WorldWideScience

Sample records for map kinase cascades

  1. Gene regulation by MAP kinase cascades

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Petersen, Klaus; Petersen, Morten

    2009-01-01

    Mitogen-activated protein kinase (MAPK) cascades are signaling modules that transduce extracellular stimuli to a range of cellular responses. Research in yeast and metazoans has shown that MAPK-mediated phosphorylation directly or indirectly regulates the activity of transcription factors. Plant ...

  2. MAP Kinase Cascades in Plant Innate Immunity

    Directory of Open Access Journals (Sweden)

    Magnus Wohlfahrt Rasmussen

    2012-07-01

    Full Text Available Plant mitogen-activated protein kinase (MAPK cascades generally transduce extracellular stimuli into cellular responses. These stimuli include the perception of pathogen-associated molecular patterns (PAMPs by host transmembrane pattern recognition receptors (PRRs which trigger MAPK-dependent innate immune responses. In the model Arabidopsis, molecular genetic evidence implicates a number of MAPK cascade components in PAMP signaling, and in responses to immunity-related phytohormones such as ethylene, jasmonate and salicylate. In a few cases, cascade components have been directly linked to the transcription of target genes or to the regulation of phytohormone synthesis. Thus MAPKs are obvious targets for bacterial effector proteins and are likely guardees of resistance (R proteins, which mediate defense signaling in response to the action of effectors, or effector-triggered immunity (ETI. This mini-review discusses recent progress in this field with a focus on the Arabidopsis MAPKs MPK3, 4, 6 and 11 in their apparent pathways.

  3. MAP kinase cascades in Arabidopsis innate immunity

    DEFF Research Database (Denmark)

    Rasmussen, Magnus Wohlfahrt; Roux, Milena Edna; Petersen, Morten

    2012-01-01

    immune responses. In the model Arabidopsis, molecular genetic evidence implicates a number of MAPK cascade components in PAMP signaling, and in responses to immunity-related phytohormones such as ethylene, jasmonate, and salicylate. In a few cases, cascade components have been directly linked...... to the transcription of target genes or to the regulation of phytohormone synthesis. Thus MAPKs are obvious targets for bacterial effector proteins and are likely guardees of resistance proteins, which mediate defense signaling in response to the action of effectors, or effector-triggered immunity. This mini...

  4. Signal transduction by MAP kinase cascades in budding yeast.

    Science.gov (United States)

    Posas, F; Takekawa, M; Saito, H

    1998-04-01

    Budding yeast contain at least four distinct MAPK (mitogen activated protein kinase) cascades that transduce a variety of intracellular signals: mating-pheromone response, pseudohyphal/invasive growth, cell wall integrity, and high osmolarity adaptation. Although each MAPK cascade contains a conserved set of three protein kinases, the upstream activation mechanisms for these cascades are diverse, including a trimeric G protein, monomeric small G proteins, and a prokaryotic-like two-component system. Recently, it became apparent that there is extensive sharing of signaling elements among the MAPK pathways; however, little undesirable cross-talk occurs between various cascades. The formation of multi-protein signaling complexes is probably centrally important for this insulation of individual MAPK cascades.

  5. Involvement of the MAP kinase cascade in Xenopus mesoderm induction.

    OpenAIRE

    Gotoh, Y.; Masuyama, N; Suzuki, A.; Ueno, N; Nishida, E

    1995-01-01

    Mitogen-activated protein kinase (MAPK) is activated by MAPK kinase (MAPKK) in a variety of signaling pathways. This kinase cascade has been shown to function in cell proliferation and differentiation, but its role in early vertebrate development remains to be investigated. During early vertebrate embryogenesis, the induction and patterning of mesoderm are thought to be determined by signals from intercellular factors such as members of the fibroblast growth factor (FGF) family and members of...

  6. Modulation of the MAP kinase signaling cascade by Raf kinase inhibitory protein

    Institute of Scientific and Technical Information of China (English)

    Nicholas TRAKUL; Marsha R. ROSNER

    2005-01-01

    Proteins like Raf kinase inhibitory protein (RKIP) that serve as modulators of signaling pathways, either by promoting or inhibiting the formation of productive signaling complexes through protein-protein interactions, have been demonstrated to play an increasingly important role in a number of cell types and organisms. These proteins have been implicated in development as well as the progression of cancer. RKIP is a particularly interesting regulator, as it is a highly conserved, ubiquitously expressed protein that has been shown to play a role in growth and differentiation in a number of organisms and can regulate multiple signaling pathways. RKIP is also the first MAP kinase signaling modulator to be identified as playing a role in cancer metastasis, and identification of the mechanism by which it regulates Raf-1 activation provides new targets for therapeutic intervention.

  7. Identification and characterization of an ABA-activated MAP kinase cascade in Arabidopsis thaliana

    KAUST Repository

    Danquah, Agyemang

    2015-04-01

    Summary Abscisic acid (ABA) is a major phytohormone involved in important stress-related and developmental plant processes. Recent phosphoproteomic analyses revealed a large set of ABA-triggered phosphoproteins as putative mitogen-activated protein kinase (MAPK) targets, although the evidence for MAPKs involved in ABA signalling is still scarce. Here, we identified and reconstituted in vivo a complete ABA-activated MAPK cascade, composed of the MAP3Ks MAP3K17/18, the MAP2K MKK3 and the four C group MAPKs MPK1/2/7/14. In planta, we show that ABA activation of MPK7 is blocked in mkk3-1 and map3k17mapk3k18 plants. Coherently, both mutants exhibit hypersensitivity to ABA and altered expression of a set of ABA-dependent genes. A genetic analysis further reveals that this MAPK cascade is activated by the PYR/PYL/RCAR-SnRK2-PP2C ABA core signalling module through protein synthesis of the MAP3Ks, unveiling an atypical mechanism for MAPK activation in eukaryotes. Our work provides evidence for a role of an ABA-induced MAPK pathway in plant stress signalling. Significance Statement We report in this article the identification of a complete MAPK module, composed of MAP3K17/18, MKK3 and MPK1/2/7/14, which is activated by ABA through the ABA core signalling complex. We showed that the activation of this module requires the MAP3K protein synthesis which occurs after hours of stress treatment, suggesting that the pathway is involved in a delayed wave of cellular responses to ABA and drought. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  8. Dual role for membrane localization in yeast MAP kinase cascade activation and its contribution to signaling fidelity.

    Science.gov (United States)

    Lamson, Rachel E; Takahashi, Satoe; Winters, Matthew J; Pryciak, Peter M

    2006-03-21

    Distinct MAP kinase pathways in yeast share several signaling components , including the PAK Ste20 and the MAPKKK Ste11, yet signaling is specific. Mating pheromones trigger an initial step in which Ste20 activates Ste11 , and this requires plasma membrane recruitment of the MAP kinase cascade scaffold protein, Ste5 . Here, we demonstrate an additional role for Ste5 membrane localization. Once Ste11 is activated, signaling through the mating pathway remains minimal but is substantially amplified when Ste5 is recruited to the membrane either by the Gbetagamma dimer or by direct membrane targeting, even to internal membranes. Ste11 signaling is also amplified by Ste5 oligomerization and by a hyperactivating mutation in the Ste7 binding region of Ste5. We suggest a model in which membrane recruitment of Ste5 concentrates its binding partners and thereby amplifies signaling through the kinase cascade. We find similar behavior in the osmotically responsive HOG pathway. Remarkably, while both pheromone and hyperosmotic stimuli amplify signaling from constitutively active Ste11, the resulting signaling output remains pathway specific. These findings suggest a common mode of regulation in which pathway stimuli both initiate and amplify MAP kinase cascade signaling. The regulation of rate-limiting steps that lie after a branchpoint from shared components helps ensure signaling specificity.

  9. Activation of the MAP Kinase Cascade by Exogenous Calcium-Sensing Receptor

    Energy Technology Data Exchange (ETDEWEB)

    Hobson, Susan A.; Wright, Jay W.; Lee, Fred; Mcneil, Scott; Bilderback, Tim R.; Rodland, Karin D.

    2003-02-01

    In Rat-1 fibroblasts and ovarian surface epithelial cells, extracellular calcium induces a proliferative response which appears to be mediated by the G-protein coupled Calcium-sensing Receptor (CaR), as expression of the non-functional CaR-R795W mutant inhibits both thymidine incorporation and activation of the extracellular-regulated kinase (ERK) in response to calcium. In this report we utilized CaR-transfected HEK293 cells to demonstrate that functional CaR is necessary and sufficient for calcium-induced ERK activation. CaR-dependent ERK activation was blocked by co-expression of the Ras dominant-negative mutant, Ras N17, and by exposure to the phosphatidyl inositol 3' kinase inhibitors wortmannin and LY294002. In contrast to Rat-1 fibroblasts, CaR-mediated in vitro kinase activity of ERK2 was unaffected by tyrosine kinase inhibitor herbimycin in CaR-transfected HEK293 cells. These results suggest that usage of distinct pathways downstream of the CaR varies in a cell-type specific manner, suggesting a potential mechanism by which activation of the CaR could couple to distinct calcium-dependent responses.

  10. Regulation of the MAP kinase cascade in PC12 cells: B-Raf activates MEK-1 (MAP kinase or ERK kinase) and is inhibited by cAMP

    DEFF Research Database (Denmark)

    Peraldi, P; Frödin, M; Barnier, J V

    1995-01-01

    the role of B-Raf in this process. We observed that NGF, PMA and cAMP induce the phosphorylation of B-Raf as well as an upward shift in its electrophoretic mobility. We show that B-Raf is activated following NGF and PMA treatment of PC12 cells, and that it can phosphorylate and activate MEK-1. However, c......AMP inhibits B-Raf autokinase activity as well as its ability to phosphorylate and activate MEK-1. This inhibition is likely to be due to a direct effect since we found that PKA phosphorylates B-Raf in vitro. Further, we show that B-Raf binds to p21ras, but more important, this binding to p21ras is virtually...... abolished with B-Raf from PC12 cells treated with CPT-cAMP. Hence, these data indicate that the PKA-mediated phosphorylation of B-Raf hampers its interaction with p21ras, which is responsible for the PKA-mediated decrease in B-Raf activity. Finally, our work suggests that in PC12 cells, cAMP stimulates MAP...

  11. IDC1, a pezizomycotina-specific gene that belongs to the PaMpk1 MAP kinase transduction cascade of the filamentous fungus Podospora anserina.

    Science.gov (United States)

    Jamet-Vierny, Corinne; Debuchy, Robert; Prigent, Magali; Silar, Philippe

    2007-12-01

    Components involved in the activation of the MAPK cascades in filamentous fungi are not well known. Here, we provide evidence that IDC1, a pezizomycotina-specific gene is involved along with the PaNox1 NADPH oxidase in the nuclear localization of the PaMpk1 MAP kinase, a prerequisite for MAPK activity. Mutants of IDC1 display the same phenotypes as mutants in PaNox1 and PaMpk1, i.e., lack of pigment and of aerial hyphae, female sterility, impairment in hyphal interference and inability to develop Crippled Growth cell degeneration. As observed for the PaNox1 mutant, IDC1 mutants are hypostatic to PaMpk1 mutants. IDC1 seems to play a key role in sexual reproduction. Indeed, fertility is diminished in strains with lower level of IDC1. In strains over-expressing IDC1, protoperithecia reach a later stage of development towards perithecia without fertilization; however, upon fertilization maturation of fertile perithecia is diminished and delayed. In addition, heterokaryon construction shows that IDC1 is necessary together with PaNox1 in the perithecial envelope but not in the dikaryon resulting from fertilization.

  12. An Arabidopsis kinase cascade influences auxin-responsive cell expansion.

    Science.gov (United States)

    Enders, Tara A; Frick, Elizabeth M; Strader, Lucia C

    2017-10-01

    Mitogen-activated protein kinase (MPK) cascades are conserved mechanisms of signal transduction across eukaryotes. Despite the importance of MPK proteins in signaling events, specific roles for many Arabidopsis MPK proteins remain unknown. Multiple studies have suggested roles for MPK signaling in a variety of auxin-related processes. To identify MPK proteins with roles in auxin response, we screened mpk insertional alleles and identified mpk1-1 as a mutant that displays hypersensitivity in auxin-responsive cell expansion assays. Further, mutants defective in the upstream MAP kinase kinase MKK3 also display hypersensitivity in auxin-responsive cell expansion assays, suggesting that this MPK cascade affects auxin-influenced cell expansion. We found that MPK1 interacts with and phosphorylates ROP BINDING PROTEIN KINASE 1 (RBK1), a protein kinase that interacts with members of the Rho-like GTPases from Plants (ROP) small GTPase family. Similar to mpk1-1 and mkk3-1 mutants, rbk1 insertional mutants display auxin hypersensitivity, consistent with a possible role for RBK1 downstream of MPK1 in influencing auxin-responsive cell expansion. We found that RBK1 directly phosphorylates ROP4 and ROP6, supporting the possibility that RBK1 effects on auxin-responsive cell expansion are mediated through phosphorylation-dependent modulation of ROP activity. Our data suggest a MKK3 • MPK1 • RBK1 phosphorylation cascade that may provide a dynamic module for altering cell expansion. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  13. Mitogen-activated protein kinase cascades in Vitis vinifera

    Science.gov (United States)

    Çakır, Birsen; Kılıçkaya, Ozan

    2015-01-01

    Protein phosphorylation is one of the most important mechanisms to control cellular functions in response to external and endogenous signals. Mitogen-activated protein kinases (MAPK) are universal signaling molecules in eukaryotes that mediate the intracellular transmission of extracellular signals resulting in the induction of appropriate cellular responses. MAPK cascades are composed of four protein kinase modules: MAPKKK kinases (MAPKKKKs), MAPKK kinases (MAPKKKs), MAPK kinases (MAPKKs), and MAPKs. In plants, MAPKs are activated in response to abiotic stresses, wounding, and hormones, and during plant pathogen interactions and cell division. In this report, we performed a complete inventory of MAPK cascades genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with MAPK, MAPK kinases, MAPK kinase kinases and MAPK kinase kinase kinase kinase members of Arabidopsis thaliana, we revealed the existence of 14 MAPKs, 5 MAPKKs, 62 MAPKKKs, and 7 MAPKKKKs in Vitis vinifera. We identified orthologs of V. vinifera putative MAPKs in different species, and ESTs corresponding to members of MAPK cascades in various tissues. This work represents the first complete inventory of MAPK cascades in V. vinifera and could help elucidate the biological and physiological functions of these proteins in V. vinifera. PMID:26257761

  14. MAP Kinases in Immune Responses

    Institute of Scientific and Technical Information of China (English)

    Yongliang Zhang; Chen Dong

    2005-01-01

    MAP kinases are evolutionarily conserved signaling regulators from budding yeast to mammals and play essential roles in both innate and adaptive immune responses. There are three main families of MAPKs in mammals. Each of them has its own activators, inactivators, substrates and scaffolds, which altogether form a fine signaling network in response to different extracellular or intracellular stimulation. In this review, we summarize recent advances in understanding of the regulation of MAP kinases and the roles of MAP kinases in innate and adaptive immune responses.

  15. MAP Kinases in Immune Responses

    Institute of Scientific and Technical Information of China (English)

    YongliangZhang; ChenDong

    2005-01-01

    MAP kinases are evolutionarily conserved signaling regulators from budding yeast to mammals and play essential roles in both innate and adaptive immune responses. There are three main families of MAPKs in mammals. Each of them has its own activators, inactivators, substrates and scaffolds, which altogether form a fine signaling network in response to different extracellular or intracellular stimulation. In this review, we summarize recent advances in understanding of the regulation of MAP kinases and the roles of MAP kinases in innate and adaptive immune responses. Cellular & Molecular Immunology. 2005;2(1):20-27.

  16. MAP kinase meets mitosis: A role for Raf Kinase Inhibitory Protein in spindle checkpoint regulation

    Directory of Open Access Journals (Sweden)

    Rosner Marsha

    2007-01-01

    Full Text Available Abstract Raf Kinase Inhibitory Protein (RKIP is an evolutionarily conserved protein that functions as a modulator of signaling by the MAP kinase cascade. Implicated as a metastasis suppressor, Raf Kinase Inhibitory Protein depletion correlates with poor prognosis for breast, prostate and melanoma tumors but the mechanism is unknown. Recent evidence indicates that Raf Kinase Inhibitory Protein regulates the mitotic spindle assembly checkpoint by controlling Aurora B Kinase activity, and the mechanism involves Raf/MEK/ERK signaling. In contrast to elevated MAP kinase signaling during the G1, S or G2 phases of the cell cycle that activates checkpoints and induces arrest or senescence, loss of RKIP during M phase leads to bypass of the spindle assembly checkpoint and the generation of chromosomal abnormalities. These results reveal a role for Raf Kinase Inhibitory Protein and the MAP kinase cascade in ensuring the fidelity of chromosome segregation prior to cell division. Furthermore, these data highlight the need for precise titration of the MAP kinase signal to ensure the integrity of the spindle assembly process and provide a mechanism for generating genomic instability in tumors. Finally, these results raise the possibility that RKIP status in tumors could influence the efficacy of treatments such as poisons that stimulate the Aurora B-dependent spindle assembly checkpoint.

  17. The cAMP Signaling and MAP Kinase Pathways in Plant Pathogenic Fungi

    NARCIS (Netherlands)

    Mehrabi, R.; Zhao, X.; Kim, Y.; Xu, J.R.

    2009-01-01

    The key components of the well conserved cyclic AMP signaling and MAP kinase pathways have been functionally characterized in the corn smut Ustilago maydis, rice blast fungus Magnaporthe grisea, and a few other fungal pathogens. In general, the cAMP signaling and the MAP kinase cascade homologous to

  18. Cascades with coupled map lattices in preferential attachment community networks

    Institute of Scientific and Technical Information of China (English)

    Cui Di; Gao Zi-You; Zhao Xiao-Mei

    2008-01-01

    In this paper,cascading failure is studied by coupled map lattice (CML) methods in preferential attachment community networks.It is found that external perturbation R is increasing with modularity Q growing by simulation.In particular,the large modularity Q can hold off the cascading failure dynamic process in community networks.Furthermore,different attack strategies also greatly affect the cascading failure dynamic process. It is particularly significant to control cascading failure process in real community networks.

  19. MAP Kinase 4 Substrates and Plant Innate Immunity

    DEFF Research Database (Denmark)

    Rasmussen, Magnus Wohlfahrt

    Multi-layered defense responses are activated in plants upon recognition of invading pathogens. Transmembrane receptors recognize conserved pathogen-associated molecular patterns and activate MAP kinase cascades, which regulate changes in gene expression to produce appropriate immune responses...... recognition, which also induce its localization to cytoplasmic processing bodies. All three proteins; PAT1, AOC3 and eIF4E also interacts with MPK4 in vivo although the functional outcome of these interactions are still elusive. The thesis comprise a general introduction to plant innate immunity followed...... by two review articles “MAP kinase cascades in Arabidopsis innate immunity” published in Frontiers in Plant Science and “mRNA decay in plant immunity” under revision for Cellular and Molecular Life Science. Together these sections gives a comprehensive overview of Arabidopsis defense signaling...

  20. Universal fractional map and cascade of bifurcations type attractors

    Science.gov (United States)

    Edelman, M.

    2013-09-01

    We modified the way in which the Universal Map is obtained in the regular dynamics to derive the Universal α-Family of Maps depending on a single parameter α >0, which is the order of the fractional derivative in the nonlinear fractional differential equation describing a system experiencing periodic kicks. We consider two particular α-families corresponding to the Standard and Logistic Maps. For fractional α <2 in the area of parameter values of the transition through the period doubling cascade of bifurcations from regular to chaotic motion in regular dynamics corresponding fractional systems demonstrate a new type of attractors—cascade of bifurcations type trajectories.

  1. MAP Kinase 4 Substrates and Plant Innate Immunity

    DEFF Research Database (Denmark)

    Rasmussen, Magnus Wohlfahrt

    recognition, which also induce its localization to cytoplasmic processing bodies. All three proteins; PAT1, AOC3 and eIF4E also interacts with MPK4 in vivo although the functional outcome of these interactions are still elusive. The thesis comprise a general introduction to plant innate immunity followed...... by two review articles “MAP kinase cascades in Arabidopsis innate immunity” published in Frontiers in Plant Science and “mRNA decay in plant immunity” under revision for Cellular and Molecular Life Science. Together these sections gives a comprehensive overview of Arabidopsis defense signaling...

  2. Tolerance of edge cascades with coupled map lattices methods

    Institute of Scientific and Technical Information of China (English)

    Cui Di; Gao Zi-You; Zheng Jian-Feng

    2009-01-01

    This paper studies the cascading failure on random networks and scale-free networks by introducing the tolerance parameter of edge based on the coupled map lattices methods. The whole work focuses on investigating some indices including the number of failed edges, dynamic edge tolerance capacity and the perturbation of edge. In general, it assumes that the perturbation is attributed to the normal distribution in adopted simulations. By investigating the effectiveness of edge tolerance in scale-free and random networks, it finds that the larger tolerance parameter 位 can more efficiently delay the cascading failure process for scale-free networks than random networks. These results indicate that the cascading failure process can be effectively controlled by increasing the tolerance parameter A. Moreover, the simulations also show that, larger variance of perturbation can easily trigger the cascading failures than the smaller one. This study may be useful for evaluating efficiency of whole traffic systems, and for alleviating cascading failure in such systems.

  3. Regulation of MAP kinase-dependent apoptotic pathway: implication of reactive oxygen and nitrogen species.

    Science.gov (United States)

    Sumbayev, Vadim V; Yasinska, Inna M

    2005-04-15

    Mitogen-activated protein (MAP) kinase signaling cascades are multi-functional signaling networks that influence cell growth, differentiation, apoptosis, and cellular responses to stress. Apoptosis signal-regulating kinase 1 (ASK1) is a MAP kinase kinase kinase that triggers apoptogenic kinase cascade leading to the phosphorylation/activation of c-Jun N-terminal kinases and p38-MAP kinase, which are responsible for inducing apoptotic cell death. This pathway plays a pivotal role in transduction of signals from different apoptotic stimuli. In the present review, we summarized the recent evidence concerning MAP kinase-dependent apoptotic pathway and its regulation in the mammalian cells and organism in vivo. We have shown that the key messengers of regulation of this pathway are the reactive oxygen and nitrogen species. The role of protein oxidation and S-nitrosation in induction of apoptotic cell death via ASK1 is discussed. Also we have outlined other recently discovered signal transduction processes involved in the regulation of ASK1 activity and downstream pathway.

  4. The role of MAP kinase cascades in cell signaling,neural plasticity and pain facilitation%MAP激酶在细胞内信号传递,神经可塑性及痛觉易化中的作用

    Institute of Scientific and Technical Information of China (English)

    Ru-Rong Ji; Yu-Qiu Zhang

    2005-01-01

    病理性疼痛通常指由组织损伤引起的炎性痛和神经损伤引起的神经病理性痛.损伤和强烈的伤害刺激能导致痛过敏.痛过敏现象的产生是由外周敏化(初级伤害感受器的敏感性增加)和中枢敏化(脊髓背角以及其他中枢神经元敏感性增加)引起的.有些蛋白激酶通过翻译后的调节如关键膜受体和通道蛋白磷酸化而参与外周和中枢敏化的形成.特别的是多种信号通路可汇聚而激活MAPK(mitogen-activated protein kinase).伤害性刺激、生长因子以及炎性介质均能在初级和二级痛感受神经元中激活MAPK家族成员ERK和P38.ERK和P38的激活不仅能够引起转录后过程发生改变,而且还能够通过对转录和非转录水平的调节增加多种基因的表达,从而导致损伤后痛过敏的形成和维持.%Pathological pain, normally referring to tissue injury-induced inflammatory pain and nerve injury-induced neuropathic pain, is an expression of neural plasticity. Injuries and intense noxious stimuli result in pain hypersensitivity,which is contributed by peripheral sensitization (increased sensitivity of primary sensory nociceptors) and central sensitization (increased sensitivity of spinal dorsal horn and other CNS neurons). Activation of several protein kinases causes both forms of sensitization via posttranslational regulation, such as phosphorylation of key membrane receptors and channels. In particular, activation of multiple signal cascades converge on the activation of MAPK (mitogen-activated protein kinase).Activation of MAPK family members of ERK and p38 by nociceptive activity, growth factors, and inflammatory mediators in primary sensory and secondary order neurons, not only results in posttranslational modification, but also increases the expression of numerous genes via transcriptional and non-transcriptional regulation. Eventually this activation contributes to the development and maintenance of heightened pain

  5. MAP kinases and histone modification

    Institute of Scientific and Technical Information of China (English)

    Tamaki Suganuma; Jerry L. Workman

    2012-01-01

    Signal transduction pathways alter the gene expression program in response to extracellular or intracellular cues.Mitogen-activated protein kinases (MAPKs) govern numerous cellular processes including cell growth,stress response,apoptosis,and differentiation.In the past decade,MAPKs have been shown to regulate the transcription machinery and associate with chromatin-modifying complexes.Moreover,recent studies demonstrate that several MAPKs bind directly to chromatin at target genes.This review highlights the recent discoveries of MAPK signaling in regard to histone modifications and chromatin regulation.Evidence suggesting that further unknown mechanisms integrate signal transduction with chromatin biology is discussed.

  6. Universal fractional map and cascade of bifurcations type attractors.

    Science.gov (United States)

    Edelman, M

    2013-09-01

    We modified the way in which the Universal Map is obtained in the regular dynamics to derive the Universal α-Family of Maps depending on a single parameter α>0, which is the order of the fractional derivative in the nonlinear fractional differential equation describing a system experiencing periodic kicks. We consider two particular α-families corresponding to the Standard and Logistic Maps. For fractional αbifurcations from regular to chaotic motion in regular dynamics corresponding fractional systems demonstrate a new type of attractors--cascade of bifurcations type trajectories.

  7. Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress.

    Science.gov (United States)

    Xing, Yu; Chen, Wei-hua; Jia, Wensuo; Zhang, Jianhua

    2015-09-01

    Superoxide dismutases (SODs) are involved in plant adaptive responses to biotic and abiotic stresses but the upstream signalling process that modulates their expression is not clear. Expression of two iron SODs, FSD2 and FSD3, was significantly increased in Arabidopsis in response to NaCl treatment but blocked in transgenic MKK5-RNAi plant, mkk5. Using an assay system for transient expression in protoplasts, it was found that mitogen-activated protein kinase kinase 5 (MKK5) was also activated in response to salt stress. Overexpression of MKK5 in wild-type plants enhanced their tolerance to salt treatments, while mkk5 mutant exhibited hypersensitivity to salt stress in germination on salt-containing media. Moreover, another kinase, MPK6, was also involved in the MKK5-mediated iron superoxide dismutase (FSD) signalling pathway in salt stress. The kinase activity of MPK6 was totally turned off in mkk5, whereas the activity of MPK3 was only partially blocked. MKK5 interacted with the MEKK1 protein that was also involved in the salt-induced FSD signalling pathway. These data suggest that salt-induced FSD2 and FSD3 expressions are influenced by MEKK1 via MKK5-MPK6-coupled signalling. This MAP kinase cascade (MEKK1, MKK5, and MPK6) mediates the salt-induced expression of iron superoxide dismutases.

  8. MAP kinase pathways in the yeast Saccharomyces cerevisiae

    Science.gov (United States)

    Gustin, M. C.; Albertyn, J.; Alexander, M.; Davenport, K.; McIntire, L. V. (Principal Investigator)

    1998-01-01

    A cascade of three protein kinases known as a mitogen-activated protein kinase (MAPK) cascade is commonly found as part of the signaling pathways in eukaryotic cells. Almost two decades of genetic and biochemical experimentation plus the recently completed DNA sequence of the Saccharomyces cerevisiae genome have revealed just five functionally distinct MAPK cascades in this yeast. Sexual conjugation, cell growth, and adaptation to stress, for example, all require MAPK-mediated cellular responses. A primary function of these cascades appears to be the regulation of gene expression in response to extracellular signals or as part of specific developmental processes. In addition, the MAPK cascades often appear to regulate the cell cycle and vice versa. Despite the success of the gene hunter era in revealing these pathways, there are still many significant gaps in our knowledge of the molecular mechanisms for activation of these cascades and how the cascades regulate cell function. For example, comparison of different yeast signaling pathways reveals a surprising variety of different types of upstream signaling proteins that function to activate a MAPK cascade, yet how the upstream proteins actually activate the cascade remains unclear. We also know that the yeast MAPK pathways regulate each other and interact with other signaling pathways to produce a coordinated pattern of gene expression, but the molecular mechanisms of this cross talk are poorly understood. This review is therefore an attempt to present the current knowledge of MAPK pathways in yeast and some directions for future research in this area.

  9. A mitotically inheritable unit containing a MAP kinase module.

    Science.gov (United States)

    Kicka, Sébastien; Bonnet, Crystel; Sobering, Andrew K; Ganesan, Latha P; Silar, Philippe

    2006-09-05

    Prions are novel kinds of hereditary units, relying solely on proteins, that are infectious and inherited in a non-Mendelian fashion. To date, they are either based on autocatalytic modification of a 3D conformation or on autocatalytic cleavage. Here, we provide further evidence that in the filamentous fungus Podospora anserina, a MAP kinase cascade is probably able to self-activate and generate C, a hereditary unit that bears many similarities to prions and triggers cell degeneration. We show that in addition to the MAPKKK gene, both the MAPKK and MAPK genes are necessary for the propagation of C, and that overexpression of MAPK as that of MAPKKK facilitates the appearance of C. We also show that a correlation exists between the presence of C and localization of the MAPK inside nuclei. These data emphasize the resemblance between prions and a self-positively regulated cascade in terms of their transmission. This thus further expands the concept of protein-base inheritance to regulatory networks that have the ability to self-activate.

  10. CNNcon: improved protein contact maps prediction using cascaded neural networks.

    Directory of Open Access Journals (Sweden)

    Wang Ding

    Full Text Available BACKGROUNDS: Despite continuing progress in X-ray crystallography and high-field NMR spectroscopy for determination of three-dimensional protein structures, the number of unsolved and newly discovered sequences grows much faster than that of determined structures. Protein modeling methods can possibly bridge this huge sequence-structure gap with the development of computational science. A grand challenging problem is to predict three-dimensional protein structure from its primary structure (residues sequence alone. However, predicting residue contact maps is a crucial and promising intermediate step towards final three-dimensional structure prediction. Better predictions of local and non-local contacts between residues can transform protein sequence alignment to structure alignment, which can finally improve template based three-dimensional protein structure predictors greatly. METHODS: CNNcon, an improved multiple neural networks based contact map predictor using six sub-networks and one final cascade-network, was developed in this paper. Both the sub-networks and the final cascade-network were trained and tested with their corresponding data sets. While for testing, the target protein was first coded and then input to its corresponding sub-networks for prediction. After that, the intermediate results were input to the cascade-network to finish the final prediction. RESULTS: The CNNcon can accurately predict 58.86% in average of contacts at a distance cutoff of 8 Å for proteins with lengths ranging from 51 to 450. The comparison results show that the present method performs better than the compared state-of-the-art predictors. Particularly, the prediction accuracy keeps steady with the increase of protein sequence length. It indicates that the CNNcon overcomes the thin density problem, with which other current predictors have trouble. This advantage makes the method valuable to the prediction of long length proteins. As a result, the effective

  11. Different designs of kinase-phosphatase interactions and phosphatase sequestration shapes the robustness and signal flow in the MAPK cascade

    Directory of Open Access Journals (Sweden)

    Sarma Uddipan

    2012-07-01

    Full Text Available Abstract Background The three layer mitogen activated protein kinase (MAPK signaling cascade exhibits different designs of interactions between its kinases and phosphatases. While the sequential interactions between the three kinases of the cascade are tightly preserved, the phosphatases of the cascade, such as MKP3 and PP2A, exhibit relatively diverse interactions with their substrate kinases. Additionally, the kinases of the MAPK cascade can also sequester their phosphatases. Thus, each topologically distinct interaction design of kinases and phosphatases could exhibit unique signal processing characteristics, and the presence of phosphatase sequestration may lead to further fine tuning of the propagated signal. Results We have built four architecturally distinct types of models of the MAPK cascade, each model with identical kinase-kinase interactions but unique kinases-phosphatases interactions. Our simulations unravelled that MAPK cascade’s robustness to external perturbations is a function of nature of interaction between its kinases and phosphatases. The cascade’s output robustness was enhanced when phosphatases were sequestrated by their target kinases. We uncovered a novel implicit/hidden negative feedback loop from the phosphatase MKP3 to its upstream kinase Raf-1, in a cascade resembling the B cell MAPK cascade. Notably, strength of the feedback loop was reciprocal to the strength of phosphatases’ sequestration and stronger sequestration abolished the feedback loop completely. An experimental method to verify the presence of the feedback loop is also proposed. We further showed, when the models were activated by transient signal, memory (total time taken by the cascade output to reach its unstimulated level after removal of signal of a cascade was determined by the specific designs of interaction among its kinases and phosphatases. Conclusions Differences in interaction designs among the kinases and phosphatases can

  12. Interaction of LRRK2 with kinase and GTPase signaling cascades

    Directory of Open Access Journals (Sweden)

    Joon Y Boon

    2014-07-01

    Full Text Available LRRK2 is a protein that interacts with a plethora of signaling molecules, but the complexity of LRRK2 function presents a challenge for understanding the role of LRRK2 in the pathophysiology of Parkinson’s disease. Studies of LRRK2 using over-expression in transgenic mice have been disappointing, however studies using invertebrate systems have yielded a much clearer picture, with clear effects of LRRK2 expression, knockdown or deletion in C. elegans and Drosophila on modulation of survival of dopaminergic neurons. Recent studies have begun to focus attention on particular signaling cascades that are a target of LRRK2 function. LRRK2 interacts with members of the MAPK pathway and might regulate the pathway action by acting as a scaffold that directs the location of MAPK pathway activity, without strongly affecting the amount of MAPK pathway activity. Binding to GTPases, GAPs and GEFs are another strong theme in LRRK2 biology, with LRRK2 binding to Rac1, cdc42, rab5, rab7L1, endoA, RGS2, ArfGAP1 and ArhGEF7. All of these molecules appear to feed into a function output for LRRK2 that modulates cytoskeletal outgrowth and vesicular dynamics, including autophagy. These functions likely impact modulation of α-synuclein aggregation and associated toxicity eliciting the disease processes that we term Parkinson’s disease.

  13. Cyclic AMP activates the mitogen-activated protein kinase cascade in PC12 cells

    DEFF Research Database (Denmark)

    Frödin, M; Peraldi, P; Van Obberghen, E

    1994-01-01

    reported. In rat pheochromocytoma PC12 cells, we demonstrate here a stimulation of the MAP kinase isozyme extracellular signal-regulated kinase 1 (ERK1) following elevation of intracellular cAMP after exposure of the cells to isobutylmethylxanthine, cholera toxin, forskolin, or cAMP-analogues. cAMP acted...

  14. Orexin-stimulated MAP kinase cascades are activated through multiple G-protein signalling pathways in human H295R adrenocortical cells: diverse roles for orexins A and B.

    Science.gov (United States)

    Ramanjaneya, Manjunath; Conner, Alex C; Chen, Jing; Kumar, Prashanth; Brown, James E P; Jöhren, Olaf; Lehnert, Hendrik; Stanfield, Peter R; Randeva, Harpal S

    2009-08-01

    Orexins A and B (ORA and ORB) are neuropeptide hormones found throughout the central nervous system and periphery. They are required for a host of physiological processes including mitogen-activated protein kinase (MAPK) regulation, steroidogenesis, appetite control and energy regulation. While some signalling mechanisms have been proposed for individual recombinant orexin receptors in generic mammalian cell types, it is clear that the peripheral effects of orexin are spatially and temporally complex. This study dissects the different G-protein signalling and MAPK pathways activated in a pluripotent human adrenal H295R cell line capable of all the physiological steps involved in steroidogenesis. Both extracellular receptor kinase 1/2 (ERK1/2) and p38 were phosphorylated rapidly with a subsequent decline, in a time- and dose-dependent manner, in response to both ORA and ORB. Conversely, there was little or no direct activation of the ERK5 or JNK pathway. Analysis using signalling and MAPK inhibitors as well as receptor-specific antagonists determined the precise mediators of the orexin response in these cells. Both ERK1/2 and p38 activation were predominantly G(q)- and to a lesser extent G(s)-mediated; p38 activation even had a small G(i)-component. Effects were broadly comparable for both orexin sub-types ORA and ORB and although most of the effects were transmitted through the orexin receptor-1 subtype, we did observe a role for orexin receptor-2-mediated activation of both ERK1/2 and p38. Cortisol secretion also differed in response to ORA and ORB. These data suggest multiple roles for orexin-mediated MAPK activation in an adrenal cell-line, this complexity may help to explain the diverse biological actions of orexins with wide-ranging consequences for our understanding of the mechanisms initiated by these steroidogenic molecules.

  15. Crosstalk and signalling switches in mitogen-activated protein kinase cascades

    Directory of Open Access Journals (Sweden)

    Dirk eFey

    2012-09-01

    Full Text Available Mitogen-activated protein kinase (MAPK cascades control cell fate decisions, such as proliferation, differentiation and apoptosis by integrating and processing intra- and extracellular cues. However, similar MAPK kinetic profiles can be associated with opposing cellular decisions depending on cell type, signal strength and dynamics. This implies that signalling by each individual MAPK cascade has to be considered in the context of the entire MAPK network. Here, we develop a dynamic model of feedback and crosstalk for the three major MAPK cascades; extracellular signal-regulated kinase (ERK, p38 mitogen-activated protein kinase (p38, c-Jun N-terminal kinase (JNK, and also include input from protein kinase B (AKT. Focusing on the bistable activation characteristics of the JNK pathway, this model explains how pathway crosstalk harmonises different MAPK responses resulting in pivotal cell fate decisions. We show that JNK can switch from a transient to sustained activity due to multiple positive feedback loops. Once activated, positive feedback locks JNK in a highly active state and promotes cell death. The switch is modulated by the ERK, p38 and AKT pathways. ERK activation enhances the dual specificity phosphatase (DUSP mediated dephosphorylation of JNK and shifts the threshold of the apoptotic switch to higher inputs. Activation of p38 restores the threshold by inhibiting ERK activity via the PP1 or PP2A phosphatases. Finally, AKT activation inhibits the JNK positive feedback, thus abrogating the apoptotic switch and allowing only proliferative signalling. Our model facilitates understanding of how cancerous deregulations disturb MAPK signal processing and provides explanations for certain drug resistances. We highlight a critical role of DUSP1 and DUSP2 expression patterns in facilitating the switching of JNK activity and show how oncogene induced ERK hyperactivity prevents the normal apoptotic switch explaining the failure ocertain drugs to

  16. H pylori stimulates proliferation of gastric cancer cells through activating mitogen-activated protein kinase cascade

    Institute of Scientific and Technical Information of China (English)

    Yong-Chang Chen; Ying Wang; Jing-Yan Li; Wen-Rong Xu; You-Li Zhang

    2006-01-01

    AIM: To explore the mechanism by which H pylori causes activation of gastric epithelial cells.METHODS: A VacA (+) and CagA (+) standard Hpyloriline NCTC 11637 and a human gastric adenocarcinoma derived gastric epithelial cell line BGC-823 were applied in the study. MTT assay and 3H-TdR incorporation test were used to detect the proliferation of BGC-823 cells and Western blotting was used to detect the activity and existence of related proteins.RESULTS: Incubation with Hpylori extract increased the proliferation of gastric epithelial cells, reflected by both live cell number and DNA synthesis rate. The activity of extracellular signal-regulated protein kinase (ERK) signal transduction cascade increased within 20 min after incubation with Hpylori extract and appeared to be a sustained event. MAPK/ERK kinase (MEK) inhibitor PD98059abolished the action of H pylori extract on both ERK activity and cell proliferation. Incubation with H pyloriextract increased c-Fos expression and SRE-dependentgene expression. H pylori extract caused phosphorylation of several proteins including a protein with molecular size of 97.4 kDa and tyrosine kinase inhibitor genistein inhibited the activation of ERK and the proliferation of cells caused by H pylori extract.CONCLUSION: Biologically active elements in H pylori extract cause proliferation of gastric epithelial cells through activating tyrosine kinase and ERK signal transduction cascade.

  17. Arabidopsis MAP kinase 4 negatively regulates systemic acquired resistance

    DEFF Research Database (Denmark)

    Petersen, M.; Brodersen, P.; Naested, H.

    2000-01-01

    Transposon inactivation of Arabidopsis MAP kinase 4 produced the mpk4 mutant exhibiting constitutive systemic acquired resistance (SAR) including elevated salicylic acid (SA) revels, increased resistance to virulent pathogens, and constitutive pathogenesis-related gene expression shown by Northern...

  18. Roles of MAP kinase signaling pathway in oocyte meiosis

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Mitogen-activated protein kinase (MAPK) is a family of Ser/Thr protein kinases expressed widely in eukaryotic cells. MAPK is activated by a cascade of protein kinase phosphorylation and plays pivotal roles in regulating meiosis process in oocytes. As an important physical substrate of MAPK, p90rsk mediates numerous MAPK functions. MAPK was activated at G2/M transition during meiosis. Its activity reached the peak at MⅠ stage and maintained at this level until the time before the pronuclear formation after fertilization. There is complex interplay between MAPK and MPF in the meiosis regulation. Furthermore, other intracellular signal transducers, such as cAMP, protein kinase C and protein phosphotase, ect., also regulated the activity of MAPK at different stages during meiosis in oocytes. In the present article, the roles of MAPK signaling pathway in oocyte meiosis are reviewed and discussed.

  19. Regulation and function of TPL-2,an IκB kinase-regulated MAP kinase kinase kinase

    Institute of Scientific and Technical Information of China (English)

    Thorsten Gantke; Srividya Sriskantharajah; Steven C Ley

    2011-01-01

    The IκB kinase(IKK)complex plays a well-documented role in innate and adaptive immunity.This function has been widely attributed to its role as the central activator of the NF-κB family of transcription factors.However,another important consequence of IKK activation is the regulation of TPL-2,a MEK kinase that is required for activation of ERK-1/2 MAP kinases in myeioid cells following Toll-like receptor and TNF receptor stimulation.In unstimulated cells,TPL-2 is stoichiometrically complexed with the NF-κB inhibitory protein NF-κB1 p105,which blocks TPL-2 access to its substrate MEK,and the ubiquitin-binding protein ABIN-2(A20-binding inhibitor of NF-κB 2),both of which are required to maintain TPL-2 protein stability.Following agonist stimulation,the IKK complex phosphorylates p105,triggering its K48-1inked ubiquitination and degradation by the proteasome.This releases TPL-2 from p105-mediated inhibition,facilitating activation of MEK,in addition to modulating NF-κB activation by liberating associated Rel subunits for translocation into the nucleus.IKK-induced proteolysis of 0105,therefore,can directly regulate both NF-κB and ERK MAP kinase activation via NF-κB1 p105.TPL-2 is critical for production of the proinflammatory cytokine TNF during inflammatory responses.Consequently,there has been considerable interest in the pharmaceutical industry to develop selective TPL-2 inhibitors as drugs for the treatment of TNF-dependent inflammatory,diseases,such as rheumatoid arthritis and inflammatory bowel disease.This review summarizes our current understanding of the regulation of TPL-2 signaling function,and also the complex positive and negative roles of TPL-2 in immune and inflammatory responses.

  20. MAP kinases in inflammatory bowel disease

    DEFF Research Database (Denmark)

    Coskun, Mehmet; Olsen, Jørgen; Seidelin, Jakob Benedict;

    2011-01-01

    The mammalian family of mitogen-activated protein kinases (MAPKs) is activated by diverse extracellular and intracellular stimuli, and thereby they play an essential role in connecting cell-surface receptors to changes in transcriptional programs. The MAPK signaling pathways regulate a wide range...

  1. Discovery and characterization of non-ATP site inhibitors of the mitogen activated protein (MAP) kinases.

    Science.gov (United States)

    Comess, Kenneth M; Sun, Chaohong; Abad-Zapatero, Cele; Goedken, Eric R; Gum, Rebecca J; Borhani, David W; Argiriadi, Maria; Groebe, Duncan R; Jia, Yong; Clampit, Jill E; Haasch, Deanna L; Smith, Harriet T; Wang, Sanyi; Song, Danying; Coen, Michael L; Cloutier, Timothy E; Tang, Hua; Cheng, Xueheng; Quinn, Christopher; Liu, Bo; Xin, Zhili; Liu, Gang; Fry, Elizabeth H; Stoll, Vincent; Ng, Teresa I; Banach, David; Marcotte, Doug; Burns, David J; Calderwood, David J; Hajduk, Philip J

    2011-03-18

    Inhibition of protein kinases has validated therapeutic utility for cancer, with at least seven kinase inhibitor drugs on the market. Protein kinase inhibition also has significant potential for a variety of other diseases, including diabetes, pain, cognition, and chronic inflammatory and immunologic diseases. However, as the vast majority of current approaches to kinase inhibition target the highly conserved ATP-binding site, the use of kinase inhibitors in treating nononcology diseases may require great selectivity for the target kinase. As protein kinases are signal transducers that are involved in binding to a variety of other proteins, targeting alternative, less conserved sites on the protein may provide an avenue for greater selectivity. Here we report an affinity-based, high-throughput screening technique that allows nonbiased interrogation of small molecule libraries for binding to all exposed sites on a protein surface. This approach was used to screen both the c-Jun N-terminal protein kinase Jnk-1 (involved in insulin signaling) and p38α (involved in the formation of TNFα and other cytokines). In addition to canonical ATP-site ligands, compounds were identified that bind to novel allosteric sites. The nature, biological relevance, and mode of binding of these ligands were extensively characterized using two-dimensional (1)H/(13)C NMR spectroscopy, protein X-ray crystallography, surface plasmon resonance, and direct enzymatic activity and activation cascade assays. Jnk-1 and p38α both belong to the MAP kinase family, and the allosteric ligands for both targets bind similarly on a ledge of the protein surface exposed by the MAP insertion present in the CMGC family of protein kinases and distant from the active site. Medicinal chemistry studies resulted in an improved Jnk-1 ligand able to increase adiponectin secretion in human adipocytes and increase insulin-induced protein kinase PKB phosphorylation in human hepatocytes, in similar fashion to Jnk-1 si

  2. Discovery and Characterization of Non-ATP Site Inhibitors of the Mitogen Activated Protein (MAP) Kinases

    Energy Technology Data Exchange (ETDEWEB)

    Comess, Kenneth M.; Sun, Chaohong; Abad-Zapatero, Cele; Goedken, Eric R.; Gum, Rebecca J.; Borhani, David W.; Argiriadi, Maria; Groebe, Duncan R.; Jia, Yong; Clampit, Jill E.; Haasch, Deanna L.; Smith, Harriet T.; Wang, Sanyi; Song, Danying; Coen, Michael L.; Cloutier, Timothy E.; Tang, Hua; Cheng, Xueheng; Quinn, Christopher; Liu, Bo; Xin, Zhili; Liu, Gang; Fry, Elizabeth H.; Stoll, Vincent; Ng, Teresa I.; Banach, David; Marcotte, Doug; Burns, David J.; Calderwood, David J.; Hajduk, Philip J. (Abbott)

    2012-03-02

    Inhibition of protein kinases has validated therapeutic utility for cancer, with at least seven kinase inhibitor drugs on the market. Protein kinase inhibition also has significant potential for a variety of other diseases, including diabetes, pain, cognition, and chronic inflammatory and immunologic diseases. However, as the vast majority of current approaches to kinase inhibition target the highly conserved ATP-binding site, the use of kinase inhibitors in treating nononcology diseases may require great selectivity for the target kinase. As protein kinases are signal transducers that are involved in binding to a variety of other proteins, targeting alternative, less conserved sites on the protein may provide an avenue for greater selectivity. Here we report an affinity-based, high-throughput screening technique that allows nonbiased interrogation of small molecule libraries for binding to all exposed sites on a protein surface. This approach was used to screen both the c-Jun N-terminal protein kinase Jnk-1 (involved in insulin signaling) and p38{alpha} (involved in the formation of TNF{alpha} and other cytokines). In addition to canonical ATP-site ligands, compounds were identified that bind to novel allosteric sites. The nature, biological relevance, and mode of binding of these ligands were extensively characterized using two-dimensional {sup 1}H/{sup 13}C NMR spectroscopy, protein X-ray crystallography, surface plasmon resonance, and direct enzymatic activity and activation cascade assays. Jnk-1 and p38{alpha} both belong to the MAP kinase family, and the allosteric ligands for both targets bind similarly on a ledge of the protein surface exposed by the MAP insertion present in the CMGC family of protein kinases and distant from the active site. Medicinal chemistry studies resulted in an improved Jnk-1 ligand able to increase adiponectin secretion in human adipocytes and increase insulin-induced protein kinase PKB phosphorylation in human hepatocytes, in

  3. Database for the geologic map of upper Eocene to Holocene volcanic and related rocks in the Cascade Range, Washington

    Science.gov (United States)

    Barron, Andrew D.; Ramsey, David W.; Smith, James G.

    2014-01-01

    This geospatial database for a geologic map of the Cascades Range in Washington state is one of a series of maps that shows Cascade Range geology by fitting published and unpublished mapping into a province-wide scheme of lithostratigraphic units. Geologic maps of the Eocene to Holocene Cascade Range in California and Oregon complete the series, providing a comprehensive geologic map of the entire Cascade Range that incorporates modern field studies and that has a unified and internally consistent explanantion. The complete series will be useful for regional studies of volcanic hazards, volcanology, and tectonics.

  4. Analysis of Road Traffic Network Cascade Failures with Coupled Map Lattice Method

    Directory of Open Access Journals (Sweden)

    Yanan Zhang

    2015-01-01

    Full Text Available In recent years, there is growing literature concerning the cascading failure of network characteristics. The object of this paper is to investigate the cascade failures on road traffic network, considering the aeolotropism of road traffic network topology and road congestion dissipation in traffic flow. An improved coupled map lattice (CML model is proposed. Furthermore, in order to match the congestion dissipation, a recovery mechanism is put forward in this paper. With a real urban road traffic network in Beijing, the cascading failures are tested using different attack strategies, coupling strengths, external perturbations, and attacked road segment numbers. The impacts of different aspects on road traffic network are evaluated based on the simulation results. The findings confirmed the important roles that these characteristics played in the cascading failure propagation and dissipation on road traffic network. We hope these findings are helpful to find out the optimal road network topology and avoid cascading failure on road network.

  5. The RWP-RK factor GROUNDED promotes embryonic polarity by facilitating YODA MAP kinase signaling.

    Science.gov (United States)

    Jeong, Sangho; Palmer, Travis M; Lukowitz, Wolfgang

    2011-08-09

    The division of plant zygotes is typically asymmetric, generating daughter cells with different developmental fates. In Arabidopsis, the apical daughter cell produces the proembryo, whereas the basal daughter cell forms the mostly extraembryonic suspensor. Establishment of apical and basal fates is known to depend on the YODA (YDA) mitogen-associated protein (MAP) kinase cascade and WUSCHEL-LIKE HOMEOBOX (WOX) homeodomain transcription factors. Mutations in GROUNDED (GRD) cause anatomical defects implying a partial loss of developmental asymmetry in the first division. Subsequently, suspensor-specific WOX8 expression disappears while proembryo-specific ZLL expression expands in the mutants, revealing that basal fates are confounded. GRD encodes a small nuclear protein of the RWP-RK family and is broadly transcribed in the early embryo. Loss of GRD eliminates the dominant effects of hyperactive YDA variants, indicating that GRD is required for YDA-dependent signaling in the embryo. However, GRD function is not regulated via direct phosphorylation by MAP kinases, and forced expression of GRD does not suppress the effect of yda mutations. In a strong synthetic interaction, grd;wox8;wox9 triple mutants arrest as zygotes or one-cell embryos lacking apparent polarity. The predicted transcription factor GRD acts cooperatively with WOX homeodomain proteins to establish embryonic polarity in the first division. Like YDA, GRD promotes zygote elongation and basal cell fates. GRD function is required for YDA-dependent signaling but apparently not regulated by the YDA MAP kinase cascade. Similarity of GRD to Chlamydomonas MID suggests a conserved role for small RWP-RK proteins in regulating the transcriptional programs of generative cells and the zygote. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Ras, Raf, and MAP kinase in melanoma.

    Science.gov (United States)

    Solus, Jason F; Kraft, Stefan

    2013-07-01

    A growing understanding of the biology and molecular mechanisms of melanoma has led to the identification of a number of driver mutations for this aggressive tumor. The most common mutations affect signaling of the Ras/Raf/MAPK (mitogen-activated protein kinase) pathway. This review will focus on mutations in genes encoding proteins that play a role in the MAPK pathway and that have been implicated in melanoma biology, such as BRAF, NRAS, and MEK (MAPK kinase), and detail the current understanding of their role in melanoma progression from a molecular biology perspective. Furthermore, this review will also consider some additional mutations in genes such as KIT, GNAQ, and GNA11, which can be seen in certain subtypes of melanoma and whose gene products interact with the MAPK pathway. In addition, the association of these molecular changes with clinical and classical histopathologic characteristics of melanoma will be outlined and their role in diagnosis of melanocytic lesions discussed. Finally, a basic overview of the current targeted therapy landscape, as far as relevant to the pathologist, will be provided.

  7. MEKK1,MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase cascade to regulate innate immunity in plants

    Institute of Scientific and Technical Information of China (English)

    Minghui Gao; Jinman Liu; Dongling Bi; Zhibin Zhang; Fang Cheng; Sanfeng Chen; Yuelin Zhang

    2008-01-01

    Mitogen-activated protein kinase (MAPK) cascades play important roles in regulating plant innate immune responses.In a genetic screen to search for mutants with constitutive defense responses,we identified multiple alleles of mpk4 and mekkl that exhibit cell death and constitutive defense responses.Bimolecular fluorescence complementation (BiFC) analysis showed that both MPK4 and MEKK1 interact with MKK1 and MKK2,two closely related MAPK kinases,mkk1 and mkk2 single mutant plants do not have obvious mutant phenotypes.To test whether MKK1 and MKK2 function redundantly,mkk1 mkk2 double mutants were generated.The mkk1 mkk2 double mutant plants die at seedling stage and the seedling-lethality phenotype is temperature-dependent.Similar to the mpk4 and mekk1 mutants,the mkk1 mkk2 double mutant seedlings accumulate high levels of H2O2,display spontaneous cell death,constitutively express Pathogenesis Related (PR) genes and exhibit pathogen resistance.In addition,activation of MPK4 by fig22 is impaired in the mkk1 mkk2 double mutants,suggesting that MKK1 and MKK2 function together with MPK4 and MEKK1 in a MAP kinase cascade to negatively regulate innate immune responses in plants.

  8. Effect of prolonged hydroxytamoxifen treatment of MCF-7 cells on mitogen activated kinase cascade.

    Science.gov (United States)

    Rabenoelina, Fanjaniriana; Semlali, Abdelhabib; Duchesne, Marie-Josèphe; Freiss, Gilles; Pons, Michel; Badia, Eric

    2002-04-10

    Resistance to the antiestrogen tamoxifen is the main stumbling block for the success of breast cancer therapy. We focused our study on cellular alterations induced by a prolonged treatment with the active tamoxifen metabolite hydroxytamoxifen (OHT). We show that a prolonged OHT treatment (for up to 7 days) led to a progressive increase in the level of phosphorylated p44/42 mitogen activated kinase (MAP kinase) induced by 10(-7) M TPA stimulation, without any significant change in the protein level. This effect was also observed in MCF-7 cells grown first in medium containing dextran-coated charcoal-treated FCS (DCC medium) for 20 days prior to OHT treatment, indicating a specific effect of the antiestrogen and not an effect of estrogen deprivation. It was prevented by cotreatment with estradiol and not observed in the estrogen receptor negative HeLa cell line, suggesting that it was mediated by the estrogen receptor. TPA induced phosphorylation of MEK1/2 was also raised by OHT treatment, without any change in their protein level or Raf-1 and H-Ras levels. When the MCF-7R OHT resistant cell line was grown in antiestrogen containing medium, the level of phosphorylated p44/42 MAP kinase was also high but reversed when the antiestrogen was removed. The 2 other MAP kinase, JNK and P38 pathways were not affected in the same way by OHT treatment. In conclusion, our data reveal that a prolonged OHT treatment, by increasing p44/42 MAPK activity, affects a key step in the growth control of MCF-7 cells, although not sufficiently to overcome the growth inhibitory effect of the drug. Copyright 2002 Wiley-Liss, Inc.

  9. MAP kinases Erk1/2 phosphorylate sterol regulatory element-binding protein (SREBP)-1a at serine 117 in vitro.

    Science.gov (United States)

    Roth, G; Kotzka, J; Kremer, L; Lehr, S; Lohaus, C; Meyer, H E; Krone, W; Müller-Wieland, D

    2000-10-27

    Sterol regulatory element-binding protein (SREBP)-1a is a transcription factor sensing cellular cholesterol levels and integrating gene regulatory signals mediated by MAP kinase cascades. Here we report the identification of serine 117 in SREBP-1a as the major phosphorylation site of the MAP kinases Erk1/2. This site was identified by nanoelectrospray mass spectrometry and peptide sequencing of recombinant fusion proteins phosphorylated by Erk1/2 in vitro. Serine 117 was verified as the major phosphorylation site by in vitro mutagenesis. Mutation of serine 117 to alanine abolished Erk2-mediated phosphorylation in vitro and the MAP kinase-related transcriptional activation of SREBP-1a by insulin and platelet-derived growth factor in vivo. Our data indicate that the MAP kinase-mediated effects on SREBP-1a-regulated target genes are linked to this phosphorylation site.

  10. Phosphorylation sites of Arabidopsis MAP Kinase Substrate 1 (MKS1)

    DEFF Research Database (Denmark)

    Caspersen, M.B.; Qiu, J.-L.; Zhang, X.

    2007-01-01

    The Arabidopsis MAP kinase 4 (MPK4) substrate MKS1 was expressed in Escherichia coli and purified, full-length, 6x histidine (His)-tagged MKS1 was phosphorylated in vitro by hemagglutinin (HA)-tagged MPK4 immuno-precipitated from plants. MKS1 phosphorylation was initially verified by electrophore......The Arabidopsis MAP kinase 4 (MPK4) substrate MKS1 was expressed in Escherichia coli and purified, full-length, 6x histidine (His)-tagged MKS1 was phosphorylated in vitro by hemagglutinin (HA)-tagged MPK4 immuno-precipitated from plants. MKS1 phosphorylation was initially verified...... phosphopeptide detection. As MAP kinases generally phosphorylate serine or threonine followed by proline (Ser/Thr-Pro), theoretical masses of potentially phosphorylated peptides were calculated and mass spectrometric peaks matching these masses were fragmented and searched for a neutral-loss signal...... at approximately 98 Da indicative of phosphorylation. Additionally, mass spectrometric peaks present in the MPK4-treated MKS1, but not in the control peptide map of untreated MKS1, were fragmented. Fragmentation spectra were subjected to a MASCOT database search which identified three of the twelve Ser-Pro serine...

  11. DIGITAL FLOOD INSURANCE RATE MAP DATABASE, CASCADE COUNTY, MONTANA, USA

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — The Digital Flood Insurance Rate Map (DFIRM) Database depicts flood risk Information And supporting data used to develop the risk data. The primary risk;...

  12. Mitogen-activated protein kinase kinase 4 (MAP2K4 promotes human prostate cancer metastasis.

    Directory of Open Access Journals (Sweden)

    Janet M Pavese

    Full Text Available Prostate cancer (PCa is the second leading cause of cancer death in the US. Death from PCa primarily results from metastasis. Mitogen-activated protein kinase kinase 4 (MAP2K4 is overexpressed in invasive PCa lesions in humans, and can be inhibited by small molecule therapeutics that demonstrate favorable activity in phase II studies. However, MAP2K4's role in regulating metastatic behavior is controversial and unknown. To investigate, we engineered human PCa cell lines which overexpress either wild type or constitutive active MAP2K4. Orthotopic implantation into mice demonstrated MAP2K4 increases formation of distant metastasis. Constitutive active MAP2K4, though not wild type, increases tumor size and circulating tumor cells in the blood and bone marrow. Complementary in vitro studies establish stable MAP2K4 overexpression promotes cell invasion, but does not affect cell growth or migration. MAP2K4 overexpression increases the expression of heat shock protein 27 (HSP27 protein and protease production, with the largest effect upon matrix metalloproteinase 2 (MMP-2, both in vitro and in mouse tumor samples. Further, MAP2K4-mediated increases in cell invasion are dependent upon heat shock protein 27 (HSP27 and MMP-2, but not upon MAP2K4's immediate downstream targets, p38 MAPK or JNK. We demonstrate that MAP2K4 increases human PCa metastasis, and prolonged over expression induces long term changes in cell signaling pathways leading to independence from p38 MAPK and JNK. These findings provide a mechanistic explanation for human studies linking increases in HSP27 and MMP-2 to progression to metastatic disease. MAP2K4 is validated as an important therapeutic target for inhibiting human PCa metastasis.

  13. Activation and signaling of the p38 MAP kinase pathway

    Institute of Scientific and Technical Information of China (English)

    Tyler ZARUBIN; Jiahuai HAN

    2005-01-01

    The family members of the mitogen-activated protein (MAP) kinases mediate a wide variety of cellular behaviors in response to extracellular stimuli. One of the four main sub-groups, the p38 group of MAP kinases, serve as a nexus for signal transduction and play a vital role in numerous biological processes. In this review, we highlight the known characteristics and components of the p38 pathway along with the mechanism and consequences of p38 activation. We focus on the role of p38 as a signal transduction mediator and examine the evidence linking p38 to inflammation, cell cycle, cell death, development, cell differentiation, senescence and tumorigenesis in specific cell types. Upstream and downstream components of p38 are described and questions remaining to be answered are posed. Finally, we propose several directions for future research on p38.

  14. Arabidopsis map kinase 4 negatively regulates systemic acquired resistance

    DEFF Research Database (Denmark)

    Brodersen, P; Johansen, Bo; Petersen, M;

    2000-01-01

    Transposon inactivation of Arabidopsis MAP kinase 4 produced the mpk4 mutant exhibiting constitutive systemic acquired resistance (SAR) including elevated salicylic acid (SA) levels, increased resistance to virulent pathogens, and constitutive pathogenesis-related gene expression shown by Northern...... of NPR1. PDF1.2 and THI2.1 gene induction by jasmonate was blocked in mpk4 expressing NahG, suggesting that MPK4 is required for jasmonic acid-responsive gene expression....

  15. Axon Regeneration Requires A Conserved MAP Kinase Pathway

    OpenAIRE

    Hammarlund, Marc; Nix, Paola; Hauth, Linda; Jorgensen, Erik M.; Bastiani, Michael

    2009-01-01

    Regeneration of injured neurons can restore function, but most neurons regenerate poorly or not at all. The failure to regenerate in some cases is due to a lack of activation of cell-intrinsic regeneration pathways. Thus, these pathways might be targeted for the development of therapies that can restore neuron function after injury or disease. Here, we show that the DLK-1 MAP kinase pathway is essential for regeneration in C. elegans motor neurons. Loss of this pathway eliminates regeneration...

  16. Building keypoint mappings on multispectral images by a cascade of classifiers with a resurrection mechanism.

    Science.gov (United States)

    Li, Yong; Jing, Jing; Jin, Hongbin; Qiao, Wei

    2015-05-21

    Inspired by the boosting technique for detecting objects, this paper proposes a cascade structure with a resurrection mechanism to establish keypoint mappings on multispectral images. The cascade structure is composed of four steps by utilizing best bin first (BBF), color and intensity distribution of segment (CIDS), global information and the RANSAC process to remove outlier keypoint matchings. Initial keypoint mappings are built with the descriptors associated with keypoints; then, at each step, only a small number of keypoint mappings of a high confidence are classified to be incorrect. The unclassified keypoint mappings will be passed on to subsequent steps for determining whether they are correct. Due to the drawback of a classification rule, some correct keypoint mappings may be misclassified as incorrect at a step. Observing this, we design a resurrection mechanism, so that they will be reconsidered and evaluated by the rules utilized in subsequent steps. Experimental results show that the proposed cascade structure combined with the resurrection mechanism can effectively build more reliable keypoint mappings on multispectral images than existing methods.

  17. Building Keypoint Mappings on Multispectral Images by a Cascade of Classifiers with a Resurrection Mechanism

    Directory of Open Access Journals (Sweden)

    Yong Li

    2015-05-01

    Full Text Available Inspired by the boosting technique for detecting objects, this paper proposes a cascade structure with a resurrection mechanism to establish keypoint mappings on multispectral images. The cascade structure is composed of four steps by utilizing best bin first (BBF, color and intensity distribution of segment (CIDS, global information and the RANSAC process to remove outlier keypoint matchings. Initial keypoint mappings are built with the descriptors associated with keypoints; then, at each step, only a small number of keypoint mappings of a high confidence are classified to be incorrect. The unclassified keypoint mappings will be passed on to subsequent steps for determining whether they are correct. Due to the drawback of a classification rule, some correct keypoint mappings may be misclassified as incorrect at a step. Observing this, we design a resurrection mechanism, so that they will be reconsidered and evaluated by the rules utilized in subsequent steps. Experimental results show that the proposed cascade structure combined with the resurrection mechanism can effectively build more reliable keypoint mappings on multispectral images than existing methods.

  18. Context Specificity of Stress-activated Mitogen-activated Protein (MAP) Kinase Signaling: The Story as Told by Caenorhabditis elegans.

    Science.gov (United States)

    Andrusiak, Matthew G; Jin, Yishi

    2016-04-01

    Stress-associated p38 and JNK mitogen-activated protein (MAP) kinase signaling cascades trigger specific cellular responses and are involved in multiple disease states. At the root of MAP kinase signaling complexity is the differential use of common components on a context-specific basis. The roundwormCaenorhabditis eleganswas developed as a system to study genes required for development and nervous system function. The powerful genetics ofC. elegansin combination with molecular and cellular dissections has led to a greater understanding of how p38 and JNK signaling affects many biological processes under normal and stress conditions. This review focuses on the studies revealing context specificity of different stress-activated MAPK components inC. elegans.

  19. The Croonian Lecture 1998. Identification of a protein kinase cascade of major importance in insulin signal transduction.

    Science.gov (United States)

    Cohen, P

    1999-02-28

    Diabetes affects 3% of the European population and 140 million people worldwide, and is largely a disease of insulin resistance in which the tissues fail to respond to this hormone. This emphasizes the importance of understanding how insulin signals to the cell's interior. We have recently dissected a protein kinase cascade that is triggered by the formation of the insulin 'second messenger' phosphatidylinositide (3,4,5) trisphosphate (PtdIns (3,4,5)P3) and which appears to mediate many of the metabolic actions of this hormone. The first enzyme in the cascade is termed 3-phosphoinositide-dependent protein kinase-1 (PDK1), because it only activates protein kinase B (PKB), the next enzyme in the pathway, in the presence of PtdIns (3,4,5)P3. PKB then inactivates glycogen synthase kinase-3 (GSK3). PDK1, PKB and GSK3 regulate many physiological events by phosphorylating a variety of intracellular proteins. In addition, PKB plays an important role in mediating protection against apoptosis by survival factors, such as insulin-like growth factor-1.

  20. Role of calcium, protein kinase C and MAP kinase in the activation of mast cells

    Directory of Open Access Journals (Sweden)

    Michael A. Beaven

    1996-01-01

    Full Text Available The mechanisms of activation of mast cells have been studied in most detail in rat RBL-2H3 cells. These cells respond to antigen via the IgE receptor (FceRI through sequential activation of the tyrosine kinases, Lyn and Syk, and to adenosine analogs via the adenosine A3 receptor (A3R and a pertussis toxin-sensitive G protein, most likely Gi-3. Other receptors, introduced through gene transfection, include the muscarinic ml receptor (mlR which acts via Gq/11. Stimulation of cells via FceRI, A3R or ml R leads to the activation of phospholipase (PL C, PLD and mitogen-activated protein (MAP kinase resulting in the generation of inositol phosphates and diglycerides, an increase of cytosolic Ca2+, the activation of protein kinase C (PKC and the phosphorylation of various proteins by PKC and MAP kinase. The extent and time course of these events varies for each receptor. These variations, as well as the effects of pharmacologic probes, gene transfection and reconstitution of responses in washed permeabilized cells, indicate how these events relate to functional responses. A modest but sustained elevation of cytosolic Ca2+ through an influx of extracellular Ca2+ and activation of PKCβ and PKCδ are sufficient for optimal release of preformed secretory granules. Phosphorylation of a cytosolic PLAj by AMP kinase (p42mapk and a modest increase in cytosolic Ca2+ are necessary for the activation of Pl^ and the binding of PLA2 to membranes, respectively. Finally, both de novo generation and secretion via Golgi-derived vesicles of certain cytokines are dependent on Ca2+ and PKC as well as additional signals most probably phosphorylation of proteins by Syk and p42mapk.

  1. Protein kinase D stabilizes aldosterone-induced ERK1/2 MAP kinase activation in M1 renal cortical collecting duct cells to promote cell proliferation.

    LENUS (Irish Health Repository)

    McEneaney, Victoria

    2010-01-01

    Aldosterone elicits transcriptional responses in target tissues and also rapidly stimulates the activation of protein kinase signalling cascades independently of de novo protein synthesis. Here we investigated aldosterone-induced cell proliferation and extra-cellular regulated kinase 1 and 2 (ERK1\\/2) mitogen activated protein (MAP) kinase signalling in the M1 cortical collecting duct cell line (M1-CCD). Aldosterone promoted the proliferative growth of M1-CCD cells, an effect that was protein kinase D1 (PKD1), PKCdelta and ERK1\\/2-dependent. Aldosterone induced the rapid activation of ERK1\\/2 with peaks of activation at 2 and 10 to 30 min after hormone treatment followed by sustained activation lasting beyond 120 min. M1-CCD cells suppressed in PKD1 expression exhibited only the early, transient peaks in ERK1\\/2 activation without the sustained phase. Aldosterone stimulated the physical association of PKD1 with ERK1\\/2 within 2 min of treatment. The mineralocorticoid receptor (MR) antagonist RU28318 inhibited the early and late phases of aldosterone-induced ERK1\\/2 activation, and also aldosterone-induced proliferative cell growth. Aldosterone induced the sub-cellular redistribution of ERK1\\/2 to the nuclei at 2 min and to cytoplasmic sites, proximal to the nuclei after 30 min. This sub-cellular distribution of ERK1\\/2 was inhibited in cells suppressed in the expression of PKD1.

  2. Tiam1-Rac1 Axis Promotes Activation of p38 MAP Kinase in the Development of Diabetic Retinopathy: Evidence for a Requisite Role for Protein Palmitoylation

    Directory of Open Access Journals (Sweden)

    Rajakrishnan Veluthakal

    2015-04-01

    Full Text Available Background/Aims: Evidence in multiple tissues, including retina, suggests generation of reactive oxygen species (ROS and the ensuing oxidative stress as triggers for mitochondrial defects and cell apoptosis. We recently reported novel roles for Tiam1-Rac1-Nox2 axis in retinal mitochondrial dysfunction and cell death leading to the development of diabetic retinopathy. Herein, we tested the hypothesis that activation of p38 MAP kinase, a stress kinase, represents the downstream signaling event to Rac1-Nox2 activation in diabetes-induced metabolic stress leading to capillary cell apoptosis. Methods: Activation of p38 MAP kinase was quantified by Western blotting in retinal endothelial cells incubated with high glucose (20 mM for up to 96 hours, a duration where mitochondrial dysfunction and capillary cell apoptosis can be observed. NSC23766 and 2-bromopalmitate (2-BP were used to assess the roles of Tiam1-Rac1 and palmitoylation pathways, respectively. Results: Activation of p38 MAP kinase was observed as early as 3 hours after high glucose exposure, and continued until 96 hours. Consistent with this, p38 MAP kinase activation was significantly higher in the retina from diabetic mice compared to age-matched normal mice. NSC23766 markedly attenuated hyperglycemia-induced activation of p38 MAP kinase. Lastly, 2-BP inhibited glucose-induced Rac1, Nox2 and p38 MAP kinase activation in endothelial cells. Conclusions: Tiam1-Rac1-mediated activation of Nox2 and p38 MAP kinase constitutes early signaling events leading to mitochondrial dysfunction and the development of diabetic retinopathy. Our findings also provide the first evidence to implicate novel roles for protein palmitoylation in this signaling cascade.

  3. Tiam1-Rac1 Axis Promotes Activation of p38 MAP Kinase in the Development of Diabetic Retinopathy: Evidence for a Requisite Role for Protein Palmitoylation.

