo, Jesus; Quintario Olmeda, Adrián; Redondo, Ignacio; Romero, Luciano; Senghi Soares, Mara; Albajar, Carmen; de Trocóniz, Jorge F; Missiroli, Marino; Moran, Dermot; Brun, Hugues; Cuevas, Javier; Fernandez Menendez, Javier; Folgueras, Santiago; Gonzalez Caballero, Isidro; Brochero Cifuentes, Javier Andres; Cabrillo, Iban Jose; Calderon, Alicia; Duarte Campderros, Jordi; Fernandez, Marcos; Gomez, Gervasio; Graziano, Alberto; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Matorras, Francisco; Munoz Sanchez, Francisca Javiela; Piedra Gomez, Jonatan; Rodrigo, Teresa; Rodríguez-Marrero, Ana Yaiza; Ruiz-Jimeno, Alberto; Scodellaro, Luca; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Bachtis, Michail; Baillon, Paul; Ball, Austin; Barney, David; Benaglia, Andrea; Bendavid, Joshua; Benhabib, Lamia; Benitez, Jose F; Bloch, Philippe; Bocci, Andrea; Bonato, Alessio; Bondu, Olivier; Botta, Cristina; Breuker, Horst; Camporesi, Tiziano; Cerminara, Gianluca; Colafranceschi, Stefano; D'Alfonso, Mariarosaria; D'Enterria, David; Dabrowski, Anne; David Tinoco Mendes, Andre; De Guio, Federico; De Roeck, Albert; De Visscher, Simon; Di Marco, Emanuele; Dobson, Marc; Dordevic, Milos; Dorney, Brian; Dupont-Sagorin, Niels; Elliott-Peisert, Anna; Franzoni, Giovanni; Funk, Wolfgang; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Girone, Maria; Glege, Frank; Guida, Roberto; Gundacker, Stefan; Guthoff, Moritz; Hammer, Josef; Hansen, Magnus; Harris, Philip; Hegeman, Jeroen; Innocente, Vincenzo; Janot, Patrick; Kortelainen, Matti J; Kousouris, Konstantinos; Krajczar, Krisztian; Lecoq, Paul; Lourenco, Carlos; Magini, Nicolo; Malgeri, Luca; Mannelli, Marcello; Marrouche, Jad; Masetti, Lorenzo; Meijers, Frans; Mersi, Stefano; Meschi, Emilio; Moortgat, Filip; Morovic, Srecko; Mulders, Martijn; Orfanelli, Styliani; Orsini, Luciano; Pape, Luc; Perez, Emmanuelle; Petrilli, Achille; Petrucciani, Giovanni; Pfeiffer, Andreas; Pimiä, Martti; Piparo, Danilo; Plagge, Michael; Racz, Attila; Rolandi, Gigi; Rovere, Marco; Sakulin, Hannes; Schäfer, Christoph; Schwick, Christoph; Sharma, Archana; Siegrist, Patrice; Silva, Pedro; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Steggemann, Jan; Stieger, Benjamin; Stoye, Markus; Takahashi, Yuta; Treille, Daniel; Tsirou, Andromachi; Veres, Gabor Istvan; Wardle, Nicholas; Wöhri, Hermine Katharina; Wollny, Heiner; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; Kotlinski, Danek; Langenegger, Urs; Renker, Dieter; Rohe, Tilman; Bachmair, Felix; Bäni, Lukas; Bianchini, Lorenzo; Buchmann, Marco-Andrea; Casal, Bruno; Dissertori, Günther; Dittmar, Michael; Donegà, Mauro; Dünser, Marc; Eller, Philipp; Grab, Christoph; Hits, Dmitry; Hoss, Jan; Kasieczka, Gregor; Lustermann, Werner; Mangano, Boris; Marini, Andrea Carlo; Marionneau, Matthieu; Martinez Ruiz del Arbol, Pablo; Masciovecchio, Mario; Meister, Daniel; Mohr, Niklas; Musella, Pasquale; Nägeli, Christoph; Nessi-Tedaldi, Francesca; Pandolfi, Francesco; Pauss, Felicitas; Perrozzi, Luca; Peruzzi, Marco; Quittnat, Milena; Rebane, Liis; Rossini, Marco; Starodumov, Andrei; Takahashi, Maiko; Theofilatos, Konstantinos; Wallny, Rainer; Weber, Hannsjoerg Artur; Amsler, Claude; Canelli, Maria Florencia; Chiochia, Vincenzo; De Cosa, Annapaola; Hinzmann, Andreas; Hreus, Tomas; Kilminster, Benjamin; Lange, Clemens; Ngadiuba, Jennifer; Pinna, Deborah; Robmann, Peter; Ronga, Frederic Jean; Salerno, Daniel; Taroni, Silvia; Yang, Yong; Cardaci, Marco; Chen, Kuan-Hsin; Ferro, Cristina; Kuo, Chia-Ming; Lin, Willis; Lu, Yun-Ju; Volpe, Roberta; Yu, Shin-Shan; Chang, Paoti; Chang, You-Hao; Chao, Yuan; Chen, Kai-Feng; Chen, Po-Hsun; Dietz, Charles; Grundler, Ulysses; Hou, George Wei-Shu; Liu, Yueh-Feng; Lu, Rong-Shyang; Miñano Moya, Mercedes; Petrakou, Eleni; Tsai, Jui-fa; Tzeng, Yeng-Ming; Wilken, Rachel; Asavapibhop, Burin; Singh, Gurpreet; Srimanobhas, Norraphat; Suwonjandee, Narumon; Adiguzel, Aytul; Bakirci, Mustafa Numan; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gokbulut, Gul; Guler, Yalcin; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sunar Cerci, Deniz; Tali, Bayram; Topakli, Huseyin; Vergili, Mehmet; Zorbilmez, Caglar; Akin, Ilina Vasileva; Bilin, Bugra; Bilmis, Selcuk; Gamsizkan, Halil; Isildak, Bora; Karapinar, Guler; Ocalan, Kadir; Sekmen, Sezen; Surat, Ugur Emrah; Yalvac, Metin; Zeyrek, Mehmet; Albayrak, Elif Asli; Gülmez, Erhan; Kaya, Mithat; Kaya, Ozlem; Yetkin, Taylan; Cankocak, Kerem; Vardarlı, Fuat Ilkehan; Levchuk, Leonid; Sorokin, Pavel; Brooke, James John; Clement, Emyr; Cussans, David; Flacher, Henning; Goldstein, Joel; Grimes, Mark; Heath, Greg P; Heath, Helen F; Jacob, Jeson; Kreczko, Lukasz; Lucas, Chris; Meng, Zhaoxia; Newbold, Dave M; Paramesvaran, Sudarshan; Poll, Anthony; Sakuma, Tai; Seif El Nasr-storey, Sarah; Senkin, Sergey; Smith, Vincent J; Bell, Ken W; Belyaev, Alexander; Brew, Christopher; Brown, Robert M; Cockerill, David JA; Coughlan, John A; Harder, Kristian; Harper, Sam; Olaiya, Emmanuel; Petyt, David; Shepherd-Themistocleous, Claire; Thea, Alessandro; Tomalin, Ian R; Williams, Thomas; Womersley, William John; Worm, Steven; Baber, Mark; Bainbridge, Robert; Buchmuller, Oliver; Burton, Darren; Colling, David; Cripps, Nicholas; Dauncey, Paul; Davies, Gavin; De Wit, Adinda; Della Negra, Michel; Dunne, Patrick; Elwood, Adam; Ferguson, William; Fulcher, Jonathan; Futyan, David; Hall, Geoffrey; Iles, Gregory; Jarvis, Martyn; Karapostoli, Georgia; Kenzie, Matthew; Lane, Rebecca; Lucas, Robyn; Lyons, Louis; Magnan, Anne-Marie; Malik, Sarah; Mathias, Bryn; Nash, Jordan; Nikitenko, Alexander; Pela, Joao; Pesaresi, Mark; Petridis, Konstantinos; Raymond, David Mark; Rogerson, Samuel; Rose, Andrew; Seez, Christopher; Sharp, Peter; Tapper, Alexander; Vazquez Acosta, Monica; Virdee, Tejinder; Zenz, Seth Conrad; Cole, Joanne; Hobson, Peter R; Khan, Akram; Kyberd, Paul; Leggat, Duncan; Leslie, Dawn; Reid, Ivan; Symonds, Philip; Teodorescu, Liliana; Turner, Mark; Dittmann, Jay; Hatakeyama, Kenichi; Kasmi, Azeddine; Liu, Hongxuan; Pastika, Nathaniel; Scarborough, Tara; Wu, Zhenbin; Charaf, Otman; Cooper, Seth; Henderson, Conor; Rumerio, Paolo; Avetisyan, Aram; Bose, Tulika; Fantasia, Cory; Lawson, Philip; Richardson, Clint; Rohlf, James; St John, Jason; Sulak, Lawrence; Zou, David; Alimena, Juliette; Berry, Edmund; Bhattacharya, Saptaparna; Christopher, Grant; Cutts, David; Demiragli, Zeynep; Dhingra, Nitish; Ferapontov, Alexey; Garabedian, Alex; Heintz, Ulrich; Laird, Edward; Landsberg, Greg; Mao, Zaixing; Narain, Meenakshi; Sagir, Sinan; Sinthuprasith, Tutanon; Speer, Thomas; Swanson, Joshua; Breedon, Richard; Breto, Guillermo; Calderon De La Barca Sanchez, Manuel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Conway, Rylan; Cox, Peter Timothy; Erbacher, Robin; Gardner, Michael; Ko, Winston; Lander, Richard; Mulhearn, Michael; Pellett, Dave; Pilot, Justin; Ricci-Tam, Francesca; Shalhout, Shalhout; Smith, John; Squires, Michael; Stolp, Dustin; Tripathi, Mani; Wilbur, Scott; Yohay, Rachel; Cousins, Robert; Everaerts, Pieter; Farrell, Chris; Hauser, Jay; Ignatenko, Mikhail; Rakness, Gregory; Takasugi, Eric; Valuev, Vyacheslav; Weber, Matthias; Burt, Kira; Clare, Robert; Ellison, John Anthony; Gary, J William; Hanson, Gail; Heilman, Jesse; Ivova Rikova, Mirena; Jandir, Pawandeep; Kennedy, Elizabeth; Lacroix, Florent; Long, Owen Rosser; Luthra, Arun; Malberti, Martina; Olmedo Negrete, Manuel; Shrinivas, Amithabh; Sumowidagdo, Suharyo; Wimpenny, Stephen; Branson, James G; Cerati, Giuseppe Benedetto; Cittolin, Sergio; D'Agnolo, Raffaele Tito; Holzner, André; Kelley, Ryan; Klein, Daniel; Letts, James; Macneill, Ian; Olivito, Dominick; Padhi, Sanjay; Palmer, Christopher; Pieri, Marco; Sani, Matteo; Sharma, Vivek; Simon, Sean; Tadel, Matevz; Tu, Yanjun; Vartak, Adish; Welke, Charles; Würthwein, Frank; Yagil, Avraham; Zevi Della Porta, Giovanni; Barge, Derek; Bradmiller-Feld, John; Campagnari, Claudio; Danielson, Thomas; Dishaw, Adam; Dutta, Valentina; Flowers, Kristen; Franco Sevilla, Manuel; Geffert, Paul; George, Christopher; Golf, Frank; Gouskos, Loukas; Incandela, Joe; Justus, Christopher; Mccoll, Nickolas; Mullin, Sam Daniel; Richman, Jeffrey; Stuart, David; To, Wing; West, Christopher; Yoo, Jaehyeok; Apresyan, Artur; Bornheim, Adolf; Bunn, Julian; Chen, Yi; Duarte, Javier; Mott, Alexander; Newman, Harvey B; Pena, Cristian; Pierini, Maurizio; Spiropulu, Maria; Vlimant, Jean-Roch; Wilkinson, Richard; Xie, Si; Zhu, Ren-Yuan; Azzolini, Virginia; Calamba, Aristotle; Carlson, Benjamin; Ferguson, Thomas; Iiyama, Yutaro; Paulini, Manfred; Russ, James; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Ford, William T; Gaz, Alessandro; Krohn, Michael; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Smith, James; Stenson, Kevin; Wagner, Stephen Robert; Alexander, James; Chatterjee, Avishek; Chaves, Jorge; Chu, Jennifer; Dittmer, Susan; Eggert, Nicholas; Mirman, Nathan; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Ryd, Anders; Salvati, Emmanuele; Skinnari, Louise; Sun, Werner; Teo, Wee Don; Thom, Julia; Thompson, Joshua; Tucker, Jordan; Weng, Yao; Winstrom, Lucas; Wittich, Peter; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Anderson, Jacob; Apollinari, Giorgio; Bauerdick, Lothar AT; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C; Bolla, Gino; Burkett, Kevin; Butler, Joel Nathan; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gottschalk, Erik; Gray, Lindsey; Green, Dan; Grünendahl, Stefan; Gutsche, Oliver; Hanlon, Jim; Hare, Daryl; Harris, Robert M; Hirschauer, James; Hooberman, Benjamin; Jindariani, Sergo; Johnson, Marvin; Joshi, Umesh; Klima, Boaz; Kreis, Benjamin; Kwan, Simon; Linacre, Jacob; Lincoln, Don; Lipton, Ron; Liu, Tiehui; Lopes De Sá, Rafael; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Martinez Outschoorn, Verena Ingrid; Maruyama, Sho; Mason, David; McBride, Patricia; Merkel, Petra; Mishra, Kalanand; Mrenna, Stephen; Nahn, Steve; Newman-Holmes, Catherine; O'Dell, Vivian; Prokofyev, Oleg; Sexton-Kennedy, Elizabeth; Soha, Aron; Spalding, William J; Spiegel, Leonard; Taylor, Lucas; Tkaczyk, Slawek; Tran, Nhan Viet; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitbeck, Andrew; Whitmore, Juliana; Yang, Fan; Acosta, Darin; Avery, Paul; Bortignon, Pierluigi; Bourilkov, Dimitri; Carver, Matthew; Curry, David; Das, Souvik; De Gruttola, Michele; Di Giovanni, Gian Piero; Field, Richard D; Fisher, Matthew; Furic, Ivan-Kresimir; Hugon, Justin; Konigsberg, Jacobo; Korytov, Andrey; Kypreos, Theodore; Low, Jia Fu; Matchev, Konstantin; Mei, Hualin; Milenovic, Predrag; Mitselmakher, Guenakh; Muniz, Lana; Rinkevicius, Aurelijus; Shchutska, Lesya; Snowball, Matthew; Sperka, David; Yelton, John; Zakaria, Mohammed; Hewamanage, Samantha; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Adams, Jordon Rowe; Adams, Todd; Askew, Andrew; Bochenek, Joseph; Diamond, Brendan; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Johnson, Kurtis F; Prosper, Harrison; Veeraraghavan, Venkatesh; Weinberg, Marc; Baarmand, Marc M; Hohlmann, Marcus; Kalakhety, Himali; Yumiceva, Francisco; Adams, Mark Raymond; Apanasevich, Leonard; Berry, Douglas; Betts, Russell Richard; Bucinskaite, Inga; Cavanaugh, Richard; Evdokimov, Olga; Gauthier, Lucie; Gerber, Cecilia Elena; Hofman, David Jonathan; Kurt, Pelin; O'Brien, Christine; Sandoval Gonzalez, Irving Daniel; Silkworth, Christopher; Turner, Paul; Varelas, Nikos; Bilki, Burak; Clarida, Warren; Dilsiz, Kamuran; Haytmyradov, Maksat; Khristenko, Viktor; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Ogul, Hasan; Onel, Yasar; Ozok, Ferhat; Penzo, Aldo; Rahmat, Rahmat; Sen, Sercan; Tan, Ping; Tiras, Emrah; Wetzel, James; Yi, Kai; Anderson, Ian; Barnett, Bruce Arnold; Blumenfeld, Barry; Bolognesi, Sara; Fehling, David; Gritsan, Andrei; Maksimovic, Petar; Martin, Christopher; Swartz, Morris; Xiao, Meng; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Bruner, Christopher; Gray, Julia; Kenny III, Raymond Patrick; Majumder, Devdatta; Malek, Magdalena; Murray, Michael; Noonan, Daniel; Sanders, Stephen; Sekaric, Jadranka; Stringer, Robert; Wang, Quan; Wood, Jeffrey Scott; Chakaberia, Irakli; Ivanov, Andrew; Kaadze, Ketino; Khalil, Sadia; Makouski, Mikhail; Maravin, Yurii; Saini, Lovedeep Kaur; Skhirtladze, Nikoloz; Svintradze, Irakli; Gronberg, Jeffrey; Lange, David; Rebassoo, Finn; Wright, Douglas; Anelli, Christopher; Baden, Drew; Belloni, Alberto; Calvert, Brian; Eno, Sarah Catherine; Gomez, Jaime; Hadley, Nicholas John; Jabeen, Shabnam; Kellogg, Richard G; Kolberg, Ted; Lu, Ying; Mignerey, Alice; Pedro, Kevin; Shin, Young Ho; Skuja, Andris; Tonjes, Marguerite; Tonwar, Suresh C; Apyan, Aram; Barbieri, Richard; Baty, Austin; Bierwagen, Katharina; Brandt, Stephanie; Busza, Wit; Cali, Ivan Amos; Di Matteo, Leonardo; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Gulhan, Doga; Klute, Markus; Lai, Yue Shi; Lee, Yen-Jie; Levin, Andrew; Luckey, Paul David; Paus, Christoph; Ralph, Duncan; Roland, Christof; Roland, Gunther; Stephans, George; Sumorok, Konstanty; Velicanu, Dragos; Veverka, Jan; Wyslouch, Bolek; Yang, Mingming; Zanetti, Marco; Zhukova, Victoria; Dahmes, Bryan; Gude, Alexander; Kao, Shih-Chuan; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Nourbakhsh, Shervin; Rusack, Roger; Singovsky, Alexander; Tambe, Norbert; Turkewitz, Jared; Acosta, John Gabriel; Oliveros, Sandra; Avdeeva, Ekaterina; Bloom, Kenneth; Bose, Suvadeep; Claes, Daniel R; Dominguez, Aaron; Gonzalez Suarez, Rebeca; Keller, Jason; Knowlton, Dan; Kravchenko, Ilya; Lazo-Flores, Jose; Meier, Frank; Ratnikov, Fedor; Snow, Gregory R; Zvada, Marian; Dolen, James; Godshalk, Andrew; Iashvili, Ia; Kharchilava, Avto; Kumar, Ashish; Rappoccio, Salvatore; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Chasco, Matthew; Massironi, Andrea; Morse, David Michael; Nash, David; Orimoto, Toyoko; Trocino, Daniele; Wang, Ren-Jie; Wood, Darien; Zhang, Jinzhong; Hahn, Kristan Allan; Kubik, Andrew; Mucia, Nicholas; Odell, Nathaniel; Pollack, Brian; Pozdnyakov, Andrey; Schmitt, Michael Henry; Stoynev, Stoyan; Sung, Kevin; Trovato, Marco; Velasco, Mayda; Won, Steven; Brinkerhoff, Andrew; Chan, Kwok Ming; Drozdetskiy, Alexey; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kellams, Nathan; Lannon, Kevin; Lynch, Sean; Marinelli, Nancy; Musienko, Yuri; Pearson, Tessa; Planer, Michael; Ruchti, Randy; Smith, Geoffrey; Valls, Nil; Wayne, Mitchell; Wolf, Matthias; Woodard, Anna; Antonelli, Louis; Brinson, Jessica; Bylsma, Ben; Durkin, Lloyd Stanley; Flowers, Sean; Hart, Andrew; Hill, Christopher; Hughes, Richard; Kotov, Khristian; Ling, Ta-Yung; Luo, Wuming; Puigh, Darren; Rodenburg, Marissa; Winer, Brian L; Wolfe, Homer; Wulsin, Howard Wells; Driga, Olga; Elmer, Peter; Hardenbrook, Joshua; Hebda, Philip; Koay, Sue Ann; Lujan, Paul; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroué, Pierre; Quan, Xiaohang; Saka, Halil; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zuranski, Andrzej; Brownson, Eric; Malik, Sudhir; Mendez, Hector; Ramirez Vargas, Juan Eduardo; Barnes, Virgil E; Benedetti, Daniele; Bortoletto, Daniela; Gutay, Laszlo; Hu, Zhen; Jha, Manoj; Jones, Matthew; Jung, Kurt; Kress, Matthew; Leonardo, Nuno; Miller, David Harry; Neumeister, Norbert; Primavera, Federica; Radburn-Smith, Benjamin Charles; Shi, Xin; Shipsey, Ian; Silvers, David; Svyatkovskiy, Alexey; Wang, Fuqiang; Xie, Wei; Xu, Lingshan; Zablocki, Jakub; Parashar, Neeti; Stupak, John; Adair, Antony; Akgun, Bora; Ecklund, Karl Matthew; Geurts, Frank JM; Li, Wei; Michlin, Benjamin; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Zabel, James; Betchart, Burton; Bodek, Arie; de Barbaro, Pawel; Demina, Regina; Eshaq, Yossof; Ferbel, Thomas; Galanti, Mario; Garcia-Bellido, Aran; Goldenzweig, Pablo; Han, Jiyeon; Harel, Amnon; Hindrichs, Otto; Khukhunaishvili, Aleko; Korjenevski, Sergey; Petrillo, Gianluca; Verzetti, Mauro; Vishnevskiy, Dmitry; Ciesielski, Robert; Demortier, Luc; Goulianos, Konstantin; Mesropian, Christina; Arora, Sanjay; Barker, Anthony; Chou, John Paul; Contreras-Campana, Christian; Contreras-Campana, Emmanuel; Duggan, Daniel; Ferencek, Dinko; Gershtein, Yuri; Gray, Richard; Halkiadakis, Eva; Hidas, Dean; Hughes, Elliot; Kaplan, Steven; Kunnawalkam Elayavalli, Raghav; Lath, Amitabh; Panwalkar, Shruti; Park, Michael; Salur, Sevil; Schnetzer, Steve; Sheffield, David; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Thomassen, Peter; Walker, Matthew; Rose, Keith; Spanier, Stefan; York, Andrew; Bouhali, Othmane; Castaneda Hernandez, Alfredo; Dalchenko, Mykhailo; De Mattia, Marco; Dildick, Sven; Eusebi, Ricardo; Flanagan, Will; Gilmore, Jason; Kamon, Teruki; Khotilovich, Vadim; Krutelyov, Vyacheslav; Montalvo, Roy; Osipenkov, Ilya; Pakhotin, Yuriy; Patel, Rishi; Perloff, Alexx; Roe, Jeffrey; Rose, Anthony; Safonov, Alexei; Suarez, Indara; Tatarinov, Aysen; Ulmer, Keith; Akchurin, Nural; Cowden, Christopher; Damgov, Jordan; Dragoiu, Cosmin; Dudero, Phillip Russell; Faulkner, James; Kovitanggoon, Kittikul; Kunori, Shuichi; Lee, Sung Won; Libeiro, Terence; Volobouev, Igor; Appelt, Eric; Delannoy, Andrés G; Greene, Senta; Gurrola, Alfredo; Johns, Willard; Maguire, Charles; Mao, Yaxian; Melo, Andrew; Sharma, Monika; Sheldon, Paul; Snook, Benjamin; Tuo, Shengquan; Velkovska, Julia; Arenton, Michael Wayne; Boutle, Sarah; Cox, Bradley; Francis, Brian; Goodell, Joseph; Hirosky, Robert; Ledovskoy, Alexander; Li, Hengne; Lin, Chuanzhe; Neu, Christopher; Wolfe, Evan; Wood, John; Clarke, Christopher; Harr, Robert; Karchin, Paul Edmund; Kottachchi Kankanamge Don, Chamath; Lamichhane, Pramod; Sturdy, Jared; Belknap, Donald; Carlsmith, Duncan; Cepeda, Maria; Dasu, Sridhara; Dodd, Laura; Duric, Senka; Friis, Evan; Hall-Wilton, Richard; Herndon, Matthew; Hervé, Alain; Klabbers, Pamela; Lanaro, Armando; Lazaridis, Christos; Levine, Aaron; Loveless, Richard; Mohapatra, Ajit; Ojalvo, Isabel; Perry, Thomas; Pierro, Giuseppe Antonio; Polese, Giovanni; Ross, Ian; Sarangi, Tapas; Savin, Alexander; Smith, Wesley H; Taylor, Devin; Vuosalo, Carl; Woods, Nathaniel

    2015-06-09

    A search for a standard model Higgs boson produced in association with a top-quark pair and decaying to bottom quarks is presented. Events with hadronic jets and one or two oppositely charged leptons are selected from a data sample corresponding to an integrated luminosity of 19.5 fb$^{-1}$ collected by the CMS experiment at the LHC in pp collisions at a centre-of-mass energy of 8 TeV. In order to separate the signal from the larger $\\mathrm{t \\bar{t}}$+jets background, this analysis uses a matrix element method that assigns a probability density value to each reconstructed event under signal or background hypotheses. The ratio between the two values is used in a maximum likelihood fit to extract the signal yield. The results are presented in terms of the measured signal strength modifier, $\\mu$, relative to the standard model prediction for a Higgs boson mass of 125 GeV. The observed (expected) exclusion limit at a 95% confidence level is $\\mu$ lower than 4.2 (3.3), corresponding to a best fit value $\\hat{\\m...

  12. Architecture of the organic matrix in the sternal CaCO3 deposits of Porcellio scaber (Crustacea, Isopoda).

    Science.gov (United States)

    Fabritius, Helge; Walther, Paul; Ziegler, Andreas

    2005-05-01

    Before the molt terrestrial isopods resorb calcium from the posterior cuticle and store it in large deposits within the first four anterior sternites. In Porcellio scaber the deposits consist of three structurally distinct layers consisting of amorphous CaCO3 (ACC) and an organic matrix that consists of concentric and radial elements. It is thought that the organic matrix plays a role in the structural organization of deposits and in the stabilization of ACC, which is unstable in vitro. In this paper, we present a thorough analysis of the ultrastructure of the organic matrix in the CaCO3 deposits using high-resolution field-emission scanning electron microscopy. The spherules and the homogeneous layer contain an elaborate organic matrix with similar structural organization consisting of concentric reticules and radial strands. The decalcification experiments reveal an inhomogeneous solubility of ACC within the spherules probably caused by variations in the stabilizing properties of matrix components. The transition between the three layers can be explained by changes in the number of spherule nucleation sites.

  13. On the evaluation of the U(3) content of the matrix elements of one-and two-body operators

    International Nuclear Information System (INIS)

    Vanagas, V.; Alcaras, J.A.C.

    1991-09-01

    An expression for the U(3) content of the matrix elements of one- and two-body operators in Elliott's basis is obtained. Three alternative ways of evaluating this content with increasing performance in computing time are presented. All of them allow an exact representation of that content in terms of integers, avoiding rounding errors in the computer codes. The role of dual bases in dealing with non-orthogonal bases is also clarified. (author)

  14. Matrix interdiction problem

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Feng [Los Alamos National Laboratory; Kasiviswanathan, Shiva [Los Alamos National Laboratory

    2010-01-01

    In the matrix interdiction problem, a real-valued matrix and an integer k is given. The objective is to remove k columns such that the sum over all rows of the maximum entry in each row is minimized. This combinatorial problem is closely related to bipartite network interdiction problem which can be applied to prioritize the border checkpoints in order to minimize the probability that an adversary can successfully cross the border. After introducing the matrix interdiction problem, we will prove the problem is NP-hard, and even NP-hard to approximate with an additive n{gamma} factor for a fixed constant {gamma}. We also present an algorithm for this problem that achieves a factor of (n-k) mUltiplicative approximation ratio.

  15. Automated evaluation of matrix elements between contracted wavefunctions: A Mathematica version of the FRODO program

    Science.gov (United States)

    Angeli, C.; Cimiraglia, R.

    2013-02-01

    A symbolic program performing the Formal Reduction of Density Operators (FRODO), formerly developed in the MuPAD computer algebra system with the purpose of evaluating the matrix elements of the electronic Hamiltonian between internally contracted functions in a complete active space (CAS) scheme, has been rewritten in Mathematica. New version : A program summaryProgram title: FRODO Catalogue identifier: ADV Y _v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADVY_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 3878 No. of bytes in distributed program, including test data, etc.: 170729 Distribution format: tar.gz Programming language: Mathematica Computer: Any computer on which the Mathematica computer algebra system can be installed Operating system: Linux Classification: 5 Catalogue identifier of previous version: ADV Y _v1_0 Journal reference of previous version: Comput. Phys. Comm. 171(2005)63 Does the new version supersede the previous version?: No Nature of problem. In order to improve on the CAS-SCF wavefunction one can resort to multireference perturbation theory or configuration interaction based on internally contracted functions (ICFs) which are obtained by application of the excitation operators to the reference CAS-SCF wavefunction. The previous formulation of such matrix elements in the MuPAD computer algebra system, has been rewritten using Mathematica. Solution method: The method adopted consists in successively eliminating all occurrences of inactive orbital indices (core and virtual) from the products of excitation operators which appear in the definition of the ICFs and in the electronic Hamiltonian expressed in the second quantization formalism. Reasons for new version: Some years ago we published in this journal a couple of papers [1, 2

  16. The temporal Fresnel number in terms of ray matrix elements

    International Nuclear Information System (INIS)

    Zhang Zhuhong; Fan Dianyuan

    1993-01-01

    By using the analogy between temporal ray matrix and the well known ray matrix, the temporal Fresnel number, which gives the qualitative and quasiquantitative characteristics (shape, width and chirp) of optical pulses, is derived. A concept of effective propagation time is introduced. Several typical examples are discussed. 6 refs

  17. Matrix multiplication operations with data pre-conditioning in a high performance computing architecture

    Science.gov (United States)

    Eichenberger, Alexandre E; Gschwind, Michael K; Gunnels, John A

    2013-11-05

    Mechanisms for performing matrix multiplication operations with data pre-conditioning in a high performance computing architecture are provided. A vector load operation is performed to load a first vector operand of the matrix multiplication operation to a first target vector register. A load and splat operation is performed to load an element of a second vector operand and replicating the element to each of a plurality of elements of a second target vector register. A multiply add operation is performed on elements of the first target vector register and elements of the second target vector register to generate a partial product of the matrix multiplication operation. The partial product of the matrix multiplication operation is accumulated with other partial products of the matrix multiplication operation.

  18. The O(αs3) massive operator matrix elements of O(nf) for the structure function F2(x,Q2) and transversity

    International Nuclear Information System (INIS)

    Ablinger, J.; Bluemlein, J.; Klein, S.; Schneider, C.; Wissbrock, F.

    2011-01-01

    The contributions ∝n f to the O(α s 3 ) massive operator matrix elements describing the heavy flavor Wilson coefficients in the limit Q 2 >>m 2 are computed for the structure function F 2 (x,Q 2 ) and transversity for general values of the Mellin variable N. Here, for two matrix elements, A qq,Q PS (N) and A qg,Q (N), the complete result is obtained. A first independent computation of the contributions to the 3-loop anomalous dimensions γ qg (N), γ qq PS (N), and γ qq NS,(TR) (N) is given. In the computation advanced summation technologies for nested sums over products of hypergeometric terms with harmonic sums have been used. For intermediary results generalized harmonic sums occur, while the final results can be expressed by nested harmonic sums only.

  19. Quadrupole corrections to matrix elements of transitions in resonant reactions of muonic molecule formation

    International Nuclear Information System (INIS)

    Faifman, M.P.; Strizh, T.A.; Armour, E.A.G.; Harston, M.R.

    1996-01-01

    The calculated resonant formation rates of the muonic molecules DDμ and DTμ are presented. The approach developed earlier for calculating the transition matrix elements in the dipole approximation has been extended to include the quadrupole terms in the multipole expansion of the interaction operator. The calculated dependence of the DTμ formation rates on the energies of the incident Tμ muonic atoms shows that the effect of including the quadrupole correction is to reduce the magnitude of the peak rates by about 20-30% at the different temperatures, compared to those calculated in the dipole approximation. The dependence on temperature for the DDμ formation rates is obtained with the differences between the presented and previous calculations being less than 5%. (orig.)

  20. Improved method for eliminating center-of-mass coordinates from matrix elements in oscillator basis

    International Nuclear Information System (INIS)

    Richardson, R.H.; Shapiro, J.Y.

    1986-01-01

    This paper presents a concise, efficient method of reducing potential energy matrix elements to relative coordinates, when one is using an oscillator basis. It is especially suited to computer calculations. One nice feature of the method is its modular form, which allows a wide range of calculations. Separate FORTRAN subroutines have been written which calculate and store tables of the one-dimensional brackets of an equation that is presented and the single particle brackets from the isotropic to the axially symmetric oscillator equations. The tables are used by other subroutines which calculate the modified brackets and the brackets with spin. The methods developed here are a substantial improvement over what has been done heretofore, and open up new possibilities for performing nuclear structure calculations

  1. Data-driven probability concentration and sampling on manifold

    Energy Technology Data Exchange (ETDEWEB)

    Soize, C., E-mail: christian.soize@univ-paris-est.fr [Université Paris-Est, Laboratoire Modélisation et Simulation Multi-Echelle, MSME UMR 8208 CNRS, 5 bd Descartes, 77454 Marne-La-Vallée Cedex 2 (France); Ghanem, R., E-mail: ghanem@usc.edu [University of Southern California, 210 KAP Hall, Los Angeles, CA 90089 (United States)

    2016-09-15

    A new methodology is proposed for generating realizations of a random vector with values in a finite-dimensional Euclidean space that are statistically consistent with a dataset of observations of this vector. The probability distribution of this random vector, while a priori not known, is presumed to be concentrated on an unknown subset of the Euclidean space. A random matrix is introduced whose columns are independent copies of the random vector and for which the number of columns is the number of data points in the dataset. The approach is based on the use of (i) the multidimensional kernel-density estimation method for estimating the probability distribution of the random matrix, (ii) a MCMC method for generating realizations for the random matrix, (iii) the diffusion-maps approach for discovering and characterizing the geometry and the structure of the dataset, and (iv) a reduced-order representation of the random matrix, which is constructed using the diffusion-maps vectors associated with the first eigenvalues of the transition matrix relative to the given dataset. The convergence aspects of the proposed methodology are analyzed and a numerical validation is explored through three applications of increasing complexity. The proposed method is found to be robust to noise levels and data complexity as well as to the intrinsic dimension of data and the size of experimental datasets. Both the methodology and the underlying mathematical framework presented in this paper contribute new capabilities and perspectives at the interface of uncertainty quantification, statistical data analysis, stochastic modeling and associated statistical inverse problems.

  2. Effect of sample matrix on the fundamental properties of the inductively coupled plasma

    International Nuclear Information System (INIS)

    Lehn, Scott A.; Warner, Kelly A.; Huang Mao; Hieftje, Gary M.

    2003-01-01

    In the inductively coupled plasma (ICP), the emission intensities of atomic and ionic spectral lines are controlled by fundamental parameters such as electron temperature, electron number density, gas-kinetic temperature, analyte atom and ion number densities, and others. Accordingly, the effect of a sample matrix on the analyte emission intensity in an ICP might be attributable to changes in these fundamental parameters caused by the matrix elements. In the present study, a plasma imaging instrument that combines Thomson scattering, Rayleigh scattering, laser-induced fluorescence and computed tomography has been employed to measure the above-mentioned parameters in the presence and absence of matrix elements. The data thus obtained were all collected on a spatially resolved basis and without the need for Abel inversion. Calcium, strontium and barium served as analytes, while lithium, copper and zinc were introduced as matrix elements. Comparing the data with and without the matrix elements allows us to determine the extent to which each fundamental parameter changes in the presence of a matrix element, and to better understand the nature of the matrix effects that occur in the ICP. As has been seen in previous studies with different matrix elements, ion emission and ion number densities follow opposite trends when matrix interferents are introduced into the plasma: ion emission is enhanced by the presence of matrix interferents while ion concentrations are lowered. These changes are consistent with a shift from collisional deactivation to radiative decay of excited-state analyte species

  3. Probabilistic homogenization of random composite with ellipsoidal particle reinforcement by the iterative stochastic finite element method

    Science.gov (United States)

    Sokołowski, Damian; Kamiński, Marcin

    2018-01-01

    This study proposes a framework for determination of basic probabilistic characteristics of the orthotropic homogenized elastic properties of the periodic composite reinforced with ellipsoidal particles and a high stiffness contrast between the reinforcement and the matrix. Homogenization problem, solved by the Iterative Stochastic Finite Element Method (ISFEM) is implemented according to the stochastic perturbation, Monte Carlo simulation and semi-analytical techniques with the use of cubic Representative Volume Element (RVE) of this composite containing single particle. The given input Gaussian random variable is Young modulus of the matrix, while 3D homogenization scheme is based on numerical determination of the strain energy of the RVE under uniform unit stretches carried out in the FEM system ABAQUS. The entire series of several deterministic solutions with varying Young modulus of the matrix serves for the Weighted Least Squares Method (WLSM) recovery of polynomial response functions finally used in stochastic Taylor expansions inherent for the ISFEM. A numerical example consists of the High Density Polyurethane (HDPU) reinforced with the Carbon Black particle. It is numerically investigated (1) if the resulting homogenized characteristics are also Gaussian and (2) how the uncertainty in matrix Young modulus affects the effective stiffness tensor components and their PDF (Probability Density Function).

  4. Spectrofluorimetric determination of rare earth elements using solidmatrix

    International Nuclear Information System (INIS)

    Suh, I.S.; Chi, K.Y.

    1982-01-01

    In this experiment, rare earth elements are separated from uranium by using the alumina column, anion exchange resin column, and 20% TOA in xylene and fluorescence characteristics were found in the solid matrix to analyze these elements without preseparation from each other. It becomes clear that the YVO 4 matrix is more sensitive than the Y 2 O 3 matrix when the red filter is used to minimized the second order peak intensity. And micro quantity of the rare earth elements in the yellow cake are analyzed by the using of the YVO 4 soid matrix. (Author)

  5. Matrix theory selected topics and useful results

    CERN Document Server

    Mehta, Madan Lal

    1989-01-01

    Matrices and operations on matrices ; determinants ; elementary operations on matrices (continued) ; eigenvalues and eigenvectors, diagonalization of normal matrices ; functions of a matrix ; positive definiteness, various polar forms of a matrix ; special matrices ; matrices with quaternion elements ; inequalities ; generalised inverse of a matrix ; domain of values of a matrix, location and dispersion of eigenvalues ; symmetric functions ; integration over matrix variables ; permanents of doubly stochastic matrices ; infinite matrices ; Alexander matrices, knot polynomials, torsion numbers.

  6. Measurement of the Top Quark Mass Using the Matrix Element Technique in Dilepton Final States

    CERN Document Server

    Abazov, Victor Mukhamedovich

    2016-08-18

    We present a measurement of the top quark mass in ppbar collisions at a center-of-mass energy of 1.96 TeV at the Fermilab Tevatron collider. The data were collected by the D0 experiment corresponding to an integrated luminosity of 9.7 fb-1. The matrix element technique is applied to ttbar events in the final state containing leptons (electrons or muons) with high transverse momenta and at least two jets. The calibration of the jet energy scale determined in the lepton + jets final state of ttbar decays is applied to jet energies. This correction provides a substantial reduction in systematic uncertainties. We obtain a top quark mass of mt = 173.93 +- 1.84 GeV.

  7. Evaluation of matrix effect on the determination of rare earth elements and As, Bi, Cd, Pb, Se and In in honey and pollen of native Brazilian bees (Tetragonisca angustula - Jataí) by Q-ICP-MS.

    Science.gov (United States)

    de Oliveira, Fernanda Ataide; de Abreu, Adriana Trópia; de Oliveira Nascimento, Nathália; Froes-Silva, Roberta Eliane Santos; Antonini, Yasmine; Nalini, Hermínio Arias; de Lena, Jorge Carvalho

    2017-01-01

    Bees are considered the main pollinators in natural and agricultural environments. Chemical elements from honey and pollen have been used for monitoring the environment, the health of bees and the quality of their products. Nevertheless, there are not many studies on honey and pollen of native Brazilian bees. The goal of this work was to determine important chemical elements (Sc, Y, La, Ce, Pr, Nd, Sm, Eu, Gd, Dy, Ho, Er, Tm, Lu and Yb) along with As, Bi, Cd, Pb, Se and In, in honey and pollen of native Brazilian bees, assessing analytical interferences from the matrix. A proposed analytical method was developed for these elements by quadrupole ICP-MS. Matrix effect was verified in honey matrix in the quantification of As, Bi and Dy; and in pollen matrix for Bi, Cd, Ce, Gd, La, Pb and Sc. The quality of the method was considered satisfactory taking into consideration the recovery rate of each element in the spiked solutions: honey matrix (91.6-103.9%) and pollen matrix (94.1-115.6%). The quantification limits of the method ranged between 0.00041 and 10.3μgL -1 for honey and 0.00041-0.095μgL -1 for pollen. The results demonstrate that the method is accurate, precise and suitable. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Minimal parameter solution of the orthogonal matrix differential equation

    Science.gov (United States)

    Bar-Itzhack, Itzhack Y.; Markley, F. Landis

    1990-01-01

    As demonstrated in this work, all orthogonal matrices solve a first order differential equation. The straightforward solution of this equation requires n sup 2 integrations to obtain the element of the nth order matrix. There are, however, only n(n-1)/2 independent parameters which determine an orthogonal matrix. The questions of choosing them, finding their differential equation and expressing the orthogonal matrix in terms of these parameters are considered. Several possibilities which are based on attitude determination in three dimensions are examined. It is shown that not all 3-D methods have useful extensions to higher dimensions. It is also shown why the rate of change of the matrix elements, which are the elements of the angular rate vector in 3-D, are the elements of a tensor of the second rank (dyadic) in spaces other than three dimensional. It is proven that the 3-D Gibbs vector (or Cayley Parameters) are extendable to other dimensions. An algorithm is developed emplying the resulting parameters, which are termed Extended Rodrigues Parameters, and numerical results are presented of the application of the algorithm to a fourth order matrix.

  9. Study on thermal conductivity of HTR spherical fuel element matrix graphite

    International Nuclear Information System (INIS)

    Zhang Kaihong; Liu Xiaoxue; Zhao Hongsheng; Li Ziqiang; Tang Chunhe

    2014-01-01

    Taking the spherical fuel element matrix graphite ball samples as an example, this paper introduced the principle and method of laser thermal conductivity meter, as well as the specific heat capacity, and analyzed the effects of different test methods and sampling methods on the thermal conductivities at 1000 ℃ of graphite material. The experimental results show that the thermal conductivities of graphite materials tested by synchronous thermal analyzer combining with laser thermal conductivity meter were different from that directly by laser thermal conductivity meter, the former was more reliable and accurate than the later; When sampling from different positions, central samples had higher thermal conductivities than edging samples, which was related to the material density and porosity at the different locations; the thermal conductivities had obvious distinction between samples from different directions, which was because the layer structure of polycrystalline graphite preferred orientation under pressure, generally speaking, the thermal conductivities perpendicular to the molding direction were higher than that parallel to the molding direction. Besides this, the test results show that the thermal conductivities of all the graphite material samples were greater than 30 W/(m (K), achieving the thermal performance index of high temperature gas cooled reactor. (authors)

  10. The matrix-elements of two-particle residual interaction in the shell-model formalism with the M.S.D.I. approximation. Part 2

    International Nuclear Information System (INIS)

    Jasielska, A.; Wiktor, S.

    1977-01-01

    The table of two-particle matrix elements calculated according to the formalism of MSDI approximation for the orbits 1fsub(7/2), 2psub(3/2), 2psub(1/2) and 1fsub(5/2) and published previously is now supplemented by inclusion of the 1gsub(9/2) orbit. (author)

  11. Performance evaluation of matrix gradient coils.

    Science.gov (United States)

    Jia, Feng; Schultz, Gerrit; Testud, Frederik; Welz, Anna Masako; Weber, Hans; Littin, Sebastian; Yu, Huijun; Hennig, Jürgen; Zaitsev, Maxim

    2016-02-01

    In this paper, we present a new performance measure of a matrix coil (also known as multi-coil) from the perspective of efficient, local, non-linear encoding without explicitly considering target encoding fields. An optimization problem based on a joint optimization for the non-linear encoding fields is formulated. Based on the derived objective function, a figure of merit of a matrix coil is defined, which is a generalization of a previously known resistive figure of merit for traditional gradient coils. A cylindrical matrix coil design with a high number of elements is used to illustrate the proposed performance measure. The results are analyzed to reveal novel features of matrix coil designs, which allowed us to optimize coil parameters, such as number of coil elements. A comparison to a scaled, existing multi-coil is also provided to demonstrate the use of the proposed performance parameter. The assessment of a matrix gradient coil profits from using a single performance parameter that takes the local encoding performance of the coil into account in relation to the dissipated power.

  12. Random Correlation Matrix and De-Noising

    OpenAIRE

    Ken-ichi Mitsui; Yoshio Tabata

    2006-01-01

    In Finance, the modeling of a correlation matrix is one of the important problems. In particular, the correlation matrix obtained from market data has the noise. Here we apply the de-noising processing based on the wavelet analysis to the noisy correlation matrix, which is generated by a parametric function with random parameters. First of all, we show that two properties, i.e. symmetry and ones of all diagonal elements, of the correlation matrix preserve via the de-noising processing and the...

  13. Matrix effect on the detection limit and accuracy in total reflection X-ray fluorescence analysis of trace elements in environmental and biological samples

    International Nuclear Information System (INIS)

    Karjou, J.

    2007-01-01

    The effect of matrix contents on the detection limit of total reflection X-ray fluorescence analysis was experimentally investigated using a set of multielement standard solutions (500 ng/mL of each element) in variable concentrations of NH 4 NO 3 . It was found that high matrix concentration, i.e. 0.1-10% NH 4 NO 3 , had a strong effect on the detection limits for all investigated elements, whereas no effect was observed at lower matrix concentration, i.e. 0-0.1% NH 4 NO 3 . The effect of soil and blood sample masses on the detection limit was also studied. The results showed decreasing the detection limit (in concentration unit, μg/g) with increasing the sample mass. However, the detection limit increased (in mass unit, ng) with increasing sample mass. The optimal blood sample mass of ca. 200 μg was sufficient to improve the detection limit of Se determination by total reflection X-ray fluorescence. The capability of total reflection X-ray fluorescence to analyze different kinds of samples was discussed with respect to the accuracy and detection limits based on certified and reference materials. Direct analysis of unknown water samples from several sources was also presented in this work

  14. Supersymmetry in random matrix theory

    International Nuclear Information System (INIS)

    Kieburg, Mario

    2010-01-01

    I study the applications of supersymmetry in random matrix theory. I generalize the supersymmetry method and develop three new approaches to calculate eigenvalue correlation functions. These correlation functions are averages over ratios of characteristic polynomials. In the first part of this thesis, I derive a relation between integrals over anti-commuting variables (Grassmann variables) and differential operators with respect to commuting variables. With this relation I rederive Cauchy- like integral theorems. As a new application I trace the supermatrix Bessel function back to a product of two ordinary matrix Bessel functions. In the second part, I apply the generalized Hubbard-Stratonovich transformation to arbitrary rotation invariant ensembles of real symmetric and Hermitian self-dual matrices. This extends the approach for unitarily rotation invariant matrix ensembles. For the k-point correlation functions I derive supersymmetric integral expressions in a unifying way. I prove the equivalence between the generalized Hubbard-Stratonovich transformation and the superbosonization formula. Moreover, I develop an alternative mapping from ordinary space to superspace. After comparing the results of this approach with the other two supersymmetry methods, I obtain explicit functional expressions for the probability densities in superspace. If the probability density of the matrix ensemble factorizes, then the generating functions exhibit determinantal and Pfaffian structures. For some matrix ensembles this was already shown with help of other approaches. I show that these structures appear by a purely algebraic manipulation. In this new approach I use structures naturally appearing in superspace. I derive determinantal and Pfaffian structures for three types of integrals without actually mapping onto superspace. These three types of integrals are quite general and, thus, they are applicable to a broad class of matrix ensembles. (orig.)

  15. Supersymmetry in random matrix theory

    Energy Technology Data Exchange (ETDEWEB)

    Kieburg, Mario

    2010-05-04

    I study the applications of supersymmetry in random matrix theory. I generalize the supersymmetry method and develop three new approaches to calculate eigenvalue correlation functions. These correlation functions are averages over ratios of characteristic polynomials. In the first part of this thesis, I derive a relation between integrals over anti-commuting variables (Grassmann variables) and differential operators with respect to commuting variables. With this relation I rederive Cauchy- like integral theorems. As a new application I trace the supermatrix Bessel function back to a product of two ordinary matrix Bessel functions. In the second part, I apply the generalized Hubbard-Stratonovich transformation to arbitrary rotation invariant ensembles of real symmetric and Hermitian self-dual matrices. This extends the approach for unitarily rotation invariant matrix ensembles. For the k-point correlation functions I derive supersymmetric integral expressions in a unifying way. I prove the equivalence between the generalized Hubbard-Stratonovich transformation and the superbosonization formula. Moreover, I develop an alternative mapping from ordinary space to superspace. After comparing the results of this approach with the other two supersymmetry methods, I obtain explicit functional expressions for the probability densities in superspace. If the probability density of the matrix ensemble factorizes, then the generating functions exhibit determinantal and Pfaffian structures. For some matrix ensembles this was already shown with help of other approaches. I show that these structures appear by a purely algebraic manipulation. In this new approach I use structures naturally appearing in superspace. I derive determinantal and Pfaffian structures for three types of integrals without actually mapping onto superspace. These three types of integrals are quite general and, thus, they are applicable to a broad class of matrix ensembles. (orig.)