    Science.gov (United States)

    Veluthakal, Rajakrishnan; Kumar, Binit; Mohammad, Ghulam; Kowluru, Anjaneyulu; Kowluru, Renu A

    2015-01-01

    Evidence in multiple tissues, including retina, suggests generation of reactive oxygen species (ROS) and the ensuing oxidative stress as triggers for mitochondrial defects and cell apoptosis. We recently reported novel roles for Tiam1-Rac1-Nox2 axis in retinal mitochondrial dysfunction and cell death leading to the development of diabetic retinopathy. Herein, we tested the hypothesis that activation of p38 MAP kinase, a stress kinase, represents the downstream signaling event to Rac1-Nox2 activation in diabetes-induced metabolic stress leading to capillary cell apoptosis. Activation of p38 MAP kinase was quantified by Western blotting in retinal endothelial cells incubated with high glucose (20 mM) for up to 96 hours, a duration where mitochondrial dysfunction and capillary cell apoptosis can be observed. NSC23766 and 2-bromopalmitate (2-BP) were used to assess the roles of Tiam1-Rac1 and palmitoylation pathways, respectively. Activation of p38 MAP kinase was observed as early as 3 hours after high glucose exposure, and continued until 96 hours. Consistent with this, p38 MAP kinase activation was significantly higher in the retina from diabetic mice compared to age-matched normal mice. NSC23766 markedly attenuated hyperglycemia-induced activation of p38 MAP kinase. Lastly, 2-BP inhibited glucose-induced Rac1, Nox2 and p38 MAP kinase activation in endothelial cells. Tiam1-Rac1-mediated activation of Nox2 and p38 MAP kinase constitutes early signaling events leading to mitochondrial dysfunction and the development of diabetic retinopathy. Our findings also provide the first evidence to implicate novel roles for protein palmitoylation in this signaling cascade.

  4. A review of redox signaling and the control of MAP kinase pathway in plants

    Directory of Open Access Journals (Sweden)

    Yukun Liu

    2017-04-01

    Full Text Available Mitogen-activated protein kinase (MAPK cascades are evolutionarily conserved modules among eukaryotic species that range from yeast, plants, flies to mammals. In eukaryotic cells, reactive oxygen species (ROS has both physiological and toxic effects. Both MAPK cascades and ROS signaling are involved in plant response to various biotic and abiotic stresses. It has been observed that not only can ROS induce MAPK activation, but also that disturbing MAPK cascades can modulate ROS production and responses. This review will discuss the potential mechanisms by which ROS may activate and/or regulate MAPK cascades in plants. The role of MAPK cascades and ROS signaling in regulating gene expression, stomatal function, and programmed cell death (PCD is also discussed. In addition, the relationship between Rboh-dependent ROS production and MAPK activation in PAMP-triggered immunity will be reviewed.

  5. Signaling Network Map of Endothelial TEK Tyrosine Kinase

    Directory of Open Access Journals (Sweden)

    Aafaque Ahmad Khan

    2014-01-01

    Full Text Available TEK tyrosine kinase is primarily expressed on endothelial cells and is most commonly referred to as TIE2. TIE2 is a receptor tyrosine kinase modulated by its ligands, angiopoietins, to regulate the development and remodeling of vascular system. It is also one of the critical pathways associated with tumor angiogenesis and familial venous malformations. Apart from the vascular system, TIE2 signaling is also associated with postnatal hematopoiesis. Despite the involvement of TIE2-angiopoietin system in several diseases, the downstream molecular events of TIE2-angiopoietin signaling are not reported in any pathway repository. Therefore, carrying out a detailed review of published literature, we have documented molecular signaling events mediated by TIE2 in response to angiopoietins and developed a network map of TIE2 signaling. The pathway information is freely available to the scientific community through NetPath, a manually curated resource of signaling pathways. We hope that this pathway resource will provide an in-depth view of TIE2-angiopoietin signaling and will lead to identification of potential therapeutic targets for TIE2-angiopoietin associated disorders.

  6. Identification of p38α MAP kinase inhibitors by pharmacophore based virtual screening

    DEFF Research Database (Denmark)

    Gangwal, Rahul P; Das, Nihar R; Thanki, Kaushik;

    2014-01-01

    The p38α mitogen-activated protein (MAP) kinase plays a vital role in treating many inflammatory diseases. In the present study, a combined ligand and structure based pharmacophore model was developed to identify potential DFG-in selective p38 MAP kinase inhibitors. Conformations of co-crystallised...

  7. The signalling mucin Msb2 regulates surface sensing and host penetration via BMP1 MAP kinase signalling in Botrytis cinerea.

    Science.gov (United States)

    Leroch, Michaela; Mueller, Nathalie; Hinsenkamp, Isabel; Hahn, Matthias

    2015-10-01

    Botrytis cinerea is a necrotrophic fungus that infects a wide range of fruit, vegetable and flower crops. Penetration of the host cuticle occurs via infection structures that are formed in response to appropriate plant surface signals. The differentiation of these structures requires a highly conserved mitogen-activated protein (MAP) kinase cascade including the MAP kinase BMP1. In yeast and several plant-pathogenic fungi, the signalling mucin Msb2 has been shown to be involved in surface recognition and MAP kinase activation. In this study, a B. cinerea msb2 mutant was generated and characterized. The mutant showed normal growth, sporulation, sclerotia formation and stress resistance. In the absence of nutrients, abnormal germination with multiple germ tubes was observed. In the presence of sugars, normal germination occurred, but msb2 germlings were almost unable to form appressoria or infection cushions on hard surfaces. Nevertheless, the msb2 mutant showed only a moderate delay in lesion formation on different host plants, and formed expanding lesions similar to the wild-type. Although the wild-type showed increasing BMP1 phosphorylation during the first hours of germination on hard surfaces, the phosphorylation levels in the msb2 mutant were strongly reduced. Several genes encoding secreted proteins were found to be co-regulated by BMP1 and Msb2 during germination. Taken together, B. cinerea Msb2 is likely to represent a hard surface sensor of germlings and hyphae that triggers infection structure formation via the activation of the BMP1 MAP kinase pathway.

  8. Preparation of Residual Gravity Maps for the Southern Cascade Mountains, Washington Using Fourier Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Dishberger, Debra McLean

    1983-04-01

    This report represents a continuation of gravity work in the Cascade Mountains of Washington supported by the Division of Geology and Earth Resources since 1974. The purpose of this research has been collection of baseline gravity data for use in geothermal resource evaluation. Results of the Division's gravity studies to date are given in Danes and Phillips (1983a, 1983b). One of the problems encountered when analyzing gravity data is distinguishing between those parts of the data that represent geologic structures of interest, and those that do not. In many cases, the features of interest are relatively small, near-surface features, such as those sought in mineral, petroleum, or geothermal exploration. Gravity anomalies caused by such structures may be distorted or masked by anomalies caused by larger, deeper geologic structures. Gravity anomalies caused by relatively shallow, small geologic structures are termed residual anomalies. Those due to broad, deep-seated features can be described as regional anomalies. The purpose of this report is to describe a Fourier analysis method for separating residual and regional gravity anomalies from a complete Bouguer gravity anomaly field. The technique has been applied to gravity data from the Southern Cascade Mountains, Washington. Residual gravity anomaly maps at a scale of 1:250,000 are presented for various regional wavelength filters, and a power spectrum of the frequency components in the South Cascade gravity data is displayed. No attempt is made to interpret the results of this study in terms of geologic structures.

  9. Phosphatidylinositol 3-kinase/Akt signaling pathway activates the WNK-OSR1/SPAK-NCC phosphorylation cascade in hyperinsulinemic db/db mice.

    Science.gov (United States)

    Nishida, Hidenori; Sohara, Eisei; Nomura, Naohiro; Chiga, Motoko; Alessi, Dario R; Rai, Tatemitsu; Sasaki, Sei; Uchida, Shinichi

    2012-10-01

    Metabolic syndrome patients have insulin resistance, which causes hyperinsulinemia, which in turn causes aberrant increased renal sodium reabsorption. The precise mechanisms underlying this greater salt sensitivity of hyperinsulinemic patients remain unclear. Abnormal activation of the recently identified with-no-lysine kinase (WNK)-oxidative stress-responsive kinase 1 (OSR1)/STE20/SPS1-related proline/alanine-rich kinase (SPAK)-NaCl cotransporter (NCC) phosphorylation cascade results in the salt-sensitive hypertension of pseudohypoaldosteronism type II. Here, we report a study of renal WNK-OSR1/SPAK-NCC cascade activation in the db/db mouse model of hyperinsulinemic metabolic syndrome. Thiazide sensitivity was increased, suggesting greater activity of NCC in db/db mice. In fact, increased phosphorylation of OSR1/SPAK and NCC was observed. In both SpakT243A/+ and Osr1T185A/+ knock-in db/db mice, which carry mutations that disrupt the signal from WNK kinases, increased phosphorylation of NCC and elevated blood pressure were completely corrected, indicating that phosphorylation of SPAK and OSR1 by WNK kinases is required for the increased activation and phosphorylation of NCC in this model. Renal phosphorylated Akt was increased in db/db mice, suggesting that increased NCC phosphorylation is regulated by the phosphatidylinositol 3-kinase/Akt signaling cascade in the kidney in response to hyperinsulinemia. A phosphatidylinositol 3-kinase inhibitor (NVP-BEZ235) corrected the increased OSR1/SPAK-NCC phosphorylation. Another more specific phosphatidylinositol 3-kinase inhibitor (GDC-0941) and an Akt inhibitor (MK-2206) also inhibited increased NCC phosphorylation. These results indicate that the phosphatidylinositol 3-kinase/Akt signaling pathway activates the WNK-OSR1/SPAK-NCC phosphorylation cascade in db/db mice. This mechanism may play a role in the pathogenesis of salt-sensitive hypertension in human hyperinsulinemic conditions, such as the metabolic syndrome.

  10. Arabidopsis MAP Kinase 4 regulates gene expression via transcription factor release in the nucleus

    DEFF Research Database (Denmark)

    Qiu, Jin-Long; Fiil, Berthe Katrine; Petersen, Klaus

    2008-01-01

    Plant and animal perception of microbes through pathogen surveillance proteins leads to MAP kinase signalling and the expression of defence genes. However, little is known about how plant MAP kinases regulate specific gene expression. We report that, in the absence of pathogens, Arabidopsis MAP...... supported by the suppression of PAD3 expression in mpk4-wrky33 double mutant backgrounds. Our data establish direct links between MPK4 and innate immunity and provide an example of how a plant MAP kinase can regulate gene expression by releasing transcription factors in the nucleus upon activation....

  11. Translational control of myelin basic protein expression by ERK2 MAP kinase regulates timely remyelination in the adult brain.

    Science.gov (United States)

    Michel, Kelly; Zhao, Tianna; Karl, Molly; Lewis, Katherine; Fyffe-Maricich, Sharyl L

    2015-05-20

    Successful myelin repair in the adult CNS requires the robust and timely production of myelin proteins to generate new myelin sheaths. The underlying regulatory mechanisms and complex molecular basis of myelin regeneration, however, remain poorly understood. Here, we investigate the role of ERK MAP kinase signaling in this process. Conditional deletion of Erk2 from cells of the oligodendrocyte lineage resulted in delayed remyelination following demyelinating injury to the adult mouse corpus callosum. The delayed repair occurred as a result of a specific deficit in the translation of the major myelin protein, MBP. In the absence of ERK2, activation of the ribosomal protein S6 kinase (p70S6K) and its downstream target, ribosomal protein S6 (S6RP), was impaired at a critical time when premyelinating oligodendrocytes were transitioning to mature cells capable of generating new myelin sheaths. Thus, we have described an important link between the ERK MAP kinase signaling cascade and the translational machinery specifically in remyelinating oligodendrocytes in vivo. These results suggest an important role for ERK2 in the translational control of MBP, a myelin protein that appears critical for ensuring the timely generation of new myelin sheaths following demyelinating injury in the adult CNS.

  12. Stimulation of receptor-associated kinase, tyrosine kinase, and MAP kinase is required for prolactin-mediated macromolecular biosynthesis and mitogenesis in Nb2 lymphoma.

    Science.gov (United States)

    Carey, G B; Liberti, J P

    1995-01-10

    Lactogens [prolactin (Prl) and growth hormone] stimulate phosphorylation of the 40S ribosomal protein, S6, in Nb2 cells by mechanisms that do not involve participation of cAMP or protein kinase A, protein kinase C, or cGMP-dependent protein kinase. However, inhibition of tyrosine kinase (TK) abrogates Prl-mediated macromolecular biosynthesis. Inasmuch as lactogen signaling may involve sequential activation of protein kinases, the effect of Prl on the well-characterized mitogen-activated protein kinase (MAPK) and S6 kinase (S6K), the enzyme responsible for S6 phosphorylation in vivo, and their relationship to Nb2 macromolecular biosynthesis and mitogenesis were investigated. The results show that MAPK stimulation is transient (peak activity, 30 min) and precedes that of S6K, which reaches a maximum at 1.5-2 h, and slowly returns towards control levels at 6 h. Both staurosporine which inhibits GH receptor-associated kinase (JAK2) and genistein (GEN), an inhibitor of membrane-associated and cytoplasmic TKs, abrogate Prl-stimulated TK, MAPK, and S6K. Rapamycin (RAP), a specific inhibitor of p70S6K, completely blocks S6K but does not affect TK and MAPK. TK and MAPK activity correlates with Prl-stimulated anabolism, i.e., protein and DNA synthesis and mitogenesis. Thus, concentrations of STR and GEN which abrogate TK and MAPK inhibit anabolism virtually 100%. However, RAP, which inhibits S6K (ca. 100%) but not TK or MAPK, only delays Prl-mediated anabolism. These results indicate that Prl signaling in Nb2 cells involves a protein kinase cascade and that regulation of receptor-associated kinase, TK, and MAPK correlates with anabolism. The role of S6K (and S6 phosphorylation) appears to be ancillary.

  13. Asymmetric double-image encryption based on cascaded discrete fractional random transform and logistic maps.

    Science.gov (United States)

    Sui, Liansheng; Duan, Kuaikuai; Liang, Junli; Hei, Xinhong

    2014-05-05

    A double-image encryption is proposed based on the discrete fractional random transform and logistic maps. First, an enlarged image is composited from two original images and scrambled in the confusion process which consists of a number of rounds. In each round, the pixel positions of the enlarged image are relocated by using cat maps which are generated based on two logistic maps. Then the scrambled enlarged image is decomposed into two components. Second, one of two components is directly separated into two phase masks and the other component is used to derive the ciphertext image with stationary white noise distribution by using the cascaded discrete fractional random transforms generated based on the logistic map. The cryptosystem is asymmetric and has high resistance against to the potential attacks such as chosen plaintext attack, in which the initial values of logistic maps and the fractional orders are considered as the encryption keys while two decryption keys are produced in the encryption process and directly related to the original images. Simulation results and security analysis verify the feasibility and effectiveness of the proposed encryption scheme.

  14. Complexes between the LKB1 tumor suppressor, STRADα/β and MO25α/β are upstream kinases in the AMP-activated protein kinase cascade

    Directory of Open Access Journals (Sweden)

    Alessi Dario R

    2003-09-01

    Full Text Available Abstract Background The AMP-activated protein kinase (AMPK cascade is a sensor of cellular energy charge that acts as a 'metabolic master switch' and inhibits cell proliferation. Activation requires phosphorylation of Thr172 of AMPK within the activation loop by upstream kinases (AMPKKs that have not been identified. Recently, we identified three related protein kinases acting upstream of the yeast homolog of AMPK. Although they do not have obvious mammalian homologs, they are related to LKB1, a tumor suppressor that is mutated in the human Peutz-Jeghers cancer syndrome. We recently showed that LKB1 exists as a complex with two accessory subunits, STRADα/β and MO25α/β. Results We report the following observations. First, two AMPKK activities purified from rat liver contain LKB1, STRADα and MO25α, and can be immunoprecipitated using anti-LKB1 antibodies. Second, both endogenous and recombinant complexes of LKB1, STRADα/β and MO25α/β activate AMPK via phosphorylation of Thr172. Third, catalytically active LKB1, STRADα or STRADβ and MO25α or MO25β are required for full activity. Fourth, the AMPK-activating drugs AICA riboside and phenformin do not activate AMPK in HeLa cells (which lack LKB1, but activation can be restored by stably expressing wild-type, but not catalytically inactive, LKB1. Fifth, AICA riboside and phenformin fail to activate AMPK in immortalized fibroblasts from LKB1-knockout mouse embryos. Conclusions These results provide the first description of a physiological substrate for the LKB1 tumor suppressor and suggest that it functions as an upstream regulator of AMPK. Our findings indicate that the tumors in Peutz-Jeghers syndrome could result from deficient activation of AMPK as a consequence of LKB1 inactivation.

  15. Control of signaling in a MAP-kinase pathway by an RNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Susanne Prinz

    Full Text Available Signaling-protein mRNAs tend to have long untranslated regions (UTRs containing binding sites for RNA-binding proteins regulating gene expression. Here we show that a PUF-family RNA-binding protein, Mpt5, represses the yeast MAP-kinase pathway controlling differentiation to the filamentous form. Mpt5 represses the protein levels of two pathway components, the Ste7 MAP-kinase kinase and the Tec1 transcriptional activator, and negatively regulates the kinase activity of the Kss1 MAP kinase. Moreover, Mpt5 specifically inhibits the output of the pathway in the absence of stimuli, and thereby prevents inappropriate cell differentiation. The results provide an example of what may be a genome-scale level of regulation at the interface of signaling networks and protein-RNA binding networks.

  16. Crystal Structure of the MAP3K TAO2 Kinase Domain Bound by an Inhibitor Staurosporine

    Institute of Scientific and Technical Information of China (English)

    Tian-Jun ZHOU; Li-Guang SUN; Yan GAO; Elizabeth J. GOLDSMITH

    2006-01-01

    Mitogen-activated protein kinase (MAPK) signal transduction pathways are ubiquitous in eukaryotic cells, which transfer signals from the cell surface to the nucleus, controlling multiple cellular programs. MAPKs are activated by MAPK kinases [MAP2Ks or MAP/extracellular signal-regulated kinase (ERK) kinases (MEK)], which in turn are activated by MAPK kinase kinases (MAP3Ks). TAO2 is a MAP3K level kinase that activates the MAP2Ks MEK3 and MEK6 to activate p38 MAPKs. Because p38 MAPKs are key regulators of expression of inflammatory cytokines, they appear to be involved in human diseases such as asthma and autoimmunity. As an upstream activator of p38s, TAO2 represents a potential drug target. Here we report the crystal structure of active TAO2 kinase domain in complex with staurosporine, a broadrange protein kinase inhibitor that inhibits TAO2 with an IC50 of 3 μM. The structure reveals that staurosporine occupies the position where the adenosine of ATP binds in TAO2, and the binding of the inhibitor mimics many features of ATP binding. Both polar and nonpolar interactions contribute to the enzyme-inhibitor recognition. Staurosporine induces conformational changes in TAO2 residues that surround the inhibitor molecule, but causes very limited global changes in the kinase. The structure provides atomic details for TAO2-staurosporine interactions, and explains the relatively low potency of staurosporine against TAO2. The structure presented here should aid in the design of inhibitors specific to TAO2 and related kinases.

  17. Targeting the Raf kinase cascade in cancer therapy--novel molecular targets and therapeutic strategies.

    Science.gov (United States)

    Lee, John T; McCubrey, James A

    2002-12-01

    The mitogen-activated protein kinases (MAPKs) are a group of signal transducers with oncogenic potential in an assortment of cell types. Dysregulated signalling from any of the members of this family has been shown to result in development of human malignancies. Consequently, the collective goal of the scientific community is to inhibit aberrant signalling initiated from these molecules whilst minimising toxicity associated with such inhibition. This review covers events responsible for MAPK activation in detail, with an emphasis placed upon possible points of pharmacological intervention. A discussion addressing numerous chemotherapeutic approaches that have been developed over the previous decade for MAPK inhibition is also included. In addition, emphasis is placed upon the various arrays of kinase inhibitors, small molecule inhibitors, competitive inhibitors, nucleic acid aptamers and other molecules which have been proven effective in prevention of MAPK signalling. Finally, the potential therapeutic promise of many of these compounds is addressed in a manner that encompasses the complexities of MAPK signal transduction, in addition to concerns surrounding the development of drug resistance.

  18. Cascaded Fresnel holographic image encryption scheme based on a constrained optimization algorithm and Henon map

    Science.gov (United States)

    Su, Yonggang; Tang, Chen; Chen, Xia; Li, Biyuan; Xu, Wenjun; Lei, Zhenkun

    2017-01-01

    We propose an image encryption scheme using chaotic phase masks and cascaded Fresnel transform holography based on a constrained optimization algorithm. In the proposed encryption scheme, the chaotic phase masks are generated by Henon map, and the initial conditions and parameters of Henon map serve as the main secret keys during the encryption and decryption process. With the help of multiple chaotic phase masks, the original image can be encrypted into the form of a hologram. The constrained optimization algorithm makes it possible to retrieve the original image from only single frame hologram. The use of chaotic phase masks makes the key management and transmission become very convenient. In addition, the geometric parameters of optical system serve as the additional keys, which can improve the security level of the proposed scheme. Comprehensive security analysis performed on the proposed encryption scheme demonstrates that the scheme has high resistance against various potential attacks. Moreover, the proposed encryption scheme can be used to encrypt video information. And simulations performed on a video in AVI format have also verified the feasibility of the scheme for video encryption.

  19. Differential effects of the peptides Stomagen, EPF1 and EPF2 on activation of MAP kinase MPK6 and the SPCH protein level.

    Science.gov (United States)

    Jewaria, Pawan Kumar; Hara, Toshiaki; Tanaka, Hirokazu; Kondo, Tatsuhiko; Betsuyaku, Shigeyuki; Sawa, Shinichiro; Sakagami, Youji; Aimoto, Saburo; Kakimoto, Tatsuo

    2013-08-01

    The positioning and density of leaf stomata are regulated by three secretory peptides, EPIDERMAL PATTERNING FACTOR 1 (EPF1), EPF2 and stomagen. Several lines of published evidence have suggested a regulatory pathway as follows. EPF1 and EPF2 are perceived by receptor complexes consisting of a receptor-like protein, TOO MANY MOUTHS (TMM), and receptor kinases, ERECTA (ER), ERECTA-LIKE (ERL) 1 and ERL2. These receptors activate a mitogen-activated protein (MAP) kinase module. MAP kinases phosphorylate and destabilize the transcription factor SPEECHLESS (SPCH), resulting in a decrease in the number of stomatal lineage cells. Stomagen acts antagonistically to EPF1 and EPF2. However, there is no direct evidence that EPF1 and EPF2 activate or that stomagen inactivates the MAP kinase cascade, through which they might regulate the SPCH level. Experimental modulation of these peptides in Arabidopsis thaliana would change the number of stomatal lineage cells in developing leaves, which in turn would change the expression of SPCH, making the interpretation difficult. Here we reconstructed this signaling pathway in differentiated leaf cells of Nicotiana benthamiana to examine signaling without the confounding effect of cell type change. We show that EPF1 and EPF2 are able to activate the MAP kinase MPK6, and that both EPF1 and EPF2 are able to decrease the SPCH level, whereas stomagen is able to increase it. Our data also suggest that EPF1 can be recognized by TMM together with any ER family receptor kinase, whereas EPF2 can be recognized by TMM together with ERL1 or ERL2, but not by TMM together with ER.

  20. Modulating factors for the Pkn4 kinase cascade in regulating 6-phosphofructokinase in Myxococcus xanthus.

    Science.gov (United States)

    Nariya, Hirofumi; Inouye, Sumiko

    2005-06-01

    Myxococcus xanthus, a Gram-negative developmental bacterium, contains a large number of protein Ser/Thr kinases (PSTKs). Among these PSTKs, Pkn4 has been shown to be 6-phosphofructokinase (PFK) kinase. PFK associates with the regulatory domain of Pkn4 (Pkn4RD) and is activated by Pkn4-mediated phosphorylation. The activation of PFK is required to consume glycogen accumulated during early development and is essential for efficient sporulation. Using the yeast two-hybrid screen, we identified three new factors, MkapA, MkapB and MkapC, that interact with Pkn4 and each contains well-known protein-protein interaction domains. MkapB contains eight tandem repeats of the TPR (tetratrico peptide repeat) domain and its interaction with Pkn4RD was phosphorylation-dependent. MkapB remained associated with Pkn4RD. As a result, Pkn4 did not interact with PFK and its activation was inhibited. While deletion of the pfk-pkn4 operon did not inhibit fruiting body formation, the spore yield was low. In contrast, a mkapB deletion mutant exhibited a 24 h delay in fruiting body formation, accumulated less glycogen in the stationary phase and gave rise to 3.2% spore formation as opposed to 100% attained with DZF1. In addition to Pkn4, MkapA associated with other membrane-associated PSTKs, Pkn1, Pkn2, Pkn8 and Pkn9, while MkapB associated with Pkn8 and Pkn9, and MkapC with Pkn8. These results indicate that there are complex PSTK networks in M. xanthus that share common modulating factors.

  1. Factors that modulate the Pkn4 kinase cascade in Myxococcus xanthus.

    Science.gov (United States)

    Nariya, Hirofumi; Inouye, Sumiko

    2005-01-01

    Myxococcus xanthus, a gram-negative developmental bacterium, contains a large number of protein Ser/Thr kinases (PSTKs). Among these PSTKs, Pkn4 is shown to be 6-phosphofructokinase (PFK) kinase. PFK associates with the regulatory domain of Pkn4 (Pkn4RD) and is activated 2.7-fold upon phosphorylation at Thr-226 by Pkn4. The activation of PFK is required to consume glycogen accumulated during early development and is essential for efficient sporulation. Three new factors, MkapA, MkapB and MkapC have been identified that associate with Pkn4 by the yeast two-hybrid screen and each contains well-known protein-protein interaction domains. MkapB interacts with Pkn4 in a phosphorylation-dependent manner and remains associated with Pkn4 after its phosphorylation. Binding of MkapB to Pkn4 prevents the interaction of Pkn4 with PFK and consequently PFK phosphorylation and activation. A pfk-pkn4 deletion mutant accumulates glycogen at a rate two folds higher than the parent strain, DZF1, at the stationary phase and early development stage, it is unable to consume glycogen during development and produces only 3.4% of the DZF1 spore yield. In contrast, an mkapB deletion mutant exhibits a 24 h delay in fruiting body formation, accumulates less glycogen in the stationary phase and gives rise to 6.4% of the DZF1 spore yield. In addition to Pkn4, MkapA associates with other membrane-associated PSTKs, Pkn1, Pkn2, Pkn8 and Pkn9, while MkapB associates with Pkn8 and Pkn9, and MkapC with Pkn8. These results indicate that there are complex PSTK networks in M. xanthus sharing common modulating factors.

  2. Lithium and neuropsychiatric therapeutics: neuroplasticity via glycogen synthase kinase-3beta, beta-catenin, and neurotrophin cascades.

    Science.gov (United States)

    Wada, Akihiko

    2009-05-01

    Mood disorders are not merely attributed to the functional defect of neurotransmission, but also are due to the structural impairment of neuroplasticity. Chronic stress decreases neurotrophin levels, precipitating or exacerbating depression; conversely, antidepressants increase expression of various neurotrophins (e.g., brain-derived neurotrophic factor and vascular endothelial growth factor), thereby blocking or reversing structural and functional pathologies via promoting neurogenesis. Since the worldwide approval of lithium therapy in 1970, lithium has been used for its anti-manic, antidepressant, and anti-suicidal effects, yet the therapeutic mechanisms at the cellular level remain not-fully defined. During the last five years, multiple lines of evidence have shown that the mood stabilization and neurogenesis by lithium are due to the lithium-induced inhibition of glycogen synthase kinase-3beta (GSK-3beta), allowing accumulation of beta-catenin and beta-catenin-dependent gene transcriptional events. Altered levels of GSK-3beta and beta-catenin are associated with various neuropsychiatric and neurodegenerative diseases, while various classical neuropsychiatric drugs inhibit GSK-3beta and up-regulate beta-catenin expression. In addition, evidence has emerged that insulin-like growth factor-I enhances antidepression, anti-anxiety, memory, neurogenesis, and angiogenesis; antidepressants up-regulate expression of insulin-like growth factor-I, while insulin-like growth factor-I up-regulates brain-derived neurotrophic factor expression and its receptor TrkB level, as well as brain-derived neurotrophic factor-induced synaptic protein levels. More importantly, physical exercise and healthy diet raise transport of peripheral circulating insulin-like growth factor I into the brain, reinforcing the expression of neurotrophins (e.g., brain-derived neurotrophic factor) and the strength of cell survival signalings (e.g., phosphoinositide 3-kinase / Akt / GSK-3beta pathway

  3. Regulation of kinase cascade activation and heat shock protein expression by poly(ADP-ribose) polymerase inhibition in doxorubicin-induced heart failure.

    Science.gov (United States)

    Bartha, Eva; Solti, Izabella; Szabo, Aliz; Olah, Gabor; Magyar, Klara; Szabados, Eszter; Kalai, Tamas; Hideg, Kalman; Toth, Kalman; Gero, Domokos; Szabo, Csaba; Sumegi, Balazs; Halmosi, Robert

    2011-10-01

    Cardiomyopathy is one of the most severe side effects of the chemotherapeutic agent doxorubicin (DOX). The formation of reactive oxygen species plays a critical role in the development of cardiomyopathies, and the pathophysiological cascade activates nuclear enzyme poly(ADP-ribose) polymerase (PARP), and kinase pathways. We characterized the effects of the PARP-inhibitor and kinase-modulator compound L-2286 in DOX-induced cardiac injury models. We studied the effect of the established superoxide dismutase-mimic Tempol and compared the effects of this agent with those of the PARP inhibitor. In the rat H9C2 cardiomyocytes, in which DOX-induced poly(ADP-ribosyl)ation, L-2286 protected them from the DOX-induced injury in a concentration-dependent manner. In the in vivo studies, mice were pretreated (for 1 week) with L-2286 or Tempol before the DOX treatment. Both the agents improved the activation of cytoprotective kinases, Akt, phospho-specific protein kinase C ϵ, ζ/λ and suppressed the activity of cell death promoting kinases glycogen synthase kinase-3β, JNK, and p38 mitogen-activated protein kinase, but the effect of PARP inhibitor was more pronounced and improved the survival as well. L-2286 activated the phosphorylation of proapoptotic transcription factor FKHR1 and promoted the expression of Hsp72 and Hsp90. These data suggest that the mode of the cytoprotective action of the PARP inhibitor may include the modulation of kinase pathways and heat shock protein expression.

  4. Bioelectrocatalytic sensor for triglycerides in human skin sebum based on enzymatic cascade reaction of lipase, glycerol kinase and glycerophosphate oxidase.

    Science.gov (United States)

    Jeong, Chi Yong; Han, Yong Duk; Yoon, Jae Ho; Yoon, Hyun C

    2014-04-10

    We report the development of an electrochemical biosensor for the quantification of triglycerides in human skin sebum, based on a multienzyme cascade reaction. The presence of excessive triglycerides in human sebum is one of the leading causes of various skin ailments. However, to the best of our knowledge, no bioelectrocatalytic approach for the quantification of sebum triglycerides has been made. In order to develop triglyceride biosensor, we fabricated a multienzyme-associated electrode incorporating lipase, glycerol kinase, and glycerophosphate oxidase. Enzymes were deposited by electrostatic force and further stabilized via crosslinking between enzymes and polymer matrices. The enzyme-modified biosensing electrode maintained its bioelectrocatalytic activity for five days. An additional constraint was the limited solubility of sebum triglycerides in aqueous electrolytes, impeding the analysis. To address this issue, triglyceride samples were prepared in the form of micelles, enabling efficient sample preparation for biosensor signaling. Calibration tests revealed that the designed assay had a detection range of 15-200mg/dL of micellar triglyceride, which covered the required determination range. The developed biosensing approach was successfully used to determine triglyceride concentrations in real sebum samples of unknown triglyceride content.

  5. A cell-autonomous molecular cascade initiated by AMP-activated protein kinase represses steroidogenesis.

    Science.gov (United States)

    Abdou, Houssein S; Bergeron, Francis; Tremblay, Jacques J

    2014-12-01

    Steroid hormones regulate essential physiological processes, and inadequate levels are associated with various pathological conditions. In testosterone-producing Leydig cells, steroidogenesis is strongly stimulated by luteinizing hormone (LH) via its receptor leading to increased cyclic AMP (cAMP) production and expression of the steroidogenic acute regulatory (STAR) protein, which is essential for the initiation of steroidogenesis. Steroidogenesis then passively decreases with the degradation of cAMP into AMP by phosphodiesterases. In this study, we show that AMP-activated protein kinase (AMPK) is activated following cAMP-to-AMP breakdown in MA-10 and MLTC-1 Leydig cells. Activated AMPK then actively inhibits cAMP-induced steroidogenesis by repressing the expression of key regulators of steroidogenesis, including Star and Nr4a1. Similar results were obtained in Y-1 adrenal cells and in the constitutively steroidogenic R2C cells. We have also determined that maximum AMPK activation following stimulation of steroidogenesis in MA-10 Leydig cells occurs when steroid hormone production has reached a plateau. Our data identify AMPK as a molecular rheostat that actively represses steroid hormone biosynthesis to preserve cellular energy homeostasis and prevent excess steroid production.

  6. Risk and Resilience Analysis of Complex Network Systems Considering Cascading Failure and Recovery Strategy Based on Coupled Map Lattices

    Directory of Open Access Journals (Sweden)

    Fuchun Ren

    2015-01-01

    Full Text Available Risk and resilience are important and challenging issues in complex network systems since a single failure may trigger a whole collapse of the systems due to cascading effect. New theories, models, and methods are urgently demanded to deal with this challenge. In this paper, a coupled map lattices (CML based approach is adopted to analyze the risk of cascading process in Watts-Strogatz (WS small-world network and Barabási and Albert (BA scale-free network, respectively. Then, to achieve an effective and robust system and provide guidance in countering the cascading failure, a modified CML model with recovery strategy factor is proposed. Numerical simulations are put forward based on small-world CML and scale-free CML. The simulation results reveal that appropriate recovery strategies would significantly improve the resilience of networks.

  7. Parallelizing Backpropagation Neural Network Using MapReduce and Cascading Model.

    Science.gov (United States)

    Liu, Yang; Jing, Weizhe; Xu, Lixiong

    2016-01-01

    Artificial Neural Network (ANN) is a widely used algorithm in pattern recognition, classification, and prediction fields. Among a number of neural networks, backpropagation neural network (BPNN) has become the most famous one due to its remarkable function approximation ability. However, a standard BPNN frequently employs a large number of sum and sigmoid calculations, which may result in low efficiency in dealing with large volume of data. Therefore to parallelize BPNN using distributed computing technologies is an effective way to improve the algorithm performance in terms of efficiency. However, traditional parallelization may lead to accuracy loss. Although several complements have been done, it is still difficult to find out a compromise between efficiency and precision. This paper presents a parallelized BPNN based on MapReduce computing model which supplies advanced features including fault tolerance, data replication, and load balancing. And also to improve the algorithm performance in terms of precision, this paper creates a cascading model based classification approach, which helps to refine the classification results. The experimental results indicate that the presented parallelized BPNN is able to offer high efficiency whilst maintaining excellent precision in enabling large-scale machine learning.

  8. Parallelizing Backpropagation Neural Network Using MapReduce and Cascading Model

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2016-01-01

    Full Text Available Artificial Neural Network (ANN is a widely used algorithm in pattern recognition, classification, and prediction fields. Among a number of neural networks, backpropagation neural network (BPNN has become the most famous one due to its remarkable function approximation ability. However, a standard BPNN frequently employs a large number of sum and sigmoid calculations, which may result in low efficiency in dealing with large volume of data. Therefore to parallelize BPNN using distributed computing technologies is an effective way to improve the algorithm performance in terms of efficiency. However, traditional parallelization may lead to accuracy loss. Although several complements have been done, it is still difficult to find out a compromise between efficiency and precision. This paper presents a parallelized BPNN based on MapReduce computing model which supplies advanced features including fault tolerance, data replication, and load balancing. And also to improve the algorithm performance in terms of precision, this paper creates a cascading model based classification approach, which helps to refine the classification results. The experimental results indicate that the presented parallelized BPNN is able to offer high efficiency whilst maintaining excellent precision in enabling large-scale machine learning.

  9. Neurotrophins stimulate phosphorylation of synapsin I by MAP kinase and regulate synapsin I-actin interactions.

    OpenAIRE

    Jovanovic, J. N.; Benfenati, F; Siow, Y L; SIHRA, T. S.; Sanghera, J.S.; Pelech, S L; Greengard, P; Czernik, A J

    1996-01-01

    The ability of neurotrophins to modulate the survival and differentiation of neuronal populations involves the Trk/MAP (mitogen-activated protein kinase) kinase signaling pathway. More recently, neurotrophins have also been shown to regulate synaptic transmission. The synapsins are a family of neuron-specific phosphoproteins that play a role in regulation of neurotransmitter release, in axonal elongation, and in formation and maintenance of synaptic contacts. We report here that synapsin I is...

  10. Uveitis as a Result of MAP Kinase Pathway Inhibition

    Directory of Open Access Journals (Sweden)

    Lavnish Joshi

    2013-11-01

    Full Text Available We report the case of a patient treated with dabrafenib and trametinib (mitogen-activated protein kinase pathway inhibitors for stage 3b cutaneous melanoma who developed bilateral uveitis. Although there have been reports of ocular side effects with this class of drugs, uveitis has not been previously reported to the best of our knowledge. This case indicates the wide range of side effects that can be seen with the newer targeted biological therapies.

  11. An unusual MAP kinase is required for efficient penetration of the plant surface by Ustilago maydis

    OpenAIRE

    Brachmann, Andreas; Schirawski, Jan; Müller, Philip; Kahmann, Regine

    2003-01-01

    In Ustilago maydis, pathogenic development is controlled by a heterodimer of the two homeodomain proteins bW and bE. We have identified by RNA fingerprinting a b-regulated gene, kpp6, which encodes an unusual MAP kinase. Kpp6 is similar to a number of other fungal MAP kinases involved in mating and pathogenicity, but contains an additional N-terminal domain unrelated to other proteins. Transcription of the kpp6 gene yields two transcripts differing in length, but encoding proteins of identica...

  12. Molecular Basis of Meiotic Maturation and Apoptosis of Oocytes, Sperm-Oocyte Interactions and Early Cleavage of Embryos in Mice, Role of Phosphatidylinositol 3-Kinase, Mos, Fas-Fas Ligand, Integrinα6 and MAP Kinase

    Directory of Open Access Journals (Sweden)

    Yumi Hoshino

    2005-01-01

    Full Text Available The interaction between molecular biology and embryology made an extensive progress in the research on gametogenesis, fertilization and early embryogenesis in mice. In this article, molecules involving in meiotic maturation and apoptosis of oocytes, sperm-oocyte interactions and early cleavage of fertilized embryos in mice are described including our recent following experiments. 1 Phosphatidylinositol 3-kinase and Akt participate in the follicle stimulating hormone-induced meiotic maturation of mouse oocytes. 2 Mos plays a crucial role in normal spindle and chromosome morphology and the reactivation of maturation promoting factor after first meiosis. 3 Follicular atresia is caused by apoptosis and the apoptosis associated with internucleosomal DNA fragmentation is directly regulated by the Fas-Fas ligand system. 4 Integrin α6β1 is involved in sperm-egg binding leading to fusion via direct association of the integrin α 6 with sperm. 5 MAP kinase cascade is activated at the M-phase and some MAP kinases other than ERKs are activated during early cleavage of fertilized eggs.

  13. The germinal center kinase GCK-1 is a negative regulator of MAP kinase activation and apoptosis in the C. elegans germline.

    Directory of Open Access Journals (Sweden)

    Katherine R Schouest

    Full Text Available The germinal center kinases (GCK constitute a large, highly conserved family of proteins that has been implicated in a wide variety of cellular processes including cell growth and proliferation, polarity, migration, and stress responses. Although diverse, these functions have been attributed to an evolutionarily conserved role for GCKs in the activation of ERK, JNK, and p38 MAP kinase pathways. In addition, multiple GCKs from different species promote apoptotic cell death. In contrast to these paradigms, we found that a C. elegans GCK, GCK-1, functions to inhibit MAP kinase activation and apoptosis in the C. elegans germline. In the absence of GCK-1, a specific MAP kinase isoform is ectopically activated and oocytes undergo abnormal development. Moreover, GCK-1- deficient animals display a significant increase in germ cell death. Our results suggest that individual germinal center kinases act in mechanistically distinct ways and that these functions are likely to depend on organ- and developmental-specific contexts.

  14. Structural Bioinformatics-Based Prediction of Exceptional Selectivity of p38 MAP Kinase Inhibitor PH-797804

    Energy Technology Data Exchange (ETDEWEB)

    Xing, Li; Shieh, Huey S.; Selness, Shaun R.; Devraj, Rajesh V.; Walker, John K.; Devadas, Balekudru; Hope, Heidi R.; Compton, Robert P.; Schindler, John F.; Hirsch, Jeffrey L.; Benson, Alan G.; Kurumbail, Ravi G.; Stegeman, Roderick A.; Williams, Jennifer M.; Broadus, Richard M.; Walden, Zara; Monahan, Joseph B.; Pfizer

    2009-07-24

    PH-797804 is a diarylpyridinone inhibitor of p38{alpha} mitogen-activated protein (MAP) kinase derived from a racemic mixture as the more potent atropisomer (aS), first proposed by molecular modeling and subsequently confirmed by experiments. On the basis of structural comparison with a different biaryl pyrazole template and supported by dozens of high-resolution crystal structures of p38{alpha} inhibitor complexes, PH-797804 is predicted to possess a high level of specificity across the broad human kinase genome. We used a structural bioinformatics approach to identify two selectivity elements encoded by the TXXXG sequence motif on the p38{alpha} kinase hinge: (i) Thr106 that serves as the gatekeeper to the buried hydrophobic pocket occupied by 2,4-difluorophenyl of PH-797804 and (ii) the bidentate hydrogen bonds formed by the pyridinone moiety with the kinase hinge requiring an induced 180{sup o} rotation of the Met109-Gly110 peptide bond. The peptide flip occurs in p38{alpha} kinase due to the critical glycine residue marked by its conformational flexibility. Kinome-wide sequence mining revealed rare presentation of the selectivity motif. Corroboratively, PH-797804 exhibited exceptionally high specificity against MAP kinases and the related kinases. No cross-reactivity was observed in large panels of kinase screens (selectivity ratio of >500-fold). In cellular assays, PH-797804 demonstrated superior potency and selectivity consistent with the biochemical measurements. PH-797804 has met safety criteria in human phase I studies and is under clinical development for several inflammatory conditions. Understanding the rationale for selectivity at the molecular level helps elucidate the biological function and design of specific p38{alpha} kinase inhibitors.

  15. MAP kinase phosphatase 2 regulates macrophage-adipocyte interaction.

    Directory of Open Access Journals (Sweden)

    Huipeng Jiao

    Full Text Available Inflammation is critical for the development of obesity-associated metabolic disorders. This study aims to investigate the role of mitogen-activated protein kinase phosphatase 2 (MKP-2 in inflammation during macrophage-adipocyte interaction.White adipose tissues (WAT from mice either on a high-fat diet (HFD or normal chow (NC were isolated to examine the expression of MKP-2. Murine macrophage cell line RAW264.7 stably expressing MKP-2 was used to study the regulation of MKP-2 in macrophages in response to saturated free fatty acid (FFA and its role in macrophage M1/M2 activation. Macrophage-adipocyte co-culture system was employed to investigate the role of MKP-2 in regulating inflammation during adipocyte-macrophage interaction. c-Jun N-terminal kinase (JNK- and p38-specific inhibitors were used to examine the mechanisms by which MKP-2 regulates macrophage activation and macrophage-adipocytes interaction.HFD changed the expression of MKP-2 in WAT, and MKP-2 was highly expressed in the stromal vascular cells (SVCs. MKP-2 inhibited the production of proinflammatory cytokines in response to FFA stimulation in macrophages. MKP-2 inhibited macrophage M1 activation through JNK and p38. In addition, overexpression of MKP-2 in macrophages suppressed inflammation during macrophage-adipocyte interaction.MKP-2 is a negative regulator of macrophage M1 activation through JNK and p38 and inhibits inflammation during macrophage-adipocyte interaction.

  16. Involvement of PI3 kinase and MAP kinase in IGF-I and insulin-induced ovarian steroidogenesis in common carp Cyprinus carpio.

    Science.gov (United States)

    Paul, Sudipta; Pramanick, Kousik; Kundu, Sourav; Roy Moulik, Sujata; Pal, Puja; Mukherjee, Dilip

    2013-01-15

    Previously, we observed that in vitro steroidogenesis in intact ovarian follicles of common carp Cyprinus carpio can alone be induced by recombinant human insulin-like growth factor (IGF-I) and bovine insulin (b-insulin) and this induction was gonadotropin-independent. To investigate early signal transduction components involved in this process, the possible role of phosphatidylinositol 3-kinase (PI3 kinase) during ovarian steroidogenesis was examined. IGF-I and b-insulin induced testosterone and 17β-estradiol production in carp ovarian theca and granulosa cells in short-term coincubation and this induction was significantly inhibited by Wortmannin and LY294002, two mechanistically different specific inhibitors of PI3 kinase. IGF-I and b-insulin were shown to activate PI3 kinase from 30 min onwards with a maximum at 90 min. In this study, we found the involvement of mitogen-activated protein kinase (MAP kinase) in the regulation of IGF-I- and b-insulin-induced steroidogenesis in carp ovary. An antagonist of mitogen-activated protein kinase kinase1/2 (MEK1/2) markedly attenuated IGF-I- and b-insulin-induced steroid production. Cells treated with IGF-I and b-insulin stimulated ERK1/2-dependent phosphorylation of extracellular signal regulated protein kinase1/2 (ERKs1/2) in a time-dependent manner, which was significantly attenuated in presence of MEK1/2 inhibitor. PI3 kinase inhibitors strongly attenuated phosphorylation and activation of MAP kinase, which was increased during IGF-I and b-insulin-induced steroidogenesis. Taken together, these results suggest that PI3 kinase is an initial component of the signal transduction pathway which precedes the MAP kinase during IGF-I- and b-insulin-induced steroidogenesis in C. carpio ovarian follicles.

  17. The MAP kinase pathway is required for entry into mitosis and cell survival.

    Science.gov (United States)

    Liu, Xiaoqi; Yan, Shi; Zhou, Tianhua; Terada, Yasuhiko; Erikson, Raymond L

    2004-01-22

    In this communication, we examined the role of the MAP kinase pathway in the G2/M phase of the cell cycle. Activation of the Plk1 and MAP kinase pathways was initially evaluated in FT210 cells, which arrest at G2 phase at the restrictive temperature (39 degrees C), due to a mutation in the cdc2 gene. Previous studies had shown that these cells enter mitosis at the nonpermissive temperature upon incubation with okadaic acid, a protein phosphatase 1 and 2A inhibitor. We show that treatment of FT210 cells at 39 degrees C with okadaic acid activated Plk1, as shown by hyperphosphorylation and elevated protein kinase activity, and also induced activation of the MAP kinase pathway. The specific Mek inhibitor PD98059 antagonized the okadaic acid-induced activation of both Plk1 and MAP kinases. This suggests that activation of the MAP kinase pathway may contribute to the okadaic acid-induced activation of Plk1 in FT210 cells at 39 degrees C. We also found that PD98059 strongly attenuated progression of HeLa cells through mitosis, and active Mek colocalizes with Plk1 at mitotic structures. To study the potential function of the MAP kinase pathway during mitosis, RNAi was used to specifically deplete five members of this pathway (Raf1, Mek1/2, Erk1/2). Each of these five protein kinases is required for cell proliferation and survival, and depletion of any of these proteins eventually leads to apoptosis. Treatment with Mek inhibitors also inhibited cell proliferation and caused apoptosis. A dramatic increase of Plk1 activities and a moderate increase of Cdc2 activities in Raf1-depleted cells indicate that Raf1-depleted cells arrest in the late G2 or M phase. Mek1 and Erk1 depletion also caused cell cycle arrest at G2, suggesting that these enzymes are required for the G2/M transition, whereas the loss of Mek2 or Erk2 caused arrest at G1.

  18. The MAP kinase substrate MKS1 is a regulator of plant defense responses

    DEFF Research Database (Denmark)

    Andreasson, Erik; Jenkins, Thomas; Brodersen, Peter

    2005-01-01

    Arabidopsis MAP kinase 4 (MPK4) functions as a regulator of pathogen defense responses, because it is required for both repression of salicylic acid (SA)-dependent resistance and for activation of jasmonate (JA)-dependent defense gene expression. To understand MPK4 signaling mechanisms, we used...

  19. Altered MAP kinase phosphorylation and impaired motor coordination in PTPRR deficient mice

    NARCIS (Netherlands)

    Chirivi, R.G.S.; Noordman, Y.E.; Zee, C.E.E.M. van der; Hendriks, W.J.A.J.

    2007-01-01

    The neuronal protein tyrosine phosphatases encoded by mouse gene Ptprr (PTPBR7, PTP-SL, PTPPBSgamma-42 and PTPPBSgamma-37) have been implicated in mitogen-activated protein (MAP) kinase deactivation on the basis of transfection experiments. To determine their physiological role in vivo, we generated

  20. Arabidopsis MAP kinase 4 regulates gene expression through transcription factor release in the nucleus.

    Science.gov (United States)

    Qiu, Jin-Long; Fiil, Berthe Katrine; Petersen, Klaus; Nielsen, Henrik Bjørn; Botanga, Christopher J; Thorgrimsen, Stephan; Palma, Kristoffer; Suarez-Rodriguez, Maria Cristina; Sandbech-Clausen, Signe; Lichota, Jacek; Brodersen, Peter; Grasser, Klaus D; Mattsson, Ole; Glazebrook, Jane; Mundy, John; Petersen, Morten

    2008-08-20

    Plant and animal perception of microbes through pathogen surveillance proteins leads to MAP kinase signalling and the expression of defence genes. However, little is known about how plant MAP kinases regulate specific gene expression. We report that, in the absence of pathogens, Arabidopsis MAP kinase 4 (MPK4) exists in nuclear complexes with the WRKY33 transcription factor. This complex depends on the MPK4 substrate MKS1. Challenge with Pseudomonas syringae or flagellin leads to the activation of MPK4 and phosphorylation of MKS1. Subsequently, complexes with MKS1 and WRKY33 are released from MPK4, and WRKY33 targets the promoter of PHYTOALEXIN DEFICIENT3 (PAD3) encoding an enzyme required for the synthesis of antimicrobial camalexin. Hence, wrky33 mutants are impaired in the accumulation of PAD3 mRNA and camalexin production upon infection. That WRKY33 is an effector of MPK4 is further supported by the suppression of PAD3 expression in mpk4-wrky33 double mutant backgrounds. Our data establish direct links between MPK4 and innate immunity and provide an example of how a plant MAP kinase can regulate gene expression by releasing transcription factors in the nucleus upon activation.

  1. Mice lacking MAP kinase phosphatase-1 have enhanced MAP kinase activity and resistance to diet-induced obesity.

    Science.gov (United States)

    Wu, J Julie; Roth, Rachel J; Anderson, Ethan J; Hong, Eun-Gyoung; Lee, Mi-Kyung; Choi, Cheol Soo; Neufer, P Darrell; Shulman, Gerald I; Kim, Jason K; Bennett, Anton M

    2006-07-01

    The mitogen-activated protein kinases (MAPK) play critical roles in the pathogenesis of diabetes and obesity. The MAPKs are inactivated by MAPK phosphatases (MKPs) either in the cytosol or nucleus. Here we show that mice lacking the nuclear-localized MKP, MKP-1 (mkp-1(-/-)), have enhanced Erk, p38 MAPK and c-Jun NH(2)-terminal kinase (JNK) activities in insulin-responsive tissues as compared with wild-type mice. Although JNK promotes insulin resistance, mkp-1(-/-) mice exhibited unimpaired insulin-mediated signaling and glucose homeostasis. We reconciled these results by demonstrating that in mkp-1(-/-) mice, JNK activity was increased in the nucleus, but not the cytosol. Significantly, mkp-1(-/-) mice are resistant to diet-induced obesity due to enhanced energy expenditure, but succumb to glucose intolerance on a high fat diet. These results suggest that nuclear regulation of the MAPKs by MKP-1 is essential for the management of metabolic homeostasis in a manner that is spatially uncoupled from the cytosolic actions of the MAPKs.

  2. Mitogen-activated protein kinase signaling in plants

    DEFF Research Database (Denmark)

    Rodriguez, Maria Cristina Suarez; Petersen, Morten; Mundy, John

    2010-01-01

    Eukaryotic mitogen-activated protein kinase (MAPK) cascades have evolved to transduce environmental and developmental signals into adaptive and programmed responses. MAPK cascades relay and amplify signals via three types of reversibly phosphorylated kinases leading to the phosphorylation of subs...... the Arabidopsis thaliana MAPKs MPK3, 4, and 6 and MAP2Ks MKK1, 2, 4, and 5. Future work needs to focus on identifying substrates of MAPKs, and on understanding how specificity is achieved among MAPK signaling pathways....

  3. Long-distance pulse propagation on high-frequency dissipative nonlinear transmission lines/resonant tunneling diode line cascaded maps

    Energy Technology Data Exchange (ETDEWEB)

    Klofai, Yerima [Department of Physics, Higher Teacher Training College, University of Maroua, PO Box 46 Maroua (Cameroon); Essimbi, B Z [Department of Physics, Faculty of Science, University of Yaounde 1, PO Box 812 Yaounde (Cameroon); Jaeger, D, E-mail: bessimb@yahoo.fr [ZHO, Optoelectronik, Universitaet Duisburg-Essen, D-47048 Duisburg (Germany)

    2011-10-15

    Pulse propagation on high-frequency dissipative nonlinear transmission lines (NLTLs)/resonant tunneling diode line cascaded maps is investigated for long-distance propagation of short pulses. Applying perturbative analysis, we show that the dynamics of each line is reduced to an expanded Korteweg-de Vries-Burgers equation. Moreover, it is found by computer experiments that the soliton developed in NLTLs experiences an exponential amplitude decay on the one hand and an exponential amplitude growth on the other. As a result, the behavior of a pulse in special electrical networks made of concatenated pieces of lines is closely similar to the transmission of information in optical/electrical communication systems.

  4. RKIP regulates MAP kinase signaling in cells with defective B-Raf activity.

    Science.gov (United States)

    Zeng, Lingchun; Ehrenreiter, Karin; Menon, Jyotsana; Menard, Ray; Kern, Florian; Nakazawa, Yoko; Bevilacqua, Elena; Imamoto, Akira; Baccarini, Manuela; Rosner, Marsha Rich

    2013-05-01

    MAP kinase (MAPK) signaling results from activation of Raf kinases in response to external or internal stimuli. Here, we demonstrate that Raf kinase inhibitory protein (RKIP) regulates the activation of MAPK when B-Raf signaling is defective. We used multiple models including mouse embryonic fibroblasts (MEFs) and primary keratinocytes from RKIP- or Raf-deficient mice as well as allografts in mice to investigate the mechanism. Loss of B-Raf protein or activity significantly reduces MAPK activation in these cells. We show that RKIP depletion can rescue the compromised ERK activation and promote proliferation, and this rescue occurs through a Raf-1 dependent mechanism. These results provide formal evidence that RKIP is a bona fide regulator of Raf-1. We propose a new model in which RKIP plays a key role in regulating the ability of cells to signal through Raf-1 to ERK in B-Raf compromised cells.

  5. BDNF stimulation of protein synthesis in cortical neurons requires the MAP kinase-interacting kinase MNK1.

    Science.gov (United States)

    Genheden, Maja; Kenney, Justin W; Johnston, Harvey E; Manousopoulou, Antigoni; Garbis, Spiros D; Proud, Christopher G

    2015-01-21

    Although the MAP kinase-interacting kinases (MNKs) have been known for >15 years, their roles in the regulation of protein synthesis have remained obscure. Here, we explore the involvement of the MNKs in brain-derived neurotrophic factor (BDNF)-stimulated protein synthesis in cortical neurons from mice. Using a combination of pharmacological and genetic approaches, we show that BDNF-induced upregulation of protein synthesis requires MEK/ERK signaling and the downstream kinase, MNK1, which phosphorylates eukaryotic initiation factor (eIF) 4E. Translation initiation is mediated by the interaction of eIF4E with the m(7)GTP cap of mRNA and with eIF4G. The latter interaction is inhibited by the interactions of eIF4E with partner proteins, such as CYFIP1, which acts as a translational repressor. We find that BDNF induces the release of CYFIP1 from eIF4E, and that this depends on MNK1. Finally, using a novel combination of BONCAT and SILAC, we identify a subset of proteins whose synthesis is upregulated by BDNF signaling via MNK1 in neurons. Interestingly, this subset of MNK1-sensitive proteins is enriched for functions involved in neurotransmission and synaptic plasticity. Additionally, we find significant overlap between our subset of proteins whose synthesis is regulated by MNK1 and those encoded by known FMRP-binding mRNAs. Together, our data implicate MNK1 as a key component of BDNF-mediated translational regulation in neurons.

  6. Mitogen activated protein kinase kinase kinase 3 (MAP3K3/MEKK3) overexpression is an early event in esophageal tumorigenesis and is a predictor of poor disease prognosis

    OpenAIRE

    2014-01-01

    Background Mitogen-activated protein kinase kinase kinase3 (MAP3K3/MEKK3) was identified to be differentially expressed in esophageal squamous cell carcinoma (ESCC) using cDNA microarrays by our laboratory. Here in we determined the clinical significance of MEKK3 in ESCC. Methods Immunohistochemical analysis of MEKK3 expression was carried out in archived tissue sections from 93 ESCCs, 47 histologically normal and 61 dysplastic esophageal tissues and correlated with clinicopathological parame...

  7. Interdomain allosteric regulation of Polo kinase by Aurora B and Map205 is required for cytokinesis.

    Science.gov (United States)

    Kachaner, David; Pinson, Xavier; El Kadhi, Khaled Ben; Normandin, Karine; Talje, Lama; Lavoie, Hugo; Lépine, Guillaume; Carréno, Sébastien; Kwok, Benjamin H; Hickson, Gilles R; Archambault, Vincent

    2014-10-27

    Drosophila melanogaster Polo and its human orthologue Polo-like kinase 1 fulfill essential roles during cell division. Members of the Polo-like kinase (Plk) family contain an N-terminal kinase domain (KD) and a C-terminal Polo-Box domain (PBD), which mediates protein interactions. How Plks are regulated in cytokinesis is poorly understood. Here we show that phosphorylation of Polo by Aurora B is required for cytokinesis. This phosphorylation in the activation loop of the KD promotes the dissociation of Polo from the PBD-bound microtubule-associated protein Map205, which acts as an allosteric inhibitor of Polo kinase activity. This mechanism allows the release of active Polo from microtubules of the central spindle and its recruitment to the site of cytokinesis. Failure in Polo phosphorylation results in both early and late cytokinesis defects. Importantly, the antagonistic regulation of Polo by Aurora B and Map205 in cytokinesis reveals that interdomain allosteric mechanisms can play important roles in controlling the cellular functions of Plks.

  8. Exploitation of latent allostery enables the evolution of new modes of MAP kinase regulation.

    Science.gov (United States)

    Coyle, Scott M; Flores, Jonathan; Lim, Wendell A

    2013-08-15

    Allosteric interactions provide precise spatiotemporal control over signaling proteins, but how allosteric activators and their targets coevolve is poorly understood. Here, we trace the evolution of two allosteric activator motifs within the yeast scaffold protein Ste5 that specifically target the mating MAP kinase Fus3. One activator (Ste5-VWA) provides pathway insulation and dates to the divergence of Fus3 from its paralog, Kss1; a second activator (Ste5-FBD) that tunes mating behavior is, in contrast, not conserved in most lineages. Surprisingly, both Ste5 activator motifs could regulate MAP kinases that diverged from Fus3 prior to the emergence of Ste5, suggesting that Ste5 activators arose by exploiting latent regulatory features already present in the MAPK ancestor. The magnitude of this latent allosteric potential drifts widely among pre-Ste5 MAP kinases, providing a pool of hidden phenotypic diversity that, when revealed by new activators, could lead to functional divergence and to the evolution of distinct signaling behaviors.

  9. FAK acts as a suppressor of RTK-MAP kinase signalling in Drosophila melanogaster epithelia and human cancer cells.

    OpenAIRE

    2014-01-01

    Receptor Tyrosine Kinases (RTKs) and Focal Adhesion Kinase (FAK) regulate multiple signalling pathways, including mitogen-activated protein (MAP) kinase pathway. FAK interacts with several RTKs but little is known about how FAK regulates their downstream signalling. Here we investigated how FAK regulates signalling resulting from the overexpression of the RTKs RET and EGFR. FAK suppressed RTKs signalling in Drosophila melanogaster epithelia by impairing MAPK pathway. This regulation was also ...

  10. Porins from Salmonella enterica Serovar Typhimurium Activate the Transcription Factors Activating Protein 1 and NF-κB through the Raf-1-Mitogen-Activated Protein Kinase Cascade

    Science.gov (United States)

    Galdiero, Massimiliano; Vitiello, Mariateresa; Sanzari, Emma; D’Isanto, Marina; Tortora, Annalisa; Longanella, Anna; Galdiero, Stefania

    2002-01-01

    In this study we examined the ability of Salmonella enterica serovar Typhimurium porins to activate activating protein 1 (AP-1) and nuclear factor κB (NF-κB) through the mitogen-activated protein kinase (MAPK) cascade, and we identified the AP-1-induced protein subunits. Our results demonstrate that these enzymes may participate in cell signaling pathways leading to AP-1 and NF-κB activation following porin stimulation of cells. Raf-1 was phosphorylated in response to the treatment of U937 cells with porins; moreover, the porin-mediated increase in Raf-1 phosphorylation is accompanied by the phosphorylation of MAPK kinase 1/2 (MEK1/2), p38, extracellular-signal-regulated kinase 1/2, and c-Jun N-terminal kinase. We used three different inhibitors of phosphorylation pathways: 2′-amino-3′-methoxyflavone (PD-098059), a selective inhibitor of MEK1 activator and the MAPK cascade; 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)1H-imidazole (SB203580), a specific inhibitor of the p38 pathway; and 7β-acetoxy-1α,6β,9α-trihydroxy-8,13-epoxy-labd-14-en-11-one (forskolin), an inhibitor at the level of Raf-1 kinase. PD-098059 pretreatment of cells decreases AP-1 and NF-κB activation by lipopolysaccharide (LPS) but not by porins, and SB203580 pretreatment of cells decreases mainly AP-1 and NF-κB activation by porins; in contrast, forskolin pretreatment of cells does not affect AP-1 and NF-κB activation following either porin or LPS stimulation. Our data suggest that the p38 signaling pathway mainly regulates AP-1 and NF-κB activation in cells treated with S. enterica serovar Typhimurium porins. Antibody electrophoretic mobility shift assays showed that JunD and c-Fos binding is found in cells treated with porins, in cells treated with LPS, and in unstimulated cells. However, by 30 to 60 min of stimulation, a different complex including c-Jun appears in cells treated with porins or LPS, while the Fra-2 subunit is present only after porin stimulation

  11. Combinatory action of VEGFR2 and MAP kinase pathways maintains endothelial-cell integrity

    Institute of Scientific and Technical Information of China (English)

    Hanbing Zhong; Danyang Wang; Nan Wang; Yesenia Rios; Haigen Huang; Song Li; Xinrong Wu; Shuo Lin

    2011-01-01

    Blood vessels normally maintain stereotyped lumen diameters and their stable structures are crucial for vascular function. However, very little is known about the molecular mechanisms controlling the maintenance of vessel diameters and the integrity of endothelial cells. We investigated this issue in zebrafish embryos by a chemical genetics approach. Small molecule libraries were screened using live Tg(kdrl:GRCFP)zn1 transgenic embryos in which endothelial cells are specifically labeled with GFP. By analyzing the effects of compounds on the morphology and function of embryonic blood vessels after lumen formation, PP1, a putative Src kinase inhibitor, was identified as capable of specifically reducing vascular lumen size by interrupting endothelial-cell integrity. The inhibitory effect is not due to Src or general VEGF signaling inhibition because another Src inhibitor and Src morpholino as well as several VEGFR inhibitors failed to produce a similar phenotype. After profiling a panel of 22 representative mammalian kinases and surveying published data, we selected a few possible new candidates. Combinational analysis of these candidate kinase inhibitors established that PP1 induced endothelial collapse by inhibiting both the VEGFR2 and MAP kinase pathways. More importantly, combinatory use of two clinically approved drugs Dasatinib and Sunitinib produced the same phenotype. This is the first study to elucidate the pathways controlling maintenance of endothelial integrity using a chemical genetics approach, indicating that endothelial integrity is controlled by the combined action of the VEGFR2 and MAP kinase pathways. Our results also suggest the possible side effect of the combination of two anticancer drugs on the circulatory system.

  12. Lidar Mapping Documents Post-glacial Faulting West of the High Cascades Axis at Crater Lake National Park, Oregon

    Science.gov (United States)

    Bacon, C. R.; Robinson, J. E.

    2014-12-01

    The Cascades magmatic arc lies mainly within the High Cascades graben system in the state of Oregon. Normal faults of the Klamath graben trend north into Mount Mazama, the volcano whose catastrophic eruption ~7700 cal y BP resulted in collapse of 8x10 km Crater Lake caldera. Geologic mapping of Mount Mazama (Bacon, USGS SIM 2832, 2008) delineated faults of the West Klamath Lake fault zone (WKLFZ) and their northern extensions through Crater Lake National Park west of the caldera. Outcrop patterns implied presence of normal faults farther west but dense conifer forest made discovery of subtle scarps impractical. Closer to the Cascades axis, successively decreasing offsets of mapped Mazama lava flows with decreasing age yielded a long-term vertical slip rate of ~0.3 mm/y on the principal fault segments of the WKLFZ near Crater Lake, where the youngest offset lavas are 35 ka in age. Other workers have found offset lateral moraine crests where Last Glacial Maximum (LGM) valley glaciers crossed the WKLFZ south of Crater Lake. A lidar survey of Crater Lake National Park in 2010 supported by the Oregon Lidar Consortium (Robinson, USGS Data Series 716, 2012) revealed meter-scale, dominantly N-S trending fault scarps with down-to-the-east displacement west of most previously mapped faults at the latitude of Crater Lake, increasing the known width of the fault zone there to as much as 11 km. Fault segments as long as 7-16 km form a semi-continuous system for virtually the entire 32 km N-S extent of lidar coverage. Along the western part of the fault zone, scarp height is as great as ~20 m. Scarp length and height imply that several M>6-7 earthquakes have occurred in late Pleistocene-Holocene time. Field observations show that the ignimbrite of the Mazama climactic eruption banks against or covers scarps. One fault vertically displaces a lateral moraine ~3 m. The moraine contains clasts of ~50 ka andesite and therefore likely dates from the LGM so that the most recent

  13. Mapping of a liver phosphorylase kinase [alpha]-subunit gene on the mouse x chromosome

    Energy Technology Data Exchange (ETDEWEB)

    Geng, Yan; Derry, J.M.J.; Barnard, P.J. (MRC Molecular Neurobiology Unit, Cambridge (United Kingdom)); Hendrickx, J.; Coucke, P.; Willems, P.R. (Univ. of Antwerp (Belgium))

    1993-01-01

    Phosphorylase kinase (PHK) is a regulatory enzyme of the glycogenolytic pathway composed of a complex of four subunits. We recently mapped the muscle [alpha]-subunit gene (Phka) to the mouse X chromosome in a region syntenic with the proximal long arm of the human X chromosome and containing the human homologue of this gene, PHKA. We now report the mapping of the liver [alpha]-subunit gene to the telomeric end of the mouse X chromosome. This mapping position would suggest a location for the human liver [alpha]-subunit gene on the proximal short arm of the X chromosome, a region recently implicated in X-linked liver glycogenosis (XLG). 20 refs., 2 figs.

  14. Inducible Deletion of Protein Kinase Map4k4 in Obese Mice Improves Insulin Sensitivity in Liver and Adipose Tissues.

    Science.gov (United States)

    Danai, Laura V; Flach, Rachel J Roth; Virbasius, Joseph V; Menendez, Lorena Garcia; Jung, Dae Young; Kim, Jong Hun; Kim, Jason K; Czech, Michael P

    2015-07-01

    Studies in vitro suggest that mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) attenuates insulin signaling, but confirmation in vivo is lacking since Map4k4 knockout is lethal during embryogenesis. We thus generated mice with floxed Map4k4 alleles and a tamoxifen-inducible Cre/ERT2 recombinase under the control of the ubiquitin C promoter to induce whole-body Map4k4 deletion after these animals reached maturity. Tamoxifen administration to these mice induced Map4k4 deletion in all tissues examined, causing decreased fasting blood glucose concentrations and enhanced insulin signaling to AKT in adipose tissue and liver but not in skeletal muscle. Surprisingly, however, mice generated with a conditional Map4k4 deletion in adiponectin-positive adipocytes or in albumin-positive hepatocytes displayed no detectable metabolic phenotypes. Instead, mice with Map4k4 deleted in Myf5-positive tissues, including all skeletal muscles tested, were protected from obesity-induced glucose intolerance and insulin resistance. Remarkably, these mice also showed increased insulin sensitivity in adipose tissue but not skeletal muscle, similar to the metabolic phenotypes observed in inducible whole-body knockout mice. Taken together, these results indicate that (i) Map4k4 controls a pathway in Myf5-positive cells that suppresses whole-body insulin sensitivity and (ii) Map4k4 is a potential therapeutic target for improving glucose tolerance and insulin sensitivity in type 2 diabetes.

  15. Deriving global flood hazard maps of fluvial floods through a physical model cascade

    OpenAIRE

    Pappenberger, F.; E. Dutra; Wetterhall, F.; Cloke, H

    2012-01-01

    Global flood hazard maps can be used in the assessment of flood risk in a number of different applications, including (re)insurance and large scale flood preparedness. Such global hazard maps can be generated using large scale physically based models of rainfall-runoff and river routing, when used in conjunction with a number of post-processing methods. In this study, the European Centre for Medium Range Weather Forecasts (ECMWF) land surface model is coupled to ERA-Interim reanalysis meteoro...

  16. Mapping the structural topology of IRS family cascades through computational biology.

    Science.gov (United States)

    Chakraborty, Chiranjib; Doss, C George Priya; Bandyopadhyay, Sanghamitra; Sarkar, Bimal Kumar; Haneef, S A Syed

    2013-01-01

    Structural topologies of proteins play significant roles in analyzing their biological functions. Converting the amino acid data in a protein sequence into structural information to outline the function of a protein is a major challenge in post-genome research which can add an extra room in understanding the protein sequence-structure-function relationships. In this study, we performed a comprehensive bioinformatics analysis of structural topology of the IRS family members such as IRS-1, IRS-2, IRS-3, IRS-4, IRS-5 and IRS-6. Based on this assessment, we found that IRS-2 encloses the highest number of α helices, β sheets and β turns in the secondary structure topology compared to IRS-1 and IRS-6. IRS family members are rich in serine or leucine residues. Among the IRS family members, the highest percentage of serine and leucine was observed in IRS-1 (15%) and IRS-5 (10%), respectively. Notably, the highest number of disulphide bonds was observed in IRS-1 (10) which is responsible for structural stability of the protein. Hydrogen bond pattern in α helices and β sheet was recorded in IRS-1, IRS-2 and IRS-6. By conservation analysis, the longest protein IRS-3 was found to be highly conserved among the IRS family members. The cluster of sequence logo present in the N terminus of these cascades was noted, and highly conserved residues in N-terminal region help in the formation of the two highly conserved domains such as PH domain and PTB domain. Results generated from this analysis will be more beneficial to researchers in understanding more about insulin signalling mechanism(s) as well as insulin resistance pathway. We discuss here that bioinformatics tools utilized in this study can play a vital role in addressing the complexity of structural topology to understand structure-function relationships in insulin signalling cascades.

  17. Involvement of the mitogen-activated protein (MAP kinase signalling pathway in host cell invasion by Toxoplasma gondii

    Directory of Open Access Journals (Sweden)

    Robert-Gangneux F.

    2000-06-01

    Full Text Available Little is known about signalling in Toxoplasma gondii, but it is likely that protein kinases might play a key role in the parasite proliferation, differentiation and probably invasion. We previously characterized Mitogen-Activated Protein (MAP kinases in T. gondii lysates. In this study, cultured cells were tested for their susceptibility to Toxoplasma gondii infection after tachyzoite pretreatment with drugs interfering with AMP kinase activation pathways. Protein kinases inhibitors, i.e. genistein, R031-8220 and PD098059, reduced tachyzoite infectivity by 38 ± 4.5 %, 85.5 ± 9 % and 56 ± 10 %, respectively. Conversely, protein kinases activators, i.e. bombesin and PMA, markedly increased infectivity (by 202 ± 37 % and 258 ± 14 %, respectively. These results suggest that signalling pathways involving PKC and AAAP kinases play a role in host cell invasion by Toxoplasma.