  16. Influence of polarization potential on probabilities of free-free transitions of electrons

    International Nuclear Information System (INIS)

    Dobrolyubov, N.Yu.; Kukin, V.D.; Rostovskij, V.S.

    1997-01-01

    The method for calculating the matrix element of electrical dipole transition between the continuos spectrum states with an account of existence of coulomb and polarization potentials in the atom external area is considered. The recurrent of formulae, enabling the calculation of contribution to the matrix element from integrals over the area outside the atom with application of values of radial wave functions and their first derivatives at the boundary, are obtained

  17. Quarkonium polarization and the long distance matrix elements hierarchies using jet substructure

    Science.gov (United States)

    Dai, Lin; Shrivastava, Prashant

    2017-08-01

    We investigate the quarkonium production mechanisms in jets at the LHC, using the fragmenting jet functions (FJF) approach. Specifically, we discuss the jet energy dependence of the J /ψ production cross section at the LHC. By comparing the cross sections for the different NRQCD production channels (1S0[8], 3S1[8], 3PJ[8], and 3cripts>S1[1]), we find that at fixed values of energy fraction z carried by the J /ψ , if the normalized cross section is a decreasing function of the jet energy, in particular for z >0.5 , then the depolarizing 1S0[8] must be the dominant channel. This makes the prediction made in [Baumgart et al., J. High Energy Phys. 11 (2014) 003, 10.1007/JHEP11(2014)003] for the FJF's also true for the cross section. We also make comparisons between the long distance matrix elements extracted by various groups. This analysis could potentially shed light on the polarization properties of the J /ψ production in high pT region.

  18. Matrix diffusion user guide (release 2)

    International Nuclear Information System (INIS)

    Herbert, A.W.; Preece, T.E.

    1989-04-01

    This report presents an introduction to the use of the matrix diffusion option of the finite-element package NAMMU. The facilities available in the package are described; and the process of preparing the necessary input data is illustrated with an example. The matrix diffusion option of NAMMU models the transport of radionuclides in groundwater in a flow field governed by Darcy's Law. A detailed description of the mathematical model used for this option is given. The package uses the finite-element method. This allows the easy modelling of complex geological structures. (author)

  19. Neutral kaon mixing beyond the Standard Model with n{sub f}=2+1 chiral fermions. Part 1: bare matrix elements and physical results

    Energy Technology Data Exchange (ETDEWEB)

    Garron, Nicolas [Theoretical Physics Division, Department of Mathematical Sciences, University of Liverpool,Brownlow Hill, Liverpool, L69 3BX (United Kingdom); Hudspith, Renwick J. [Department of Physics and Astronomy, York University,4700 Keele Street, Toronto, Ontario, M3J 1P3 (Canada); Lytle, Andrew T. [SUPA, School of Physics and Astronomy, University of Glasgow,University Avenue, Glasgow, G12 8QQ (United Kingdom); Collaboration: The RBC/UKQCD collaboration

    2016-11-02

    We compute the hadronic matrix elements of the four-quark operators relevant for K{sup 0}−K̄{sup 0} mixing beyond the Standard Model. Our results are from lattice QCD simulations with n{sub f}=2+1 flavours of domain-wall fermion, which exhibit continuum-like chiral-flavour symmetry. The simulations are performed at two different values of the lattice spacing (a∼0.08 and a∼0.11 fm) and with lightest unitary pion mass ∼300 MeV. For the first time, the full set of relevant four-quark operators is renormalised non-perturbatively through RI-SMOM schemes; a detailed description of the renormalisation procedure is presented in a companion paper. We argue that the intermediate renormalisation scheme is responsible for the discrepancies found by different collaborations. We also study different normalisations and determine the matrix elements of the relevant four-quark operators with a precision of ∼5% or better.

  20. Apparatus and method for identification of matrix materials in which transuranic elements are embedded using thermal neutron capture gamma-ray emission

    Science.gov (United States)

    Close, D.A.; Franks, L.A.; Kocimski, S.M.

    1984-08-16

    An invention is described that enables the quantitative simultaneous identification of the matrix materials in which fertile and fissile nuclides are embedded to be made along with the quantitative assay of the fertile and fissile materials. The invention also enables corrections for any absorption of neutrons by the matrix materials and by the measurement apparatus by the measurement of the prompt and delayed neutron flux emerging from a sample after the sample is interrogated by simultaneously applied neutrons and gamma radiation. High energy electrons are directed at a first target to produce gamma radiation. A second target receives the resulting pulsed gamma radiation and produces neutrons from the interaction with the gamma radiation. These neutrons are slowed by a moderator surrounding the sample and bathe the sample uniformly, generating second gamma radiation in the interaction. The gamma radiation is then resolved and quantitatively detected, providing a spectroscopic signature of the constituent elements contained in the matrix and in the materials within the vicinity of the sample. (LEW)

  1. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  2. SU(2) X SU(2) X U(1) basis for symmetric SO(6) representations: matrix elements of the generators

    International Nuclear Information System (INIS)

    Piepenbring, R.; Silvestre-Brac, B.; Szymanski, Z.

    1987-01-01

    Matrix elements of the group generators for the symmetric irreducible representations of SO(6) are explicitly calculated in a closed form employing thedecomposition chain SO(6) is contained in SU(2) X SU(2) X U(1) (which is different from the well known Wigner supermultiplet scheme). The relation to the Gel'fand Tsetlin method using SO(6) contained in SO(5) up to ... SO(2) is indicated. An example of a physical application is given

  3. Multi-scale damage modelling in a ceramic matrix composite using a finite-element microstructure meshfree methodology

    Science.gov (United States)

    2016-01-01

    The problem of multi-scale modelling of damage development in a SiC ceramic fibre-reinforced SiC matrix ceramic composite tube is addressed, with the objective of demonstrating the ability of the finite-element microstructure meshfree (FEMME) model to introduce important aspects of the microstructure into a larger scale model of the component. These are particularly the location, orientation and geometry of significant porosity and the load-carrying capability and quasi-brittle failure behaviour of the fibre tows. The FEMME model uses finite-element and cellular automata layers, connected by a meshfree layer, to efficiently couple the damage in the microstructure with the strain field at the component level. Comparison is made with experimental observations of damage development in an axially loaded composite tube, studied by X-ray computed tomography and digital volume correlation. Recommendations are made for further development of the model to achieve greater fidelity to the microstructure. This article is part of the themed issue ‘Multiscale modelling of the structural integrity of composite materials’. PMID:27242308

  4. Two-loop massive operator matrix elements for unpolarized heavy flavor production to O({epsilon})

    Energy Technology Data Exchange (ETDEWEB)

    Bierenbaum, I.; Bluemlein, J.; Klein, S. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Schneider, C. [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation

    2008-02-15

    We calculate the O({alpha}{sup 2}{sub s}) massive operator matrix elements for the twist-2 operators, which contribute to the heavy flavor Wilson coefficients in unpolarized deeply inelastic scattering in the region Q{sup 2}>>m{sup 2}, up to the O({epsilon}) contributions. These terms contribute through the renormalization of the O({alpha}{sup 3}{sub s}) heavy flavor Wilson coefficients of the structure function F{sub 2}(x,Q{sup 2}). The calculation has been performed using light-cone expansion techniques without using the integration-by-parts method. We represent the individual Feynman diagrams by generalized hypergeometric structures, the {epsilon}-expansion of which leads to infinite sums depending on the Mellin variable N. These sums are finally expressed in terms of nested harmonic sums using the general summation techniques implemented in the Sigma package. (orig.)

  5. Exact Wigner surmise type evaluation of the spacing distribution in the bulk of the scaled random matrix ensembles

    International Nuclear Information System (INIS)

    Forrester, P.J.; Witte, N.S.

    2000-01-01

    Random matrix ensembles with orthogonal and unitary symmetry correspond to the cases of real symmetric and Hermitian random matrices respectively. We show that the probability density function for the corresponding spacings between consecutive eigenvalues can be written exactly in the Wigner surmise type form a(s) e-b(s) for a simply related to a Painleve transcendent and b its anti-derivative. A formula consisting of the sum of two such terms is given for the symplectic case (Hermitian matrices with real quaternion elements)

  6. Matrix Transformation in Boron Containing High-Temperature Co-Re-Cr Alloys

    Science.gov (United States)

    Strunz, Pavel; Mukherji, Debashis; Beran, Přemysl; Gilles, Ralph; Karge, Lukas; Hofmann, Michael; Hoelzel, Markus; Rösler, Joachim; Farkas, Gergely

    2018-03-01

    An addition of boron largely increases the ductility in polycrystalline high-temperature Co-Re alloys. Therefore, the effect of boron on the alloy structural characteristics is of high importance for the stability of the matrix at operational temperatures. Volume fractions of ɛ (hexagonal close-packed—hcp), γ (face-centered cubic—fcc) and σ (Cr2Re3 type) phases were measured at ambient and high temperatures (up to 1500 °C) for a boron-containing Co-17Re-23Cr alloy using neutron diffraction. The matrix phase undergoes an allotropic transformation from ɛ to γ structure at high temperatures, similar to pure cobalt and to the previously investigated, more complex Co-17Re-23Cr-1.2Ta-2.6C alloy. It was determined in this study that the transformation temperature depends on the boron content (0-1000 wt. ppm). Nevertheless, the transformation temperature did not change monotonically with the increase in the boron content but reached a minimum at approximately 200 ppm of boron. A probable reason is the interplay between the amount of boron in the matrix and the amount of σ phase, which binds hcp-stabilizing elements (Cr and Re). Moreover, borides were identified in alloys with high boron content.

  7. Elastic K-means using posterior probability.

    Science.gov (United States)

    Zheng, Aihua; Jiang, Bo; Li, Yan; Zhang, Xuehan; Ding, Chris

    2017-01-01

    The widely used K-means clustering is a hard clustering algorithm. Here we propose a Elastic K-means clustering model (EKM) using posterior probability with soft capability where each data point can belong to multiple clusters fractionally and show the benefit of proposed Elastic K-means. Furthermore, in many applications, besides vector attributes information, pairwise relations (graph information) are also available. Thus we integrate EKM with Normalized Cut graph clustering into a single clustering formulation. Finally, we provide several useful matrix inequalities which are useful for matrix formulations of learning models. Based on these results, we prove the correctness and the convergence of EKM algorithms. Experimental results on six benchmark datasets demonstrate the effectiveness of proposed EKM and its integrated model.

  8. Application of dot matrix LCD in multi-element portable X-ray fluorescence spectrometry The LCD is stated for Liquid Crystal Display

    CERN Document Server

    Lin Yan Chang; Lai Wan Chang; Zhou Si Chun

    2002-01-01

    Dot matrix LCD based on T6963C is a low power supply module. It needs no complex interface circuits connecting with MCU. Application in text and graphics is easy. Application of this LCD in multi-element portable XRF spectrometry is show. How to use it in Chinese, pull-down menu, spectrum and how to design the interface circuits with embedded computer are shown as well

  9. Overall determination of the CKM matrix

    International Nuclear Information System (INIS)

    Plaszczynski, S.; Schune, M.H.

    1999-11-01

    We discuss the problem of theoretical uncertainties in the combination of observables related to the CKM matrix elements and propose a statistically sensible method for combining them. The overall fit is performed on present data, and constraints on the matrix elements are presented as well as on ∫ B d √B B d . We then explore the implications of recent measurements and developments: J/ψK 0 s asymmetry, ε'/ε and B → Kπ branching fractions. Finally, we extract from the overall fit the Standard Model expectations for the rare kaon decays K → πνν-bar. (authors)

  10. An element-based finite-volume method approach for naturally fractured compositional reservoir simulation

    Energy Technology Data Exchange (ETDEWEB)

    Marcondes, Francisco [Federal University of Ceara, Fortaleza (Brazil). Dept. of Metallurgical Engineering and Material Science], e-mail: marcondes@ufc.br; Varavei, Abdoljalil; Sepehrnoori, Kamy [The University of Texas at Austin (United States). Petroleum and Geosystems Engineering Dept.], e-mails: varavei@mail.utexas.edu, kamys@mail.utexas.edu

    2010-07-01

    An element-based finite-volume approach in conjunction with unstructured grids for naturally fractured compositional reservoir simulation is presented. In this approach, both the discrete fracture and the matrix mass balances are taken into account without any additional models to couple the matrix and discrete fractures. The mesh, for two dimensional domains, can be built of triangles, quadrilaterals, or a mix of these elements. However, due to the available mesh generator to handle both matrix and discrete fractures, only results using triangular elements will be presented. The discrete fractures are located along the edges of each element. To obtain the approximated matrix equation, each element is divided into three sub-elements and then the mass balance equations for each component are integrated along each interface of the sub-elements. The finite-volume conservation equations are assembled from the contribution of all the elements that share a vertex, creating a cell vertex approach. The discrete fracture equations are discretized only along the edges of each element and then summed up with the matrix equations in order to obtain a conservative equation for both matrix and discrete fractures. In order to mimic real field simulations, the capillary pressure is included in both matrix and discrete fracture media. In the implemented model, the saturation field in the matrix and discrete fractures can be different, but the potential of each phase in the matrix and discrete fracture interface needs to be the same. The results for several naturally fractured reservoirs are presented to demonstrate the applicability of the method. (author)

  11. Standard error propagation in R-matrix model fitting for light elements

    International Nuclear Information System (INIS)

    Chen Zhenpeng; Zhang Rui; Sun Yeying; Liu Tingjin

    2003-01-01

    The error propagation features with R-matrix model fitting 7 Li, 11 B and 17 O systems were researched systematically. Some laws of error propagation were revealed, an empirical formula P j = U j c / U j d = K j · S-bar · √m / √N for describing standard error propagation was established, the most likely error ranges for standard cross sections of 6 Li(n,t), 10 B(n,α0) and 10 B(n,α1) were estimated. The problem that the standard error of light nuclei standard cross sections may be too small results mainly from the R-matrix model fitting, which is not perfect. Yet R-matrix model fitting is the most reliable evaluation method for such data. The error propagation features of R-matrix model fitting for compound nucleus system of 7 Li, 11 B and 17 O has been studied systematically, some laws of error propagation are revealed, and these findings are important in solving the problem mentioned above. Furthermore, these conclusions are suitable for similar model fitting in other scientific fields. (author)

  12. Transfer matrix representation for periodic planar media

    Science.gov (United States)

    Parrinello, A.; Ghiringhelli, G. L.

    2016-06-01

    Sound transmission through infinite planar media characterized by in-plane periodicity is faced by exploiting the free wave propagation on the related unit cells. An appropriate through-thickness transfer matrix, relating a proper set of variables describing the acoustic field at the two external surfaces of the medium, is derived by manipulating the dynamic stiffness matrix related to a finite element model of the unit cell. The adoption of finite element models avoids analytical modeling or the simplification on geometry or materials. The obtained matrix is then used in a transfer matrix method context, making it possible to combine the periodic medium with layers of different nature and to treat both hard-wall and semi-infinite fluid termination conditions. A finite sequence of identical sub-layers through the thickness of the medium can be handled within the transfer matrix method, significantly decreasing the computational burden. Transfer matrices obtained by means of the proposed method are compared with analytical or equivalent models, in terms of sound transmission through barriers of different nature.

  13. Information matrix estimation procedures for cognitive diagnostic models.

    Science.gov (United States)

    Liu, Yanlou; Xin, Tao; Andersson, Björn; Tian, Wei

    2018-03-06

    Two new methods to estimate the asymptotic covariance matrix for marginal maximum likelihood estimation of cognitive diagnosis models (CDMs), the inverse of the observed information matrix and the sandwich-type estimator, are introduced. Unlike several previous covariance matrix estimators, the new methods take into account both the item and structural parameters. The relationships between the observed information matrix, the empirical cross-product information matrix, the sandwich-type covariance matrix and the two approaches proposed by de la Torre (2009, J. Educ. Behav. Stat., 34, 115) are discussed. Simulation results show that, for a correctly specified CDM and Q-matrix or with a slightly misspecified probability model, the observed information matrix and the sandwich-type covariance matrix exhibit good performance with respect to providing consistent standard errors of item parameter estimates. However, with substantial model misspecification only the sandwich-type covariance matrix exhibits robust performance. © 2018 The British Psychological Society.

  14. Statistical theory of nuclear cross section fluctuations with account s-matrix unitarity

    International Nuclear Information System (INIS)

    Kun, S.Yu.

    1985-01-01

    Statistical properties of the S-matrix fluctuating part delta S=S- sub(T) in the T/D>>1, N>>1 Ericoson fluctuations mode are investigated. A unitary representation is used for the investigation of statistical properties of the S-matrix. The problem on correlation of fluctuating elements of the S-matrix is discussed. The S-matrix unitary representation allows one to strictly substantiates the assumptions of the Ericson fluctuations theory: a) the real and imaginary parts of the deltaS-matrix have identical dispersions, do not correlate and are distributed according to the normal law; 2) various deltaS-matrix elements do not correlate

  15. The enigma of probability and physics

    International Nuclear Information System (INIS)

    Mayants, L.

    1984-01-01

    This volume contains a coherent exposition of the elements of two unique sciences: probabilistics (science of probability) and probabilistic physics (application of probabilistics to physics). Proceeding from a key methodological principle, it starts with the disclosure of the true content of probability and the interrelation between probability theory and experimental statistics. This makes is possible to introduce a proper order in all the sciences dealing with probability and, by conceiving the real content of statistical mechanics and quantum mechanics in particular, to construct both as two interconnected domains of probabilistic physics. Consistent theories of kinetics of physical transformations, decay processes, and intramolecular rearrangements are also outlined. The interrelation between the electromagnetic field, photons, and the theoretically discovered subatomic particle 'emon' is considered. Numerous internal imperfections of conventional probability theory, statistical physics, and quantum physics are exposed and removed - quantum physics no longer needs special interpretation. EPR, Bohm, and Bell paradoxes are easily resolved, among others. (Auth.)

  16. GENERALIZED MATRIXES OF GALOIS PROTOCOLS EXCHANGE ENCRYPTION KEYS

    Directory of Open Access Journals (Sweden)

    Anatoly Beletsky

    2016-03-01

    Full Text Available The methods of construction of matrix formation the secret protocols legalized subscribers of public communications networks encryption keys. Based key exchange protocols laid asymmetric cryptography algorithms. The solution involves the calculation of one-way functions and is based on the use of generalized Galois arrays of isomorphism relationship with forming elements, and depending on the selected irreducible polynomial generating matrix. A simple method for constructing generalized Galois matrix by the method of filling the diagonal. In order to eliminate the isomorphism of Galois arrays and their constituent elements, limiting the possibility of building one-way functions, Galois matrix subjected to similarity transformation carried out by means of permutation matrices. The variant of the organization of the algebraic attacks on encryption keys sharing protocols and discusses options for easing the consequences of an attack.

  17. Gradient-based stochastic estimation of the density matrix

    Science.gov (United States)

    Wang, Zhentao; Chern, Gia-Wei; Batista, Cristian D.; Barros, Kipton

    2018-03-01

    Fast estimation of the single-particle density matrix is key to many applications in quantum chemistry and condensed matter physics. The best numerical methods leverage the fact that the density matrix elements f(H)ij decay rapidly with distance rij between orbitals. This decay is usually exponential. However, for the special case of metals at zero temperature, algebraic decay of the density matrix appears and poses a significant numerical challenge. We introduce a gradient-based probing method to estimate all local density matrix elements at a computational cost that scales linearly with system size. For zero-temperature metals, the stochastic error scales like S-(d+2)/2d, where d is the dimension and S is a prefactor to the computational cost. The convergence becomes exponential if the system is at finite temperature or is insulating.

  18. Analytical solutions to matrix diffusion problems

    Energy Technology Data Exchange (ETDEWEB)

    Kekäläinen, Pekka, E-mail: pekka.kekalainen@helsinki.fi [Laboratory of Radiochemistry, Department of Chemistry, P.O. Box 55, FIN-00014 University of Helsinki (Finland)

    2014-10-06

    We report an analytical method to solve in a few cases of practical interest the equations which have traditionally been proposed for the matrix diffusion problem. In matrix diffusion, elements dissolved in ground water can penetrate the porous rock surronuding the advective flow paths. In the context of radioactive waste repositories this phenomenon provides a mechanism by which the area of rock surface in contact with advecting elements is greatly enhanced, and can thus be an important delay mechanism. The cases solved are relevant for laboratory as well for in situ experiments. Solutions are given as integral representations well suited for easy numerical solution.

  19. Calculations with off-shell matrix elements, TMD parton densities and TMD parton showers

    Energy Technology Data Exchange (ETDEWEB)

    Bury, Marcin; Hameren, Andreas van; Kutak, Krzysztof; Sapeta, Sebastian [Polish Academy of Sciences, Institute of Nuclear Physics, Cracow (Poland); Jung, Hannes [Polish Academy of Sciences, Institute of Nuclear Physics, Cracow (Poland); DESY, Hamburg (Germany); Serino, Mirko [Polish Academy of Sciences, Institute of Nuclear Physics, Cracow (Poland); Ben Gurion University of the Negev, Department of Physics, Beersheba (Israel)

    2018-02-15

    A new calculation using off-shell matrix elements with TMD parton densities supplemented with a newly developed initial state TMD parton shower is described. The calculation is based on the KaTie package for an automated calculation of the partonic process in high-energy factorization, making use of TMD parton densities implemented in TMDlib. The partonic events are stored in an LHE file, similar to the conventional LHE files, but now containing the transverse momenta of the initial partons. The LHE files are read in by the Cascade package for the full TMD parton shower, final state shower and hadronization from Pythia where events in HEPMC format are produced. We have determined a full set of TMD parton densities and developed an initial state TMD parton shower, including all flavors following the TMD distribution. As an example of application we have calculated the azimuthal de-correlation of high p{sub t} dijets as measured at the LHC and found very good agreement with the measurement when including initial state TMD parton showers together with conventional final state parton showers and hadronization. (orig.)

  20. The selection of a matrix for the recovery of uranium by wet high-intensity magnetic separation

    International Nuclear Information System (INIS)

    Svoboda, J.

    1985-01-01

    The proper choice of a suitable matrix for high-intensity magnetic separation is of the utmost importance, since the geometry and size of the matrix play decisive roles in the achievement of optimum separation conditions. In relatively simple filtration applications, the matrix must offer a high efficiency of collision with suspended particles, a high probability of retention of intercepted particles, and high loading capacity. Also, it must be easily cleaned. The results obtained by the use of theoretical models of magnetic separation fail to agree with the experimental results for basic parameters like the ratio of particle size to matrix size, the length of the matrix, and the magnetic properties of the matrix material. Preconceived ideas about the matrix often lead to the erroneous choice of a matrix, and hence to its unsatisfactory performance during magnetic separation. The potential value of high-intensity magnetic separation as applied to the recovery of uranium and gold from leach residues and in association with the development of a large-scale magnetic separator to be used for the same purpose led to the present investigation in which a wide spectrum of matrix shapes and sizes were tested. It was found that the optimum recovery and selectivity of separation are obtained at a ratio of particle size to matrix-element size ranging from 200 to 300. The use of these matrices also results in a low degree of mechanical entrapment, particularly of coarser particles, for which straining plays a significant role for fine matrices. It was also found that the magnetization of a matrix plays a minor role, contrary to the theoretical predictions. Furthermore, the effects of matrix height, matrix loading, and scalping of the pulp by paramagnetic matrices were evaluated for various types of matrices

  1. Anisotropic damping of Timoshenko beam elements

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, M.H.

    2001-05-01

    This report contains a description of a structural damping model for Timoshenko beam elements used in the aeroelastic code HawC developed at Risoe for modeling wind turbines. The model has been developed to enable modeling of turbine blades which often have different damping characteristics for flapwise, edgewise and torsional vibrations. The structural damping forces acting on the beam element are modeled by viscous damping described by an element damping matrix. The composition of this matrix is based on the element mass and stiffness matrices. It is shown how the coefficients for the mass and stiffness contributions can be calibrated to give the desired modal damping in the complete model of a blade. (au)

  2. Exact and approximate exchange potentials investigated in terms of their matrix elements with the Kohn-Sham orbitals

    International Nuclear Information System (INIS)

    Holas, A.; Cinal, M.

    2005-01-01

    Three approximate exchange potentials of high accuracy v x Y (r), Y=A,B,C, for the density-functional theory applications are obtained by replacing the matrix elements of the exact potential between the Kohn-Sham (KS) orbitals with such elements of the Fock exchange operator (within the virtual-occupied subset only) in three representations found for any local potential. A common identity is the base of these representations. The potential v x C happens to be the same as that derived by Harbola and Sahni, and v x A as that derived by Gritsenko and Baerends, and Della Sala and Goerling. The potentials obtained can be expressed in terms of occupied KS orbitals only. At large r, their asymptotic form -1/r is the same as that of the exact potential. The high quality of these three approximations is demonstrated by direct comparison with the exact potential and using various consistency tests. A common root established for the three approximations could be helpful in finding new and better approximations via modification of identities employed in the present investigation

  3. Mindset of employees working in a matrix organizational structure

    OpenAIRE

    Lukinaitė, Eglė; Sondaitė, Jolanta

    2017-01-01

    Organizations wishing to be successful and control their complexity will probably have to develop matrix mindset. The main goal of this research is to reveal the mindset of employees working in a matrix organizational structure. The data were collected through focus groups. A thematic analysis was employed to achieve the goal. The results revealed that employees working in a matrix organizational structure perceive their influence through cooperation, discussion and personal efficiency. Emplo...

  4. The chiral Gaussian two-matrix ensemble of real asymmetric matrices

    International Nuclear Information System (INIS)

    Akemann, G; Phillips, M J; Sommers, H-J

    2010-01-01

    We solve a family of Gaussian two-matrix models with rectangular N x (N + ν) matrices, having real asymmetric matrix elements and depending on a non-Hermiticity parameter μ. Our model can be thought of as the chiral extension of the real Ginibre ensemble, relevant for Dirac operators in the same symmetry class. It has the property that its eigenvalues are either real, purely imaginary or come in complex conjugate eigenvalue pairs. The eigenvalue joint probability distribution for our model is explicitly computed, leading to a non-Gaussian distribution including K-Bessel functions. All n-point density correlation functions are expressed for finite N in terms of a Pfaffian form. This contains a kernel involving Laguerre polynomials in the complex plane as a building block which was previously computed by the authors. This kernel can be expressed in terms of the kernel for complex non-Hermitian matrices, generalizing the known relation among ensembles of Hermitian random matrices. Compact expressions are given for the density at finite N as an example, as well as its microscopic large-N limits at the origin for fixed ν at strong and weak non-Hermiticity.

  5. General-transformation matrix for Dirac spinors and the calculation of spinorial amplitudes

    International Nuclear Information System (INIS)

    Nam, K.; Moravcsik, M.J.

    1983-01-01

    A general transformation matrix T(p's';p,s) is constructed which transforms a Dirac spinor psi(p,s) into another Dirac spinor psi(p',s') with arbitrarily given momenta and polarization states by expoloting the so-called Stech operator as one of generators for those transformations. This transformation matrix is then used in a calculation to yield the spinorial matrix element M = anti psi(p',s')GAMMApsi(p,s) for any spin polarization state. The final expressions of these matrix elements show the explicit structure of spin dependence for the process described by these spinorial amplitudes. The kinematical limiting cases such as very low energy or high energy of the various matrix elements can also be easily displayed. Our method is superior to the existing one in the following points. Since we have a well-defined transformation operator between two Dirac spinor states, we can evaluate the necessary phase factor of the matrix elements in an unambiguous way without introducing the coordinate system. This enables us to write down the Feynman amplitudes of complicated processes in any spin basis very easily in terms of previously calculated matrix elements of anti psiGAMMApsi which are building blocks of those Feynman amplitudes. The usefulness of the results is illustrated on Compton scattering and on the elastic scattering of two identical massive leptons where the phase factor is important. It is also shown that the Stech operator as a polarization operator is simply related to the operator K = #betta#(polarized μ . polarized L + 1)/2 which is often used in bound state problems

  6. Correlation matrix for quartet codon usage

    CERN Document Server

    Frappat, L; Sorba, Paul

    2005-01-01

    It has been argued that the sum of usage probabilities for codons, belonging to quartets, that have as third nucleotide C or A, is independent of the biological species for vertebrates. The comparison between the theoretical correlation matrix derived from these sum rules and the experimentally computed matrix for 26 species shows a satisfactory agreement. The Shannon entropy, weakly depending on the biological species, gives further support. Suppression of codons containing the dinucleotides CG or AU is put in evidence.

  7. Multiphonon states in even-even spherical nuclei. Pt. 2. Calculation of the matrix elements of one and two body operators

    International Nuclear Information System (INIS)

    Piepenbring, R.; Protasov, K.V.; Silvestre-Brac, B.

    1995-01-01

    Matrix elements of one and two body operators, which appear in a general hamiltonian and in electromagnetic transitions are derived in a subspace spanned by multiphonon states. The method is illustrated for a single j-shell, where phonons built with one type of particles are introduced. The eigenvalues obtained within the space spanned by the phonons of lowest angular momentum are compared to those of the full space. In such a method, the Pauli principle is fully and properly taken into account. ((orig.))

  8. Efficient sparse matrix-matrix multiplication for computing periodic responses by shooting method on Intel Xeon Phi

    Science.gov (United States)

    Stoykov, S.; Atanassov, E.; Margenov, S.

    2016-10-01

    Many of the scientific applications involve sparse or dense matrix operations, such as solving linear systems, matrix-matrix products, eigensolvers, etc. In what concerns structural nonlinear dynamics, the computations of periodic responses and the determination of stability of the solution are of primary interest. Shooting method iswidely used for obtaining periodic responses of nonlinear systems. The method involves simultaneously operations with sparse and dense matrices. One of the computationally expensive operations in the method is multiplication of sparse by dense matrices. In the current work, a new algorithm for sparse matrix by dense matrix products is presented. The algorithm takes into account the structure of the sparse matrix, which is obtained by space discretization of the nonlinear Mindlin's plate equation of motion by the finite element method. The algorithm is developed to use the vector engine of Intel Xeon Phi coprocessors. It is compared with the standard sparse matrix by dense matrix algorithm and the one developed by Intel MKL and it is shown that by considering the properties of the sparse matrix better algorithms can be developed.

  9. Finite-size scaling of survival probability in branching processes

    OpenAIRE

    Garcia-Millan, Rosalba; Font-Clos, Francesc; Corral, Alvaro

    2014-01-01

    Branching processes pervade many models in statistical physics. We investigate the survival probability of a Galton-Watson branching process after a finite number of generations. We reveal the finite-size scaling law of the survival probability for a given branching process ruled by a probability distribution of the number of offspring per element whose standard deviation is finite, obtaining the exact scaling function as well as the critical exponents. Our findings prove the universal behavi...

  10. Linear positivity and virtual probability

    International Nuclear Information System (INIS)

    Hartle, James B.

    2004-01-01

    We investigate the quantum theory of closed systems based on the linear positivity decoherence condition of Goldstein and Page. The objective of any quantum theory of a closed system, most generally the universe, is the prediction of probabilities for the individual members of sets of alternative coarse-grained histories of the system. Quantum interference between members of a set of alternative histories is an obstacle to assigning probabilities that are consistent with the rules of probability theory. A quantum theory of closed systems therefore requires two elements: (1) a condition specifying which sets of histories may be assigned probabilities and (2) a rule for those probabilities. The linear positivity condition of Goldstein and Page is the weakest of the general conditions proposed so far. Its general properties relating to exact probability sum rules, time neutrality, and conservation laws are explored. Its inconsistency with the usual notion of independent subsystems in quantum mechanics is reviewed. Its relation to the stronger condition of medium decoherence necessary for classicality is discussed. The linear positivity of histories in a number of simple model systems is investigated with the aim of exhibiting linearly positive sets of histories that are not decoherent. The utility of extending the notion of probability to include values outside the range of 0-1 is described. Alternatives with such virtual probabilities cannot be measured or recorded, but can be used in the intermediate steps of calculations of real probabilities. Extended probabilities give a simple and general way of formulating quantum theory. The various decoherence conditions are compared in terms of their utility for characterizing classicality and the role they might play in further generalizations of quantum mechanics

  11. Reducing Data Size Inequality during Finite Element Model Separation into Superelements

    Directory of Open Access Journals (Sweden)

    Yu. V. Berchun

    2015-01-01

    Full Text Available The work considers two methods of automatic separation of final element model into super-elements to decrease computing resource demand when solving the linearly - elastic problems of solid mechanics. The first method represents an algorithm to separate a final element grid into simply connected sub-regions according to the set specific number of nodes in the super-element. The second method is based on the generation of a super-element with the set specific data size of the coefficient matrix of the system of equations of the internal nodes balance, which are eliminated during super-element transformation. Both methods are based on the theory of graphs. The data size of a matrix of coefficients is assessed on the assumption that the further solution of a task will use Holetsky’s method. Before assessment of data size, a KatkhillaMackey's (Cuthill-McKee algorithm renumbers the internal nodes of a super-element both to decrease a profile width of the appropriate matrix of the system of equations of balance and to reduce the number of nonzero elements. Test examples show work results of abovementioned methods compared in terms of inequality of generated super-element separation according to the number of nodes and data size of the coefficient matrix of the system of equations of the internal nodes balance. It is shown that the offered approach provides smaller inequality of data size of super-element matrixes, with slightly increasing inequality by the number of tops.

  12. General 4–zero texture mass matrix parametrizations

    International Nuclear Information System (INIS)

    Barranco, J; Delepine, D; Lopez-Lozano, L

    2014-01-01

    It is performed the diagonalization of a non–Hermitian four–zero texture Yukawa matrix with a general formalism. This procedure leads to 3 possibilities to parametrize the relation between the fermion masses and the elements of the corresponding Yukawa matrix. Then, the matrices that diagonalize each Yukawa mass matrix are combined in order to obtain 9 different theoretical CKM or PMNS mixing matrices [1]. Through a χ 2 analysis, we have constrained the values of the remaining free parameters such as the theoretical mixing matrix matches the latest experimental measurements of the mixing matrices. This analysis was done without assuming any approximations. In the case of the quark sector, it is found that only four different theoretical mixing matrices are compatible with the actual high precision experimental measurement of the CKM matrix elements. For the lepton sector, where the masses of neutrinos are not known, we found that independently of the parametrization that have been chosen, the updated experimental measurements of the mixing angles in the PMNS matrix, imply a mass for the heaviest left–handed neutrino to be ∼ 0.05eV

  13. The summation of the matrix elements of Hamiltonian and transition operators. The variance of the emission spectrum

    International Nuclear Information System (INIS)

    Karaziya, R.I.; Rudzikajte, L.S.

    1988-01-01

    The general method to obtain the explicit expressions for sums of the matrix elements of Hamiltonian and transition operators has been extended. It can be used for determining the main characteristics of atomic spectra, such as the mean energy, the variance, the asymmetry coefficient, etc., as well as for the average quantities which describe the configuration mixing. By mean of this method the formula for the variance of the emission spectrum has been derived. It has been shown that this quantity of the emission spectrum can be expressed by the variances of the energy spectra of the initial and final configurations and by additional terms, caused by the distribution of the intensity in spectrum

  14. The logarithmic contributions to the O(α{sub s}{sup 3}) asymptotic massive Wilson coefficients and operator matrix elements in deeply inelastic scattering

    Energy Technology Data Exchange (ETDEWEB)

    Behring, A.; Bluemlein, J.; Freitas, A. de [Deutsches Elektronen Synchrotron, DESY, Zeuthen (Germany); Bierenbaum, I. [Universitaet Hamburg, II. Institut fuer Theoretische Physik, Hamburg (Germany); Klein, S. [RWTH Aachen University, Institut fuer Theoretische Teilchenphysik und Kosmologie, Aachen (Germany); Wissbrock, F. [Deutsches Elektronen Synchrotron, DESY, Zeuthen (Germany); Johannes Kepler University, Research Institute for Symbolic Computation (RISC), Linz (Austria); IHES, Bures-sur-Yvette (France)

    2014-09-15

    We calculate the logarithmic contributions to the massive Wilson coefficients for deep-inelastic scattering in the asymptotic region Q{sup 2} >> m{sup 2} to 3-loop order in the fixed flavor number scheme and present the corresponding expressions for the massive operator matrix elements needed in the variable flavor number scheme. Explicit expressions are given in Mellin N-space. (orig.)

  15. A search for the ttH (H → bb) channel at the Large Hadron Collider with the ATLAS detector using a matrix element method

    CERN Document Server

    Basye, Austin Thomas

    A matrix element method analysis of the Standard Model Higgs boson, produced in association with two top quarks decaying to the lepton-plus-jets channel is presented. Based on 20.3 fb−1 of √s=8 TeV data, produced at the Large Hadron Collider and collected by the ATLAS detector, this analysis utilizes multiple advanced techniques to search for tt ̄H signatures with a 125 GeV Higgs boson decaying to two b-quarks. After categorizing selected events based on their jet and b-tag multiplicities, signal rich regions are analyzed using the matrix element method. Resulting variables are then propagated to two parallel multivariate analyses utilizing Neural Networks and Boosted Decision Trees respectively. As no significant excess is found, an observed (expected) limit of 3.4 (2.2) times the Standard Model cross-section is determined at 95% confidence, using the CLs method, for the Neural Network analysis. For the Boosted Decision Tree analysis, an observed (expected) limit of 5.2 (2.7) times the Standard Model cr...

  16. The probability representation as a new formulation of quantum mechanics

    International Nuclear Information System (INIS)

    Man'ko, Margarita A; Man'ko, Vladimir I

    2012-01-01

    We present a new formulation of conventional quantum mechanics, in which the notion of a quantum state is identified via a fair probability distribution of the position measured in a reference frame of the phase space with rotated axes. In this formulation, the quantum evolution equation as well as the equation for finding energy levels are expressed as linear equations for the probability distributions that determine the quantum states. We also give the integral transforms relating the probability distribution (called the tomographic-probability distribution or the state tomogram) to the density matrix and the Wigner function and discuss their connection with the Radon transform. Qudit states are considered and the invertible map of the state density operators onto the probability vectors is discussed. The tomographic entropies and entropic uncertainty relations are reviewed. We demonstrate the uncertainty relations for the position and momentum and the entropic uncertainty relations in the tomographic-probability representation, which is suitable for an experimental check of the uncertainty relations.

  17. Measurement of the t-channel single-top-quark-production cross section and the CKM-matrix element Vtb with the CMS experiment

    International Nuclear Information System (INIS)

    Klingebiel, Dennis

    2014-01-01

    The electroweak production of single top quarks offers a unique access to the Cabibbo-Kobayashi-Maskawa (CKM) matrix element V tb , which is a fundamental parameter of the Standard Model of particle physics (SM). In this thesis, measurements of the inclusive t-channel single-top-quark-production cross section, the CKM-matrix element V tb , and the ratio of t-channel top-quark-production and top-antiquark-production cross sections are presented. Proton-proton collisions with a center-of-mass energy of 7 TeV are analyzed. These collisions were recorded with the Compact Muon Solenoid (CMS) experiment at the particle-accelerator complex Large Hadron Collider (LHC), which is operated by the European Organization for Nuclear Research (CERN) near Geneva, Switzerland. The analyzed data correspond to an integrated luminosity of 1.6/fb. This analysis uses events with at least two jets and either an electron or muon. Each event is classified according to the flavor and charge of the electron or muon, the number of jets, and the number of b-tagged jets. Signal and background processes are discriminated using Boosted Decision Trees (BDTs). The signal cross section is simultaneously measured in twelve orthogonal categories. A Bayesian approach is used to infer the signal cross section from data. Particular emphasis is placed on the modeling of systematic uncertainties and the evaluation of their impact on the measurement. Systematic uncertainties are incorporated as additional nuisance parameters into the likelihood function. Marginalization is used to eliminate the nuisance parameters. The single-top-quark t-channel production cross section is measured to be (66.6 +6.7 -6.2 ) pb. The measured value is in agreement with the next-to-next-to-leading order SM prediction. With a relative uncertainty of -9.3% +10.1%, this measurement is significantly more precise than previous measurements in proton-proton und proton-antiproton collisions. The absolute value of the CKM-matrix element

  18. Dynamic-stiffness matrix of embedded and pile foundations by indirect boundary-element method

    International Nuclear Information System (INIS)

    Wolf, J.P.; Darbre, G.R.

    1984-01-01

    The boundary-integral equation method is well suited for the calculation of the dynamic-stiffness matrix of foundations embedded in a layered visco-elastic halfspace (or a transmitting boundary of arbitrary shape), which represents an unbounded domain. It also allows pile groups to be analyzed, taking pile-soil-pile interaction into account. The discretization of this boundary-element method is restricted to the structure-soil interface. All trial functions satisfy exactly the field equations and the radiation condition at infinity. In the indirect boundary-element method distributed source loads of initially unknown intensities act on a source line located in the excavated part of the soil and are determined such that the prescribed boundary conditions on the structure-soil interface are satisfied in an average sense. In the two-dimensional case the variables are expanded in a Fourier integral in the wave number domain, while in three dimensions, Fourier series in the circumferential direction and bessel functions of the wave number domain, while in three dimensions, Fourier series in the circumferential direction and Bessel functions of the wave number in the radial direction are selected. Accurate results arise with a small number of parameters of the loads acting on a source line which should coincide with the structure-soil interface. In a parametric study the dynamic-stiffness matrices of rectangular foundations of various aspect ratios embedded in a halfplane and in a layer built-in at its base are calculated. For the halfplane, the spring coefficients for the translational directions hardly depend on the embedment, while the corresponding damping coefficients increase for larger embedments, this tendency being more pronounced in the horizontal direction. (orig.)

  19. Radial Matrix Elements of Hydrogen Atom and the Correspondence ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    Hydrogen excited states—radial matrix element—corres- ... atoms, its availability, production, its spectras, and importance in astrophysics (Dupree ... far away revolving lazily around in a slow orbit like a distant planet in the solar system. As the electron orbit diameter grows rapidly, its energy also decreases rapidly. Currently ...

  20. The transition matrix element A{sub gq}(N) of the variable flavor number scheme at O(α{sub s}{sup 3})

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, J. [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstraße 69, A-4040 Linz (Austria); Blümlein, J.; De Freitas, A. [Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Hasselhuhn, A. [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstraße 69, A-4040 Linz (Austria); Manteuffel, A. von [PRISMA Cluster of Excellence and Institute of Physics, J. Gutenberg University, D-55099 Mainz (Germany); Round, M. [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstraße 69, A-4040 Linz (Austria); Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Schneider, C. [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstraße 69, A-4040 Linz (Austria); Wißbrock, F. [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstraße 69, A-4040 Linz (Austria); Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany)

    2014-05-15

    We calculate the massive unpolarized operator matrix element A{sub gq}{sup (3)}(N) to 3-loop order in Quantum Chromodynamics at general values of the Mellin variable N. This is the first complete transition function needed in the variable flavor number scheme obtained at O(α{sub s}{sup 3}). A first independent recalculation is performed for the contributions ∝N{sub F} of the 3-loop anomalous dimension γ{sub gq}{sup (2)}(N)

  1. On the shake-off probability for atomic systems

    Energy Technology Data Exchange (ETDEWEB)

    Santos, A.C.F., E-mail: toniufrj@gmail.com [Instituto de Física, Universidade Federal do Rio de Janeiro, P.O. Box 68528, 21941-972 Rio de Janeiro, RJ (Brazil); Almeida, D.P. [Departamento de Física, Universidade Federal de Santa Catarina, 88040-900 Florianópolis (Brazil)

    2016-07-15

    Highlights: • The scope is to find the relationship among SO probabilities, Z and electron density. • A scaling law is suggested, allowing us to find the SO probabilities for atoms. • SO probabilities have been scaled as a function of target Z and polarizability. - Abstract: The main scope in this work has been upon the relationship between shake-off probabilities, target atomic number and electron density. By comparing the saturation values of measured double-to-single photoionization ratios from the literature, a simple scaling law has been found, which allows us to predict the shake-off probabilities for several elements up to Z = 54 within a factor 2. The electron shake-off probabilities accompanying valence shell photoionization have been scaled as a function of the target atomic number, Z, and polarizability, α. This behavior is in qualitative agreement with the experimental results.

  2. K →π matrix elements of the chromomagnetic operator on the lattice

    Science.gov (United States)

    Constantinou, M.; Costa, M.; Frezzotti, R.; Lubicz, V.; Martinelli, G.; Meloni, D.; Panagopoulos, H.; Simula, S.; ETM Collaboration

    2018-04-01

    We present the results of the first lattice QCD calculation of the K →π matrix elements of the chromomagnetic operator OCM=g s ¯ σμ νGμ νd , which appears in the effective Hamiltonian describing Δ S =1 transitions in and beyond the standard model. Having dimension five, the chromomagnetic operator is characterized by a rich pattern of mixing with operators of equal and lower dimensionality. The multiplicative renormalization factor as well as the mixing coefficients with the operators of equal dimension have been computed at one loop in perturbation theory. The power divergent coefficients controlling the mixing with operators of lower dimension have been determined nonperturbatively, by imposing suitable subtraction conditions. The numerical simulations have been carried out using the gauge field configurations produced by the European Twisted Mass Collaboration with Nf=2 +1 +1 dynamical quarks at three values of the lattice spacing. Our result for the B parameter of the chromomagnetic operator at the physical pion and kaon point is BCMOK π=0.273 (69 ) , while in the SU(3) chiral limit we obtain BCMO=0.076 (23 ) . Our findings are significantly smaller than the model-dependent estimate BCMO˜1 - 4 , currently used in phenomenological analyses, and improve the uncertainty on this important phenomenological quantity.

  3. A measurement of the top quark mass with a matrix element method

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, Adam Paul [Univ. of California, Berkeley, CA (United States)

    2006-01-01

    The authors present a measurement of the mass of the top quark. The event sample is selected from proton-antiproton collisions, at 1.96 TeV center-of-mass energy, observed with the CDF detector at Fermilab's Tevatron. They consider a 318 pb-1 dataset collected between March 2002 and August 2004. They select events that contain one energetic lepton, large missing transverse energy, exactly four energetic jets, and at least one displaced vertex b tag. The analysis uses leading-order t$\\bar{t}$ and background matrix elements along with parameterized parton showering to construct event-by-event likelihoods as a function of top quark mass. From the 63 events observed with the 318 pb-1 dataset they extract a top quark mass of 172.0 ± 2.6(stat) ± 3.3(syst) GeV/c2 from the joint likelihood. The mean expected statistical uncertainty is 3.2 GeV/c2 for m $\\bar{t}$ = 178 GTeV/c2 and 3.1 GeV/c2 for m $\\bar{t}$ = 172.5 GeV/c2. The systematic error is dominated by the uncertainty of the jet energy scale.

  4. Consolidation effects on tensile properties of an elemental Al matrix composite

    Energy Technology Data Exchange (ETDEWEB)

    Tang, F. [Building 4515, MS 6064, Metals and Ceramics Division, Oak Ridge National Lab, Oak Ridge, TN 37831 (United States)]. E-mail: tangf@ornl.gov; Meeks, H. [Ceracon Inc., 5150 Fairoaks Blvd. 01-330, Carmichael, CA 95628 (United States); Spowart, J.E. [UES Incorporated, AFRL/MLLM Building 655, 2230 Tenth St. Suite 1, Wright-Patterson AFB, OH 45433 (United States); Gnaeupel-Herold, T. [NIST Center for Neutron Research, 100 Bureau Dr. Stop 8562, Gaithersburg, MD 20899-8562 (United States); Prask, H. [NIST Center for Neutron Research, 100 Bureau Dr. Stop 8562, Gaithersburg, MD 20899-8562 (United States); Anderson, I.E. [Materials and Engineering Physics Program, Ames Laboratory, Iowa State University, Ames, IA 50011 (United States)

    2004-11-25

    In a simplified composite design, an unalloyed Al matrix was reinforced by spherical Al-Cu-Fe alloy particles (30 vol.%), using either commercial purity (99.7%) or high purity (99.99%) fine powders (diameter < 10 {mu}m). This composite material was consolidated by either vacuum hot pressing (VHP) or quasi-isostatic forging. The spatial distribution of reinforcement particles in both VHP and forged samples was shown to be almost the same by quantitative characterization with a multi-scale area fraction analysis technique. The tensile properties of all composite samples were tested and the forged materials showed significantly higher strength, while the elastic modulus values of all composite materials were close to the upper bound of theoretical predictions. Neutron diffraction measurements showed that there were high compressive residual stresses in the Al matrix of the forged samples and relatively low Al matrix residual stresses (predominantly compressive) in the VHP samples. By tensile tests and neutron diffraction measurements of the forged samples after annealing, it was shown that the high compressive residual stresses in the Al matrix were relieved and that tensile strength was also reduced to almost the same level as that of the VHP samples. Therefore, it was deduced that increased compressive residual stresses and enhanced dislocation densities in the forged composites raised the tensile strength to higher values than those of the VHP composites.

  5. Electric dipole moment function of the X1 Sigma/+/ state of CO - Vibration-rotation matrix elements for transitions of gas laser and astrophysical interest

    Science.gov (United States)

    Chackerian, C., Jr.