  18. Arabidopsis mitogen-activated protein kinase kinases MKK1 and MKK2 have overlapping functions in defense signaling mediated by MEKK1, MPK4, and MKS1

    DEFF Research Database (Denmark)

    Qiu, Jin-Long; Zhou, Lu; Yun, Byung-Wook

    2008-01-01

    The Arabidopsis thaliana MKK1 and MKK2 MAP kinase kinases have been implicated in biotic and abiotic stress responses as part of a signalling cascade including MEKK1 and MPK4. Here, the double loss-of-function mutant (mkk1/2) of MKK1 and MKK2 is shown to have marked phenotypes in development...

  19. PSM/SH2-B distributes selected mitogenic receptor signals to distinct components in the PI3-kinase and MAP kinase signaling pathways.

    Science.gov (United States)

    Deng, Youping; Xu, Hu; Riedel, Heimo

    2007-02-15

    The Pro-rich, PH, and SH2 domain containing mitogenic signaling adapter PSM/SH2-B has been implicated as a cellular partner of various mitogenic receptor tyrosine kinases and related signaling mechanisms. Here, we report in a direct comparison of three peptide hormones, that PSM participates in the assembly of distinct mitogenic signaling complexes in response to insulin or IGF-I when compared to PDGF in cultured normal fibroblasts. The complex formed in response to insulin or IGF-I involves the respective peptide hormone receptor and presumably the established components leading to MAP kinase activation. However, our data suggest an alternative link from the PDGF receptor via PSM directly to MEK1/2 and consequently also to p44/42 activation, possibly through a scaffold protein. At least two PSM domains participate, the SH2 domain anticipated to link PSM to the respective receptor and the Pro-rich region in an association with an unidentified downstream component resulting in direct MEK1/2 and p44/42 regulation. The PDGF receptor signaling complex formed in response to PDGF involves PI 3-kinase in addition to the same components and interactions as described for insulin or IGF-I. PSM associates with PI 3-kinase via p85 and in addition the PSM PH domain participates in the regulation of PI 3-kinase activity, presumably through membrane interaction. In contrast, the PSM Pro-rich region appears to participate only in the MAP kinase signal. Both pathways contribute to the mitogenic response as shown by cell proliferation, survival, and focus formation. PSM regulates p38 MAP kinase activity in a pathway unrelated to the mitogenic response.

  20. Bendamustine increases interleukin-10 secretion from B cells via p38 MAP kinase activation.

    Science.gov (United States)

    Lu, Le; Yoshimoto, Keiko; Morita, Atsuho; Kameda, Hideto; Takeuchi, Tsutomu

    2016-10-01

    We investigated the effects of bendamustine on B cell functions and explored potential clinical applications of the drugs to autoimmune diseases. Proliferation of Ramos cells, a human B cell line, was significantly inhibited by 25-100μM of bendamustine in a dose-dependent manner. Concordantly, IgM secretion from Ramos cells was significantly inhibited at these concentrations by up to 70%. Interestingly, however, the production and secretion of interleukin-10 (IL-10) were dramatically (at least >10-fold) increased by bendamustine at growth inhibitory concentrations. Exploration of the molecular mechanism of IL-10 production revealed that bendamustine enhanced the phosphorylation of p38 MAP kinase. Further, Sp1 was identified as a downstream transcription factor, and the inhibition of p38 MAP kinase and Sp1 with their inhibitors led to the abrogation of bendamustine-induced IL-10 production and the DNA binding of Sp1. Importantly, when PBMC from healthy donors were cultured with bendamustine at the concentration of 30μM, under the stimulation with an anti-IgM antibody, an anti-CD40 antibody, recombinant human IL-21 (rhIL-21) and recombinant human soluble BAFF (rhsBAFF), IL-10 production by B cells (CD20+CD4-CD8-CD14-) among peripheral blood mononuclear cell (PBMC) was significantly enhanced by adding bendamustine. These results collectively suggest that the p38 MAP kinase-Sp1 pathway plays a crucial role in bendamustine-induced IL-10 production by B cells. Our findings suggest a novel therapeutic possibility for autoimmune diseases through the upregulation of IL-10 which has an anti-inflammatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Deriving global flood hazard maps of fluvial floods through a physical model cascade

    Science.gov (United States)

    Pappenberger, Florian; Dutra, Emanuel; Wetterhall, Fredrik; Cloke, Hannah L.

    2013-04-01

    Global flood hazard maps can be used in the assessment of flood risk in a number of different applications, including (re)insurance and large scale flood preparedness. Such global hazard maps can be generated using large scale physically based models of rainfall-runoff and river routing, when used in conjunction with a number of post-processing methods. In this study, the European Centre for Medium Range Weather Forecasts (ECMWF) land surface model is coupled to ERA-Interim reanalysis meteorological forcing data, and resultant runoff is passed to a river routing algorithm which simulates floodplains and flood flow across the global land area. The global hazard map is based on a 30 yr (1979-2010) simulation period. A Gumbel distribution is fitted to the annual maxima flows to derive a number of flood return periods. The return periods are calculated initially for a 25 × 25 km grid, which is then reprojected onto a 1 × 1 km grid to derive maps of higher resolution and estimate flooded fractional area for the individual 25 × 25 km cells. Several global and regional maps of flood return periods ranging from 2 to 500 yr are presented. The results compare reasonably to a benchmark data set of global flood hazard. The developed methodology can be applied to other datasets on a global or regional scale.

  2. Deriving global flood hazard maps of fluvial floods through a physical model cascade

    Directory of Open Access Journals (Sweden)

    F. Pappenberger

    2012-11-01

    Full Text Available Global flood hazard maps can be used in the assessment of flood risk in a number of different applications, including (reinsurance and large scale flood preparedness. Such global hazard maps can be generated using large scale physically based models of rainfall-runoff and river routing, when used in conjunction with a number of post-processing methods. In this study, the European Centre for Medium Range Weather Forecasts (ECMWF land surface model is coupled to ERA-Interim reanalysis meteorological forcing data, and resultant runoff is passed to a river routing algorithm which simulates floodplains and flood flow across the global land area. The global hazard map is based on a 30 yr (1979–2010 simulation period. A Gumbel distribution is fitted to the annual maxima flows to derive a number of flood return periods. The return periods are calculated initially for a 25 × 25 km grid, which is then reprojected onto a 1 × 1 km grid to derive maps of higher resolution and estimate flooded fractional area for the individual 25 × 25 km cells. Several global and regional maps of flood return periods ranging from 2 to 500 yr are presented. The results compare reasonably to a benchmark data set of global flood hazard. The developed methodology can be applied to other datasets on a global or regional scale.

  3. Suppression of integrin activation by activated Ras or Raf does not correlate with bulk activation of ERK MAP kinase.

    Science.gov (United States)

    Hughes, Paul E; Oertli, Beat; Hansen, Malene; Chou, Fan-Li; Willumsen, Berthe M; Ginsberg, Mark H

    2002-07-01

    The rapid modulation of ligand-binding affinity ("activation") is a central property of the integrin family of cell adhesion receptors. The Ras family of small GTP-binding proteins and their downstream effectors are key players in regulating integrin activation. H-Ras can suppress integrin activation in fibroblasts via its downstream effector kinase, Raf-1. In contrast, to H-Ras, a closely related small GTP-binding protein R-Ras has the opposite activity, and promotes integrin activation. To gain insight into the regulation of integrin activation by Ras GTPases, we created a series of H-Ras/R-Ras chimeras. We found that a 35-amino acid stretch of H-Ras was required for full suppressive activity. Furthermore, the suppressive chimeras were weak activators of the ERK1/2 MAP kinase pathway, suggesting that the suppression of integrin activation may be independent of the activation of the bulk of ERK MAP kinase. Additional data demonstrating that the ability of H-Ras or Raf-1 to suppress integrin activation was unaffected by inhibition of bulk ERK1/2 MAP kinase activation supported this hypothesis. Thus, the suppression of integrin activation is a Raf kinase induced regulatory event that can be mediated independently of bulk activation of the ERK MAP-kinase pathway.

  4. PD98059, a specific MAP kinase inhibitor, attenuates multiple organ dysfunction syndrome/failure (MODS) induced by zymosan in mice.

    Science.gov (United States)

    Di Paola, Rosanna; Galuppo, Maria; Mazzon, Emanuela; Paterniti, Irene; Bramanti, Placido; Cuzzocrea, Salvatore

    2010-02-01

    PD98059 (MEK1 Inhibitor) has been shown to act in vivo as a highly selective inhibitor of MEK1 activation and the MAP kinase cascade. In the present study, we have investigated the effects of PD98059, on the development of non-septic shock caused by zymosan in mice. Mice received either intraperitoneally zymosan (500mg/kg, administered i.p. as a suspension in saline) or vehicle (0.25ml/mouse saline). PD98059 (10mg/kg) was administered 1 and 6h after zymosan administration i.p. Organ failure and systemic inflammation in mice was assessed 18h after administration of zymosan and/or PD98059. Treatment of mice with PD98059 attenuated the peritoneal exudation and the migration of polymorphonuclear cells caused by zymosan. PD98059 also attenuated the lung, liver and pancreatic injury and renal dysfunction caused by zymosan as well as the increase of TNF-alpha and IL-1beta plasma levels caused by zymosan. Immunohistochemical analysis for inducible nitric oxide synthase (iNOS), nitrotyrosine, poly(ADP-ribose) (PAR), ICAM-1, P-selectin, Bax, Bcl-2 and FAS-ligand revealed positive staining in pancreatic and intestinal tissue obtained from zymosan-injected mice. The degree of staining for nitrotyrosine, iNOS, PAR, ICAM-1, P-selectin, Bax, Bcl-2 and FAS-ligand were markedly reduced in tissue sections obtained from zymosan-injected mice, which had received PD98059. Moreover treatment of mice with PD98059 (10mg/kg) attenuated the NF-kappaB activation and mitogen-activated protein kinases (MAPK) expression induced by zymosan injection. In addition, administration of zymosan caused a severe illness in the mice characterized by a systemic toxicity, significant loss of body weight and a 60% of mortality at the end of observation period. Treatment with PD98059 significantly reduced the development of systemic toxicity, the loss in body weight and the mortality (20%) caused by zymosan. This study provides evidence that PD98059 attenuates the degree of zymosan-induced non-septic shock

  5. Facial/License Plate Detection Using a Two-Level Cascade Classifier and a Single Convolutional Feature Map

    Directory of Open Access Journals (Sweden)

    Ying-Nong Chen

    2015-12-01

    Full Text Available In this paper, an object detector is proposed based on a convolution/subsampling feature map and a two-level cascade classifier. First, a convolution/subsampling operation alleviates illumination, rotation and noise variances. Then, two classifiers are concatenated to check a large number of windows using a coarse-to-fine strategy. Since the sub-sampled feature map with enhanced pixels was fed into the coarse-level classifier, the checked windows were drastically reduced to a quarter of the original image. A few remaining windows showing detailed data were further checked using a fine-level classifier. In addition to improving the detection process, the proposed mechanism also sped up the training process. Some features generated from the prototypes within the small window were selected and trained to obtain the coarse-level classifier. Moreover, a feature ranking algorithm reduced the large feature pool to a small set, thus speeding up the training process without losing detection performance. The contribution of this paper is twofold: first, the coarse-to-fine scheme shortens both the training and detection processes. Second, the feature ranking algorithm reduces training time. Finally, some experimental results were achieved for evaluation. From the results, the proposed method was shown to outperform the rapidly performing Adaboost, as well as forward feature selection methods.

  6. The role of arachidonic acid/cyclooxygenase cascade, phosphodiesterase IV and Rho-kinase in H2S-induced relaxation in the mouse corpus cavernosum.

    Science.gov (United States)

    Aydinoglu, Fatma; Ogulener, Nuran

    2017-08-01

    Penile corpus cavernosum is an extremely vascularized tissue and cavernosal smooth muscle tone is regulated by the balance between contractile and relaxant factor. We investigated the possible role of arachidonic acid/cyclooxygenase cascade, phosphodiesterase IV (PDEIV) and Rho-kinase in exogenous hydrogen sulfide (H2S)-induced relaxation in mouse corpus cavernosum. The relaxant response to H2S (NaHS as exogenous H2S; 1-1000μM) were obtained in isolated mouse corpus cavernosum tissues which pre-contracted by phenylephrine (5μM). The effects of 4-(4-octadecylphenyl)-4-oxobutenoic acid (OBAA; 10μM), a selective phospholipase A2 (PLA2) inhibitor, indomethacin (1μM), a non-selective cyclooxygenase (COX) inhibitor, baicalein (10μM), a lipoxygenase (LOX) inhibitor, and proadifen (10μM), cytochrome P450 inhibitor, on the relaxant responses to H2S were investigated. Furthermore, the effects of theophylline (500μM) and rolipram (1μM), a non-selective and selective PDEIV inhibitor, and fasudil (3μM), a specific Rho-kinase inhibitor, were studied on H2S-induced relaxation. H2S-induced relaxations were significantly reduced by OBAA, indomethacin and proadifen but not baicalein. Furthermore, theophylline, rolipram and fasudil reduced H2S-induced relaxations. These results suggest that PLA2, COX, cytochrome P450, PDEIV and Rho-kinase pathway may involve in H2S-induced relaxation in mouse corpus cavernosum tissues. Copyright © 2017 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  7. Inhibition of fast axonal transport by pathogenic SOD1 involves activation of p38 MAP kinase.

    Directory of Open Access Journals (Sweden)

    Gerardo A Morfini

    Full Text Available Dying-back degeneration of motor neuron axons represents an established feature of familial amyotrophic lateral sclerosis (FALS associated with superoxide dismutase 1 (SOD1 mutations, but axon-autonomous effects of pathogenic SOD1 remained undefined. Characteristics of motor neurons affected in FALS include abnormal kinase activation, aberrant neurofilament phosphorylation, and fast axonal transport (FAT deficits, but functional relationships among these pathogenic events were unclear. Experiments in isolated squid axoplasm reveal that FALS-related SOD1 mutant polypeptides inhibit FAT through a mechanism involving a p38 mitogen activated protein kinase pathway. Mutant SOD1 activated neuronal p38 in mouse spinal cord, neuroblastoma cells and squid axoplasm. Active p38 MAP kinase phosphorylated kinesin-1, and this phosphorylation event inhibited kinesin-1. Finally, vesicle motility assays revealed previously unrecognized, isoform-specific effects of p38 on FAT. Axon-autonomous activation of the p38 pathway represents a novel gain of toxic function for FALS-linked SOD1 proteins consistent with the dying-back pattern of neurodegeneration characteristic of ALS.

  8. Intermittent hypoxia-induced endothelial barrier dysfunction requires ROS-dependent MAP kinase activation.

    Science.gov (United States)

    Makarenko, Vladislav V; Usatyuk, Peter V; Yuan, Guoxiang; Lee, May M; Nanduri, Jayasri; Natarajan, Viswanathan; Kumar, Ganesh K; Prabhakar, Nanduri R

    2014-04-15

    The objective of the present study was to determine the impact of simulated apnea with intermittent hypoxia (IH) on endothelial barrier function and assess the underlying mechanism(s). Experiments were performed on human lung microvascular endothelial cells exposed to IH-consisting alternating cycles of 1.5% O2 for 30s followed by 20% O2 for 5 min. IH decreased transendothelial electrical resistance (TEER) suggesting attenuated endothelial barrier function. The effect of IH on TEER was stimulus dependent and reversible after reoxygenation. IH-exposed cells exhibited stress fiber formation and redistribution of cortactin, vascular endothelial-cadherins, and zona occludens-1 junction proteins along with increased intercellular gaps at cell-cell boundaries. Extracellular signal-regulated kinase (ERK) and c-jun NH2-terminal kinase (JNK) were phosphorylated in IH-exposed cells. Inhibiting either ERK or JNK prevented the IH-induced decrease in TEER and the reorganization of the cytoskeleton and junction proteins. IH increased reactive oxygen species (ROS) levels, and manganese (III) tetrakis (1-methyl-4-pyridyl) porphyrin pentachloride, a membrane-permeable antioxidant, prevented ERK and JNK phosphorylation as well as IH-induced changes in endothelial barrier function. These results demonstrate that IH via ROS-dependent activation of MAP kinases leads to reorganization of cytoskeleton and junction proteins resulting in endothelial barrier dysfunction.

  9. Rapamycin induces mitogen-activated protein (MAP) kinase phosphatase-1 (MKP-1) expression through activation of protein kinase B and mitogen-activated protein kinase kinase pathways.

    Science.gov (United States)

    Rastogi, Ruchi; Jiang, Zhongliang; Ahmad, Nisar; Rosati, Rita; Liu, Yusen; Beuret, Laurent; Monks, Robert; Charron, Jean; Birnbaum, Morris J; Samavati, Lobelia

    2013-11-22

    Mitogen-activated protein kinase phosphatase-1 (MKP-1), also known as dual specificity phosphatase-1 (DUSP-1), plays a crucial role in the deactivation of MAPKs. Several drugs with immune-suppressive properties modulate MKP-1 expression as part of their mechanism of action. We investigated the effect of mTOR inhibition through rapamycin and a dual mTOR inhibitor (AZD2014) on MKP-1 expression. Low dose rapamycin led to a rapid activation of both AKT and ERK pathways with a subsequent increase in MKP-1 expression. Rapamycin treatment led to phosphorylation of CREB, transcription factor 1 (ATF1), and ATF2, three transcription factors that bind to the cyclic AMP-responsive elements on the Mkp-1 promoter. Inhibition of either the MEK/ERK or the AKT pathway attenuated rapamycin-mediated MKP-1 induction. AZD2014 did not activate AKT but activated the ERK pathway, leading to a moderate MKP-1 induction. Using bone marrow-derived macrophages (BMDMs) derived from wild-type (WT) mice or mice deficient in AKT1 and AKT2 isoforms or BMDM from targeted deficiency in MEK1 and MEK2, we show that rapamycin treatment led to an increased MKP1 expression in BMDM from WT but failed to do so in BMDMs lacking the AKT1 isoform or MEK1 and MEK2. Importantly, rapamycin pretreatment inhibited LPS-mediated p38 activation and decreased nitric oxide and IL-6 production. Our work provides a conceptual framework for the observed immune modulatory effect of mTOR inhibition.

  10. Role of signal transduction crosstalk between adenylyl cyclase and MAP kinase in hippocampus-dependent memory.

    Science.gov (United States)

    Xia, Zhengui; Storm, Daniel R

    2012-08-16

    One of the intriguing questions in neurobiology is how long-term memory (LTM) traces are established and maintained in the brain. Memory can be divided into at least two temporally and mechanistically distinct forms. Short-term memory (STM) lasts no longer than several hours, while LTM persists for days or longer. A crucial step in the generation of LTM is consolidation, a process in which STM is converted to LTM. Hippocampus-dependent LTM depends on activation of Ca(2+), Erk/MAP kinase (MAPK), and cAMP signaling pathways, as well as de novo gene expression and translation. One of the transcriptional pathways strongly implicated in LTM is the CREB/CRE (calcium, cAMP response element) transcriptional pathway. Interestingly, this transcriptional pathway may also contribute to other forms of neuroplasticity including adaptive responses to drugs. Evidence discussed in this review indicates that activation of the Erk1/2 MAP Kinase (MAPK)/CRE transcriptional pathway during the formation of hippocampus-dependent memory depends on calmodulin (CaM)-stimulated adenylyl cyclases.

  11. An unusual MAP kinase is required for efficient penetration of the plant surface by Ustilago maydis.

    Science.gov (United States)

    Brachmann, Andreas; Schirawski, Jan; Müller, Philip; Kahmann, Regine

    2003-05-01

    In Ustilago maydis, pathogenic development is controlled by a heterodimer of the two homeodomain proteins bW and bE. We have identified by RNA fingerprinting a b-regulated gene, kpp6, which encodes an unusual MAP kinase. Kpp6 is similar to a number of other fungal MAP kinases involved in mating and pathogenicity, but contains an additional N-terminal domain unrelated to other proteins. Transcription of the kpp6 gene yields two transcripts differing in length, but encoding proteins of identical mass. One transcript is upregulated by the bW/bE heterodimer, while the other is induced after pheromone stimulation. kpp6 deletion mutants are attenuated in pathogenicity. kpp6(T355A,Y357F) mutants carrying a non-activatable allele of kpp6 are more severely compromised in pathogenesis. These strains can still form appressoria, but are defective in the subsequent penetration of the plant cuticle. Kpp6 is expressed during all stages of the sexual life cycle except mature spores. We speculate that Kpp6 may respond to a plant signal and regulate the genes necessary for efficient penetration of plant tissue.

  12. Valproate inhibits MAP kinase signalling and cell cycle progression in S. cerevisiae

    Science.gov (United States)

    Desfossés-Baron, Kristelle; Hammond-Martel, Ian; Simoneau, Antoine; Sellam, Adnane; Roberts, Stephen; Wurtele, Hugo

    2016-01-01

    The mechanism of action of valproate (VPA), a widely prescribed short chain fatty acid with anticonvulsant and anticancer properties, remains poorly understood. Here, the yeast Saccharomyces cerevisiae was used as model to investigate the biological consequences of VPA exposure. We found that low pH strongly potentiates VPA-induced growth inhibition. Transcriptional profiling revealed that under these conditions, VPA modulates the expression of genes involved in diverse cellular processes including protein folding, cell wall organisation, sexual reproduction, and cell cycle progression. We further investigated the impact of VPA on selected processes and found that this drug: i) activates markers of the unfolded protein stress response such as Hac1 mRNA splicing; ii) modulates the cell wall integrity pathway by inhibiting the activation of the Slt2 MAP kinase, and synergizes with cell wall stressors such as micafungin and calcofluor white in preventing yeast growth; iii) prevents activation of the Kss1 and Fus3 MAP kinases of the mating pheromone pathway, which in turn abolishes cellular responses to alpha factor; and iv) blocks cell cycle progression and DNA replication. Overall, our data identify heretofore unknown biological responses to VPA in budding yeast, and highlight the broad spectrum of cellular pathways influenced by this chemical in eukaryotes. PMID:27782169

  13. Mite and cockroach proteases activate p44/p42 MAP kinases in human lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Kong Xiaoyuan

    2003-10-01

    Full Text Available Abstract Background The mechanisms underlying epithelial cell activation by indoor inhaled antigens are poorly understood. Methods In this study, we investigated the role of mitogen-activated protein kinases (MAPKs in A549 epithelial cells upon exposure to antigens of house dust mite (HDMA, German cockroach (GCA, and American cockroach (ACA. Results Each of these antigens induced a significant increase in IL-8 levels compared to the medium control. Exposure of A549 cells to these antigens induced the phosphorylation of p44/42 MAPKs within 5 minutes, which reached a peak at 25 minutes later and reached baseline levels at 1 hour after exposure. PD98059, a MEK1 inhibitor, significantly decreased phosphorylation of p44/p42 MAPKs and IL-8 production. Exposure of A549 cells with antigens, which had been preincubated with different protease inhibitors, also resulted in a reduction of both MAPK phosphorylation and IL-8 production. Conclusion Thus, proteolytic antigens present in HDMA, GCA and ACA activate the p44/42 MAPKs airway epithelial cells, which lead to elevated IL-8 production and initiation of the inflammatory cascade.

  14. Modeling and hazard mapping of complex cascading mass movement processes: the case of glacier lake 513, Carhuaz, Peru

    Science.gov (United States)

    Schneider, Demian; Huggel, Christian; García, Javier; Ludeña, Sebastian; Cochachin, Alejo

    2013-04-01

    that complex cascades of mass movement processes can realistically be modeled using different models and model parameters. The method to semi-automatically produce hazard maps is promising and should be applied in other case studies. Verification of model based results in the field remains an important requirement. Results from this study are important for the GLOF early warning system that is currently in an implementation phase, and for risk reduction efforts in general.

  15. Hormonal activation of a kinase cascade localized at the mitochondria is required for StAR protein activity.

    Science.gov (United States)

    Poderoso, Cecilia; Maloberti, Paula; Duarte, Alejandra; Neuman, Isabel; Paz, Cristina; Cornejo Maciel, Fabiana; Podesta, Ernesto J

    2009-03-01

    It is known that ERK1/2 and MEK1/2 participate in the regulation of Star gene transcription. However, their role in StAR protein post-transcriptional regulation is not described yet. In this study we analyzed the relationship between the MAPK cascade and StAR protein phosphorylation and function. We have demonstrated that (a) steroidogenesis in MA-10 Leydig cells depends on the specific of ERK1/2 activation at the mitochondria; (b) ERK1/2 phosphorylation is driven by mitochondrial PKA and constitutive MEK1/2 in this organelle; (c) active ERK1/2 interacts with StAR protein, leads to StAR protein phosphorylation at Ser(232) only in the presence of cholesterol; (d) directed mutagenesis of Ser(232) (S232A) inhibited in vitro StAR protein phosphorylation by ERK1; (e) transient transfection of MA-10 cells with StAR S232A cDNA markedly reduced the yield of progesterone production. We show that StAR protein is a substrate of ERK1/2, and that mitochondrial ERK1/2 is part of a multimeric complex that regulates cholesterol transport.

  16. Mapping Atmospheric Ammonia Emissions Using a Mobile Quantum Cascade Laser-based Open-path Sensor

    Science.gov (United States)

    Sun, K.; Tao, L.; Miller, D. J.; Khan, M. A.; Zondlo, M. A.

    2012-12-01

    Ammonia (NH3) is a key precursor to atmospheric fine particulate matter, with strong implications for regional air quality and global climate change. Despite the importance of atmospheric ammonia, its spatial/temporal variation is poorly characterized, and the knowledge of its sources, sinks, and transport is severely limited. Existing measurements suggest that traffic exhaust may provide significant amounts of ammonia in urban areas, which cause greater impacts on particulate matter formation and urban air quality. To capture the spatial and temporal variation of ammonia emissions, a portable, low power sensor with high time resolution is necessary. We have developed a portable open-path ammonia sensor with a detection limit of 0.5 ppbv ammonia for 1 s measurements. The sensor has a power consumption of about 60 W and is capable of running on a car battery continuously for 24 hours. An additional laser has been coupled to the sensor to yield concurrent N2O and CO measurements as tracers for determining various sources. The overall sensor prototype fits on a 60 cm × 20 cm aluminum breadboard. Roadside measurements indicated NH3/CO emission ratios of 4.1±5.4 ppbv/ppmv from a fleet of 320 vehicles, which agree with existing on-ramp measurements. Urban measurements in the Baltimore and Washington, DC metropolitan areas have shown significant ammonia mixing ratios concurrent with carbon monoxide levels from the morning and evening rush hours. On-road measurements of our open-path sensor have also been performed continuously from the Midwest to Princeton, NJ including urban areas such as Pittsburgh, tunnels, and relatively clean conditions. The emission ratios of ammonia against CO and/or CO2 help identify the sources and amounts of both urban and agricultural ammonia emissions. Preliminary data from both spatial mapping, monitoring, and vehicle exhaust measurements suggest that urban ammonia emissions from fossil fuel combustion are significant and may provide an

  17. [Implication of MAP kinases in obesity-induced inflammation and insulin resistance].

    Science.gov (United States)

    Ceppo, Franck; Jager, Jennifer; Berthou, Flavien; Giorgetti-Peraldi, Sophie; Cormont, Mireille; Bost, Fréderic; Tanti, Jean-François

    2014-01-01

    Insulin resistance is often associated with obesity and is a major risk factor for development of type 2 diabetes as well as cardiovascular and hepatic diseases. Insulin resistance may also increase the incidence or the aggressiveness of some cancers. Insulin resistance occurs owing to defects in insulin signaling in target tissues of this hormone. During the last ten years, it became evident that the chronic low-grade inflammatory state that develops during obesity plays an important role in insulin resistance development. Indeed, inflammatory cytokines activate several signaling pathways that impinge on the insulin signaling pathway. Among them, this review will focus on the implication of the MAP kinases JNK and ERK1/2 signaling in the development of insulin signaling alterations and will discuss the possibility to target these pathways in order to fight insulin resistance. © Société de Biologie, 2014.

  18. Oncogenic Activation of MAP Kinase by BRAF Pseudogene in Thyroid Tumors

    Directory of Open Access Journals (Sweden)

    Minjing Zou

    2009-01-01

    Full Text Available Activating BRAF mutations have been reported in 40% of papillary thyroid carcinomas (PTCs. The involvement of BRAF pseudogene in thyroid tumorigenesis has not previously been studied. We investigated BRAF pseudogene expression in 68 thyroid tumors: 16 multinodular goiters, 43 classic PTCs, 6 follicular variants of PTC, and 3 anaplastic thyroid carcinomas. BRAF pseudogene function was studied by Western blots, soft agar assay, and tumorigenesis in nude mice. BRAF pseudogene expression was detected in 7 multinodular goiters, 18 classic PTC, and 1 follicular variants of PTC. There is an inverse correlation between BRAF pseudogene expression and BRAF mutation. The pseudogene transcripts were more frequently detected in tumors without BRAF mutation than those with BRAF mutation. Furthermore, BRAF pseudogene expression could activate the MAP kinase signaling pathway, transform NIH3T3 cells in vitro, and induce tumors in nude mice. These data suggest that BRAF pseudogene activation may play a role in thyroid tumor development.

  19. Purification of reversibly oxidized proteins (PROP reveals a redox switch controlling p38 MAP kinase activity.

    Directory of Open Access Journals (Sweden)

    Dennis J Templeton

    Full Text Available Oxidation of cysteine residues of proteins is emerging as an important means of regulation of signal transduction, particularly of protein kinase function. Tools to detect and quantify cysteine oxidation of proteins have been a limiting factor in understanding the role of cysteine oxidation in signal transduction. As an example, the p38 MAP kinase is activated by several stress-related stimuli that are often accompanied by in vitro generation of hydrogen peroxide. We noted that hydrogen peroxide inhibited p38 activity despite paradoxically increasing the activating phosphorylation of p38. To address the possibility that cysteine oxidation may provide a negative regulatory effect on p38 activity, we developed a biochemical assay to detect reversible cysteine oxidation in intact cells. This procedure, PROP, demonstrated in vivo oxidation of p38 in response to hydrogen peroxide and also to the natural inflammatory lipid prostaglandin J2. Mutagenesis of the potential target cysteines showed that oxidation occurred preferentially on residues near the surface of the p38 molecule. Cysteine oxidation thus controls a functional redox switch regulating the intensity or duration of p38 activity that would not be revealed by immunodetection of phosphoprotein commonly interpreted as reflective of p38 activity.

  20. The MAP kinase substrate MKS1 is a regulator of plant defense responses.

    Science.gov (United States)

    Andreasson, Erik; Jenkins, Thomas; Brodersen, Peter; Thorgrimsen, Stephan; Petersen, Nikolaj H T; Zhu, Shijiang; Qiu, Jin-Long; Micheelsen, Pernille; Rocher, Anne; Petersen, Morten; Newman, Mari-Anne; Bjørn Nielsen, Henrik; Hirt, Heribert; Somssich, Imre; Mattsson, Ole; Mundy, John

    2005-07-20

    Arabidopsis MAP kinase 4 (MPK4) functions as a regulator of pathogen defense responses, because it is required for both repression of salicylic acid (SA)-dependent resistance and for activation of jasmonate (JA)-dependent defense gene expression. To understand MPK4 signaling mechanisms, we used yeast two-hybrid screening to identify the MPK4 substrate MKS1. Analyses of transgenic plants and genome-wide transcript profiling indicated that MKS1 is required for full SA-dependent resistance in mpk4 mutants, and that overexpression of MKS1 in wild-type plants is sufficient to activate SA-dependent resistance, but does not interfere with induction of a defense gene by JA. Further yeast two-hybrid screening revealed that MKS1 interacts with the WRKY transcription factors WRKY25 and WRKY33. WRKY25 and WRKY33 were shown to be in vitro substrates of MPK4, and a wrky33 knockout mutant was found to exhibit increased expression of the SA-related defense gene PR1. MKS1 may therefore contribute to MPK4-regulated defense activation by coupling the kinase to specific WRKY transcription factors.

  1. Mapping C-terminal transactivation domains of the nuclear HER family receptor tyrosine kinase HER3.

    Science.gov (United States)

    Brand, Toni M; Iida, Mari; Luthar, Neha; Wleklinski, Matthew J; Starr, Megan M; Wheeler, Deric L

    2013-01-01

    Nuclear localized HER family receptor tyrosine kinases (RTKs) have been observed in primary tumor specimens and cancer cell lines for nearly two decades. Inside the nucleus, HER family members (EGFR, HER2, and HER3) have been shown to function as co-transcriptional activators for various cancer-promoting genes. However, the regions of each receptor that confer transcriptional potential remain poorly defined. The current study aimed to map the putative transactivation domains (TADs) of the HER3 receptor. To accomplish this goal, various intracellular regions of HER3 were fused to the DNA binding domain of the yeast transcription factor Gal4 (Gal4DBD) and tested for their ability to transactivate Gal4 UAS-luciferase. Results from these analyses demonstrated that the C-terminal domain of HER3 (CTD, amino acids distal to the tyrosine kinase domain) contained potent transactivation potential. Next, nine HER3-CTD truncation mutants were constructed to map minimal regions of transactivation potential using the Gal4 UAS-luciferase based system. These analyses identified a bipartite region of 34 (B₁) and 27 (B₂) amino acids in length that conferred the majority of HER3's transactivation potential. Next, we identified full-length nuclear HER3 association and regulation of a 122 bp region of the cyclin D1 promoter. To understand how the B₁ and B₂ regions influenced the transcriptional functions of nuclear HER3, we performed cyclin D1 promoter-luciferase assays in which HER3 deleted of the B₁ and B₂ regions was severely hindered in regulating this promoter. Further, the overexpression of HER3 enhanced cyclin D1 mRNA expression, while HER3 deleted of its identified TADs was hindered at doing so. Thus, the ability for HER3 to function as a transcriptional co-activator may be dependent on specific C-terminal TADs.

  2. Adenylyl cyclase-associated protein Aca1 regulates virulence and differentiation of Cryptococcus neoformans via the cyclic AMP-protein kinase A cascade.

    Science.gov (United States)

    Bahn, Yong-Sun; Hicks, Julie K; Giles, Steven S; Cox, Gary M; Heitman, Joseph

    2004-12-01

    The evolutionarily conserved cyclic AMP (cAMP) signaling pathway controls cell functions in response to environmental cues in organisms as diverse as yeast and mammals. In the basidiomycetous human pathogenic fungus Cryptococcus neoformans, the cAMP pathway governs virulence and morphological differentiation. Here we identified and characterized adenylyl cyclase-associated protein, Aca1, which functions in parallel with the Galpha subunit Gpa1 to control the adenylyl cyclase (Cac1). Aca1 interacted with the C terminus of Cac1 in the yeast two-hybrid system. By molecular and genetic approaches, Aca1 was shown to play a critical role in mating by regulating cell fusion and filamentous growth in a cAMP-dependent manner. Aca1 also regulates melanin and capsule production via the Cac1-cAMP-protein kinase A pathway. Genetic epistasis studies support models in which Aca1 and Gpa1 are necessary and sufficient components that cooperate to activate adenylyl cyclase. Taken together, these studies further define the cAMP signaling cascade controlling virulence of this ubiquitous human fungal pathogen.

  3. Scattering of MCF7 cells by heregulin ß-1 depends on the MEK and p38 MAP kinase pathway.

    Directory of Open Access Journals (Sweden)

    Rintaro Okoshi

    Full Text Available Heregulin (HRG β1 signaling promotes scattering of MCF7 cells by inducing breakdown of adherens and tight junctions. Here, we show that stimulation with HRG-β1 causes the F-actin backbone of junctions to destabilize prior to the loss of adherent proteins and scattering of the cells. The adherent proteins dissociate and translocate from cell-cell junctions to the cytosol. Moreover, using inhibitors we show that the MEK1 pathway is required for the disappearance of F-actin from junctions and p38 MAP kinase activity is essential for scattering of the cells. Upon treatment with a p38 MAP kinase inhibitor, adherens junction complexes immediately reassemble, most likely in the cytoplasm, and move to the plasma membrane in cells dissociated by HRG-β1 stimulation. Subsequently, tight junction complexes form, most likely in the cytoplasm, and move to the plasma membrane. Thus, the p38 MAP kinase inhibitor causes a re-aggregation of scattered cells, even in the presence of HRG-β1. These results suggest that p38 MAP kinase signaling to adherens junction proteins regulates cell aggregation, providing a novel understanding of the regulation of cell-cell adhesion.

  4. Adiponectin inhibits neutrophil apoptosis via activation of AMP kinase, PKB and ERK 1/2 MAP kinase.

    Science.gov (United States)

    Rossi, Alessandra; Lord, Janet M

    2013-12-01

    Neutrophils are abundant, short-lived leukocytes that play a key role in the immune defense against microbial infections. These cells die by apoptosis following activation and uptake of microbes and will also enter apoptosis spontaneously at the end of their lifespan if they do not encounter a pathogen. Adiponectin exerts anti-inflammatory effects on neutrophil antimicrobial functions, but whether this abundant adipokine influences neutrophil apoptosis is unknown. Here we report that adiponectin in the physiological range (1-10 μg/ml) reduced apoptosis in resting neutrophils, decreasing caspase-3 cleavage and maintaining Mcl-1 expression by stabilizing this anti-apoptotic protein. We show that adiponectin induced phosphorylation of AMP-activated kinase (AMPK), protein kinase B (PKB), extracellular signal-regulated kinase (ERK 1/2) and p38 mitogen activated protein kinase (MAPK). Pharmacological inhibition of AMPK, PKB and ERK 1/2 ablated the pro-survival effects of adiponectin and treatment of neutrophils with an AMPK specific activator (AICAR) and AMPK inhibitor (compound C) respectively decreased and increased apoptosis. Finally, activation of AMPK by AICAR or adiponectin also decreased ceramide accumulation in the neutrophil cell membrane, a process involved in the early stages of spontaneous apoptosis, giving another possible mechanism downstream of AMPK activation for the inhibition of neutrophil apoptosis.

  5. The MAP kinase-activated protein kinase Rck2p regulates cellular responses to cell wall stresses, filamentation and virulence in the human fungal pathogen Candida albicans.

    Science.gov (United States)

    Li, Xichuan; Du, Wei; Zhao, Jingwen; Zhang, Lilin; Zhu, Zhiyan; Jiang, Linghuo

    2010-06-01

    Rck2p is the Hog1p-MAP kinase-activated protein kinase required for the attenuation of protein synthesis in response to an osmotic challenge in Saccharomyces cerevisiae. Rck2p also regulates rapamycin sensitivity in both S. cerevisiae and Candida albicans. In this study, we demonstrate that the deletion of CaRCK2 renders C. albicans cells sensitive to, and CaRck2p translocates from the cytosol to the nucleus in response to, cell wall stresses caused by Congo red, Calcoflor White, elevated heat and zymolyase. However, the kinase activity of CaRck2p is not required for the cellular response to these cell wall stresses. Furthermore, transcripts of cell wall protein-encoding genes CaBGL2, CaHWP1 and CaXOG1 are reduced in C. albicans cells lacking CaRCK2. The deletion of CaRCK2 also reduces the in vitro filamentation of C. albicans and its virulence in a mouse model of systemic candidasis. The kinase activity of CaRck2p is required for the virulence, but not for the in vitro filamentation, in C. albicans. Therefore, Rck2p regulates cellular responses to cell wall stresses, filamentation and virulence in the human fungal pathogen C. albicans.

  6. Torilin Inhibits Inflammation by Limiting TAK1-Mediated MAP Kinase and NF-κB Activation

    Directory of Open Access Journals (Sweden)

    Mehari Endale

    2017-01-01

    Full Text Available Torilin, a sesquiterpene isolated from the fruits of Torilis japonica, has shown antimicrobial, anticancer, and anti-inflammatory properties. However, data on the mechanism of torilin action against inflammation is limited. This study aimed at determining the anti-inflammatory property of torilin in LPS-induced inflammation using in vitro model of inflammation. We examined torilin’s effect on expression levels of inflammatory mediators and cytokines in LPS-stimulated RAW 264.7 macrophages. The involvement of NF-kB and AP-1, MAP kinases, and adaptor proteins were assessed. Torilin strongly inhibited LPS-induced NO release, iNOS, PGE2, COX-2, NF-α, IL-1β, IL-6, and GM-CSF gene and protein expressions. In addition, MAPKs were also suppressed by torilin pretreatment. Involvement of ERK1/2, P38MAPK, and JNK1/2 was further confirmed by PD98059, SB203580, and SP600125 mediated suppression of iNOS and COX-2 proteins. Furthermore, torilin attenuated NF-kB and AP-1 translocation, DNA binding, and reporter gene transcription. Interestingly, torilin inhibited TAK1 kinase activation with the subsequent suppression of MAPK-mediated JNK, p38, ERK1/2, and AP-1 (ATF-2 and c-jun activation and IKK-mediated I-κBα degradation, p65/p50 activation, and translocation. Together, the results revealed the suppression of NF-κB and AP-1 regulated inflammatory mediator and cytokine expressions, suggesting the test compound’s potential as a candidate anti-inflammatory agent.

  7. Torilin Inhibits Inflammation by Limiting TAK1-Mediated MAP Kinase and NF-κB Activation

    Science.gov (United States)

    Kim, Tae-Hwan; Kwak, Yi-Seong; Kim, Na-Mi; Kim, Seung-Hyung

    2017-01-01

    Torilin, a sesquiterpene isolated from the fruits of Torilis japonica, has shown antimicrobial, anticancer, and anti-inflammatory properties. However, data on the mechanism of torilin action against inflammation is limited. This study aimed at determining the anti-inflammatory property of torilin in LPS-induced inflammation using in vitro model of inflammation. We examined torilin's effect on expression levels of inflammatory mediators and cytokines in LPS-stimulated RAW 264.7 macrophages. The involvement of NF-kB and AP-1, MAP kinases, and adaptor proteins were assessed. Torilin strongly inhibited LPS-induced NO release, iNOS, PGE2, COX-2, NF-α, IL-1β, IL-6, and GM-CSF gene and protein expressions. In addition, MAPKs were also suppressed by torilin pretreatment. Involvement of ERK1/2, P38MAPK, and JNK1/2 was further confirmed by PD98059, SB203580, and SP600125 mediated suppression of iNOS and COX-2 proteins. Furthermore, torilin attenuated NF-kB and AP-1 translocation, DNA binding, and reporter gene transcription. Interestingly, torilin inhibited TAK1 kinase activation with the subsequent suppression of MAPK-mediated JNK, p38, ERK1/2, and AP-1 (ATF-2 and c-jun) activation and IKK-mediated I-κBα degradation, p65/p50 activation, and translocation. Together, the results revealed the suppression of NF-κB and AP-1 regulated inflammatory mediator and cytokine expressions, suggesting the test compound's potential as a candidate anti-inflammatory agent. PMID:28316375

  8. Panaxynol induces neurite outgrowth in PC12D cells via cAMP- and MAP kinase-dependent mechanisms.

    Science.gov (United States)

    Wang, Ze-Jian; Nie, Bao-Ming; Chen, Hong-Zhuan; Lu, Yang

    2006-01-05

    Panaxynol, a polyacetylene ((3R)-heptadeca-1,9-diene-4,6-diyn-3-ol; syn. falcarinol), was isolated from the lipophilic fractions of Panax notoginseng, a Chinese traditional medicinal plant. In the present study, we reported the neurotrophic effects of panaxynol on PC12D cells and mechanism involved in neurite outgrowth of the cells. Panaxynol could morphologically promote neurite outgrowth in PC12D cells, concentration-dependently reduce cell division and up-regulate molecular marker (MAP1B) expression in PC12D cells. Panaxynol induces the elevation of intracellular cAMP in PC12D cells. The neurite outgrowth in PC12D cells induced by panaxynol could be inhibited by the protein kinase A inhibitor RpcAMPS and by MAP kinase kinase 1/2 inhibitor U0126. These observations reveal that panaxynol could induce the differentiation of PC12D cells in a process similar to but distinct from that of NGF and the panaxynol's effects were via cAMP- and MAP kinase-dependent mechanisms.

  9. Analysis of the Mitogen-activated protein kinase kinase 4 (MAP2K4 tumor suppressor gene in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Ryland Georgina L

    2011-05-01

    Full Text Available Abstract Background MAP2K4 is a putative tumor and metastasis suppressor gene frequently found to be deleted in various cancer types. We aimed to conduct a comprehensive analysis of this gene to assess its involvement in ovarian cancer. Methods We screened for mutations in MAP2K4 using High Resolution Melt analysis of 149 primary ovarian tumors and methylation at the promoter using Methylation-Specific Single-Stranded Conformation Polymorphism analysis of 39 tumors. We also considered the clinical impact of changes in MAP2K4 using publicly available expression and copy number array data. Finally, we used siRNA to measure the effect of reducing MAP2K4 expression in cell lines. Results In addition to 4 previously detected homozygous deletions, we identified a homozygous 16 bp truncating deletion and a heterozygous 4 bp deletion, each in one ovarian tumor. No promoter methylation was detected. The frequency of MAP2K4 homozygous inactivation was 5.6% overall, and 9.8% in high-grade serous cases. Hemizygous deletion of MAP2K4 was observed in 38% of samples. There were significant correlations of copy number and expression in three microarray data sets. There was a significant correlation between MAP2K4 expression and overall survival in one expression array data set, but this was not confirmed in an independent set. Treatment of JAM and HOSE6.3 cell lines with MAP2K4 siRNA showed some reduction in proliferation. Conclusions MAP2K4 is targeted by genetic inactivation in ovarian cancer and restricted to high grade serous and endometrioid carcinomas in our cohort.

  10. Phosphorylation of MAP65-1 by Arabidopsis Aurora Kinases Is Required for Efficient Cell Cycle Progression1[OPEN

    Science.gov (United States)

    Weimer, Annika K.; Stoppin-Mellet, Virginie; Kosetsu, Ken; Cedeño, Cesyen; Jaquinod, Michel; Njo, Maria; De Milde, Liesbeth; Tompa, Peter; Inzé, Dirk; Beeckman, Tom; Vantard, Marylin

    2017-01-01

    Aurora kinases are key effectors of mitosis. Plant Auroras are functionally divided into two clades. The alpha Auroras (Aurora1 and Aurora2) associate with the spindle and the cell plate and are implicated in controlling formative divisions throughout plant development. The beta Aurora (Aurora3) localizes to centromeres and likely functions in chromosome separation. In contrast to the wealth of data available on the role of Aurora in other kingdoms, knowledge on their function in plants is merely emerging. This is exemplified by the fact that only histone H3 and the plant homolog of TPX2 have been identified as Aurora substrates in plants. Here we provide biochemical, genetic, and cell biological evidence that the microtubule-bundling protein MAP65-1—a member of the MAP65/Ase1/PRC1 protein family, implicated in central spindle formation and cytokinesis in animals, yeasts, and plants—is a genuine substrate of alpha Aurora kinases. MAP65-1 interacts with Aurora1 in vivo and is phosphorylated on two residues at its unfolded tail domain. Its overexpression and down-regulation antagonistically affect the alpha Aurora double mutant phenotypes. Phospho-mutant analysis shows that Aurora contributes to the microtubule bundling capacity of MAP65-1 in concert with other mitotic kinases. PMID:27879390

  11. Sorbic acid stress activates the Candida glabrata high osmolarity glycerol MAP kinase pathway

    Science.gov (United States)

    Jandric, Zeljkica; Gregori, Christa; Klopf, Eva; Radolf, Martin; Schüller, Christoph

    2013-01-01

    Weak organic acids such as sorbic acid are important food preservatives and powerful fungistatic agents. These compounds accumulate in the cytosol and disturb the cellular pH and energy homeostasis. Candida glabrata is in many aspects similar to Saccharomyces cerevisiae. However, with regard to confrontation to sorbic acid, two of the principal response pathways behave differently in C. glabrata. In yeast, sorbic acid stress causes activation of many genes via the transcription factors Msn2 and Msn4. The C. glabrata homologs CgMsn2 and CgMsn4 are apparently not activated by sorbic acid. In contrast, in C. glabrata the high osmolarity glycerol (HOG) pathway is activated by sorbic acid. Here we show that the MAP kinase of the HOG pathway, CgHog1, becomes phosphorylated and has a function for weak acid stress resistance. Transcript profiling of weak acid treated C. glabrata cells suggests a broad and very similar response pattern of cells lacking CgHog1 compared to wild type which is over lapping with but distinct from S. cerevisiae. The PDR12 gene was the highest induced gene in both species and it required CgHog1 for full expression. Our results support flexibility of the response cues for general stress signaling pathways, even between closely related yeasts, and functional extension of a specific response pathway. PMID:24324463

  12. Inhaled ultrafine particulate matter affects CNS inflammatory processes and may act via MAP kinase signaling pathways.

    Science.gov (United States)

    Kleinman, M T; Araujo, J A; Nel, A; Sioutas, C; Campbell, A; Cong, P Q; Li, H; Bondy, S C

    2008-05-05

    In addition to evidence that inhalation of ambient particulate matter (PM) can increase cardiopulmonary morbidity and mortality, the brain may also constitute a site adversely effected by the environmental presence of airborne particulate matter. We have examined the association between exposure to PM and adverse CNS effects in apolipoprotein E knockout (ApoE-/-) mice exposed to two levels of concentrated ultrafine particulate matter in central Los Angeles. Mice were euthanized 24h after the last exposure and brain, liver, heart, lung and spleen tissues were collected and frozen for subsequent bioassays. There was clear evidence of aberrant immune activation in the brains of exposed animals as judged by a dose-related increase in nuclear translocation of two key transcription factors, NF-kappaB and AP-1. These factors are involved in the promotion of inflammation. Increased levels of glial fibrillary acidic protein (GFAP) were also found consequent to particulate inhalation suggesting that glial activation was taking place. In order to determine the mechanism by which these events occurred, levels of several MAP kinases involved in activation of these transcription factors were assayed by Western blotting. There were no significant changes in the proportion of active (phosphorylated) forms of ERK-1, IkB and p38. However, the fraction of JNK in the active form was significantly increased in animals receiving the lower concentration of concentrated ambient particles (CAPs). This suggests that the signaling pathway by which these transcription factors are activated involves the activation of JNK.

  13. Sorbic acid stress activates the Candida glabrata high osmolarity glycerol MAP kinase pathway

    Directory of Open Access Journals (Sweden)

    Zeljkica eJandric

    2013-11-01

    Full Text Available Weak organic acids such as sorbic acid are important food preservatives and powerful fungistatic agents. These compounds accumulate in the cytosol and disturb the cellular pH and energy homeostasis. Candida glabrata is in many aspects similar to Saccharomyces cerevisiae. However, with regard to confrontation to sorbic acid, two of the principal response pathways behave differently in Candida glabrata. In yeast, sorbic acid stress causes activation of many genes via the transcription factors Msn2 and Msn4. The C. glabrata homologues CgMsn2 and CgMsn4 are apparently not activated by sorbic acid. In contrast, in C. glabrata the high osmolarity glycerol (HOG pathway is activated by sorbic acid. Here we show that the MAP kinase of the HOG pathway, CgHog1, becomes phosphorylated and has a function for weak acid stress resistance. Transcript profiling of weak acid treated C. glabrata cells suggests a broad and very similar response pattern of cells lacking CgHog1 compared to wild type which is over lapping with but distinct from S. cerevisiae. The PDR12 gene was the highest induced gene in both species, and required CgHog1 for full expression. Our results support flexibility of the response cues for general stress signaling pathways, even between closely related yeasts, and functional extension of a specific response pathway.

  14. Period-doubling cascades galore

    OpenAIRE

    Sander, Evelyn; Yorke, James A.

    2009-01-01

    The appearance of numerous period-doubling cascades is among the most prominent features of {\\bf parametrized maps}, that is, smooth one-parameter families of maps $F:R \\times {\\mathfrak M} \\to {\\mathfrak M}$, where ${\\mathfrak M}$ is a smooth locally compact manifold without boundary, typically $R^N$. Each cascade has infinitely many period-doubling bifurcations, and it is typical to observe -- such as in all the examples we investigate here -- that whenever there are any cascades, there are...

  15. Flagellin of Pseudomonas aeruginosa induces transforming growth factor beta 1 expression in normal bronchial epithelial cells through mitogen activated protein kinase cascades

    Institute of Scientific and Technical Information of China (English)

    YANG Jing-jing; WANG Dan-dan; SUN Tie-ying

    2011-01-01

    Background Acute lung infection due to Pseudomonas aeruginosa (P. Aeruginosa) is a serious problem, especially in patients with structural lung conditions or immune compromised hosts, leading to an overwhelming threat with a high risk of morbidity and mortality. As an outcome of infection, fibrosis can be linked with chronic lung diseases. But some fibrotic manifestations, such as an irreversible decrease of lung function and fibrous bands seen on chest imaging, have been found after an acute infection with P. Aeruginosa. Fibrogenesis/remodeling resulting from acute lung infection by P.aeruginosa is rarely reported. This study was designed to explore the relation between fibrogenesis/remodeling and acute infection by P. Aeruginosa in vitro. We used flagellin protein from P. Aeruginosa, a key initiator of acute P.aeruginosa lung infection, to elucidate mechanisms by which acute lung infection with P. Aeruginosa can cause fibrogenesis/remodeling.Methods We studied the effect of flagellin from P. Aeruginosa (flagellin for short) on the transforming growth factor beta 1 (TGF-β1) and interleukin-8 (IL-8) expression, and the possible involvement of the signaling pathway, tumor necrosis factor receptor-associated factor 6 (TRAF6)/mitogen activated protein kinase (MAPK) pathway. Flagellin was purified from the P. Aeruginosa standard strain, PAO1. Normal bronchial epithelial cells BEAS-2B were challenged with different concentrations of flagellin, and cell viability assessment was performed by cell counting kit-8. BEAS-2B cells were incubated with flagellin with the specific MAPK inhibitors or TRAF6 siRNA. Cell lysates and the cultured supernatant were collected. The level of TGF-β1 and IL-8 were detected by enzyme-linked immunosorbant assay (ELISA). Western blotting was used to detect the protein levels of MAPK signal proteins p38, c-Jun NH2-terminal kinase (JNK) and extracellular regulated kinase (ERK).Results Expression of TGF-β1 in BEAS-2B cells was elevated by

  16. Genetic analysis of the Arabidopsis protein kinases MAP3Kε1 and MAP3Kε2 indicates roles in cell expansion and embryo development.

    Science.gov (United States)

    Chaiwongsar, Suraphon; Strohm, Allison K; Su, Shih-Heng; Krysan, Patrick J

    2012-01-01

    MAP3Kε1 and MAP3Kε2 are a pair of Arabidopsis thaliana genes that encode protein kinases related to cdc7p from Saccharomyces cerevisiae. We have previously shown that the map3kε1;map3kε2 double-mutant combination causes pollen lethality. In this study, we have used an ethanol-inducible promoter construct to rescue this lethal phenotype and create map3kε1(-/-);map3kε2(-/-) double-mutant plants in order to examine the function of these genes in the sporophyte. These rescued double-mutant plants carry a yellow fluorescent protein (YFP)-MAP3Kε1 transgene under the control of the alcohol-inducible AlcA promoter from Aspergillus nidulans. The double-mutant plants were significantly smaller and had shorter roots than wild-type when grown in the absence of ethanol treatment. Microscopic analysis indicated that cell elongation was reduced in the roots of the double-mutant plants and cell expansion was reduced in rosette leaves. Treatment with ethanol to induce expression of YFP-MAP3Kε1 largely rescued the leaf phenotypes. The double-mutant combination also caused embryos to arrest in the early stages of development. Through the use of YFP reporter constructs we determined that MAP3Kε1 and MAP3Kε2 are expressed during embryo development, and also in root tissue. Our results indicate that MAP3Kε1 and MAP3Kε2 have roles outside of pollen development and that these genes affect several aspects of sporophyte development.

  17. The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Serena A D'Souza

    2016-04-01

    Full Text Available The proper display of transmembrane receptors on the leading edge of migrating cells and cell extensions is essential for their response to guidance cues. We previously discovered that MADD-4, which is an ADAMTSL secreted by motor neurons in Caenorhabditis elegans, interacts with an UNC-40/EVA-1 co-receptor complex on muscles to attract plasma membrane extensions called muscle arms. In nematodes, the muscle arm termini harbor the post-synaptic elements of the neuromuscular junction. Through a forward genetic screen for mutants with disrupted muscle arm extension, we discovered that a LAMMER kinase, which we call MADD-3, is required for the proper display of the EVA-1 receptor on the muscle's plasma membrane. Without MADD-3, EVA-1 levels decrease concomitantly with a reduction of the late-endosomal marker RAB-7. Through a genetic suppressor screen, we found that the levels of EVA-1 and RAB-7 can be restored in madd-3 mutants by eliminating the function of a p38 MAP kinase pathway. We also found that EVA-1 and RAB-7 will accumulate in madd-3 mutants upon disrupting CUP-5, which is a mucolipin ortholog required for proper lysosome function. Together, our data suggests that the MADD-3 LAMMER kinase antagonizes the p38-mediated endosomal trafficking of EVA-1 to the lysosome. In this way, MADD-3 ensures that sufficient levels of EVA-1 are present to guide muscle arm extension towards the source of the MADD-4 guidance cue.

  18. The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans

    Science.gov (United States)

    D’Souza, Serena A.; Rajendran, Luckshika; Bagg, Rachel; van Pel, Derek M.; Moshiri, Houtan; Roy, Peter J.

    2016-01-01

    The proper display of transmembrane receptors on the leading edge of migrating cells and cell extensions is essential for their response to guidance cues. We previously discovered that MADD-4, which is an ADAMTSL secreted by motor neurons in Caenorhabditis elegans, interacts with an UNC-40/EVA-1 co-receptor complex on muscles to attract plasma membrane extensions called muscle arms. In nematodes, the muscle arm termini harbor the post-synaptic elements of the neuromuscular junction. Through a forward genetic screen for mutants with disrupted muscle arm extension, we discovered that a LAMMER kinase, which we call MADD-3, is required for the proper display of the EVA-1 receptor on the muscle’s plasma membrane. Without MADD-3, EVA-1 levels decrease concomitantly with a reduction of the late-endosomal marker RAB-7. Through a genetic suppressor screen, we found that the levels of EVA-1 and RAB-7 can be restored in madd-3 mutants by eliminating the function of a p38 MAP kinase pathway. We also found that EVA-1 and RAB-7 will accumulate in madd-3 mutants upon disrupting CUP-5, which is a mucolipin ortholog required for proper lysosome function. Together, our data suggests that the MADD-3 LAMMER kinase antagonizes the p38-mediated endosomal trafficking of EVA-1 to the lysosome. In this way, MADD-3 ensures that sufficient levels of EVA-1 are present to guide muscle arm extension towards the source of the MADD-4 guidance cue. PMID:27123983

  19. The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans.

    Science.gov (United States)

    D'Souza, Serena A; Rajendran, Luckshika; Bagg, Rachel; Barbier, Louis; van Pel, Derek M; Moshiri, Houtan; Roy, Peter J

    2016-04-01

    The proper display of transmembrane receptors on the leading edge of migrating cells and cell extensions is essential for their response to guidance cues. We previously discovered that MADD-4, which is an ADAMTSL secreted by motor neurons in Caenorhabditis elegans, interacts with an UNC-40/EVA-1 co-receptor complex on muscles to attract plasma membrane extensions called muscle arms. In nematodes, the muscle arm termini harbor the post-synaptic elements of the neuromuscular junction. Through a forward genetic screen for mutants with disrupted muscle arm extension, we discovered that a LAMMER kinase, which we call MADD-3, is required for the proper display of the EVA-1 receptor on the muscle's plasma membrane. Without MADD-3, EVA-1 levels decrease concomitantly with a reduction of the late-endosomal marker RAB-7. Through a genetic suppressor screen, we found that the levels of EVA-1 and RAB-7 can be restored in madd-3 mutants by eliminating the function of a p38 MAP kinase pathway. We also found that EVA-1 and RAB-7 will accumulate in madd-3 mutants upon disrupting CUP-5, which is a mucolipin ortholog required for proper lysosome function. Together, our data suggests that the MADD-3 LAMMER kinase antagonizes the p38-mediated endosomal trafficking of EVA-1 to the lysosome. In this way, MADD-3 ensures that sufficient levels of EVA-1 are present to guide muscle arm extension towards the source of the MADD-4 guidance cue.

  20. Mycosporine-Like Amino Acids Promote Wound Healing through Focal Adhesion Kinase (FAK and Mitogen-Activated Protein Kinases (MAP Kinases Signaling Pathway in Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yun-Hee Choi

    2015-11-01

    Full Text Available Mycosporine-like amino acids (MAAs are secondary metabolites found in diverse marine, freshwater, and terrestrial organisms. Evidence suggests that MAAs have several beneficial effects on skin homeostasis such as protection against UV radiation and reactive oxygen species (ROS. In addition, MAAs are also involved in the modulation of skin fibroblasts proliferation. However, the regulatory function of MAAs on wound repair in human skin is not yet clearly elucidated. To investigate the roles of MAAs on the wound healing process in human keratinocytes, three MAAs, Shinorine (SH, Mycosporine-glycine (M-Gly, and Porphyra (P334 were purified from Chlamydomonas hedlyei and Porphyra yezoensis. We found that SH, M-Gly, and P334 have significant effects on the wound healing process in human keratinocytes and these effects were mediated by activation of focal adhesion kinases (FAK, extracellular signal-regulated kinases (ERK, and c-Jun N-terminal kinases (JNK. These results suggest that MAAs accelerate wound repair by activating the FAK-MAPK signaling pathways. This study also indicates that MAAs can act as a new wound healing agent and further suggests that MAAs might be a novel biomaterial for wound healing therapies.

  1. Stimulation of MAP kinase pathways after maternal IL-1β exposure induces fetal lung fluid absorption in guinea pigs

    Directory of Open Access Journals (Sweden)

    Carter Ethan P

    2007-03-01

    Full Text Available Abstract Background We tested the hypothesis that maternal interleukin-1β (IL-1β pretreatment and induction of fetal cortisol synthesis activates MAP kinases and thereby affects lung fluid absorption in preterm guinea pigs. Methods IL-1β was administered subcutaneously daily to timed-pregnant guinea pigs for three days. Fetuses were obtained by abdominal hysterotomy and instilled with isosmolar 5% albumin into the lungs and lung fluid movement was measured over 1 h by mass balance. MAP kinase expression was measured by western blot. Results Lung fluid absorption was induced at 61 days (D gestation and stimulated at 68D gestation by IL-1β. Maternal IL-1β pretreatment upregulated ERK and upstream MEK expression at both 61 and 68D gestation, albeit being much more pronounced at 61D gestation. U0126 instillation completely blocked IL-1β-induced lung fluid absorption as well as IL-1β-induced/stimulated ERK expression. Cortisol synthesis inhibition by metyrapone attenuated ERK expression and lung fluid absorption in IL-1β-pretreated fetal lungs. JNK expression after maternal IL-1β pretreatment remained unaffected at either gestation age. Conclusion These data implicate the ERK MAP kinase pathway as being important for IL-1β induction/stimulation of lung fluid absorption in fetal guinea pigs.

  2. Stimulation of MAP kinase pathways after maternal IL-1beta exposure induces fetal lung fluid absorption in guinea pigs.

    Science.gov (United States)

    Bhattacharjee, Reshma; Li, Tianbo; Koshy, Shyny; Beard, LaMonta L; Sharma, Kapil; Carter, Ethan P; Garat, Chrystelle; Folkesson, Hans G

    2007-03-26

    We tested the hypothesis that maternal interleukin-1beta (IL-1beta) pretreatment and induction of fetal cortisol synthesis activates MAP kinases and thereby affects lung fluid absorption in preterm guinea pigs. IL-1beta was administered subcutaneously daily to timed-pregnant guinea pigs for three days. Fetuses were obtained by abdominal hysterotomy and instilled with isosmolar 5% albumin into the lungs and lung fluid movement was measured over 1 h by mass balance. MAP kinase expression was measured by western blot. Lung fluid absorption was induced at 61 days (D) gestation and stimulated at 68D gestation by IL-1beta. Maternal IL-1beta pretreatment upregulated ERK and upstream MEK expression at both 61 and 68D gestation, albeit being much more pronounced at 61D gestation. U0126 instillation completely blocked IL-1beta-induced lung fluid absorption as well as IL-1beta-induced/stimulated ERK expression. Cortisol synthesis inhibition by metyrapone attenuated ERK expression and lung fluid absorption in IL-1beta-pretreated fetal lungs. JNK expression after maternal IL-1beta pretreatment remained unaffected at either gestation age. These data implicate the ERK MAP kinase pathway as being important for IL-1beta induction/stimulation of lung fluid absorption in fetal guinea pigs.

  3. MAPK Cascades in Guard Cell Signal Transduction

    Science.gov (United States)

    Lee, Yuree; Kim, Yun Ju; Kim, Myung-Hee; Kwak, June M.

    2016-01-01

    Guard cells form stomata on the epidermis and continuously respond to endogenous and environmental stimuli to fine-tune the gas exchange and transpirational water loss, processes which involve mitogen-activated protein kinase (MAPK) cascades. MAPKs form three-tiered kinase cascades with MAPK kinases and MAPK kinase kinases, by which signals are transduced to the target proteins. MAPK cascade genes are highly conserved in all eukaryotes, and they play crucial roles in myriad developmental and physiological processes. MAPK cascades function during biotic and abiotic stress responses by linking extracellular signals received by receptors to cytosolic events and gene expression. In this review, we highlight recent findings and insights into MAPK-mediated guard cell signaling, including the specificity of MAPK cascades and the remaining questions. PMID:26904052

  4. MAPK cascades in guard cell signal transduction

    Directory of Open Access Journals (Sweden)

    Yuree eLee

    2016-02-01

    Full Text Available Guard cells form stomata on the epidermis and continuously respond to endogenous and environmental stimuli to fine-tune the gas exchange and transpirational water loss, processes which involve mitogen-activated protein kinase (MAPK cascades. MAPKs form three-tiered kinase cascades with MAPK kinases and MAPK kinase kinases, by which signals are transduced to the target proteins. MAPK cascade genes are highly conserved in all eukaryotes, and they play crucial roles in myriad developmental and physiological processes. MAPK cascades function during biotic and abiotic stress responses by linking extracellular signals received by receptors to cytosolic events and gene expression. In this review, we highlight recent findings and insights into MAPK-mediated guard cell signaling, including the specificity of MAPK cascades and the remaining questions.

  5. Function and interaction of maturation-promoting factor and mitogen-activated protein kinase during meiotic maturation and fertilization of oocyte

    Institute of Scientific and Technical Information of China (English)

    HUO Lijun; FAN Hengyu; CHEN Dayuan; SUN Qingyuan

    2004-01-01

    Mitogen-activated protein kinase (MAP kinase) cascade and maturation-promoting factor (MPF) play very important roles during meiotic maturation and fertilization of oocyte. Interaction between MAP kinase and MPF influences meiotic maturation and fertilization of oocyte throughout the animal kingdom, including stimulation of germinal vesicle breakdown (GVBD), suppression of DNA replication, control of meiotic chromosome segregation, maintenance of metaphase II arrest, and resumption and completion of second meiosis. This review focuses on the function and interaction of MAP kinase and MPF during meiotic maturation and fertilization of oocyte.

  6. A novel function for the MAP kinase SMA-5 in intestinal tube stability.

    Science.gov (United States)

    Geisler, Florian; Gerhardus, Harald; Carberry, Katrin; Davis, Wayne; Jorgensen, Erik; Richardson, Christine; Bossinger, Olaf; Leube, Rudolf E

    2016-12-01

    Intermediate filaments are major cytoskeletal components whose assembly into complex networks and isotype-specific functions are still largely unknown. Caenorhabditis elegans provides an excellent model system to study intermediate filament organization and function in vivo. Its intestinal intermediate filaments localize exclusively to the endotube, a circumferential sheet just below the actin-based terminal web. A genetic screen for defects in the organization of intermediate filaments identified a mutation in the catalytic domain of the MAP kinase 7 orthologue sma-5(kc1) In sma-5(kc1) mutants, pockets of lumen penetrate the cytoplasm of the intestinal cells. These membrane hernias increase over time without affecting epithelial integrity and polarity. A more pronounced phenotype was observed in the deletion allele sma-5(n678) and in intestine-specific sma-5(RNAi) Besides reduced body length, an increased time of development, reduced brood size, and reduced life span were observed in the mutants, indicating compromised food uptake. Ultrastructural analyses revealed that the luminal pockets include the subapical cytoskeleton and coincide with local thinning and gaps in the endotube that are often enlarged in other regions. Increased intermediate filament phosphorylation was detected by two-dimensional immunoblotting, suggesting that loss of SMA-5 function leads to reduced intestinal tube stability due to altered intermediate filament network phosphorylation. © 2016 Geisler et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  7. Activation of the Cph1-dependent MAP kinase signaling pathway induces white-opaque switching in Candida albicans.

    Directory of Open Access Journals (Sweden)

    Bernardo Ramírez-Zavala

    Full Text Available Depending on the environmental conditions, the pathogenic yeast Candida albicans can undergo different developmental programs, which are controlled by dedicated transcription factors and upstream signaling pathways. C. albicans strains that are homozygous at the mating type locus can switch from the normal yeast form (white to an elongated cell type (opaque, which is the mating-competent form of this fungus. Both white and opaque cells use the Ste11-Hst7-Cek1/Cek2 MAP kinase signaling pathway to react to the presence of mating pheromone. However, while opaque cells employ the transcription factor Cph1 to induce the mating response, white cells recruit a different downstream transcription factor, Tec1, to promote the formation of a biofilm that facilitates mating of opaque cells in the population. The switch from the white to the opaque cell form is itself induced by environmental signals that result in the upregulation of the transcription factor Wor1, the master regulator of white-opaque switching. To get insight into the upstream signaling pathways controlling the switch, we expressed all C. albicans protein kinases from a tetracycline-inducible promoter in a switching-competent strain. Screening of this library of strains showed that a hyperactive form of Ste11 lacking its N-terminal domain (Ste11(ΔN467 efficiently stimulated white cells to switch to the opaque phase, a behavior that did not occur in response to pheromone. Ste11(ΔN467-induced switching specifically required the downstream MAP kinase Cek1 and its target transcription factor Cph1, but not Cek2 and Tec1, and forced expression of Cph1 also promoted white-opaque switching in a Wor1-dependent manner. Therefore, depending on the activation mechanism, components of the pheromone-responsive MAP kinase pathway can be reconnected to stimulate an alternative developmental program, switching of white cells to the mating-competent opaque phase.

  8. Network analysis of sediment cascades derived from a digital geomorphological map - an example from the Gradenbach catchment (Schober Mountains, Austrian Alps)

    Science.gov (United States)

    Götz, Joachim; Heckmann, Tobias; Schrott, Lothar

    2013-04-01

    A detailed geomorphological map of the Gradenbach catchment (32 km², Schober Mountains, Austrian Alps) is presented that focuses on the sediment transfer system. Data were acquired in the field and by the interpretation of orthophotos, LIDAR data and derivatives (slope, curvature, aspect, shaded relief). The resulting digital geomorphological map contains polygon representations of landforms together with their morphometric parameters and an assessment of recent geomorphic activity. Special attention was paid to landform coupling, i.e. an additional table was constructed that indicates recently observable coupling between specific landforms (based on their ID in the database). From these data, we can obtain sediment cascades as a succession of coupled landforms along which sediment transfer occurs through the activity of various geomorphic processes. Based on this digital landform inventory the sediment transfer system is analysed using graph theory. As a rather new approach in geomorphology (already established within several disciplines; e.g. hydrology, biogeography), graph theory provides a promising framework for connectivity analysis in geomorphologic systems and powerful tools to visualise and analyse catchment-wide sediment transfer networks. Since the concept is arbitrarily scalable it can be applied to discrete land surface units (e.g. mapped landforms) or to continuous surface data (e.g. grid cells). In combination with geomorphological mapping, the concept allows for the (abstracted) visualisation of complex coupling relationships between multiple sediment storage landforms. Graph networks can be analysed at the level of nodes (e.g. the number of incoming and/or outgoing edges and their character as sediment source, sink or link), edges (e.g. importance within the network as conveyors of sediment from different sources), pathways (e.g. edge sequences leading to the catchment outlet or to storage landforms; these can be termed sediment cascades), or the

  9. Activation of ERK/MAP kinase in the amygdala is required for memory consolidation of pavlovian fear conditioning.

    Science.gov (United States)

    Schafe, G E; Atkins, C M; Swank, M W; Bauer, E P; Sweatt, J D; LeDoux, J E

    2000-11-01

    Although much has been learned about the neurobiological mechanisms underlying Pavlovian fear conditioning at the systems and cellular levels, relatively little is known about the molecular mechanisms underlying fear memory consolidation. The present experiments evaluated the role of the extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/MAPK) signaling cascade in the amygdala during Pavlovian fear conditioning. We first show that ERK/MAPK is transiently activated-phosphorylated in the amygdala, specifically the lateral nucleus (LA), at 60 min, but not 15, 30, or 180 min, after conditioning, and that this activation is attributable to paired presentations of tone and shock rather than to nonassociative auditory stimulation, foot shock sensitization, or unpaired tone-shock presentations. We next show that infusions of U0126, an inhibitor of ERK/MAPK activation, aimed at the LA, dose-dependently impair long-term memory of Pavlovian fear conditioning but leaves short-term memory intact. Finally, we show that bath application of U0126 impairs long-term potentiation in the LA in vitro. Collectively, these results demonstrate that ERK/MAPK activation is necessary for both memory consolidation of Pavlovian fear conditioning and synaptic plasticity in the amygdala.

  10. Neuroprotective effects of inhibiting N-methyl-D-aspartate receptors, P2X receptors and the mitogen-activated protein kinase cascade: a quantitative analysis in organotypical hippocampal slice cultures subjected to oxygen and glucose deprivation.

    Science.gov (United States)

    Rundén-Pran, E; Tansø, R; Haug, F M; Ottersen, O P; Ring, A

    2005-01-01

    Cell death was assessed by quantitative analysis of propidium iodide uptake in rat hippocampal slice cultures transiently exposed to oxygen and glucose deprivation, an in vitro model of brain ischemia. The hippocampal subfields CA1 and CA3, and fascia dentata were analyzed at different stages from 0 to 48 h after the insult. Cell death appeared at 3 h and increased steeply toward 12 h. Only a slight additional increase in propidium iodide uptake was seen at later intervals. The mitogen-activated protein kinases extracellular signal-regulated kinase 1 and extracellular signal-regulated kinase 2 were activated immediately after oxygen and glucose deprivation both in CA1 and in CA3/fascia dentata. Inhibition of the specific mitogen-activated protein kinase activator mitogen-activated protein kinase kinase by PD98059 or U0126 offered partial protection against oxygen and glucose deprivation-induced cell damage. The non-selective P2X receptor antagonist suramin gave neuroprotection of the same magnitude as the N-methyl-D-aspartate channel blocker MK-801 (approximately 70%). Neuroprotection was also observed with the P2 receptor blocker PPADS. Immunogold data indicated that hippocampal slice cultures (like intact hippocampi) express several isoforms of P2X receptors at the synaptic level, consistent with the idea that the effects of suramin and PPADS are mediated by P2X receptors. Virtually complete neuroprotection was obtained by combined blockade of N-methyl-D-aspartate receptors, P2X receptors, and mitogen-activated protein kinase kinase. Both P2X receptors and N-methyl-D-aspartate receptors mediate influx of calcium. Our results suggest that inhibition of P2X receptors has a neuroprotective potential similar to that of inhibition of N-methyl-D-aspartate receptors. In contrast, our comparative analysis shows that only partial protection can be achieved by inhibiting the extracellular signal-regulated kinase 1/2 mitogen-activated protein kinase cascade, one of the

  11. STATE OF JNK AND P38 MAP-KINASE SYSTEM IN BLOOD monon uclea r le ucocytes DUR ING INFLAMMATION

    Directory of Open Access Journals (Sweden)

    N. Y. Chasovskih

    2009-01-01

    Full Text Available Abstract. Pogrammed cell death of peripheral blood mononuclear leucocytes from patients with acute inflammatory diseases (non-nosocomial pneumonia, acute appendicitis was investigated under ex vivo conditions, upon cultivation of the cells with selective inhibitors of JNK (SP600125 and р38 МАРК (ML3403. In vitro addition of SP600125 and ML3403 under oxidative stress conditions prevents increase of annexinpositive mononuclear cells numbers, thus suggesting JNK and р38 МАР-kinases to be involved into oxidative mechanisms of apoptosis deregulation. A role of JNK in IL-8 production by mononuclear leucocytes was revealed in cases of acute inflammation. Regulatory effect of JNK and p38 MAP-kinases can be mediated through activation of redox-sensitive apoptogenic signal transduction systems, as well as due to changes in cellular cytokine-producing function.

  12. Neuronal development in Caenorhabditis elegans is regulated by inhibition of an MLK MAP kinase pathway.

    Science.gov (United States)

    Baker, Scott T; Turgeon, Shane M; Tulgren, Erik D; Wigant, Jeanne; Rahimi, Omeed; Opperman, Karla J; Grill, Brock

    2015-01-01

    We show that loss-of-function mutations in kinases of the MLK-1 pathway (mlk-1, mek-1, and kgb-1/jnk) function cell-autonomously in neurons to suppress defects in synapse formation and axon termination caused by rpm-1 loss of function. Our genetic analysis also suggests that the phosphatase PPM-1, like RPM-1, is a potential inhibitor of kinases in the MLK-1 pathway.

  13. Gene for the catalytic subunit of mouse DNA-dependent protein kinase maps to the scid locus.

    Science.gov (United States)

    Miller, R D; Hogg, J; Ozaki, J H; Gell, D; Jackson, S P; Riblet, R

    1995-01-01

    The gene encoding the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) has been proposed recently as a candidate gene for the mouse severe combined immune deficiency (scid) locus. We have used a partial cDNA clone for human DNA-PKcs to map the mouse homologue using a large interspecific backcross panel. We found that the mouse gene for DNA-PKcs does not recombine with scid, consistent with the hypothesis that scid is a mutation in the mouse gene for DNA-PKcs. Images Fig. 3 PMID:7479885

  14. Intermittent Hypoxia-Induced Spinal Inflammation Impairs Respiratory Motor Plasticity by a Spinal p38 MAP Kinase-Dependent Mechanism.

    Science.gov (United States)

    Huxtable, Adrianne G; Smith, Stephanie M C; Peterson, Timothy J; Watters, Jyoti J; Mitchell, Gordon S

    2015-04-29

    Inflammation is characteristic of most clinical disorders that challenge the neural control of breathing. Since inflammation modulates neuroplasticity, we studied the impact of inflammation caused by prolonged intermittent hypoxia on an important form of respiratory plasticity, acute intermittent hypoxia (three, 5 min hypoxic episodes, 5 min normoxic intervals) induced phrenic long-term facilitation (pLTF). Because chronic intermittent hypoxia elicits neuroinflammation and pLTF is undermined by lipopolysaccharide-induced systemic inflammation, we hypothesized that one night of intermittent hypoxia (IH-1) elicits spinal inflammation, thereby impairing pLTF by a p38 MAP kinase-dependent mechanism. pLTF and spinal inflammation were assessed in anesthetized rats pretreated with IH-1 (2 min hypoxia, 2 min normoxia; 8 h) or sham normoxia and allowed 16 h for recovery. IH-1 (1) transiently increased IL-6 (1.5 ± 0.2-fold; p = 0.02) and inducible nitric oxide synthase (iNOS) (2.4 ± 0.4-fold; p = 0.01) mRNA in cervical spinal homogenates, (2) elicited a sustained increase in IL-1β mRNA (2.4 ± 0.2-fold; p < 0.001) in isolated cervical spinal microglia, and (3) abolished pLTF (-1 ± 5% vs 56 ± 10% in controls; p < 0.001). pLTF was restored after IH-1 by systemic NSAID administration (ketoprofen; 55 ± 9%; p < 0.001) or spinal p38 MAP kinase inhibition (58 ± 2%; p < 0.001). IH-1 increased phosphorylated (activated) p38 MAP kinase immunofluorescence in identified phrenic motoneurons and adjacent microglia. In conclusion, IH-1 elicits spinal inflammation and impairs pLTF by a spinal p38 MAP kinase-dependent mechanism. By targeting inflammation, we may develop strategies to manipulate respiratory motor plasticity for therapeutic advantage when the respiratory control system is compromised (e.g., sleep apnea, apnea of prematurity, spinal injury, or motor neuron disease).

  15. Gene-Environment Interactions Target Mitogen-activated Protein 3 Kinase 1 (MAP3K1) Signaling in Eyelid Morphogenesis*

    Science.gov (United States)

    Mongan, Maureen; Meng, Qinghang; Wang, Jingjing; Kao, Winston W.-Y.; Puga, Alvaro; Xia, Ying

    2015-01-01

    Gene-environment interactions determine the biological outcomes through mechanisms that are poorly understood. Mouse embryonic eyelid closure is a well defined model to study the genetic control of developmental programs. Using this model, we investigated how exposure to dioxin-like environmental pollutants modifies the genetic risk of developmental abnormalities. Our studies reveal that mitogen-activated protein 3 kinase 1 (MAP3K1) signaling is a focal point of gene-environment cross-talk. Dioxin exposure, acting through the aryl hydrocarbon receptor (AHR), blocked eyelid closure in genetic mutants in which MAP3K1 signaling was attenuated but did not disturb this developmental program in either wild type or mutant mice with attenuated epidermal growth factor receptor or WNT signaling. Exposure also markedly inhibited c-Jun phosphorylation in Map3k1+/− embryonic eyelid epithelium, suggesting that dioxin-induced AHR pathways can synergize with gene mutations to inhibit MAP3K1 signaling. Our studies uncover a novel mechanism through which the dioxin-AHR axis interacts with the MAP3K1 signaling pathways during fetal development and provide strong empirical evidence that specific gene alterations can increase the risk of developmental abnormalities driven by environmental pollutant exposure. PMID:26109068

  16. MAP kinase pathways and calcitonin influence CD44 alternate isoform expression in prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Yang Kui

    2008-09-01

    Full Text Available Abstract Background Dysregulated expression and splicing of cell adhesion marker CD44 is found in many types of cancer. In prostate cancer (PC specifically, the standard isoform (CD44s has been found to be downregulated compared with benign tissue whereas predominant variant isoform CD44v7-10 is upregulated. Mitogen-activated protein kinase pathways and paracrine calcitonin are two common factors linked to dysregulated expression and splicing of CD44 in cancer. Calcitonin has been found to increase proliferation and invasion in PC acting through the protein kinase A pathway. Methods In androgen-independent PC with known high CD44v7-10 expression, CD44 total and CD44v7-10 RNA or protein were assessed in response to exogenous and endogenous calcitonin and to inhibitors of protein kinase A, MEK, JNK, or p38 kinase. Benign cells and calcitonin receptor-negative PC cells were also tested. Results MEK or p38 but not JNK reduced CD44 total RNA by 40%–65% in cancer and benign cells. Inhibition of protein kinase A reduced CD44 total and v7-10 protein expression. In calcitonin receptor-positive cells only, calcitonin increased CD44 variant RNA and protein by 3 h and persisting to 48 h, apparently dependent on an uninhibited p38 pathway. Cells with constitutive CT expression showed an increase in CD44v7-10 mRNA but a decrease in CD44 total RNA. Conclusion The MEK pathway increases CD44 RNA, while calcitonin, acting through the protein kinase A and p38 pathway, facilitates variant splicing. These findings could be used in the formulation of therapeutic methods for PC targeting CD44 alternate splicing.

  17. Identification of a 115kDa MAP-kinase activated by freezing and anoxic stresses in the marine periwinkle, Littorina littorea.

    Science.gov (United States)

    MacDonald, Justin A; Storey, Kenneth B

    2006-06-15

    The mitogen-activated protein kinase (MAPK) cascade regulates changes in gene transcription by transmitting extracellular stimuli from the plasma membrane to the cell nucleus and has an important role to play in organismal responses to environmental stresses. The activities of MAPKs were investigated in the marine gastropod mollusk, Littorina littorea, a species that tolerates both extracellular freezing and long term oxygen deprivation. In-gel kinase assays revealed the presence of two MAPKs in foot muscle and hepatopancreas, a 42 and a 115kDa protein. Immunoblot analysis showed that both were MAPK proteins and that one was the periwinkle homologue of p42(ERK2). Size exclusion chromatography confirmed the 115kDa size of the novel snail MAPK and its role as the dominant MAPK activity in foot muscle. In-gel kinase assays, immunoblotting with phospho-specific ERK antibody, as well as kinase activity profiles from hydroxyapatite chromatography demonstrated that p115 MAPK kinase activity was increased in foot muscle in response to in vivo freezing or anoxia exposures. The results suggest a role for this novel kinase in environmental stress response.

  18. A genome-wide RNAi screen reveals MAP kinase phosphatases as key ERK pathway regulators during embryonic stem cell differentiation.

    Directory of Open Access Journals (Sweden)

    Shen-Hsi Yang

    Full Text Available Embryonic stem cells and induced pluripotent stem cells represent potentially important therapeutic agents in regenerative medicine. Complex interlinked transcriptional and signaling networks control the fate of these cells towards maintenance of pluripotency or differentiation. In this study we have focused on how mouse embryonic stem cells begin to differentiate and lose pluripotency and, in particular, the role that the ERK MAP kinase and GSK3 signaling pathways play in this process. Through a genome-wide siRNA screen we have identified more than 400 genes involved in loss of pluripotency and promoting the onset of differentiation. These genes were functionally associated with the ERK and/or GSK3 pathways, providing an important resource for studying the roles of these pathways in controlling escape from the pluripotent ground state. More detailed analysis identified MAP kinase phosphatases as a focal point of regulation and demonstrated an important role for these enzymes in controlling ERK activation kinetics and subsequently determining early embryonic stem cell fate decisions.

  19. Inducible activation of ERK5 MAP kinase enhances adult neurogenesis in the olfactory bulb and improves olfactory function.

    Science.gov (United States)

    Wang, Wenbin; Lu, Song; Li, Tan; Pan, Yung-Wei; Zou, Junhui; Abel, Glen M; Xu, Lihong; Storm, Daniel R; Xia, Zhengui

    2015-05-20

    Recent discoveries have suggested that adult neurogenesis in the subventricular zone (SVZ) and olfactory bulb (OB) may be required for at least some forms of olfactory behavior in mice. However, it is unclear whether conditional and selective enhancement of adult neurogenesis by genetic approaches is sufficient to improve olfactory function under physiological conditions or after injury. Furthermore, specific signaling mechanisms regulating adult neurogenesis in the SVZ/OB are not fully defined. We previously reported that ERK5, a MAP kinase selectively expressed in the neurogenic regions of the adult brain, plays a critical role in adult neurogenesis in the SVZ/OB. Using a site-specific knock-in mouse model, we report here that inducible and targeted activation of the endogenous ERK5 in adult neural stem/progenitor cells enhances adult neurogenesis in the OB by increasing cell survival and neuronal differentiation. This conditional ERK5 activation also improves short-term olfactory memory and odor-cued associative olfactory learning under normal physiological conditions. Furthermore, these mice show enhanced recovery of olfactory function and have more adult-born neurons after a zinc sulfate-induced lesion of the main olfactory epithelium. We conclude that ERK5 MAP kinase is an important endogenous signaling pathway regulating adult neurogenesis in the SVZ/OB, and that conditional activation of endogenous ERK5 is sufficient to enhance adult neurogenesis in the OB thereby improving olfactory function both under normal conditions and after injury.

  20. QSAR Analysis of Some Antagonists for p38 map kinase Using Combination of Principal Component Analysis and Artificial Intelligence.

    Science.gov (United States)

    Doosti, Elham; Shahlaei, Mohsen

    2015-01-01

    Quantitative relationships between structures of a set of p38 map kinase inhibitors and their activities were investigated by principal component regression (PCR) and principal componentartificial neural network (PC-ANN). Latent variables (called components) generated by principal component analysis procedure were applied as the input of developed Quantitative structure- activity relationships (QSAR) models. An exact study of predictability of PCR and PC-ANN showed that the later model has much higher ability to calculate the biological activity of the investigated molecules. Also, experimental and estimated biological activities of compounds used in model development step have indicated a good correlation. Obtained results show that a non-linear model explaining the relationship between the pIC50s and the calculated principal components (that extract from structural descriptors of the studied molecules) is superior than linear model. Some typical figures of merit for QSAR studies explaining the accuracy and predictability of the suggested models were calculated. Therefore, to design novel inhibitors of p38 map kinase with high potency and low undesired effects the developed QSAR models were used to estimate biological pIC50 of the studied compounds.

  1. A Myb transcription factor of Phytophthora sojae, regulated by MAP kinase PsSAK1, is required for zoospore development.

    Directory of Open Access Journals (Sweden)

    Meng Zhang

    Full Text Available PsSAK1, a mitogen-activated protein (MAP kinase from Phytophthora sojae, plays an important role in host infection and zoospore viability. However, the downstream mechanism of PsSAK1 remains unclear. In this study, the 3'-tag digital gene expression (DGE profiling method was applied to sequence the global transcriptional sequence of PsSAK1-silenced mutants during the cysts stage and 1.5 h after inoculation onto susceptible soybean leaf tissues. Compared with the gene expression levels of the recipient P. sojae strain, several candidates of Myb family were differentially expressed (up or down in response to the loss of PsSAK1, including of a R2R3-type Myb transcription factor, PsMYB1. qRT-PCR indicated that the transcriptional level of PsMYB1 decreased due to PsSAK1 silencing. The transcriptional level of PsMYB1 increased during sporulating hyphae, in germinated cysts, and early infection. Silencing of PsMYB1 results in three phenotypes: a no cleavage of the cytoplasm into uninucleate zoospores or release of normal zoospores, b direct germination of sporangia, and c afunction in zoospore-mediated plant infection. Our data indicate that the PsMYB1 transcription factor functions downstream of MAP kinase PsSAK1 and is required for zoospore development of P. sojae.

  2. MAP kinase specifically mediates the ABA-induced H2O2 generation in guard cells of Vicia faba L

    Institute of Scientific and Technical Information of China (English)

    JIANG Jing; AN Guoyong; WANG Pengcheng; WANG Pengtao; HAN Jinfeng; JIA Yanbin; SONG Chunpeng

    2003-01-01

    Mitogen-activated protein (MAP) kinase is involved in ABA- or H2O2-signaling, and H2O2 acts as intermediate in the downstream of ABA signal transduction pathway, which has recently emerged as a secondary messenger of ABA signaling. Using an epidermal strip bioassay and laser scanning confocal microscope, we provided the first evidence that MAP kinase plays an important role in H2O2 signal initial, amplification and specific targeting in response to stimuli in guard cells. ABA- or H2O2-induced Vicia faba stomatal closure was inhibited or reversed by the specific inhibitor PD98059 of MEK1/2; the guard cells were pre-incubated or -microinjected by 10 (mol·L-1 PD98059, ABA could not enhance the fluorescence intensity of H2O2 probe dichlorofluorescein (DCF). Meanwhile, after ABA induced the H2O2 accumulation in guard cells, the exogenous or intracellular PD98059 could reduce the DCF fluorescence intensity. Most interestingly, on the contrary to ABA, the DCF fluorescence intensity of guard cells treated by 100 (mol·L-1 salicylic acid (SA) was not down-regulated by PD98059, yet PD98059 did not regulate the stomatal movement being induced by light, dark or salicylic acid. These results suggest that MEK1/2 could mediate stomatal closure by abolishing the ABA-induced H2O2 generation/accumula- tion in the specific manner.

  3. Novel mechanisms of sildenafil in pulmonary hypertension involving cytokines/chemokines, MAP kinases and Akt.

    Directory of Open Access Journals (Sweden)

    Tamas Kiss

    Full Text Available Pulmonary arterial hypertension (PH is associated with high mortality due to right ventricular failure and hypoxia, therefore to understand the mechanism by which pulmonary vascular remodeling initiates these processes is very important. We used a well-characterized monocrotaline (MCT-induced rat PH model, and analyzed lung morphology, expression of cytokines, mitogen-activated protein kinase (MAPK phosphorylation, and phosphatidylinositol 3-kinase-Akt (PI-3k-Akt pathway and nuclear factor (NF-κB activation in order to elucidate the mechanisms by which sildenafil's protective effect in PH is exerted. Besides its protective effect on lung morphology, sildenafil suppressed multiple cytokines involved in neutrophil and mononuclear cells recruitment including cytokine-induced neutrophil chemoattractant (CINC-1, CINC-2α/β, tissue inhibitor of metalloproteinase (TIMP-1, interleukin (IL-1α, lipopolysaccharide induced CXC chemokine (LIX, monokine induced by gamma interferon (MIG, macrophage inflammatory protein (MIP-1α, and MIP-3α. NF-κB activation and phosphorylation were also attenuated by sildenafil. Furthermore, sildenafil reduced extracellular signal-regulated kinase (ERK1/2 and p38 MAPK activation while enhanced activation of the cytoprotective Akt pathway in PH. These data suggest a beneficial effect of sildenafil on inflammatory and kinase signaling mechanisms that substantially contribute to its protective effects, and may have potential implications in designing future therapeutic strategies in the treatment of pulmonary hypertension.

  4. Extracellular simian virus 40 induces an ERK/MAP kinase-independent signalling pathway that activates primary response genes and promotes virus entry.

    Science.gov (United States)

    Dangoria, N S; Breau, W C; Anderson, H A; Cishek, D M; Norkin, L C

    1996-09-01

    Simian virus 40 (SV40) binding to growth-arrested cells activated an intracellular signalling pathway that induced the up-regulation of the primary response genes c-myc, c-jun and c-sis within 30 min and of JE within 90 min. The up-regulation of the primary response genes occurred in the presence of cycloheximide and when UV-inactivated SV40 was adsorbed to cells. SV40 binding did not activate Raf or mitogen-activated protein kinase (MAP/ERK1), or mobilize intracellular Ca2+. The SV40-induced up-regulation of c-myc and c-jun was blocked by the tyrosine kinase inhibitor, genistein, and by the protein kinase C (PKC) inhibitor, calphostin C, but not by expression of the MAP kinase-specific phosphatase, MKP-1. These results suggest that the SV40-induced signalling pathway includes the activities of a tyrosine kinase and a Ca(2+)-independent isoform of PKC, but not of Raf or MAP kinase. Finally, SV40 infectious entry into cells was specifically and reversibly blocked by genistein.

  5. Evaluate ERTS imagery for mapping and detection of changes of snowcover on land and on glaciers. [North Cascades, Washington and Tweedsmuir Glacier, Alaska

    Science.gov (United States)

    Meier, M. F. (Principal Investigator)

    1974-01-01

    The author has identified the following significant results. Snowlines on a small (6 sq km) drainage basin were accurately measured without use of digital processing, and snow patches as small as 150 m (maximum dimension) were correctly identified, proving that the resolution of ERTS is ample for snow mapping needs. The area of snow cover on 10 individual drainage basins in the North Cascades, Washington, has been determined at 12 different times; these data can be used for more accurate forecasts of streamflow. Progress has been made in distinguishing snow in trees using multispectral analysis. Motion of the surging Tweedsmuir Glacier was measured. Velocities ranged from 2 to 88 m per day; a zone of intense crevassing also appeared to spread up and down the glacier (at about 200 m per day upglacier). This tentative result may be of great importance to an understanding of surging glacier dynamics. ERTS images also show that the most recent debris flow (20-21 August 1973) from Mount Baker can be clearly discerned and mapped, in order to monitor this potential hazard.

  6. Helicobacter pylori VacA enhances prostaglandin E2 production through induction of cyclooxygenase 2 expression via a p38 mitogen-activated protein kinase/activating transcription factor 2 cascade in AZ-521 cells

    DEFF Research Database (Denmark)

    Hisatsune, Junzo; Yamasaki, Eiki; Nakayama, Masaaki;

    2007-01-01

    Treatment of AZ-521 cells with Helicobacter pylori VacA increased cyclooxygenase 2 (COX-2) mRNA in a time- and dose-dependent manner. A p38 mitogen-activated protein kinase (MAPK) inhibitor, SB203580, blocked elevation of COX-2 mRNA levels, whereas PD98059, which blocks the Erk1/2 cascade......A-induced COX-2 expression. In parallel with COX-2 expression, VacA increased prostaglandin E(2) (PGE(2)) production, which was inhibited by SB203580 and NS-398, a COX-2 inhibitor. VacA-induced PGE(2) production was markedly attenuated in AZ-521 cells stably expressing DN-p38. VacA increased transcription...... promoter activation. The reduction of ATF-2 expression in AZ-521 cells transformed with ATF-2-small interfering RNA duplexes resulted in suppression of COX-2 expression. Thus, VacA enhances PGE(2) production by AZ-521 cells through induction of COX-2 expression via the p38 MAPK/ATF-2 cascade, leading...

  7. Co-culture with pig membrana granulosa cells modulates the activity of cdc2 and MAP kinase in maturing cattle oocytes.

    Science.gov (United States)

    Motlík, J; Sutovský, P; Kalous, J; Kubelka, M; Moos, J; Schultz, R M

    1996-08-01

    Bovine cumulus-enclosed oocytes, initially cultured up to diakinesis (8 h of initial culture) or metaphase I (12 h of initial culture), were subsequently co-cultured for 6 h in contact with pig membrana granulosa (PMG) cells and then assayed for histone H1 and MAP kinase activities. In addition, the phosphorylation state of ERK 1,2 proteins was determined by Western blotting. The alterations in nuclear envelope breakdown, meiotic spindle formation and the patterns of chromosome condensation were analysed by immunofluorescence and transmission electron microscopy. The diakinesis-stage oocytes (initially cultured for 8 h) already possessed high histone H1 kinase and MAP kinase activities that were correlated with condensed and partially individualised chromosomes. The ERK 1 and most ERK 2 proteins were partly phosphorylated. Following the 6 h co-culture of these oocytes with PMG a rapid decrease in MAP kinase activity and a slower decrease in histone H1 kinase occurred, as well as ERK 1 and ERK 2 dephosphorylation. Both kinase activities and ERK 1,2 phosphorylation were fully restored following the release of the oocytes from co-culture and a subsequent culture in the absence of PMG. Moreover, the clumped bivalents were reindividualised and 56% of these oocytes reached metaphase II after 20 h of culture without PMG. The metaphase I oocytes, initially cultured for 12 h, displayed a fusiform meiotic spindle and a metaphase array of chromosomal bivalents, accompanied by high levels of both histone H1 and MAP kinase activity. Co-culture of MI oocytes with PMG abolished the activity of both kinases and caused the dephosphorylation of ERK 1 and ERK 2. Furthermore, the spindle microtubules were depolymerised and the chromosomal bivalents clumped into a single mass. Neither of the protein kinase activities nor the meiotic spindle were restored following subsequent culture in the absence of PMG for up to 20 h. These observations indicate that under in vitro conditions

  8. Systems Analysis of Adaptive Responses to MAP Kinase Pathway Blockade in BRAF Mutant Melanoma.

    Directory of Open Access Journals (Sweden)

    Brian J Capaldo

    Full Text Available Fifty percent of cutaneous melanomas are driven by activated BRAFV600E, but tumors treated with RAF inhibitors, even when they respond dramatically, rapidly adapt and develop resistance. Thus, there is a pressing need to identify the major mechanisms of intrinsic and adaptive resistance and develop drug combinations that target these resistance mechanisms. In a combinatorial drug screen on a panel of 12 treatment-naïve BRAFV600E mutant melanoma cell lines of varying levels of resistance to mitogen-activated protein kinase (MAPK pathway inhibition, we identified the combination of PLX4720, a targeted inhibitor of mutated BRaf, and lapatinib, an inhibitor of the ErbB family of receptor tyrosine kinases, as synergistically cytotoxic in the subset of cell lines that displayed the most resistance to PLX4720. To identify potential mechanisms of resistance to PLX4720 treatment and synergy with lapatinib treatment, we performed a multi-platform functional genomics analysis to profile the genome as well as the transcriptional and proteomic responses of these cell lines to treatment with PLX4720. We found modest levels of resistance correlated with the zygosity of the BRAF V600E allele and receptor tyrosine kinase (RTK mutational status. Layered over base-line resistance was substantial upregulation of many ErbB pathway genes in response to BRaf inhibition, thus generating the vulnerability to combination with lapatinib. The transcriptional responses of ErbB pathway genes are associated with a number of transcription factors, including ETS2 and its associated cofactors that represent a convergent regulatory mechanism conferring synergistic drug susceptibility in the context of diverse mutational landscapes.

  9. Regulation of endothelial protein C receptor shedding by cytokines is mediated through differential activation of MAP kinase signaling pathways

    Energy Technology Data Exchange (ETDEWEB)

    Menschikowski, Mario, E-mail: Mario.Menschikowski@uniklinikum-dresden.de [Institute of Clinical Chemistry and Laboratory Medicine, Technical University of Dresden, Medical Faculty ' Carl Gustav Carus' , Fetscherstrasse 74, D-01307 Dresden (Germany); Hagelgans, Albert; Eisenhofer, Graeme; Siegert, Gabriele [Institute of Clinical Chemistry and Laboratory Medicine, Technical University of Dresden, Medical Faculty ' Carl Gustav Carus' , Fetscherstrasse 74, D-01307 Dresden (Germany)

    2009-09-10

    The endothelial protein C receptor (EPCR) plays a pivotal role in coagulation, inflammation, cell proliferation, and cancer, but its activity is markedly changed by ectodomain cleavage and release as the soluble protein (sEPCR). In this study we examined the mechanisms involved in the regulation of EPCR shedding in human umbilical endothelial cells (HUVEC). Interleukin-1{beta} (IL-1{beta}) and tumor necrosis factor-{alpha} (TNF-{alpha}), but not interferon-{gamma} and interleukin-6, suppressed EPCR mRNA transcription and cell-associated EPCR expression in HUVEC. The release of sEPCR induced by IL-1{beta} and TNF-{alpha} correlated with activation of p38 MAPK and c-Jun N-terminal kinase (JNK). EPCR shedding was also induced by phorbol 12-myristate 13-acetate, ionomycin, anisomycin, thiol oxidants or alkylators, thrombin, and disruptors of lipid rafts. Both basal and induced shedding of EPCR was blocked by the metalloproteinase inhibitors, TAPI-0 and GM6001, and by the reduced non-protein thiols, glutathione, dihydrolipoic acid, dithiothreitol, and N-acetyl-L-cysteine. Because other antioxidants and scavengers of reactive oxygen species failed to block the cleavage of EPCR, a direct suppression of metalloproteinase activity seems responsible for the observed effects of reduced thiols. In summary, the shedding of EPCR in HUVEC is effectively regulated by IL-1{beta} and TNF-{alpha}, and downstream by MAP kinase signaling pathways and metalloproteinases.

  10. Cell-permeable p38 MAP kinase promotes migration of adult neural stem/progenitor cells

    Science.gov (United States)

    Hamanoue, Makoto; Morioka, Kazuhito; Ohsawa, Ikuroh; Ohsawa, Keiko; Kobayashi, Masaaki; Tsuburaya, Kayo; Akasaka, Yoshikiyo; Mikami, Tetsuo; Ogata, Toru; Takamatsu, Ken

    2016-01-01

    Endogenous neural stem/progenitor cells (NPCs) can migrate toward sites of injury, but the migration activity of NPCs is insufficient to regenerate damaged brain tissue. In this study, we showed that p38 MAP kinase (p38) is expressed in doublecortin-positive adult NPCs. Experiments using the p38 inhibitor SB203580 revealed that endogenous p38 participates in NPC migration. To enhance NPC migration, we generated a cell-permeable wild-type p38 protein (PTD-p38WT) in which the HIV protein transduction domain (PTD) was fused to the N-terminus of p38. Treatment with PTD-p38WT significantly promoted the random migration of adult NPCs without affecting cell survival or differentiation; this effect depended on the cell permeability and kinase activity of the fusion protein. These findings indicate that PTD-p38WT is a novel and useful tool for unraveling the roles of p38, and that this protein provides a reasonable approach for regenerating the injured brain by enhancing NPC migration. PMID:27067799

  11. The Pelargonium sidoides Extract EPs 7630 Drives the Innate Immune Defense by Activating Selected MAP Kinase Pathways in Human Monocytes.

    Science.gov (United States)

    Witte, Katrin; Koch, Egon; Volk, Hans-Dieter; Wolk, Kerstin; Sabat, Robert

    2015-01-01

    Pelargonium sidoides is a medical herb and respective extracts are used very frequently for the treatment of respiratory tract infections. However, the effects of Pelargonium sidoides and a special extract prepared from its roots (EPs 7630) on human immune cells are not fully understood. Here we demonstrate that EPs 7630 induced a rapid and dose-dependent production of TNF-α, IL-6, and IL-10 by human blood immune cells. This EPs 7630-induced cytokine profile was more pro-inflammatory in comparison with the profile induced by viral or bacterial infection-mimicking agents. The search for EPs 7630 target cells revealed that T-cells did not respond to EPs 7630 stimulation by production of TNF-α, IL-6, or IL-10. Furthermore, pretreatment of T-cells with EPs 7630 did not modulate their TNF-α, IL-6, and IL-10 secretion during subsequent activation. In contrast to lymphocytes, monocytes showed clear intracellular TNF-α staining after EPs 7630 treatment. Accordingly, EPs 7630 predominantly provoked activation of MAP kinases and inhibition of p38 strongly reduced the monocyte TNF-α production. The pretreatment of blood immune cells with EPs 7630 lowered their secretion of TNF-α and IL-10 and caused an IL-6 dominant response during second stimulation with viral or bacterial infection-mimicking agents. In summary, we demonstrate that EPs 7630 activates human monocytes, induces MAP kinase-dependent pro-inflammatory cytokines in these cells, and specifically modulates their production capacity of mediators known to lead to an increase of acute phase protein production in the liver, neutrophil generation in the bone marrow, and the generation of adaptive Th17 and Th22 cells.

  12. The Pelargonium sidoides Extract EPs 7630 Drives the Innate Immune Defense by Activating Selected MAP Kinase Pathways in Human Monocytes.

    Directory of Open Access Journals (Sweden)

    Katrin Witte

    Full Text Available Pelargonium sidoides is a medical herb and respective extracts are used very frequently for the treatment of respiratory tract infections. However, the effects of Pelargonium sidoides and a special extract prepared from its roots (EPs 7630 on human immune cells are not fully understood. Here we demonstrate that EPs 7630 induced a rapid and dose-dependent production of TNF-α, IL-6, and IL-10 by human blood immune cells. This EPs 7630-induced cytokine profile was more pro-inflammatory in comparison with the profile induced by viral or bacterial infection-mimicking agents. The search for EPs 7630 target cells revealed that T-cells did not respond to EPs 7630 stimulation by production of TNF-α, IL-6, or IL-10. Furthermore, pretreatment of T-cells with EPs 7630 did not modulate their TNF-α, IL-6, and IL-10 secretion during subsequent activation. In contrast to lymphocytes, monocytes showed clear intracellular TNF-α staining after EPs 7630 treatment. Accordingly, EPs 7630 predominantly provoked activation of MAP kinases and inhibition of p38 strongly reduced the monocyte TNF-α production. The pretreatment of blood immune cells with EPs 7630 lowered their secretion of TNF-α and IL-10 and caused an IL-6 dominant response during second stimulation with viral or bacterial infection-mimicking agents. In summary, we demonstrate that EPs 7630 activates human monocytes, induces MAP kinase-dependent pro-inflammatory cytokines in these cells, and specifically modulates their production capacity of mediators known to lead to an increase of acute phase protein production in the liver, neutrophil generation in the bone marrow, and the generation of adaptive Th17 and Th22 cells.

  13. Mechanisms of cell signaling by nitric oxide and peroxynitrite: from mitochondria to MAP kinases

    Science.gov (United States)

    Levonen, A. L.; Patel, R. P.; Brookes, P.; Go, Y. M.; Jo, H.; Parthasarathy, S.; Anderson, P. G.; Darley-Usmar, V. M.

    2001-01-01

    Many of the biological and pathological effects of nitric oxide (NO) are mediated through cell signaling pathways that are initiated by NO reacting with metalloproteins. More recently, it has been recognized that the reaction of NO with free radicals such as superoxide and the lipid peroxyl radical also has the potential to modulate redox signaling. Although it is clear that NO can exert both cytotoxic and cytoprotective actions, the focus of this overview are those reactions that could lead to protection of the cell against oxidative stress in the vasculature. This will include the induction of antioxidant defenses such as glutathione, activation of mitogen-activated protein kinases in response to blood flow, and modulation of mitochondrial function and its impact on apoptosis. Models are presented that show the increased synthesis of glutathione in response to shear stress and inhibition of cytochrome c release from mitochondria. It appears that in the vasculature NO-dependent signaling pathways are of three types: (i) those involving NO itself, leading to modulation of mitochondrial respiration and soluble guanylate cyclase; (ii) those that involve S-nitrosation, including inhibition of caspases; and (iii) autocrine signaling that involves the intracellular formation of peroxynitrite and the activation of the mitogen-activated protein kinases. Taken together, NO plays a major role in the modulation of redox cell signaling through a number of distinct pathways in a cellular setting.

  14. Comprehensive gene expression atlas for the Arabidopsis MAP kinase signalling pathways.

    Science.gov (United States)

    Menges, Margit; Dóczi, Róbert; Okrész, László; Morandini, Piero; Mizzi, Luca; Soloviev, Mikhail; Murray, James A H; Bögre, László

    2008-01-01

    * Mitogen activated protein kinase (MAPK) pathways are signal transduction modules with layers of protein kinases having c. 120 genes in Arabidopsis, but only a few have been linked experimentally to functions. * We analysed microarray expression data for 114 MAPK signalling genes represented on the ATH1 Affymetrix arrays; determined their expression patterns during development, and in a wide range of time-course microarray experiments for their signal-dependent transcriptional regulation and their coregulation with other signalling components and transcription factors. * Global expression correlation of the MAPK genes with each of the represented 21 692 Arabidopsis genes was determined by calculating Pearson correlation coefficients. To group MAPK signalling genes based on similarities in global regulation, we performed hierarchical clustering on the pairwise correlation values. This should allow inferring functional information from well-studied MAPK components to functionally uncharacterized ones. Statistical overrepresentation of specific gene ontology (GO) categories in the gene lists showing high expression correlation values with each of the MAPK components predicted biological themes for the gene functions. * The combination of these methods provides functional information for many uncharacterized MAPK genes, and a framework for complementary future experimental dissection of the function of this complex family.

  15. Mechanisms of cell signaling by nitric oxide and peroxynitrite: from mitochondria to MAP kinases

    Science.gov (United States)

    Levonen, A. L.; Patel, R. P.; Brookes, P.; Go, Y. M.; Jo, H.; Parthasarathy, S.; Anderson, P. G.; Darley-Usmar, V. M.

    2001-01-01

    Many of the biological and pathological effects of nitric oxide (NO) are mediated through cell signaling pathways that are initiated by NO reacting with metalloproteins. More recently, it has been recognized that the reaction of NO with free radicals such as superoxide and the lipid peroxyl radical also has the potential to modulate redox signaling. Although it is clear that NO can exert both cytotoxic and cytoprotective actions, the focus of this overview are those reactions that could lead to protection of the cell against oxidative stress in the vasculature. This will include the induction of antioxidant defenses such as glutathione, activation of mitogen-activated protein kinases in response to blood flow, and modulation of mitochondrial function and its impact on apoptosis. Models are presented that show the increased synthesis of glutathione in response to shear stress and inhibition of cytochrome c release from mitochondria. It appears that in the vasculature NO-dependent signaling pathways are of three types: (i) those involving NO itself, leading to modulation of mitochondrial respiration and soluble guanylate cyclase; (ii) those that involve S-nitrosation, including inhibition of caspases; and (iii) autocrine signaling that involves the intracellular formation of peroxynitrite and the activation of the mitogen-activated protein kinases. Taken together, NO plays a major role in the modulation of redox cell signaling through a number of distinct pathways in a cellular setting.

  16. The p38 MAP kinase inhibitor SB203580 enhances nuclear factor-kappa B transcriptional activity by a non-specific effect upon the ERK pathway

    NARCIS (Netherlands)

    Birkenkamp, KU; Tuyt, LML; Lummen, C; Wierenga, LTJ; Kruijer, W; Vellenga, E

    2000-01-01

    1 In the present study we investigated a possible role for the p38 mitogen-activated protein (MAP) kinase pathway in mediating nuclear factor-kappa B (NF-kappa B) transcriptional activity in the erythroleukaemic cell line TF-1. 2 TF-1 cells stimulated with the phosphatase inhibitor okadaic acid (OA)

  17. Elucidating the roles of MAP kinases in the moss Physcomitrella patens

    DEFF Research Database (Denmark)

    Stanimirovic, Sabrina

    during treatment with phytohormones and osmotic and light stress. This thesis contains of a general introduction to plant immunity and the role of MPKs in signaling processes related to immunity, abiotic stress, and plant development in both vascular and non-vascular plants. The focus in this thesis...... changes of plant immunity required for the conquest of land by plants. I describe the role of MPKs (MPK3, MPK5, RAK1 & double knockout RAK1/RAK2) upon abiotic stress by characterizing the phenotypes and morphological changes there may be during stress treatments. I characterized the mutant phenotypes......-Acetyltransferase-Kinase). This thesis and work on these MPK mutants gives the laboratory a great start on several future publications, since many of the mutant lines have interesting phenotypes with and without exposure to abiotic stresses...

  18. Synergistic effect of vasoactive intestinal peptides on TNF-alpha-induced IL-6 synthesis in osteoblasts: amplification of p44/p42 MAP kinase activation.

    Science.gov (United States)

    Natsume, Hideo; Tokuda, Haruhiko; Mizutani, Jun; Adachi, Seiji; Matsushima-Nishiwaki, Rie; Minamitani, Chiho; Kato, Kenji; Kozawa, Osamu; Otsuka, Takanobu

    2010-05-01

    We previously showed that tumor necrosis factor-alpha (TNF-alpha) stimulates synthesis of interleukin-6 (IL-6), a potent bone resorptive agent, via p44/p42 mitogen-activated protein (MAP) kinase and phosphatidylinositol 3-kinase/Akt in osteoblast-like MC3T3-E1 cells. In the present study, we investigated the effect of vasoactive intestinal peptide (VIP) on TNF-alpha-induced IL-6 synthesis in these cells. VIP, which by itself slightly stimulated IL-6 synthesis, synergistically enhanced the TNF-alpha-induced IL-6 synthesis in MC3T3-E1 cells. The synergistic effect of VIP on the TNF-alpha-induced IL-6 synthesis was concentration-dependent in the range between 1 and 70 nM. We previously reported that VIP stimulated cAMP production in MC3T3-E1 cells. Forskolin, a direct activator of adenylyl cyclase, or 8-bromoadenosine-3',5'-cyclic monophosphate (8bromo-cAMP), a plasma membrane-permeable cAMP analogue, markedly enhanced the TNF-alpha-induced IL-6 synthesis as well as VIP. VIP markedly up-regulated the TNF-alpha-induced p44/p42 MAP kinase phosphorylation. The Akt phosphorylation stimulated by TNF-alpha was only slightly affected by VIP. PD98059, a specific inhibitor of MEK1/2, significantly suppressed the enhancement of TNF-alpha-induced IL-6 synthesis by VIP. The synergistic effect of a combination of VIP and TNF-alpha on the phosphorylation of p44/p42 MAP kinase was diminished by H-89, an inhibitor of cAMP-dependent protein kinase. These results strongly suggest that VIP synergistically enhances TNF-alpha-stimulated IL-6 synthesis via up-regulating p44/p42 MAP kinase through the adenylyl cyclase-cAMP system in osteoblasts.

  19. Cascade Chaotic System With Applications.

    Science.gov (United States)

    Zhou, Yicong; Hua, Zhongyun; Pun, Chi-Man; Chen, C L Philip

    2015-09-01

    Chaotic maps are widely used in different applications. Motivated by the cascade structure in electronic circuits, this paper introduces a general chaotic framework called the cascade chaotic system (CCS). Using two 1-D chaotic maps as seed maps, CCS is able to generate a huge number of new chaotic maps. Examples and evaluations show the CCS's robustness. Compared with corresponding seed maps, newly generated chaotic maps are more unpredictable and have better chaotic performance, more parameters, and complex chaotic properties. To investigate applications of CCS, we introduce a pseudo-random number generator (PRNG) and a data encryption system using a chaotic map generated by CCS. Simulation and analysis demonstrate that the proposed PRNG has high quality of randomness and that the data encryption system is able to protect different types of data with a high-security level.

  20. Identification of a c-Jun N-terminal kinase-2-dependent signal amplification cascade that regulates c-Myc levels in ras transformation

    DEFF Research Database (Denmark)

    Mathiasen, D.P.; Egebjerg, C.; Andersen, S.H.

    2012-01-01

    that is critical for ras transformation in murine embryonic fibroblasts. This cascade is coordinated by ERK and JNK2 MAPKs, whose Ras-mediated activation leads to the enhanced levels of three oncogenic transcription factors, namely, c-Myc, activating transcription factor 2 (ATF2) and ATF3, all of which...... that counteracts protein phosphatase 2A-mediated dephosphorylation of c-Myc. Here we show that JNK2 regulates Cip2a transcription via ATF2. ATF2 and c-Myc cooperate to activate the transcription of ATF3. Remarkably, not only ectopic JNK2, but also ectopic ATF2, CIP2A, c-Myc and ATF3 are sufficient to rescue...

  1. UVB-irradiated human keratinocytes and interleukin-1αindirectly increase MAP kinase/AP-1 activation and MMP-1 production in UVA-irradiated dermal fibroblasts

    Institute of Scientific and Technical Information of China (English)

    WANG Xiao-yong; BI Zhi-gang

    2006-01-01

    Background Solar ultraviolet (UV) irradiation induces the production of matrix metalloproteinases (MMPs) by activating cellular signalling transduction pathways. MMPs are responsible for the degradation and/or inhibition of synthesis of collagenous extracellular matrix in connective tissues. We mimicked the action of environmental ultraviolet on skin and investigated the effects of UVB-irradiated human keratinocytes HaCaT and IL-1α on mitogen activated protein (MAP) kinase activation, c-Jun and c-Fos (AP-1 is composed of Jun and Fos proteins)mRNA expression and MMP-1 production in UVA-irradiated dermal fibroblasts.Methods Following UVA irradiation, the culture medium of fibroblasts was replaced by culture medium from UVB-irradiated HaCaT, or replaced by the complete culture medium with interleukin (IL)-1α. MAP kinase activity expression in fibroblasts was detected by Western blot. c-Jun and c-Fos mRNA expressions were determined by reverse transcriptional polymerase chain reaction (RT-PCR); MMP-1 production in culture medium was detected by enzyme-linked immunosorbent assay (ELISA).Results Culture medium from UVB-irradiated keratinocytes increased MAP kinase activity and c-Jun mRNA expression in UVA-irradiated fibroblasts. IL-1α increased MAP kinase activity and c-Jun mRNA expression,IL-1 α also increased c-Fos mRNA expression. Both culture media from UVB-irradiated human keratinocytes and externally applied IL-1 α increased MMP-1 production in UVA-irradiated fibroblasts.Conclusions UVB-irradiated keratinocytes and IL-1α indirectly promote MMP-1 production in UVA-irradiated fibroblasts by increasing MAP kinase/AP-1 activity. IL-1 may play an important role in the paracrine activation and dermal collagen excessive degradation leading to skin photoaging.

  2. Differential expression profiles of poplar MAP kinase kinases in response to abiotic stresses and plant hormones, and overexpression of PtMKK4 improves the drought tolerance of poplar.

    Science.gov (United States)

    Wang, Lei; Su, Hongyan; Han, Liya; Wang, Chuanqi; Sun, Yanlin; Liu, Fenghong

    2014-07-15

    Mitogen-activated protein kinase (MAPK) cascades are universal signal transduction modules that play essential roles in plant growth, development and stress response. MAPK kinases (MAPKKs), which link MAPKs and MAPKK kinases (MAPKKKs), are integral in mediating various stress responses in plants. However, to date few data about the roles of poplar MAPKKs in stress signal transduction are available. In this study, we performed a systemic analysis of poplar MAPKK gene family expression profiles in response to several abiotic stresses and stress-associated hormones. Furthermore, Populus trichocarpa MAPKK4 (PtMKK4) was chosen for functional characterization. Transgenic analysis showed that overexpression of the PtMKK4 gene remarkably enhanced drought stress tolerance in the transgenic poplar plants. The PtMKK4-overexpressing plants also exhibited much lower levels of H2O2 and higher antioxidant enzyme activity after exposure to drought stress compared to the wide type lines. Besides, some drought marker genes including PtP5CS, PtSUS3, PtLTP3 and PtDREB8 exhibited higher expression levels in the transgenic lines than in the wide type under drought conditions. This study provided valuable information for understanding the putative functions of poplar MAPKKs involved in important signaling pathways under different stress conditions.

  3. Perturbation of EGF-induced MAP kinase activation by TGF-ß1

    Directory of Open Access Journals (Sweden)

    Wenner C.E.

    1999-01-01

    Full Text Available TGF-ß1 regulates both cellular growth and phenotypic plasticity important for maintaining a growth advantage and increased invasiveness in progressively malignant cells. Recent studies indicate that TGF-ß-1 stimulates the conversion of epitheliod to fibroblastoid phenotype which presumably leads to the inactivation of growth-inhibitory effects by TGF-ß1 (Portella et al. (1998 Cell Growth and Differentiation, 9: 393-404. Therefore, the investigation of TGF-ß1 signaling that leads to altered growth and migration may provide novel targets for the prevention of increased cell growth and invasion. Although much attention has been paid to TGF-ß1 responses in epithelial cells, the above studies suggest that examination of signal transduction pathways in fibroblasts are important as well. Data from our laboratory are consistent with the concept that TGF-ß1 can act as a regulatory switch in density-dependent C3H 10T1/2 fibroblasts capable of either promoting or delaying G1 traverse. The regulation of this switch is proposed to occur prior to pRb phosphorylation, namely prior to activation of cyclin-dependent kinases. The current study is concerned with the evaluation of a key cyclin (cyclin D1 which activates cdk4 and p27KIP1 which in turn inhibit cdk2 in the proliferative responses of epidermal growth factor (EGF and platelet-derived growth factor (PDGF and their modulation by TGF-ß1. Although the molecular events that lead to elevation of cyclin D1 are not completely understood, it appears likely that activation of p42/p44MAPK kinases is involved in its transcriptional regulation. TGF-ß1 delayed EGF- or PDGF-induced cyclin D1 expression and blocked the induction of active p42/p44MAPK. The mechanism by which TGF-ß1 induces a block in p42/p44MAPK activation is being examined and the possibility that TGF-ß1 regulates phosphatase activity is being tested.

  4. Network Modeling Reveals Cross Talk of MAP Kinases during Adaptation to Caspofungin Stress in Aspergillus fumigatus.

    Science.gov (United States)

    Altwasser, Robert; Baldin, Clara; Weber, Jakob; Guthke, Reinhard; Kniemeyer, Olaf; Brakhage, Axel A; Linde, Jörg; Valiante, Vito

    2015-01-01

    Mitogen activated protein kinases (MAPKs) are highly conserved in eukaryotic organisms. In pathogenic fungi, their activities were assigned to different physiological functions including drug adaptation and resistance. Aspergillus fumigatus is a human pathogenic fungus, which causes life-threatening invasive infections. Therapeutic options against invasive mycoses are still limited. One of the clinically used drugs is caspofungin, which specifically targets the fungal cell wall biosynthesis. A systems biology approach, based on comprehensive transcriptome data sets and mathematical modeling, was employed to infer a regulatory network and identify key interactions during adaptation to caspofungin stress in A. fumigatus. Mathematical modeling and experimental validations confirmed an intimate cross talk occurring between the cell wall-integrity and the high osmolarity-glycerol signaling pathways. Specifically, increased concentrations of caspofungin promoted activation of these signalings. Moreover, caspofungin affected the intracellular transport, which caused an additional osmotic stress that is independent of glucan inhibition. High concentrations of caspofungin reduced this osmotic stress, and thus decreased its toxic activity. Our results demonstrated that MAPK signaling pathways play a key role during caspofungin adaptation and are contributing to the paradoxical effect exerted by this drug.

  5. Mapping of protein-protein interactions within the DNA-dependent protein kinase complex.

    Science.gov (United States)

    Gell, D; Jackson, S P

    1999-01-01

    In mammalian cells, the Ku and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) proteins are required for the correct and efficient repair of DNA double-strand breaks. Ku comprises two tightly-associated subunits of approximately 69 and approximately 83 kDa, which are termed Ku70 and Ku80 (or Ku86), respectively. Previously, a number of regions of both Ku subunits have been demonstrated to be involved in their interaction, but the molecular mechanism of this interaction remains unknown. We have identified a region in Ku70 (amino acid residues 449-578) and a region in Ku80 (residues 439-592) that participate in Ku subunit interaction. Sequence analysis reveals that these interaction regions share sequence homology and suggests that the Ku subunits are structurally related. On binding to a DNA double-strand break, Ku is able to interact with DNA-PKcs, but how this interaction is mediated has not been defined. We show that the extreme C-terminus of Ku80, specifically the final 12 amino acid residues, mediates a highly specific interaction with DNA-PKcs. Strikingly, these residues appear to be conserved only in Ku80 sequences from vertebrate organisms. These data suggest that Ku has evolved to become part of the DNA-PK holo-enzyme by acquisition of a protein-protein interaction motif at the C-terminus of Ku80. PMID:10446239

  6. Cascade Support Vector Machines with Dimensionality Reduction

    Directory of Open Access Journals (Sweden)

    Oliver Kramer

    2015-01-01

    Full Text Available Cascade support vector machines have been introduced as extension of classic support vector machines that allow a fast training on large data sets. In this work, we combine cascade support vector machines with dimensionality reduction based preprocessing. The cascade principle allows fast learning based on the division of the training set into subsets and the union of cascade learning results based on support vectors in each cascade level. The combination with dimensionality reduction as preprocessing results in a significant speedup, often without loss of classifier accuracies, while considering the high-dimensional pendants of the low-dimensional support vectors in each new cascade level. We analyze and compare various instantiations of dimensionality reduction preprocessing and cascade SVMs with principal component analysis, locally linear embedding, and isometric mapping. The experimental analysis on various artificial and real-world benchmark problems includes various cascade specific parameters like intermediate training set sizes and dimensionalities.

  7. ERK1/2 map kinase metabolic pathway is responsible for phosphorylation of translation initiation factor eIF4E during in vitro maturation of pig oocytes.

    Science.gov (United States)

    Ellederová, Zdenka; Cais, Ondrej; Susor, Andrej; Uhlírová, Katka; Kovárová, Hana; Jelínková, Lucie; Tomek, Wolfgang; Kubelka, Michal

    2008-02-01

    Eukaryotic initiation factor 4E (eIF4E) plays an important role in mRNA translation by binding the 5'-cap structure of the mRNA and facilitating the recruitment to the mRNA of other translation factors and the 40S ribosomal subunit. eIF4E undergoes regulated phosphorylation on Ser-209 and this phosphorylation is believed to be important for its binding to mRNA and to other initiation factors. The findings showing that the translation initiation factor eIF4E becomes gradually phosphorylated during in vitro maturation (IVM) of pig oocytes with a maximum in metaphase II (M II) stage oocytes have been documented by us recently (Ellederova et al., 2006). The aim of this work was to study in details the metabolic pathways involved in this process. Using inhibitors of cyclin-dependent kinases, Butyrolactone I (BL I) and protein phosphatases, okadaic acid (OA) we show that ERK1/2 MAP kinase pathway is involved in this phosphorylation. We also demonstrate that activation and phosphorylation of ERK1/2 MAP kinase and eIF4E is associated with the activating phosphorylation of Mnk1 kinase, one of the two main kinases phosphorylating eIF4E in somatic cells.

  8. MAP-kinase activity in etiolated Cucumis sativus cotyledons: the effect of red and far-red light irradiation.

    Science.gov (United States)

    Alvarez-Flórez, Fagua; Vidal, Dolors; Simón, Esther

    2013-02-01

    Phytochrome (phy) signalling in plants may be transduced through protein phosphorylation. Mitogen-activated protein kinase (MAP-kinase, MAPK) activity and the effect of R (red) and FR (far-red) light irradiation on MAPK activity were studied in etiolated Cucumis sativus L. cotyledons. By in vitro protein phosphorylation and in-gel assays with myelin basic protein (MBP), a protein band (between 48 and 45 kDa) with MAPK-like activity was detected. The addition to the phosphorylation buffer of specific protein phosphatase (PTP) inhibitors (Na(3)VO(4) and NaF) and genistein, apigenin or PD98059 as MAPK inhibitors allowed us to confirm the MAPK activity of the protein band. Irradiation of etiolated cotyledons with FR light for 5, 10 or 60 min rapidly and transiently stimulated the MAPK activity of the protein band. This suggests that there was a very low fluence response (VLFR) of phys. In addition, 15 min of R light irradiation or a sequential treatment of 15 min of R plus 5 min of FR also increased MAPK activity. The stimulatory effect of R light was also attributed to the same photoreceptor, which suggests that MAPKs are involved in phytochrome signal transduction. Protein immunoprecipitation and immunoblotting analysis with the polyclonal antibody anti-pERK1/2 (Tyr 204) and the monoclonal antibody anti-phosphotyrosine PY20 allowed us to recognize the above mentioned protein band as two proteins with molecular masses (M(r)) of approximately 47 and 45 kDa, and MAPK activity. The biochemical and immunological properties showed by the proteins detected indicated that they were members of the MAPK family phosphorylated in tyrosine residues.

  9. Conserved regulation of MAP kinase expression by PUF RNA-binding proteins.

    Directory of Open Access Journals (Sweden)

    Myon-Hee Lee

    2007-12-01

    Full Text Available Mitogen-activated protein kinase (MAPK and PUF (for Pumilio and FBF [fem-3 binding factor] RNA-binding proteins control many cellular processes critical for animal development and tissue homeostasis. In the present work, we report that PUF proteins act directly on MAPK/ERK-encoding mRNAs to downregulate their expression in both the Caenorhabditis elegans germline and human embryonic stem cells. In C. elegans, FBF/PUF binds regulatory elements in the mpk-1 3' untranslated region (3' UTR and coprecipitates with mpk-1 mRNA; moreover, mpk-1 expression increases dramatically in FBF mutants. In human embryonic stem cells, PUM2/PUF binds 3'UTR elements in both Erk2 and p38alpha mRNAs, and PUM2 represses reporter constructs carrying either Erk2 or p38alpha 3' UTRs. Therefore, the PUF control of MAPK expression is conserved. Its biological function was explored in nematodes, where FBF promotes the self-renewal of germline stem cells, and MPK-1 promotes oocyte maturation and germ cell apoptosis. We found that FBF acts redundantly with LIP-1, the C. elegans homolog of MAPK phosphatase (MKP, to restrict MAPK activity and prevent apoptosis. In mammals, activated MAPK can promote apoptosis of cancer cells and restrict stem cell self-renewal, and MKP is upregulated in cancer cells. We propose that the dual negative regulation of MAPK by both PUF repression and MKP inhibition may be a conserved mechanism that influences both stem cell maintenance and tumor progression.

  10. MAP kinase pathway gene copy alterations in NRAS/BRAF wild-type advanced melanoma.

    Science.gov (United States)

    Orouji, Elias; Orouji, Azadeh; Gaiser, Timo; Larribère, Lionel; Gebhardt, Christoffer; Utikal, Jochen

    2016-05-01

    Recent therapeutic advances have improved melanoma patientś clinical outcome. Novel therapeutics targeting BRAF, NRAS and cKit mutant melanomas are widely used in clinical practice. However therapeutic options in NRAS(wild-type) /BRAF(wild-type) /cKit(wild-type) melanoma patients are limited. Our study shows that gene copy numbers of members of the MAPK signaling pathway vary in different melanoma subgroups. NRAS(wild-type) /BRAF(wild-type) melanoma metastases are characterized by significant gains of MAP2K1 (MEK1) and MAPK3 (ERK1) gene loci. These additional gene copies could lead to an activation of the MAPK signaling pathway via a gene-dosage effect. Our results suggest that downstream analyses of the pMEK and pERK expression status in NRAS(wild-type) /BRAF(wild-type) melanoma patients identify patients that could benefit from targeted therapies with MEK and ERK inhibitors.

  11. Intein-mediated peptide arrays for epitope mapping and kinase/phosphatase assays.

    Science.gov (United States)

    Xu, Ming-Qun; Ghosh, Inca; Kochinyan, Samvel; Sun, Luo

    2007-01-01

    Synthetic peptides are widely used for production and analysis of antibodies as well as in the study of protein modification enzymes. To circumvent the technical challenges of the existing techniques regarding peptide quantization and normalization, a new method of producing peptide arrays has been developed. This approach utilizes intein-mediated protein ligation that involves linkage of a carrier protein possessing a reactive carboxyl-terminal thioester to a peptide with an amino-terminal cysteine through a native peptide bond. Ligated protein substrates or enzyme-treated samples are arrayed on nitrocellulose membranes with a standard dot-blot apparatus and analyzed by immunoassay. This technique has improved sensitivity and reproducibility, and is suitable for various peptide-based applications. In this report, several experimental procedures including epitope mapping and the study of protein modifications were described.

  12. An inside job: hacking into Janus kinase/signal transducer and activator of transcription signaling cascades by the intracellular protozoan Toxoplasma gondii.

    Science.gov (United States)

    Denkers, Eric Y; Bzik, David J; Fox, Barbara A; Butcher, Barbara A

    2012-02-01

    The intracellular protozoan Toxoplasma gondii is well known for its skill at invading and living within host cells. New discoveries are now also revealing the astounding ability of the parasite to inject effector proteins into the cytoplasm to seize control of the host cell. This review summarizes recent advances in our understanding of one such secretory protein called ROP16. This molecule is released from rhoptries into the host cell during invasion. The ROP16 molecule acts as a kinase, directly activating both signal transducer and activator of transcription 3 (STAT3) and STAT6 signaling pathways. In macrophages, an important and preferential target cell of parasite infection, the injection of ROP16 has multiple consequences, including downregulation of proinflammatory cytokine signaling and macrophage deviation to an alternatively activated phenotype.

  13. An Inside Job: Hacking into Janus Kinase/Signal Transducer and Activator of Transcription Signaling Cascades by the Intracellular Protozoan Toxoplasma gondii

    Science.gov (United States)

    Bzik, David J.; Fox, Barbara A.; Butcher, Barbara A.

    2012-01-01

    The intracellular protozoan Toxoplasma gondii is well known for its skill at invading and living within host cells. New discoveries are now also revealing the astounding ability of the parasite to inject effector proteins into the cytoplasm to seize control of the host cell. This review summarizes recent advances in our understanding of one such secretory protein called ROP16. This molecule is released from rhoptries into the host cell during invasion. The ROP16 molecule acts as a kinase, directly activating both signal transducer and activator of transcription 3 (STAT3) and STAT6 signaling pathways. In macrophages, an important and preferential target cell of parasite infection, the injection of ROP16 has multiple consequences, including downregulation of proinflammatory cytokine signaling and macrophage deviation to an alternatively activated phenotype. PMID:22104110

  14. Learning Cascading

    CERN Document Server

    Covert, Michael

    2015-01-01

    This book is intended for software developers, system architects and analysts, big data project managers, and data scientists who wish to deploy big data solutions using the Cascading framework. You must have a basic understanding of the big data paradigm and should be familiar with Java development techniques.

  15. Mammalian mitogen-activated protein kinase pathways are regulated through formation of specific kinase-activator complexes.

    Science.gov (United States)

    Zanke, B W; Rubie, E A; Winnett, E; Chan, J; Randall, S; Parsons, M; Boudreau, K; McInnis, M; Yan, M; Templeton, D J; Woodgett, J R

    1996-11-22

    Mammalian cells contain at least three signaling systems which are structurally related to the mitogen-activated protein kinase (MAPK) pathway. Growth factors acting through Ras primarily stimulate the Raf/MEK/MAPK cascade of protein kinases. In contrast, many stress-related signals such as heat shock, inflammatory cytokines, and hyperosmolarity induce the MEKK/SEK(MKK4)/SAPK(JNK) and/or the MKK3 or MKK6/p38(hog) pathways. Physiological agonists of these pathway types are either qualitatively or quantitatively distinct, suggesting few common proximal signaling elements, although past studies performed in vitro, or in cells using transient over-expression, reveal interaction between the components of all three pathways. These studies suggest a high degree of cross-talk apparently not seen in vivo. We have examined the possible molecular basis of the differing agonist profiles of these three MAPK pathways. We report preferential association between MAP kinases and their activators in eukaryotic cells. Furthermore, using the yeast 2-hybrid system, we show that association between these components can occur independent of additional eukaryotic proteins. We show that SAPK(JNK) or p38(hog) activation is specifically impaired by co-expression of cognate dominant negative MAP kinase kinase mutants, demonstrating functional specificity at this level. Further divergence and insulation of the stress pathways occurs proximal to the MAPK kinases since activation of the MAPK kinase kinase MEKK results in SAPK(JNK) activation but does not cause p38(hog) phosphorylation. Therefore, in intact cells, the three MAPK pathways may be independently regulated and their components show specificity in their interaction with cognate cascade members. The degree of intermolecular specificity suggests that mammalian MAPK signaling pathways may remain distinct without the need for specific scaffolding proteins to sequester components of individual pathways.

  16. Expression of protein phosphatases (PP-1, PP-2A, PP-2B and PTP-1B) and protein kinases (MAP kinase and P34cdc2) in the hippocampus of patients with Alzheimer disease and normal aged individuals.

    Science.gov (United States)

    Pei, J J; Sersen, E; Iqbal, K; Grundke-Iqbal, I

    1994-08-29

    Microtubule-associated protein tau is abnormally hyperphosphorylated in the brain of patients with Alzheimer disease (AD). Previous studies have shown (i) that in vitro tau can be phosphorylated to an Alzheimer abnormally phosphorylated state-like protein by proline-directed protein kinases MAP kinase and p34cdc2, and (ii) that the AD abnormally phosphorylated tau can be in vitro dephosphorylated by protein phosphatases PP-2B, PP-2A and PP-1 and not by PP-2C. However, to have a direct effect on the regulation of phosphorylation of tau, these enzymes should be present in the affected neurons. In the present study immunocytochemical localization of protein phosphatases PP-1, PP-2A, PP-2B and PTP, and protein kinases MAP kinase and p34cdc2 were studied in the hippocampal formation of AD and as a control in non-demented elderly patients. All the protein phosphatases and protein kinases studied were localized to both granular and pyramidal neurons. In the pyramidal neurons, the enzymes staining was observed in neuronal soma and neurites. PTP-1B, PP-1 and PP-2A were also highly expressed in microglia. The topographical distributions of all the enzymes studied were similar, i.e. the intensity of immunostaining in hippocampus in end-plate (CA3 and CA4) > prosubiculum, subiculum > entorhinal cortex > dentate gyrus > CA2 > CA1. Furthermore, the expression of all the enzymes was also observed in the tangle-bearing neurons. The PP-2B staining of the tangle-bearing neurons was weaker than the unaffected neurons in the same tissue section field in AD cases.

  17. Genetic activation of ERK5 MAP kinase enhances adult neurogenesis and extends hippocampus-dependent long-term memory.

    Science.gov (United States)

    Wang, Wenbin; Pan, Yung-Wei; Zou, Junhui; Li, Tan; Abel, Glen M; Palmiter, Richard D; Storm, Daniel R; Xia, Zhengui

    2014-02-05

    Recent studies have shown that inhibition of adult neurogenesis impairs the formation of hippocampus-dependent memory. However, it is not known whether increasing adult neurogenesis affects the persistence of hippocampus-dependent long-term memory. Furthermore, signaling mechanisms that regulate adult neurogenesis are not fully defined. We recently reported that the conditional and targeted knock-out of ERK5 MAP kinase in adult neurogenic regions of the mouse brain attenuates adult neurogenesis in the hippocampus and disrupts several forms of hippocampus-dependent memory. Here, we developed a gain-of-function knock-in mouse model to specifically activate endogenous ERK5 in the neurogenic regions of the adult brain. We report that the selective and targeted activation of ERK5 increases adult neurogenesis in the dentate gyrus by enhancing cell survival, neuronal differentiation, and dendritic complexity. Conditional ERK5 activation also improves the performance of challenging forms of spatial learning and memory and extends hippocampus-dependent long-term memory. We conclude that enhancing signal transduction of a single signaling pathway within adult neural stem/progenitor cells is sufficient to increase adult neurogenesis and improve the persistence of hippocampus-dependent memory. Furthermore, activation of ERK5 may provide a novel therapeutic target to improve long-term memory.

  18. Conditional deletion of ERK5 MAP kinase in the nervous system impairs pheromone information processing and pheromone-evoked behaviors.

    Directory of Open Access Journals (Sweden)

    Junhui Zou

    Full Text Available ERK5 MAP kinase is highly expressed in the developing nervous system but absent in most regions of the adult brain. It has been implicated in regulating the development of the main olfactory bulb and in odor discrimination. However, whether it plays an essential role in pheromone-based behavior has not been established. Here we report that conditional deletion of the Mapk7 gene which encodes ERK5 in mice in neural stem cells impairs several pheromone-mediated behaviors including aggression and mating in male mice. These deficits were not caused by a reduction in the level of testosterone, by physical immobility, by heightened fear or anxiety, or by depression. Using mouse urine as a natural pheromone-containing solution, we provide evidence that the behavior impairment was associated with defects in the detection of closely related pheromones as well as with changes in their innate preference for pheromones related to sexual and reproductive activities. We conclude that expression of ERK5 during development is critical for pheromone response and associated animal behavior in adult mice.

  19. The ERK MAP kinase-PEA3/ETV4-MMP-1 axis is operative in oesophageal adenocarcinoma

    LENUS (Irish Health Repository)

    Keld, Richard

    2010-12-09

    Abstract Background Many members of the ETS-domain transcription factor family are important drivers of tumourigenesis. In this context, their activation by Ras-ERK pathway signaling is particularly relevant to the tumourigenic properties of many ETS-domain transcription factors. The PEA3 subfamily of ETS-domain transcription factors have been implicated in tumour metastasis in several different cancers. Results Here, we have studied the expression of the PEA3 subfamily members PEA3\\/ETV4 and ER81\\/ETV1 in oesophageal adenocarcinomas and determined their role in oesophageal adenocarcinoma cell function. PEA3 plays an important role in controlling both the proliferation and invasive properties of OE33 oesophageal adenocarcinoma cells. A key target gene is MMP-1. The ERK MAP kinase pathway activates PEA3 subfamily members and also plays a role in these PEA3 controlled events, establishing the ERK-PEA3-MMP-1 axis as important in OE33 cells. PEA3 subfamily members are upregulated in human adenocarcinomas and expression correlates with MMP-1 expression and late stage metastatic disease. Enhanced ERK signaling is also more prevalent in late stage oesophageal adenocarcinomas. Conclusions This study shows that the ERK-PEA3-MMP-1 axis is upregulated in oesophageal adenocarcinoma cells and is a potentially important driver of the metastatic progression of oesophageal adenocarcinomas.

  20. A New MAP Kinase Protein Involved in Estradiol-Stimulated Reproduction of the Helminth Parasite Taenia crassiceps

    Science.gov (United States)

    Escobedo, Galileo; Soldevila, Gloria; Ortega-Pierres, Guadalupe; Chávez-Ríos, Jesús Ramsés; Nava, Karen; Fonseca-Liñán, Rocío; López-Griego, Lorena; Hallal-Calleros, Claudia; Ostoa-Saloma, Pedro; Morales-Montor, Jorge

    2010-01-01

    MAP kinases (MAPK) are involved in the regulation of cellular processes such as reproduction and growth. In parasites, the role of MAPK has been scarcely studied. Here, we describe the participation of an ERK-like protein in estrogen-dependent reproduction of the helminth parasite Taenia crassiceps. Our results show that 17β-estradiol induces a concentration-dependent increase in the bud number of in vitro cultured cysticerci. If parasites are also incubated in presence of an ERK-inhibitor, the stimulatory effect of estrogen is blocked. The expression of ERK-like mRNA and its corresponding protein was detected in the parasite. The ERK-like protein was over-expressed by all treatments. Nevertheless, a strong induction of phosphorylation of this protein was observed only in response to 17β-estradiol. Cross-contamination by host cells was discarded by flow cytometry analysis. Parasite cells expressing the ERK-like protein were exclusively located at the subtegument tissue by confocal microscopy. Finally, the ERK-like protein was separated by bidimensional electrophoresis and then sequenced, showing the conserved TEY activation motif, typical of all known ERK 1/2 proteins. Our results show that an ERK-like protein is involved in the molecular signalling during the interaction between the host and T. crassiceps, and may be considered as target for anti-helminth drugs design. PMID:20145710

  1. The ERK MAP kinase-PEA3/ETV4-MMP-1 axis is operative in oesophageal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Gulmann Christian

    2010-12-01

    Full Text Available Abstract Background Many members of the ETS-domain transcription factor family are important drivers of tumourigenesis. In this context, their activation by Ras-ERK pathway signaling is particularly relevant to the tumourigenic properties of many ETS-domain transcription factors. The PEA3 subfamily of ETS-domain transcription factors have been implicated in tumour metastasis in several different cancers. Results Here, we have studied the expression of the PEA3 subfamily members PEA3/ETV4 and ER81/ETV1 in oesophageal adenocarcinomas and determined their role in oesophageal adenocarcinoma cell function. PEA3 plays an important role in controlling both the proliferation and invasive properties of OE33 oesophageal adenocarcinoma cells. A key target gene is MMP-1. The ERK MAP kinase pathway activates PEA3 subfamily members and also plays a role in these PEA3 controlled events, establishing the ERK-PEA3-MMP-1 axis as important in OE33 cells. PEA3 subfamily members are upregulated in human adenocarcinomas and expression correlates with MMP-1 expression and late stage metastatic disease. Enhanced ERK signaling is also more prevalent in late stage oesophageal adenocarcinomas. Conclusions This study shows that the ERK-PEA3-MMP-1 axis is upregulated in oesophageal adenocarcinoma cells and is a potentially important driver of the metastatic progression of oesophageal adenocarcinomas.