    1976-01-01

    The electric dipole moment function of the ground electronic state of carbon monoxide has been determined by combining numerical solutions of the radial Schrodinger equation with absolute intensity data of vibration-rotation bands. The derived dipole moment function is used to calculate matrix elements of interest to stellar astronomy and of importance in the carbon monoxide laser.

  6. The role of the tunneling matrix element and nuclear reorganization in the design of quantum-dot cellular automata molecules

    Science.gov (United States)

    Henry, Jackson; Blair, Enrique P.

    2018-02-01

    Mixed-valence molecules provide an implementation for a high-speed, energy-efficient paradigm for classical computing known as quantum-dot cellular automata (QCA). The primitive device in QCA is a cell, a structure with multiple quantum dots and a few mobile charges. A single mixed-valence molecule can function as a cell, with redox centers providing quantum dots. The charge configuration of a molecule encodes binary information, and device switching occurs via intramolecular electron transfer between dots. Arrays of molecular cells adsorbed onto a substrate form QCA logic. Individual cells in the array are coupled locally via the electrostatic electric field. This device networking enables general-purpose computing. Here, a quantum model of a two-dot molecule is built in which the two-state electronic system is coupled to the dominant nuclear vibrational mode via a reorganization energy. This model is used to explore the effects of the electronic inter-dot tunneling (coupling) matrix element and the reorganization energy on device switching. A semi-classical reduction of the model also is made to investigate the competition between field-driven device switching and the electron-vibrational self-trapping. A strong electron-vibrational coupling (high reorganization energy) gives rise to self-trapping, which inhibits the molecule's ability to switch. Nonetheless, there remains an expansive area in the tunneling-reorganization phase space where molecules can support adequate tunneling. Thus, the relationship between the tunneling matrix element and the reorganization energy affords significant leeway in the design of molecules viable for QCA applications.

  7. Assessment of the influence of anthropogenic factors on elements of the ecological network in Vojvodina (Serbia using the Leopold matrix

    Directory of Open Access Journals (Sweden)

    Kicošev Vesna

    2015-01-01

    Full Text Available Salt steppes and marshes represent the most valuable ecosystems in the world, providing numerous ecosystem services that are extremely vulnerable to anthropogenic influences. These types of habitat in the territory of Serbia are most dominant in Banat and a significant portion of them is under protection or in the process of becoming protected. The section surrounding the protected areas of Slano Kopovo Special Nature Reserve, Rusanda Nature Park and Okanj Bara Special Nature Reserve with the non-building area of Novi Bečej, Kumane, Melenci, Elemir and Taraš cadastral municipalities, has been chosen for the analysis. The aim of this paper was to assess the influence of specific anthropogenic factors on the elements of an ecological network using the analytical method that can generate the required results in a manner suitable for presentation to various stakeholders. To achieve this aim, the Leopold matrix model, used for assessing anthropogenic influence on the environment, has been chosen. The specificity of this issue of protecting and preserving elements of an ecological network resulted in the need to isolate and evaluate the factors affecting the preservation of habitats and functionality of ecosystems, unlike the concept of Leopold matrix, which treats all factors as equally important in the process of evaluation. Evaluation results indicate significant effects of historical, perennial manner of using the area and other resources in the non-building area.

  8. Evaluation of Jefferies' level population ratios, and generalization of Seaton's cascade matrix, by a Markov-chain method

    International Nuclear Information System (INIS)

    Kastner, S.O.

    1980-01-01

    Closed expressions are obtained for the conditional probabilities qsub(i)sub(j)sub(,)sub(k) required in evaluating particular ratios of atomic level populations, using a Markov-chain representation of the system of levels. The total transition probability between two arbitrary levels is also evaluated and its relation to population ratios is clarified. It is shown that Seaton's cascade matrix is a subset of the total transition probability matrix. (orig.)

  9. A direct derivation of the exact Fisther information matrix of Gaussian vector state space models

    NARCIS (Netherlands)

    Klein, A.A.B.; Neudecker, H.

    2000-01-01

    This paper deals with a direct derivation of Fisher's information matrix of vector state space models for the general case, by which is meant the establishment of the matrix as a whole and not element by element. The method to be used is matrix differentiation, see [4]. We assume the model to be

  10. Explicit Covariance Matrix for Particle Measurement Precision

    CERN Document Server

    Karimäki, Veikko

    1997-01-01

    We derive explicit and precise formulae for 3 by 3 error matrix of the particle transverse momentum, direction and impact parameter. The error matrix elements are expressed as functions of up to fourth order statistical moments of the measured coordinates. The formulae are valid for any curvature and track length in case of negligible multiple scattering.

  11. Subspace Learning via Local Probability Distribution for Hyperspectral Image Classification

    Directory of Open Access Journals (Sweden)

    Huiwu Luo

    2015-01-01

    Full Text Available The computational procedure of hyperspectral image (HSI is extremely complex, not only due to the high dimensional information, but also due to the highly correlated data structure. The need of effective processing and analyzing of HSI has met many difficulties. It has been evidenced that dimensionality reduction has been found to be a powerful tool for high dimensional data analysis. Local Fisher’s liner discriminant analysis (LFDA is an effective method to treat HSI processing. In this paper, a novel approach, called PD-LFDA, is proposed to overcome the weakness of LFDA. PD-LFDA emphasizes the probability distribution (PD in LFDA, where the maximum distance is replaced with local variance for the construction of weight matrix and the class prior probability is applied to compute the affinity matrix. The proposed approach increases the discriminant ability of the transformed features in low dimensional space. Experimental results on Indian Pines 1992 data indicate that the proposed approach significantly outperforms the traditional alternatives.

  12. Reliability enhancement of portal frame structure by finite element synthesis

    International Nuclear Information System (INIS)

    Nakagiri, S.

    1989-01-01

    The stochastic finite element methods have been applied to the evaluation of structural response and reliability of uncertain structural systems. The structural reliability index of the advanced first-order second moment (AFOSM) method is a candidate of the measure of assessing structural safety and reliability. The reliability index can be evaluated when a baseline design of structures under interest is proposed and the covariance matrix of the probabilistic variables is acquired to represent uncertainties involved in the structure systems. The reliability index thus evaluated is not assured the largest one for the structure. There is left a possibility to enhance the structural reliability for the given covariance matrix by changing the baseline design. From such a viewpoint of structural optimization, some ideas have been proposed to maximize the reliability or to minimize the failure probability of uncertain structural systems. A method of changing the design is proposed to increase the reliability index from its baseline value to another desired value. The reliability index in this paper is calculated mainly by the method of Lagrange multiplier

  13. The matrix effect in secondary ion mass spectrometry

    Science.gov (United States)

    Seah, M. P.; Shard, A. G.

    2018-05-01

    Matrix effects in the secondary ion mass spectrometry (SIMS) of selected elemental systems have been analyzed to investigate the applicability of a mathematical description of the matrix effect, called here the charge transfer (CT) model. This model was originally derived for proton exchange and organic positive secondary ions, to characterise the enhancement or suppression of intensities in organic binary systems. In the systems considered in this paper protons are specifically excluded, which enables an assessment of whether the model applies for electrons as well. The present importance is in organic systems but, here we analyse simpler inorganic systems. Matrix effects in elemental systems cannot involve proton transfer if there are no protons present but may be caused by electron transfer and so electron transfer may also be involved in the matrix effects for organic systems. There are general similarities in both the magnitudes of the ion intensities as well as the matrix effects for both positive and negative secondary ions in both systems and so the CT model may be more widely applicable. Published SIMS analyses of binary elemental mixtures are analyzed. The data of Kim et al., for the Pt/Co system, provide, with good precision, data for such a system. This gives evidence for the applicability of the CT model, where electron, rather than proton, transfer is the matrix enhancing and suppressing mechanism. The published data of Prudon et al., for the important Si/Ge system, provides further evidence for the effects for both positive and negative secondary ions and allows rudimentary rules to be developed for the enhancing and suppressing species.

  14. Fabrication technology of spherical fuel element for HTR-10

    International Nuclear Information System (INIS)

    He Jun; Zou Yanwen; Liang Tongxiang; Qiu Xueliang

    2002-01-01

    R and D on the fabrication technology of the spherical fuel elements for the 10 MW HTR Test Module (HTR-10) began from 1986. Cold quasi-isostatic molding with a silicon rubber die is used for manufacturing the spherical fuel elements.The fabrication technology and the graphite matrix materials were investigated and optimized. Twenty five batches of fuel elements, about 11000 of the fuel elements, have been produced. The cold properties of the graphite matrix materials satisfied the design specifications. The mean free uranium fraction of 25 batches was 5 x 10 -5

  15. Poisson statistics of PageRank probabilities of Twitter and Wikipedia networks

    Science.gov (United States)

    Frahm, Klaus M.; Shepelyansky, Dima L.

    2014-04-01

    We use the methods of quantum chaos and Random Matrix Theory for analysis of statistical fluctuations of PageRank probabilities in directed networks. In this approach the effective energy levels are given by a logarithm of PageRank probability at a given node. After the standard energy level unfolding procedure we establish that the nearest spacing distribution of PageRank probabilities is described by the Poisson law typical for integrable quantum systems. Our studies are done for the Twitter network and three networks of Wikipedia editions in English, French and German. We argue that due to absence of level repulsion the PageRank order of nearby nodes can be easily interchanged. The obtained Poisson law implies that the nearby PageRank probabilities fluctuate as random independent variables.

  16. Probability density functions for CP-violating rephasing invariants

    Science.gov (United States)

    Fortin, Jean-François; Giasson, Nicolas; Marleau, Luc

    2018-05-01

    The implications of the anarchy principle on CP violation in the lepton sector are investigated. A systematic method is introduced to compute the probability density functions for the CP-violating rephasing invariants of the PMNS matrix from the Haar measure relevant to the anarchy principle. Contrary to the CKM matrix which is hierarchical, it is shown that the Haar measure, and hence the anarchy principle, are very likely to lead to the observed PMNS matrix. Predictions on the CP-violating Dirac rephasing invariant |jD | and Majorana rephasing invariant |j1 | are also obtained. They correspond to 〈 |jD | 〉 Haar = π / 105 ≈ 0.030 and 〈 |j1 | 〉 Haar = 1 / (6 π) ≈ 0.053 respectively, in agreement with the experimental hint from T2K of | jDexp | ≈ 0.032 ± 0.005 (or ≈ 0.033 ± 0.003) for the normal (or inverted) hierarchy.

  17. Sufficient Statistics for Divergence and the Probability of Misclassification

    Science.gov (United States)

    Quirein, J.

    1972-01-01

    One particular aspect is considered of the feature selection problem which results from the transformation x=Bz, where B is a k by n matrix of rank k and k is or = to n. It is shown that in general, such a transformation results in a loss of information. In terms of the divergence, this is equivalent to the fact that the average divergence computed using the variable x is less than or equal to the average divergence computed using the variable z. A loss of information in terms of the probability of misclassification is shown to be equivalent to the fact that the probability of misclassification computed using variable x is greater than or equal to the probability of misclassification computed using variable z. First, the necessary facts relating k-dimensional and n-dimensional integrals are derived. Then the mentioned results about the divergence and probability of misclassification are derived. Finally it is shown that if no information is lost (in x = Bz) as measured by the divergence, then no information is lost as measured by the probability of misclassification.

  18. An Experiment on the Carbonization of Fuel Compact Matrix Graphite for HTGR

    International Nuclear Information System (INIS)

    Lee, Young Woo; Kim, Joo Hyoung; Cho, Moon Sung

    2012-01-01

    The fuel element for HTGR is manufactured by mixing coated fuel particles with matrix graphite powder and forming into either pebble type or cylindrical type compacts depending on their use in different HTGR cores. The coated fuel particle, the so-called TRISO particle, consists of 500-μm spherical UO 2 particles coated with the low density buffer Pyrolytic Carbon (PyC) layer, the inner and outer high density PyC layer and SiC layer sandwiched between the two inner and outer PyC layers. The coated TRISO particles are mixed with a properly prepared matrix graphite powder, pressed into a spherical shape or a cylindrical compact, and finally heat-treated at about 1800 .deg. C. These fuel elements can have different sizes and forms of compact. The basic steps for manufacturing a fuel element include preparation of graphite matrix powder, over coating the fuel particles, mixing the fuel particles with a matrix powder, carbonizing green compact, and the final high-temperature heat treatment of the carbonized fuel compact. The carbonization is a process step where the binder that is incorporated during the matrix graphite powder preparation step is evaporated and the residue of the binder is carbonized during the heat treatment at about 1073 K, In order to develop a fuel compact fabrication technology, and for fuel matrix graphite to meet the required material properties, it is of extreme importance to investigate the relationship among the process parameters of the matrix graphite powder preparation, fabrication parameters of fuel element green compact and the carbonization condition, which has a strong influence on further steps and the material properties of fuel element. In this work, the carbonization behavior of green compact samples prepared from the matrix graphite powder mixtures with different binder materials was investigated in order to elucidate the behavior of binders during the carbonization heat treatment by analyzing the change in weight, density and its

  19. Block fuel element for gas-cooled high temperature reactors

    International Nuclear Information System (INIS)

    Hrovat, M.F.

    1978-01-01

    The invention concerns a block fuel element consisting of only one carbon matrix which is almost isotropic of high crystallinity into which the coated particles are incorporated by a pressing process. This block element is produced under isostatic pressure from graphite matrix powder and coated particles in a rubber die and is subsequently subjected to heat treatment. The main component of the graphite matrix powder consists of natural graphite powder to which artificial graphite powder and a small amount of a phenol resin binding agent are added

  20. Random matrix theory of the energy-level statistics of disordered systems at the Anderson transition

    International Nuclear Information System (INIS)

    Canali, C.M.

    1995-09-01

    We consider a family of random matrix ensembles (RME) invariant under similarity transformations and described by the probability density P(H) exp[-TrV(H)]. Dyson's mean field theory (MFT) of the corresponding plasma model of eigenvalues is generalized to the case of weak confining potential, V(is an element of) ∼ A/2 ln 2 (is an element of). The eigenvalue statistics derived from MFT are shown to deviate substantially from the classical Wigner-Dyson statistics when A c approx. 0.4 the distribution function of the level spacings (LSDF) coincides in a large energy window with the energy LSDF of the three dimensional Anderson model at the metal-insulator transition. For the same A = A c , the RME eigenvalue-number variance is linear and its slope is equal to 0.32 ± 0.02, which is consistent with the value found for the Anderson model at the critical point. (author). 51 refs, 10 figs

  1. Finite Element Formulation for Stability and Free Vibration Analysis of Timoshenko Beam

    Directory of Open Access Journals (Sweden)

    Abbas Moallemi-Oreh

    2013-01-01

    Full Text Available A two-node element is suggested for analyzing the stability and free vibration of Timoshenko beam. Cubic displacement polynomial and quadratic rotational fields are selected for this element. Moreover, it is assumed that shear strain of the element has the constant value. Interpolation functions for displacement field and beam rotation are exactly calculated by employing total beam energy and its stationing to shear strain. By exploiting these interpolation functions, beam elements' stiffness matrix is also examined. Furthermore, geometric stiffness matrix and mass matrix of the proposed element are calculated by writing governing equation on stability and beam free vibration. At last, accuracy and efficiency of proposed element are evaluated through numerical tests. These tests show high accuracy of the element in analyzing beam stability and finding its critical load and free vibration analysis.

  2. Economic choices reveal probability distortion in macaque monkeys.

    Science.gov (United States)

    Stauffer, William R; Lak, Armin; Bossaerts, Peter; Schultz, Wolfram

    2015-02-18

    Economic choices are largely determined by two principal elements, reward value (utility) and probability. Although nonlinear utility functions have been acknowledged for centuries, nonlinear probability weighting (probability distortion) was only recently recognized as a ubiquitous aspect of real-world choice behavior. Even when outcome probabilities are known and acknowledged, human decision makers often overweight low probability outcomes and underweight high probability outcomes. Whereas recent studies measured utility functions and their corresponding neural correlates in monkeys, it is not known whether monkeys distort probability in a manner similar to humans. Therefore, we investigated economic choices in macaque monkeys for evidence of probability distortion. We trained two monkeys to predict reward from probabilistic gambles with constant outcome values (0.5 ml or nothing). The probability of winning was conveyed using explicit visual cues (sector stimuli). Choices between the gambles revealed that the monkeys used the explicit probability information to make meaningful decisions. Using these cues, we measured probability distortion from choices between the gambles and safe rewards. Parametric modeling of the choices revealed classic probability weighting functions with inverted-S shape. Therefore, the animals overweighted low probability rewards and underweighted high probability rewards. Empirical investigation of the behavior verified that the choices were best explained by a combination of nonlinear value and nonlinear probability distortion. Together, these results suggest that probability distortion may reflect evolutionarily preserved neuronal processing. Copyright © 2015 Stauffer et al.

  3. Finite element formulation of fluctuating hydrodynamics for fluids filled with rigid particles using boundary fitted meshes

    Energy Technology Data Exchange (ETDEWEB)

    De Corato, M., E-mail: marco.decorato@unina.it [Dipartimento di Ingegneria Chimica, dei Materiali e della Produzione Industriale, Università di Napoli Federico II, Piazzale Tecchio 80, 80125 Napoli (Italy); Slot, J.J.M., E-mail: j.j.m.slot@tue.nl [Department of Mathematics and Computer Science, Eindhoven University of Technology, PO Box 513, 5600 MB Eindhoven (Netherlands); Hütter, M., E-mail: m.huetter@tue.nl [Department of Mechanical Engineering, Eindhoven University of Technology, PO Box 513, 5600 MB Eindhoven (Netherlands); D' Avino, G., E-mail: gadavino@unina.it [Dipartimento di Ingegneria Chimica, dei Materiali e della Produzione Industriale, Università di Napoli Federico II, Piazzale Tecchio 80, 80125 Napoli (Italy); Maffettone, P.L., E-mail: pierluca.maffettone@unina.it [Dipartimento di Ingegneria Chimica, dei Materiali e della Produzione Industriale, Università di Napoli Federico II, Piazzale Tecchio 80, 80125 Napoli (Italy); Hulsen, M.A., E-mail: m.a.hulsen@tue.nl [Department of Mechanical Engineering, Eindhoven University of Technology, PO Box 513, 5600 MB Eindhoven (Netherlands)

    2016-07-01

    In this paper, we present a finite element implementation of fluctuating hydrodynamics with a moving boundary fitted mesh for treating the suspended particles. The thermal fluctuations are incorporated into the continuum equations using the Landau and Lifshitz approach [1]. The proposed implementation fulfills the fluctuation–dissipation theorem exactly at the discrete level. Since we restrict the equations to the creeping flow case, this takes the form of a relation between the diffusion coefficient matrix and friction matrix both at the particle and nodal level of the finite elements. Brownian motion of arbitrarily shaped particles in complex confinements can be considered within the present formulation. A multi-step time integration scheme is developed to correctly capture the drift term required in the stochastic differential equation (SDE) describing the evolution of the positions of the particles. The proposed approach is validated by simulating the Brownian motion of a sphere between two parallel plates and the motion of a spherical particle in a cylindrical cavity. The time integration algorithm and the fluctuating hydrodynamics implementation are then applied to study the diffusion and the equilibrium probability distribution of a confined circle under an external harmonic potential.

  4. Trace elemental analysis of Indian natural moonstone gems by PIXE and XRD techniques.

    Science.gov (United States)

    Venkateswara Rao, R; Venkateswarulu, P; Kasipathi, C; Sivajyothi, S

    2013-12-01

    A selected number of Indian Eastern Ghats natural moonstone gems were studied with a powerful nuclear analytical and non-destructive Proton Induced X-ray Emission (PIXE) technique. Thirteen elements, including V, Co, Ni, Zn, Ga, Ba and Pb, were identified in these moonstones and may be useful in interpreting the various geochemical conditions and the probable cause of their inceptions in the moonstone gemstone matrix. Furthermore, preliminary XRD studies of different moonstone patterns were performed. The PIXE technique is a powerful method for quickly determining the elemental concentration of a substance. A 3MeV proton beam was employed to excite the samples. The chemical constituents of moonstones from parts of the Eastern Ghats geological formations of Andhra Pradesh, India were determined, and gemological studies were performed on those gems. The crystal structure and the lattice parameters of the moonstones were estimated using X-Ray Diffraction studies, trace and minor elements were determined using the PIXE technique, and major compositional elements were confirmed by XRD. In the present work, the usefulness and versatility of the PIXE technique for research in geo-scientific methodology is established. © 2013 Elsevier Ltd. All rights reserved.

  5. Matrix Encryption Scheme

    Directory of Open Access Journals (Sweden)

    Abdelhakim Chillali

    2017-05-01

    Full Text Available In classical cryptography, the Hill cipher is a polygraphic substitution cipher based on linear algebra. In this work, we proposed a new problem applicable to the public key cryptography, based on the Matrices, called “Matrix discrete logarithm problem”, it uses certain elements formed by matrices whose coefficients are elements in a finite field. We have constructed an abelian group and, for the cryptographic part in this unreliable group, we then perform the computation corresponding to the algebraic equations, Returning the encrypted result to a receiver. Upon receipt of the result, the receiver can retrieve the sender’s clear message by performing the inverse calculation.

  6. Study of K/sup -/p. -->. anti K*(890)n at 13GeV. [Differential cross sections, density matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Brandenburg, G W; Dunwoodie, W M; Lasinski, T A; Leith, D W.G.S.; Williams, S H [Stanford Linear Accelerator Center, Calif. (USA); Carnegie, R K [Carleton Univ., Ottawa, Ontario (Canada). Dept. of Physics; Cashmore, R J [Oxford Univ. (UK). Dept. of Physics; Davier, M [Lab. de l' Accelerateur Lineaire, Orsay, France; Matthews, J A.J. [Michigan State Univ., East Lansing (USA). Dept. of Physics; Walden, P [British Columbia Univ., Vancouver (Canada). TRIUMF Facility

    1975-11-24

    The results of a wire chamber spectrometer experiment studying anti K*(890) production in the reaction K/sup -/p..-->..K/sup -/..pi../sup +/n at 13 GeV are presented. Strong forward structure is observed for mod(t)matrix elements and differential cross section. These features are similar to those observed in ..pi../sup -/p..-->..rho/sup 0/n data and are characteristic of ..pi.. exchange. In contrast in the intermediate, mod(t)approximately 0.2 GeV/sup 2/, and large momentum transfer regions anti K*(890) production is dominated by the natural parity rho-A/sub 2/ exchange contribution.

  7. Non-Hermitian Extensions of Wishart Random Matrix Ensembles

    International Nuclear Information System (INIS)

    Akemann, G.

    2011-01-01

    We briefly review the solution of three ensembles of non-Hermitian random matrices generalizing the Wishart-Laguerre (also called chiral) ensembles. These generalizations are realized as Gaussian two-matrix models, where the complex eigenvalues of the product of the two independent rectangular matrices are sought, with the matrix elements of both matrices being either real, complex or quaternion real. We also present the more general case depending on a non-Hermiticity parameter, that allows us to interpolate between the corresponding three Hermitian Wishart ensembles with real eigenvalues and the maximally non-Hermitian case. All three symmetry classes are explicitly solved for finite matrix size N x M for all complex eigenvalue correlations functions (and real or mixed correlations for real matrix elements). These are given in terms of the corresponding kernels built from orthogonal or skew-orthogonal Laguerre polynomials in the complex plane. We then present the corresponding three Bessel kernels in the complex plane in the microscopic large-N scaling limit at the origin, both at weak and strong non-Hermiticity with M - N ≥ 0 fixed. (author)

  8. Matrix Analytic Methods in Applied Probability with a View towards Engineering Applications

    DEFF Research Database (Denmark)

    Nielsen, Bo Friis

    contributions and a summary introductory paper. The outline of the summary is as follows. The class of MAPs and the related class of Phase Type (PH) distributions belong to the slightly larger classes of what have been termed Rational Arrival Processes (RAP) and Matrix Exponential (ME) distributions......-trivial mathematical and theoretical questions. If just some of these problems can be solved satisfactorily it will pave the way for a huge application potential, and it is very likely that the distributions can and will be useful in statistical analysis too. The research on multivariate distributions lead...

  9. The massive 3-loop operator matrix elements with two masses and the generalized variable flavor number scheme

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, J.; Schneider, C. [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation (RISC); Bluemlein, J.; Freitas, A. de; Schoenwald, K. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Goedicke, A. [Karlsruher Institut fuer Technologie (KIT), Karlsruhe (Germany). Inst. fuer Theoretische Teilchenphysik; Wissbrock, F. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation (RISC)

    2017-12-15

    We report on our latest results in the calculation of the two-mass contributions to 3-loop operator matrix elements (OMEs). These OMEs are needed to compute the corresponding contributions to the deep-inelastic scattering structure functions and to generalize the variable flavor number scheme by including both charm and bottom quarks. We present the results for the non-singlet and A{sub gq,Q} OMEs, and compare the size of their contribution relative to the single mass case. Results for the gluonic OME A{sub gg,Q} are given in the physical case, going beyond those presented in a previous publication where scalar diagrams were computed. We also discuss our recently published two-mass contribution to the pure singlet OME, and present an alternative method of calculating the corresponding diagrams.