  2. Activation of stress-activated MAP protein kinases up-regulates expression of transgenes driven by the cytomegalovirus immediate/early promoter.

    OpenAIRE

    Bruening, W; Giasson, B; Mushynski, W; Durham, H D

    1998-01-01

    The immediate/early promoter/enhancer of cytomegalovirus (CMV promoter) is one of the most commonly used promoters for expression of transgenes in eukaryotic cells. In practice, the CMV promoter is often thought of as a constitutively active unregulated promoter. However, we have observed that transcription from the CMV promoter can be up-regulated by a variety of environmental stresses. Many forms of cellular stress stimulate MAP kinase signalling pathways, resulting in activation of stress-...

  3. The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism.

    Science.gov (United States)

    Bermingham, Daniel P; Hardaway, J Andrew; Refai, Osama; Marks, Christian R; Snider, Sam L; Sturgeon, Sarah M; Spencer, William C; Colbran, Roger J; Miller, David M; Blakely, Randy D

    2017-09-20

    The neurotransmitter dopamine (DA) regulates multiple behaviors across phylogeny, with disrupted DA signaling in humans associated with addiction, attention-deficit/ hyperactivity disorder, schizophrenia, and Parkinson's disease. The DA transporter (DAT) imposes spatial and temporal limits on DA action, and provides for presynaptic DA recycling to replenish neurotransmitter pools. Molecular mechanisms that regulate DAT expression, trafficking, and function, particularly in vivo, remain poorly understood, though recent studies have implicated rho-linked pathways in psychostimulant action. To identify genes that dictate the ability of DAT to sustain normal levels of DA clearance, we pursued a forward genetic screen in Caenorhabditis elegans based on the phenotype swimming-induced paralysis (Swip), a paralytic behavior observed in hermaphrodite worms with loss-of-function dat-1 mutations. Here, we report the identity of swip-13, which encodes a highly conserved ortholog of the human atypical MAP kinase ERK8. We present evidence that SWIP-13 acts presynaptically to insure adequate levels of surface DAT expression and DA clearance. Moreover, we provide in vitro and in vivo evidence supporting a conserved pathway involving SWIP-13/ERK8 activation of Rho GTPases that dictates DAT surface expression and function.SIGNIFICANCE STATEMENT Signaling by the neurotransmitter dopamine (DA) is tightly regulated by the DA transporter (DAT), insuring efficient DA clearance after release. Molecular networks that regulate DAT are poorly understood, particularly in vivo Using a forward genetic screen in the nematode Caenorhabditis elegans, we implicate the atypical mitogen activated protein kinase, SWIP-13, in DAT regulation. Moreover, we provide in vitro and in vivo evidence that SWIP-13, as well as its human counterpart ERK8, regulate DAT surface availability via the activation of Rho proteins. Our findings implicate a novel pathway that regulates DA synaptic availability and that may

  4. Localization of the human stress responsive MAP kinase-like CSAIDs binding protein (CSBP) gene to chromosome 6p21.3/21.2

    Energy Technology Data Exchange (ETDEWEB)

    McDonnell, P.C.; Young, P.R.; DiLella, A.G. [SmithKline Beecham Pharmaceuticals, King of Prussia, PA (United States)] [and others

    1995-09-01

    The proinflammatory cytokines interleukin 1 (IL-1) and tumor necrosis factor (TNF) play a pivotal role in the initiation of inflammatory responses. Soluble protein antagonists of IL-1 and TNF, such as IL-1ra, sTNFR-Fc fusion, and monoclonal antibodies to TNF have proven to be effective at blocking acute and chronic responses in a number of animal models of inflammatory diseases such as rheumatoid arthritis, septic shock, and inflammatory bowel disease. Consequently, there has been considerable interest in discovering compounds that could inhibit the production of these cytokines and might therefore become treatments. Recently, a structurally related series of pyridinyl imidazoles was found to block IL-1 and TNF production from LPS-stimulated human monocytes and to ameliorate inflammatory diseases significantly in vivo, leading to their being named CSAIDs (cytokine suppressive anti-inflammatory drugs). The protein target of these compounds, termed CSBP (CSAID binding protein), was discovered to be a new member of the MAP kinase family of serine-threonine protein kinases whose kinase activity is activated by LPS in human monocytes. Independently, the same kinase, or its rodent homologues, was found to respond also to chemical, thermal, and osmotic stress and IL-1 treatment. Inhibition of this kinase correlated with reduction in inflammatory cytokine production from LPS-activated monocytes. 15 refs., 1 fig.

  5. PRO40 is a scaffold protein of the cell wall integrity pathway, linking the MAP kinase module to the upstream activator protein kinase C.

    Directory of Open Access Journals (Sweden)

    Ines Teichert

    2014-09-01

    Full Text Available Mitogen-activated protein kinase (MAPK pathways are crucial signaling instruments in eukaryotes. Most ascomycetes possess three MAPK modules that are involved in key developmental processes like sexual propagation or pathogenesis. However, the regulation of these modules by adapters or scaffolds is largely unknown. Here, we studied the function of the cell wall integrity (CWI MAPK module in the model fungus Sordaria macrospora. Using a forward genetic approach, we found that sterile mutant pro30 has a mutated mik1 gene that encodes the MAPK kinase kinase (MAPKKK of the proposed CWI pathway. We generated single deletion mutants lacking MAPKKK MIK1, MAPK kinase (MAPKK MEK1, or MAPK MAK1 and found them all to be sterile, cell fusion-deficient and highly impaired in vegetative growth and cell wall stress response. By searching for MEK1 interaction partners via tandem affinity purification and mass spectrometry, we identified previously characterized developmental protein PRO40 as a MEK1 interaction partner. Although fungal PRO40 homologs have been implicated in diverse developmental processes, their molecular function is currently unknown. Extensive affinity purification, mass spectrometry, and yeast two-hybrid experiments showed that PRO40 is able to bind MIK1, MEK1, and the upstream activator protein kinase C (PKC1. We further found that the PRO40 N-terminal disordered region and the central region encompassing a WW interaction domain are sufficient to govern interaction with MEK1. Most importantly, time- and stress-dependent phosphorylation studies showed that PRO40 is required for MAK1 activity. The sum of our results implies that PRO40 is a scaffold protein for the CWI pathway, linking the MAPK module to the upstream activator PKC1. Our data provide important insights into the mechanistic role of a protein that has been implicated in sexual and asexual development, cell fusion, symbiosis, and pathogenicity in different fungal systems.

  6. A superoxide anion-scavenger, 1,3-selenazolidin-4-one suppresses serum deprivation-induced apoptosis in PC12 cells by activating MAP kinase

    Energy Technology Data Exchange (ETDEWEB)

    Nishina, Atsuyoshi, E-mail: nishina@yone.ac.jp [Yonezawa Women' s Junior College, 6-15-1 Tohrimachi, Yonezawa, Yamagata 992-0025 (Japan); Kimura, Hirokazu; Kozawa, Kunihisa [Gunma Prefectural Institute of Public Health and Environmental Sciences, 378 Kamioki, Maebashi, Gunma 371-0052 (Japan); Sommen, Geoffroy [Lonza Braine SA, Chaussee de Tubize 297, B-1420 Braine l' Alleud (Belgium); Nakamura, Takao [Department of Biomedical Information Engineering, Graduate School of Medical Science, Yamagata University, Yamagata 990-9585 (Japan); Heimgartner, Heinz [University of Zuerich, Institut of Organic Chemistry, Winterthurerstrasse 190, CH-8057 Zuerich (Switzerland); Koketsu, Mamoru [Department of Materials Science and Technology, Faculty of Engineering, Gifu University, Gifu 501-1193 (Japan); Furukawa, Shoei [Laboratory of Molecular Biology, Gifu Pharmaceutical University, 5-6-1 Mitahora-higashi, Gifu 502-8585 (Japan)

    2011-12-15

    Synthetic organic selenium compounds, such as ebselen, may show glutathione peroxidase-like antioxidant activity and have a neurotrophic effect. We synthesized 1,3-selenazolidin-4-ones, new types of synthetic organic selenium compounds (five-member ring compounds), to study their possible applications as antioxidants or neurotrophic-like molecules. Their superoxide radical scavenging effects were assessed using the quantitative, highly sensitive method of real-time kinetic chemiluminescence. At 166 {mu}M, the O{sub 2}{sup -} scavenging activity of 1,3-selenazolidin-4-ones ranged from 0 to 66.2%. 2-[3-(4-Methoxyphenyl)-4-oxo-1,3-selenazolidin-2-ylidene]malononitrile (compound b) showed the strongest superoxide anion-scavenging activity among the 6 kinds of 2-methylene-1,3-selenazolidin-4-ones examined. Compound b had a 50% inhibitory concentration (IC{sub 50}) at 92.4 {mu}M and acted as an effective and potentially useful O{sub 2}{sup -} scavenger in vitro. The effect of compound b on rat pheochromocytome cell line PC12 cells was compared with that of ebselen or nerve growth factor (NGF) by use of the MTT [3-(4, 5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay. When ebselen was added at 100 {mu}M or more, toxicity toward PC12 cells was evident. On the contrary, compound b suppressed serum deprivation-induced apoptosis in PC12 cells more effectively at a concentration of 100 {mu}M. The activity of compound b to phosphorylate mitogen-activated protein kinase/extracellular signal-regulated protein kinase (ERK) 1/2 (MAP kinase) in PC12 cells was higher than that of ebselen, and the former at 100 {mu}M induced the phosphorylation of MAP kinase to a degree similar to that induced by NGF. From these results, we conclude that this superoxide anion-scavenger, compound b, suppressed serum deprivation-induced apoptosis by promoting the phosphorylation of MAP kinase. -- Highlights: Black-Right-Pointing-Pointer We newly synthesized 1,3-selenazolidin-4-ones to

  7. Inhibition of MAP kinase promotes the recruitment of corepressor SMRT by tamoxifen-bound estrogen receptor alpha and potentiates tamoxifen action in MCF-7 cells

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Wei, E-mail: hongwei@tijmu.edu.cn [Department of Immunology, Tianjin Medical University, 300070 Tianjin (China); Department of Laboratory Medicine, Tianjin Medical University, 300070 Tianjin (China); Chen, Linfeng [Department of Medical Oncology, Harvard Medical School, Dana Farber Cancer Institute, Boston, 02115 MA (United States); Li, Juan [Department of Laboratory Medicine, Tianjin Medical University, 300070 Tianjin (China); Yao, Zhi [Department of Immunology, Tianjin Medical University, 300070 Tianjin (China)

    2010-05-28

    Estrogen receptor alpha (ER{alpha}), a ligand controlled transcription factor, plays an important role in breast cancer growth and endocrine therapy. Tamoxifen (TAM) antagonizes ER{alpha} activity and has been applied in breast cancer treatment. TAM-bound ER{alpha} associates with nuclear receptor-corepressors. Mitogen-activated protein kinase (MAPK) has been elucidated to result in cross-talk between growth factor and ER{alpha} mediated signaling. We show that activated MAPK represses interaction of TAM-bound ER{alpha} with silencing mediator for retinoid and thyroid hormone receptors (SMRT) and inhibits the recruitment of SMRT by ER{alpha} to certain estrogen target genes. Blockade of MAPK signaling cascade with MEK inhibitor U0126 promotes the interaction and subsequently inhibits ER{alpha} activity via enhanced recruitment of SMRT, leading to reduced expression of ER{alpha} target genes. The growth rate of MCF-7 cells was decelerated when treated with both TAM and U0126. Moreover, the growth of MCF-7 cells stably expressing SMRT showed a robust repression in the presence of TAM and U0126. These results suggest that activated MAPK signaling cascade attenuates antagonist-induced recruitment of SMRT to ER{alpha}, suggesting corepressor mediates inhibition of ER{alpha} transactivation and breast cancer cell growth by antagonist. Taken together, our finding indicates combination of antagonist and MAPK inhibitor could be a helpful approach for breast cancer therapy.

  8. Rapid CB1 cannabinoid receptor desensitization defines the time course of ERK1/2 MAP kinase signaling.

    Science.gov (United States)

    Daigle, Tanya L; Kearn, Christopher S; Mackie, Ken

    2008-01-01

    Molecular mechanisms regulating the development of physiological and behavioral tolerance to cannabinoids are not well understood. Two cellular correlates implicated in the development and maintenance of tolerance are CB(1) cannabinoid receptor internalization and uncoupling of receptor signal transduction. Both processes have been proposed as mediators of tolerance because of observations that chronic Delta(9)-tetrahydrocannabinol (THC) treatment causes both region-specific decreases in CB(1) receptors and G-protein coupling in the brain. To determine the balance of these two processes in regulating CB(1) receptor signaling during sustained receptor stimulation, we evaluated the parameters affecting ERK1/2 MAP kinase activity in HEK293 cells stably expressing CB(1) receptors. CB(1) receptor stimulation by the potent CB(1) receptor agonist, CP 55,940 transiently activated ERK1/2. To determine if CB(1) receptor desensitization or internalization was responsible for the transient nature of ERK1/2 activation, we evaluated ERK1/2 phosphorylation in HEK293 cells expressing a desensitization-deficient CB(1) receptor (S426A/S430A CB(1)). Here, the duration of S426A/S430A CB(1) receptor-mediated activation of ERK1/2 was markedly prolonged relative to wild-type receptors, and was dynamically reversed by SR141716A. Interestingly, the S426A/S430A CB(1) receptor was still able to recruit betaarrestin-2, a key mediator of receptor desensitization, to the cell surface following agonist activation. In contrast to a central role for desensitization, pharmacological and genetic approaches suggested CB(1) receptor internalization is dispensable in the transient activation of ERK1/2. This study indicates that the duration of ERK1/2 activation by CB(1) receptors is regulated by receptor desensitization and underscores the importance of G-protein uncoupling in the regulation of CB(1) receptor signaling.

  9. DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Aniek van der Vaart

    2015-12-01

    Full Text Available Cilia are sensory organelles present on almost all vertebrate cells. Cilium length is constant, but varies between cell types, indicating that cilium length is regulated. How this is achieved is unclear, but protein transport in cilia (intraflagellar transport, IFT plays an important role. Several studies indicate that cilium length and function can be modulated by environmental cues. As a model, we study a C. elegans mutant that carries a dominant active G protein α subunit (gpa-3QL, resulting in altered IFT and short cilia. In a screen for suppressors of the gpa-3QL short cilium phenotype, we identified uev-3, which encodes an E2 ubiquitin-conjugating enzyme variant that acts in a MAP kinase pathway. Mutation of two other components of this pathway, dual leucine zipper-bearing MAPKKK DLK-1 and p38 MAPK PMK-3, also suppress the gpa-3QL short cilium phenotype. However, this suppression seems not to be caused by changes in IFT. The DLK-1/p38 pathway regulates several processes, including microtubule stability and endocytosis. We found that reducing endocytosis by mutating rabx-5 or rme-6, RAB-5 GEFs, or the clathrin heavy chain, suppresses gpa-3QL. In addition, gpa-3QL animals showed reduced levels of two GFP-tagged proteins involved in endocytosis, RAB-5 and DPY-23, whereas pmk-3 mutant animals showed accumulation of GFP-tagged RAB-5. Together our results reveal a new role for the DLK-1/p38 MAPK pathway in control of cilium length by regulating RAB-5 mediated endocytosis.

  10. DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.

    Science.gov (United States)

    van der Vaart, Aniek; Rademakers, Suzanne; Jansen, Gert

    2015-12-01

    Cilia are sensory organelles present on almost all vertebrate cells. Cilium length is constant, but varies between cell types, indicating that cilium length is regulated. How this is achieved is unclear, but protein transport in cilia (intraflagellar transport, IFT) plays an important role. Several studies indicate that cilium length and function can be modulated by environmental cues. As a model, we study a C. elegans mutant that carries a dominant active G protein α subunit (gpa-3QL), resulting in altered IFT and short cilia. In a screen for suppressors of the gpa-3QL short cilium phenotype, we identified uev-3, which encodes an E2 ubiquitin-conjugating enzyme variant that acts in a MAP kinase pathway. Mutation of two other components of this pathway, dual leucine zipper-bearing MAPKKK DLK-1 and p38 MAPK PMK-3, also suppress the gpa-3QL short cilium phenotype. However, this suppression seems not to be caused by changes in IFT. The DLK-1/p38 pathway regulates several processes, including microtubule stability and endocytosis. We found that reducing endocytosis by mutating rabx-5 or rme-6, RAB-5 GEFs, or the clathrin heavy chain, suppresses gpa-3QL. In addition, gpa-3QL animals showed reduced levels of two GFP-tagged proteins involved in endocytosis, RAB-5 and DPY-23, whereas pmk-3 mutant animals showed accumulation of GFP-tagged RAB-5. Together our results reveal a new role for the DLK-1/p38 MAPK pathway in control of cilium length by regulating RAB-5 mediated endocytosis.

  11. Microglial Signaling in Chronic Pain with a Special Focus on Caspase 6, p38 MAP Kinase, and Sex Dependence.

    Science.gov (United States)

    Berta, T; Qadri, Y J; Chen, G; Ji, R R

    2016-09-01

    Microglia are the resident immune cells in the spinal cord and brain. Mounting evidence suggests that activation of microglia plays an important role in the pathogenesis of chronic pain, including chronic orofacial pain. In particular, microglia contribute to the transition from acute pain to chronic pain, as inhibition of microglial signaling reduces pathologic pain after inflammation, nerve injury, and cancer but not baseline pain. As compared with inflammation, nerve injury induces much more robust morphologic activation of microglia, termed microgliosis, as shown by increased expression of microglial markers, such as CD11b and IBA1. However, microglial signaling inhibitors effectively reduce inflammatory pain and neuropathic pain, arguing against the importance of morphologic activation of microglia in chronic pain sensitization. Importantly, microglia enhance pain states via secretion of proinflammatory and pronociceptive mediators, such as tumor necrosis factor α, interleukins 1β and 18, and brain-derived growth factor. Mechanistically, these mediators have been shown to enhance excitatory synaptic transmission and suppress inhibitory synaptic transmission in the pain circuits. While early studies suggested a predominant role of microglia in the induction of chronic pain, further studies have supported a role of microglia in the maintenance of chronic pain. Intriguingly, recent studies show male-dominant microglial signaling in some neuropathic pain and inflammatory pain states, although both sexes show identical morphologic activation of microglia after nerve injury. In this critical review, we provide evidence to show that caspase 6-a secreted protease that is expressed in primary afferent axonal terminals surrounding microglia-is a robust activator of microglia and induces profound release of tumor necrosis factor α from microglia via activation of p38 MAP kinase. The authors also show that microglial caspase 6/p38 signaling is male dominant in some

  12. The Aspergillus fumigatus SchASCH9 kinase modulates SakAHOG1 MAP kinase activity and it is essential for virulence

    Science.gov (United States)

    Alves de Castro, Patrícia; dos Reis, Thaila Fernanda; Dolan, Stephen K.; Manfiolli, Adriana Oliveira; Brown, Neil Andrew; Jones, Gary W.; Doyle, Sean; Riaño-Pachón, Diego M.; Squina, Fábio Márcio; Caldana, Camila; Singh, Ashutosh; Del Poeta, Maurizio; Hagiwara, Daisuke; Silva-Rocha, Rafael; Goldman, Gustavo H.

    2016-01-01

    Summary The serine-threonine kinase TOR, the Target of Rapamycin, is an important regulator of nutrient, energy and stress signaling in eukaryotes. Sch9, a Ser/Thr kinase of AGC family (the cAMP-dependent PKA, cGMP- dependent protein kinase G and phospholipid-dependent protein kinase C family), is a substrate of TOR. Here, we characterized the fungal opportunistic pathogen Aspergillus fumigatus Sch9 homologue (SchA). The schA null mutant was sensitive to rapamycin, high concentrations of calcium, hyperosmotic stress and SchA was involved in iron metabolism. The ΔschA null mutant showed increased phosphorylation of SakA, the A. fumigatus Hog1 homologue. The schA null mutant has increased and decreased trehalose and glycerol accumulation, respectively, suggesting SchA performs different roles for glycerol and trehalose accumulation during osmotic stress. The schA was transcriptionally regulated by osmotic stress and this response was dependent on SakA and MpkC. The double ΔschA ΔsakA and ΔschA ΔmpkC mutants were more sensitive to osmotic stress than the corresponding parental strains. Transcriptomics and proteomics identified direct and indirect targets of SchA post-exposure to hyperosmotic stress. Finally, ΔschA was avirulent in a low dose murine infection model. Our results suggest there is a complex network of interactions amongst the A. fumigatus TOR, SakA and SchA pathways. PMID:27538790

  13. Tomato 14-3-3 protein TFT7 interacts with a MAP kinase kinase to regulate immunity-associated programmed cell death mediated by diverse disease resistance proteins.

    Science.gov (United States)

    Oh, Chang-Sik; Martin, Gregory B

    2011-04-22

    Programmed cell death (PCD) associated with immunity is triggered when a plant disease resistance (R) protein recognizes a corresponding pathogen virulence protein. In tomato, detection by the host Pto kinase of the Pseudomonas syringae proteins AvrPto or AvrPtoB causes localized PCD. Previously, we reported that both MAPKKKα (mitogen-activated protein kinase kinase kinase) and the tomato 14-3-3 protein 7 (TFT7) positively regulate Pto-mediated PCD in tomato and Nicotiana benthamiana. In addition, in contrast to MAPKKKα, TFT7 is required for PCD mediated by four other R proteins. Here we investigate why TFT7 is required for PCD induced by diverse R proteins in plants. We discovered that a MAPKK, SlMKK2, which acts downstream of SlMAPKKKα, also interacts with TFT7 in plant cells. Gene silencing experiments revealed that the orthologous genes of both SlMKK2 and TFT7 in N. benthamiana are required for PCD mediated by the same set of R proteins. SlMKK2 and its orthologs contain a 14-3-3 binding site in their N terminus, and Thr(33) in this site is required for interaction with TFT7 in vivo. Like the structurally similar human 14-3-3ε protein, TFT7 forms a homodimer in vivo. Because TFT7 interacts with both SlMAPKKKα and SlMKK2 and also forms a homodimer, we propose that TFT7 may coordinately recruit these client proteins for efficient signal transfer, leading to PCD induction.

  14. Methylglyoxal activates the target of rapamycin complex 2-protein kinase C signaling pathway in Saccharomyces cerevisiae.

    Science.gov (United States)

    Nomura, Wataru; Inoue, Yoshiharu

    2015-04-01

    Methylglyoxal is a typical 2-oxoaldehyde derived from glycolysis. We show here that methylglyoxal activates the Pkc1-Mpk1 mitogen-activated protein (MAP) kinase cascade in a target of rapamycin complex 2 (TORC2)-dependent manner in the budding yeast Saccharomyces cerevisiae. We demonstrate that TORC2 phosphorylates Pkc1 at Thr(1125) and Ser(1143). Methylglyoxal enhanced the phosphorylation of Pkc1 at Ser(1143), which transmitted the signal to the downstream Mpk1 MAP kinase cascade. We found that the phosphorylation status of Pkc1(T1125) affected the phosphorylation of Pkc1 at Ser(1143), in addition to its protein levels. Methylglyoxal activated mammalian TORC2 signaling, which, in turn, phosphorylated Akt at Ser(473). Our results suggest that methylglyoxal is a conserved initiator of TORC2 signaling among eukaryotes.

  15. Signaling through P2X7 receptor in human T cells involves p56lck, MAP kinases, and transcription factors AP-1 and NF-kappa B.

    Science.gov (United States)

    Budagian, Vadim; Bulanova, Elena; Brovko, Luba; Orinska, Zane; Fayad, Raja; Paus, Ralf; Bulfone-Paus, Silvia

    2003-01-17

    ATP-gated ion channel P2X receptors are expressed on the surface of most immune cells and can trigger multiple cellular responses, such as membrane permeabilization, cytokine production, and cell proliferation or apoptosis. Despite broad distribution and pleiotropic activities, signaling pathways downstream of these ionotropic receptors are still poorly understood. Here, we describe intracellular signaling events in Jurkat cells treated with millimolar concentrations of extracellular ATP. Within minutes, ATP treatment resulted in the phosphorylation and activation of p56(lck) kinase, extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase but not p38 kinase. These effects were wholly dependent upon the presence of extracellular Ca(2+) ions in the culture medium. Nevertheless, calmodulin antagonist calmidazolium and CaM kinase inhibitor KN-93 both had no effect on the activation of p56(lck) and ERK, whereas a pretreatment of Jurkat cells with MAP kinase kinase inhibitor P098059 was able to abrogate phosphorylation of ERK. Further, expression of c-Jun and c-Fos proteins and activator protein (AP-1) DNA binding activity were enhanced in a time-dependent manner. In contrast, DNA binding activity of NF-kappa B was reduced. ATP failed to stimulate the phosphorylation of ERK and c-Jun N-terminal kinase and activation of AP-1 in the p56(lck)-deficient isogenic T cell line JCaM1, suggesting a critical role for p56(lck) kinase in downstream signaling. Regarding the biological significance of the ATP-induced signaling events we show that although extracellular ATP was able to stimulate proliferation of both Jurkat and JCaM1 cells, an increase in interleukin-2 transcription was observed only in Jurkat cells. The nucleotide selectivity and pharmacological profile data supported the evidence that the ATP-induced effects in Jurkat cells were mediated through the P2X7 receptor. Taken together, these results demonstrate the ability of extracellular ATP to activate

  16. Cascading Cosmology

    CERN Document Server

    Agarwal, Nishant; Khoury, Justin; Trodden, Mark

    2009-01-01

    We develop a fully covariant, well-posed 5D effective action for the 6D cascading gravity brane-world model, and use this to study cosmological solutions. We obtain this effective action through the 6D decoupling limit, in which an additional scalar degree mode, \\pi, called the brane-bending mode, determines the bulk-brane gravitational interaction. The 5D action obtained this way inherits from the sixth dimension an extra \\pi self-interaction kinetic term. We compute appropriate boundary terms, to supplement the 5D action, and hence derive fully covariant junction conditions and the 5D Einstein field equations. Using these, we derive the cosmological evolution induced on a 3-brane moving in a static bulk. We study the strong- and weak-coupling regimes analytically in this static ansatz, and perform a complete numerical analysis of our solution. Although the cascading model can generate an accelerating solution in which the \\pi field comes to dominate at late times, the presence of a critical singularity prev...

  17. Inducible and targeted deletion of the ERK5 MAP kinase in adult neurogenic regions impairs adult neurogenesis in the olfactory bulb and several forms of olfactory behavior.

    Directory of Open Access Journals (Sweden)

    Yung-Wei Pan

    Full Text Available Although adult-born neurons in the subventricular zone (SVZ and olfactory bulb (OB have been extensively characterized at the cellular level, their functional impact on olfactory behavior is still highly controversial with many conflicting results reported in the literature. Furthermore, signaling mechanisms regulating adult SVZ/OB neurogenesis are not well defined. Here we report that inducible and targeted deletion of erk5, a MAP kinase selectively expressed in the adult neurogenic regions of the adult brain, impairs adult neurogenesis in the SVZ and OB of transgenic mice. Although erk5 deletion had no effect on olfactory discrimination among discrete odorants in the habituation/dishabituation assay, it reduced short-term olfactory memory as well as detection sensitivity to odorants and pheromones including those evoking aggression and fear. Furthermore, these mice show impaired acquisition of odor-cued associative olfactory learning, a novel phenotype that had not been previously linked to adult neurogenesis. These data suggest that ERK5 MAP kinase is a critical kinase signaling pathway regulating adult neurogenesis in the SVZ/OB, and provide strong evidence supporting a functional role for adult neurogenesis in several distinct forms of olfactory behavior.

  18. p42/p44 MAP kinase activation is localized to caveolae-free membrane domains in airway smooth muscle

    NARCIS (Netherlands)

    Gosens, Reinoud; Dueck, Gordon; Gerthoffer, William T; Unruh, Helmut; Zaagsma, Johan; Meurs, Herman; Halayko, Andrew J

    2007-01-01

    Caveolae are abundant plasma membrane invaginations in airway smooth muscle that may function as preorganized signalosomes by sequestering and regulating proteins that control cell proliferation, including receptor tyrosine kinases (RTKs) and their signaling effectors. We previously demonstrated, ho

  19. Opposite effects of the p52shc/p46shc and p66shc splicing isoforms on the EGF receptor-MAP kinase-fos signalling pathway

    DEFF Research Database (Denmark)

    Migliaccio, E; Mele, S; Salcini, A E;

    1997-01-01

    66shc expression varies from cell type to cell type. p66shc differs from p52shc/p46shc in its inability to transform mouse fibroblasts in vitro. Like p52shc/p46shc, p66shc is tyrosine-phosphorylated upon epidermal growth factor (EGF) stimulation, binds to activated EGF receptors (EGFRs) and forms...... on the EGFR-MAP kinase and other signalling pathways that control fos promoter activity. Regulation of p66shc expression might, therefore, influence the cellular response to growth factors.......Shc proteins are targets of activated tyrosine kinases and are implicated in the transmission of activation signals to Ras. The p46shc and p52shc isoforms share a C-terminal SH2 domain, a proline- and glycine-rich region (collagen homologous region 1; CH1) and a N-terminal PTB domain. We have...

  20. Transgenic analysis of the Leishmania MAP kinase MPK10 reveals an auto-inhibitory mechanism crucial for stage-regulated activity and parasite viability.

    Directory of Open Access Journals (Sweden)

    Mathieu Cayla

    2014-09-01

    Full Text Available Protozoan pathogens of the genus Leishmania have evolved unique signaling mechanisms that can sense changes in the host environment and trigger adaptive stage differentiation essential for host cell infection. The signaling mechanisms underlying parasite development remain largely elusive even though Leishmania mitogen-activated protein kinases (MAPKs have been linked previously to environmentally induced differentiation and virulence. Here, we unravel highly unusual regulatory mechanisms for Leishmania MAP kinase 10 (MPK10. Using a transgenic approach, we demonstrate that MPK10 is stage-specifically regulated, as its kinase activity increases during the promastigote to amastigote conversion. However, unlike canonical MAPKs that are activated by dual phosphorylation of the regulatory TxY motif in the activation loop, MPK10 activation is independent from the phosphorylation of the tyrosine residue, which is largely constitutive. Removal of the last 46 amino acids resulted in significantly enhanced MPK10 activity both for the recombinant and transgenic protein, revealing that MPK10 is regulated by an auto-inhibitory mechanism. Over-expression of this hyperactive mutant in transgenic parasites led to a dominant negative effect causing massive cell death during amastigote differentiation, demonstrating the essential nature of MPK10 auto-inhibition for parasite viability. Moreover, phosphoproteomics analyses identified a novel regulatory phospho-serine residue in the C-terminal auto-inhibitory domain at position 395 that could be implicated in kinase regulation. Finally, we uncovered a feedback loop that limits MPK10 activity through dephosphorylation of the tyrosine residue of the TxY motif. Together our data reveal novel aspects of protein kinase regulation in Leishmania, and propose MPK10 as a potential signal sensor of the mammalian host environment, whose intrinsic pre-activated conformation is regulated by auto-inhibition.

  1. The transcription factor Ste12 mediates the regulatory role of the Tmk1 MAP kinase in mycoparasitism and vegetative hyphal fusion in the filamentous fungus Trichoderma atroviride.

    Science.gov (United States)

    Gruber, Sabine; Zeilinger, Susanne

    2014-01-01

    Mycoparasitic species of the fungal genus Trichoderma are potent antagonists able to combat plant pathogenic fungi by direct parasitism. An essential step in this mycoparasitic fungus-fungus interaction is the detection of the fungal host followed by activation of molecular weapons in the mycoparasite by host-derived signals. The Trichoderma atroviride MAP kinase Tmk1, a homolog of yeast Fus3/Kss1, plays an essential role in regulating the mycoparasitic host attack, aerial hyphae formation and conidiation. However, the transcription factors acting downstream of Tmk1 are hitherto unknown. Here we analyzed the functions of the T. atroviride Ste12 transcription factor whose orthologue in yeast is targeted by the Fus3 and Kss1 MAP kinases. Deletion of the ste12 gene in T. atroviride not only resulted in reduced mycoparasitic overgrowth and lysis of host fungi but also led to loss of hyphal avoidance in the colony periphery and a severe reduction in conidial anastomosis tube formation and vegetative hyphal fusion events. The transcription of several orthologues of Neurospora crassa hyphal fusion genes was reduced upon ste12 deletion; however, the Δste12 mutant showed enhanced expression of mycoparasitism-relevant chitinolytic and proteolytic enzymes and of the cell wall integrity MAP kinase Tmk2. Based on the comparative analyses of Δste12 and Δtmk1 mutants, an essential role of the Ste12 transcriptional regulator in mediating outcomes of the Tmk1 MAPK pathway such as regulation of the mycoparasitic activity, hyphal fusion and carbon source-dependent vegetative growth is suggested. Aerial hyphae formation and conidiation, in contrast, were found to be independent of Ste12.

  2. Histamine activates p38 MAP kinase and alters local lamellipodia dynamics, reducing endothelial barrier integrity and eliciting central movement of actin fibers.

    Science.gov (United States)

    Adderley, Shaquria P; Lawrence, Curtis; Madonia, Eyong; Olubadewo, Joseph O; Breslin, Jerome W

    2015-07-01

    The role of the actin cytoskeleton in endothelial barrier function has been debated for nearly four decades. Our previous investigation revealed spontaneous local lamellipodia in confluent endothelial monolayers that appear to increase overlap at intercellular junctions. We tested the hypothesis that the barrier-disrupting agent histamine would reduce local lamellipodia protrusions and investigated the potential involvement of p38 mitogen-activated protein (MAP) kinase activation and actin stress fiber formation. Confluent monolayers of human umbilical vein endothelial cells (HUVEC) expressing green fluorescent protein-actin were studied using time-lapse fluorescence microscopy. The protrusion and withdrawal characteristics of local lamellipodia were assessed before and after addition of histamine. Changes in barrier function were determined using electrical cell-substrate impedance sensing. Histamine initially decreased barrier function, lamellipodia protrusion frequency, and lamellipodia protrusion distance. A longer time for lamellipodia withdrawal and reduced withdrawal distance and velocity accompanied barrier recovery. After barrier recovery, a significant number of cortical fibers migrated centrally, eventually resembling actin stress fibers. The p38 MAP kinase inhibitor SB203580 attenuated the histamine-induced decreases in barrier function and lamellipodia protrusion frequency. SB203580 also inhibited the histamine-induced decreases in withdrawal distance and velocity, and the subsequent actin fiber migration. These data suggest that histamine can reduce local lamellipodia protrusion activity through activation of p38 MAP kinase. The findings also suggest that local lamellipodia have a role in maintaining endothelial barrier integrity. Furthermore, we provide evidence that actin stress fiber formation may be a reaction to, rather than a cause of, reduced endothelial barrier integrity.

  3. Staphylococcus aureus α-toxin-mediated cation entry depolarizes membrane potential and activates p38 MAP kinase in airway epithelial cells.

    Science.gov (United States)

    Eiffler, Ina; Behnke, Jane; Ziesemer, Sabine; Müller, Christian; Hildebrandt, Jan-Peter

    2016-09-01

    Membrane potential (Vm)-, Na(+)-, or Ca(2+)-sensitive fluorescent dyes were used to analyze changes in Vm or intracellular ion concentrations in airway epithelial cells treated with Staphylococcus aureus α-toxin (Hla), a major virulence factor of pathogenic strains of these bacteria. Gramicidin, a channel-forming peptide causing membrane permeability to monovalent cations, a mutated form of Hla, rHla-H35L, which forms oligomers in the plasma membranes of eukaryotic cells but fails to form functional transmembrane pores, or the cyclodextrin-derivative IB201, a blocker of the Hla pore, were used to investigate the permeability of the pore. Na(+) as well as Ca(2+) ions were able to pass the Hla pore and accumulated in the cytosol. The pore-mediated influx of calcium ions was blocked by IB201. Treatment of cells with recombinant Hla resulted in plasma membrane depolarization as well as in increases in the phosphorylation levels of paxillin (signaling pathway mediating disruption of the actin cytoskeleton) and p38 MAP kinase (signaling pathway resulting in defensive actions). p38 MAP kinase phosphorylation, but not paxillin phosphorylation, was elicited by treatment of cells with gramicidin. Although treatment of cells with rHla-H35L resulted in the formation of membrane-associated heptamers, none of these cellular effects were observed in our experiments. This indicates that formation of functional Hla-transmembrane pores is required to induce the cell physiological changes mediated by α-toxin. Specifically, the changes in ion equilibria and plasma membrane potential are important activators of p38 MAP kinase, a signal transduction module involved in host cell defense.

  4. The transcription factor Ste12 mediates the regulatory role of the Tmk1 MAP kinase in mycoparasitism and vegetative hyphal fusion in the filamentous fungus Trichoderma atroviride.

    Directory of Open Access Journals (Sweden)

    Sabine Gruber

    Full Text Available Mycoparasitic species of the fungal genus Trichoderma are potent antagonists able to combat plant pathogenic fungi by direct parasitism. An essential step in this mycoparasitic fungus-fungus interaction is the detection of the fungal host followed by activation of molecular weapons in the mycoparasite by host-derived signals. The Trichoderma atroviride MAP kinase Tmk1, a homolog of yeast Fus3/Kss1, plays an essential role in regulating the mycoparasitic host attack, aerial hyphae formation and conidiation. However, the transcription factors acting downstream of Tmk1 are hitherto unknown. Here we analyzed the functions of the T. atroviride Ste12 transcription factor whose orthologue in yeast is targeted by the Fus3 and Kss1 MAP kinases. Deletion of the ste12 gene in T. atroviride not only resulted in reduced mycoparasitic overgrowth and lysis of host fungi but also led to loss of hyphal avoidance in the colony periphery and a severe reduction in conidial anastomosis tube formation and vegetative hyphal fusion events. The transcription of several orthologues of Neurospora crassa hyphal fusion genes was reduced upon ste12 deletion; however, the Δste12 mutant showed enhanced expression of mycoparasitism-relevant chitinolytic and proteolytic enzymes and of the cell wall integrity MAP kinase Tmk2. Based on the comparative analyses of Δste12 and Δtmk1 mutants, an essential role of the Ste12 transcriptional regulator in mediating outcomes of the Tmk1 MAPK pathway such as regulation of the mycoparasitic activity, hyphal fusion and carbon source-dependent vegetative growth is suggested. Aerial hyphae formation and conidiation, in contrast, were found to be independent of Ste12.

  5. ATF-1 transcription factor regulates the expression of ccg-1 and cat-1 genes in response to fludioxonil under OS-2 MAP kinase in Neurospora crassa.

    Science.gov (United States)

    Yamashita, Kazuhiro; Shiozawa, Azusa; Watanabe, Setsuko; Fukumori, Fumiyasu; Kimura, Makoto; Fujimura, Makoto

    2008-12-01

    The ATF/CREB family transcriptional factors are regulated by stress-activated MAP kinase in yeast. The disruptants of the atf-1 gene, which encodes an ATF/CREB family transcriptional factor, were isolated and characterized in Neurospora crassa. The characteristic phenotypes in the os-2 MAP kinase strain, such as osmotic sensitivity and fludioxonil resistance, were not observed in the Deltaatf-1 strain; however, like the os-2 strain, up-regulation of the catalase gene cat-1 and the clock-controlled gene ccg-1 by treatment with fludioxonil (1 microg/mL) or 4% NaCl was almost completely abolished in the Deltaatf-1 strain. A gel shift assay indicated that ATF-1 bound to the cat-1 and ccg-1 promoters probably through the CRE motifs. The enzyme activity of large-subunit catalase CAT-1, the major conidial catalase, was not detected in the Deltaatf-1 strain, suggesting that the production of CAT-1 during formation of conidia is largely dependent on ATF-1. Among 11 clock-controlled genes, the expression of ccg-1, ccg-9, ccg-13, and ccg-14 was induced by fludioxonil in an OS-2-dependent manner; however, induction of ccg-13 and ccg-14 was observed in the Deltaatf-1 strain, suggesting the existence of another transcription factor regulated by OS-2. The homozygous cross between the Deltaatf-1 strains produced perithecia and ascospores; however, their ascospores never germinated. These findings suggest that ATF-1 acts as one of the transcriptional factors downstream of the OS-2 MAP kinase and probably regulates some genes involved in conidiation, circadian rhythm, and ascospore maturation in N. crassa.

  6. Amide-based inhibitors of p38alpha MAP kinase. Part 2: design, synthesis and SAR of potent N-pyrimidyl amides.

    Science.gov (United States)

    Tester, Richland; Tan, Xuefei; Luedtke, Gregory R; Nashashibi, Imad; Schinzel, Kurt; Liang, Weiling; Jung, Joon; Dugar, Sundeep; Liclican, Albert; Tabora, Jocelyn; Levy, Daniel E; Do, Steven

    2010-04-15

    Optimization of a tri-substituted N-pyridyl amide led to the discovery of a new class of potent N-pyrimidyl amide based p38alpha MAP kinase inhibitors. Initial SAR studies led to the identification of 5-dihydrofuran as an optimal hydrophobic group. Additional side chain modifications resulted in the introduction of hydrogen bond interactions. Through extensive SAR studies, analogs bearing free amino groups and alternatives to the parent (S)-alpha-methyl benzyl moiety were identified. These compounds exhibited improved cellular activities and maintained balance between p38alpha and CYP3A4 inhibition.

  7. [INHIBITORS OF MAP-KINASE PATHWAY U0126 AND PD98059 DIFFERENTLY AFFECT ORGANIZATION OF TUBULIN CYTOSKELETON AFTER STIMULATION OF EGF RECEPTOR ENDOCYTOSIS].

    Science.gov (United States)

    Zlobina, M V; Steblyanko, Yu Yu; Shklyaeva, M A; Kharchenko, V V; Salova, A V; Kornilova, E S

    2015-01-01

    To confirm the hypothesis about the involvement of EGF-stimulated MAP-kinase ERK1/2 in the regulation of microtubule (MT) system, the influence of two widely used ERK1/2 inhibitors, U0126 and PD98059, on the organization of tubulin cytoskeleton in interphase HeLa cells during EGF receptor endocytosis has been investigated. We have found that addition of U0126 or PD98059 to not-stimulated with EGF ells for 30 min has no effect on radially organized MT system. However, in the case of U0126 addition before EGF endocytosis stimulation, the number of MT per cell decreased within 15 min after such stimulation and was followed by complete MT depolymerization by 60-90 min. Stimulation of EGF endocytosis in the presence of PD98059 resulted only in insignificant depolymerization of MT and it could be detected mainly from their minus-ends. At the same time, MT regions close to plasma membrane became stabilized, which was proved by increase in tubulin acetylation level. This situation was characteristic for all period of the experiment. It has been also found that the inhibitors affect endocytosis dynamics of EGF-receptor complexes. Quantitative analysis demonstrated that the stimulation of endocytosis in the presence of U0126 generated a greater number of endosomes compared to control cells, and their number did not change significantly during the experiment. All these endosomes were localized peripherally. Effect of PD98059 resulted in the formation of lower number of endosomes that in control, but they demonstrated very slow clusterization despite the presence of some intact MT. Both inhibitors decreased EGFR colocolization with early endosomal marker EEA1, which indicated a delay in endosome fusions and maturation. The inhibitors were also shown to affect differently phospho-ERK 1 and 2 forms: U0126 completely inhibited phospho-ERK1 and 2, white, in the presence of PD98059, the two ERK forms demonstrated sharp transient activation in 15 min after stimulation, but only

  8. Mechanical stimuli activation of calpain is required for myoblast differentiation and occurs via an ERK/MAP kinase signaling pathway

    DEFF Research Database (Denmark)

    Grossi, Alberto; Karlsson, Anders H; Lawson, Moira Ann

    fusion, cell membrane and cytoskeleton component reorganization due to the activity of ubiquitous proteolytic enzymes known as calpains has been reported. Whether there is a link between stretch- or load induced signals, the MAPK pathway and calpain expression and activation is not known. Using......, with each individual myotube containing fewer nuclei. Mechanical stimulation increases not only the expression of m-calpain but also the overall activity of calpain in the cells through the MAPK signaling cascade. Our findings underline that the mechanical modulation of MAPK signaling cascade enhances...... the expression and activity of m-calpain, which play a pivotal role during myoblast fusion, strengthening the idea of its implication during the initial events of muscle development....

  9. Targeted deletion of the ERK5 MAP kinase impairs neuronal differentiation, migration, and survival during adult neurogenesis in the olfactory bulb.

    Directory of Open Access Journals (Sweden)

    Tan Li

    Full Text Available Recent studies have led to the exciting idea that adult-born neurons in the olfactory bulb (OB may be critical for complex forms of olfactory behavior in mice. However, signaling mechanisms regulating adult OB neurogenesis are not well defined. We recently reported that extracellular signal-regulated kinase (ERK 5, a MAP kinase, is specifically expressed in neurogenic regions within the adult brain. This pattern of expression suggests a role for ERK5 in the regulation of adult OB neurogenesis. Indeed, we previously reported that conditional deletion of erk5 in adult neurogenic regions impairs several forms of olfactory behavior in mice. Thus, it is important to understand how ERK5 regulates adult neurogenesis in the OB. Here we present evidence that shRNA suppression of ERK5 in adult neural stem/progenitor cells isolated from the subventricular zone (SVZ reduces neurogenesis in culture. By contrast, ectopic activation of endogenous ERK5 signaling via expression of constitutive active MEK5, an upstream activating kinase for ERK5, stimulates neurogenesis. Furthermore, inducible and conditional deletion of erk5 specifically in the neurogenic regions of the adult mouse brain interferes with cell cycle exit of neuroblasts, impairs chain migration along the rostral migratory stream and radial migration into the OB. It also inhibits neuronal differentiation and survival. These data suggest that ERK5 regulates multiple aspects of adult OB neurogenesis and provide new insights concerning signaling mechanisms governing adult neurogenesis in the SVZ-OB axis.

  10. FvBck1, a Component of Cell Wall Integrity MAP Kinase Pathway, is Required for Virulence and Oxidative Stress Response in Sugarcane Pokkah Boeng Pathogen

    Directory of Open Access Journals (Sweden)

    Chengkang eZhang

    2015-10-01

    Full Text Available Fusarium verticillioides (formerly F. moniliforme is suggested as one of the causal agents of Pokkah Boeng, a serious disease of sugarcane worldwide. Currently, detailed molecular and physiological mechanism of pathogenesis is unknown. In this study, we focused on cell wall integrity MAPK pathway as one of the potential signaling mechanisms associated with Pokkah Boeng pathogenesis. We identified FvBCK1 gene that encodes a MAP kinase kinase kinase homolog and determined that it is not only required for growth, micro- and macro-conidia production, and cell wall integrity but also for response to osmotic and oxidative stresses. The deletion of FvBCK1 caused a significant reduction in virulence and FB1 production, a carcinogenic mycotoxin produced by the fungus. Moreover, we found the expression levels of three genes, which are known to be involved in superoxide scavenging, were down regulated in the mutant. We hypothesized that the loss of superoxide scavenging capacity was one of the reasons for reduced virulence, but overexpression of catalase or peroxidase gene failed to restore the virulence defect in the deletion mutant. When we introduced Magnaporthe oryzae MCK1 into the FvBck1 deletion mutant, while certain phenotypes were restored, the complemented strain failed to gain full virulence. In summary, FvBck1 plays a diverse role in F. verticillioides, and detailed investigation of downstream signaling pathways will lead to a better understanding of how this MAPK pathway regulates Pokkah Boeng on sugarcane.

  11. The transcriptional response to the inactivation of the PaMpk1 and PaMpk2 MAP kinase pathways in Podospora anserina.

    Science.gov (United States)

    Bidard, Frédérique; Coppin, Evelyne; Silar, Philippe

    2012-08-01

    Transcription pattern during mycelium growth of Podospora anserina was assayed by microarray analysis in wild type and in mutants affected in the MAP kinase genes PaMpk1 and PaMpk2 and in the NADPH oxidase gene PaNox1. 15% of the genes have their expression modified by a factor two or more as growth proceeds in wild type. The genes whose expression is modified during growth in P. anserina are either not conserved or differently regulated in Neurospora crassa and Aspergillus niger, two fungi for which transcriptome data during growth are available. The P. anserina mutants display a similar alteration of their transcriptome profile, with nearly 1000 genes affected similarly in the three mutants, accounting for their similar growth phenotypes. Yet, each mutant has its specific set of modified transcripts, in line with particular phenotypes exhibited by each mutant. Again, there is limited conservation during evolution of the genes regulated at the transcription level by MAP kinases, as indicated by the comparison the P. anserina data, with those of Aspergillus fumigatus and N. crassa, two fungi for which gene expression data are available for mutants of the MAPK pathways. Among the genes regulated in wild type and affected in the mutants, those involved in carbohydrate and secondary metabolisms appear prominent. The vast majority of the genes differentially expressed are of unknown function. Availability of their transcription profile at various stages of development should help to decipher their role in fungal physiology and development.

  12. Nitric oxide affects ERK signaling through down-regulation of MAP kinase phosphatase levels during larval development of the ascidian Ciona intestinalis.

    Directory of Open Access Journals (Sweden)

    Immacolata Castellano

    Full Text Available In the ascidian Ciona intestinalis larval development and metamorphosis require a complex interplay of events, including nitric oxide (NO production, MAP kinases (ERK, JNK and caspase-3 activation. We have previously shown that NO levels affect the rate of metamorphosis, regulate caspase activity and promote an oxidative stress pathway, resulting in protein nitration. Here, we report that NO down-regulates MAP kinase phosphatases (mkps expression affecting positively ERK signaling. By pharmacological approach, we observed that the reduction of endogenous NO levels caused a decrease of ERK phosphorylation, whereas increasing levels of NO induced ERK activation. We have also identified the ERK gene network affected by NO, including mpk1, mpk3 and some key developmental genes by quantitative gene expression analysis. We demonstrate that NO induces an ERK-independent down-regulation of mkp1 and mkp3, responsible for maintaining the ERK phosphorylation levels necessary for transcription of key metamorphic genes, such as the hormone receptor rev-erb and the van willebrand protein vwa1c. These results add new insights into the role played by NO during larval development and metamorphosis in Ciona, highlighting the cross-talk between different signaling pathways.

  13. The inflammatory kinase MAP4K4 promotes reactivation of Kaposi's sarcoma herpesvirus and enhances the invasiveness of infected endothelial cells.

    Directory of Open Access Journals (Sweden)

    Darya A Haas

    Full Text Available Kaposi's sarcoma (KS is a mesenchymal tumour, which is caused by Kaposi's sarcoma herpesvirus (KSHV and develops under inflammatory conditions. KSHV-infected endothelial spindle cells, the neoplastic cells in KS, show increased invasiveness, attributed to the elevated expression of metalloproteinases (MMPs and cyclooxygenase-2 (COX-2. The majority of these spindle cells harbour latent KSHV genomes, while a minority undergoes lytic reactivation with subsequent production of new virions and viral or cellular chemo- and cytokines, which may promote tumour invasion and dissemination. In order to better understand KSHV pathogenesis, we investigated cellular mechanisms underlying the lytic reactivation of KSHV. Using a combination of small molecule library screening and siRNA silencing we found a STE20 kinase family member, MAP4K4, to be involved in KSHV reactivation from latency and to contribute to the invasive phenotype of KSHV-infected endothelial cells by regulating COX-2, MMP-7, and MMP-13 expression. This kinase is also highly expressed in KS spindle cells in vivo. These findings suggest that MAP4K4, a known mediator of inflammation, is involved in KS aetiology by regulating KSHV lytic reactivation, expression of MMPs and COX-2, and, thereby modulating invasiveness of KSHV-infected endothelial cells.

  14. Mechanical stress triggers cardiomyocyte autophagy through angiotensin II type 1 receptor-mediated p38MAP kinase independently of angiotensin II.

    Directory of Open Access Journals (Sweden)

    Li Lin

    Full Text Available Angiotensin II (Ang II type 1 (AT1 receptor is known to mediate a variety of physiological actions of Ang II including autophagy. However, the role of AT1 receptor in cardiomyocyte autophagy triggered by mechanical stress still remains elusive. The aim of this study was therefore to examine whether and how AT1 receptor participates in cardiomyocyte autophagy induced by mechanical stresses. A 48-hour mechanical stretch and a 4-week transverse aorta constriction (TAC were imposed to cultured cardiomyocytes of neonatal rats and adult male C57B/L6 mice, respectively, to induce cardiomyocyte hypertrophy prior to the assessment of cardiomyocyte autophagy using LC3b-II. Losartan, an AT1 receptor blocker, but not PD123319, the AT2 inhibitor, was found to significantly reduce mechanical stretch-induced LC3b-II upregulation. Moreover, inhibition of p38MAP kinase attenuated not only mechanical stretch-induced cardiomyocyte hypertrophy but also autophagy. To the contrary, inhibition of ERK and JNK suppressed cardiac hypertrophy but not autophagy. Intriguingly, mechanical stretch-induced autophagy was significantly inhibited by Losartan in the absence of Ang II. Taken together, our results indicate that mechanical stress triggers cardiomyocyte autophagy through AT1 receptor-mediated activation of p38MAP kinase independently of Ang II.

  15. Dual Roles of Quercetin in Platelets: Phosphoinositide-3-Kinase and MAP Kinases Inhibition, and cAMP-Dependent Vasodilator-Stimulated Phosphoprotein Stimulation

    Directory of Open Access Journals (Sweden)

    Won Jun Oh

    2012-01-01

    Full Text Available Background. Progressive diseases including cancer, metabolic, and cardiovascular disorders are marked by platelet activation and chronic inflammation. Studies suggest that dietary flavonoids such as quercetin possess antioxidant, anti-inflammatory, and antiplatelet properties, which could prevent various chronic diseases including atherosclerosis and thrombosis. However, the mechanism and the signaling pathway that links quercetin's antiplatelet activity with its anti-inflammatory property is limited and thus further exploration is required. The aim of this paper was to examine the link between antiplatelet and anti-inflammatory roles of quercetin in agonist-induced platelet activation. Methods. Quercetin effects on agonist-activated platelet-aggregation, granule-secretion, [Ca2+]i, and glycoprotein-IIb/IIIa activation were examined. Its effects on PI3K/Akt, VASP, and MAPK phosphorylations were also studied on collaged-activated platelets. Results. Quercetin dose dependently suppressed collagen, thrombin, or ADP-induced platelet aggregation. It significantly inhibited collagen-induced ATP release, P-selectin expression, [Ca2+]i mobilization, integrin-αIIbβ3 activation, and augmented cAMP and VASP levels. Moreover, quercetin attenuated PI3K, Akt, ERK2, JNK1, and p38 MAPK activations, which were supported by platelet-aggregation inhibition with the respective kinase inhibitors. Conclusion. Quercetin-mediated antiplatelet activity involves PI3K/Akt inactivation, cAMP elevation, and VASP stimulation that, in turn, suppresses MAPK phosphorylations. This result suggests quercetin may have a potential to treat cardiovascular diseases involving aberrant platelet activation and inflammation.

  16. Specific MAP-kinase blockade protects against renal damage in homozygous TGR(mRen2)27 rats

    NARCIS (Netherlands)

    de Borst, MH; Navis, G; de Boer, RA; Vis, LM; van Gilst, WH; van Goor, H

    2003-01-01

    Angiotensin II (AngII) plays an important role in renal damage by acting on hemodynamics, cell-growth, proliferation, and fibrosis, mainly by effects on the AngII type 1 (AT,) receptor. The AT, receptor activates several intracellular signaling molecules such as mitogen-activated protein kinases ext

  17. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous scree...

  18. The Campylobacter jejuni CiaD effector protein activates MAP kinase signaling pathways and is required for the development of disease

    Science.gov (United States)

    2013-01-01

    Background Enteric pathogens utilize a distinct set of proteins to modulate host cell signaling events that promote host cell invasion, induction of the inflammatory response, and intracellular survival. Human infection with Campylobacter jejuni, the causative agent of campylobacteriosis, is characterized by diarrhea containing blood and leukocytes. The clinical presentation of acute disease, which is consistent with cellular invasion, requires the delivery of the Campylobacter invasion antigens (Cia) to the cytosol of host cells via a flagellar Type III Secretion System (T3SS). We identified a novel T3SS effector protein, which we termed CiaD that is exported from the C. jejuni flagellum and delivered to the cytosol of host cells. Results We show that the host cell kinases p38 and Erk 1/2 are activated by CiaD, resulting in the secretion of interleukin-8 (IL-8) from host cells. Additional experiments revealed that CiaD-mediated activation of p38 and Erk 1/2 are required for maximal invasion of host cells by C. jejuni. CiaD contributes to disease, as evidenced by infection of IL-10 knockout mice. Noteworthy is that CiaD contains a Mitogen-activated protein (MAP) kinase-docking site that is found within effector proteins produced by other enteric pathogens. These findings indicate that C. jejuni activates the MAP kinase signaling pathways Erk 1/2 and p38 to promote cellular invasion and the release of the IL-8 pro-inflammatory chemokine. Conclusions The identification of a novel T3SS effector protein from C. jejuni significantly expands the knowledge of virulence proteins associated with C. jejuni pathogenesis and provides greater insight into the mechanism utilized by C. jejuni to invade host cells. PMID:24144181

  19. ERK MAP kinase activation in spinal cord regulates phosphorylation of Cdk5 at serine 159 and contributes to peripheral inflammation induced pain/hypersensitivity.

    Directory of Open Access Journals (Sweden)

    Xiaoqin Zhang

    Full Text Available Cyclin-dependent kinase 5 is a proline-directed serine/threonine kinase and its activity participates in the regulation of nociceptive signaling. Like binding with the activators (P35 or P25, the phosphorylation of Cdk5 plays a critical role in Cdk5 activation. However, it is still unclear whether Cdk5 phosphorylation (p-Cdk5 contributes to pain hyperalgesia. The aim of our current study was to identify the roles of p-Cdk5 and its upstream regulator in response to peripheral inflammation. Complete Freund's adjuvant (CFA injection induced acute peripheral inflammation and heat hyperalgesia, which was accompanied by sustained increases in phospho-ERK1/2 (p-ERK1/2 and phospho-Cdk5(S159 (p-Cdk5(S159 in the spinal cord dorsal horn (SCDH. CFA-induced p-ERK primarily colocalized with p-Cdk5(S159 in superficial dorsal horn neurons. Levels in p-ERK and p-Cdk5 were also increased in the 2(nd phase of hyperalgesia induced by formalin injection, which can produce acute and tonic inflammatory pain. MAP kinase kinase inhibitor U0126 intrathecal delivery significantly suppressed the elevation of p-Cdk5(S159, Cdk5 activity and pain response behavior (Heat hyperalgesia, Spontaneous flinches induced by CFA or formalin injection. Cdk5 inhibitor roscovitine intrathecal administration also suppressed CFA-induced heat hyperalgesia and Cdk5 phosphorylation, but did not attenuate ERK activation. All these findings suggested that p-Cdk5(S159 regulated by ERK pathway activity may be a critical mechanism involved in the activation of Cdk5 in nociceptive spinal neurons contributes to peripheral inflammatory pain hypersensitivity.

  20. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.

    Science.gov (United States)

    Kotzka, Jorg; Knebel, Birgit; Haas, Jutta; Kremer, Lorena; Jacob, Sylvia; Hartwig, Sonja; Nitzgen, Ulrike; Muller-Wieland, Dirk

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  1. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.

    Directory of Open Access Journals (Sweden)

    Jorg Kotzka

    Full Text Available The transcription factor sterol regulatory element binding protein (SREBP-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK. Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  2. Protein kinase C δ (PKCδ)-extracellular signal-regulated kinase 1/2 (ERK1/2) signaling cascade regulates glycogen synthase kinase-3 (GSK-3) inhibition-mediated interleukin-10 (IL-10) expression in lipopolysaccharide (LPS)-induced endotoxemia.

    Science.gov (United States)

    Noh, Kyung Tae; Son, Kwang Hee; Jung, In Duk; Kang, Hyun Kyu; Hwang, Sun Ae; Lee, Won Suk; You, Ji Chang; Park, Yeong-Min

    2012-04-20

    Glycogen synthase kinase-3 (GSK-3) modulates a wide array of cellular processes, including embryonic development, cell differentiation, survival, and apoptosis. Recently, it was reported that a GSK-3 inhibitor attenuates lipopolysaccharide (LPS)-induced septic shock and regulates the mortality of endotoxemic mice. However, the detailed mechanism of reduced mortality via GSK-3 inhibition is not well defined. Herein, we showed that GSK-3 inhibition induces extracellular signal-regulated kinase 1/2 (ERK1/2) activation under LPS-stressed conditions via protein kinase C δ (PKCδ) activation. Furthermore, PKCδ-induced ERK1/2 activation by the inhibition of GSK-3 provoked the production of interleukin (IL)-10, playing a crucial role in regulating endotoxemia. Using a mitogen-activated protein kinase kinase-1 (MEK-1) and PKCδ inhibitor, we confirmed that GSK-3 inhibition induces PKCδ and subsequent ERK1/2 activation, resulting in increased IL-10 expression under LPS-treated conditions. We verified that septic shock caused by LPS is attenuated by GSK-3 inhibition using a GSK-3 inhibitor. This relieved endotoxemia induced by GSK-3 inhibition was restored in an ERK1/2-dependent manner. Taken together, IL-10 expression produced by GSK-3 inhibition-induced ERK1/2 activation via PKCδ relieved LPS-mediated endotoxemia. This finding suggests that IL-10 hyperexpression resulting from GSK-3 inhibition-induced ERK activation could be a new therapeutic pathway for endotoxemia.

  3. Role of the p70 S6 kinase cascade in neutrophilic differentiation and proliferation of HL-60 cells-a study of transferrin receptor-positive and -negative cells obtained from dimethyl sulfoxide- or retinoic acid-treated HL-60 cells.

    Science.gov (United States)

    Kanayasu-Toyoda, Toshie; Yamaguchi, Teruhide; Oshizawa, Tadashi; Kogi, Mieko; Uchida, Eriko; Hayakawa, Takao

    2002-09-01

    Previously, we suggested that p70 S6 kinase (p70 S6K) plays an important role in the regulation of neutrophilic differentiation of HL-60 cells; this conclusion was based on our analysis of transferrin receptor (Trf-R) positive (Trf-R(+)) and negative (Trf-R(-)) cells that appeared after treatment with dimethyl sulfoxide (Me(2)SO). In this study, we analyzed the upstream of p70 S6K in relation to the differentiation and proliferation of both cell types. The granulocyte colony-stimulating factor (G-CSF)-induced enhancement of phosphatidylinositol 3-kinase (PI3K) activity in Trf-R(+) cells was markedly higher than that in Trf-R(-) cells. Wortmannin, a specific inhibitor of PI3K, partially inhibited G-CSF-induced p70 S6K activity and G-CSF-dependent proliferation, whereas rapamycin, an inhibitor of p70 S6K, completely inhibited these activities. The wortmannin-dependent enhancement of neutrophilic differentiation was similar to that induced by rapamycin. From these results, we conclude that the PI3K/p70 S6K cascade may play an important role in negative regulation of neutrophilic differentiation in HL-60 cells. For the G-CSF-dependent proliferation, however, p70 S6K appears to be a highly important pathway through not only a PI3K-dependent but also possibly an independent cascade.

  4. Cyanidin-3-glucoside inhibits UVB-induced oxidative damage and inflammation by regulating MAP kinase and NF-κB signaling pathways in SKH-1 hairless mice skin

    Energy Technology Data Exchange (ETDEWEB)

    Pratheeshkumar, Poyil; Son, Young-Ok; Wang, Xin; Divya, Sasidharan Padmaja [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Joseph, Binoy [Spinal Cord and Brain Injury Research Center and Department of Physiology, University of Kentucky, Lexington, KY 40536-0509 (United States); Hitron, John Andrew; Wang, Lei [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Kim, Donghern [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Yin, Yuanqin [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Cancer Institute, The First Affiliated Hospital, China Medical University, Shenyang (China); Roy, Ram Vinod [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Lu, Jian [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Institute of Life Sciences, Jiangsu University, Zhenjiang, Jiangsu 212013 (China); Zhang, Zhuo [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Wang, Yitao [State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences, University of Macau, Macau (China); and others

    2014-10-01

    Skin cancer is one of the most commonly diagnosed cancers in the United States. Exposure to ultraviolet-B (UVB) radiation induces inflammation and photocarcinogenesis in mammalian skin. Cyanidin-3-glucoside (C3G), a member of the anthocyanin family, is present in various vegetables and fruits especially in edible berries, and displays potent antioxidant and anticarcinogenic properties. In this study, we have assessed the in vivo effects of C3G on UVB irradiation induced chronic inflammatory responses in SKH-1 hairless mice, a well-established model for UVB-induced skin carcinogenesis. Here, we show that C3G inhibited UVB-induced skin damage and inflammation in SKH-1 hairless mice. Our results indicate that C3G inhibited glutathione depletion, lipid peroxidation and myeloperoxidation in mouse skin by chronic UVB exposure. C3G significantly decreased the production of UVB-induced pro-inflammatory cytokines, such as IL-6 and TNF-α, associated with cutaneous inflammation. Likewise, UVB-induced inflammatory responses were diminished by C3G as observed by a remarkable reduction in the levels of phosphorylated MAP kinases, Erk1/2, p38, JNK1/2 and MKK4. Furthermore, C3G also decreased UVB-induced cyclooxygenase-2 (COX-2), PGE{sub 2} and iNOS levels, which are well-known key mediators of inflammation and cancer. Treatment with C3G inhibited UVB-induced nuclear translocation of NF-κB and degradation of IκBα in mice skin. Immunofluorescence assay revealed that topical application of C3G inhibited the expression of 8-hydroxy-2′-deoxyguanosine, proliferating cell nuclear antigen, and cyclin D1 in chronic UVB exposed mouse skin. Collectively, these data indicates that C3G can provide substantial protection against the adverse effects of UVB radiation by modulating UVB-induced MAP kinase and NF-κB signaling pathways. - Highlights: • C3G inhibited UVB-induced oxidative damage and inflammation. • C3G inhibited UVB-induced COX-2, iNOS and PGE{sub 2} production. • C3G

  5. Modification of collagen by 3-deoxyglucosone alters wound healing through differential regulation of p38 MAP kinase.

    Directory of Open Access Journals (Sweden)

    Danielle T Loughlin

    Full Text Available BACKGROUND: Wound healing is a highly dynamic process that requires signaling from the extracellular matrix to the fibroblasts for migration and proliferation, and closure of the wound. This rate of wound closure is impaired in diabetes, which may be due to the increased levels of the precursor for advanced glycation end products, 3-deoxyglucosone (3DG. Previous studies suggest a differential role for p38 mitogen-activated kinase (MAPK during wound healing; whereby, p38 MAPK acts as a growth kinase during normal wound healing, but acts as a stress kinase during diabetic wound repair. Therefore, we investigated the signaling cross-talk by which p38 MAPK mediates wound healing in fibroblasts cultured on native collagen and 3DG-collagen. METHODOLOGY/PRINCIPAL FINDINGS: Using human dermal fibroblasts cultured on 3DG-collagen as a model of diabetic wounds, we demonstrated that p38 MAPK can promote either cell growth or cell death, and this was dependent on the activation of AKT and ERK1/2. Wound closure on native collagen was dependent on p38 MAPK phosphorylation of AKT and ERK1/2. Furthermore, proliferation and collagen production in fibroblasts cultured on native collagen was dependent on p38 MAPK regulation of AKT and ERK1/2. In contrast, 3DG-collagen decreased fibroblast migration, proliferation, and collagen expression through ERK1/2 and AKT downregulation via p38 MAPK. CONCLUSIONS/SIGNIFICANCE: Taken together, the present study shows that p38 MAPK is a key signaling molecule that plays a significantly opposite role during times of cellular growth and cellular stress, which may account for the differing rates of wound closure seen in diabetic populations.

  6. Short waves-induced enhancement of proliferation of human chondrocytes: involvement of extracellular signal-regulated map-kinase (erk).

    Science.gov (United States)

    Wang, Jue-Long; Chan, Rai-Chi; Cheng, He-Hsiung; Huang, Chun-Jen; Lu, Yih-Chau; Chen, I-Shu; Liu, Shiuh-Inn; Hsu, Shu-Shong; Chang, Hong-Tai; Huang, Jong-Khing; Chen, Jin-Shyr; Ho, Chin-Man; Jan, Chung-Ren

    2007-07-01

    1. Short-wave diathermy (SWD) is a form of radiofrequency radiation that is used therapeutically by physiotherapists. The cellular mechanisms of SWD are unclear. The present study was performed to explore the effect of different conditions of short-wave exposure on the proliferation of cultured human chondrocytes. 2. Cells exposed to short waves once per day for seven consecutive days exhibited a significant increase in proliferation by 42% compared with the control cells. In cells that were treated with short waves twice per day for seven consecutive days, or only once on Day 1 and then examined for proliferation on Day 7, cell proliferation was greater than the control cells by 40% and 30%, respectively. 3. Given the importance of mitogen-activated protein kinases (MAPK) in the proliferation of different cell types, efforts were extended to explore the role of three major types of MAPK; that is, extracellular signal-regulated kinase (ERK), c-Jun NH(2)-terminal protein kinase (JNK) and p38. 4. It was found that the level of phosphorylated ERK (phospho-ERK 1 and ERK 2) increased significantly within 5-120 min following consecutive exposure to short waves for 7 days. Exposure to short waves failed to alter the intensity of phosphorylated JNK and p38 within 0-240 min. 5. Cells were exposed to short waves once for seven consecutive days in the presence of 0, 10 micromol/L, 20 micromol/L or 50 micromol/L PD98059 (an ERK inhibitor). PD98059 totally inhibited short waves-induced enhancement of proliferation without altering normal control viability. In the presence of short waves and PD98059, the cell viability was lower than the normal control. Together, the data suggest that short waves could increase proliferation in human chondrocytes through activation of the ERK pathway, which is also involved in maintaining normal cell proliferation under physiological conditions.

  7. Convergent evidence identifying MAP/microtubule affinity-regulating kinase 1 (MARK1) as a susceptibility gene for autism.

    Science.gov (United States)

    Maussion, Gilles; Carayol, Jérôme; Lepagnol-Bestel, Aude-Marie; Tores, Frédéric; Loe-Mie, Yann; Milbreta, Ulla; Rousseau, Francis; Fontaine, Karine; Renaud, Julie; Moalic, Jean-Marie; Philippi, Anne; Chedotal, Alain; Gorwood, Philip; Ramoz, Nicolas; Hager, Jörg; Simonneau, Michel

    2008-08-15

    Autism spectrum disorders (ASDs) are common, heritable, but genetically heterogeneous neurodevelopmental conditions. We recently defined a susceptibility locus for ASDs on chromosome 1q41-q42. High-resolution single-nucleotide polymorphisms (126 SNPs) genotyping across the chromosome 1q41-q42 region, followed by a MARK1 (microtubule affinity-regulating kinase 1)-tagged-SNP association study in 276 families with autism from the Autism Genetic Research Exchange, showed that several SNPs within the MARK1 gene were significantly associated with ASDs by transmission disequilibrium tests. Haplotype rs12740310*C-rs3737296*G-rs12410279*A was overtransmitted (P(corrected)= 0.0016), with a relative risk for autism of 1.8 in homozygous carriers. Furthermore, ASD-associated SNP rs12410279 modulates the level of transcription of MARK1. We found that MARK1 was overexpressed in the prefrontal cortex (BA46) but not in cerebellar granule cells, on postmortem brain tissues from patients. MARK1 displayed an accelerated evolution along the lineage leading to humans, suggesting possible involvement of this gene in cognition. MARK1 encodes a kinase-regulating microtubule-dependent transport in axons and dendrites. Both overexpression and silencing of MARK1 resulted in significantly shorter dendrite length in mouse neocortical neurons and modified dendritic transport speed. As expected for a gene encoding a key polarity determinant Par-1 protein kinase, MARK1 is involved in axon-dendrite specification. Thus, MARK1 overexpression in humans may be responsible for subtle changes in dendritic functioning.

  8. Pharmacological profile of AW-814141, a novel, potent, selective and orally active inhibitor of p38 MAP kinase

    DEFF Research Database (Denmark)

    Chopra, Puneet; Kulkarni, Onkar; Gupta, Shashank

    2010-01-01

    -inflammatory activity of a p38 MAPK inhibitor, AW-814141. AW-814141 inhibited enzymatic activity of recombinant p38-alpha and beta isoforms with IC(50) value of 100nM and 158nM, respectively. AW-814141 also inhibited the release of tumor necrosis factor (TNF)-alpha by lipopolysaccharide (LPS) treated human peripheral...... blood mononuclear cells with an IC(50) value of 212nM and demonstrated selectivity against a panel of few kinases. Oral administration of AW-814141 (10mpk) in LPS-injected mice resulted in a significant reduction in TNF-alpha production in the circulation. In a carrageenan-induced rat paw edema model...

  9. A crucial role for the mitogen-activated protein kinase pathway in nicotinic cholinergic signaling to secretory protein transcription in pheochromocytoma cells.

    Science.gov (United States)

    Tang, K; Wu, H; Mahata, S K; O'Connor, D T

    1998-07-01

    The mitogen-activated protein kinase (MAPK) pathway plays a pivotal role in intracellular signaling, and this cascade may impinge on cAMP response elements (CREs) of target genes. Both the MAPK pathway and chromogranin A expression may be activated by cytosolic calcium influx, and calcium-dependent signals map onto the chromogranin A promoter proximal CRE. We therefore probed the role of the MAPK pathway in chromogranin A biosynthesis after secretory stimulation of PC12 pheochromocytoma cells by the nicotinic cholinergic pathway, the physiological secretory trigger. Chemical inhibition of either MAPK or MAPK kinase blocked the response of a transfected chromogranin A promoter to nicotine or protein kinase C activation [by phorbol-12-myristate-13-acetate (PMA)], although nicotine-evoked catecholamine secretion was unaffected. Activation of the MAP kinase cascade (Ras, Raf, MAPK, or CREB kinase) by cotransfection of pathway components stimulated the chromogranin A promoter. Cotransfection of MAPK pathway dominant negative mutants (for Raf, MAPK, or CREB kinase) blocked nicotinic or PMA activation of chromogranin A, although a dominant negative Ras mutant was without effect. MAPK pathway enzymatic activity was stimulated by both nicotine and PMA. Point mutations of the chromogranin A CRE suggested that this element was necessary in cis for stimulation by nicotine, PMA, or chemical activation of the MAPK pathway. Transfer of the CRE to a heterologous promoter conferred inducibility by not only nicotine or cAMP but also MAPK activation. Expression of the CREB antagonist KCREB blocked the response of the chromogranin A promoter to nicotine, cAMP, or MAPK pathway activation by either chemical stimulation or cotransfection of active cascade components. Chromogranin A mRNA responded to MAPK pathway manipulation in a fashion similar to the transfected chromogranin A promoter, in both direction and magnitude. We conclude that the MAPK pathway is a necessary intermediate in

  10. Lead decreases cell survival, proliferation, and neuronal differentiation of primary cultured adult neural precursor cells through activation of the JNK and p38 MAP kinases

    Science.gov (United States)

    Engstrom, Anna; Wang, Hao; Xia, Zhengui

    2015-01-01

    Adult hippocampal neurogenesis is the process whereby adult neural precursor cells (aNPCs) in the subgranular zone (SGZ) of the dentate gyrus (DG) generate adult-born, functional neurons in the hippocampus. This process is modulated by various extracellular and intracellular stimuli, and the adult-born neurons have been implicated in hippocampus-dependent learning and memory. However, studies on how neurotoxic agents affect this process and the underlying mechanisms are limited. The goal of this study was to determine whether lead, a heavy metal, directly impairs critical processes in adult neurogenesis and to characterize the underlying signaling pathways using primary cultured SGZ-aNPCs isolated from adult mice. We report here that lead significantly increases apoptosis and inhibits proliferation in SGZ-aNPCs. In addition, lead significantly impairs spontaneous neuronal differentiation and maturation. Furthermore, we found that activation of the c-Jun NH2-terminal kinase (JNK) and p38 mitogen activated protein (MAP) kinase signaling pathways are important for lead cytotoxicity. Our data suggest that lead can directly act on adult neural stem cells and impair critical processes in adult hippocampal neurogenesis, which may contribute to its neurotoxicity and adverse effects on cognition in adults. PMID:25967738

  11. A Potent Inhibitor of Phosphoinositide 3-Kinase (PI3K) and Mitogen Activated Protein (MAP) Kinase Signalling, Quercetin (3, 3', 4', 5, 7-Pentahydroxyflavone) Promotes Cell Death in Ultraviolet (UV)-B-Irradiated B16F10 Melanoma Cells

    Science.gov (United States)

    Rafiq, Rather A.; Quadri, Afnan; Nazir, Lone A.; Peerzada, Kaiser; Ganai, Bashir A.; Tasduq, Sheikh A.

    2015-01-01

    Ultraviolet (UV) radiation–induced skin damage contributes strongly to the formation of melanoma, a highly lethal form of skin cancer. Quercetin (Qu), the most widely consumed dietary bioflavonoid and well known inhibitor of phosphoinositide 3-kinase (PI3K) and mitogen activated protein (MAP) kinase signalling, has been reported to be chemopreventive in several forms of non-melanoma skin cancers. Here, we report that the treatment of ultraviolet (UV)-B-irradiated B16F10 melanoma cells with quercetin resulted in a dose dependent reduction in cell viability and increased apoptosis. The present study has brought out that the pro-apoptotic effects of quercetin in UVB-irradiated B16F10 cells are mediated through the elevation of intracellular reactive oxygen species (ROS) formation, calcium homeostasis imbalance, modulation of anti-oxidant defence response and depolarization of mitochondrial membrane potential (ΔΨM). Promotion of UVB-induced cell death by quercetin was further revealed by cleavage of chromosomal DNA, caspase activation, poly (ADP) ribose polymerase (PARP) cleavage, and an increase in sub-G1 cells. Quercetin markedly attenuated MEK-ERK signalling, influenced PI3K/Akt pathway, and potentially enhanced the UVB-induced NF-κB nuclear translocation. Furthermore, combined UVB and quercetin treatment decreased the ratio of Bcl-2 to that of Bax, and upregulated the expression of Bim and apoptosis inducing factor (AIF). Overall, these results suggest the possibility of using quercetin in combination with UVB as a possible treatment option for melanoma in future. PMID:26148186

  12. A Potent Inhibitor of Phosphoinositide 3-Kinase (PI3K and Mitogen Activated Protein (MAP Kinase Signalling, Quercetin (3, 3', 4', 5, 7-Pentahydroxyflavone Promotes Cell Death in Ultraviolet (UV-B-Irradiated B16F10 Melanoma Cells.

    Directory of Open Access Journals (Sweden)

    Rather A Rafiq

    Full Text Available Ultraviolet (UV radiation-induced skin damage contributes strongly to the formation of melanoma, a highly lethal form of skin cancer. Quercetin (Qu, the most widely consumed dietary bioflavonoid and well known inhibitor of phosphoinositide 3-kinase (PI3K and mitogen activated protein (MAP kinase signalling, has been reported to be chemopreventive in several forms of non-melanoma skin cancers. Here, we report that the treatment of ultraviolet (UV-B-irradiated B16F10 melanoma cells with quercetin resulted in a dose dependent reduction in cell viability and increased apoptosis. The present study has brought out that the pro-apoptotic effects of quercetin in UVB-irradiated B16F10 cells are mediated through the elevation of intracellular reactive oxygen species (ROS formation, calcium homeostasis imbalance, modulation of anti-oxidant defence response and depolarization of mitochondrial membrane potential (ΔΨM. Promotion of UVB-induced cell death by quercetin was further revealed by cleavage of chromosomal DNA, caspase activation, poly (ADP ribose polymerase (PARP cleavage, and an increase in sub-G1 cells. Quercetin markedly attenuated MEK-ERK signalling, influenced PI3K/Akt pathway, and potentially enhanced the UVB-induced NF-κB nuclear translocation. Furthermore, combined UVB and quercetin treatment decreased the ratio of Bcl-2 to that of Bax, and upregulated the expression of Bim and apoptosis inducing factor (AIF. Overall, these results suggest the possibility of using quercetin in combination with UVB as a possible treatment option for melanoma in future.

  13. 22(R)-hydroxycholesterol induces HuR-dependent MAP kinase phosphatase-1 expression via mGluR5-mediated Ca(2+)/PKCα signaling.

    Science.gov (United States)

    Kim, Hyunmi; Woo, Joo Hong; Lee, Jee Hoon; Joe, Eun-Hye; Jou, Ilo

    2016-08-01

    MAP kinase phosphatase (MKP)-1 plays a pivotal role in controlling MAP kinase (MAPK)-dependent (patho) physiological processes. Although MKP-1 gene expression is tightly regulated at multiple levels, the underlying mechanistic details remain largely unknown. In this study, we demonstrate that MKP-1 expression is regulated at the post-transcriptional level by 22(R)-hydroxycholesterol [22(R)-HC] through a novel mechanism. 22(R)-HC induces Hu antigen R (HuR) phosphorylation, cytoplasmic translocation and binding to MKP-1 mRNA, resulting in stabilization of MKP-1 mRNA. The resulting increase in MKP-1 leads to suppression of JNK-mediated inflammatory responses in brain astrocytes. We further demonstrate that 22(R)-HC-induced phosphorylation of nuclear HuR is mediated by PKCα, which is activated in the cytosol by increases in intracellular Ca(2+) levels mediated by the phospholipase C/inositol 1,4,5-triphosphate receptor (PLC/IP3R) pathway and translocates from cytoplasm to nucleus. In addition, pharmacological interventions reveal that metabotropic glutamate receptor5 (mGluR5) is responsible for the increases in intracellular Ca(2+) that underlie these actions of 22(R)-HC. Collectively, our findings identify a novel anti-inflammatory mechanism of 22(R)-HC, which acts through PKCα-mediated cytoplasmic shuttling of HuR to post-transcriptionally regulate MKP-1 expression. These findings provide an experimental basis for the development of a RNA-targeted therapeutic agent to control MAPK-dependent inflammatory responses.

  14. Role of MAP kinases in regulating expression of antioxidants and inflammatory mediators in mouse keratinocytes following exposure to the half mustard, 2-chloroethyl ethyl sulfide

    Science.gov (United States)

    Black, Adrienne T.; Joseph, Laurie B.; Casillas, Robert P.; Heck, Diane E.; Gerecke, Donald R.; Sinko, Patrick J.; Laskin, Debra L.; Laskin, Jeffrey D.

    2012-01-01

    Dermal exposure to sulfur mustard causes inflammation and tissue injury. This is associated with changes in expression of antioxidants and eicosanoids which contribute to oxidative stress and toxicity. In the present studies we analyzed mechanisms regulating expression of these mediators using an in vitro skin construct model in which mouse keratinocytes were grown at an air-liquid interface and exposed directly to 2-chloroethyl ethyl sulfide (CEES), a model sulfur mustard vesicant. CEES (100-1000 μM) was found to cause marked increases in keratinocyte protein carbonyls, a marker of oxidative stress. This was correlated with increases in expression of Cu,Zn superoxide dismutase, catalase, thioredoxin reductase and the glutathione-S-transferases, GSTA1-2, GSTP1 and mGST2. CEES also upregulated several enzymes important in the synthesis of prostaglandins and leukotrienes including cyclooxygenase-2 (COX-2), microsomal prostaglandin E synthase-2 (mPGES-2), prostaglandin D synthase (PGDS), 5-lipoxygenase (5-LOX), leukotriene A4 (LTA4) hydrolase and leukotriene C4 (LTC4) synthase. CEES readily activated keratinocyte JNK and p38 MAP kinases, signaling pathways which are known to regulate expression of antioxidants, as well as prostaglandin and leukotriene synthases. Inhibition of p38 MAP kinase suppressed CEES-induced expression of GSTA1-2, COX-2, mPGES-2, PGDS, 5-LOX, LTA4 hydrolase and LTC4 synthase, while JNK inhibition blocked PGDS and GSTP1. These data indicate that CEES modulates expression of antioxidants and enzymes producing inflammatory mediators by distinct mechanisms. Increases in antioxidants may be an adaptive process to limit tissue damage. Inhibiting the capacity of keratinocytes to generate eicosanoids may be important in limiting inflammation and protecting the skin from vesicant-induced oxidative stress and injury. PMID:20382172

  15. Activation of cyclin D1 by estradiol and spermine in MCF-7 breast cancer cells: a mechanism involving the p38 MAP kinase and phosphorylation of ATF-2.

    Science.gov (United States)

    Lewis, Joan S; Vijayanathan, Veena; Thomas, T J; Pestell, Richard G; Albanese, Chris; Gallo, Michael A; Thomas, Thresia

    2005-01-01

    Estradiol (E2) and the naturally occurring polyamines (putrescine, spermidine, and spermine) play important roles in breast cancer cell growth and differentiation. We examined the effects of E2 and spermine on the phosphorylation and DNA binding of activating transcription factor-2 (ATF-2) in MCF-7 breast cancer cells. ATF-2 is a transcription factor involved in estrogenic regulation of cyclin D1 gene, and thereby cell cycle progression. DNA affinity immunoblot assays showed a six- to eightfold increase in the binding of ATF-2 to a 74-mer ATF/CRE oligonucleotide (ODN1) from cyclin D1 promoter in the presence of 4 nM E2 and 0.5 mM spermine, compared to untreated control. Individual treatments with E2 or spermine caused a twofold or lower increase in ATF-2 binding to ODN1. Immunoblotting with phospho-ATF-2 antibody showed that increased DNA binding of ATF-2 was associated with its phosphorylation. A p38 MAP kinase inhibitor, PD169316, inhibited ATF-2 phosphorylation. In contrast, the MEK-ERK1/2 inhibitor, PD98059, or the JNK inhibitor, SP600125, had no significant effect on DNA binding of ATF-2. Cyclin D1 promoter (-1745CD1) activity increased by approximately 12-fold (above control) in the presence of E2 and spermine, compared to a sixfold increase in the presence of E2 alone and a twofold increase with spermine. Cells transfected with a dominant negative mutant of ATF-2 showed decreased transactivation of cyclin D1 promoter in response to E2 and spermine. These results indicate that spermine can enhance E2-induced cell signaling and cyclin D1 transcription by activation of the p38 MAP kinase and phosphorylation of ATF-2, contributing to breast cancer cell proliferation.

  16. Interplay between calcineurin and the Slt2 MAP-kinase in mediating cell wall integrity, conidiation and virulence in the insect fungal pathogen Beauveria bassiana.

    Science.gov (United States)

    Huang, Shuaishuai; He, Zhangjiang; Zhang, Shiwei; Keyhani, Nemat O; Song, Yulin; Yang, Zhi; Jiang, Yahui; Zhang, Wenli; Pei, Yan; Zhang, Yongjun

    2015-10-01

    The entomopathogenic fungus, Beauveria bassiana, is of environmental and economic importance as an insect pathogen, currently used for the biological control of a number of pests. Cell wall integrity and conidiation are critical parameters for the ability of the fungus to infect insects and for production of the infectious propagules. The contribution of calcineurin and the Slt2 MAP kinase to cell wall integrity and development in B. bassiana was investigated. Gene knockouts of either the calcineurin CNA1 subunit or the Slt2 MAP kinase resulted in decreased tolerance to calcofluor white and high temperature. In contrast, the Δcna1 strain was more tolerant to Congo red but more sensitive to osmotic stress (NaCl, sorbitol) than the wild type, whereas the Δslt2 strain had the opposite phenotype. Changes in cell wall structure and composition were seen in the Δslt2 and Δcna1 strains during growth under cell wall stress as compared to the wild type. Both Δslt2 and Δcna1 strains showed significant alterations in growth, conidiation, and viability. Elevation of intracellular ROS levels, and decreased conidial hydrophobicity and adhesion to hydrophobic surfaces, were also seen for both mutants, as well as decreased virulence. Under cell wall stress conditions, inactivation of Slt2 significantly repressed CN-mediated phosphatase activity suggesting some level of cross talk between the two pathways. Comparative transcriptome profiling of the Δslt2 and Δcna1 strains revealed alterations in the expression of distinct gene sets, with overlap in transcripts involved in cell wall integrity, stress response, conidiation and virulence. These data illustrate convergent and divergent phenotypes and targets of the calcineurin and Slt2 pathways in B. bassiana.

  17. Piceatannol bolsteres fetal haemoglobin formation in K562 cells via p38 map kinase activation and ERK inactivation

    Directory of Open Access Journals (Sweden)

    AAYUSH KUKREJA

    2015-08-01

    Full Text Available Elevation of the level of fetal haemoglobin (HbF by pharmacological agents is a safe and a promising approach for treating beta thalassemia. In this study, the effect of piceatannol was studied in human erythroleukemic K562 cells for their role in gamma-globin mRNA and HbF induction. The role of p38 mitogen activated protein kinase (MAPK and extracellular regulated protein kinase (ERK signaling pathways were also examined. It was found that piceatannol significantly increased gamma-globin mRNA and HbF levels in dose and time dependent manner in K562 cells. This was determined by enzyme linked immunosorbent assay (ELISA and western blot analysis. Pretreatment with p38 MAPK inhibitor (SB203580 obstructed the stimulatory effect of piceatannol in total and HbF activation. In contrast, no change in HbF level was observed in K562 cells when treated with ERK inhibitor (PD98059. Moreover, piceatannol activated p38 MAPK and inhibited ERK signaling pathways in K562 cells as shown by western blot analysis. Besides, the inhibitor SB203580 inhibited p38 MAPK activation when cells were pre-treated with piceatannol. In summary, piceatannol was found to be a strong inducer of HbF production in K562 cells. The results mark the role of p38 MAPK and ERK signaling as molecular targets for stimulation of HbF synthesis upon treatment with piceatannol.

  18. Cloning and molecular characterization of a gene encoding MAP kinase from maize and its expression in E. coli

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    A new MAPK gene, ZmSIMK1 (Zea mays L. salt-induced mitogen-activated protein kinase 1), is isolated from a maize cDNA library. The full-length ZmSIMK1 gene contains 1636 bp and an open reading frame of 1122 nucleotides capable of encoding 373 amino acid polypeptides with a predicted molecular mass of 42.3 kda and pI of 6.01. The putative ZmSIMK1 protein contains all 11 conserved subdomains that are characteristics of serine/threonine protein kinases and the TEY motif, which is the putative phosphorylation site. Northern blot analysis shows that ZmSIMK1 is ubiquitously expressed in roots, stems, and leaves of maize seedlings and its mRNA accumulation is observed in maize seedlings treated with 30 mmol/L PEG-6000 and 137 mmol/L NaCl, but the expression of ZmSIMK1 is not significantly affected by 4℃ treatment. The expression vector pET-ZmSIMK1 is constructed by inserting the coding region of ZmSIMK1 cDNA into pET-42a(+), and transformed into E. coli strain BL21(DE3). A 77kda fusion protein is induced by the further culture at 37℃ after addition of 1mmol/L IPTG.

  19. Analysis of Activated Platelet-Derived Growth Factor β Receptor and Ras-MAP Kinase Pathway in Equine Sarcoid Fibroblasts

    Directory of Open Access Journals (Sweden)

    Gennaro Altamura

    2013-01-01

    Full Text Available Equine sarcoids are skin tumours of fibroblastic origin affecting equids worldwide. Bovine papillomavirus type-1 (BPV-1 and, less commonly, type-2 are recognized as etiological factors of sarcoids. The transforming activity of BPV is related to the functions of its major oncoprotein E5 which binds to the platelet-derived growth factor β receptor (PDGFβR causing its phosphorylation and activation. In this study, we demonstrate, by coimmunoprecipitation and immunoblotting, that in equine sarcoid derived cell lines PDGFβR is phosphorylated and binds downstream molecules related to Ras-mitogen-activated protein kinase-ERK pathway thus resulting in Ras activation. Imatinib mesylate is a tyrosine kinase receptors inhibitor which selectively inhibits the activation of PDGFβR in the treatment of several human and animal cancers. Here we show that imatinib inhibits receptor phosphorylation, and cell viability assays demonstrate that this drug decreases sarcoid fibroblasts viability in a dose-dependent manner. This study contributes to a better understanding of the molecular mechanisms involved in the pathology of sarcoids and paves the way to a new therapeutic approach for the treatment of this common equine skin neoplasm.

  20. cAMP-Induced Histones H3 Dephosphorylation Is Independent of PKA and MAP Kinase Activations and Correlates With mTOR Inactivation.

    Science.gov (United States)

    Rodriguez, Pedro; Rojas, Juan

    2016-03-01

    cAMP is a second messenger well documented to be involved in the phosphorylation of PKA, MAP kinase, and histone H3 (H3). Early, we reported that cAMP also induced H3 dephosphorylation in a variety of proliferating cell lines. Herein, it is shown that cAMP elicits a biphasic H3 dephosphorylation independent of PKA activation in cycling cells. H89, a potent inhibitor of PKA catalytic sub-unite, could not abolish this effect. Additionally, H89 induces a rapid and biphasic H3 serine 10 dephosphorylation, while a decline in the basal phosphorylation of CREB/ATF-1 is observed. Rp-cAMPS, an analog of cAMP and specific inhibitor of PKA, is unable to suppress cAMP-mediated H3 dephosphorylation, whereas Rp-cAMPS effectively blocks CREB/ATF-1 hyper-phosphorylation by cAMP and its inducers. Interestingly, cAMP exerts a rapid and profound H3 dephosphorylation at much lower concentration (50-fold lower, 0.125 mM) than the concentration required for maximal CREB/ATF-1 phosphorylation (5 mM). Much higher cAMP concentration is required to fully induce CREB/ATF-1 gain in phosphate (5 mM), which correlates with the inhibition of H3 dephosphorylation. Also, the dephosphorylation of H3 does not overlap at onset of MAP kinase phosphorylation pathways, p38 and ERK. Surprisingly, rapamycin (an mTOR inhibitor), cAMP, and its natural inducer isoproterenol, elicit identical dephosphorylation kinetics on both S6K1 ribosomal kinase (a downstream mTOR target) and H3. Finally, cAMP-induced H3 dephosphorylation is PP1/2-dependent. The results suggest that a pathway, requiring much lower cAMP concentration to that required for CREB/ATF-1 hyper-phosphorylation, is responsible for histone H3 dephosphorylation and may be linked to mTOR down regulation.

  1. Role of stress-activated MAP kinase P38 in cisplatin-and DTT-induced apoptosis of the esophageal carcinoma cell line Eca109

    Institute of Scientific and Technical Information of China (English)

    Qian-Xian Zhang; Ruo Feng; Wei Zhang; Yi Ding; Ji-Yao Yang; Guo-Hong Liu

    2005-01-01

    AIM: To study the role of P38 kinase in esophageal cancer cell apoptosis induced by genotoxin, cisplatin and the unfolded protein response (UPR) inducer, dithiothreitol(DTT).METHODS: Esophageal carcinoma cell line Eca109 was cultured in RPMI 1640 medium to 70% confluency and treated with either cisplatin, DTT, or cisplatin plus DTT in the presence or absence of P38 inhibitor, SB203580. The untreated cells served as the control. The esophageal carcinoma cell apoptosis was detected by agarose gel DNA ladder analysis and quantified by flow cytometry.The P38 phosphorylation was detected by immunohis-tochemistry using antibodies specific to phosphorylated P38 protein.RESULTS: (1) Both cisplatin and DTT induced apoptosis in the esophageal cancer cell line Eca109 as shown by DNA ladder formation; (2) As detected by antibodies specific for the phosphorylated P38 protein (p-P38), both cisplatin and DTT treatments activated the stress-activated enzyme, MAP kinase P38. The number of positive cells was about 50% for the treatment groups, comparing to that of 10% for untreated group. DTT treatment, but not cisplatin treatment, induces nuclear localization of p-P38;(3) As measured by flow cytometry, inhibition of P38 activity by SB203580 blocks DFT- and cisplatin-induced apoptosis.The rates for DTT, cisplatin, and DTT plus cisplatin-induced apoptosis were 16.8%, 17.1%, and 21.4%, respectively.Addition of the SB compound during the incubation reduced the apoptotic rate to about 7.6% for all the treatment groups, suggesting that P38 activation is essential for cisplatin- and DTT-induced apoptosis in Eca109 cells.CONCLUSION: (1) Both DTT and cisplatin were able to induce apoptosis in esophageal cancer cell line Eca109;(2) P38 MAP kinase is essential for DTT- and cisplatin-induced apoptosis in Eca109 cells; (3) P38 activation may be the common signaling component relaying the multiple upstream signaling events to the downstream cell death program.

  2. Mutagenesis of p38alpha MAP Kinase Establishes Key Roles of Phe169 in Function and Structural Dynamics and Reveals a Novel DFG-OUT State

    Energy Technology Data Exchange (ETDEWEB)

    Bukhtiyarova,M.; Karpusas, M.; Northrup, K.; Namboodiri, H.; Springman, E.

    2007-01-01

    In order to study the role of Phe169 in p38{alpha} MAP kinase structure and function, wild-type p38{alpha} and five p38{alpha} DFG motif mutants were examined in vitro for phosphorylation by MKK6, kinase activity toward ATF2 substrate, thermal stability, and X-ray crystal structure. All six p38{alpha} variants were efficiently phosphorylated by MKK6. However, only one activated p38{alpha} mutant (F169Y) possessed measurable kinase activity (1% compared to wild-type). The loss of kinase activity among the DFG mutants may result from an inability to correctly position Asp168 in the activated form of p38{alpha}. Two mutations significantly increased the thermal stability of p38{alpha} (F169A {Delta}T{sub m} = 1.3 {sup o}C and D168G {Delta}T{sub m} = 3.8 {sup o}C), and two mutations significantly decreased the stability of p38{alpha} (F169R {Delta}T{sub m} = -3.2 {sup o}C and F169G {Delta}T{sub m} = -4.7 {sup o}C). Interestingly, X-ray crystal structures of two thermally destabilized p38{alpha}-F169R and p38{alpha}-F169G mutants revealed a DFG-OUT conformation in the absence of an inhibitor molecule. This DFG-OUT conformation, termed {alpha}-DFG-OUT, is different from the ones previously identified in p38{alpha} crystal structures with bound inhibitors and postulated from high-temperature molecular dynamics simulations. Taken together, these results indicate that Phe169 is optimized for p38{alpha} functional activity and structural dynamics, rather than for structural stability. The {alpha}-DFG-OUT conformation observed for p38{alpha}-F169R and p38{alpha}-F169G may represent a naturally occurring intermediate state of p38{alpha} that provides access for binding of allosteric inhibitors. A model of the local forces driving the DFG IN-OUT transition in p38{alpha} is proposed.

  3. Monocyte intracellular cytokine production during human endotoxaemia with or without a second in vitro LPS challenge : effect of RWJ-67657, a p38 MAP-kinase inhibitor, on LPS-hyporesponsiveness

    NARCIS (Netherlands)

    Faas, MM; Moes, H; Fijen, JW; Kobold, ACM; Tulleken, JE; Zijlstra, JG

    2002-01-01

    In the present study, we investigated the effect of RWJ-67657, a p38 MAP kinase inhibitor, upon in vivo LPS-induced monocyte cytokine production and upon monocyte LPS-hyporesponsiveness. Thirty minutes before a single injection of LPS (4 ng/kg BW), healthy male volunteers received a single oral dose

  4. Monocyte intracellular cytokine production during human endotoxaemia with or without a second in vitro LPS challenge : effect of RWJ-67657, a p38 MAP-kinase inhibitor, on LPS-hyporesponsiveness

    NARCIS (Netherlands)

    Faas, MM; Moes, H; Fijen, JW; Kobold, ACM; Tulleken, JE; Zijlstra, JG

    In the present study, we investigated the effect of RWJ-67657, a p38 MAP kinase inhibitor, upon in vivo LPS-induced monocyte cytokine production and upon monocyte LPS-hyporesponsiveness. Thirty minutes before a single injection of LPS (4 ng/kg BW), healthy male volunteers received a single oral dose

  5. Constitutive Activity of the Arabidopsis MAP Kinase 3 Confers Resistance to Pseudomonas syringae and Drives Robust Immune Responses

    KAUST Repository

    Lang, Julien

    2017-08-02

    Mitogen Activated Protein Kinases (MAPKs) are known to be important mediators of plant responses to biotic and abiotic stresses. In a recent report, we enlarged the understanding of the Arabidopsis thaliana MPK3 functions showing that the expression of a constitutively active (CA) form of the protein led to auto-immune phenotypes. CA-MPK3 plants are dwarf and display defense responses that are characterized by the accumulation of salicylic acid and phytoalexins as well as by the upregulation of several defense genes. Consistently with these data, we present here results demonstrating that, compared to wild type controls, CA-MPK3 plants are more resistant to the hemibiotrophic pathogen Pseudomonas syringae DC3000. Based on our previous work, we also discuss the mechanisms of robust plant immunity controlled by sustained MPK3 activity, focusing especially on the roles of disease resistance proteins.

  6. Evaluate ERTS imagery for mapping and detection of changes of snowcover on land and on glaciers. [Cascade Range, Washington and Tweedsmuir Glacier, Alaska

    Science.gov (United States)

    Meier, M. F. (Principal Investigator)

    1974-01-01

    The author has identified the following significant results. The area of snowcover on 10 individual drainage basins in the North Cascades, Washington, has been determined by use of a semi-automatic radiance threshold technique. The result is a unique record of the changing water storage as snow in these important hydrologic units, the runoff of which is utilized for hydroelectric power, dilution of wastes and heat, support of salmon migration, and irrigation. These data allow a new type of hydrologic modelling to proceed which should permit more accurate forecasts of streamflow. A new technique has been developed for measuring snow-covered area or snowline altitude semi-automatically. This variable contour overlay method permits the snowcover to be matched efficiently to the best fit contour of altitude. The motion of the Yentna Glacier during the concluding phase of its surge was successfully measured by a flicker technique using images of two dates. It appears that displacements as small as 100 to 200 m can be measured. Motion of the Tweedsmuir Glacier in Alaska was measured using ERTS-1 images enlarged to 1:50,000. Changes detected included a shock wave moving down the glacier, the margin expanding, the moraine pattern deforming, and the marginal valley deepening.

  7. Quantitative assay for the detection of the V617F variant in the Janus kinase 2 (JAK2 gene using the Luminex xMAP technology

    Directory of Open Access Journals (Sweden)

    Gaudet Daniel

    2010-04-01

    Full Text Available Abstract Background The availability of clinically valid biomarkers contribute to improve the diagnosis and clinical management of diseases. A valine-to-phenylalanine substitution at position 617 (V617F in the Janus kinase 2 (JAK2 gene has been recently associated with key signaling abnormalities in the transduction of haemopoietic growth-factor receptors and is now considered as a useful clinical marker of myeloproliferative neoplasms. Several methods have recently been reported to detect the JAK2 V617F point mutation and show variable sensitivity. Methods Using the Luminex xMAP technology, we developed a quantitative assay to detect the JAK2V617F variant. The method was based on polymerase chain reaction (PCR followed by hybridization to specific probes coupled with internally dyed microspheres. The assay comprises 3 steps: genomic DNA extraction, end point PCR reaction, direct hybridization of PCR fragments and quantification. It has been tested with different sources of nucleic acid. Results Applied to whole blood samples, this quantitative assay showed a limit of detection of 2%. A highly sensitive allele-specific primer extension reaction performed in parallel allowed to validate the results and to identify the specimens with values below 2%. Conclusion Direct hybridization assay using the Luminex xMAP technology allows sensitive quantification of JAK2V617F from blood spots. It is simple and can be easily performed in a clinical setting.

  8. Efficacy and gastrointestinal tolerability of ML3403, a selective inhibitor of p38 MAP kinase and CBS-3595, a dual inhibitor of p38 MAP kinase and phosphodiesterase 4 in CFA-induced arthritis in rats.

    Science.gov (United States)

    Koch, Diana A; Silva, Rodrigo B M; de Souza, Alessandra H; Leite, Carlos E; Nicoletti, Natália F; Campos, Maria M; Laufer, Stefan; Morrone, Fernanda B

    2014-03-01

    Mitogen-activated protein kinase (MAPK) p38 inhibitors have entered the clinical phase, although many of them have failed due to high toxicity and lack of efficacy. In the present study we compared the effects of the selective p38 inhibitor ML3403 and the dual p38-PDE4 inhibitor CBS-3595, on inflammatory and nociceptive parameters in a model of polyarthritis in rats. Male Wistar rats (180-200 g) were used for the complete Freund's adjuvant (CFA)-induced arthritis model and they were evaluated at 14-21 days. We also analysed the effects of these pharmacological tools on liver and gastrointestinal toxicity and on cytokine levels. Repeated CBS-3595 (3 mg/kg) or ML3403 (10 mg/kg) administration produced significant anti-inflammatory actions in the chronic arthritis model induced by CFA. CBS-3595 and ML3403 treatment also markedly reduced the production of the proinflammatory cytokine IL-6 in the paw tissue, whereas it widely increased the levels of the anti-inflammatory cytokine IL-10. Moreover, CBS-3595 produced partial anti-allodynic effects in the CFA model at 4 and 8 days after treatment. Notably, ML3403 and CBS-3595 did not show marked signs of hepatoxicity, as supported by unaltered histological observations in the liver sections. Finally, both compounds were safe in the gastrointestinal tract, according to evaluation of intestinal biopsies. CBS-3595 displayed a superior profile regarding its anti-inflammatory effects. Thus p38 MAPK/PDE4 blocking might well constitute a relevant strategy for the treatment of RA.

  9. P38 MAP kinase inhibitors as potential therapeutics for the treatment of joint degeneration and pain associated with osteoarthritis

    Directory of Open Access Journals (Sweden)

    Taiwo Yetunde O

    2008-12-01

    Full Text Available Abstract Background Evaluate the potential role of p38 inhibitors for the treatment of osteoarthritis using an animal model of joint degeneration (iodoacetate-induced arthritis and a pain model (Hargraeves assay. Methods P38 kinase activity was evaluated in a kinase assay by measuring the amount of phosphorylated substrate ATF2 using a phosphoATF2 (Thr71 specific primary antibody and an alkaline phosphate coupled secondary antibody and measuring the OD at 405 nm. TNFα and IL-1β secretion from LPS stimulated THP-1 monocytic cells and human peripheral blood mononuclear cells were measured by ELISA. Rats treated with vehicle or p38 inhibitor were injected intra-articularly in one knee with iodoacetate and damage to the tibial plateau was assessed from digitized images captured using an image analyzer. The effect of p38 inhibitors on hyperalgesia was evaluated in rats given an intraplantar injection of carrageenan and 4 h later the paw withdrawal time to a radiant heat source was measured. Results SB-203580 and VX-745 are both potent inhibitors of p38 with IC50s of 136 ± 64 nM and 35 ± 14 nM (mean ± S.D., respectively. Similarly, SB-203580 and VX-745 potently inhibited TNF release from LPS stimulated human THP-1 cells with IC50s of 72 ± 15 nM; and 29 ± 14 nM (mean ± S.D. respectively. TNF release from LPS stimulated human peripheral blood mononuclear cells was inhibited with IC50s 16 ± 6 nM and 14 ± 8 nM, (mean ± S.D. for SB-203580 and VX-745 and IL-1 was inhibited with IC50s of 20 ± 8 nM and 15 ± 4 nM (mean ± S.D., respectively. SB-203580 and VX-745 administered orally at a dose of 50 mg/kg resulted in the significant (p Conclusion SB203580 and VX-745 demonstrated attenuation of both cartilage degeneration and pain in animal models and suggest that p38 inhibitors may be a useful approach for the treatment of osteoarthritis.

  10. Cascade of period doublings of tori

    Science.gov (United States)

    Arneodo, A.; Coullet, P. H.; Spiegel, E. A.

    1983-02-01

    A three-dimensional map is proposed to model the effects of periodic forcing on a system displaying a transition to chaos through a cascade of period-doubling bifurcations. The study outlined here raises the problem of the existence and bifurcation of invariant tori. A principal feature of the simulations of both the differential equations and the discrete dynamical systems is that it is possible to disrupt period-doubling sequences (and inverse sequences as well) by periodic external forcing. Even though the way in which this abortion works is not understood, the mechanism is thought to be associated with the destruction of tori (Aronson et al., 1982) when the system is on the verge of bifurcation. The simulations therefore suggest that in moving farther along the cascade, the tori become more fragile. It is suspected that for arbitrarily weak driving, the cascade will eventually be disrupted after the cascade has proceeded through a sufficient number of steps.

  11. Shock Waves Increase T-cell Proliferation or IL-2 Expression by Activating p38 MAP Kinase

    Institute of Scientific and Technical Information of China (English)

    Tie-Cheng YU; Yi LIU; Yan TAN; Yanfang JIANG; Xueqing ZHENG; Xinxiang XU

    2004-01-01

    Shock waves were elicited by transient pressure disturbances, which could be used to treat musculoskeletal disorders. In present studies, we i. nvestigated whether the low-density shock waves (LDSWs), which are able to damage plasma membrane without impairing the vimentin or other organelles, might augment T-cell proliferation as well as IL-2 expression, and if mitogen activated protein kinase p38 (p38 MAPK)might be an underlying mechanism through which the LDSWs enhanced T-cell function. We found that the LDSWs increased activation of p38 MAPK in Jurkat T cells. The LDSWs alone didn't result in the T-cell proliferation and IL-2 expression. However, in combination with other stimuli, LDSWs could augment the T-cell proliferation and IL-2 expression. Inhibition of p38 MAPK using SB203580 reduced the stimulatory effects of the LDSWs, which indicated that the LDSWs enhanced IL-2 expression through a mechanism that involved p38 MAPK activation. We concluded that the p38 MAPK activation played a key role in the regulation of T cell function by the LDSWs.

  12. Arabidopsis MAP kinase 4 regulates salicylic acid- and jasmonic acid/ethylene-dependent responses via EDS1 and PAD4.

    Science.gov (United States)

    Brodersen, Peter; Petersen, Morten; Bjørn Nielsen, Henrik; Zhu, Shijiang; Newman, Mari-Anne; Shokat, Kevan M; Rietz, Steffen; Parker, Jane; Mundy, John

    2006-08-01

    Arabidopsis MPK4 has been implicated in plant defense regulation because mpk4 knockout plants exhibit constitutive activation of salicylic acid (SA)-dependent defenses, but fail to induce jasmonic acid (JA) defense marker genes in response to JA. We show here that mpk4 mutants are also defective in defense gene induction in response to ethylene (ET), and that they are more susceptible than wild-type (WT) to Alternaria brassicicola that induces the ET/JA defense pathway(s). Both SA-repressing and ET/JA-(co)activating functions depend on MPK4 kinase activity and involve the defense regulators EDS1 and PAD4, as mutations in these genes suppress de-repression of the SA pathway and suppress the block of the ET/JA pathway in mpk4. EDS1/PAD4 thus affect SA-ET/JA signal antagonism as activators of SA but as repressors of ET/JA defenses, and MPK4 negatively regulates both of these functions. We also show that the MPK4-EDS1/PAD4 branch of ET defense signaling is independent of the ERF1 transcription factor, and use comparative microarray analysis of ctr1, ctr1/mpk4, mpk4 and WT to show that MPK4 is required for induction of a small subset of ET-regulated genes. The regulation of some, but not all, of these genes involves EDS1 and PAD4.

  13. Constitutively active Arabidopsis MAP Kinase 3 triggers defense responses involving salicylic acid and SUMM2 resistance protein

    KAUST Repository

    Genot, Baptiste

    2017-04-12

    Mitogen-activated protein kinases (MAPKs) are important regulators of plant immunity. Most of the knowledge about the function of these pathways is derived from loss-of-function approaches. Using a gain-of-function approach, we investigated the responses controlled by a constitutively active (CA) MPK3 in Arabidopsis thaliana. CA-MPK3 plants are dwarfed and display a massive de-repression of defense genes associated with spontaneous cell death as well as accumulation of reactive oxygen species (ROS), phytoalexins and the stress-related hormones ethylene and salicylic acid (SA). Remarkably CA-MPK3/sid2 and CA-MPK3/ein2-50 lines which are impaired in SA synthesis and ethylene signaling, respectively, retain most of the CA-MPK3-associated phenotypes, indicating that constitutive activity of MPK3 can bypass SA and ethylene signaling to activate defense responses. A comparative analysis of the molecular phenotypes of CA-MPK3 and mpk4 autoimmunity suggested convergence between the MPK3 and MPK4-guarding modules. In support of this model, CA-MPK3 crosses with summ1 and summ2, two known suppressors of mpk4, resulted in a partial reversion of the CA-MPK3 phenotypes. Overall, our data unravel a novel mechanism by which the MAPK signaling network contributes to a robust defense response system.

  14. Inhibition of the MAP kinase activity suppresses estrogen-induced breast tumor growth both in vitro and in vivo.

    Science.gov (United States)

    Reddy, Kaladhar B; Glaros, Selina

    2007-04-01

    Elevated expression of mitogen-activated protein kinase (Erk/MAPK) has been noted in a significant percentage of primary human breast cancers. To directly assess the importance of Erk/MAPK activation in estrogen (E2)-induced tumor progression, we blocked E2-signaling with MEK-inhibitor CI-1040 and/or tamoxifen (Tam). Our data show that both MEK-inhibitor CI-1040 and Tam blocked E2-induced MAPK phosphorylation and cell proliferation in MCF-7 breast cancer cells in vitro. However, in vivo studies show that anti-tumor efficacy of combining the CI-1040 and Tam was similar to single agent(s). Furthermore, sequential treatment with Tam followed by CI-1040 or CI-1040 followed by Tam did not significantly reduce E2-induced tumor growth. This suggests that the combination of CI-1040 and Tam may not be synergistic in inhibiting E2-induced tumor growth. However, these findings also indicate that MAPK plays a critical role in E2-induced tumor growth, and that this could be a potential therapeutic target to combat hormonally regulated growth in ER-positive tumors.

  15. A Major Facilitator Superfamily Transporter-Mediated Resistance to Oxidative Stress and Fungicides Requires Yap1, Skn7, and MAP Kinases in the Citrus Fungal Pathogen Alternaria alternata

    Science.gov (United States)

    Chen, Li-Hung; Tsai, Hsieh-Chin; Yu, Pei-Ling

    2017-01-01

    Major Facilitator Superfamily (MFS) transporters play an important role in multidrug resistance in fungi. We report an AaMFS19 gene encoding a MFS transporter required for cellular resistance to oxidative stress and fungicides in the phytopathogenic fungus Alternaria alternata. AaMFS19, containing 12 transmembrane domains, displays activity toward a broad range of substrates. Fungal mutants lacking AaMFS19 display profound hypersensitivities to cumyl hydroperoxide, potassium superoxide, many singlet oxygen-generating compounds (eosin Y, rose Bengal, hematoporphyrin, methylene blue, and cercosporin), and the cell wall biosynthesis inhibitor, Congo red. AaMFS19 mutants also increase sensitivity to copper ions, clotrimazole, fludioxonil, and kocide fungicides, 2-chloro-5-hydroxypyridine (CHP), and 2,3,5-triiodobenzoic acid (TIBA). AaMFS19 mutants induce smaller necrotic lesions on leaves of a susceptible citrus cultivar. All observed phenotypes in the mutant are restored by introducing and expressing a wild-type copy of AaMFS19. The wild-type strain of A. alternata treated with either CHP or TIBA reduces radial growth and formation and germination of conidia, increases hyphal branching, and results in decreased expression of the AaMFS19 gene. The expression of AaMFS19 is regulated by the Yap1 transcription activator, the Hog1 and Fus3 mitogen-activated protein (MAP) kinases, the ‘two component’ histidine kinase, and the Skn7 response regulator. Our results demonstrate that A. alternata confers resistance to different chemicals via a membrane-bound MFS transporter. PMID:28060864

  16. Oleanolic acid induces migration in Mv1Lu and MDA-MB-231 epithelial cells involving EGF receptor and MAP kinases activation

    Science.gov (United States)

    Ruzafa-Martínez, María; Ramos-Morcillo, Antonio Jesús

    2017-01-01

    During wound healing, skin function is restored by the action of several cell types that undergo differentiation, migration, proliferation and/or apoptosis. These dynamics are tightly regulated by the evolution of the extra cellular matrix (ECM) contents along the process. Pharmacologically active flavonoids have shown to exhibit useful physiological properties interesting in pathological states. Among them, oleanolic acid (OA), a pentacyclic triterpene, shows promising properties over wound healing, as increased cell migration in vitro and improved wound resolution in vivo. In this paper, we pursued to disclose the molecular mechanisms underlying those effects, by using an in vitro scratch assay in two epithelial cell lines of different linage: non-malignant mink lung epithelial cells, Mv1Lu; and human breast cancer cells, MDA-MB-231. In every case, we observed that OA clearly enhanced cell migration for in vitro scratch closure. This correlated with the stimulation of molecular pathways related to mitogen-activated protein (MAP) kinases, as ERK1,2 and Jun N-terminal kinase (JNK) 1,2 activation and c-Jun phosphorylation. Moreover, MDA-MB-231 cells treated with OA displayed an altered gene expression profile affecting transcription factor genes (c-JUN) as well as proteins involved in migration and ECM dynamics (PAI1), in line with the development of an epithelial to mesenchymal transition (EMT) status. Strikingly, upon OA treatment, we observed changes in the epidermal growth factor receptor (EGFR) subcellular localization, while interfering with its signalling completely prevented migration effects. This data provides a physiological framework supporting the notion that lipophilic plant extracts used in traditional medicine, might modulate wound healing processes in vivo through its OA contents. The molecular implications of these observations are discussed. PMID:28231262

  17. The involvement of calcium and MAP kinase signaling pathways in the production of radiation-induced bystander effects.

    LENUS (Irish Health Repository)

    Lyng, F M

    2006-04-01

    Much evidence now exists regarding radiation-induced bystander effects, but the mechanisms involved in the transduction of the signal are still unclear. The mitogen-activated protein kinase (MAPK) pathways have been linked to growth factor-mediated regulation of cellular events such as proliferation, senescence, differentiation and apoptosis. Activation of multiple MAPK pathways such as the ERK, JNK and p38 pathways have been shown to occur after exposure of cells to radiation and a variety of other toxic stresses. Previous studies have shown oxidative stress and calcium signaling to be important in radiation-induced bystander effects. The aim of the present study was to investigate MAPK signaling pathways in bystander cells exposed to irradiated cell conditioned medium (ICCM) and the role of oxidative metabolism and calcium signaling in the induction of bystander responses. Human keratinocytes (HPV-G cell line) were irradiated (0.005-5 Gy) using a cobalt-60 teletherapy unit. The medium was harvested 1 h postirradiation and transferred to recipient HPV-G cells. Phosphorylated forms of p38, JNK and ERK were studied by immunofluorescence 30 min-24 h after exposure to ICCM. Inhibitors of the ERK pathway (PD98059 and U0126), the JNK pathway (SP600125), and the p38 pathway (SB203580) were used to investigate whether bystander-induced cell death could be blocked. Cells were also incubated with ICCM in the presence of superoxide dismutase, catalase, EGTA, verapamil, nifedipine and thapsigargin to investigate whether bystander effects could be inhibited because of the known effects on calcium homeostasis. Activated forms of JNK and ERK proteins were observed after exposure to ICCM. Inhibition of the ERK pathway appeared to increase bystander-induced apoptosis, while inhibition of the JNK pathway appeared to decrease apoptosis. In addition, reactive oxygen species, such as superoxide and hydrogen peroxide, and calcium signaling were found to be important modulators of

  18. C-type natriuretic peptide regulates endochondral bone growth through p38 MAP kinase-dependent and – independent pathways

    Directory of Open Access Journals (Sweden)

    Serra Rosa

    2007-03-01

    Full Text Available Abstract Background C-type natriuretic peptide (CNP has recently been identified as an important anabolic regulator of endochondral bone growth, but the molecular mechanisms mediating its effects are not completely understood. Results We demonstrate in a tibia organ culture system that pharmacological inhibition of p38 blocks the anabolic effects of CNP. We further show that CNP stimulates endochondral bone growth largely through expansion of the hypertrophic zone of the growth plate, while delaying mineralization. Both effects are reversed by p38 inhibition. We also performed Affymetrix microarray analyses on micro-dissected tibiae to identify CNP target genes. These studies confirmed that hypertrophic chondrocytes are the main targets of CNP signaling in the growth plate, since many more genes were regulated by CNP in this zone than in the others. While CNP receptors are expressed at similar levels in all three zones, cGMP-dependent kinases I and II, important transducers of CNP signaling, are expressed at much higher levels in hypertrophic cells than in other areas of the tibia, providing a potential explanation for the spatial distribution of CNP effects. In addition, our data show that CNP induces the expression of NPR3, a decoy receptor for natriuretic peptides, suggesting the existence of a feedback loop to limit CNP signaling. Finally, detailed analyses of our microarray data showed that CNP regulates numerous genes involved in BMP signaling and cell adhesion. Conclusion Our data identify novel target genes of CNP and demonstrate that the p38 pathway is a novel, essential mediator of CNP effects on endochondral bone growth, with potential implications for understanding and treatment of numerous skeletal diseases.

  19. Cyclic stretch enhances the expression of Toll-like Receptor 4 gene in cultured cardiomyocytes via p38 MAP kinase and NF-κB pathway

    Directory of Open Access Journals (Sweden)

    Wang Bao-Wei

    2010-03-01

    Full Text Available Abstract Background Toll-like receptor 4 (TLR4 plays an important role in innate immunity. The role of TLR4 in stretched cardiomyocytes is not known. We sought to investigate whether mechanical stretch could regulate TLR4 expression, as well as the possible molecular mechanisms and signal pathways mediating the expression of TLR4 by cyclic mechanical stretch in cardiomyocytes. Methods Neonatal Wistar rat cardiomyocytes grown on a flexible membrane base were stretched by vacuum to 20% of maximum elongation at 60 cycles/min. Western blot, real-time polymerase chain reaction, and promoter activity assay were performed. In vitro monocyte adhesion to stretched myocyte was detected. Results Cyclic stretch significantly increased TLR4 protein and mRNA expression after 2 h to 24 h of stretch. Addition of SB203580, TNF-α antibody, and p38α MAP kinase siRNA 30 min before stretch inhibited the induction of TLR4 protein. Cyclic stretch increased, while SB203580 abolished the phosphorylated p38 protein. Gel shifting assay showed significant increase of DNA-protein binding activity of NF-κB after stretch and SB203580 abolished the DNA-protein binding activity induced by cyclic stretch. DNA-binding complexes induced by cyclic stretch could be supershifted by p65 monoclonal antibody. Cyclic stretch increased TLR4 promoter activity while SB203580 and NF-κB siRNA decreased TLR4 promoter activity. Cyclic stretch increased adhesion of monocyte to cardiomyocytes while SB203580, TNF-α antibody, and TLR4 siRNA attenuated the adherence of monocyte. TNF-α and Ang II significantly increased TLR4 protein expression. Addition of losartan, TNF-α antibody, or p38α siRNA 30 min before Ang II and TNF-α stimulation significantly blocked the increase of TLR4 protein by AngII and TNF-α. Conclusions Cyclic mechanical stretch enhances TLR4 expression in cultured rat neonatal cardiomyocytes. The stretch-induced TLR4 is mediated through activation of p38 MAP kinase and NF

  20. Blackberry extract inhibits UVB-induced oxidative damage and inflammation through MAP kinases and NF-κB signaling pathways in SKH-1 mice skin

    Energy Technology Data Exchange (ETDEWEB)

    Divya, Sasidharan Padmaja; Wang, Xin; Pratheeshkumar, Poyil; Son, Young-Ok; Roy, Ram Vinod [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Kim, Donghern; Dai, Jin [Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Hitron, John Andrew; Wang, Lei [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Asha, Padmaja [National Centre for Aquatic Animal Health, Cochin University of Science and Technology, Cochin (India); Shi, Xianglin [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Zhang, Zhuo, E-mail: zhuo.zhang@uky.edu [Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States)

    2015-04-01

    Extensive exposure of solar ultraviolet-B (UVB) radiation to skin induces oxidative stress and inflammation that play a crucial role in the induction of skin cancer. Photochemoprevention with natural products represents a simple but very effective strategy for the management of cutaneous neoplasia. In this study, we investigated whether blackberry extract (BBE) reduces chronic inflammatory responses induced by UVB irradiation in SKH-1 hairless mice skin. Mice were exposed to UVB radiation (100 mJ/cm{sup 2}) on alternate days for 10 weeks, and BBE (10% and 20%) was applied topically a day before UVB exposure. Our results show that BBE suppressed UVB-induced hyperplasia and reduced infiltration of inflammatory cells in the SKH-1 hairless mice skin. BBE treatment reduced glutathione (GSH) depletion, lipid peroxidation (LPO), and myeloperoxidase (MPO) in mouse skin by chronic UVB exposure. BBE significantly decreased the level of pro-inflammatory cytokines IL-6 and TNF-α in UVB-exposed skin. Likewise, UVB-induced inflammatory responses were diminished by BBE as observed by a remarkable reduction in the levels of phosphorylated MAP Kinases, Erk1/2, p38, JNK1/2 and MKK4. Furthermore, BBE also reduced inflammatory mediators such as cyclooxygenase-2 (COX-2), prostaglandin E{sub 2} (PGE{sub 2}), and inducible nitric oxide synthase (iNOS) levels in UVB-exposed skin. Treatment with BBE inhibited UVB-induced nuclear translocation of NF-κB and degradation of IκBα in mouse skin. Immunohistochemistry analysis revealed that topical application of BBE inhibited the expression of 8-oxo-7, 8-dihydro-2′-deoxyguanosine (8-oxodG), cyclobutane pyrimidine dimers (CPD), proliferating cell nuclear antigen (PCNA), and cyclin D1 in UVB-exposed skin. Collectively, these data indicate that BBE protects from UVB-induced oxidative damage and inflammation by modulating MAP kinase and NF-κB signaling pathways. - Highlights: • Blackberry extract inhibits UVB-induced glutathione depletion.

  1. The role of EGFR/ERK/ELK-1 MAP kinase pathway in the underlying damage to diabetic rat skin

    Directory of Open Access Journals (Sweden)

    Xinhong Ge

    2013-01-01

    Full Text Available Background: Diabetes mellitus (DM is a highly prevalent disease. Atrophy and spontaneous ulcers are the most common cutaneous manifestation of diabetic dermopathy (DD. Before spontaneous ulcers, we believe there is an underlying damage stage although the mechanism is unknown. Aims: To explore the expression of extracellular signal-regulated kinase1/2 (ERK1/2, its correlated upstream protein epidermal growth factor receptor (EGFR and its downstream transcription factor E twenty-six (ETS-like 1(ELK-1in the damage of the diabetic rat skin, and to explore the role of ERK1/2 on the recessive damage to diabetic rat skin. Materials and Methods: Eighty Sprague-Dawley (SD rats weighing 260-300 g were randomly divided into control and streptozotocin (STZ-induced diabetes groups. After 0.5, 2, 4, and 8 weeks, the shaved skin specimens from the back of rats in both groups were collected to observe the histological characteristics of the skin, to measure the thickness of the epidermis and the dermis, and to observe the ultrastructure. Immunohistochemistry (IHC and Western blot techniques were used to detect the expression and activation of ERK1/2, EGFR, ELK-1 in the skin of the rats. Results: There are ultrastructural changes in the DM skin. With the continuance of the diabetes course, the thicknesses of the epidermis and dermis decreased, and the expression of phospho-ERK1/2 (P-ERK1/2, EGFR, and ELK-1 was decreased gradually in the back skin of the diabetes rats. It was significantly lower in 4 and 8 week DM than that of the normal control ( P < 0.05. The expression of P-EGFR and P-ERK1/2 in the back skin of the diabetes rats was positively correlated ( r = 0.572 P < 0.05, and the positive correlation was also obtained between P-ERK1/2 and P-ELK-1 ( r = 0.715, P < 0.05. Conclusion: The phenomenon of recessive damage exists in the skin of diabetes rats, which probably may relate to the weakness of the signal transduction: P-EGFR → ERK1/2 → ELK-1.

  2. Activation of brain B-Raf protein kinase by Rap1B small GTP-binding protein.

    Science.gov (United States)

    Ohtsuka, T; Shimizu, K; Yamamori, B; Kuroda, S; Takai, Y

    1996-01-19

    Rap1 small GTP-binding protein has the same amino acid sequence at its effector domain as that of Ras. Rap1 has been shown to antagonize the Ras functions, such as the Ras-induced transformation of NIH 3T3 cells and the Ras-induced activation of the c-Raf-1 protein kinase-dependent mitogen-activated protein (MAP) kinase cascade in Rat-1 cells, whereas we have shown that Rap1 as well as Ras stimulates DNA synthesis in Swiss 3T3 cells. We have established a cell-free assay system in which Ras activates bovine brain B-Raf protein kinase. Here we have used this assay system and examined the effect of Rap1 on the B-Raf activity to phosphorylate recombinant MAP kinase kinase (MEK). Recombinant Rap1B stimulated the activity of B-Raf, which was partially purified from bovine brain and immunoprecipitated by an anti-B-Raf antibody. The GTP-bound form was active, but the GDP-bound form was inactive. The fully post-translationally lipid-modified form was active, but the unmodified form was nearly inactive. The maximum B-Raf activity stimulated by Rap1B was nearly the same as that stimulated by Ki-Ras. Rap1B enhanced the Ki-Ras-stimulated B-Raf activity in an additive manner. These results indicate that not only Ras but also Rap1 is involved in the activation of the B-Raf-dependent MAP kinase cascade.

  3. Raf kinase inhibitory protein: a signal transduction modulator and metastasis suppressor

    Institute of Scientific and Technical Information of China (English)

    Alexey E Granovsky; Marsha Rich Rosner

    2008-01-01

    Cells have a multitude of controls to maintain their integrity and prevent random switching from one biological state to another. Raf Kinase Inhibitory Protein (RKIP), a member of the phosphatidylethanolamine binding protein (PEBP) family, is representative of a new class of modulators of signaling cascades that function to maintain the "yin yang" or balance of biological systems. RKIP inhibits MAP kinase (Raf-MEK-ERK), G protein-coupled receptor (GPCR) kinase and NFkB signaling cascades. Because RKIP targets different kinases dependent upon its state of phosphorylation, RKIP also acts to integrate crosstalk initiated by multiple environmental stimuli. Loss or depletion of RKIP results in disruption of the normal cellular stasis and can lead to chromosomal abnormalities and disease states such as cancer. Since RKIP and the PEBP family have been reviewed previously, the goal of this analysis is to provide an update and highlight some of the unique features of RKIP that make it a critical player in the regulation of cellular signaling processes.

  4. Signaling Cascades: Consequences of Varying Substrate and Phosphatase Levels

    DEFF Research Database (Denmark)

    Feliu, Elisenda; Knudsen, Michael; Wiuf, Carsten Henrik

    2012-01-01

    We study signaling cascades with an arbitrary number of layers of one-site phosphorylation cycles. Such cascades are abundant in nature and integrated parts of many pathways. Based on the Michaelis-Menten model of enzyme kinetics and the law of mass-action, we derive explicit analytic expressions...... for how the steady state concentrations and the total amounts of substrates, kinase, and phosphatates depend on each other. In particular, we use these to study how the responses (the activated substrates) vary as a function of the available amounts of substrates, kinase, and phosphatases. Our results...

  5. Protein kinases mediate increment of the phosphorylation of cyclic AMP -responsive element binding protein in spinal cord of rats following capsaicin injection

    Directory of Open Access Journals (Sweden)

    Li Junfa

    2005-09-01

    Full Text Available Abstract Background Strong noxious stimuli cause plastic changes in spinal nociceptive neurons. Intracellular signal transduction pathways from cellular membrane to nucleus, which may further regulate gene expression by critical transcription factors, convey peripheral stimulation. Cyclic AMP-responsive element binding protein (CREB is a well-characterized stimulus-induced transcription factor whose activation requires phosphorylation of the Serine-133 residue. Phospho-CREB can further induce gene transcription and strengthen synaptic transmission by the activation of the protein kinase cascades. However, little is known about the mechanisms by which CREB phosphorylation is regulated by protein kinases during nociception. This study was designed to use Western blot analysis to investigate the role of mitogen-activated protein (MAP/extracellular signal-regulated kinase (ERK kinase (MEK 1/2, PKA and PKC in regulating the phosphorylation of CREB in the spinal cord of rats following intraplantar capsaicin injection. Results We found that capsaicin injection significantly increased the phosphorylation level of CREB in the ipsilateral side of the spinal cord. Pharmacological manipulation of MEK 1/2, PKA and PKC with their inhibitors (U0126, H89 and NPC 15473, respectively significantly blocked this increment of CREB phosphorylation. However, the expression of CREB itself showed no change in any group. Conclusion These findings suggest that the activation of intracellular MAP kinase, PKA and PKC cascades may contribute to the regulation of phospho-CREB in central nociceptive neurons following peripheral painful stimuli.

  6. Suppression of Heregulin-β1/HER2-Modulated Invasive and Aggressive Phenotype of Breast Carcinoma by Pterostilbene via Inhibition of Matrix Metalloproteinase-9, p38 Kinase Cascade and Akt Activation

    Directory of Open Access Journals (Sweden)

    Min-Hsiung Pan

    2011-01-01

    Full Text Available Invasive breast cancer is the major cause of death among females and its incidence is closely linked to HER2 (human epidermal growth factor receptor 2 overexpression. Pterostilbene, a natural analog of resveratrol, exerts its cancer chemopreventive activity similar to resveratrol by inhibiting cancer cell proliferation and inducing apoptosis. However, the anti-invasive effect of pterostilbene on HER2-bearing breast cancer has not been evaluated. Here, we used heregulin-β1 (HRG-β1, a ligand for HER3, to transactivate HER2 signaling. We found that pterostilbene was able to suppress HRG-β1-mediated cell invasion, motility and cell transformation of MCF-7 human breast carcinoma through down-regulation of matrix metalloproteinase-9 (MMP-9 activity and growth inhibition. In parallel, pterostilbene also inhibited protein and mRNA expression of MMP-9 driven by HRG-β1, suggesting that pterostilbene decreased HRG-β1-mediated MMP-9 induction via transcriptional regulation. Examining the signaling pathways responsible for HRG-β1-associated MMP-9 induction and growth inhibition, we observed that pterostilbene, as well as SB203580 (p38 kinase inhibitor, can abolish the phosphorylation of p38 mitogen-activated protein kinase (p38 kinase, a downstream HRG-β1-responsive kinase responsible for MMP-9 induction. In addition, HRG-β1-driven Akt phosphorylation required for cell proliferation was also suppressed by pterostilbene. Taken together, our present results suggest that pterostilbene may serve as a chemopreventive agent to inhibit HRG-β1/HER2-mediated aggressive and invasive phenotype of breast carcinoma through down-regulation of MMP-9, p38 kinase and Akt activation.

  7. Are free energy calculations useful in practice? A comparison with rapid scoring functions for the p38 MAP kinase protein system.

    Science.gov (United States)

    Pearlman, D A; Charifson, P S

    2001-10-11

    Precise thermodynamic integration free energy simulations have been applied to a congeneric series of 16 inhibitors to the p38 MAP kinase protein for which the experimental binding data (IC(50)) is known. The relative free energy of binding for each compound has been determined. For comparison, the same series of compounds have also scored using the best rapid scoring functions used in database screening. From the results of these calculations, we find (1) that precise free energy simulations allow predictions that are reliable and in good agreement with experiment; (2) that predictions of lower reliability, but still in good qualitative agreement with experiment, can be obtained using the OWFEG free energy grid method, at a much lower computational cost; (3) and that other methods, not based on free energy simulations yield results in much poorer agreement with experiment. A new predictive index, which measures the reliability of a prediction method in the context of normal use, is defined and calculated for each scoring method. Predictive indices of 0.84, 0.56, 0.04, -0.05, and 0.25 are calculated for thermodynamic integration, OWFEG, ChemScore, PLPScore, and Dock Energy Score, respectively, where +1.0 is perfect correct prediction, -1.0 is perfect incorrect prediction, and 0.0 is random.

  8. Cascade quantum teleportation

    Institute of Scientific and Technical Information of China (English)

    ZHOU Nan-run; GONG Li-hua; LIU Ye

    2006-01-01

    In this letter a cascade quantum teleportation scheme is proposed. The proposed scheme needs less local quantum operations than those of quantum multi-teleportation. A quantum teleportation scheme based on entanglement swapping is presented and compared with the cascade quantum teleportation scheme. Those two schemes can effectively teleport quantum information and extend the distance of quantum communication.

  9. The TAK1-JNK cascade is required for IRF3 function in the innate immune response

    Institute of Scientific and Technical Information of China (English)

    Bianhong Zhang; Meng Li; Liang Chen; Kai Yang; Yufei Shan; Lianhui Zhu; Shaogang Sun; Lin Li; Chen Wang

    2009-01-01

    Interferon regulatory factor (IRF)3 is critical for the transcriptional induction of chemokines and cytokines during viral or bacterial invasion. The kinases Tank binding kinase (TBK)1 and Ikappa B kinase (IKK)ε can phosphorylate the C-terminal part of IRF3 and play important roles in IRF3 activation. In this study, we show that another kinase, c-Jun-NH2-terminal kinase (JNK), phosphorylates IRF3 on its N-terminal serine 173 residue, and TAK1 can stimulate IRF3 phosphorylation via JNK. JNK specific inhibitor SP600125 inhibits the N-terminal phosphorylation without affecting the C-terminal phosphorylation. In addition, IRF3-mediated gene expressions on lipopolysaccharide (LPS) or polyinosinic-cytidylic acid (polyI:C) treatment are severely impaired by SP600125, as well as for reporter gene assay of IRF3 activation. Knockdown of TAK1 further confirmed these observations. Interestingly, constitutive active IRF3(5D) can be inhibited by SP600125; JNK1 can synergize the action of IRF3(5D), but not the S173A-IRF3(5D) mutant. More importantly, polyI:C failed to induce the phosphorylation of mutant S173A and SP600125 dramatically abrogated IRF3 phosphorylation and dimerization that was stimulated by polyI:C. Thus, this study demonstrates that the TAK1-JNK cascade is required for IRF3 function, in addition to TBK1/IKKε, uncovering a new mechanism for mitogen-activated protein (MAP) kinase to regulate the innate immunity.

  10. Cascade vulnerability for risk analysis of water infrastructure.

    Science.gov (United States)

    Sitzenfrei, R; Mair, M; Möderl, M; Rauch, W

    2011-01-01

    One of the major tasks in urban water management is failure-free operation for at least most of the time. Accordingly, the reliability of the network systems in urban water management has a crucial role. The failure of a component in these systems impacts potable water distribution and urban drainage. Therefore, water distribution and urban drainage systems are categorized as critical infrastructure. Vulnerability is the degree to which a system is likely to experience harm induced by perturbation or stress. However, for risk assessment, we usually assume that events and failures are singular and independent, i.e. several simultaneous events and cascading events are unconsidered. Although failures can be causally linked, a simultaneous consideration in risk analysis is hardly considered. To close this gap, this work introduces the term cascade vulnerability for water infrastructure. Cascade vulnerability accounts for cascading and simultaneous events. Following this definition, cascade risk maps are a merger of hazard and cascade vulnerability maps. In this work cascade vulnerability maps for water distribution systems and urban drainage systems based on the 'Achilles-Approach' are introduced and discussed. It is shown, that neglecting cascading effects results in significant underestimation of risk scenarios.

  11. The AngFus3 Mitogen-Activated Protein Kinase Controls Hyphal Differentiation and Secondary Metabolism in Aspergillus niger.

    Science.gov (United States)

    Priegnitz, Bert-Ewald; Brandt, Ulrike; Pahirulzaman, Khomaizon A K; Dickschat, Jeroen S; Fleißner, André

    2015-06-01

    Adaptation to a changing environment is essential for the survival and propagation of sessile organisms, such as plants or fungi. Filamentous fungi commonly respond to a worsening of their growth conditions by differentiation of asexually or sexually produced spores. The formation of these specialized cell types is, however, also triggered as part of the general life cycle by hyphal age or density. Spores typically serve for dispersal and, therefore, translocation but can also act as resting states to endure times of scarcity. Eukaryotic differentiation in response to environmental and self-derived signals is commonly mediated by three-tiered mitogen-activated protein (MAP) kinase signaling cascades. Here, we report that the MAP kinase Fus3 of the black mold Aspergillus niger (AngFus3) and its upstream kinase AngSte7 control vegetative spore formation and secondary metabolism. Mutants lacking these kinases are defective in conidium induction in response to hyphal density but are fully competent in starvation-induced sporulation, indicating that conidiation in A. niger is triggered by various independent signals. In addition, the mutants exhibit an altered profile of volatile metabolites and secrete dark pigments into the growth medium, suggesting a dysregulation of the secondary metabolism. By assigning the AngFus3 MAP kinase pathway to the transduction of a potentially self-derived trigger, this work contributes to the unraveling of the intricate signaling networks controlling fungal differentiation. Moreover, our data further support earlier observations that differentiation and secondary metabolism are tightly linked in filamentous fungi.

  12. Phosphatidylinositol 3-kinase in myogenesis.

    Science.gov (United States)

    Kaliman, P; Zorzano, A

    1997-08-01

    Phosphatidylinositol 3-kinase (PI 3-kinase) has been cloned and characterized in a wide range of organisms. PI 3-kinases are activated by a diversity of extracellular stimuli and are involved in multiple cell processes such as cell proliferation, protein trafficking, cell motility, differentiation, regulation of cytoskeletal structure, and apoptosis. It has recently been shown that PI 3-kinase is a crucial second messenger in the signaling of myogenesis. Two structurally unrelated highly specific inhibitors of PI 3-kinase-wortmannin and LY294002-block the morphological and biochemical differentiation program of different skeletal-muscle cell models. Moreover, L6E9 myoblasts overexpressing a dominant-negative mutant of PI 3-kinase p85 regulatory subunit (Δp85) are unable to differentiate. Furthermore, PI 3-kinase is specifically involved in the insulinlike growth factor (IGF)-dependent myogenic pathway. Indeed, the ability of IGF-I, des-1,3-IGF-I, and IGF-II to promote cell fusion and muscle-specific protein expression is impaired after treatment with PI 3-kinase inhibitors or in cells overexpressing Δp85. The identification of additional key downstream elements of the IGF/PI 3-kinase myogenic cascade is crucial to a detailed understanding of the process of muscle differentiation and may generate new tools for skeletal and cardiac muscle regeneration therapies. (Trends Cardiovasc Med 1997;7:198-202). © 1997, Elsevier Science Inc.

  13. Acquisition of contextual discrimination involves the appearance of a RAS-GRF1/p38 mitogen-activated protein (MAP) kinase-mediated signaling pathway that promotes long term potentiation (LTP).

    Science.gov (United States)

    Jin, Shan-Xue; Arai, Junko; Tian, Xuejun; Kumar-Singh, Rajendra; Feig, Larry A

    2013-07-26

    RAS-GRF1 is a guanine nucleotide exchange factor with the ability to activate RAS and RAC GTPases in response to elevated calcium levels. We previously showed that beginning at 1 month of age, RAS-GRF1 mediates NMDA-type glutamate receptor (NMDAR)-induction of long term depression in the CA1 region of the hippocampus of mice. Here we show that beginning at 2 months of age, when mice first acquire the ability to discriminate between closely related contexts, RAS-GRF1 begins to contribute to the induction of long term potentiation (LTP) in the CA1 hippocampus by mediating the action of calcium-permeable, AMPA-type glutamate receptors (CP-AMPARs). Surprisingly, LTP induction by CP-AMPARs through RAS-GRF1 occurs via activation of p38 MAP kinase rather than ERK MAP kinase, which has more frequently been linked to LTP. Moreover, contextual discrimination is blocked by knockdown of Ras-Grf1 expression specifically in the CA1 hippocampus, infusion of a p38 MAP kinase inhibitor into the CA1 hippocampus, or the injection of an inhibitor of CP-AMPARs. These findings implicate the CA1 hippocampus in the developmentally dependent capacity to distinguish closely related contexts through the appearance of a novel LTP-supporting signaling pathway.

  14. Effects of interleukins 2 and 12 on TBT-induced alterations of MAP kinases p38 and p44/42 in human natural killer cells.

    Science.gov (United States)

    Aluoch, Aloice O; Whalen, Margaret M

    2006-01-01

    NK cells are lymphocytes in the non-adaptive immune system that protect the body against intracellular pathogens and eliminate tumor cells. Tributyltin (TBT) is a toxic chemical that has been detected in human foods as well as in human blood. The role of TBT in immunosuppression has been described, including inhibition of the human NK-cell cytotoxic function. Previous studies indicated that exposure of NK cells to TBT for 1 h induced progressive and irreversible inhibition of cytotoxic function. However, it was found that if NK cells were incubated in TBT-free media with either IL-2 or IL-12, loss of cytotoxic function was prevented/reversed within 24 h. Molecular studies established that loss of cytotoxic function is accompanied by alteration of MAP kinases (MAPKs) p38 and p44/42 phosphorylation. This study examined whether interleukin-mediated recovery of cytotoxicity involved reversal of tributyltin-altered p38 and p44/42 phosphorylation. The results indicated that there was no substantial IL-2 prevention/reversal of the TBT-induced alteration of phosphorylation of either p38 or p44/42 after either a 24 or 48 h recovery period. Additionally, IL-12 caused no substantial prevention/reversal of the TBT-induced alteration of phosphorylation of the MAPKs seen after either 24 or 48 h. These data suggest that IL-2 and/or IL-12-mediated recovery of NK cytotoxic function is not a result of prevention/reversal of TBT-induced phosphorylation of p38 and p44/42 MAPKs at the 24 or 48 h time points.