  10. Efficient computation method of Jacobian matrix

    International Nuclear Information System (INIS)

    Sasaki, Shinobu

    1995-05-01

    As well known, the elements of the Jacobian matrix are complex trigonometric functions of the joint angles, resulting in a matrix of staggering complexity when we write it all out in one place. This article addresses that difficulties to this subject are overcome by using velocity representation. The main point is that its recursive algorithm and computer algebra technologies allow us to derive analytical formulation with no human intervention. Particularly, it is to be noted that as compared to previous results the elements are extremely simplified throughout the effective use of frame transformations. Furthermore, in case of a spherical wrist, it is shown that the present approach is computationally most efficient. Due to such advantages, the proposed method is useful in studying kinematically peculiar properties such as singularity problems. (author)

  11. Modeling cometary photopolarimetric characteristics with Sh-matrix method

    Science.gov (United States)

    Kolokolova, L.; Petrov, D.

    2017-12-01

    Cometary dust is dominated by particles of complex shape and structure, which are often considered as fractal aggregates. Rigorous modeling of light scattering by such particles, even using parallelized codes and NASA supercomputer resources, is very computer time and memory consuming. We are presenting a new approach to modeling cometary dust that is based on the Sh-matrix technique (e.g., Petrov et al., JQSRT, 112, 2012). This method is based on the T-matrix technique (e.g., Mishchenko et al., JQSRT, 55, 1996) and was developed after it had been found that the shape-dependent factors could be separated from the size- and refractive-index-dependent factors and presented as a shape matrix, or Sh-matrix. Size and refractive index dependences are incorporated through analytical operations on the Sh-matrix to produce the elements of T-matrix. Sh-matrix method keeps all advantages of the T-matrix method, including analytical averaging over particle orientation. Moreover, the surface integrals describing the Sh-matrix elements themselves can be solvable analytically for particles of any shape. This makes Sh-matrix approach an effective technique to simulate light scattering by particles of complex shape and surface structure. In this paper, we present cometary dust as an ensemble of Gaussian random particles. The shape of these particles is described by a log-normal distribution of their radius length and direction (Muinonen, EMP, 72, 1996). Changing one of the parameters of this distribution, the correlation angle, from 0 to 90 deg., we can model a variety of particles from spheres to particles of a random complex shape. We survey the angular and spectral dependencies of intensity and polarization resulted from light scattering by such particles, studying how they depend on the particle shape, size, and composition (including porous particles to simulate aggregates) to find the best fit to the cometary observations.

  12. Probability Modeling and Thinking: What Can We Learn from Practice?

    Science.gov (United States)

    Pfannkuch, Maxine; Budgett, Stephanie; Fewster, Rachel; Fitch, Marie; Pattenwise, Simeon; Wild, Chris; Ziedins, Ilze

    2016-01-01

    Because new learning technologies are enabling students to build and explore probability models, we believe that there is a need to determine the big enduring ideas that underpin probabilistic thinking and modeling. By uncovering the elements of the thinking modes of expert users of probability models we aim to provide a base for the setting of…

  13. Contribution to the neutronic theory of random stacks (diffusion coefficient and first-flight collision probabilities) with a general theorem on collision probabilities

    International Nuclear Information System (INIS)

    Dixmier, Marc.

    1980-10-01

    A general expression of the diffusion coefficient (d.c.) of neutrons was given, with stress being put on symmetries. A system of first-flight collision probabilities for the case of a random stack of any number of types of one- and two-zoned spherical pebbles, with an albedo at the frontiers of the elements or (either) consideration of the interstital medium, was built; to that end, the bases of collision probability theory were reviewed, and a wide generalisation of the reciprocity theorem for those probabilities was demonstrated. The migration area of neutrons was expressed for any random stack of convex, 'simple' and 'regular-contact' elements, taking into account the correlations between free-paths; the average cosinus of re-emission of neutrons by an element, in the case of a homogeneous spherical pebble and the transport approximation, was expressed; the superiority of the so-found result over Behrens' theory, for the type of media under consideration, was established. The 'fine structure current term' of the d.c. was also expressed, and it was shown that its 'polarisation term' is negligible. Numerical applications showed that the global heterogeneity effect on the d.c. of pebble-bed reactors is comparable with that for Graphite-moderated, Carbon gas-cooled, natural Uranium reactors. The code CARACOLE, which integrates all the results here obtained, was introduced [fr

  14. Finite-element time evolution operator for the anharmonic oscillator

    Science.gov (United States)

    Milton, Kimball A.

    1995-01-01

    The finite-element approach to lattice field theory is both highly accurate (relative errors approximately 1/N(exp 2), where N is the number of lattice points) and exactly unitary (in the sense that canonical commutation relations are exactly preserved at the lattice sites). In this talk I construct matrix elements for dynamical variables and for the time evolution operator for the anharmonic oscillator, for which the continuum Hamiltonian is H = p(exp 2)/2 + lambda q(exp 4)/4. Construction of such matrix elements does not require solving the implicit equations of motion. Low order approximations turn out to be extremely accurate. For example, the matrix element of the time evolution operator in the harmonic oscillator ground state gives a results for the anharmonic oscillator ground state energy accurate to better than 1 percent, while a two-state approximation reduces the error to less than 0.1 percent.

  15. Matrix effects for calcium and potassium K-X-rays, in fenugreek plants grown in iron rich soils

    International Nuclear Information System (INIS)

    Deep, Kanan; Rao, Preeti; Bansal, Himani; Mittal, Raj

    2014-01-01

    The present work comprises the matrix effects study of the plant system (plant and soil) for macronutrients Ca and K with elevated levels of iron in the soil. The earlier derived matrix effect terms from fundamental relations of intensities of analyte and substrate elements with basic atomic and experimental setup parameters had led to iterative determination of enhanced elements rather than avoiding their enhancement. The relations also facilitated the evaluations of absorption for close Z interfering constituents (like Ca and K) in samples of a lot of particular category with interpolation of matrix terms with elemental amounts. The process has already been employed successfully for potato, radish, rice and maize plants. On similar lines, the observed prominent change in interpolation parameters for the plants in the present experiment serves as a tool to check the toxicity/contamination of the growing medium. - Highlights: • Matrix effects for Ca and K in Fenugreek plant and its soil with elevated iron level. • Fenugreek plants grown in iron rich soil and treated with K/Ca fertilizers. • The matrix terms correlated to analyte and enhancer element amounts. • Interpolation of matrix terms with elemental amounts points to Fe toxicity of soil

  16. Constraints on parity-mixing matrix elements from hard-pion exchange corrections to first-forbidden beta decays

    International Nuclear Information System (INIS)

    Kirchbach, M.

    1986-01-01

    In this paper the experience in extracting the value of the weak pion-nucleon coupling constant f/sub π//sup l/ from the parity-mixing matrix element + , T = 1; 1.042 MeV | V/sub PNC/ | O - , T = 0; 1.081 MeV> in 18 F is summarized with the aim to reveal some sources of uncertainties of the models exploited. We show that beyond of the long wavelenth approximation and in treating non-soft pion corrections to the two-body nuclear chiral charge density an upper bound for f/sub π//sup l/ is obtained which is about two times smaller as compared to results of previous analyses of similar character. Finally, we accentuate on the importance of the heavy-meson exchanges in the weak NN-potential for understanding recent measurement results of f/sub π//sup l/ which strongly deviate from earlier data. (author)

  17. Bivariate- distribution for transition matrix elements in Breit-Wigner to Gaussian domains of interacting particle systems.

    Science.gov (United States)

    Kota, V K B; Chavda, N D; Sahu, R

    2006-04-01

    Interacting many-particle systems with a mean-field one-body part plus a chaos generating random two-body interaction having strength lambda exhibit Poisson to Gaussian orthogonal ensemble and Breit-Wigner (BW) to Gaussian transitions in level fluctuations and strength functions with transition points marked by lambda = lambda c and lambda = lambda F, respectively; lambda F > lambda c. For these systems a theory for the matrix elements of one-body transition operators is available, as valid in the Gaussian domain, with lambda > lambda F, in terms of orbital occupation numbers, level densities, and an integral involving a bivariate Gaussian in the initial and final energies. Here we show that, using a bivariate-t distribution, the theory extends below from the Gaussian regime to the BW regime up to lambda = lambda c. This is well tested in numerical calculations for 6 spinless fermions in 12 single-particle states.

  18. General factorization relations and consistency conditions in the sudden approximation via infinite matrix inversion

    International Nuclear Information System (INIS)

    Chan, C.K.; Hoffman, D.K.; Evans, J.W.

    1985-01-01

    Local, i.e., multiplicative, operators satisfy well-known linear factorization relations wherein matrix elements (between states associated with a complete set of wave functions) can be obtained as a linear combination of those out of the ground state (the input data). Analytic derivation of factorization relations for general state input data results in singular integral expressions for the coefficients, which can, however, be regularized using consistency conditions between matrix elements out of a single (nonground) state. Similar results hold for suitable ''symmetry class'' averaged matrix elements where the symmetry class projection operators are ''complete.'' In several cases where the wave functions or projection operators incorporate orthogonal polynomial dependence, we show that the ground state factorization relations have a simplified structure allowing an alternative derivation of the general factorization relations via an infinite matrix inversion procedure. This form is shown to have some advantages over previous versions. In addition, this matrix inversion procedure obtains all consistency conditions (which is not always the case from regularization of singular integrals)

  19. Collective probabilities algorithm for surface hopping calculations

    International Nuclear Information System (INIS)

    Bastida, Adolfo; Cruz, Carlos; Zuniga, Jose; Requena, Alberto

    2003-01-01

    General equations that transition probabilities of the hopping algorithms in surface hopping calculations must obey to assure the equality between the average quantum and classical populations are derived. These equations are solved for two particular cases. In the first it is assumed that probabilities are the same for all trajectories and that the number of hops is kept to a minimum. These assumptions specify the collective probabilities (CP) algorithm, for which the transition probabilities depend on the average populations for all trajectories. In the second case, the probabilities for each trajectory are supposed to be completely independent of the results from the other trajectories. There is, then, a unique solution of the general equations assuring that the transition probabilities are equal to the quantum population of the target state, which is referred to as the independent probabilities (IP) algorithm. The fewest switches (FS) algorithm developed by Tully is accordingly understood as an approximate hopping algorithm which takes elements from the accurate CP and IP solutions. A numerical test of all these hopping algorithms is carried out for a one-dimensional two-state problem with two avoiding crossings which shows the accuracy and computational efficiency of the collective probabilities algorithm proposed, the limitations of the FS algorithm and the similarity between the results offered by the IP algorithm and those obtained with the Ehrenfest method

  20. Direct determination of scattering time delays using the R-matrix propagation method

    International Nuclear Information System (INIS)

    Walker, R.B.; Hayes, E.F.

    1989-01-01

    A direct method for determining time delays for scattering processes is developed using the R-matrix propagation method. The procedure involves the simultaneous generation of the global R matrix and its energy derivative. The necessary expressions to obtain the energy derivative of the S matrix are relatively simple and involve many of the same matrix elements required for the R-matrix propagation method. This method is applied to a simple model for a chemical reaction that displays sharp resonance features. The test results of the direct method are shown to be in excellent agreement with the traditional numerical differentiation method for scattering energies near the resonance energy. However, for sharp resonances the numerical differentiation method requires calculation of the S-matrix elements at many closely spaced energies. Since the direct method presented here involves calculations at only a single energy, one is able to generate accurate energy derivatives and time delays much more efficiently and reliably

  1. Algebraic manipulation of the states associated with the U(5)containsO(5)containsO(3) chain of groups: Orthonormalization and matrix elements

    International Nuclear Information System (INIS)

    Yannouleas, C.; Pacheco, J.M.

    1989-01-01

    A collection of procedures able to perform algebraic manipulations for the orthonormalization and for the calculation of matrix elements between the states associated with the U(5)containsO(5)containsO(3) chain of groups is presented. These procedures combine both the exact- and the bigfloat-arithmetic modes and thus return arbitrarily accurate results; this is particulary relevant to the Gram-Schmidt orthonormalization, where strong cancellations usually pose serious problems in all floating-point implementations. (orig.)

  2. The O(α{sub s}{sup 3}T{sub F}{sup 2}) contributions to the gluonic operator matrix element

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, J. [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstraße 69, A-4040, Linz (Austria); Blümlein, J.; De Freitas, A. [Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Hasselhuhn, A. [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstraße 69, A-4040, Linz (Austria); Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Manteuffel, A. von [PRISMA Cluster of Excellence, Institute of Physics, J. Gutenberg University, D-55099 Mainz (Germany); Round, M. [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstraße 69, A-4040, Linz (Austria); Deutsches Elektronen-Synchrotron, DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Schneider, C. [Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstraße 69, A-4040, Linz (Austria)

    2014-08-15

    The O(α{sub s}{sup 3}T{sub F}{sup 2}C{sub F}(C{sub A})) contributions to the transition matrix element A{sub gg,Q} relevant for the variable flavor number scheme at 3-loop order are calculated. The corresponding graphs contain two massive fermion lines of equal mass leading to terms given by inverse binomially weighted sums beyond the usual harmonic sums. In x-space two root-valued letters contribute in the iterated integrals in addition to those forming the harmonic polylogarithms. We outline technical details needed in the calculation of graphs of this type, which are as well of importance in the case of two different internal massive lines.

  3. Decomposition of conditional probability for high-order symbolic Markov chains

    Science.gov (United States)

    Melnik, S. S.; Usatenko, O. V.

    2017-07-01

    The main goal of this paper is to develop an estimate for the conditional probability function of random stationary ergodic symbolic sequences with elements belonging to a finite alphabet. We elaborate on a decomposition procedure for the conditional probability function of sequences considered to be high-order Markov chains. We represent the conditional probability function as the sum of multilinear memory function monomials of different orders (from zero up to the chain order). This allows us to introduce a family of Markov chain models and to construct artificial sequences via a method of successive iterations, taking into account at each step increasingly high correlations among random elements. At weak correlations, the memory functions are uniquely expressed in terms of the high-order symbolic correlation functions. The proposed method fills the gap between two approaches, namely the likelihood estimation and the additive Markov chains. The obtained results may have applications for sequential approximation of artificial neural network training.

  4. A Measurement of the Top Quark Mass with the D0 Detector at s**(1/2) = 1.96-TeV using the Matrix Element Method

    Energy Technology Data Exchange (ETDEWEB)

    Kroeninger, Kevin Alexander; /Bonn U.

    2004-04-01

    Using a data set of 158 and 169 pb{sup -1} of D0 Run-II data in the electron and muon plus jets channel, respectively, the top quark mass has been measured using the Matrix Element Method. The method and its implementation are described. Its performance is studied in Monte Carlo using ensemble tests and the method is applied to the Moriond 2004 data set.

  5. The extracellular matrix - the under-recognized element in lung disease?

    NARCIS (Netherlands)

    Burgess, Janette K.; Mauad, Thais; Tjin, Gavin; Karlsson, Jenny C.; Westergren-Thorsson, Gunilla

    2016-01-01

    The lung is composed of airways and lung parenchyma, and the extracellular matrix (ECM) contains the main building blocks of both components. The ECM provides physical support and stability to the lung, and as such it has in the past been regarded as an inert structure. More recent research has

  6. Investigations on the use of pneumatic cross-flow nebulizers with dual solution loading including the correction of matrix effects in elemental determinations by inductively coupled plasma optical emission spectrometry

    International Nuclear Information System (INIS)

    Bauer, Mathieu; Broekaert, Jose A.C.

    2007-01-01

    The use of a so-called trihedral and a T-shaped cross-flow pneumatic nebulizer with dual solution loading for inductively coupled plasma optical emission spectrometry has been studied. By these devices analyte clouds from two solutions can be mixed during the aerosol generation step. For both nebulizers the correction of matrix effects using internal standardization and standard addition calibration in an on-line way was investigated and compared to elemental determinations using a conventional cross-flow nebulizer and calibration with synthetic standard solutions without matrix matching. A significant improvement of accuracy, both for calibration with internal standardization and standard addition, was obtained in the case of four synthetic solutions containing each 40 mmol L -1 Na, K, Rb and Ba as matrix elements and 300 μg L -1 Cd, Co, Cr, Cu, Fe, Mn, Ni and Pb as analytes. Calibration by standard addition in the case of dual solution loading has been shown to be very useful in the determination of elements at minor and trace levels in steel and alumina reference materials. The results of analysis for minor concentrations of Cr, Cu and Ni in steel as well as for Ca, Fe, Ga, Li, Mg, Mn, Na, Si and Zn in alumina powder certified reference materials subsequent to sample dissolution were found to be in good agreement with the certificates. Limits of detection were found to be only slightly above those for a conventional cross-flow nebulizer and a precision better than 3% was realized with both novel nebulizers

  7. ICP Mass and Optical Emission Spectrometry of Ore Samples Containing Rare Earth Elements

    International Nuclear Information System (INIS)

    Mohammed, A.E.W.M.

    2013-01-01

    Inductively Coupled Plasma Optical Emission and Mass Spectrometry (ICP-OES and ICPMS) are widely accepted as a rapid and sensitive techniques for Rare Earth Elements (REEs) analysis of geological samples. However, the achievable accuracy of these techniques are seriously limited by the problem of matrix interferences. In this study, matrix effects in ICP-AES were addressed using two approaches. In the first approach, the mechanisms of matrix interferences and analyte excitation were elucidated fundamentally. First, matrix effects from a comprehensive list of thirty-nine elements were investigated. It was confirmed that matrix elements with low second (instead of the widely reported first) ionization potentials (IP) produce a stronger matrix effect in all cases. Another critical parameter defining the severity of the matrix effect was found to be the availability of low-lying energy levels in the doubly charged matrix ion. Penning ionization followed by ion electron recombination through successive cycles is proposed as the mechanism for the more severe matrix effects caused by low second-IP matrices. In the second approach ICP-OES and ICP-MS are applied in this study for the analysis of Rare Earth Elements of two selected standard reference samples namely AGV-2 and BCR-2 beside a fluorspar geological sample (G-9 sample). Effective procedures are developed to avoid the spectral interference from matrix elements by using ion exchange resin Amberlite IR-120 before determination of REEs using ICP-OES and ICPMS. The potential of the method is evaluated by analysis of Certified Reference Materials (AGV-2 and BCR-2). Results obtained by ICP-MS show that experimental data are in agreement with the certified values and their values could be used as a quantitative data. The results obtained using ICP-OES were compared and discussed.

  8. Correlation between eigenvalues and sorted diagonal matrix elements of a large dimensional matrix

    International Nuclear Information System (INIS)

    Arima, A.

    2008-01-01

    Functional dependences of eigenvalues as functions of sorted diagonal elements are given for realistic nuclear shell model (NSM) hamiltonian, the uniform distribution hamiltonian and the GOE hamiltonian. In the NSM case, the dependence is found to be linear. We discuss extrapolation methods for more accurate predictions for low-lying states. (author)

  9. A matrix contraction process

    Science.gov (United States)

    Wilkinson, Michael; Grant, John

    2018-03-01

    We consider a stochastic process in which independent identically distributed random matrices are multiplied and where the Lyapunov exponent of the product is positive. We continue multiplying the random matrices as long as the norm, ɛ, of the product is less than unity. If the norm is greater than unity we reset the matrix to a multiple of the identity and then continue the multiplication. We address the problem of determining the probability density function of the norm, \

  10. Marine wind data presentation using wind transition matrix

    Digital Repository Service at National Institute of Oceanography (India)

    Mascarenhas, A.J.; Gouveia, A.D.; Desai, R.G.P.

    One of the methods to simulate the random wind behaviour through time is to use historical wind data presented in the form of wind transition matrix. Here it is assumed that, the probability that the wind will shift from one direction to another...

  11. High power X-ray welding of metal-matrix composites

    Energy Technology Data Exchange (ETDEWEB)

    Rosenberg, Richard A.; Goeppner, George A.; Noonan, John R.; Farrell, William J.; Ma, Qing

    1997-12-01

    A method for joining metal-matrix composites (MMCs) by using high power x-rays as a volumetric heat source is provided. The method involves directing an x-ray to the weld line between two adjacent MMCs materials to create an irradiated region or melt zone. The x-rays have a power density greater than about 10{sup 4} watts/cm{sup 2} and provide the volumetric heat required to join the MMC materials. Importantly, the reinforcing material of the metal-matrix composites remains uniformly distributed in the melt zone, and the strength of the MMCs are not diminished. In an alternate embodiment, high power x-rays are used to provide the volumetric heat required to weld metal elements, including metal elements comprised of metal alloys. In an alternate embodiment, high power x-rays are used to provide the volumetric heat required to weld metal elements, including metal elements comprised of metal alloys.

  12. Matrix elements of hyperfine structure operators in the SL and jj representations for the s, pN, and dN configurations and the SL-jj transformation

    International Nuclear Information System (INIS)

    Childs, W.J.

    1997-01-01

    Matrix elements of the hyperfine operators corresponding to the magnetic-dipole (A) and electric-quadrupole (B) hyperfine structures constants are given as linear combinations of the appropriate radial integrals for all states of the s, p N , and d N configurations in both the SL and pure jj representations. The associated SL-jj transformations are also given. 13 refs., 10 tabs

  13. Matrix kernels for MEG and EEG source localization and imaging

    International Nuclear Information System (INIS)

    Mosher, J.C.; Lewis, P.S.; Leahy, R.M.

    1994-01-01

    The most widely used model for electroencephalography (EEG) and magnetoencephalography (MEG) assumes a quasi-static approximation of Maxwell's equations and a piecewise homogeneous conductor model. Both models contain an incremental field element that linearly relates an incremental source element (current dipole) to the field or voltage at a distant point. The explicit form of the field element is dependent on the head modeling assumptions and sensor configuration. Proper characterization of this incremental element is crucial to the inverse problem. The field element can be partitioned into the product of a vector dependent on sensor characteristics and a matrix kernel dependent only on head modeling assumptions. We present here the matrix kernels for the general boundary element model (BEM) and for MEG spherical models. We show how these kernels are easily interchanged in a linear algebraic framework that includes sensor specifics such as orientation and gradiometer configuration. We then describe how this kernel is easily applied to ''gain'' or ''transfer'' matrices used in multiple dipole and source imaging models

  14. Wavelet analysis of biological tissue's Mueller-matrix images

    Science.gov (United States)

    Tomka, Yu. Ya.

    2008-05-01

    The interrelations between statistics of the 1st-4th orders of the ensemble of Mueller-matrix images and geometric structure of birefringent architectonic nets of different morphological structure have been analyzed. The sensitivity of asymmetry and excess of statistic distributions of matrix elements Cik to changing of orientation structure of optically anisotropic protein fibrils of physiologically normal and pathologically changed biological tissues architectonics has been shown.

  15. Fast Output-sensitive Matrix Multiplication

    DEFF Research Database (Denmark)

    Jacob, Riko; Stöckel, Morten

    2015-01-01

    We consider the problem of multiplying two $U \\times U$ matrices $A$ and $C$ of elements from a field $\\F$. We present a new randomized algorithm that can use the known fast square matrix multiplication algorithms to perform fewer arithmetic operations than the current state of the art for output...

  16. Minimal solution of linear formed fuzzy matrix equations

    Directory of Open Access Journals (Sweden)

    Maryam Mosleh

    2012-10-01

    Full Text Available In this paper according to the structured element method, the $mimes n$ inconsistent fuzzy matrix equation $Ailde{X}=ilde{B},$ which are linear formed by fuzzy structured element, is investigated. The necessary and sufficient condition for the existence of a fuzzy solution is also discussed. some examples are presented to illustrate the proposed method.

  17. Probable role of trace elements of some medicinal plants in cardio-vascular diseases

    International Nuclear Information System (INIS)

    Siddiqui, H.A.; Kan, H.A.; Khan, S.U.; Hamdard, M.E.