  15. Inhibition of lipid phosphate phosphatase activity by VPC32183 suppresses the ability of diacylglycerol pyrophosphate to activate ERK(1/2) MAP kinases.

    Science.gov (United States)

    Violet, Pierre-Christian; Billon-Denis, Emmanuelle; Robin, Philippe

    2012-11-01

    The lipidic metabolite, diacylglycerol pyrophosphate (DGPP), in its dioctanoyl form (DGPP 8:0), has been described as an antagonist for mammalian lysophosphatidic acid (LPA) receptors LPA1 and LPA3. In this study we show that DGPP 8:0 does not antagonize LPA dependent activation of ERK(1/2) MAP kinases but strongly stimulated them in various mammalian cell lines. LPA and DGPP 8:0 stimulation of ERK(1/2) occurred through different pathways. The DGPP 8:0 effect appeared to be dependent on PKC, Raf and MEK but was insensitive to pertussis toxin and did not involve G protein activation. Finally we showed that DGPP 8:0 effect on ERK(1/2) was dependent on its dephosphorylation by a phosphatase activity sharing lipid phosphate phosphatase properties. The inhibition of this phosphatase activity by VPC32183, a previously characterized LPA receptor antagonist, blocked the DGPP 8:0 effect on ERK(1/2) activation. Moreover, down-regulation of lipid phosphate phosphatase 1 (LPP1) expression by RNA interference technique also reduced DGPP 8:0-induced ERK(1/2) activation. Consistently, over expression of LPP1 in HEK293 cells increases DGPP 8:0 hydrolysis and this increased activity was inhibited by VPC32183. In conclusion, DGPP 8:0 does not exert its effect by acting on a G protein coupled receptor, but through its dephosphorylation by LPP1, generating dioctanoyl phosphatidic acid which in turn activates PKC. These results suggest that LPP1 could have a positive regulatory function on cellular signaling processes such as ERK(1/2) activation.

  16. Extracellular regulated kinase phosphorylates mitofusin 1 to control mitochondrial morphology and apoptosis.

    Science.gov (United States)

    Pyakurel, Aswin; Savoia, Claudia; Hess, Daniel; Scorrano, Luca

    2015-04-16

    Controlled changes in mitochondrial morphology participate in cellular signaling cascades. However, the molecular mechanisms modifying mitochondrial shape are largely unknown. Here we show that the mitogen-activated protein (MAP) kinase cascade member extracellular-signal-regulated kinase (ERK) phosphorylates the pro-fusion protein mitofusin (MFN) 1, modulating its participation in apoptosis and mitochondrial fusion. Phosphoproteomic and biochemical analyses revealed that MFN1 is phosphorylated at an atypical ERK site in its heptad repeat (HR) 1 domain. This site proved essential to mediate MFN1-dependent mitochondrial elongation and apoptosis regulation by the MEK/ERK cascade. A mutant mimicking constitutive MFN1 phosphorylation was less efficient in oligomerizing and mitochondria tethering but bound more avidly to the proapoptotic BCL-2 family member BAK, facilitating its activation and cell death. Moreover, neuronal apoptosis following oxygen glucose deprivation and MEK/ERK activation required an intact MFN1(T562). Our data identify MFN1 as an ERK target to modulate mitochondrial shape and apoptosis.

  17. Extracellular Regulated Kinase Phosphorylates Mitofusin 1 to Control Mitochondrial Morphology and Apoptosis

    Science.gov (United States)

    Pyakurel, Aswin; Savoia, Claudia; Hess, Daniel; Scorrano, Luca

    2015-01-01

    Summary Controlled changes in mitochondrial morphology participate in cellular signaling cascades. However, the molecular mechanisms modifying mitochondrial shape are largely unknown. Here we show that the mitogen-activated protein (MAP) kinase cascade member extracellular-signal-regulated kinase (ERK) phosphorylates the pro-fusion protein mitofusin (MFN) 1, modulating its participation in apoptosis and mitochondrial fusion. Phosphoproteomic and biochemical analyses revealed that MFN1 is phosphorylated at an atypical ERK site in its heptad repeat (HR) 1 domain. This site proved essential to mediate MFN1-dependent mitochondrial elongation and apoptosis regulation by the MEK/ERK cascade. A mutant mimicking constitutive MFN1 phosphorylation was less efficient in oligomerizing and mitochondria tethering but bound more avidly to the proapoptotic BCL-2 family member BAK, facilitating its activation and cell death. Moreover, neuronal apoptosis following oxygen glucose deprivation and MEK/ERK activation required an intact MFN1T562. Our data identify MFN1 as an ERK target to modulate mitochondrial shape and apoptosis. PMID:25801171

  18. The MAP kinase-encoding gene MgFus3 of the non-appressorium phytopathogen Mycosphaerella graminicola is required for penetration and in vitro pycnidia formation

    NARCIS (Netherlands)

    Cousin, A.; Mehrabi, R.; Guilleroux, M.; Dufresne, M.; Lee, van der T.A.J.; Waalwijk, C.; Langin, T.; Kema, G.H.J.

    2006-01-01

    In eukaryotes, a family of serine/threonine protein kinases known as mitogen-activated protein kinases (MAPKs) is involved in the transduction of a variety of extracellular signals and in the regulation of growth and development. We identified a MAPK-encoding gene in Mycosphaerella graminicola

  19. Phosphorylation of ERK/MAP Kinase Is Required for Long-Term Potentiation in Anatomically Restricted Regions of the Lateral Amygdala in Vivo

    Science.gov (United States)

    Schafe, Glenn E.; Swank, Michael W.; Rodriguez, Sarina M.; Debiec, Jacek; Doyere, Valerie

    2008-01-01

    We have previously shown that the extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/ MAPK) is transiently activated in anatomically restricted regions of the lateral amygdala (LA) following Pavlovian fear conditioning and that blockade of ERK/MAPK activation in the LA impairs both fear memory consolidation and long-term…

  20. Geothermal research, Oregon Cascades: Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    Priest, G.R.; Black, G.L.

    1988-10-27

    Previous USDOE-funded geothermal studies have produced an extensive temperature gradient and heat flow data base for the State of Oregon. One of the important features identified as a result of these studies is a rapid transition from heat flow values on the order of 40 mW/m/sup 2/ in the Willamette Valley and Western Cascades to values of greater than or equal to100 mW/m/sup 2/ in the High Cascades and the eastern portion of the Western Cascades. These data indicate that the Cascade Range in Oregon has potential as a major geothermal province and stimulated much of the later work completed by government agencies and private industry. Additional data generated as a result of this grant and published in DOGAMI Open-File Report 0-86-2 further define the location and magnitude of this transition zone. In addition, abundant data collected from the vicinity of Breitenbush and Austin Hot Springs have permitted the formulation of relatively detailed models of these hydrothermal systems. These models are published in DOGAMI Open-File Report 0-88-5. Task 1.2 of the Deliverables section of Amendment M001 is fulfilled by DOGAMI publication GMS-48, Geologic map of the McKenzie Bridge quadrangle, Lane County, Oregon. This map was printed in October, 1988, and is part of the final submission to USDOE. 8 refs.

  1. A role for the circadian clock protein Per1 in the regulation of the NaCl co-transporter (NCC) and the with-no-lysine kinase (WNK) cascade in mouse distal convoluted tubule cells.

    Science.gov (United States)

    Richards, Jacob; Ko, Benjamin; All, Sean; Cheng, Kit-Yan; Hoover, Robert S; Gumz, Michelle L

    2014-04-25

    It has been well established that blood pressure and renal function undergo circadian fluctuations. We have demonstrated that the circadian protein Per1 regulates multiple genes involved in sodium transport in the collecting duct of the kidney. However, the role of Per1 in other parts of the nephron has not been investigated. The distal convoluted tubule (DCT) plays a critical role in renal sodium reabsorption. Sodium is reabsorbed in this segment through the actions of the NaCl co-transporter (NCC), which is regulated by the with-no-lysine kinases (WNKs). The goal of this study was to test if Per1 regulates sodium transport in the DCT through modulation of NCC and the WNK kinases, WNK1 and WNK4. Pharmacological blockade of nuclear Per1 entry resulted in decreased mRNA expression of NCC and WNK1 but increased expression of WNK4 in the renal cortex of mice. These findings were confirmed by using Per1 siRNA and pharmacological blockade of Per1 nuclear entry in mDCT15 cells, a model of the mouse distal convoluted tubule. Transcriptional regulation was demonstrated by changes in short lived heterogeneous nuclear RNA. Chromatin immunoprecipitation experiments demonstrated interaction of Per1 and CLOCK with the promoters of NCC, WNK1, and WNK4. This interaction was modulated by blockade of Per1 nuclear entry. Importantly, NCC protein expression and NCC activity, as measured by thiazide-sensitive, chloride-dependent (22)Na uptake, were decreased upon pharmacological inhibition of Per1 nuclear entry. Taken together, these data demonstrate a role for Per1 in the transcriptional regulation of NCC, WNK1, and WNK4.

  2. A Role for the Circadian Clock Protein Per1 in the Regulation of the NaCl Co-transporter (NCC) and the with-no-lysine Kinase (WNK) Cascade in Mouse Distal Convoluted Tubule Cells*

    Science.gov (United States)

    Richards, Jacob; Ko, Benjamin; All, Sean; Cheng, Kit-Yan; Hoover, Robert S.; Gumz, Michelle L.

    2014-01-01

    It has been well established that blood pressure and renal function undergo circadian fluctuations. We have demonstrated that the circadian protein Per1 regulates multiple genes involved in sodium transport in the collecting duct of the kidney. However, the role of Per1 in other parts of the nephron has not been investigated. The distal convoluted tubule (DCT) plays a critical role in renal sodium reabsorption. Sodium is reabsorbed in this segment through the actions of the NaCl co-transporter (NCC), which is regulated by the with-no-lysine kinases (WNKs). The goal of this study was to test if Per1 regulates sodium transport in the DCT through modulation of NCC and the WNK kinases, WNK1 and WNK4. Pharmacological blockade of nuclear Per1 entry resulted in decreased mRNA expression of NCC and WNK1 but increased expression of WNK4 in the renal cortex of mice. These findings were confirmed by using Per1 siRNA and pharmacological blockade of Per1 nuclear entry in mDCT15 cells, a model of the mouse distal convoluted tubule. Transcriptional regulation was demonstrated by changes in short lived heterogeneous nuclear RNA. Chromatin immunoprecipitation experiments demonstrated interaction of Per1 and CLOCK with the promoters of NCC, WNK1, and WNK4. This interaction was modulated by blockade of Per1 nuclear entry. Importantly, NCC protein expression and NCC activity, as measured by thiazide-sensitive, chloride-dependent 22Na uptake, were decreased upon pharmacological inhibition of Per1 nuclear entry. Taken together, these data demonstrate a role for Per1 in the transcriptional regulation of NCC, WNK1, and WNK4. PMID:24610784

  3. Mapping of the ATP-binding domain of human fructosamine 3-kinase-related protein by affinity labelling with 5'-[p-(fluorosulfonyl)benzoyl]adenosine.

    Science.gov (United States)

    Payne, Leo S; Brown, Peter M; Middleditch, Martin; Baker, Edward; Cooper, Garth J S; Loomes, Kerry M

    2008-12-01

    The modification of proteins by reducing sugars through the process of non-enzymatic glycation is one of the principal mechanisms by which hyperglycaemia may precipitate the development of diabetic complications. Fn3K (fructosamine 3-kinase) and Fn3KRP (Fn3K-related protein) are two recently discovered enzymes that may play roles in metabolizing early glycation products. However, although the activity of these enzymes towards various glycated substrates has been established, very little is known about their structure-function relationships or their respective mechanisms of action. Furthermore, their only structural similarities noted to date with members of other kinase families has been with the bacterial aminoglycoside kinases. In the present study, we employed affinity labelling with the ATP analogue FSBA {5'-p-[(fluorosulfonyl)benzoyl]adenosine} to probe the active-site topology of Fn3KRP as an example of this enigmatic family of kinases. FSBA was found to modify Fn3KRP at five distinct sites; four of these were predicted to be localized in close proximity to its ATP-binding site, based on alignments with the aminoglycoside kinase APH(3')-IIIa, and examination of its published tertiary structure. The results of the present studies provide evidence that Fn3KRP possesses an ATP-binding domain that is structurally related to that of both the aminoglycoside kinases and eukaryotic protein kinases.

  4. Mitogen-activated protein kinase pathways are required for melatonin-mediated defense responses in plants.

    Science.gov (United States)

    Lee, Hyoung Yool; Back, Kyoungwhan

    2016-04-01

    Melatonin enhances pathogen resistance by inducing the expression of a number of plant defense-related genes. To examine whether the melatonin-mediated pathogen resistance is associated with mitogen-activated protein kinase (MAPK) cascades, Arabidopsis and tobacco leaves were treated with melatonin and investigated for MAPK activation using an antiphospho-p44/42 MAPK (Erk1/2) monoclonal antibody. Two MAPKs, MPK3 and MPK6, were activated rapidly and transiently by 1 μm melatonin treatment in Arabidopsis. Its tobacco ortholog MAPKs were also activated. The activation of MPK3 and MPK6 by 2-hydroxymelatonin and N-acetylserotonin was also observed, albeit to a lesser degree than that by melatonin. Furthermore, MAPK activation by melatonin was uncoupled from G-protein signaling, because melatonin efficiently activated two MAPKs in a G-protein β knockout mutant (agb1). Suppression of both MPK3 and MPK6 in transgenic Arabidopsis exhibited significant decreases in the induction of defense-related gene expression and pathogen resistance relative to wild-type plants. Using an array of MAP kinase kinase (MKK) knockout mutants, we found that four MKKs, namely MKK4, MKK5, MKK7, and MKK9, are responsible for the activation of MPK3 and MPK6 by melatonin, indicating that melatonin-mediated innate immunity is triggered by MAPK signaling through MKK4/5/7/9-MPK3/6 cascades.

  5. Cascade Organic Solar Cells

    KAUST Repository

    Schlenker, Cody W.

    2011-09-27

    We demonstrate planar organic solar cells consisting of a series of complementary donor materials with cascading exciton energies, incorporated in the following structure: glass/indium-tin-oxide/donor cascade/C 60/bathocuproine/Al. Using a tetracene layer grown in a descending energy cascade on 5,6-diphenyl-tetracene and capped with 5,6,11,12-tetraphenyl- tetracene, where the accessibility of the π-system in each material is expected to influence the rate of parasitic carrier leakage and charge recombination at the donor/acceptor interface, we observe an increase in open circuit voltage (Voc) of approximately 40% (corresponding to a change of +200 mV) compared to that of a single tetracene donor. Little change is observed in other parameters such as fill factor and short circuit current density (FF = 0.50 ± 0.02 and Jsc = 2.55 ± 0.23 mA/cm2) compared to those of the control tetracene-C60 solar cells (FF = 0.54 ± 0.02 and Jsc = 2.86 ± 0.23 mA/cm2). We demonstrate that this cascade architecture is effective in reducing losses due to polaron pair recombination at donor-acceptor interfaces, while enhancing spectral coverage, resulting in a substantial increase in the power conversion efficiency for cascade organic photovoltaic cells compared to tetracene and pentacene based devices with a single donor layer. © 2011 American Chemical Society.

  6. Tobacco-specific Carcinogen 4-(Methylnitrosoamino)-1-(3-pyridyl )-1-butanone(NNK) Activating ERK1/2 MAP Kinases and Stimulating Proliferation of Hmnan Mammary Epithelial Cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Cigarette smoking is correlated with the development of various cancers. 4 - (Methylnitrosoamino) -1 - ( 3 -pyridyl) -1-butanone (NNK) is one of the major tobacco-specific carcinogens in the cigarette smoke, which increases the risk of breast cancer. In the present study, it was demonstrated that NNK rapidly activated ERK1 and ERK2 MAP kinases in human normal mammary epithelial cells. It was found that there are two different routes for the activation of ERK1/2with NNK. One is from nicotinic receptor nAchR to MEK1/2, and the other is from tyrosine kinase containing receptor to MEK1/2. The tobacco-specific carcinogen NNK shows a strong proliferative effect on normal human mammary epithelial cells and cancer mammary epithelial cells.

  7. Critical Mandelbrot Cascades

    Science.gov (United States)

    Barral, Julien; Kupiainen, Antti; Nikula, Miika; Saksman, Eero; Webb, Christian

    2014-01-01

    We study Mandelbrot's multiplicative cascade measures at the critical temperature. As has been recently shown by Barral et al. (C R Acad Sci Paris Ser I 350:535-538, 2012), an appropriately normalized sequence of cascade measures converges weakly in probability to a nontrivial limit measure. We prove that these limit measures have no atoms and give bounds for the modulus of continuity of the cumulative distribution function of the measure. Using the earlier work of Barral and Seuret (Adv Math 214:437-468, 2007), we compute the multifractal spectrum of the measures. We also extend the result of Benjamini and Schramm (Commun Math Phys 289:653-662, 2009), in which the KPZ formula from quantum gravity is validated for the high temperature cascade measures, to the critical and low temperature cases.

  8. In vivo Evaluation of Two Thiazolidin-4-one Derivatives in High Sucrose Diet Fed Pre-diabetic Mice and Their Modulatory Effect on AMPK, Akt and p38 MAP Kinase in L6 Cells

    Science.gov (United States)

    Mudgal, Jayesh; Shetty, Priya; Reddy, Neetinkumar D.; Akhila, H. S.; Gourishetti, Karthik; Mathew, Geetha; Nayak, Pawan G.; Kumar, Nitesh; Kishore, Anoop; Kutty, Nampurath G.; Nandakumar, Krishnadas; Shenoy, Rekha R.; Rao, Chamallamudi M.; Joseph, Alex

    2016-01-01

    We had previously demonstrated the anti-diabetic potential and pancreatic protection of two thiazolidin-4-one derivatives containing nicotinamide moiety (NAT-1 and NAT-2) in STZ-induced diabetic mice. However, due to the limitations of the STZ model, we decided to undertake a detailed evaluation of anti-diabetic potential of the molecules on a high sucrose diet (HSD) fed diabetic mouse model. Further, in vitro mechanistic studies on the phosphorylation of AMPK, Akt and p38 MAP kinase in L6 myotubes and anti-inflammatory studies in RAW264.7 mouse monocyte macrophage cells were performed. 15 months of HSD induced fasting hyperglycaemia and impaired glucose tolerance in mice. Treatment with NAT-1 and NAT-2 (100 mg/kg) for 45 days significantly improved the glucose tolerance and lowered fasting blood glucose levels compared to untreated control. An improvement in the elevated triglycerides and total cholesterol levels, and favorable rise in HDL cholesterol were also observed with test drug treatment. Also, no major changes were observed in the liver (albumin, AST and ALT) and kidney (creatinine and urea) parameters. This was further confirmed in their respective histology profiles which revealed no gross morphological changes. In L6 cells, significant phosphorylation of Akt and p38 MAP kinase proteins were observed with 100 μM of NAT-1 and NAT-2 with no significant changes in phosphorylation of AMPK. The molecules failed to exhibit anti-inflammatory activity as observed by their effect on the generation of ROS and nitrite, and nuclear levels of NF-κB in LPS-stimulated RAW264.7 cells. In summary, the molecules activated Akt and p38 MAP kinase which could have partly contributed to their anti-hyperglycaemic and hypolipidemic activities in vivo. PMID:27790148

  9. Plant MAPK cascades: Just rapid signaling modules?

    KAUST Repository

    Boudsocq, Marie

    2015-08-27

    © 2015 Taylor & Francis Group, LLC. Abscisic acid (ABA) is a major phytohormone mediating important stress-related processes. We recently unveiled an ABA-activated MAPK signaling module constituted of MAP3K17/18-MKK3-MPK1/2/7/14. Unlike classical rapid MAPK activation, we showed that the activation of the new MAPK module is delayed and relies on the MAP3K protein synthesis. In this addendum, we discuss the role of this original and unexpected activation mechanism of MAPK cascades which suggests that MAPKs can regulate both early and longterm plant stress responses.

  10. Cascaded Poisson processes

    Science.gov (United States)

    Matsuo, Kuniaki; Saleh, Bahaa E. A.; Teich, Malvin Carl

    1982-12-01

    We investigate the counting statistics for stationary and nonstationary cascaded Poisson processes. A simple equation is obtained for the variance-to-mean ratio in the limit of long counting times. Explicit expressions for the forward-recurrence and inter-event-time probability density functions are also obtained. The results are expected to be of use in a number of areas of physics.

  11. Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region.

    Science.gov (United States)

    Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L; Hood, Molly M; Lord, John W; Lu, Wei-Ping; Miller, David F; Patt, William C; Smith, Bryan D; Vogeti, Lakshminarayana; Kaufman, Michael D; Petillo, Peter A; Wise, Scott C; Abendroth, Jan; Chun, Lawrence; Clark, Robin; Feese, Michael; Kim, Hidong; Stewart, Lance; Flynn, Daniel L

    2010-10-01

    Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or the doubly phosphorylated form of p38-alpha kinase.

  12. Integrated Broadband Quantum Cascade Laser

    Science.gov (United States)

    Mansour, Kamjou (Inventor); Soibel, Alexander (Inventor)

    2016-01-01

    A broadband, integrated quantum cascade laser is disclosed, comprising ridge waveguide quantum cascade lasers formed by applying standard semiconductor process techniques to a monolithic structure of alternating layers of claddings and active region layers. The resulting ridge waveguide quantum cascade lasers may be individually controlled by independent voltage potentials, resulting in control of the overall spectrum of the integrated quantum cascade laser source. Other embodiments are described and claimed.

  13. Preventing Phosphorylation of Sterol Regulatory Element-Binding Protein 1a by MAP-Kinases Protects Mice from Fatty Liver and Visceral Obesity

    OpenAIRE

    Jorg Kotzka; Birgit Knebel; Jutta Haas; Lorena Kremer; Sylvia Jacob; Sonja Hartwig; Ulrike Nitzgen; Dirk Muller-Wieland

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress acti...

  14. A new cascadic multigrid

    Institute of Scientific and Technical Information of China (English)

    SHI; Zhongci

    2001-01-01

    [1]Bornemann, F., Deuflhard, P., The cascadic multigrid method for elliptic problems, Numer. Math., 996, 75: 35.[2]Bornemann, F., Deuflhard, P., The cascadic multigrid method, The Eighth International Conference on Domain Decomposition Methods for Partial Differential Equations (eds. Glowinski, R., Periaux, J., Shi, Z. et al.), New York: John Wiley and Sons, 997.[3]Bornemann, F., Krause, R., Classical and cascadic multigrid-methodogical comparison, Proceedings of the 9th International Conference on Domain Decomposition (eds. Bjorstad, P., Espedal, M., Keyes, D.), New York: John Wiley and Sons, 998.[4]Shaidurov, V., Some estimates of the rate of convergence for the cascadic conjugate gradient method, Comp. Math. Applic., 996, 3: 6.[5]Shi, Z., Xu, X., Cascadic multigrid method for the second order elliptic problem, East-West J. Numer. Math., 998, 6: 309.[6]Shi, Z., Xu, X., Cascadic multigrid for elliptic problems, East-West J. Numer. Math., 999, 7: 99.[7]Shi, Z., Xu, X., Cascadic multigrid method for the plate bending problem, East-West J. Numer. Math., 998, 6: 37.[8]Braess, D., Dahmen, W., A cascade multigrid algorithm for the Stokes equations, Number. Math., 999, 82: 79.[9]Shi, Z., Xu, X., Cascadic multigrid for parabolic problems, J. Comput. Math., 2000, 8: 450.[10]Ciarlet, P.,The Finite Element Method for Elliptic Problems, Amsterdam: North-Holland, 978.[11]Zienkiewicz, O. C., The Finite Element Method, 3rd. ed., London: McGraw-Hill, 977.[12]Powell, M. J. D., Sabin, M. A., Piecewise quadratic approximations on triangles, ACM Trans. Mat. Software, 977, 3: 36.[13]Xu, J., The auxiliary space method and optimal multigrid precondition techniques for unstructured grids, Computing, 996, 56: 25.[14]Bank, R., Dupont, T., An optimal order process for solving finite element equations, Math. Comput., 980, 36: 35.[15]Brenner, S., Convergence of nonconforming multigrid methods without full elliptic regularity, Math

  15. Ras-mutant cancer cells display B-Raf binding to Ras that activates extracellular signal-regulated kinase and is inhibited by protein kinase A phosphorylation.

    Science.gov (United States)

    Li, Yanping; Takahashi, Maho; Stork, Philip J S

    2013-09-20

    The small G protein Ras regulates proliferation through activation of the mitogen-activated protein (MAP) kinase (ERK) cascade. The first step of Ras-dependent activation of ERK signaling is Ras binding to members of the Raf family of MAP kinase kinase kinases, C-Raf and B-Raf. Recently, it has been reported that in melanoma cells harboring oncogenic Ras mutations, B-Raf does not bind to Ras and does not contribute to basal ERK activation. For other types of Ras-mutant tumors, the relative contributions of C-Raf and B-Raf are not known. We examined non-melanoma cancer cell lines containing oncogenic Ras mutations and express both C-Raf and B-Raf isoforms, including the lung cancer cell line H1299 cells. Both B-Raf and C-Raf were constitutively bound to oncogenic Ras and contributed to Ras-dependent ERK activation. Ras binding to B-Raf and C-Raf were both subject to inhibition by the cAMP-dependent protein kinase PKA. cAMP inhibited the growth of H1299 cells and Ras-dependent ERK activation via PKA. PKA inhibited the binding of Ras to both C-Raf and B-Raf through phosphorylations of C-Raf at Ser-259 and B-Raf at Ser-365, respectively. These studies demonstrate that in non-melanocytic Ras-mutant cancer cells, Ras signaling to B-Raf is a significant contributor to ERK activation and that the B-Raf pathway, like that of C-Raf, is a target for inhibition by PKA. We suggest that cAMP and hormones coupled to cAMP may prove useful in dampening the effects of oncogenic Ras in non-melanocytic cancer cells through PKA-dependent actions on B-Raf as well as C-Raf.

  16. Gene expression studies demonstrate that the K-ras/Erk MAP kinase signal transduction pathway and other novel pathways contribute to the pathogenesis of cumene-induced lung tumors.

    Science.gov (United States)

    Wakamatsu, Nobuko; Collins, Jennifer B; Parker, Joel S; Tessema, Mathewos; Clayton, Natasha P; Ton, Thai-Vu T; Hong, Hue-Hua L; Belinsky, Steven; Devereux, Theodora R; Sills, Robert C; Lahousse, Stephanie A

    2008-07-01

    National Toxicology Program (NTP) inhalation studies demonstrated that cumene significantly increased the incidence of alveolar/bronchiolar adenomas and carcinomas in B6C3F1 mice. Cumene or isopropylbenzene is a component of crude oil used primarily in the production of phenol and acetone. The authors performed global gene expression analysis to distinguish patterns of gene regulation between cumene-induced tumors and normal lung tissue and to look for patterns based on the presence or absence of K-ras and p53 mutations in the tumors. Principal component analysis segregated the carcinomas into groups with and without K-ras mutations, but failed to separate the tumors based on p53 mutation status. Expression of genes associated with the Erk MAP kinase signaling pathway was significantly altered in carcinomas with K-ras mutations compared to tumors without K-ras mutations or normal lung. Gene expression analysis also suggested that cumene-induced carcinomas with K-ras mutations have greater malignant potential than those without mutations. In addition, significance analysis of function and expression (SAFE) demonstrated expression changes of genes regulated by histone modification in carcinomas with K-ras mutations. The gene expression analysis suggested the formation of alveolar/bronchiolar carcinomas in cumene-exposed mice typically involves mutation of K-ras, which results in increased Erk MAP kinase signaling and modification of histones.

  17. Membrane androgen receptor characteristics of human ZIP9 (SLC39A) zinc transporter in prostate cancer cells: Androgen-specific activation and involvement of an inhibitory G protein in zinc and MAP kinase signaling.

    Science.gov (United States)

    Thomas, Peter; Pang, Yefei; Dong, Jing

    2017-05-15

    Characteristics of novel human membrane androgen receptor (mAR), ZIP9 (SLC39A9), were investigated in ZIP9-transfected PC-3 cells (PC3-ZIP9). Ligand blot analysis showed plasma membrane [(3)H]-T binding corresponds to the position of ZIP9 on Western blots which suggests ZIP9 can bind [(3)H]-T alone, without a protein partner. Progesterone antagonized testosterone actions, blocking increases in zinc, Erk phosphorylation and apoptosis, further evidence that ZIP9 is specifically activated by androgens. Pre-treatment with GTPγS and pertussis toxin decreased plasma membrane [(3)H]-T binding and blocked testosterone-induced increases in Erk phosphorylation and intracellular zinc, indicating ZIP9 is coupled to an inhibitory G protein (Gi) that mediates both MAP kinase and zinc signaling. Testosterone treatment of nuclei and mitochondria which express ZIP9 decreased their zinc contents, suggesting ZIP9 also regulates free zinc through releasing it from these intracellular organelles. The results show ZIP9 is a specific Gi coupled-mAR mediating testosterone-induced MAP kinase and zinc signaling in PC3-ZIP9 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Chromosomal mapping and mutational analysis of the coding region of the glycogen synthase kinase-3alpha and beta isoforms in patients with NIDDM

    DEFF Research Database (Denmark)

    Hansen, L; Arden, K C; Rasmussen, S B

    1997-01-01

    Activation of glycogen synthesis in skeletal muscle in response to insulin results from the combined inactivation of glycogen synthase kinase-3 (GSK-3) and activation of the protein phosphatase-1, changing the ratio between the inactive phosphorylated state of the glycogen synthase to the active ...

  19. Inhibitory Effects of KP-A159, a Thiazolopyridine Derivative, on Osteoclast Differentiation, Function, and Inflammatory Bone Loss via Suppression of RANKL-Induced MAP Kinase Signaling Pathway.

    Directory of Open Access Journals (Sweden)

    Hye Jung Ihn

    Full Text Available Abnormally elevated formation and activation of osteoclasts are primary causes for a majority of skeletal diseases. In this study, we found that KP-A159, a newly synthesized thiazolopyridine derivative, inhibited osteoclast differentiation and function in vitro, and inflammatory bone loss in vivo. KP-A159 did not cause a cytotoxic response in bone marrow macrophages (BMMs, but significantly inhibited the formation of multinucleated tartrate-resistant acid phosphatase (TRAP-positive osteoclasts induced by macrophage colony-stimulating factor (M-CSF and receptor activator of nuclear factor-κB ligand (RANKL. KP-A159 also dramatically inhibited the expression of marker genes related to osteoclast differentiation, including TRAP (Acp5, cathepsin K (Ctsk, dendritic cell-specific transmembrane protein (Dcstamp, matrix metallopeptidase 9 (Mmp9, and nuclear factor of activated T-cells, cytoplasmic 1 (Nfatc1. Moreover, actin ring and resorption pit formation were inhibited by KP-A159. Analysis of the signaling pathway involved showed that KP-A159 inhibited RANKL-induced activation of extracellular signal-regulated kinase (ERK, c-Jun N-terminal kinase (JNK, and mitogen-activated protein kinase kinase1/2 (MEK1/2. In a mouse inflammatory bone loss model, KP-A159 significantly rescued lipopolysaccharide (LPS-induced bone loss by suppressing osteoclast numbers. Therefore, KP-A159 targets osteoclasts, and may be a potential candidate compound for prevention and/or treatment of inflammatory bone loss.

  20. The NO-cGMP-PKG Signaling Pathway Regulates Synaptic Plasticity and Fear Memory Consolidation in the Lateral Amygdala via Activation of ERK/MAP Kinase

    Science.gov (United States)

    Ota, Kristie T.; Pierre, Vicki J.; Ploski, Jonathan E.; Queen, Kaila; Schafe, Glenn E.

    2008-01-01

    Recent studies have shown that nitric oxide (NO) signaling plays a crucial role in memory consolidation of Pavlovian fear conditioning and in synaptic plasticity in the lateral amygdala (LA). In the present experiments, we examined the role of the cGMP-dependent protein kinase (PKG), a downstream effector of NO, in fear memory consolidation and…

  1. Pseudomonas aeruginosa pyocyanin activates NRF2-ARE-mediated transcriptional response via the ROS-EGFR-PI3K-AKT/MEK-ERK MAP kinase signaling in pulmonary epithelial cells.

    Science.gov (United States)

    Xu, Ying; Duan, Chaohui; Kuang, Zhizhou; Hao, Yonghua; Jeffries, Jayme L; Lau, Gee W

    2013-01-01

    The redox-active pyocyanin (PCN) secreted by the respiratory pathogen Pseudomonas aeruginosa generates reactive oxygen species (ROS) and causes oxidative stress to pulmonary epithelial cells. Nuclear factor (erythroid-derived 2)-like 2 (NRF2) confers protection against ROS-mediated cell death by inducing the expression of detoxifying enzymes and proteins via its binding to the cis-acting antioxidant response element (ARE). However, a clear relationship between NRF2 and PCN-mediated oxidative stress has not been established experimentally. In this study, we investigated the induction of NRF2-ARE response by PCN in the pulmonary epithelial cells. We analyzed the effect of PCN on NRF2 expression and nuclear translocation in cultured human airway epithelial cells, and in a mouse model of chronic PCN exposure. NRF2-dependent transcription of antioxidative enzymes was also assessed. Furthermore, we used inhibitors to examine the involvement of EGFR and its downstream signaling components that mediate NRF2-ARE-activation in response to PCN. PCN enhances the nuclear NRF2 accumulation and activates the transcription of ARE-mediated antioxidant genes. Furthermore, PCN activates NRF2 by inducing the EGFR-phosphoinositide-3-kinase (PI3K) signaling pathway and its main downstream effectors, AKT and MEK1/2-ERK1/2 MAP kinases. Inhibition of the EGFR-PI3K signaling markedly attenuates PCN-stimulated NRF2 accumulation in the nucleus. We demonstrate for the first time that PCN-mediated oxidative stress activates the EGFR-PI3K-AKT/MEK1/2-ERK1/2 MAP kinase signaling pathway, leading to nuclear NRF2 translocation and ARE responsiveness in pulmonary epithelial cells.

  2. Information cascade on networks

    Science.gov (United States)

    Hisakado, Masato; Mori, Shintaro

    2016-05-01

    In this paper, we discuss a voting model by considering three different kinds of networks: a random graph, the Barabási-Albert (BA) model, and a fitness model. A voting model represents the way in which public perceptions are conveyed to voters. Our voting model is constructed by using two types of voters-herders and independents-and two candidates. Independents conduct voting based on their fundamental values; on the other hand, herders base their voting on the number of previous votes. Hence, herders vote for the majority candidates and obtain information relating to previous votes from their networks. We discuss the difference between the phases on which the networks depend. Two kinds of phase transitions, an information cascade transition and a super-normal transition, were identified. The first of these is a transition between a state in which most voters make the correct choices and a state in which most of them are wrong. The second is a transition of convergence speed. The information cascade transition prevails when herder effects are stronger than the super-normal transition. In the BA and fitness models, the critical point of the information cascade transition is the same as that of the random network model. However, the critical point of the super-normal transition disappears when these two models are used. In conclusion, the influence of networks is shown to only affect the convergence speed and not the information cascade transition. We are therefore able to conclude that the influence of hubs on voters' perceptions is limited.

  3. Sodium nitroprusside-induced mitochondrial apoptotic events in insulin-secreting RINm5F cells are associated with MAP kinases activation.

    Science.gov (United States)

    Bernabé, J C; Tejedo, J R; Rincón, P; Cahuana, G M; Ramírez, R; Sobrino, F; Bedoya, F J

    2001-10-01

    Exposure of insulin-secreting RINm5F cells to the chemical nitric oxide donor sodium nitroprusside (SNP) resulted in apoptotic cell death, as detected by cytochrome c release from mitochondria and caspase 3 activation. SNP exposure also leads to phosphorylation and activation of enzymes involved in cellular response to stress such as signal-regulated kinase 2 (ERK2) and c-Jun NH(2)-terminal kinase 46 (JNK46). Both cytochrome c release and caspase 3 activation were abrogated in cells exposed to MEK and p38 inhibitors. Treatment of cells with the NO donors SNP, DETA-NO, GEA 5024, and SNAP resulted in phosphorylation of the antiapoptotic protein Bcl-2, which was resistant to blockade of MEK, p38, and JNK pathways and sensitive to phosphoinositide 3-kinase (PI3K) inhibition. In addition, transient transfection of cells with the wild-type PI3K gamma gene mimics the increased rate of Bcl-2 phosphorylation detected in NO-treated cells. The generation of phosphoinositides seems to participate in the process since Bcl-2 phosphorylation was not observed in cells overexpressing lipid-kinase-deficient PI3Kgamma. The potential of SNP toxicity directly from NO was supported by our finding that the NO scavenger carboxy-PTIO prevented cell death. We found no evidence to support the contention that oxygen radicals generated during cellular SNP metabolism mediate cell toxicity in RINm5F cells, since neither addition of catalase/superoxide dismutase nor transfection with superoxide dismutase prevented SNP-induced cell death. Thus, we propose that exposure to apoptotic concentrations of NO triggers ERK- and p38-dependent cytochrome c release, caspase 3 activation, and PI3K-dependent Bcl-2 phosphorylation.

  4. The nucleotide receptor P2X7 mediates actin reorganization and membrane blebbing in RAW 264.7 macrophages via p38 MAP kinase and Rho.

    Science.gov (United States)

    Pfeiffer, Zachary A; Aga, Mini; Prabhu, Usha; Watters, Jyoti J; Hall, David J; Bertics, Paul J

    2004-06-01

    Extracellular nucleotides regulate macrophage function via P2X nucleotide receptors that form ligand-gated ion channels. In particular, P2X7 activation is characterized by pore formation, membrane blebbing, and cytokine release. P2X7 is also linked to mitogen-activated protein kinases (MAPK) and Rho-dependent pathways, which are known to affect cytoskeletal structure in other systems. As cytoskeletal function is critical for macrophage behavior, we have tested the importance of these pathways in actin filament reorganization during P2X7 stimulation in RAW 264.7 macrophages. We observed that the P2X7 agonists adenosine 5'-triphosphate (ATP) and 3'-O-(4-benzoylbenzoyl) ATP (BzATP) stimulated actin reorganization and concomitant membrane blebbing within 5 min. Disruption of actin filaments with cytochalasin D attenuated membrane blebbing but not P2X7-dependent pore formation or extracellular-regulated kinase (ERK)1/ERK2 and p38 activation, suggesting that these latter processes do not require intact actin filaments. However, we provide evidence that p38 MAPK and Rho activation but not ERK1/ERK2 activation is important for P2X7-mediated actin reorganization and membrane blebbing. First, activation of p38 and Rho was detected within 5 min of BzATP treatment, which is coincident with membrane blebbing. Second, the p38 inhibitors SB202190 and SB203580 reduced nucleotide-induced blebbing and actin reorganization, whereas the MAPK kinase-1/2 inhibitor U0126, which blocks ERK1/ERK2 activation, had no discernable effect. Third, the Rho-selective inhibitor C3 exoenzyme and the Rho effector kinase, Rho-associated coiled-coil kinase, inhibitor Y-27632, markedly attenuated BzATP-stimulated actin reorganization and membrane blebbing. These data support a model wherein p38- and Rho-dependent pathways are critical for P2X7-dependent actin reorganization and membrane blebbing, thereby facilitating P2X7 involvement in macrophage inflammatory responses.

  5. Resveratrol upregulates Egr-1 expression and activity involving extracellular signal-regulated protein kinase and ternary complex factors

    Energy Technology Data Exchange (ETDEWEB)

    Rössler, Oliver G.; Glatzel, Daniel; Thiel, Gerald, E-mail: gerald.thiel@uks.eu

    2015-03-01

    Many intracellular functions have been attributed to resveratrol, a polyphenolic phytoalexin found in grapes and in other plants. Here, we show that resveratrol induces the expression of the transcription factor Egr-1 in human embryonic kidney cells. Using a chromosomally embedded Egr-1-responsive reporter gene, we show that the Egr-1 activity was significantly elevated in resveratrol-treated cells, indicating that the newly synthesized Egr-1 protein was biologically active. Stimulus-transcription coupling leading to the resveratrol-induced upregulation of Egr-1 expression and activity requires the protein kinases Raf and extracellular signal-regulated protein kinase ERK, while MAP kinase phosphatase-1 functions as a nuclear shut-off device that interrupts the signaling cascade connecting resveratrol stimulation with enhanced Egr-1 expression. On the transcriptional level, Elk-1, a key transcriptional regulator of serum response element-driven gene transcription, connects the intracellular signaling cascade elicited by resveratrol with transcription of the Egr-1 gene. These data were corroborated by the observation that stimulation of the cells with resveratrol increased the transcriptional activation potential of Elk-1. The SRE as well as the GC-rich DNA binding site of Egr-1 function as resveratrol-responsive elements. Thus, resveratrol regulates gene transcription via activation of the stimulus-regulated protein kinases Raf and ERK and the stimulus-responsive transcription factors TCF and Egr-1. - Highlights: • The plant polyphenol resveratrol upregulates Egr-1 expression and activity. • The stimulation of Egr-1 requires the protein kinases ERK and Raf. • Resveratrol treatment upregulates the transcriptional activation potential of Elk-1. • Resveratrol-induced stimulation of Egr-1 requires ternary complex factors. • Two distinct resveratrol-responsive elements were identified.

  6. Inhibitory effects of pentosan polysulfate sodium on MAP-kinase pathway and NF-κB nuclear translocation in canine chondrocytes in vitro.

    Science.gov (United States)

    Sunaga, Takafumi; Oh, Namgil; Hosoya, Kenji; Takagi, Satoshi; Okumura, Masahiro

    2012-06-01

    Pentosan polysulfate sodium (PPS) has a heparin-like structure and is purificated from the plant of European beech wood. PPS has been used for the treatment of interstitial cystitis for human patients. Recent years, it was newly recognised that PPS reduce pain and inflammation of OA. The molecular biological mechanism of PPS to express its clinical effects is not fully understood. The purpose of the present study is to investigate a mechanism of action of PPS on inflammatory reaction of chondrocytes in vitro. It was evaluated that effects of PPS on interleukin (IL)-1β-induced phosphorylation of mitogen-actiated protein kinases (MAPKs), such as p38, extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), nuclear translocation of nuclear factor-kappa B (NF-κB), and matrix metalloproteinase (MMP)-3 production in cultured articular chondrocytes. As a result, in the presence of PPS existence, IL-1β-induced phosphorylation of p38 and ERK were certainly inhibited, while JNK phosphorylation was not affected. Nuclear translocation of NF-κB and MMP-3 production were suppressed by PPS pretreatment prior to IL-1β stimulation. In conclusion, it is strongly suggested that PPS treatment prevents inflammatory intracellular responses induced by IL-1 β through inhibition of phosphorylation of certain MAPKs, p38 and ERK and then nuclear translocation of NF-κB in cultured chondrocytes. These PPS properties may contribute to suppressive consequence of catabolic MMP-3 synthesis. These data might translate the clinical efficacy as PPS treatment could inhibit the cartilage catabolism and related clinical symptoms of OA in dogs.

  7. Evaluating logic functionality of cascaded fracturable LUTs

    Institute of Scientific and Technical Information of China (English)

    GUO Zhenhong; LIN Yu; LI Tianyi; JIA Rui; GAO Tongqiang; YANG Haigang

    2016-01-01

    Look Up Tables(LUTs) are the key components of Field-Programmable Gate Arrays(FPGAs). Many LUT architectures have been studied; nevertheless, it is difficult to quantificationally evaluate an LUT based architecture. Traditionally, dedicated efforts on specific modifications to the technology mapping tools are required for LUT architecture evaluation. A more feasible evaluation method for logic functionality is strongly required for the design of LUT architecture. In this paper, a mathematical method for logic functionality calculation is proposed and conventional and fracturable LUT architectures are analyzed. Furthermore, a cascaded fracturable LUT architecture is presented, which achieves twice logic functionality compared with the conventional LUTs and fracturable LUTs.

  8. The Neurometabolic Cascade of Concussion

    National Research Council Canada - National Science Library

    Giza, Christopher C; Hovda, David A

    2001-01-01

    Data Synthesis: The primary elements of the pathophysiologic cascade following concussive brain injury include abrupt neuronal depolarization, release of excitatory neurotransmitters, ionic shifts, changes...

  9. Inferring Network Structure from Cascades

    CERN Document Server

    Ghonge, Sushrut

    2016-01-01

    Many physical, biological and social phenomena can be described by cascades taking place on a network. Often, the activity can be empirically observed, but not the underlying network of interactions. In this paper we solve the dynamics of general cascade processes. We then offer three topological inversion methods to infer the structure of any directed network given a set of cascade arrival times. Our forward and inverse formulas hold for a very general class of models where the activation probability of a node is a generic function of its degree and the number of its active neighbors. We report high success rates for synthetic and real networks, for 5 different cascade models.

  10. Pioglitazone inhibition of lipopolysaccharide-induced nitric oxide synthase is associated with altered activity of p38 MAP kinase and PI3K/Akt

    Directory of Open Access Journals (Sweden)

    Hunter Randy

    2008-01-01

    Full Text Available Abstract Background Previous studies have suggested that peroxisome proliferator activated receptor-gamma (PPAR-γ-mediated neuroprotection involves inhibition of microglial activation and decreased expression and activity of inducible nitric oxide synthase (iNOS; however, the underlying molecular mechanisms have not yet been well established. In the present study we explored: (1 the effect of the PPAR-γ agonist pioglitazone on lipopolysaccharide (LPS-induced iNOS activity and nitric oxide (NO generation by microglia; (2 the differential role of p38 mitogen-activated protein kinase (p38 MAPK, c-Jun NH(2-terminal kinase (JNK, and phosphoinositide 3-kinase (PI3K on LPS-induced NO generation; and (3 the regulation of p38 MAPK, JNK, and PI3K by pioglitazone. Methods Mesencephalic neuron-microglia mixed cultures, and microglia-enriched cultures were treated with pioglitazone and/or LPS. The protein levels of iNOS, p38 MAPK, JNK, PPAR-γ, PI3K, and protein kinase B (Akt were measured by western blot. Different specific inhibitors of iNOS, p38MAPK, JNK, PI3K, and Akt were used in our experiment, and NO generation was measured using a nitrite oxide assay kit. Tyrosine hydroxylase (TH-positive neurons were counted in mesencephalic neuron-microglia mixed cultures. Results Our results showed that pioglitazone inhibits LPS-induced iNOS expression and NO generation, and inhibition of iNOS is sufficient to protect dopaminergic neurons against LPS insult. In addition, inhibition of p38 MAPK, but not JNK, prevented LPS-induced NO generation. Further, and of interest, pioglitazone inhibited LPS-induced phosphorylation of p38 MAPK. Wortmannin, a specific PI3K inhibitor, enhanced p38 MAPK phosphorylation upon LPS stimulation of microglia. Elevations of phosphorylated PPAR-γ, PI3K, and Akt levels were observed with pioglitazone treatment, and inhibition of PI3K activity enhanced LPS-induced NO production. Furthermore, wortmannin prevented the inhibitory effect of

  11. Discovery of 4-(5-(Cyclopropylcarbamoyl)-2-methylphenylamino)-5-methyl-N-propylpyrrolo[1,2-f][1,2,4]triazine-6-carboxamide (BMS-582949), a Clinical p38[alpha] MAP Kinase Inhibitor for the Treatment of Inflammatory Diseases

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Chunjian; Lin, James; Wrobleski, Stephen T.; Lin, Shuqun; Hynes, Jr., John; Wu, Hong; Dyckman, Alaric J.; Li, Tianle; Wityak, John; Gillooly, Kathleen M.; Pitt, Sidney; Shen, Ding Ren; Zhang, Rosemary F.; McIntyre, Kim W.; Salter-Cid, Luisa; Shuster, David J.; Zhang, Hongjian; Marathe, Punit H.; Doweyko, Arthur M.; Sack, John S.; Kiefer, Susan E.; Kish, Kevin F.; Newitt, John A.; McKinnon, Murray; Dodd, John H.; Barrish, Joel C.; Schieven, Gary L.; Leftheris, Katerina (BMS)

    2013-11-20

    The discovery and characterization of 7k (BMS-582949), a highly selective p38{alpha} MAP kinase inhibitor that is currently in phase II clinical trials for the treatment of rheumatoid arthritis, is described. A key to the discovery was the rational substitution of N-cyclopropyl for N-methoxy in 1a, a previously reported clinical candidate p38{alpha} inhibitor. Unlike alkyl and other cycloalkyls, the sp{sup 2} character of the cyclopropyl group can confer improved H-bonding characteristics to the directly substituted amide NH. Inhibitor 7k is slightly less active than 1a in the p38{alpha} enzymatic assay but displays a superior pharmacokinetic profile and, as such, was more effective in both the acute murine model of inflammation and pseudoestablished rat AA model. The binding mode of 7k with p38{alpha} was confirmed by X-ray crystallographic analysis.

  12. Energy Cascades in MHD

    Science.gov (United States)

    Alexakis, A.

    2009-04-01

    Most astrophysical and planetary systems e.g., solar convection and stellar winds, are in a turbulent state and coupled to magnetic fields. Understanding and quantifying the statistical properties of magneto-hydro-dynamic (MHD) turbulence is crucial to explain the involved physical processes. Although the phenomenological theory of hydro-dynamic (HD) turbulence has been verified up to small corrections, a similar statement cannot be made for MHD turbulence. Since the phenomenological description of Hydrodynamic turbulence by Kolmogorov in 1941 there have been many attempts to derive a similar description for turbulence in conducting fluids (i.e Magneto-Hydrodynamic turbulence). However such a description is going to be based inevitably on strong assumptions (typically borrowed from hydrodynamics) that do not however necessarily apply to the MHD case. In this talk I will discuss some of the properties and differences of the energy and helicity cascades in turbulent MHD and HD flows. The investigation is going to be based on the analysis of direct numerical simulations. The cascades in MHD turbulence appear to be a more non-local process (in scale space) than in Hydrodynamics. Some implications of these results to turbulent modeling will be discussed

  13. Information cascade on networks

    CERN Document Server

    Hisakado, Masato

    2015-01-01

    In this paper, we discuss a voting model by considering three different kinds of networks: a random graph, the Barab\\'{a}si-Albert(BA) model, and a fitness model. A voting model represents the way in which public perceptions are conveyed to voters. Our voting model is constructed by using two types of voters--herders and independents--and two candidates. Independents conduct voting based on their fundamental values; on the other hand, herders base their voting on the number of previous votes. Hence, herders vote for the majority candidates and obtain information relating to previous votes from their networks. We discussed the difference between the phases on which the networks depend. Two kinds of phase transitions, an information cascade transition and a super-normal transition, were identified. The first of these is a transition between a state in which most voters make the correct choices and a state in which most of them are wrong. The second is a transition of convergence speed. The information cascade t...

  14. Positional information generated by spatially distributed signaling cascades.

    Directory of Open Access Journals (Sweden)

    Javier Muñoz-García

    2009-03-01

    Full Text Available The temporal and stationary behavior of protein modification cascades has been extensively studied, yet little is known about the spatial aspects of signal propagation. We have previously shown that the spatial separation of opposing enzymes, such as a kinase and a phosphatase, creates signaling activity gradients. Here we show under what conditions signals stall in the space or robustly propagate through spatially distributed signaling cascades. Robust signal propagation results in activity gradients with long plateaus, which abruptly decay at successive spatial locations. We derive an approximate analytical solution that relates the maximal amplitude and propagation length of each activation profile with the cascade level, protein diffusivity, and the ratio of the opposing enzyme activities. The control of the spatial signal propagation appears to be very different from the control of transient temporal responses for spatially homogenous cascades. For spatially distributed cascades where activating and deactivating enzymes operate far from saturation, the ratio of the opposing enzyme activities is shown to be a key parameter controlling signal propagation. The signaling gradients characteristic for robust signal propagation exemplify a pattern formation mechanism that generates precise spatial guidance for multiple cellular processes and conveys information about the cell size to the nucleus.

  15. Physiological roles of mitogen-activated-protein-kinase-activated p38-regulated/activated protein kinase

    Institute of Scientific and Technical Information of China (English)

    Sergiy; Kostenko; Gianina; Dumitriu; Kari; Jenssen; Lgreid; Ugo; Moens

    2011-01-01

    Mitogen-activated protein kinases(MAPKs)are a family of proteins that constitute signaling pathways involved in processes that control gene expression,cell division, cell survival,apoptosis,metabolism,differentiation and motility.The MAPK pathways can be divided into conventional and atypical MAPK pathways.The first group converts a signal into a cellular response through a relay of three consecutive phosphorylation events exerted by MAPK kinase kinases,MAPK kinase,and MAPK.Atypical MAPK pathways are not organized into this three-tiered cascade.MAPK that belongs to both conventional and atypical MAPK pathways can phosphorylate both non-protein kinase substrates and other protein kinases.The latter are referred to as MAPK-activated protein kinases.This review focuses on one such MAPK-activated protein kinase,MAPK-activated protein kinase 5(MK5)or p38-regulated/activated protein kinase(PRAK).This protein is highly conserved throughout the animal kingdom and seems to be the target of both conventional and atypical MAPK pathways.Recent findings on the regulation of the activity and subcellular localization,bona fide interaction partners and physiological roles of MK5/PRAK are discussed.

  16. The Role of Mitogen-Activated Protein (MAP Kinase Signaling Components in the Fungal Development, Stress Response and Virulence of the Fungal Cereal Pathogen Bipolaris sorokiniana.

    Directory of Open Access Journals (Sweden)

    Yueqiang Leng

    Full Text Available Mitogen-activated protein kinases (MAPKs have been demonstrated to be involved in fungal development, sexual reproduction, pathogenicity and/or virulence in many filamentous plant pathogenic fungi, but genes for MAPKs in the fungal cereal pathogen Bipolaris sorokiniana have not been characterized. In this study, orthologues of three MAPK genes (CsSLT2, CsHOG1 and CsFUS3 and one MAPK kinase kinase (MAPKKK gene (CsSTE11 were identified in the whole genome sequence of the B. sorokiniana isolate ND90Pr, and knockout mutants were generated for each of them. The ∆Csfus3 and ∆Csste11 mutants were defective in conidiation and formation of appressoria-like structures, showed hypersensitivity to oxidative stress and lost pathogenicity on non-wounded leaves of barley cv. Bowman. When inoculated on wounded leaves of Bowman, the ∆Csfus3 and ∆Csste11 mutants were reduced in virulence compared to the wild type. No morphological changes were observed in the ∆Cshog1 mutants in comparison with the wild type; however, they were slightly reduced in growth under oxidative stress and were hypersensitive to hyperosmotic stress. The ∆Cshog1 mutants formed normal appressoria-like structures but were reduced in virulence when inoculated on Bowman leaves. The ∆Csslt2 mutants produced more vegetative hyphae, had lighter pigmentation, were more sensitive to cell wall degrading enzymes, and were reduced in virulence on Bowman leaves, although they formed normal appressoria like the wild type. Root infection assays indicated that the ∆Cshog1 and ∆Csslt2 mutants were able to infect barley roots while the ∆Csfus3 and ∆Csste11 failed to cause any symptoms. However, no significant difference in virulence was observed for ∆Cshog1 mutants while ∆Csslt2 mutants showed significantly reduced virulence on barley roots in comparison with the wild type. Our results indicated that all of these MAPK and MAPKKK genes are involved in the regulation of fungal

  17. The Role of Mitogen-Activated Protein (MAP) Kinase Signaling Components in the Fungal Development, Stress Response and Virulence of the Fungal Cereal Pathogen Bipolaris sorokiniana.

    Science.gov (United States)

    Leng, Yueqiang; Zhong, Shaobin

    2015-01-01

    Mitogen-activated protein kinases (MAPKs) have been demonstrated to be involved in fungal development, sexual reproduction, pathogenicity and/or virulence in many filamentous plant pathogenic fungi, but genes for MAPKs in the fungal cereal pathogen Bipolaris sorokiniana have not been characterized. In this study, orthologues of three MAPK genes (CsSLT2, CsHOG1 and CsFUS3) and one MAPK kinase kinase (MAPKKK) gene (CsSTE11) were identified in the whole genome sequence of the B. sorokiniana isolate ND90Pr, and knockout mutants were generated for each of them. The ∆Csfus3 and ∆Csste11 mutants were defective in conidiation and formation of appressoria-like structures, showed hypersensitivity to oxidative stress and lost pathogenicity on non-wounded leaves of barley cv. Bowman. When inoculated on wounded leaves of Bowman, the ∆Csfus3 and ∆Csste11 mutants were reduced in virulence compared to the wild type. No morphological changes were observed in the ∆Cshog1 mutants in comparison with the wild type; however, they were slightly reduced in growth under oxidative stress and were hypersensitive to hyperosmotic stress. The ∆Cshog1 mutants formed normal appressoria-like structures but were reduced in virulence when inoculated on Bowman leaves. The ∆Csslt2 mutants produced more vegetative hyphae, had lighter pigmentation, were more sensitive to cell wall degrading enzymes, and were reduced in virulence on Bowman leaves, although they formed normal appressoria like the wild type. Root infection assays indicated that the ∆Cshog1 and ∆Csslt2 mutants were able to infect barley roots while the ∆Csfus3 and ∆Csste11 failed to cause any symptoms. However, no significant difference in virulence was observed for ∆Cshog1 mutants while ∆Csslt2 mutants showed significantly reduced virulence on barley roots in comparison with the wild type. Our results indicated that all of these MAPK and MAPKKK genes are involved in the regulation of fungal development under

  18. Mesoderm patterning and morphogenesis in the polychaete Alitta virens (Spiralia, Annelida): Expression of mesodermal markers Twist, Mox, Evx and functional role for MAP kinase signaling.

    Science.gov (United States)

    Kozin, Vitaly V; Filimonova, Daria A; Kupriashova, Ekaterina E; Kostyuchenko, Roman P

    2016-05-01

    Mesoderm represents the evolutionary youngest germ layer and forms numerous novel tissues in bilaterian animals. Despite the established conservation of the gene regulatory networks that drive mesoderm differentiation (e.g. myogenesis), mechanisms of mesoderm specification are highly variable in distant model species. Thus, broader phylogenetic sampling is required to reveal common features of mesoderm formation across bilaterians. Here we focus on a representative of Spiralia, the marine annelid Alitta virens, whose mesoderm development is still poorly investigated on the molecular level. We characterize three novel early mesodermal markers for A. virens - Twist, Mox, and Evx - which are differentially expressed within the mesodermal lineages. The Twist mRNA is ubiquitously distributed in the fertilized egg and exhibits specific expression in endomesodermal- and ectomesodermal-founder cells at gastrulation. Twist is expressed around the blastopore and later in a segmental metameric pattern. We consider this expression to be ancestral, and in support of the enterocoelic hypothesis of mesoderm evolution. We also revealed an early pattern of the MAPK activation in A. virens that is different from the previously reported pattern in spiralians. Inhibition of the MAPK pathway by U0126 disrupts the metameric Twist and Mox expression, indicating an early requirement of the MAPK cascade for proper morphogenesis of endomesodermal tissues.

  19. Cascade Distillation System Development

    Science.gov (United States)

    Callahan, Michael R.; Sargushingh, Miriam; Shull, Sarah

    2014-01-01

    NASA's Advanced Exploration Systems (AES) Life Support System (LSS) Project is chartered with de-veloping advanced life support systems that will ena-ble NASA human exploration beyond low Earth orbit (LEO). The goal of AES is to increase the affordabil-ity of long-duration life support missions, and to re-duce the risk associated with integrating and infusing new enabling technologies required to ensure mission success. Because of the robust nature of distillation systems, the AES LSS Project is pursuing develop-ment of the Cascade Distillation Subsystem (CDS) as part of its technology portfolio. Currently, the system is being developed into a flight forward Generation 2.0 design.

  20. Isoquercitrin suppresses the expression of histamine and pro-inflammatory cytokines by inhibiting the activation of MAP Kinases and NF-κB in human KU812 cells

    Institute of Scientific and Technical Information of China (English)

    LI Li; ZHANG Xiao-Hui; LIU Guang-Rong; LIU Chang; DONG Yin-Mao

    2016-01-01

    Mast cells and basophils are multifunctional effector cells that contain abundant secretory granules in their cytoplasm.Both cell types are involved in a variety of inflammatory and immune events,producing an array of inflammatory mediators,such as cytokines.The aim of the study was to examine whether isoquercitrin modulates allergic and inflammatory reactions in the human basophilic KU812 cells and to elucidate its influence on the phosphorylation of mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-κB activation.The KU812 cells were stimulated with phorbol-12-myristate 13-acetate plus the calcium ionophore A23187 (PMACI).The inhibitory effects of isoquercitrin on the productions of histamine and pro-inflammatory cytokines in the stimulated KU812 cells were measured using cytokine-specific enzyme-linked immunosorbent (ELISA) assays.Western blotting analysis was used to assess the effects of isoquercitrin on the MAPKs and NF-κB protein levels.Our results indicated that the isoquercitrin treatment of PMACI-stimulated KU812 cells significantly reduced the production of histamine and the pro-inflammatory cytokines,such as interleukin (IL)-6,IL-8,IL-1β,and tumor necrosis factor (TNF)-α.The treated cells exhibited decreased phosphorylation of extracellular signal-regulated kinase (ERK),revealing the role of ERK MAPK in isoquercitrin-mediated allergy inhibition.Furthermore,isoquercitrin suppressed the PMACI-mediated activation of NF-κB in the human basophil cells.In conclusion,the results from the present study provide insights into the potential therapeutic use of isoquercitrin for the treatment of inflammatory and allergic reactions.

  1. Differential regulation of iron chelator-induced IL-8 synthesis via MAP kinase and NF-κB in immortalized and malignant oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Lee Suk-Keun

    2007-09-01

    Full Text Available Abstract Background Interleukin-8 (IL-8 is a cytokine that plays an important role in tumor progression in a variety of cancer types; however, its regulation is not well understood in oral cancer cells. In the present study, we examined the expression and mechanism of IL-8 in which it is involved by treating immortalized (IHOK and malignant human oral keratinocytes (HN12 cells with deferoxamine (DFO. Methods IL-8 production was measured by an enzyme-linked immunoabsorbent assay and reverse transcriptase-polymerase chain reaction (RT-PCR analysis. Electrophoretic mobility shift assays was used to determine NF-κB binding activity. Phosphorylation and degradation of the I-κB were analyized by Western blot. Results IHOK cells incubated with DFO showed increased expression of IL-8 mRNA, as well as higher release of the IL-8 protein. The up-regulation of DFO-induced IL-8 expression was higher in IHOK cells than in HN12 cells and was concentration-dependent. DFO acted additively with IL-1β to strongly up-regulate IL-8 in IHOK cells but not in HN12 cells. Accordingly, selective p38 and ERK1/2 inhibitors for both kinases abolished DFO-induced IL-8 expression in both IHOK and HN12 cells. Furthermore, DFO induced the degradation and phosphorylation of IκB, and activation of NF-κB. The IL-8 inducing effects of DFO were mediated by a nitric oxide donor (S-nitrosoglutathione, and by pyrrolidine dithiocarbamate, an inhibitor of NF-κB, as well as by wortmannin, which inhibits the phosphatidylinositol 3-kinase-dependent activation of NAD(PH oxidase. Conclusion This results demonstrate that DFO-induced IL-8 acts via multiple signaling pathways in immortalized and malignant oral keratinocytes, and that the control of IL-8 may be an important target for immunotheraphy against human oral premalignant lesions.

  2. Isoquercitrin suppresses the expression of histamine and pro-inflammatory cytokines by inhibiting the activation of MAP Kinases and NF-κB in human KU812 cells.

    Science.gov (United States)

    Li, Li; Zhang, Xiao-Hui; Liu, Guang-Rong; Liu, Chang; Dong, Yin-Mao

    2016-06-01

    Mast cells and basophils are multifunctional effector cells that contain abundant secretory granules in their cytoplasm. Both cell types are involved in a variety of inflammatory and immune events, producing an array of inflammatory mediators, such as cytokines. The aim of the study was to examine whether isoquercitrin modulates allergic and inflammatory reactions in the human basophilic KU812 cells and to elucidate its influence on the phosphorylation of mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-κB activation. The KU812 cells were stimulated with phorbol-12-myristate 13-acetate plus the calcium ionophore A23187 (PMACI). The inhibitory effects of isoquercitrin on the productions of histamine and pro-inflammatory cytokines in the stimulated KU812 cells were measured using cytokine-specific enzyme-linked immunosorbent (ELISA) assays. Western blotting analysis was used to assess the effects of isoquercitrin on the MAPKs and NF-κB protein levels. Our results indicated that the isoquercitrin treatment of PMACI-stimulated KU812 cells significantly reduced the production of histamine and the pro-inflammatory cytokines, such as interleukin (IL)-6, IL-8, IL-1β, and tumor necrosis factor (TNF)-α. The treated cells exhibited decreased phosphorylation of extracellular signal-regulated kinase (ERK), revealing the role of ERK MAPK in isoquercitrin-mediated allergy inhibition. Furthermore, isoquercitrin suppressed the PMACI-mediated activation of NF-κB in the human basophil cells. In conclusion, the results from the present study provide insights into the potential therapeutic use of isoquercitrin for the treatment of inflammatory and allergic reactions.

  3. Interband cascade lasers

    Science.gov (United States)

    Vurgaftman, I.; Weih, R.; Kamp, M.; Meyer, J. R.; Canedy, C. L.; Kim, C. S.; Kim, M.; Bewley, W. W.; Merritt, C. D.; Abell, J.; Höfling, S.

    2015-04-01

    We review the current status of interband cascade lasers (ICLs) emitting in the midwave infrared (IR). The ICL may be considered the hybrid of a conventional diode laser that generates photons via electron-hole recombination, and an intersubband-based quantum cascade laser (QCL) that stacks multiple stages for enhanced current efficiency. Following a brief historical overview, we discuss theoretical aspects of the active region and core designs, growth by molecular beam epitaxy, and the processing of broad-area, narrow-ridge, and distributed feedback (DFB) devices. We then review the experimental performance of pulsed broad area ICLs, as well as the continuous-wave (cw) characteristics of narrow ridges having good beam quality and DFBs producing output in a single spectral mode. Because the threshold drive powers are far lower than those of QCLs throughout the λ = 3-6 µm spectral band, ICLs are increasingly viewed as the laser of choice for mid-IR laser spectroscopy applications that do not require high output power but need to be hand-portable and/or battery operated. Demonstrated ICL performance characteristics to date include threshold current densities as low as 106 A cm-2 at room temperature (RT), cw threshold drive powers as low as 29 mW at RT, maximum cw operating temperatures as high as 118 °C, maximum cw output powers exceeding 400 mW at RT, maximum cw wallplug efficiencies as high as 18% at RT, maximum cw single-mode output powers as high as 55 mW at RT, and single-mode output at λ = 5.2 µm with a cw drive power of only 138 mW at RT.

  4. Unsteady turbulence cascades

    Science.gov (United States)

    Goto, Susumu; Vassilicos, J. C.

    2016-11-01

    We have run a total of 311 direct numerical simulations (DNSs) of decaying three-dimensional Navier-Stokes turbulence in a periodic box with values of the Taylor length-based Reynolds number up to about 300 and an energy spectrum with a wide wave-number range of close to -5 /3 power-law dependence at the higher Reynolds numbers. On the basis of these runs, we have found a critical time when (i) the rate of change of the square of the integral length scale turns from increasing to decreasing, (ii) the ratio of interscale energy flux to high-pass filtered turbulence dissipation changes from decreasing to very slowly increasing in the inertial range, (iii) the signature of large-scale coherent structures disappears in the energy spectrum, and (iv) the scaling of the turbulence dissipation changes from the one recently discovered in DNSs of forced unsteady turbulence and in wind tunnel experiments of turbulent wakes and grid-generated turbulence to the classical scaling proposed by G. I. Taylor [Proc. R. Soc. London, Ser. A 151, 421 (1935), 10.1098/rspa.1935.0158] and A. N. Kolmogorov [Dokl. Akad. Nauk SSSR 31, 538 (1941)]. Even though the customary theoretical basis for this Taylor-Kolmogorov scaling is a statistically stationary cascade where large-scale energy flux balances dissipation, this is not the case throughout the entire time range of integration in all our DNS runs. The recently discovered dissipation scaling can be reformulated physically as a situation in which the dissipation rates of the small and large scales evolve together. We advance two hypotheses that may form the basis of a theoretical approach to unsteady turbulence cascades in the presence of large-scale coherent structures.

  5. Basic fibroblast growth factor induces matrix metalloproteinase-13 via ERK MAP kinase-altered phosphorylation and sumoylation of Elk-1 in human adult articular chondrocytes

    Directory of Open Access Journals (Sweden)

    Hee-Jeong Im

    2009-10-01

    Full Text Available Hee-Jeong Im,1–4 Andrew D Sharrocks,5 Xia Lin,6 Dongyao Yan,1 Jaesung Kim,1 Andre J van Wijnen,7 Robert A Hipskind81Departments of Biochemistry, 2Internal Medicine, 3Section of Rheumatology, Orthopedic Surgery, 4Rush University Medical Center, and Department of Bioengineering; University of Illinois at Chicago, IL USA; 5Faculty of Life Sciences, University of Manchester, Oxford Rd, Manchester, UK; 6Michael D DeBakey Department of Surgery, Baylor College of Medicine, Houston, Texas, USA; 7Department of Cell Biology, University of Massachusetts Medical School, Worcester, MA, USA; 8Institute De Genetique Moleculaire de Montpellier, FranceAbstract: Degradation of the extracellular matrix (ECM by matrix metalloproteinases (MMPs and release of basic fibroblast growth factor (bFGF are principal aspects of the pathology of osteoarthritis (OA. ECM disruption leads to bFGF release, which activates the extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/MAPK pathway and its downstream target the Ets-like transcription factor Elk-1. Previously we demonstrated that the bFGF-ERK-Elk-1 signaling axis is responsible for the potent induction of MMP-13 in human primary articular chondrocytes. Here we report that, in addition to phosphorylation of Elk-1, dynamic posttranslational modification of Elk-1 by small ubiquitin-related modifier (SUMO serves as an important mechanism through which MMP-13 gene expression is regulated. We show that bFGF activates Elk-1 mainly through the ERK pathway and that increased phosphorylation of Elk-1 is accompanied by decreased conjugation of SUMO to Elk-1. Reporter gene assays reveal that phosphorylation renders Elk-1 competent for induction of MMP-13 gene transcription, while sumoylation has the opposite effect. Furthermore, we demonstrate that the SUMO-conjugase Ubc9 acts as a key mediator for Elk-1 sumoylation. Taken together, our results suggest that sumoylation antagonizes the phosphorylation

  6. The MAP(K) of fear: from memory consolidation to memory extinction.

    Science.gov (United States)

    Cestari, Vincenzo; Rossi-Arnaud, Clelia; Saraulli, Daniele; Costanzi, Marco

    2014-06-01

    The highly conserved mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) signaling cascade is involved in several intracellular processes ranging from cell differentiation to proliferation, as well as in synaptic plasticity. In the last two decades, the role of MAPK/ERK in long-term memory formation in mammals, particularly in fear-related memories, has been extensively investigated. In this review we describe knowledge advancement on the role of MAPK/ERK in orchestrating the intracellular processes that lead to the consolidation, reconsolidation and extinction of fear memories. In doing so, we report studies in which the specific role of MAP/ERK in switching from memory formation to memory erasure has been suggested. The possibility to target MAPK/ERK in developing and/or refining pharmacological approaches to treat psychiatric disorders in which fear regulation is defective has also been envisaged. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Endothelin-1 induces proliferation of human lung fibroblasts and IL-11 secretion through an ET(A) receptor-dependent activation of MAP kinases.

    Science.gov (United States)

    Gallelli, Luca; Pelaia, Girolamo; D'Agostino, Bruno; Cuda, Giovanni; Vatrella, Alessandro; Fratto, Donatella; Gioffrè, Vincenza; Galderisi, Umberto; De Nardo, Marilisa; Mastruzzo, Claudio; Salinaro, Elisa Trovato; Maniscalco, Mauro; Sofia, Matteo; Crimi, Nunzio; Rossi, Francesco; Caputi, Mario; Costanzo, Francesco S; Maselli, Rosario; Marsico, Serafino A; Vancheri, Carlo

    2005-11-01

    Endothelin-1 (ET-1) is implicated in the fibrotic responses characterizing interstitial lung diseases, as well as in the airway remodeling process occurring in asthma. Within such a context, the aim of our study was to investigate, in primary cultures of normal human lung fibroblasts (NHLFs), the ET-1 receptor subtypes, and the intracellular signal transduction pathways involved in the proliferative effects of this peptide. Therefore, cells were exposed to ET-1 in the presence or absence of an overnight pre-treatment with either ET(A) or ET(B) selective receptor antagonists. After cell lysis, immunoblotting was performed using monoclonal antibodies against the phosphorylated, active forms of mitogen-activated protein kinases (MAPK). ET-1 induced a significant increase in MAPK phosphorylation pattern, and also stimulated fibroblast proliferation and IL-6/IL-11 release into cell culture supernatants. All these effects were inhibited by the selective ET(A) antagonist BQ-123, but not by the specific ET(B) antagonist BQ-788. The stimulatory influence of ET-1 on IL-11, but not on IL-6 secretion, was prevented by MAPK inhibitors. Therefore, such results suggest that in human lung fibroblasts ET-1 exerts a profibrogenic action via an ET(A) receptor-dependent, MAPK-mediated induction of IL-11 release and cell proliferation.