    1990-01-01

    A number of herbal drugs are used in the Unani (Greco-Arab) System of Medicine for cardiovascular diseases. The herbs were analyzed by flame AAS and ICP-AES to determine if their therapeutic actions can be associated with the elements present in them. Cadmium, cobalt, chromium, copper, iron, potassium, magnesium, manganese, sodium, nickel, phosphorus, lead and zinc were some of the elements which play various roles in cardiovascular affections. An effort was made to correlate the role of these elements in cardiac diseases. (Auth.). 2 tabs., 32 refs

  18. Probable role of trace elements of some medicinal plants in cardio-vascular diseases

    Energy Technology Data Exchange (ETDEWEB)

    Siddiqui, H A; Kan, H A; Khan, S U; Hamdard, M E

    1990-01-01

    A number of herbal drugs are used in the Unani (Greco-Arab) System of Medicine for cardiovascular diseases. The herbs were analyzed by flame AAS and ICP-AES to determine if their therapeutic actions can be associated with the elements present in them. Cadmium, cobalt, chromium, copper, iron, potassium, magnesium, manganese, sodium, nickel, phosphorus, lead and zinc were some of the elements which play various roles in cardiovascular affections. An effort was made to correlate the role of these elements in cardiac diseases. (Auth.). 2 tabs., 32 refs.

  19. Fibre-matrix bond strength studies of glass, ceramic, and metal matrix composites

    Science.gov (United States)

    Grande, D. H.; Mandell, J. F.; Hong, K. C. C.

    1988-01-01

    An indentation test technique for compressively loading the ends of individual fibers to produce debonding has been applied to metal, glass, and glass-ceramic matrix composites; bond strength values at debond initiation are calculated using a finite-element model. Results are correlated with composite longitudinal and interlaminar shear behavior for carbon and Nicalon fiber-reinforced glasses and glass-ceramics including the effects of matrix modifications, processing conditions, and high-temperature oxidation embrittlement. The data indicate that significant bonding to improve off-axis and shear properties can be tolerated before the longitudinal behavior becomes brittle. Residual stress and other mechanical bonding effects are important, but improved analyses and multiaxial interfacial failure criteria are needed to adequately interpret bond strength data in terms of composite performance.

  20. The correlation matrix of Higgs rates at the LHC

    CERN Document Server

    Arbey, Alexandre; Mahmoudi, Farvah; Moreau, Grégory

    2016-11-17

    The imperfect knowledge of the Higgs boson LHC cross sections and decay rates constitutes a critical systematic uncertainty in the study of the Higgs boson properties. We show that the full covariance matrix between the Higgs rates can be determined from the most elementary sources of uncertainty by a direct application of probability theory. We evaluate the error magnitudes and full correlation matrix on the set of Higgs cross sections and partial decay widths at $\\sqrt{s}=7$, $8$, $13$ and $14$~TeV, which are provided in ancillary files. The impact of this correlation matrix on the global fits is illustrated with the latest $7$+$8$ TeV Higgs dataset.

  1. Use of stirred tanks for studying matrix effects caused by inorganic acids, easily ionized elements and organic solvents in inductively coupled plasma atomic emission spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Paredes, Eduardo [Departamento de Quimica Analitica, Nutricion y Bromatologia, University of Alicante, 03080 Alicante (Spain); Maestre, Salvador E. [Departamento de Quimica Analitica, Nutricion y Bromatologia, University of Alicante, 03080 Alicante (Spain); Todoli, Jose L. [Departamento de Quimica Analitica, Nutricion y Bromatologia, University of Alicante, 03080 Alicante (Spain)]. E-mail: jose.todoli@ua.es

    2006-03-15

    A stirred tank was used for the first time to elucidate the mechanism responsible for inductively coupled plasma atomic emission spectroscopy (ICP-AES) matrix effects caused by inorganic, acids and easily ionized elements (EIEs), as well as organic, ethanol and acetic acid, compounds. In order to gradually increase the matrix concentration, a matrix solution was introduced inside a stirred container (tank) initially filled with an aqueous multielement standard. PolyTetraFluoroEthylene (PTFE) tubing was used to deliver the resulting solution to the liquid sample introduction system. Matrix concentration ranged from 0 to 2 mol l{sup -1} in the case of inorganic acids (i.e., nitric, sulfuric, hydrochloric and a mixture of them), from 0 to about 2500 mg l{sup -1} for EIEs (i.e., sodium, calcium and mixtures of both) and from 0% to 15%, w/w for organic compounds. Up to 40-50 different solutions were prepared and measured in a period of time shorter than 6-7 min. This investigation was carried out in terms of emission intensity and tertiary aerosols characteristics. The experimental setup used in the present work allowed to thoroughly study the effect of matrix concentration on analytical signal. Generally speaking, the experiments concerning tertiary aerosol characterization revealed that, in the case of inorganic acids and EIEs, the mechanism responsible for changes in aerosol characteristics was the droplet fission. In contrast, for organic matrices it was found that the interference was caused by a change in both aerosol transport and plasma thermal characteristics. The extent of the interferences caused by organic as well as inorganic compounds was compared for a set of 14 emission lines through a wide range of matrix concentrations. With a stirred tank, it is possible to choose an efficient internal standard for any given matrix composition. The time required to complete this procedure was shorter than 7 min.

  2. Use of stirred tanks for studying matrix effects caused by inorganic acids, easily ionized elements and organic solvents in inductively coupled plasma atomic emission spectrometry

    International Nuclear Information System (INIS)

    Paredes, Eduardo; Maestre, Salvador E.; Todoli, Jose L.

    2006-01-01

    A stirred tank was used for the first time to elucidate the mechanism responsible for inductively coupled plasma atomic emission spectroscopy (ICP-AES) matrix effects caused by inorganic, acids and easily ionized elements (EIEs), as well as organic, ethanol and acetic acid, compounds. In order to gradually increase the matrix concentration, a matrix solution was introduced inside a stirred container (tank) initially filled with an aqueous multielement standard. PolyTetraFluoroEthylene (PTFE) tubing was used to deliver the resulting solution to the liquid sample introduction system. Matrix concentration ranged from 0 to 2 mol l -1 in the case of inorganic acids (i.e., nitric, sulfuric, hydrochloric and a mixture of them), from 0 to about 2500 mg l -1 for EIEs (i.e., sodium, calcium and mixtures of both) and from 0% to 15%, w/w for organic compounds. Up to 40-50 different solutions were prepared and measured in a period of time shorter than 6-7 min. This investigation was carried out in terms of emission intensity and tertiary aerosols characteristics. The experimental setup used in the present work allowed to thoroughly study the effect of matrix concentration on analytical signal. Generally speaking, the experiments concerning tertiary aerosol characterization revealed that, in the case of inorganic acids and EIEs, the mechanism responsible for changes in aerosol characteristics was the droplet fission. In contrast, for organic matrices it was found that the interference was caused by a change in both aerosol transport and plasma thermal characteristics. The extent of the interferences caused by organic as well as inorganic compounds was compared for a set of 14 emission lines through a wide range of matrix concentrations. With a stirred tank, it is possible to choose an efficient internal standard for any given matrix composition. The time required to complete this procedure was shorter than 7 min

  3. Corrections to the free-nucleon values of the single-particle matrix elements of the M1 and Gamow-Teller operators, from a comparison of shell-model predictions with sd-shell data

    International Nuclear Information System (INIS)

    Brown, B.A.; Wildenthal, B.H.

    1983-01-01

    The magnetic dipole moments of states in mirror pairs of the sd-shell nuclei and the strengths of the Gamow-Teller beta decays which connect them are compared with predictions based on mixed-configuration shell-model wave functions. From this analysis we extract the average effective values of the single-particle matrix elements of the l, s, and [Y/sup( 2 )xs]/sup( 1 ) components of the M1 and Gamow-Teller operators acting on nucleons in the 0d/sub 5/2/, 1s/sub 1/2/, and 0d/sub 3/2/ orbits. These results are compared with the recent calculations by Towner and Khanna of the corrections to the free-nucleon values of these matrix elements which arise from the effects of isobar currents, mesonic-exchange currents, and mixing with configurations outside the sd shell

  4. Controlled Dissolution of Surface Layers for Elemental Analysis by Inductively Coupled Plasma-Mass Spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Lorge, Susan Elizabeth [Iowa State Univ., Ames, IA (United States)

    2007-01-01

    Determining the composition of thin layers is increasingly important for a variety of industrial materials such as adhesives, coatings and microelectronics. Secondary ion mass spectrometry (SIMS), Auger electron spectroscopy (AES), X-ray photoelectron spectroscopy (XPS), glow discharge optical emission spectroscopy (GDOES), glow discharge mass spectrometry (GDMS), and laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) are some of the techniques that are currently employed for the direct analysis of the sample surface. Although these techniques do not suffer from the contamination problems that often plague sample dissolution studies, they do require matrix matched standards for quantification. Often, these standards are not readily available. Despite the costs of clean hoods, Teflon pipette tips and bottles, and pure acids, partial sample dissolution is the primary method used in the semiconductor industry to quantify surface impurities. Specifically, vapor phase decomposition (VPD) coupled to ICP-MS or total reflection x-ray fluorescence (TXRF) provides elemental information from the top most surface layers at detection sensitivities in the 107-1010atoms/cm2 range. The ability to quantify with standard solutions is a main advantage of these techniques. Li and Houk applied a VPD-like technique to steel. The signal ratio of trace element to matrix element was used for quantification. Although controlled dissolution concentrations determined for some of the dissolved elements agreed with the certified values, concentrations determined for refractory elements (Ti, Nb and Ta) were too low. LA-ICP-MS and scanning electron microscopy (SEM) measurements indicated that carbide grains distributed throughout the matrix were high in these refractory elements. These elements dissolved at a slower rate than the matrix element, Fe. If the analyte element is not removed at a rate similar to the matrix element a true

  5. Hydra-Ring: a computational framework to combine failure probabilities

    Science.gov (United States)

    Diermanse, Ferdinand; Roscoe, Kathryn; IJmker, Janneke; Mens, Marjolein; Bouwer, Laurens

    2013-04-01

    This presentation discusses the development of a new computational framework for the safety assessment of flood defence systems: Hydra-Ring. Hydra-Ring computes the failure probability of a flood defence system, which is composed of a number of elements (e.g., dike segments, dune segments or hydraulic structures), taking all relevant uncertainties explicitly into account. This is a major step forward in comparison with the current Dutch practice in which the safety assessment is done separately per individual flood defence section. The main advantage of the new approach is that it will result in a more balanced prioratization of required mitigating measures ('more value for money'). Failure of the flood defence system occurs if any element within the system fails. Hydra-Ring thus computes and combines failure probabilities of the following elements: - Failure mechanisms: A flood defence system can fail due to different failure mechanisms. - Time periods: failure probabilities are first computed for relatively small time scales (assessment of flood defense systems, Hydra-Ring can also be used to derive fragility curves, to asses the efficiency of flood mitigating measures, and to quantify the impact of climate change and land subsidence on flood risk. Hydra-Ring is being developed in the context of the Dutch situation. However, the computational concept is generic and the model is set up in such a way that it can be applied to other areas as well. The presentation will focus on the model concept and probabilistic computation techniques.

  6. Ubiquitination of specific mitochondrial matrix proteins

    International Nuclear Information System (INIS)

    Lehmann, Gilad; Ziv, Tamar; Braten, Ori; Admon, Arie; Udasin, Ronald G.; Ciechanover, Aaron

    2016-01-01

    Several protein quality control systems in bacteria and/or mitochondrial matrix from lower eukaryotes are absent in higher eukaryotes. These are transfer-messenger RNA (tmRNA), The N-end rule ATP-dependent protease ClpAP, and two more ATP-dependent proteases, HslUV and ClpXP (in yeast). The lost proteases resemble the 26S proteasome and the role of tmRNA and the N-end rule in eukaryotic cytosol is performed by the ubiquitin proteasome system (UPS). Therefore, we hypothesized that the UPS might have substituted these systems – at least partially – in the mitochondrial matrix of higher eukaryotes. Using three independent experimental approaches, we demonstrated the presence of ubiquitinated proteins in the matrix of isolated yeast mitochondria. First, we show that isolated mitochondria contain ubiquitin (Ub) conjugates, which remained intact after trypsin digestion. Second, we demonstrate that the mitochondrial soluble fraction contains Ub-conjugates, several of which were identified by mass spectrometry and are localized to the matrix. Third, using immunoaffinity enrichment by specific antibodies recognizing digested ubiquitinated peptides, we identified a group of Ub-modified matrix proteins. The modification was further substantiated by separation on SDS-PAGE and immunoblots. Last, we attempted to identify the ubiquitin ligase(s) involved, and identified Dma1p as a trypsin-resistant protein in our mitochondrial preparations. Taken together, these data suggest a yet undefined role for the UPS in regulation of the mitochondrial matrix proteins. -- Highlights: •Mitochondrial matrix contains ubiquitinated proteins. •Ubiquitination occurs most probably in the matrix. •Dma1p is a ubiquitin ligase present in mitochondrial preparations.

  7. Ubiquitination of specific mitochondrial matrix proteins

    Energy Technology Data Exchange (ETDEWEB)

    Lehmann, Gilad [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Ziv, Tamar [The Smoler Proteomics Center, Faculty of Biology – Technion-Israel Institute of Technology, Haifa, 32000 (Israel); Braten, Ori [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Admon, Arie [The Smoler Proteomics Center, Faculty of Biology – Technion-Israel Institute of Technology, Haifa, 32000 (Israel); Udasin, Ronald G. [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Ciechanover, Aaron, E-mail: aaroncie@tx.technion.ac.il [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel)

    2016-06-17

    Several protein quality control systems in bacteria and/or mitochondrial matrix from lower eukaryotes are absent in higher eukaryotes. These are transfer-messenger RNA (tmRNA), The N-end rule ATP-dependent protease ClpAP, and two more ATP-dependent proteases, HslUV and ClpXP (in yeast). The lost proteases resemble the 26S proteasome and the role of tmRNA and the N-end rule in eukaryotic cytosol is performed by the ubiquitin proteasome system (UPS). Therefore, we hypothesized that the UPS might have substituted these systems – at least partially – in the mitochondrial matrix of higher eukaryotes. Using three independent experimental approaches, we demonstrated the presence of ubiquitinated proteins in the matrix of isolated yeast mitochondria. First, we show that isolated mitochondria contain ubiquitin (Ub) conjugates, which remained intact after trypsin digestion. Second, we demonstrate that the mitochondrial soluble fraction contains Ub-conjugates, several of which were identified by mass spectrometry and are localized to the matrix. Third, using immunoaffinity enrichment by specific antibodies recognizing digested ubiquitinated peptides, we identified a group of Ub-modified matrix proteins. The modification was further substantiated by separation on SDS-PAGE and immunoblots. Last, we attempted to identify the ubiquitin ligase(s) involved, and identified Dma1p as a trypsin-resistant protein in our mitochondrial preparations. Taken together, these data suggest a yet undefined role for the UPS in regulation of the mitochondrial matrix proteins. -- Highlights: •Mitochondrial matrix contains ubiquitinated proteins. •Ubiquitination occurs most probably in the matrix. •Dma1p is a ubiquitin ligase present in mitochondrial preparations.

  8. Uncertainties in elemental quantitative analysis by PIXE

    International Nuclear Information System (INIS)

    Montenegro, E.C.; Baptista, G.B.; Paschoa, A.S.; Barros Leite, C.V.

    1979-01-01

    The effects of the degree of non-uniformity of the particle beam, matrix composition and matrix thickness in a quantitative elemental analysis by particle induced X-ray emission (PIXE) are discussed and a criterion to evaluate the resulting degree of uncertainty in the mass determination by this method is established. (Auth.)

  9. Some remarks on unilateral matrix equations

    International Nuclear Information System (INIS)

    Cerchiai, Bianca L.; Zumino, Bruno

    2001-01-01

    We briefly review the results of our paper LBNL-46775: We study certain solutions of left-unilateral matrix equations. These are algebraic equations where the coefficients and the unknown are square matrices of the same order, or, more abstractly, elements of an associative, but possibly noncommutative algebra, and all coefficients are on the left. Recently such equations have appeared in a discussion of generalized Born-Infeld theories. In particular, two equations, their perturbative solutions and the relation between them are studied, applying a unified approach based on the generalized Bezout theorem for matrix polynomials

  10. Matrix-reinforcement reactivity in P/M titanium matrix composites

    International Nuclear Information System (INIS)

    Amigo, V.; Romero, F.; Salvador, M. D.; Busquets, D.

    2007-01-01

    The high reactivity of titanium and the facility of the same one to form intermetallics makes difficult obtaining composites with this material and brings the need in any case of covering the principal fibres used as reinforcement. To obtain composites of titanium reinforced with ceramic particles ins proposed in this paper, for this reason it turns out to be fundamental to evaluate the reactivity between the matrix and reinforcement. Both titanium nitride and carbide (TiN and TiC) are investigated as materials of low reactivity whereas titanium silicide (TiSi 2 ) is also studied as materials of major reactivity, already stated by the scientific community. This reactivity will be analysed by means of scanning electron microscopy (SEM) there being obtained distribution maps of the elements that allow to establish the possible influence of the sintering temperature and time. Hereby the matrix-reinforcement interactions are optimized to obtain suitable mechanical properties. (Author) 39 refs

  11. Optical properties of polarization-dependent geometrical phase elements with partially polarized light

    International Nuclear Information System (INIS)

    Gorodetski, Y.; Biener, G.; Niv, A.; Kleiner, V.; Hasman, E.

    2005-01-01

    Full Text:The behavior of geometrical phase elements illuminated with partially polarized monochromatic beams is being theoretically as well as experimentally investigated. The element discussed in this paper is composed of wave plates with retardation and space-variant orientation angle. We found that a beam emerging from such an element comprises two polarization orders of right and left-handed circularly polarized states with conjugate geometrical phase modification. This phase equals twice the orientation angle of the space-variant wave plate comprising the element. Apart from the two polarization orders, the emerging beam coherence polarization matrix comprises a matrix termed as the vectorial interference matrix. This matrix contains the information concerning the correlation between the two orthogonal circularly polarized portions of the incident beam. In this paper we measure this correlation by a simple interference experiment. Furthermore, we found that the equivalent mutual intensity of the emerging beam is being modulated according to the geometrical phase induced by the element. Other interesting phenomena along propagation will be discussed theoretically and experimentally demonstrated. We demonstrate experimentally our analysis by using a spherical geometrical phase element, which is realized by use of space-variant sub wavelength grating and illuminated with a CO 2 laser radiation of 10.6μm wavelength

  12. The NUMEN project: NUclear Matrix Elements for Neutrinoless double beta decay

    Science.gov (United States)

    Cappuzzello, F.; Agodi, C.; Cavallaro, M.; Carbone, D.; Tudisco, S.; Lo Presti, D.; Oliveira, J. R. B.; Finocchiaro, P.; Colonna, M.; Rifuggiato, D.; Calabretta, L.; Calvo, D.; Pandola, L.; Acosta, L.; Auerbach, N.; Bellone, J.; Bijker, R.; Bonanno, D.; Bongiovanni, D.; Borello-Lewin, T.; Boztosun, I.; Brunasso, O.; Burrello, S.; Calabrese, S.; Calanna, A.; Chávez Lomelí, E. R.; D'Agostino, G.; De Faria, P. N.; De Geronimo, G.; Delaunay, F.; Deshmukh, N.; Ferreira, J. L.; Fisichella, M.; Foti, A.; Gallo, G.; Garcia-Tecocoatzi, H.; Greco, V.; Hacisalihoglu, A.; Iazzi, F.; Introzzi, R.; Lanzalone, G.; Lay, J. A.; La Via, F.; Lenske, H.; Linares, R.; Litrico, G.; Longhitano, F.; Lubian, J.; Medina, N. H.; Mendes, D. R.; Moralles, M.; Muoio, A.; Pakou, A.; Petrascu, H.; Pinna, F.; Reito, S.; Russo, A. D.; Russo, G.; Santagati, G.; Santopinto, E.; Santos, R. B. B.; Sgouros, O.; da Silveira, M. A. G.; Solakci, S. O.; Souliotis, G.; Soukeras, V.; Spatafora, A.; Torresi, D.; Magana Vsevolodovna, R.; Yildirim, A.; Zagatto, V. A. B.

    2018-05-01

    The article describes the main achievements of the NUMEN project together with an updated and detailed overview of the related R&D activities and theoretical developments. NUMEN proposes an innovative technique to access the nuclear matrix elements entering the expression of the lifetime of the double beta decay by cross section measurements of heavy-ion induced Double Charge Exchange (DCE) reactions. Despite the fact that the two processes, namely neutrinoless double beta decay and DCE reactions, are triggered by the weak and strong interaction respectively, important analogies are suggested. The basic point is the coincidence of the initial and final state many-body wave functions in the two types of processes and the formal similarity of the transition operators. First experimental results obtained at the INFN-LNS laboratory for the 40Ca(18O,18Ne)40Ar reaction at 270MeV give an encouraging indication on the capability of the proposed technique to access relevant quantitative information. The main experimental tools for this project are the K800 Superconducting Cyclotron and MAGNEX spectrometer. The former is used for the acceleration of the required high resolution and low emittance heavy-ion beams and the latter is the large acceptance magnetic spectrometer for the detection of the ejectiles. The use of the high-order trajectory reconstruction technique, implemented in MAGNEX, allows to reach the experimental resolution and sensitivity required for the accurate measurement of the DCE cross sections at forward angles. However, the tiny values of such cross sections and the resolution requirements demand beam intensities much larger than those manageable with the present facility. The on-going upgrade of the INFN-LNS facilities in this perspective is part of the NUMEN project and will be discussed in the article.

  13. Finite element electromagnetic field computation on the Sequent Symmetry 81 parallel computer

    International Nuclear Information System (INIS)

    Ratnajeevan, S.; Hoole, H.

    1990-01-01

    Finite element field analysis algorithms lend themselves to parallelization and this fact is exploited in this paper to implement a finite element analysis program for electromagnetic field computation on the Sequent Symmetry 81 parallel computer with three processors. In terms of waiting time, the maximum gains are to be made in matrix solution and therefore this paper concentrates on the gains in parallelizing the solution part of finite element analysis. An outline of how parallelization could be exploited in most finite element operations is given in this paper although the actual implemention of parallelism on the Sequent Symmetry 81 parallel computer was in sparsity computation, matrix assembly and the matrix solution areas. In all cases, the algorithms were modified suit the parallel programming application rather than allowing the compiler to parallelize on existing algorithms

  14. The linear parameters and the decoupling matrix for linearly coupled motion in 6 dimensional phase space

    International Nuclear Information System (INIS)

    Parzen, G.

    1997-01-01

    It will be shown that starting from a coordinate system where the 6 phase space coordinates are linearly coupled, one can go to a new coordinate system, where the motion is uncoupled, by means of a linear transformation. The original coupled coordinates and the new uncoupled coordinates are related by a 6 x 6 matrix, R. It will be shown that of the 36 elements of the 6 x 6 decoupling matrix R, only 12 elements are independent. A set of equations is given from which the 12 elements of R can be computed form the one period transfer matrix. This set of equations also allows the linear parameters, the β i , α i , i = 1, 3, for the uncoupled coordinates, to be computed from the one period transfer matrix

  15. Relative measurement of heavy elements in the bile gallbladder and gallstone

    International Nuclear Information System (INIS)

    Moosavi, K.; Vatankhah, S.; Salimi, J.

    2006-01-01

    Particle Induced X-Ray Emission is a suitable method for the analysis of biological samples in which heavy trace elements are contained in light matrix elements. It is very important to know which factors or probably elements act as initial seed and lead to growing the sands. The goal of this study was to compare the relative values of Fe/K, Cu/K and Zn/K for gallstones, gallbladder, and bile of a specific patient for studying the origination of forming the gallstones. Materials and Methods Human gallbladder, bile, and gallstone samples were obtained by surgical operation from 15 patients and are bombarded by 2.0 MeV energy proton beams produced by van de Graaff accelerator in vacuum. All .. the gallstones were chosen of pigment type of stones and, all the patients were adults. In contrast with conventional methods, the shell and center of the sands has been analyzed separately. The PIXE spectrum analysis was performed using the nonlinear least square fitting code AXIL and GUPIX. Results: The results of detected minor and trace elements shows that the precipitation of calcium salt in the bile lead to reduction of crystals' formation. Elemental comparison of pigment type of gallstone and bile shows that the concentration of calcium in the shell of the stones is four times more than that in the bile. Conclusion: Precipitation of the calcium from the saturated bile on the cholesterols as a seed of gallstones led to reduced sands formation. Analysis of the gallbladder of the same patients revealed no relation between elemental concentrations of bile and gallstones

  16. Better Size Estimation for Sparse Matrix Products

    DEFF Research Database (Denmark)

    Amossen, Rasmus Resen; Campagna, Andrea; Pagh, Rasmus

    2010-01-01

    We consider the problem of doing fast and reliable estimation of the number of non-zero entries in a sparse Boolean matrix product. Let n denote the total number of non-zero entries in the input matrices. We show how to compute a 1 ± ε approximation (with small probability of error) in expected t...

  17. Top Quark Produced Through the Electroweak Force: Discovery Using the Matrix Element Analysis and Search for Heavy Gauge Bosons Using Boosted Decision Trees

    Energy Technology Data Exchange (ETDEWEB)

    Pangilinan, Monica [Brown Univ., Providence, RI (United States)

    2010-05-01

    The top quark produced through the electroweak channel provides a direct measurement of the Vtb element in the CKM matrix which can be viewed as a transition rate of a top quark to a bottom quark. This production channel of top quark is also sensitive to different theories beyond the Standard Model such as heavy charged gauged bosons termed W'. This thesis measures the cross section of the electroweak produced top quark using a technique based on using the matrix elements of the processes under consideration. The technique is applied to 2.3 fb-1 of data from the D0 detector. From a comparison of the matrix element discriminants between data and the signal and background model using Bayesian statistics, we measure the cross section of the top quark produced through the electroweak mechanism σ(p$\\bar{p}$ → tb + X, tqb + X) = 4.30-1.20+0.98 pb. The measured result corresponds to a 4.9σ Gaussian-equivalent significance. By combining this analysis with other analyses based on the Bayesian Neural Network (BNN) and Boosted Decision Tree (BDT) method, the measured cross section is 3.94 ± 0.88 pb with a significance of 5.0σ, resulting in the discovery of electroweak produced top quarks. Using this measured cross section and constraining |Vtb| < 1, the 95% confidence level (C.L.) lower limit is |Vtb| > 0.78. Additionally, a search is made for the production of W' using the same samples from the electroweak produced top quark. An analysis based on the BDT method is used to separate the signal from expected backgrounds. No significant excess is found and 95% C.L. upper limits on the production cross section are set for W' with masses within 600-950 GeV. For four general models of W{prime} boson production using decay channel W' → t$\\bar{p}$, the lower mass limits are the following: M(W'L with SM couplings) > 840 GeV; M(W'R) > 880 GeV or 890 GeV if the

  18. Boundary element method for modelling creep behaviour

    International Nuclear Information System (INIS)

    Zarina Masood; Shah Nor Basri; Abdel Majid Hamouda; Prithvi Raj Arora

    2002-01-01

    A two dimensional initial strain direct boundary element method is proposed to numerically model the creep behaviour. The boundary of the body is discretized into quadratic element and the domain into quadratic quadrilaterals. The variables are also assumed to have a quadratic variation over the elements. The boundary integral equation is solved for each boundary node and assembled into a matrix. This matrix is solved by Gauss elimination with partial pivoting to obtain the variables on the boundary and in the interior. Due to the time-dependent nature of creep, the solution has to be derived over increments of time. Automatic time incrementation technique and backward Euler method for updating the variables are implemented to assure stability and accuracy of results. A flowchart of the solution strategy is also presented. (Author)

  19. Static Analysis of Steel Fiber Concrete Beam With Heterosis Finite Elements

    Directory of Open Access Journals (Sweden)

    James H. Haido

    2014-08-01

    Full Text Available Steel fiber is considered as the most commonly used constructional fibers in concrete structures. The formulation of new nonlinearities to predict the static performance of steel fiber concrete composite structures is considered essential. Present study is devoted to investigate the efficiency of utilizing heterosis finite elements analysis in static analysis of steel fibrous beams. New and simple material nonlinearities are proposed and used in the formulation of these elements. A computer program coded in FORTRAN was developed to perform current finite element static analysis with considering four cases of elements stiffness matrix determination. The results are compared with the experimental data available in literature in terms of central deflections, strains, and failure form, good agreement was found. Suitable outcomes have been observed in present static analysis with using of tangential stiffness matrix and stiffness matrix in second iteration of the load increment.

  20. Matrix method for two-dimensional waveguide mode solution

    Science.gov (United States)

    Sun, Baoguang; Cai, Congzhong; Venkatesh, Balajee Seshasayee

    2018-05-01

    In this paper, we show that the transfer matrix theory of multilayer optics can be used to solve the modes of any two-dimensional (2D) waveguide for their effective indices and field distributions. A 2D waveguide, even composed of numerous layers, is essentially a multilayer stack and the transmission through the stack can be analysed using the transfer matrix theory. The result is a transfer matrix with four complex value elements, namely A, B, C and D. The effective index of a guided mode satisfies two conditions: (1) evanescent waves exist simultaneously in the first (cladding) layer and last (substrate) layer, and (2) the complex element D vanishes. For a given mode, the field distribution in the waveguide is the result of a 'folded' plane wave. In each layer, there is only propagation and absorption; at each boundary, only reflection and refraction occur, which can be calculated according to the Fresnel equations. As examples, we show that this method can be used to solve modes supported by the multilayer step-index dielectric waveguide, slot waveguide, gradient-index waveguide and various plasmonic waveguides. The results indicate the transfer matrix method is effective for 2D waveguide mode solution in general.

  1. Atomic Transition Probabilities Scandium through Manganese

    International Nuclear Information System (INIS)

    Martin, G.A.; Fuhr, J.R.; Wiese, W.L.

    1988-01-01

    Atomic transition probabilities for about 8,800 spectral lines of five iron-group elements, Sc(Z = 21) to Mn(Z = 25), are critically compiled, based on all available literature sources. The data are presented in separate tables for each element and stage of ionization and are further subdivided into allowed (i.e., electric dipole-E1) and forbidden (magnetic dipole-M1, electric quadrupole-E2, and magnetic quadrupole-M2) transitions. Within each data table the spectral lines are grouped into multiplets, which are in turn arranged according to parent configurations, transition arrays, and ascending quantum numbers. For each line the transition probability for spontaneous emission and the line strength are given, along with the spectroscopic designation, the wavelength, the statistical weights, and the energy levels of the upper and lower states. For allowed lines the absorption oscillator strength is listed, while for forbidden transitions the type of transition is identified (M1, E2, etc.). In addition, the estimated accuracy and the source are indicated. In short introductions, which precede the tables for each ion, the main justifications for the choice of the adopted data and for the accuracy rating are discussed. A general introduction contains a discussion of our method of evaluation and the principal criteria for our judgements

  2. Fixation of actinide elements into zeolites/zeotypes and Flexcrete-cement matrix

    International Nuclear Information System (INIS)

    Amini, S.; Dyer, A.; Durrani, S.K.

    1993-01-01

    The leaching behavior of α-emitter radionuclides (uranium and americium) from zeolite-L and the zeotype (SAPO-34) in a Flexcrete-cement matrix were examined by static and dynamic methods using 0.005M CaCl 2 and synthetic ground water as leachants. The leaching rates of UO 2 2+ were found to be higher by about ten orders of magnitude than those of Am 3+ for both zeolite-L and SAPO-34 in the cement matrix. The static and dynamic leaching rates of UO 2 2+ for SAPO-34 in CaCl 2 and synthetic ground water were ten orders of magnitude lower than those for L. SAPO-34 showed good selectivity for uranium at pH 2-3.5 and L was usefully selective for Am 3+ . Distribution coefficients of Am 3+ and UO 2 2+ increased with equilibrium pH. (author) 20 refs.; 2 figs.; 4 tabs

  3. Evidence for Enhanced Matrix Diffusion in Geological Environment

    Science.gov (United States)

    Sato, Kiminori; Fujimoto, Koichiro; Nakata, Masataka; Shikazono, Naotatsu

    2013-01-01

    Molecular diffusion in rock matrix, called as matrix diffusion, has been appreciated as a static process for elemental migration in geological environment that has been acknowledged in the context of geological disposal of radioactive waste. However, incomprehensible enhancement of matrix diffusion has been reported at a number of field test sites. Here, the matrix diffusion of saline water at Horonobe, Hokkaido, Japan is highlighted directly probing angstrom-scale pores on a field scale up to 1 km by positron--positronium annihilation spectroscopy. The first application of positron--positronium annihilation spectroscopy to field-scale geophysical research reveals the slight variation of angstrom-scale pores influenced by saline water diffusion with complete accuracy. We found widely interconnected 3 Å pores, which offer the pathway of saline water diffusion with the highly enhanced effective matrix diffusion coefficient of 4× 10-6 cm2 s-1. The present findings provide unambiguous evidence that the angstrom-scale pores enhance effective matrix diffusion on a field scale in geological environment.

  4. Matrix of transmission in structural dynamics

    International Nuclear Information System (INIS)

    Mukherjee, S.

    1975-01-01

    Within the last few years numerous papers have been published on the subject of matrix method in elasto-mechanics. 'Matrix of Transmission' is one of the methods in this field which has gained considerable attention in recent years. The basic philosophy adopted in this method is based on the idea of breaking up a complicated system into component parts with simple elastic and dynamic properties which can be readily expressed in matrix form. These component matrices are considered as building blocks, which are fitted together according to a set of predetermined rules which then provide the static and dynamic properties of the entire system. A common type of system occuring in engineering practice consists of a number of elements linked together end to end in the form of a chain. The 'Transfer Matrix' is ideally suited for such a system, because only successive multiplication is necessary to connect these elements together. The number of degrees of freedom and intermediate conditions present no difficulty. Although the 'Transfer Matrix' method is suitable for the treatment of branched and coupled systems its application to systems which do not have predominant chain topology is not effective. Apart from the requirement that the system be linearely elastic, no other restrictions are made. In this paper, it is intended to give a general outline and theoretical formulation of 'Transfer Matrix' and then its application to actual problems in structural dynamics related to seismic analysis. The natural frequencies of a freely vibrating elastic system can be found by applying proper end conditions. The end conditions will yield the frequency determinate to zero. By using a suitable numerical method, the natural frequencies and mode shapes are determined by making a frequency sweep within the range of interest. Results of an analysis of a typical nuclear building by this method show very close agreement with the results obtained by using ASKA and SAP IV program. Therefore

  5. Matrix formulation of pebble circulation in the pebbed code

    International Nuclear Information System (INIS)

    Gougar, H.D.; Terry, W.K.; Ougouag, A.M.

    2002-01-01

    The PEBBED technique provides a foundation for equilibrium fuel cycle analysis and optimization in pebble-bed cores in which the fuel elements are continuously flowing and, if desired, recirculating. In addition to the modern analysis techniques used in or being developed for the code, PEBBED incorporates a novel nuclide-mixing algorithm that allows for sophisticated recirculation patterns using a matrix generated from basic core parameters. Derived from a simple partitioning of the pebble flow, the elements of the recirculation matrix are used to compute the spatially averaged density of each nuclide at the entry plane from the nuclide densities of pebbles emerging from the discharge conus. The order of the recirculation matrix is a function of the flexibility and sophistication of the fuel handling mechanism. This formulation for coupling pebble flow and neutronics enables core design and fuel cycle optimization to be performed by the manipulation of a few key core parameters. The formulation is amenable to modern optimization techniques. (author)

  6. The correlation matrix of Higgs rates at the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Arbey, Alexandre [Univ Lyon, Univ Lyon 1, ENS de Lyon, CNRS,Centre de Recherche Astrophysique de Lyon UMR5574,F-69230 Saint-Genis-Laval (France); Theoretical Physics Department, CERN,CH-1211 Geneva 23 (Switzerland); Fichet, Sylvain [ICTP-SAIFR & IFT-UNESP,Rua Dr. Bento Teobaldo Ferraz 271, Sao Paulo (Brazil); Mahmoudi, Farvah [Univ Lyon, Univ Lyon 1, ENS de Lyon, CNRS,Centre de Recherche Astrophysique de Lyon UMR5574,F-69230 Saint-Genis-Laval (France); Theoretical Physics Department, CERN,CH-1211 Geneva 23 (Switzerland); Moreau, Grégory [Laboratoire de Physique Théorique, CNRS, Université Paris-Sud 11, Bât. 210, F-91405 Orsay Cedex (France)

    2016-11-17

    The imperfect knowledge of the Higgs boson decay rates and cross sections at the LHC constitutes a critical systematic uncertainty in the study of the Higgs boson properties. We show that the full covariance matrix between the Higgs rates can be determined from the most elementary sources of uncertainty by a direct application of probability theory. We evaluate the error magnitudes and full correlation matrix on the set of Higgs cross sections and branching ratios at √s=7, 8, 13 and 14 TeV, which are provided in ancillary files. The impact of this correlation matrix on the global fits is illustrated with the latest 7+8 TeV Higgs dataset.

  7. Covariance Estimation and Autocorrelation of NORAD Two-Line Element Sets

    National Research Council Canada - National Science Library

    Osweiler, Victor P

    2006-01-01

    This thesis investigates NORAD two-line element sets (TLE) containing satellite mean orbital elements for the purpose of estimating a covariance matrix and formulating an autocorrelation relationship...

  8. Parallel algorithms for computation of the manipulator inertia matrix

    Science.gov (United States)

    Amin-Javaheri, Masoud; Orin, David E.

    1989-01-01

    The development of an O(log2N) parallel algorithm for the manipulator inertia matrix is presented. It is based on the most efficient serial algorithm which uses the composite rigid body method. Recursive doubling is used to reformulate the linear recurrence equations which are required to compute the diagonal elements of the matrix. It results in O(log2N) levels of computation. Computation of the off-diagonal elements involves N linear recurrences of varying-size and a new method, which avoids redundant computation of position and orientation transforms for the manipulator, is developed. The O(log2N) algorithm is presented in both equation and graphic forms which clearly show the parallelism inherent in the algorithm.

  9. Measurement of the CKM Matrix Element |V sub u sub b | with B -> rho e nu Decays

    CERN Document Server

    Wilden, L

    2003-01-01

    We present a measurement of the branching fraction for the rare decays B -> rho e nu and extract a value for the magnitude of V sub u sub b , one of the smallest elements of the Cabibbo-Kobayashi-Maskawa quark-mixing matrix. The results are given for five different calculations of form factors used to parametrize the hadronic current in semileptonic decays. Using a sample of 55 million B(bar B) meson pairs recorded with the BABAR detector at the PEP-II e sup + e sup - storage ring, we obtain BETA(B sup 0 -> rho sup - sup 1 e sup + nu) = (3.29 +- 0.42 +- 0.47 +- 0.60) x 10 sup - sup 4 and |V sub u sub b | = (3.64 +- 0.22 +- 0.25 sub - sub 0 sub . sub 5 sub 6 sup + sup 0 sup . sup 3 sup 9) x 10 sup - sup 3 , where the uncertainties are statistical, systematic, and theoretical, respectively.

  10. Generalized Probability-Probability Plots

    NARCIS (Netherlands)

    Mushkudiani, N.A.; Einmahl, J.H.J.

    2004-01-01

    We introduce generalized Probability-Probability (P-P) plots in order to study the one-sample goodness-of-fit problem and the two-sample problem, for real valued data.These plots, that are constructed by indexing with the class of closed intervals, globally preserve the properties of classical P-P

  11. Quantum Probabilities as Behavioral Probabilities

    Directory of Open Access Journals (Sweden)

    Vyacheslav I. Yukalov

    2017-03-01

    Full Text Available We demonstrate that behavioral probabilities of human decision makers share many common features with quantum probabilities. This does not imply that humans are some quantum objects, but just shows that the mathematics of quantum theory is applicable to the description of human decision making. The applicability of quantum rules for describing decision making is connected with the nontrivial process of making decisions in the case of composite prospects under uncertainty. Such a process involves deliberations of a decision maker when making a choice. In addition to the evaluation of the utilities of considered prospects, real decision makers also appreciate their respective attractiveness. Therefore, human choice is not based solely on the utility of prospects, but includes the necessity of resolving the utility-attraction duality. In order to justify that human consciousness really functions similarly to the rules of quantum theory, we develop an approach defining human behavioral probabilities as the probabilities determined by quantum rules. We show that quantum behavioral probabilities of humans do not merely explain qualitatively how human decisions are made, but they predict quantitative values of the behavioral probabilities. Analyzing a large set of empirical data, we find good quantitative agreement between theoretical predictions and observed experimental data.

  12. Trace elemental imaging of rare earth elements discriminates tissues at microscale in flat fossils.

    Science.gov (United States)

    Gueriau, Pierre; Mocuta, Cristian; Dutheil, Didier B; Cohen, Serge X; Thiaudière, Dominique; Charbonnier, Sylvain; Clément, Gaël; Bertrand, Loïc

    2014-01-01

    The interpretation of flattened fossils remains a major challenge due to compression of their complex anatomies during fossilization, making critical anatomical features invisible or hardly discernible. Key features are often hidden under greatly preserved decay prone tissues, or an unpreparable sedimentary matrix. A method offering access to such anatomical features is of paramount interest to resolve taxonomic affinities and to study fossils after a least possible invasive preparation. Unfortunately, the widely-used X-ray micro-computed tomography, for visualizing hidden or internal structures of a broad range of fossils, is generally inapplicable to flattened specimens, due to the very high differential absorbance in distinct directions. Here we show that synchrotron X-ray fluorescence spectral raster-scanning coupled to spectral decomposition or a much faster Kullback-Leibler divergence based statistical analysis provides microscale visualization of tissues. We imaged exceptionally well-preserved fossils from the Late Cretaceous without needing any prior delicate preparation. The contrasting elemental distributions greatly improved the discrimination of skeletal elements material from both the sedimentary matrix and fossilized soft tissues. Aside content in alkaline earth elements and phosphorus, a critical parameter for tissue discrimination is the distinct amounts of rare earth elements. Local quantification of rare earths may open new avenues for fossil description but also in paleoenvironmental and taphonomical studies.

  13. Neutron Flux Interpolation with Finite Element Method in the Nuclear Fuel Cell Calculation using Collision Probability Method

    International Nuclear Information System (INIS)

    Shafii, M. Ali; Su'ud, Zaki; Waris, Abdul; Kurniasih, Neny; Ariani, Menik; Yulianti, Yanti

    2010-01-01

    Nuclear reactor design and analysis of next-generation reactors require a comprehensive computing which is better to be executed in a high performance computing. Flat flux (FF) approach is a common approach in solving an integral transport equation with collision probability (CP) method. In fact, the neutron flux distribution is not flat, even though the neutron cross section is assumed to be equal in all regions and the neutron source is uniform throughout the nuclear fuel cell. In non-flat flux (NFF) approach, the distribution of neutrons in each region will be different depending on the desired interpolation model selection. In this study, the linear interpolation using Finite Element Method (FEM) has been carried out to be treated the neutron distribution. The CP method is compatible to solve the neutron transport equation for cylindrical geometry, because the angle integration can be done analytically. Distribution of neutrons in each region of can be explained by the NFF approach with FEM and the calculation results are in a good agreement with the result from the SRAC code. In this study, the effects of the mesh on the k eff and other parameters are investigated.

  14. Probability Aggregates in Probability Answer Set Programming

    OpenAIRE

    Saad, Emad

    2013-01-01

    Probability answer set programming is a declarative programming that has been shown effective for representing and reasoning about a variety of probability reasoning tasks. However, the lack of probability aggregates, e.g. {\\em expected values}, in the language of disjunctive hybrid probability logic programs (DHPP) disallows the natural and concise representation of many interesting problems. In this paper, we extend DHPP to allow arbitrary probability aggregates. We introduce two types of p...

  15. Chirality dependence of dipole matrix element of carbon nanotubes in axial magnetic field: A third neighbor tight binding approach

    Science.gov (United States)

    Chegel, Raad; Behzad, Somayeh

    2014-02-01

    We have studied the electronic structure and dipole matrix element, D, of carbon nanotubes (CNTs) under magnetic field, using the third nearest neighbor tight binding model. It is shown that the 1NN and 3NN-TB band structures show differences such as the spacing and mixing of neighbor subbands. Applying the magnetic field leads to breaking the degeneracy behavior in the D transitions and creates new allowed transitions corresponding to the band modifications. It is found that |D| is proportional to the inverse tube radius and chiral angle. Our numerical results show that amount of filed induced splitting for the first optical peak is proportional to the magnetic field by the splitting rate ν11. It is shown that ν11 changes linearly and parabolicly with the chiral angle and radius, respectively.

  16. Markov chains with quasitoeplitz transition matrix: first zero hitting

    Directory of Open Access Journals (Sweden)

    Alexander M. Dukhovny

    1989-01-01

    Full Text Available This paper continues the investigation of Markov Chains with a quasitoeplitz transition matrix. Generating functions of first zero hitting probabilities and mean times are found by the solution of special Riemann boundary value problems on the unit circle. Duality is discussed.

  17. Quantitative analysis by X-ray fluorescence using first principles for matrix correction

    International Nuclear Information System (INIS)

    Hulett, L.D.; Dunn, H.W.; Tarter, J.G.

    1978-01-01

    The quantitative interpretation of X-ray fluorescence (XRF) data is often difficult because of matrix effects. The intensity of fluorescence measured for a given element is not only dependent on the element's concentration, but also on the mass absorption coefficients of the sample for the excitation and fluorescence radiation. Also, there are interelement effects in which high-energy fluorescence from heavier elements is absorbed by lighter elements with a resulting enhancement of their fluorescence. Recent theoretical treatments of this problem have shown that X-ray fluorescence data can be corrected for these matrix effects by calculations based on first principles. Fundamental constants, available in atomic physics data tables, are the only parameters needed. It is not necessary to make empirical calibrations. The application of this correctional procedure to alloys and alumina-supported catalysts is described. A description is given of a low-background spectrometer which uses monochromatic Ag Ksub(α) radiation for excitation. Matrix corrections by first principles can be easily applied to data from instruments of this type because fluorescence excitation cross-sections and mass absorption coefficients can be accurately defined for monochromatic radiation. (author)

  18. Network Model for The Problem of Integer Balancing of a Fourdimensional Matrix

    Directory of Open Access Journals (Sweden)

    A. V. Smirnov

    2016-01-01

    Full Text Available The problem of integer balancing of a four-dimensional matrix is studied. The elements of the inner part (all four indices are greater than zero of the given real matrix are summed in each direction and each two- and three-dimensional section of the matrix; the total sum is also found. These sums are placed into the elements where one or more indices are equal to zero (according to the summing directions. The problem is to find an integer matrix of the same structure, which can be produced from the initial one by replacing the elements with the largest previous or the smallest following integer. At the same time, the element with four zero indices should be produced with standard rules of rounding - off. In the article the problem of finding the maximum multiple flow in the network of any natural multiplicity   is also studied. There are arcs of three types: ordinary arcs, multiple arcs and multi-arcs. Each multiple and multi-arc is a union of   linked arcs, which are adjusted with each other. The network constructing rules are described. The definitions of a divisible network and some associated subjects are stated. There are defined the basic principles for reducing the integer balancing problem of an  -dimensional matrix (  to the problem of finding the maximum flow in a divisible multiple network of multiplicity  . There are stated the rules for reducing the four-dimensional balancing problem to the maximum flow problem in the network of multiplicity 5. The algorithm of finding the maximum flow, which meets the solvability conditions for the integer balancing problem, is formulated for such a network.

  19. Experimental determination of the real elements of the density matrix of H(n=3) atoms produced in 20--100-keV collisions of H+ on Kr

    International Nuclear Information System (INIS)

    Seifert, N.; Gibson, N.D.; Risley, J.S.

    1995-01-01

    In continuation of our previous work, charge transfer processes occurring in protons on rare-gas-atom collisions have been investigated. Diagonal and real off-diagonal coherence elements of the density matrix for H(n=3) atoms produced in 20--100-keV electron-capture collisions with Kr atoms are experimentally determined by analyzing the Balmer-α light from the decay of H atoms from the (n=3) state to the (n=2) state. The intensity and polarization of the emitted light are measured as functions of an axially symmetric electric field in the collision region. These data are fitted to a numerical model of the H atom in an electric field in order to extract density-matrix elements. The results are compared to previous studies of H + on He and Ar. The collisionally produced dipole moment of the H(n=3) atom decreases for increasing atomic number of the rare-gas target atoms, which indicates that the final phase of the collision process is not essential for the formation of the dipole moment. This physical picture is further supported by our alignment data. Absolute cross sections for charge transfer to the 3s, 3p, and 3d levels are presented as well

  20. Study of uranium matrix interference on ten analytes using inductively coupled plasma atomic emission spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ghazi, A.A.; Qamar, S.; Atta, M.A. (A.Q. Khan Research Labs., Rawalpindi (Pakistan))

    1993-08-01

    Maximum allowable concentrations of 12 elements in uranium hexafluoride feed for enrichment to reactor grade material (about 3%), vary from 1 to 100 ppm ([mu]g/g). Using an inductively coupled plasma atomic emission spectrometer, 51 lines of tine of these elements (B, Cr, Mo, P, Sb, Si, Ta, Ti, V and W) has been studied with a uranium matrix to investigate the matrix interference on the basis of signal to background (SBR), and background to background ratios (BBR). Detection limits and limits of quantitative determination (LQDs) were calculated for these elements in a uranium matrix using SBR and relative standard deviation of the background signal (RSD[sub B]) approach. In almost all cases, the uranium matrix interference reduces the SBRs to the extent that direct trace analysis is impossible. A uranium sample having known concentrations of impurities (around LQDs) was directly analysed with results that showed reasonable accuracy and precision. (Author).