  8. Deoxycholic acid and selenium metabolite methylselenol exert common and distinct effects on cell cycle, apoptosis, and MAP kinase pathway in HCT116 human colon cancer cells.

    Science.gov (United States)

    Zeng, Huawei; Botnen, James H; Briske-Anderson, Mary

    2010-01-01

    The cell growth inhibition induced by bile acid deoxycholic acid (DCA) may cause compensatory hyperproliferation of colonic epithelial cells and consequently increase colon cancer risk. On the other hand, there is increasing evidence for the efficacy of certain forms of selenium (Se) as anticancer nutrients. Methylselenol has been hypothesized to be a critical Se metabolite for anticancer activity in vivo. In this study, we demonstrated that both DCA (75-300 micromol/l) and submicromolar methylselenol inhibited colon cancer cell proliferation by up to 64% and 63%, respectively. In addition, DCA and methylselenol each increased colon cancer cell apoptosis rate by up to twofold. Cell cycle analyses revealed that DCA induced an increase in only the G1 fraction with a concomitant drop in G2 and S-phase; in contrast, methylselenol led to an increase in the G1 and G2 fractions with a concomitant drop only in the S-phase. Although both DCA and methylselenol significantly promoted apoptosis and inhibited cell growth, examination of mitogen-activated protein kinase (MAPK) pathway activation showed that DCA, but not methylselenol, induced SAPK/JNK1/2, p38 MAPK, ERK1/2 activation. Thus, our data provide, for the first time, the molecular basis for opposite effects of methylselenol and DCA on colon tumorigenesis.

  9. Biochemical and pharmacological assessment of MAP-kinase signaling along pain pathways in experimental rodent models: a potential tool for the discovery of novel antinociceptive therapeutics.

    Science.gov (United States)

    Edelmayer, Rebecca M; Brederson, Jill-Desiree; Jarvis, Michael F; Bitner, Robert S

    2014-02-01

    Injury to the peripheral or central nervous system can induce changes within the nervous tissues that promote a state of sensitization that may underlie conditions of pathological chronic pain. A key biochemical event in the initiation and maintenance of peripheral and central neuronal sensitization associated with chronic pain is the phosphorylation and subsequent activation of mitogen-activated protein kinases (MAPKs) and immediate early gene transcription factors, in particular cAMP-response element binding protein (CREB). In this commentary we review the preclinical data that describe anatomical and mechanistic aspects of nociceptive-induced signaling along nociceptive pathways including peripheral cutaneous axons, the dorsal root ganglia, spinal cord dorsal horn and cerebral cortex. In addition to the regional manifestation of nociceptive signaling, investigations have attempted to elucidate the cellular origin of biochemical nociceptive processing in which communication, i.e. cross-talk between neurons and glia is viewed as an essential component of pathogenic pain development. Here, we outline a research strategy by which nociceptive-induced cellular signaling in experimental pain models, specifically MAPK and CREB phosphorylation can be utilized to provide mechanistic insight into drug-target interaction along the nociceptive pathways. We describe a series of studies using nociceptive inflammatory and neuropathic pain models to investigate the effects of known pain therapeutics on nociceptive-induced biochemical signaling and present this as a complementary research strategy for assessing antinociceptive activity useful in the preclinical development of novel pain therapeutics.

  10. Cascade Mountain Range in Oregon

    Science.gov (United States)

    Sherrod, David R.

    2016-01-01

    The Cascade mountain system extends from northern California to central British Columbia. In Oregon, it comprises the Cascade Range, which is 260 miles long and, at greatest breadth, 90 miles wide (fig. 1). Oregon’s Cascade Range covers roughly 17,000 square miles, or about 17 percent of the state, an area larger than each of the smallest nine of the fifty United States. The range is bounded on the east by U.S. Highways 97 and 197. On the west it reaches nearly to Interstate 5, forming the eastern margin of the Willamette Valley and, farther south, abutting the Coast Ranges. 

  11. Casein kinases

    DEFF Research Database (Denmark)

    Issinger, O G

    1993-01-01

    subunits are highly conserved during evolution. The relationship between CK-2 alpha from humans and plants is still 73%. Similar relationships are reported for the beta-subunit. Chromosomal assignment of CK-2 alpha shows two gene loci, one of which is a pseudogene. They are located on different chromosomes......, no genetic changes are necessarily involved; the observed changes may be entirely due to a signal transduction pathway where CK-2 could be phosphorylated by another kinase(s). CK-2 cDNAs from various organisms have been isolated and characterized. From the deduced amino acid sequence it turns out that CK-2......-subunit affecting: (i) stability, (ii) enzyme specificity and (iii) enzyme activity. The question where CK-2 and its subunits are located throughout the cell cycle has also been addressed, mainly because of the large discrepancies that still exist between results obtained by different investigators. Tissue...

  12. Human Biliverdin Reductase Suppresses Goodpasture Antigen-binding Protein (GPBP) Kinase Activity

    Science.gov (United States)

    Miralem, Tihomir; Gibbs, Peter E. M.; Revert, Fernando; Saus, Juan; Maines, Mahin D.

    2010-01-01

    The Ser/Thr/Tyr kinase activity of human biliverdin reductase (hBVR) and the expression of Goodpasture antigen-binding protein (GPBP), a nonconventional Ser/Thr kinase for the type IV collagen of basement membrane, are regulated by tumor necrosis factor (TNF-α). The pro-inflammatory cytokine stimulates kinase activity of hBVR and activates NF-κB, a transcriptional regulator of GPBP mRNA. Increased GPBP activity is associated with several autoimmune conditions, including Goodpasture syndrome. Here we show that in HEK293A cells hBVR binds to GPBP and down-regulates its TNF-α-stimulated kinase activity; this was not due to a decrease in GPBP expression. Findings with small interfering RNA to hBVR and to the p65 regulatory subunit of NF-κB show the hBVR role in the initial stimulation of GPBP expression by TNF-α-activated NF-κB; hBVR was not a factor in mediating GPBP mRNA stability. The interacting domain was mapped to the 281CX10C motif in the C-terminal 24 residues of hBVR. A 7-residue peptide, KKRILHC281, corresponding to the core of the consensus D(δ)-Box motif in the interacting domain, was as effective as the intact 296-residue hBVR polypeptide in inhibiting GPBP kinase activity. GPBP neither regulated hBVR expression nor TNF-α dependent NF-κB expression. Collectively, our data reveal that hBVR is a regulator of the TNF-α-GPBP-collagen type IV signaling cascade and uncover a novel biological interaction that may be of relevance in autoimmune pathogenesis. PMID:20177069

  13. Cardiopulmonary bypass during cardiac surgery modulates systemic inflammation by affecting different steps of the leukocyte recruitment cascade.

    Directory of Open Access Journals (Sweden)

    Jan Rossaint

    Full Text Available BACKGROUND: It is known that the use of a cardiopulmonary bypass (CPB during cardiac surgery leads to leukocyte activation and may, among other causes, induce organ dysfunction due to increased leukocyte recruitment into different organs. Leukocyte extravasation occurs in a cascade-like fashion, including capturing, rolling, adhesion, and transmigration. However, the molecular mechanisms of increased leukocyte recruitment caused by CPB are not known. This clinical study was undertaken in order to investigate which steps of the leukocyte recruitment cascade are affected by the systemic inflammation during CPB. METHODS: We investigated the effects of CPB on the different steps of the leukocyte recruitment cascade in whole blood from healthy volunteers (n = 9 and patients undergoing cardiac surgery with the use of cardiopulmonary bypass (n = 7 or in off-pump coronary artery bypass-technique (OPCAB, n = 9 by using flow chamber experiments, transmigration assays, and biochemical analysis. RESULTS: CPB abrogated selectin-induced slow leukocyte rolling on E-selectin/ICAM-1 and P-selectin/ICAM-1. In contrast, chemokine-induced arrest and transmigration was significantly increased by CPB. Mechanistically, the abolishment of slow leukocyte rolling was due to disturbances in intracellular signaling with reduced phosphorylation of phospholipase C (PLC γ2, Akt, and p38 MAP kinase. Furthermore, CPB induced an elevated transmigration which was caused by upregulation of Mac-1 on neutrophils. CONCLUSION: These data suggest that CPB abrogates selectin-mediated slow leukocyte rolling by disturbing intracellular signaling, but that the clinically observed increased leukocyte recruitment caused by CPB is due to increased chemokine-induced arrest and transmigration. A better understanding of the underlying molecular mechanisms causing systemic inflammation after CPB may aid in the development of new therapeutic approaches.

  14. Mangiferin, a natural xanthone, protects murine liver in Pb(II induced hepatic damage and cell death via MAP kinase, NF-κB and mitochondria dependent pathways.

    Directory of Open Access Journals (Sweden)

    Pabitra Bikash Pal

    Full Text Available One of the most well-known naturally occurring environmental heavy metals, lead (Pb has been reported to cause liver injury and cellular apoptosis by disturbing the prooxidant-antioxidant balance via oxidative stress. Several studies, on the other hand, reported that mangiferin, a naturally occurring xanthone, has been used for a broad range of therapeutic purposes. In the present study, we, therefore, investigated the molecular mechanisms of the protective action of mangiferin against lead-induced hepatic pathophysiology. Lead [Pb(II] in the form of Pb(NO32 (at a dose of 5 mg/kg body weight, 6 days, orally induced oxidative stress, hepatic dysfunction and cell death in murine liver. Post treatment of mangiferin at a dose of 100 mg/kg body weight (6 days, orally, on the other hand, diminished the formation of reactive oxygen species (ROS and reduced the levels of serum marker enzymes [alanine aminotranferase (ALT and alkaline phosphatase (ALP]. Mangiferin also reduced Pb(II induced alterations in antioxidant machineries, restored the mitochondrial membrane potential as well as mutual regulation of Bcl-2/Bax. Furthermore, mangiferin inhibited Pb(II-induced activation of mitogen-activated protein kinases (MAPKs (phospho-ERK 1/2, phosphor-JNK phospho- p38, nuclear translocation of NF-κB and apoptotic cell death as was evidenced by DNA fragmentation, FACS analysis and histological assessment. In vitro studies using hepatocytes as the working model also showed the protective effect of mangiferin in Pb(II induced cytotoxicity. All these beneficial effects of mangiferin contributes to the considerable reduction of apoptotic hepatic cell death induced by Pb(II. Overall results demonstrate that mangiferin exhibit both antioxidative and antiapoptotic properties and protects the organ in Pb(II induced hepatic dysfunction.

  15. Mangiferin, a Natural Xanthone, Protects Murine Liver in Pb(II) Induced Hepatic Damage and Cell Death via MAP Kinase, NF-κB and Mitochondria Dependent Pathways

    Science.gov (United States)

    Pal, Pabitra Bikash; Sinha, Krishnendu; Sil, Parames C.

    2013-01-01

    One of the most well-known naturally occurring environmental heavy metals, lead (Pb) has been reported to cause liver injury and cellular apoptosis by disturbing the prooxidant-antioxidant balance via oxidative stress. Several studies, on the other hand, reported that mangiferin, a naturally occurring xanthone, has been used for a broad range of therapeutic purposes. In the present study, we, therefore, investigated the molecular mechanisms of the protective action of mangiferin against lead-induced hepatic pathophysiology. Lead [Pb(II)] in the form of Pb(NO3)2 (at a dose of 5 mg/kg body weight, 6 days, orally) induced oxidative stress, hepatic dysfunction and cell death in murine liver. Post treatment of mangiferin at a dose of 100 mg/kg body weight (6 days, orally), on the other hand, diminished the formation of reactive oxygen species (ROS) and reduced the levels of serum marker enzymes [alanine aminotranferase (ALT) and alkaline phosphatase (ALP)]. Mangiferin also reduced Pb(II) induced alterations in antioxidant machineries, restored the mitochondrial membrane potential as well as mutual regulation of Bcl-2/Bax. Furthermore, mangiferin inhibited Pb(II)-induced activation of mitogen-activated protein kinases (MAPKs) (phospho-ERK 1/2, phosphor-JNK phospho- p38), nuclear translocation of NF-κB and apoptotic cell death as was evidenced by DNA fragmentation, FACS analysis and histological assessment. In vitro studies using hepatocytes as the working model also showed the protective effect of mangiferin in Pb(II) induced cytotoxicity. All these beneficial effects of mangiferin contributes to the considerable reduction of apoptotic hepatic cell death induced by Pb(II). Overall results demonstrate that mangiferin exhibit both antioxidative and antiapoptotic properties and protects the organ in Pb(II) induced hepatic dysfunction. PMID:23451106

  16. Central SDF-1/CXCL12 expression and its cardiovascular and sympathetic effects: the role of angiotensin II, TNF-α, and MAP kinase signaling.

    Science.gov (United States)

    Wei, Shun-Guang; Zhang, Zhi-Hua; Yu, Yang; Felder, Robert B

    2014-12-01

    The chemokine stromal cell-derived factor-1 (SDF-1/CXCL12) and its receptors are expressed by neurons and glial cells in cardiovascular autonomic regions of the brain, including the hypothalamic paraventricular nucleus (PVN), and contribute to neurohumoral excitation in rats with ischemia-induced heart failure. The present study examined factors regulating the expression of SDF-1 in the PVN and mechanisms mediating its sympatho-excitatory effects. In urethane anesthetized rats, a 4-h intracerebroventricular (ICV) infusion of angiotensin II (ANG II) or tumor necrosis factor-α (TNF-α) in doses that increase mean blood pressure (MBP) and sympathetic drive increased the expression of SDF-1 in PVN. ICV administration of SDF-1 increased the phosphorylation of p44/42 mitogen-activated protein kinase (MAPK), JNK, and p38 MAPK in PVN, along with MBP, heart rate (HR), and renal sympathetic nerve activity (RSNA), but did not affect total p44/42 MAPK, JNK, and p38 MAPK levels. ICV pretreatment with the selective p44/42 MAPK inhibitor PD98059 prevented the SDF-1-induced increases in MBP, HR, and RSNA; ICV pretreatment with the selective JNK and p38 MAPK inhibitors attenuated but did not block these SDF-1-induced excitatory responses. ICV PD98059 also prevented the sympatho-excitatory response to bilateral PVN microinjections of SDF-1. ICV pretreatment with SDF-1 short-hairpin RNA significantly reduced ANG II- and TNF-α-induced phosphorylation of p44/42 MAPK in PVN. These findings identify TNF-α and ANG II as drivers of SDF-1 expression in PVN and suggest that the full expression of their cardiovascular and sympathetic effects depends upon SDF-1-mediated activation of p44/42 MAPK signaling.

  17. Human p38{delta} MAP kinase mediates UV irradiation induced up-regulation of the gene expression of chemokine BRAK/CXCL14

    Energy Technology Data Exchange (ETDEWEB)

    Ozawa, Shigeyuki [Oral Health Science Research Center (Japan); Department of Biochemistry and Molecular Biology (Japan); Department of Oral and Maxillofacial Surgery, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka 238-8580 (Japan); Ito, Shin; Kato, Yasumasa [Oral Health Science Research Center (Japan); Department of Biochemistry and Molecular Biology (Japan); Kubota, Eiro [Department of Biochemistry and Molecular Biology (Japan); Department of Oral and Maxillofacial Surgery, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka 238-8580 (Japan); Hata, Ryu-Ichiro, E-mail: ryuhata@gmail.com [Oral Health Science Research Center (Japan); Department of Biochemistry and Molecular Biology (Japan)

    2010-06-11

    The mitogen-activated protein kinase (MAPK) family comprises ERK, JNK, p38 and ERK5 (big-MAPK, BMK1). UV irradiation of squamous cell carcinoma cells induced up-regulation of gene expression of chemokine BRAK/CXCL14, stimulated p38 phosphorylation, and down-regulated the phosphorylation of ERK. Human p38 MAPKs exist in 4 isoforms: p38{alpha}, {beta}, {gamma} and {delta}. The UV stimulation of p38 phosphorylation was not inhibited by the presence of SB203580 or PD169316, inhibitors of p38{alpha} and {beta}, suggesting p38 phosphorylation was not dependent on these 2 isoforms and that p38{gamma} and/or {delta} was responsible for the phosphorylation. In fact, inhibition of each of these 4 p38 isoforms by the introduction of short hairpin (sh) RNAs for respective isoforms revealed that only shRNA for p38{delta} attenuated the UV-induced up-regulation of BRAK/CXCL14 gene expression. In addition, over-expression of p38 isoforms in the cells showed the association of p38{delta} with ERK1 and 2, concomitant with down-regulation of ERK phosphorylation. The usage of p38{delta} isoform by UV irradiation is not merely due to the abundance of this p38 isoform in the cells. Because serum deprivation of the cells also induced an increase in BRAK/CXCL14 gene expression, and in this case p38{alpha} and/or {beta} isoform is responsible for up-regulation of BRAK/CXCL14 gene expression. Taken together, the data indicate that the respective stress-dependent action of p38 isoforms is responsible for the up-regulation of the gene expression of the chemokine BRAK/CXCL14.

  18. Effects of TGF-beta and glucocorticoids on map kinase phosphorylation, IL-6/IL-11 secretion and cell proliferation in primary cultures of human lung fibroblasts.

    Science.gov (United States)

    Pelaia, Girolamo; Gallelli, Luca; D'Agostino, Bruno; Vatrella, Alessandro; Cuda, Giovanni; Fratto, Donatella; Renda, Teresa; Galderisi, Umberto; Piegari, Elena; Crimi, Nunzio; Rossi, Francesco; Caputi, Mario; Costanzo, Francesco S; Vancheri, Carlo; Maselli, Rosario; Marsico, Serafino A

    2007-02-01

    Transforming growth factor-beta1 (TGF-beta1) is crucially involved in the fibrotic events characterizing interstitial lung diseases (ILDs), as well as in the airway remodeling process typical of asthma. Within such a context, the aim of our study was to investigate, in primary cultures of normal and fibrotic human lung fibroblasts (HLFs), the effects of TGF-beta1 on mitogen-activated protein kinase (MAPK) phosphorylation, cell proliferation, and production of interleukins 6 (IL-6) and 11 (IL-11), in the presence or absence of a pretreatment with budesonide (BUD). MAPK phosphorylation was detected by Western blotting, cell viability and proliferation were evaluated using Trypan blue staining and [(3)H]-thymidine incorporation assay, respectively, and the release of IL-6 and IL-11 into cell culture supernatants was assessed by ELISA. TGF-beta1 (10 ng/ml) significantly stimulated MAPK phosphorylation (P < 0.01), and also enhanced cell proliferation as well as the secretion of both IL-6 and IL-11, which reached the highest increases at the 72nd h of cell exposure to this growth factor. All such effects were prevented by BUD (10(-8) M) and, with the exception of IL-6 release, also by a mixture of MAPK inhibitors. Therefore, our findings suggest that the fibrotic action exerted by TGF-beta1 in the lung is mediated at least in part by MAPK activation and by an increased synthesis of the profibrogenic cytokines IL-6 and IL-11; all these effects appear to be prevented by corticosteroids via inhibition of MAPK phosphorylation.

  19. Expression of Pseudomonas syringae type III effectors in yeast under stress conditions reveals that HopX1 attenuates activation of the high osmolarity glycerol MAP kinase pathway.

    Science.gov (United States)

    Salomon, Dor; Bosis, Eran; Dar, Daniel; Nachman, Iftach; Sessa, Guido

    2012-11-01

    The Gram-negative bacterium Pseudomonas syringae pv. tomato (Pst) is the causal agent of speck disease in tomato. Pst pathogenicity depends on a type III secretion system that delivers effector proteins into host cells, where they promote disease by manipulating processes to the advantage of the pathogen. Previous studies identified seven Pst effectors that inhibit growth when expressed in yeast under normal growth conditions, suggesting that they interfere with cellular processes conserved in yeast and plants. We hypothesized that effectors also target conserved cellular processes that are required for yeast growth only under stress conditions. We therefore examined phenotypes induced by expression of Pst effectors in yeast grown in the presence of various stressors. Out of 29 effectors tested, five (HopX1, HopG1, HopT1-1, HopH1 and AvrPtoB) displayed growth inhibition phenotypes only in combination with stress conditions. Viability assays revealed that the HopX1 effector caused loss of cell viability under prolonged osmotic stress. Using transcription reporters, we found that HopX1 attenuated the activation of the high osmolarity glycerol (HOG) mitogen-activated protein kinase (MAPK) pathway, which is responsible for yeast survival under osmotic stress, while other MAPK pathways were mildly affected by HopX1. Interestingly, HopX1-mediated phenotypes in yeast were dependent on the putative transglutaminase catalytic triad of the effector. This study enlarges the pool of phenotypes available for the functional analysis of Pst type III effectors in yeast, and exemplifies how analysis of phenotypes detected in yeast under stress conditions can lead to the identification of eukaryotic cellular processes affected by bacterial effectors.

  20. Different muscarinic receptor subtypes modulate proliferation of primary human detrusor smooth muscle cells via Akt/PI3K and map kinases.

    Science.gov (United States)

    Arrighi, Nicola; Bodei, Serena; Zani, Danilo; Michel, Martin C; Simeone, Claudio; Cosciani Cunico, Sergio; Spano, Pierfranco; Sigala, Sandra

    2013-08-01

    While acetylcholine (ACh) and muscarinic receptors in the bladder are mainly known for their role in the regulation of smooth muscle contractility, in other tissues they are involved in tissue remodelling and promote cell growth and proliferation. In the present study we have used primary cultures of human detrusor smooth muscle cells (HDSMCs), in order to investigate the role of muscarinic receptors in HDSMC proliferation. Samples were obtained as discarded tissue from men >65 years undergoing radical cystectomy for bladder cancer and cut in pieces that were either immediately frozen or placed in culture medium for the cell culture establishment. HDSMCs were isolated from samples, propagated and maintained in culture. [(3)H]-QNB radioligand binding on biopsies revealed the presence of muscarinic receptors, with a Kd of 0.10±0.02nM and a Bmax of 72.8±0.1fmol/mg protein. The relative expression of muscarinic receptor subtypes, based on Q-RT-PCR, was similar in biopsies and HDSMC with a rank order of M2≥M3>M1>M4>M5. The cholinergic agonist carbachol (CCh, 1-100μM) concentration-dependently increased [(3)H]-thymidine incorporation (up to 46±4%). This was concentration-dependently inhibited by the general muscarinic receptor antagonist atropine and by subtype-preferring antagonists with an order of potency of darifenacin >4-DAMP>AF-DX 116. The CCh-induced cell proliferation was blocked by selective PI-3 kinase and ERK activation inhibitors, strongly suggesting that these intracellular pathways mediate, at least in part, the muscarinic receptor-mediated cell proliferation. This work shows that M2 and M3 receptors can mediate not only HDSM contraction but also proliferation; they may also contribute bladder remodelling including detrusor hypertrophy.

  1. Mapping the sites of latency and reactivation by bovine herpesvirus 5 (BoHV-5 and a thymidine kinase-deleted BoHV-5 in lambs

    Directory of Open Access Journals (Sweden)

    Gustavo C. Cadore

    2013-12-01

    Full Text Available A thymidine kinase (tk-deleted bovine herpesvirus 5 (BoHV-5tkΔ was previously shown to establish latent infection and reactivate - even poorly - in a sheep model (Cadore et al. 2013. As TK-negative alphaherpesviruses are unlike to reactivate in neural tissue, this study investigated the sites of latency and reactivation by this recombinant in lambs. For this, groups of lambs were inoculated intranasally with the parental BoHV-5 strain (SV-507/99 or with the recombinant BoHV-5tkΔ. During latent infection (40 days post-inoculation, pi, the distribution of recombinant virus DNA in neural and non-neural tissues was similar to that of the parental virus. Parental and recombinant virus DNA was consistently detected by PCR in trigeminal ganglia (TGs; frequently in palatine and pharyngeal tonsils and, less frequently in the retropharyngeal lymph nodes. In addition, latent DNA of both viruses was detected in several areas of the brain. After dexamethasone (Dx administration (day 40pi, the recombinant virus was barely detected in nasal secretions contrasting with marked shedding of the parental virus. In tissues of lambs euthanized at day 3 post-Dx treatment (pDx, reverse-transcription-PCR (RT-PCR for a late viral mRNA (glycoprotein D gene demonstrated reactivation of parental virus in neural (TGs and lymphoid tissues (tonsils, lymph node. In contrast, recombinant virus mRNA was detected only in lymphoid tissues. These results demonstrate that BoHV-5 and the recombinant BoHV-5tkΔ do establish latent infection in neural and non-neural sites. Reactivation of the recombinant BoHV-5tkΔ, however, appeared to occur only in non-neural sites. In anyway, the ability of a tk-deleted strain to reactivate latent infection deserves attention in the context of vaccine safety.

  2. The QseC adrenergic signaling cascade in Enterohemorrhagic E. coli (EHEC.

    Directory of Open Access Journals (Sweden)

    David T Hughes

    2009-08-01

    Full Text Available The ability to respond to stress is at the core of an organism's survival. The hormones epinephrine and norepinephrine play a central role in stress responses in mammals, which require the synchronized interaction of the whole neuroendocrine system. Mammalian adrenergic receptors are G-coupled protein receptors (GPCRs; bacteria, however, sense these hormones through histidine sensor kinases (HKs. HKs autophosphorylate in response to signals and transfer this phosphate to response regulators (RRs. Two bacterial adrenergic receptors have been identified in EHEC, QseC and QseE, with QseE being downstream of QseC in this signaling cascade. Here we mapped the QseC signaling cascade in the deadly pathogen enterohemorrhagic E. coli (EHEC, which exploits this signaling system to promote disease. Through QseC, EHEC activates expression of metabolic, virulence and stress response genes, synchronizing the cell response to these stress hormones. Coordination of these responses is achieved by QseC phosphorylating three of the thirty-two EHEC RRs. The QseB RR, which is QseC's cognate RR, activates the flagella regulon which controls bacteria motility and chemotaxis. The QseF RR, which is also phosphorylated by the QseE adrenergic sensor, coordinates expression of virulence genes involved in formation of lesions in the intestinal epithelia by EHEC, and the bacterial SOS stress response. The third RR, KdpE, controls potassium uptake, osmolarity, and also the formation of lesions in the intestine. Adrenergic regulation of bacterial gene expression shares several parallels with mammalian adrenergic signaling having profound effects in the whole organism. Understanding adrenergic regulation of a bacterial cell is a powerful approach for studying the underlying mechanisms of stress and cellular survival.

  3. Cigarette smoke exposure triggers the autophagic cascade via activation of the AMPK pathway in mice.

    Science.gov (United States)

    Furlong, Hayley C; Stämpfli, Martin R; Gannon, Anne M; Foster, Warren G

    2015-10-01

    We previously demonstrated that cigarette smoke (CS) exposure decreases primordial follicle counts and induces autophagy in ovarian granulosa cells in preference to apoptosis. Therefore, the objective of this study was to investigate molecular targets underlying smoke-induced activation of the reparative autophagy pathway in the ovary. Briefly, ovarian homogenates were prepared from adult female mice exposed to mainstream CS twice daily for 8 wk, using a whole-body exposure system. A gene array revealed that CS exposure induced a greater than 2-fold significant increase in the expression of proautophagic genes Cdkn1b, Map1lc3a, Bad, and Sqstm1/p62. A significant increase in Prkaa2, Pik3c3, and Maplc31b expression, as well as a significant decrease in Akt1 and Mtor expression, was detected by quantitative PCR. The 5'-AMP-activated protein kinase catalytic subunit (AMPK) alpha1 + alpha2 and ATG7 protein expression was significantly increased, whereas AKT1, mTOR, CDKN1B/p27, and CXCR4 proteins were significantly decreased in CS exposed versus control ovaries. Up-regulation of AMPK alpha1 + alpha2, a known initiator of autophagic signaling, and ATG7 further suggests activation of the autophagy cascade. Two prosurvival factors, AKT and mTOR, were decreased in expression, an outcome that favors induction of the autophagy pathway, whereas decreased levels of CDKN1B is suggestive of cell cycle dysregulation. In summary, our data suggest that CS exposure induces ovarian follicle loss through induction of the autophagic cascade via the AMPK pathway together with inhibition of antiautophagic markers AKT and mTOR. We further postulate that toxicant-induced dysregulation of reparative autophagy is a novel pathway central to impaired follicle development and subfertility. © 2015 by the Society for the Study of Reproduction, Inc.

  4. Are longer cascades more stable?

    OpenAIRE

    2004-01-01

    Yes, they are. We consider data from experimental cascade games that were run in different laboratories, and find uniformly that subjects are more willing to follow the crowd, the bigger the crowd is �although the decision makers who are added to the crowd should in theory simply follow suit and hence reveal no information. This correlation of length and strength of cascades appears consistently across games with different parameters and different choice sets for the subjects. ...

  5. Cascading Gravity is Ghost Free

    CERN Document Server

    de Rham, Claudia; Tolley, Andrew J

    2010-01-01

    We perform a full perturbative stability analysis of the 6D cascading gravity model in the presence of 3-brane tension. We demonstrate that for sufficiently large tension on the (flat) 3-brane, there are no ghosts at the perturbative level, consistent with results that had previously only been obtained in a specific 5D decoupling limit. These results establish the cascading gravity framework as a consistent infrared modification of gravity.

  6. Aeroelasticity in Turbomachine-Cascades.

    Science.gov (United States)

    1982-11-10

    STABLE -180 UNSTABLE -360 ’ - ’ - -180 0. 󈧖O DIAGRAM 3 AERODYNAMIC LIFT (OENT)COEFFICIENTI AND PHASE LEADS IN DEPENDANCE OF FLOM GUANTATIES AND CASCADE...ABL -0.8 0.0 -5 0. -5 DIAGRAM ’. AERODYNAMIC NORK AND DAMPING COEFFICIENTS (FOR A RIGID NOTION) IN DEPENDANCE OF FLOW OURNTATIES AND CASCADE GEOMETRY...coefficients on blades + blade vibration + vizualization in the transonic flow domain (Schlieren) + instability dependance on flow conditions, blade

  7. Low Noise Interband Cascade Photodetectors

    Science.gov (United States)

    2012-02-28

    National Laboratories, Zhaobing Tian, Zhihua Cai, R. T. Hinkey, L. Li, Tetsuya D. Mishima , Michael B. Santos, and Matthew B. Johnson at the...Phys. 107, No. 5, 054514 (2010). 2. R. Q. Yang, Z. Tian, J. F. Klem, T. D. Mishima , M. B. Santos, and M. B. Johnson, “Interband cascade photovoltaic...2012). 4. Z. Tian, Z. Cai, R. Q. Yang, T. D. Mishima , M. B. Santos, M. B. Johnson, and J. F. Klem, “Interband Cascade Infrared Photodetectors

  8. Cascade Product of Permutation Groups

    OpenAIRE

    Egri-Nagy, Attila; Nehaniv, Chrystopher L.

    2013-01-01

    We define the cascade product of permutation groups as an external product, an explicit construction of substructures of the iterated wreath product that are much smaller than the full wreath product. This construction is essential for computational implementations of algebraic hierarchical decompositions of finite automata. We show how direct, semidirect, and wreath products and group extensions can all be expressed as cascade products, and analyse examples of groups that can be constructed ...

  9. Pro-life role for c-Jun N-terminal kinase and p38 mitogen-activated protein kinase at rostral ventrolateral medulla in experimental brain stem death

    Directory of Open Access Journals (Sweden)

    Chang Alice YW

    2012-11-01

    Full Text Available Abstract Background Based on an experimental brain stem death model, we demonstrated previously that activation of the mitogen-activated protein kinase kinase 1/2 (MEK1/2/extracellular signal-regulated kinase 1/2 (ERK1/2/mitogen-activated protein kinase signal-interacting kinase 1/2 (MNK1/2 cascade plays a pro-life role in the rostral ventrolateral medulla (RVLM, the origin of a life-and-death signal detected from systemic arterial pressure, which sequentially increases (pro-life and decreases (pro-death to reflect progressive dysfunction of central cardiovascular regulation during the advancement towards brain stem death in critically ill patients. The present study assessed the hypothesis that, in addition to ERK1/2, c-Jun NH2-terminal kinase (JNK and p38 mitogen-activated protein kinase (p38MAPK, the other two mammalian members of MAPKs that are originally identified as stress-activated protein kinases, are activated specifically by MAPK kinase 4 (MAP2K4 or MAP2K6 and play a pro-life role in RVLM during experimental brain stem death. We further delineated the participation of phosphorylating activating transcriptional factor-2 (ATF-2 and c-Jun, the classical transcription factor activated by JNK or p38MAPK, in this process. Results An experimental model of brain stem death that employed microinjection of the organophosphate insecticide mevinphos (Mev; 10 nmol bilaterally into RVLM of Sprague–Dawley rats was used, alongside cardiovascular, pharmacological and biochemical evaluations. Results from ELISA showed that whereas the total JNK, p38MAPK, MAP2K4 and MAP2K6 were not affected, augmented phosphorylation of JNK at Thr183 and Tyr185 and p38MAPK at Thr180 and Tyr182, accompanied by phosphorylation of their upstream activators MAP2K4 at Ser257 and Thr261 and MAP2K6 at Ser207 and Thr211 in RVLM occurred preferentially during the pro-life phase of experimental brain stem death. Moreover, the activity of transcription factors ATF-2 at Thr71 and

  10. Development of "Laser Ablation Direct Analysis in Real Time Imaging" Mass Spectrometry: Application to Spatial Distribution Mapping of Metabolites Along the Biosynthetic Cascade Leading to Synthesis of Atropine and Scopolamine in Plant Tissue.

    Science.gov (United States)

    Fowble, Kristen L; Teramoto, Kanae; Cody, Robert B; Edwards, David; Guarrera, Donna; Musah, Rabi A

    2017-03-21

    Methods for the accomplishment of small-molecule imaging by mass spectrometry are challenged by the need for sample pretreatment steps, such as cryo-sectioning, dehydration, chemical fixation, or application of a matrix or solvent, that must be performed to obtain interpretable spatial distribution data. Furthermore, these steps along with requirements of the mass analyzer such as high vacuum, can severely limit the range of sample types that can be analyzed by this powerful method. Here, we report the development of a laser ablation-direct analysis in real time imaging mass spectrometry approach which couples a 213 nm Nd:YAG solid state UV laser to a direct analysis in a real time ion source and high-resolution time-of-flight mass spectrometer. This platform enables facile determination of the spatial distribution of small-molecules spanning a range of polarities in a diversity of sample types and requires no matrix, vacuum, solvent, or complicated sample pretreatment steps. It furnishes high-resolution data, can be performed under ambient conditions on samples in their native form, and results in little to no fragmentation of analytes. We demonstrate its application through determination of the spatial distribution of molecules involved in the biosynthetic cascade leading to formation of the clinically relevant alkaloids atropine and scopolamine in Datura leichhardtii seed tissue.

  11. Modelling the UNAIDS 90-90-90 treatment cascade for gay, bisexual and other men who have sex with men in South Africa: using the findings of a data triangulation process to map a way forward.

    Science.gov (United States)

    Scheibe, Andrew; Grasso, Michael; Raymond, Henry Fisher; Manyuchi, Albert; Osmand, Thomas; Lane, Tim; Struthers, Helen

    2017-04-25

    A data triangulation exercise was carried out between 2013 and 2015 to assess the HIV epidemic and response among gay, bisexual and other men who have sex with men (GBMSM) in South Africa. We used the findings to assess progress in achieving the UNAIDS 90-90-90 goals for GBMSM in the country. Three scenarios were developed using different GBMSM population factors (2.0, 3.5 and 5.0% of males aged ≥15) to estimate the population size, HIV prevalence of 13.2-49.5%, and 68% of GBMSM knowing their status. Due to data gaps, general population data were used as estimates of GBMSM on antiretroviral therapy (ART) and virologically suppressed (25.7 and 84.0%, respectively). The biggest gap is access to ART. To address the data gap we recommend developing data collection tools, indicators, and further quantification of HIV cascades. Targeted testing, linkage to services and scaled-up prevention interventions (including pre-exposure prophylaxis) are also required.

  12. Interband Cascade Photovoltaic Cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Rui Q. [Univ. of Oklahoma, Norman, OK (United States); Santos, Michael B. [Univ. of Oklahoma, Norman, OK (United States); Johnson, Matthew B. [Univ. of Oklahoma, Norman, OK (United States)

    2014-09-24

    In this project, we are performing basic and applied research to systematically investigate our newly proposed interband cascade (IC) photovoltaic (PV) cells [1]. These cells follow from the great success of infrared IC lasers [2-3] that pioneered the use of quantum-engineered IC structures. This quantum-engineered approach will enable PV cells to efficiently convert infrared radiation from the sun or other heat source, to electricity. Such cells will have important applications for more efficient use of solar energy, waste-heat recovery, and power beaming in combination with mid-infrared lasers. The objectives of our investigations are to: achieve extensive understanding of the fundamental aspects of the proposed PV structures, develop the necessary knowledge for making such IC PV cells, and demonstrate prototype working PV cells. This research will focus on IC PV structures and their segments for utilizing infrared radiation with wavelengths from 2 to 5 μm, a range well suited for emission by heat sources (1,000-2,000 K) that are widely available from combustion systems. The long-term goal of this project is to push PV technology to longer wavelengths, allowing for relatively low-temperature thermal sources. Our investigations address material quality, electrical and optical properties, and their interplay for the different regions of an IC PV structure. The tasks involve: design, modeling and optimization of IC PV structures, molecular beam epitaxial growth of PV structures and relevant segments, material characterization, prototype device fabrication and testing. At the end of this program, we expect to generate new cutting-edge knowledge in the design and understanding of quantum-engineered semiconductor structures, and demonstrate the concepts for IC PV devices with high conversion efficiencies.

  13. Role of the HaHOG1 MAP kinase in response of the conifer root and butt rot pathogen (heterobasidion annosum to osmotic and oxidative stress [corrected].

    Directory of Open Access Journals (Sweden)

    Tommaso Raffaello

    Full Text Available The basidiomycete Heterobasidion annosum (Fr. Bref. s.l. is a filamentous white rot fungus, considered to be the most economically important pathogen of conifer trees. Despite the severity of the tree infection, very little is known about the molecular and biochemical aspects related to adaptation to abiotic stresses. In this study, the osmotic and oxidative tolerance as well as the role of the HaHOG1 Mitogen Activated Protein Kinase (MAPK gene were investigated. The transcript levels of the yeast orthologues GPD1, HSP78, STL1, GRE2 and the ATPase pumps ENA1, PMR1, PMC1 known to have an important role in osmotolerance were also quantified under salt osmotic conditions. The HaHOG1 gene was used for a heterologous expression and functional study in the Saccharomyces cerevisiae Δhog1 strain. Moreover, the phosphorylation level of HaHog1p was studied under salt osmotic and oxidative stress. The result showed that H. annosum displayed a decreased growth when exposed to an increased concentration of osmotic and oxidative stressors. GPD1, HSP78, STL1 and GRE2 showed an induction already at 10 min after exposure to salt stress. Among the ATPase pumps studied, PMC1 was highly induced when the fungus was exposed to 0.2 M CaCl₂ for 60 min. The heterologous expression of the HaHOG1 sequence in yeast confirmed that the gene is able to restore the osmotolerance and oxidative tolerance in the S. cerevisiae hog1Δ mutant strain. The HaHog1p was strongly phosphorylated in the presence of NaCl, KCl, H₂O₂ but not in the presence of CaCl₂ and MgCl₂. The GFP-HaHog1p fusion protein accumulated in the nuclei of the S. cerevisiae hog1Δ cells when exposed to high osmotic conditions but not under oxidative stress. These results provide the first insights about the response of H. annosum to osmotic and oxidative stress and elucidate the role of the HaHOG1 gene in such conditions.

  14. Skepinone-L, a Novel Potent and Highly Selective Inhibitor of p38 MAP Kinase, Effectively Impairs Platelet Activation and Thrombus Formation

    Directory of Open Access Journals (Sweden)

    Oliver Borst

    2013-06-01

    Full Text Available Background/Aims: Platelets are critically important for primary haemostasis and the major players in thrombotic vascular occlusion. Platelets are activated by agonists, such as thrombin and collagen-related peptide as well as second-wave mediators including thromboxane A2 via different intracellular signaling pathways resulting in degranulation, aggregation and thrombus formation. Platelet activation is paralleled by phosphorylation and activation of p38 MAPK. The limited specificity of hitherto known p38 MAPK inhibitors precluded safe conclusions on the precise role of p38 MAPK in the regulation of platelet function. The present study examined the impact of Skepinone-L, a novel and highly selective inhibitor of p38 mitogen-activated protein kinase (p38 MAPK, on platelet activation and thrombus formation. Methods: Experiments were performed in freshly isolated human platelets. Protein phosphorylation was quantified by Western blotting, thromboxane B2 synthesis by enzyme immunoassay, ATP release by ChronoLume luciferin assay, cytosolic Ca2+ concentration by Fura-2 fluorescence-measurements, platelet aggregation by a light transmissions measurement and in vitro thrombus formation by a flow chamber. Results: Skepinone-L (1 μM virtually abrogated the phosphorylation of platelet p38 MAPK substrate Hsp27 following stimulation with CRP (1 μg/ml, thrombin (5 mU/ml or thromboxane A2 analogue U-46619 (1 μM. Furthermore, Skepinone-L significantly blunted activation-dependent platelet secretion and aggregation following threshold concentrations of CRP, thrombin and thromboxane A2 analogue U-46619. Skepinone-L did not impair platelet Ca2+ signaling but prevented agonist-induced thromboxane A2 synthesis through abrogation of p38 MAPK-dependent phosphorylation of platelet cytosolic phospholipase A2 (cPLA2. Skepinone-L further markedly blunted thrombus formation under low (500-s and high (1700-s arterial shear rates. Conclusions: The present study discloses

  15. Multi-walled carbon nanotubes induce COX-2 and iNOS expression via MAP Kinase-dependent and -independent mechanisms in mouse RAW264.7 macrophages

    Directory of Open Access Journals (Sweden)

    Lee Jong

    2012-05-01

    Full Text Available Abstract Background Carbon nanotubes (CNTs are engineered graphene cylinders with numerous applications in engineering, electronics and medicine. However, CNTs cause inflammation and fibrosis in the rodent lung, suggesting a potential human health risk. We hypothesized that multi-walled CNTs (MWCNTs induce two key inflammatory enzymes in macrophages, cyclooxygenase-2 (COX-2 and inducible nitric oxide synthase (iNOS, through activation of extracellular signal-regulated kinases (ERK1,2. Methods RAW264.7 macrophages were exposed to MWCNTs or carbon black nanoparticles (CBNPs over a range of doses and time course. Uptake and subcellular localization of MWCNTs was visualized by transmission electron microscopy (TEM. Protein levels of COX-2, iNOS, and ERK1,2 (total ERK and phosphorylated ERK were measured by Western blot analysis. Prostaglandin-E2 (PGE2 and nitric oxide (NO levels in cell supernatants were measured by ELISA and Greiss assay, respectively. Results MWCNTs, but not CBNPs, induced COX-2 and iNOS in a time- and dose-dependent manner. COX-2 and iNOS induction by MWCNTs correlated with increased PGE2 and NO production, respectively. MWCNTs caused ERK1,2 activation and inhibition of ERK1,2 (U0126 blocked MWCNT induction of COX-2 and PGE2 production, but did not reduce the induction of iNOS. Inhibition of iNOS (L-NAME did not affect ERK1,2 activation, nor did L-NAME significantly decrease COX-2 induction by MWCNT. Nickel nanoparticles (NiNPs, which are present in MWCNTs as a residual catalyst, also induced COX-2 via ERK-1,2. However, a comparison of COX-2 induction by MWCNTs containing 4.5 and 1.8% Ni did not show a significant difference in ability to induce COX-2, indicating that characteristics of MWCNTs in addition to Ni content contribute to COX-2 induction. Conclusion This study identifies COX-2 and subsequent PGE2 production, along with iNOS induction and NO production, as inflammatory mediators involved in the macrophage response to

  16. Mixtures of multiplicative cascade models in geochemistry

    Directory of Open Access Journals (Sweden)

    F. P. Agterberg

    2007-05-01

    Full Text Available Multifractal modeling of geochemical map data can help to explain the nature of frequency distributions of element concentration values for small rock samples and their spatial covariance structure. Useful frequency distribution models are the lognormal and Pareto distributions which plot as straight lines on logarithmic probability and log-log paper, respectively. The model of de Wijs is a simple multiplicative cascade resulting in discrete logbinomial distribution that closely approximates the lognormal. In this model, smaller blocks resulting from dividing larger blocks into parts have concentration values with constant ratios that are scale-independent. The approach can be modified by adopting random variables for these ratios. Other modifications include a single cascade model with ratio parameters that depend on magnitude of concentration value. The Turcotte model, which is another variant of the model of de Wijs, results in a Pareto distribution. Often a single straight line on logarithmic probability or log-log paper does not provide a good fit to observed data and two or more distributions should be fitted. For example, geochemical background and anomalies (extremely high values have separate frequency distributions for concentration values and for local singularity coefficients. Mixtures of distributions can be simulated by adding the results of separate cascade models. Regardless of properties of background, an unbiased estimate can be obtained of the parameter of the Pareto distribution characterizing anomalies in the upper tail of the element concentration frequency distribution or lower tail of the local singularity distribution. Computer simulation experiments and practical examples are used to illustrate the approach.

  17. Communication Scheme via Cascade Chaotic Systems

    Institute of Scientific and Technical Information of China (English)

    HUA Chang-Chun; GUAN Xin-Ping

    2004-01-01

    @@ A new chaotic communication scheme is constructed. Different from the existing literature, cascade chaotic systems are employed. Two cascade modes are considered. First, we investigate the input to state cascade mode;cascade systems between different kinds of chaotic systems are considered. Then the parameter cascade case of chaotic system is studied. Under the different cases, the corresponding receivers are designed, which can succeed in recovering the former emitted signal. Simulations are performed to verify the validity of the proposed main results.

  18. G-Protein Inwardly Rectifying Potassium Channel 1 (GIRK1 Knockdown Decreases Beta-Adrenergic, MAP Kinase and Akt Signaling in the MDA-MB-453 Breast Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Michael W. Hance

    2008-01-01

    Full Text Available Previous data from our laboratory have indicated that there is a functional link between the beta-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in breast cancer cell lines and that these pathways are involved in growth regulation of these cells. To determine functionality, MDA-MB-453 breast cancer cells were stimulated with ethanol, known to open GIRK channels. Decreased GIRK1 protein levels were seen after treatment with 0.12% ethanol. In addition, serum-free media completely inhibited GIRK1 protein expression. This data indicates that there are functional GIRK channels in breast cancer cells and that these channels are involved in cellular signaling. In the present research, to further define the signaling pathways involved, we performed RNA interference (siRNA studies. Three stealth siRNA constructs were made starting at bases 1104, 1315, and 1490 of the GIRK1 sequence. These constructs were transfected into MDA-MB-453 cells, and both RNA and protein were isolated. GIRK1, β2-adrenergic and 18S control levels were determined using real-time PCR 24 hours after transfection. All three constructs decreased GIRK1 mRNA levels. However, β2 mRNA levels were unchanged by the GIRK1 knockdown. GIRK1 protein levels were also reduced by the knockdown, and this knockdown led to decreases in beta-adrenergic, MAP kinase and Akt signaling.

  19. Kinase Activity Profiling of Gram-Negative Pneumonia

    NARCIS (Netherlands)

    Hoogendijk, Arie J.; Diks, Sander H.; Peppelenbosch, Maikel P.; van der Poll, Tom; Wieland, Catharina W.

    2011-01-01

    Pneumonia is a severe disease with high morbidity and mortality. A major causative pathogen is the Gram-negative bacterium Klebsiella (K.) pneumoniae Kinases play an integral role in the transduction of intracellular signaling cascades and regulate a diverse array of biological processes essential t

  20. Kinase activity profiling of gram-negative pneumonia

    NARCIS (Netherlands)

    A.J. Hoogendijk (Arie); S.H. Diks (Sander); M.P. Peppelenbosch (Maikel); T. van der Poll (Tom); C.W. Wieland (Catharina )

    2011-01-01

    textabstractPneumonia is a severe disease with high morbidity and mortality. A major causative pathogen is the Gram-negative bacterium Klebsiella (K.) pneumoniae. Kinases play an integral role in the transduction of intracellular signaling cascades and regulate a diverse array of biological processe

  1. Kinase activity profiling of gram-negative pneumonia

    NARCIS (Netherlands)

    A.J. Hoogendijk; S.H. Diks; M.P. Peppelenbosch; T. van der Poll; C.W. Wieland

    2011-01-01

    Pneumonia is a severe disease with high morbidity and mortality. A major causative pathogen is the Gram-negative bacterium Klebsiella (K.) pneumoniae. Kinases play an integral role in the transduction of intracellular signaling cascades and regulate a diverse array of biological processes essential

  2. Cascaded-cladding-pumped cascaded Raman fiber amplifier.

    Science.gov (United States)

    Jiang, Huawei; Zhang, Lei; Feng, Yan

    2015-06-01

    The conversion efficiency of double-clad Raman fiber laser is limited by the cladding-to-core area ratio. To get high conversion efficiency, the inner-cladding-to-core area ratio has to be less than about 8, which limits the brightness enhancement. To overcome the problem, a cascaded-cladding-pumped cascaded Raman fiber laser with multiple-clad fiber as the Raman gain medium is proposed. A theoretical model of Raman fiber amplifier with multiple-clad fiber is developed, and numerical simulation proves that the proposed scheme can improve the conversion efficiency and brightness enhancement of cladding pumped Raman fiber laser.

  3. A simple method for potential flow simulation of cascades

    Indian Academy of Sciences (India)

    Aravind Bhimarasetty; Raghuraman N Govardhan

    2010-12-01

    A simple method using a combination of conformal mapping and vortex panel method to simulate potential flow in cascades is presented. The cascade is first transformed to a single body using a conformal mapping, and the potential flow over this body is solved using a simple higher order vortex panel method. The advantage of this method over existing methodologies is that it enables the use of higher order panel methods, as are used to solve flow past an isolated airfoil, to solve the cascade problem without the need for any numerical integrations or iterations. The fluid loading on the blades, such as the normal force and pitching moment, may be easily calculated from the resultant velocity field. The coefficient of pressure on cascade blades calculated with this methodology shows good agreement with previous numerical and experimental results.

  4. Autoregressive cascades on random networks

    Science.gov (United States)

    Iyer, Srikanth K.; Vaze, Rahul; Narasimha, Dheeraj

    2016-04-01

    A network cascade model that captures many real-life correlated node failures in large networks via load redistribution is studied. The considered model is well suited for networks where physical quantities are transmitted, e.g., studying large scale outages in electrical power grids, gridlocks in road networks, and connectivity breakdown in communication networks, etc. For this model, a phase transition is established, i.e., existence of critical thresholds above or below which a small number of node failures lead to a global cascade of network failures or not. Theoretical bounds are obtained for the phase transition on the critical capacity parameter that determines the threshold above and below which cascade appears or disappears, respectively, that are shown to closely follow numerical simulation results.

  5. Infectious Agents Trigger Trophic Cascades.

    Science.gov (United States)

    Buck, Julia C; Ripple, William J

    2017-09-01

    Most demonstrated trophic cascades originate with predators, but infectious agents can also cause top-down indirect effects in ecosystems. Here we synthesize the literature on trophic cascades initiated by infectious agents including parasitoids, pathogens, parasitic castrators, macroparasites, and trophically transmitted parasites. Like predators, infectious agents can cause density-mediated and trait-mediated indirect effects through their direct consumptive and nonconsumptive effects respectively. Unlike most predators, however, infectious agents are not fully and immediately lethal to their victims, so their consumptive effects can also trigger trait-mediated indirect effects. We find that the frequency of trophic cascades reported for different consumer types scales with consumer lethality. Furthermore, we emphasize the value of uniting predator-prey and parasite-host theory under a general consumer-resource framework. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Procyanidin B2 3,3"-di-O-gallate induces oxidative stress-mediated cell death in prostate cancer cells via inhibiting MAP kinase phosphatase activity and activating ERK1/2 and AMPK.

    Science.gov (United States)

    Kumar, Rahul; Deep, Gagan; Wempe, Michael F; Surek, Joseph; Kumar, Amit; Agarwal, Rajesh; Agarwal, Chapla

    2017-09-06

    Neoplastic cells exhibit higher oxidative stress compared to normal cells; however, antioxidants based clinical trials have mostly failed. Another attractive therapeutic approach is to further increase the oxidative stress in cancer cells leading to cell death. Herein, we show that Procyanidin B2 3,3"-di-O-gallate (B2G2), the most active constituent of grape seed extract, treatment causes cell death in human prostate cancer (PCa) cells (LNCaP and 22Rv1) via increasing the reactive oxygen species (ROS) generation. Mechanistically, B2G2 treatment decreased the mitochondrial electron transport chain complex III activity leading to enhanced mitochondrial superoxide generation and decreased ATP production in LNCaP cells. Additional molecular studies revealed that B2G2-induced cell death was mediated mainly through ROS-induced sustained activation of ERK1/2, which was due to inhibition of MAP kinase phosphatase (MKP) activity as over-expression of MKP3 in LNCaP cells conferred significant protection against B2G2-induced cell death. Along with ERK1/2, AMP-activated protein kinase α (AMPKα) was also activated by B2G2 treatment, and pre-treatment with AMPKα inhibitor compound C significantly reversed the cytotoxic effects of B2G2 in LNCaP cells. Furthermore, pre-treatment of MKP3 over-expressing LNCaP cells with compound C further reduced the B2G2-induced cell death, suggesting the involvement of AMPKα along with MKP3 and ERK1/2 in the biological effects of B2G2. Together, these results for the first time identified that oxidative stress and MKP3 inhibition play a critical role in B2G2-induced cell death in PCa cells through sustained activation of both ERK1/2 and AMPKα. These results offer a unique opportunity to control this deadly malignancy through B2G2 use. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  7. Location and cloning of the herpes simplex virus type 2 thymidine kinase gene.

    OpenAIRE

    McDougall, J K; Masse, T H; Galloway, D A

    1980-01-01

    The herpes simplex virus type 2 thymidine kinase gene has been mapped to a position colinear with the herpes simplex virus type 1 thymidine kinase gene and cloned within a 4.0-kilobase fragment in pBR 322.

  8. Sertraline, an antidepressant, induces apoptosis in hepatic cells through the mitogen-activated protein kinase pathway.

    Science.gov (United States)

    Chen, Si; Xuan, Jiekun; Wan, Liqing; Lin, Haixia; Couch, Letha; Mei, Nan; Dobrovolsky, Vasily N; Guo, Lei

    2014-02-01

    Sertraline is generally used for the treatment of depression and is also approved for the treatment of panic, obsessive-compulsive, and posttraumatic stress disorders. Previously, using rat primary hepatocytes and isolated mitochondria, we demonstrated that sertraline caused hepatic cytotoxicity and mitochondrial impairment. In the current study, we investigated and characterized molecular mechanisms of sertraline toxicity in human hepatoma HepG2 cells. Sertraline decreased cell viability and induced apoptosis in a dose- and time-dependent manner. Sertraline activated the intrinsic checkpoint protein caspase-9 and caused the release of cytochrome c from mitochondria to cytosol; this process was Bcl-2 family dependent because antiapoptotic Bcl-2 family proteins were decreased. Pretreatment of the HepG2 cells with caspase-3, caspase-8, and caspase-9 inhibitors partially but significantly reduced the release of lactate dehydrogenase, indicating that sertraline-induced apoptosis is mediated by both intrinsic and extrinsic apoptotic pathways. Moreover, sertraline markedly increased the expression of tumor necrosis factor (TNF) and the phosphorylation of JNK, extracellular signal-regulated kinase (ERK1/2), and p38. In sertraline-treated cells, the induction of apoptosis and cell death was shown to be the result of activation of JNK, but not ERK1/2 or p38 in the mitogen-activated protein kinase (MAPK) pathway. Furthermore, silencing MAP4K4, the upstream kinase of JNK, attenuated both apoptosis and cell death caused by sertraline. Taken together, our findings suggest that sertraline induced apoptosis in HepG2 cells at least partially via activation of the TNF-MAP4K4-JNK cascade signaling pathway.

  9. Rac-1 and Raf-1 kinases, components of distinct signaling pathways, activate myotonic dystrophy protein kinase

    Science.gov (United States)

    Shimizu, M.; Wang, W.; Walch, E. T.; Dunne, P. W.; Epstein, H. F.

    2000-01-01

    Myotonic dystrophy protein kinase (DMPK) is a serine-threonine protein kinase encoded by the myotonic dystrophy (DM) locus on human chromosome 19q13.3. It is a close relative of other kinases that interact with members of the Rho family of small GTPases. We show here that the actin cytoskeleton-linked GTPase Rac-1 binds to DMPK, and coexpression of Rac-1 and DMPK activates its transphosphorylation activity in a GTP-sensitive manner. DMPK can also bind Raf-1 kinase, the Ras-activated molecule of the MAP kinase pathway. Purified Raf-1 kinase phosphorylates and activates DMPK. The interaction of DMPK with these distinct signals suggests that it may play a role as a nexus for cross-talk between their respective pathways and may partially explain the remarkable pleiotropy of DM.

  10. Enhancement of tunability of MAPK cascade due to coexistence of processive and distributive phosphorylation mechanisms.

    Science.gov (United States)

    Sun, Jianqiang; Yi, Ming; Yang, Lijian; Wei, Wenbin; Ding, Yiming; Jia, Ya

    2014-03-04

    The processive phosphorylation mechanism becomes important when there is macromolecular crowding in the cytoplasm. Integrating the processive phosphorylation mechanism with the traditional distributive one, we propose a mixed dual-site phosphorylation (MDP) mechanism in a single-layer phosphorylation cycle. Further, we build a degree model by applying the MDP mechanism to a three-layer mitogen-activated protein kinase (MAPK) cascade. By bifurcation analysis, our study suggests that the crowded-environment-induced pseudoprocessive mechanism can qualitatively change the response of this biological network. By adjusting the degree of processivity in our model, we find that the MAPK cascade is able to switch between the ultrasensitivity, bistability, and oscillatory dynamical states. Sensitivity analysis shows that the theoretical results remain unchanged within a reasonably chosen variation of parameter perturbation. By scaling the reaction rates and also introducing new connections into the kinetic scheme, we further construct a proportion model of the MAPK cascade to validate our findings. Finally, it is illustrated that the spatial propagation of the activated MAPK signal can be improved (or attenuated) by increasing the degree of processivity of kinase (or phosphatase). Our research implies that the MDP mechanism makes the MAPK cascade become a flexible signal module, and the coexistence of processive and distributive phosphorylation mechanisms enhances the tunability of the MAPK cascade.

  11. Signalling cascades integrating light-enhanced nitrate metabolism.

    Science.gov (United States)

    Lillo, Cathrine

    2008-10-01

    In higher plants, light is crucial for regulation of nitrate uptake, translocation and assimilation into organic compounds. Part of this metabolism is tightly coupled to photosynthesis because the enzymes involved, nitrite reductase and glutamate synthase, are localized to the chloroplasts and receive reducing power from photosynthetic electron transport. However, important enzymes in nitrate acquisition and reduction are localized to cellular compartments other than chloroplasts and are also up-regulated by light, i.e. transporters in cell and organellar membranes and nitrate reductase in the cytosol. This review describes the different light-dependent signalling cascades regulating nitrate metabolism at the transcriptional as well as post-transcriptional level, and how reactions in different compartments of the cell are co-ordinated. Essential players in this network are phytochrome and HY5 (long hypocotyls 5)/HYH (HY5 homologue)-dependent signalling pathways, the energy-related AMPK (AMP-activated protein kinase) protein kinase homologue SNRK1 (sucrose non-fermenting kinase 1-related kinase), chloroplastic thioredoxins and the prokaryotically originated PII protein. A complex light-dependent network of regulation emerges, which appears to be necessary for optimal nitrogen assimilation and for avoiding the accumulation of toxic intermediates and side products, such as nitrite and reactive oxygen compounds.

  12. CASCADE: Introducing AI into CBT.

    Science.gov (United States)

    Hendley, R. J.; Jurascheck, N.

    1992-01-01

    Discusses changes in training requirements of commerce and industry in the United Kingdom and describes a project, CASCADE, that was developed to investigate and implement the introduction of artificial intelligence (AI) techniques into computer-based training (CBT). An overview of pilot projects in higher education settings is provided. (eight…

  13. Unsteady transonic flow in cascades

    Science.gov (United States)

    Surampudi, S. P.; Adamczyk, J. J.

    1984-01-01

    There is a need for methods to predict the unsteady air loads associated with flutter of turbomachinery blading at transonic speeds. The results of such an analysis in which the steady relative flow approaching a cascade of thin airfoils is assumed to be transonic, irrotational, and isentropic is presented. The blades in the cascade are allowed to undergo a small amplitude harmonic oscillation which generates a small unsteady flow superimposed on the existing steady flow. The blades are assumed to oscillate with a prescribed motion of constant amplitude and interblade phase angle. The equations of motion are obtained by linearizing about a uniform flow the inviscid nonheat conducting continuity and momentum equations. The resulting equations are solved by employing the Weiner Hopf technique. The solution yields the unsteady aerodynamic forces acting on the cascade at Mach number equal to 1. Making use of an unsteady transonic similarity law, these results are compared with the results obtained from linear unsteady subsonic and supersonic cascade theories. A parametric study is conducted to find the effects of reduced frequency, solidity, stagger angle, and position of pitching axis on the flutter.

  14. Azobenzene-functionalized cascade molecules

    DEFF Research Database (Denmark)

    Archut, A.; Vogtle, F.; De Cola, L.;

    1998-01-01

    Cascade molecules bearing up to 32 azobenzene groups in the periphery have been prepared from poly(propylene imine) dendrimers and N-hydroxysuccinimide esters. The dendritic azobenzene species show similar isomerization properties as the corresponding azobenzene monomers. The all-E azobenzene...

  15. Applications of cascade multilevel inverters

    Institute of Scientific and Technical Information of China (English)

    彭方正; 钱照明

    2003-01-01

    Cascade multilevel inverters have been developed for electric utility applications. A cascade M-level inverter consists of (M-1)/2 H-bridges in which each bridge's dc voltage is supported by its own dc capacitor. The new inverter can: (1) generate almost sinusoidal waveform voltage while only switching one time per fundamental cycle; (2) dispense with multi-pulse inverters' transformers used in conventional utility interfaces and static var compensators; (3) enables direct parallel or series transformer-less connection to medium- and high-voltage power systems. In short, the cascade inverter is much more efficient and suitable for utility applications than traditional multi-pulse and pulse width modulation (PWM) inverters. The authors have experimentally demonstrated the superiority of the new inverter for power supply, (hybrid) electric vehicle (EV) motor drive, reactive power (var) and harmonic compensation. This paper summarizes the features, feasibility, and control schemes of the cascade inverter for utility applications including utility interface of renewable energy, voltage regulation, var compensation, and harmonic filtering in power systems. Analytical, simulated, and experimental results demonstrated the superiority of the new inverters.

  16. Applications of cascade multilevel inverters

    Institute of Scientific and Technical Information of China (English)

    彭方正; 钱照明

    2003-01-01

    Cascade multilevel inverters have been developed for electric utility applications. A cascade M-level inverter consists of (M-1)/2 H-bridges in which each bridge's dc voltage is supported by its own de ca-pacitor. The new inverter can : ( 1 ) generate almost sinusoidal waveform voltage while only switching one timeper fundamental cycle ; (2) dispense with multi-pulse inverters' transformers used in conventional utility in-terfaces and static var compensators; (3) enables direct parallel or series transformer-less connection to medium- and high-voltage power systems. In short, the cascade inverter is much more efficient and suitable for utility applications than traditional multi-pulse and pulse width modulation (PWM) inverters. The authors have experimentally demonstrated the superiority of the new inverter for power supply, (hybrid) electric vehicle (EV) motor drive, reactive power (var) and harmonic compensation. This paper summarizes the features,feasibility, and control schemes of the cascade inverter for utility applications including utility interface of renewable energy, voltage regulation, var compensation, and harmonic filtering in power systems. Analytical,simulated, and experimental results demonstrated the superiority of the new inverters.

  17. Rice Mitogen-activated Protein Kinase Gene Family and Its Role in Biotic and Abiotic Stress Response

    Institute of Scientific and Technical Information of China (English)

    Jai S. Rohila; Yinong Yang

    2007-01-01

    The mitogen-activated protein kinase (MARK) cascade is an important signaling module that transduces extracellular stimuli into intracellular responses in eukaryotic organisms. An increasing body of evidence has shown that the MAPK-mediated cellular signaling is crucial to plant growth and development, as well as biotic and abiotic stress responses. To date, a total of 17 MARK genes have been identified from the rice genome. Expression profiling, biochemical characterization and/or functional analysis were carried out with many members of the rice MARK gene family, especially those associated with biotic and abiotic stress responses. In this review, the phylogenetic relationship and classification of rice MARK genes are discussed to facilitate a simple nomenclature and standard annotation of the rice MARK gene family. Functional data relating to biotic and abiotic stress responses are reviewed for each MARK group and show that despite overlapping in functionality, there is a certain level of functional specificity among different rice MAP kinases. The future challenges are to functionally characterize each MARK, to identify their downstream substrates and upstream kinases, and to genetically manipulate the MARK signaling pathway in rice crops for the improvement of agronomically important traits.

  18. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    Science.gov (United States)

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  19. Cascaded Bragg scattering in fiber optics.

    Science.gov (United States)

    Xu, Y Q; Erkintalo, M; Genty, G; Murdoch, S G

    2013-01-15

    We report on a theoretical and experimental study of cascaded Bragg scattering in fiber optics. We show that the usual energy-momentum conservation of Bragg scattering can be considerably relaxed via cascade-induced phase-matching. Experimentally we demonstrate frequency translation over six- and 11-fold cascades, in excellent agreement with derived phase-matching conditions.

  20. US geothermal database and Oregon cascade thermal studies: (Final report)

    Energy Technology Data Exchange (ETDEWEB)

    Blackwell, D.D.; Steele, J.L.; Carter, L.

    1988-05-01

    This report describes two tasks of different nature. The first of these tasks was the preparation of a data base for heat flow and associated ancillary information for the United States. This data base is being used as the basis for preparation of the United States portion of a geothermal map of North America. The ''Geothermal Map of North America'' will be published as part of the Decade of North American Geology (DNAG) series of the Geological Society of America. The second of these tasks was to make a geothermal evaluation of holes drilled in the Cascade Range as part of a Department of Energy (DOE)/Industry co-sponsored deep drilling project. This second task involved field work, making temperature logs in the holes, and laboratory work, measuring thermal conductivity measurements on an extensive set of samples from these holes. The culmination of this task was an interpretation of heat flow values in terms of the regional thermal conditions; implications for geothermal systems in the Cascade Range; evaluation of the effect of groundwater flow on the depths that need to be drilled for successful measurements in the Cascade Range; and investigation of the nature of the surface groundwater effects on the temperature-depth curves. 40 refs., 7 figs., 7 tabs.

  1. Cross-phosphorylation of bacterial serine/threonine and tyrosine protein kinases on key regulatory residues

    Directory of Open Access Journals (Sweden)

    Lei eShi

    2014-09-01

    Full Text Available Bacteria possess protein serine/threonine and tyrosine kinases which resemble eukaryal kinases in their capacity to phosphorylate multiple substrates. We hypothesized that the analogy might extend further, and bacterial kinases may also undergo mutual phosphorylation and activation, which is currently considered as a hallmark of eukaryal kinase networks. In order to test this hypothesis, we explored the capacity of all members of four different classes of serine/threonine and tyrosine kinases present in the firmicute model organism Bacillus subtilis to phosphorylate each other in vitro and interact with each other in vivo. The interactomics data suggested a high degree of connectivity among all types of kinases, while phosphorylation assays revealed equally wide-spread cross-phosphorylation events. Our findings suggest that the Hanks-type kinases PrkC, PrkD and YabT exhibit the highest capacity to phosphorylate other B. subtilis kinases, while the BY-kinase PtkA and the two-component-like kinases RsbW and SpoIIAB show the highest propensity to be phosphorylated by other kinases. Analysis of phosphorylated residues on several selected recipient kinases suggests that most cross-phosphorylation events concern key regulatory residues. Therefore, cross-phosphorylation events are very likely to influence the capacity of recipient kinases to phosphorylate substrates downstream in the signal transduction cascade. We therefore conclude that bacterial serine/threonine and tyrosine kinases probably engage in a network-type behavior previously described only in eukaryal cells.

  2. and MAP kinases in tomato flower abscission

    African Journals Online (AJOL)

    Academic Journals

    2012-06-07

    Jun 7, 2012 ... signals that are generated from the perception of extra- ... each treatment were placed into a container with a glass cover (40. × 25 × 20 cm3) and ... amplified products that would produce a detectable CT value, and therefore ...

  3. Optimally Training a Cascade Classifier

    CERN Document Server

    Shen, Chunhua; Hengel, Anton van den

    2010-01-01

    Cascade classifiers are widely used in real-time object detection. Different from conventional classifiers that are designed for a low overall classification error rate, a classifier in each node of the cascade is required to achieve an extremely high detection rate and moderate false positive rate. Although there are a few reported methods addressing this requirement in the context of object detection, there is no a principled feature selection method that explicitly takes into account this asymmetric node learning objective. We provide such an algorithm here. We show a special case of the biased minimax probability machine has the same formulation as the linear asymmetric classifier (LAC) of \\cite{wu2005linear}. We then design a new boosting algorithm that directly optimizes the cost function of LAC. The resulting totally-corrective boosting algorithm is implemented by the column generation technique in convex optimization. Experimental results on object detection verify the effectiveness of the proposed bo...

  4. Bankruptcy Cascades in Interbank Markets

    Science.gov (United States)

    Tedeschi, Gabriele; Mazloumian, Amin; Gallegati, Mauro; Helbing, Dirk

    2012-01-01

    We study a credit network and, in particular, an interbank system with an agent-based model. To understand the relationship between business cycles and cascades of bankruptcies, we model a three-sector economy with goods, credit and interbank market. In the interbank market, the participating banks share the risk of bad debits, which may potentially spread a bank’s liquidity problems through the network of banks. Our agent-based model sheds light on the correlation between bankruptcy cascades and the endogenous economic cycle of booms and recessions. It also demonstrates the serious trade-off between, on the one hand, reducing risks of individual banks by sharing them and, on the other hand, creating systemic risks through credit-related interlinkages of banks. As a result of our study, the dynamics underlying the meltdown of financial markets in 2008 becomes much better understandable. PMID:23300760

  5. Thermal cascaded lattice Boltzmann method

    CERN Document Server

    Fei, Linlin

    2016-01-01

    In this paper, a thermal cascaded lattice Boltzmann method (TCLBM) is developed in combination with the double-distribution-function (DDF) approach. A density distribution function relaxed by the cascaded scheme is employed to solve the flow field, and a total energy distribution function relaxed by the BGK scheme is used to solve temperature field, where two distribution functions are coupled naturally. The forcing terms are incorporated by means of central moments, which is consistent with the previous force scheme [Premnath \\emph{et al.}, Phys. Rev. E \\textbf{80}, 036702 (2009)] but the derivation is more intelligible and the evolution process is simpler. In the method, the viscous heat dissipation and compression work are taken into account, the Prandtl number and specific-heat ratio are adjustable, the external force is considered directly without the Boussinesq assumption, and the low-Mach number compressible flows can also be simulated. The forcing scheme is tested by simulating a steady Taylor-Green f...

  6. Bankruptcy cascades in interbank markets.

    Science.gov (United States)

    Tedeschi, Gabriele; Mazloumian, Amin; Gallegati, Mauro; Helbing, Dirk

    2012-01-01

    We study a credit network and, in particular, an interbank system with an agent-based model. To understand the relationship between business cycles and cascades of bankruptcies, we model a three-sector economy with goods, credit and interbank market. In the interbank market, the participating banks share the risk of bad debits, which may potentially spread a bank's liquidity problems through the network of banks. Our agent-based model sheds light on the correlation between bankruptcy cascades and the endogenous economic cycle of booms and recessions. It also demonstrates the serious trade-off between, on the one hand, reducing risks of individual banks by sharing them and, on the other hand, creating systemic risks through credit-related interlinkages of banks. As a result of our study, the dynamics underlying the meltdown of financial markets in 2008 becomes much better understandable.

  7. Bankruptcy cascades in interbank markets.

    Directory of Open Access Journals (Sweden)

    Gabriele Tedeschi

    Full Text Available We study a credit network and, in particular, an interbank system with an agent-based model. To understand the relationship between business cycles and cascades of bankruptcies, we model a three-sector economy with goods, credit and interbank market. In the interbank market, the participating banks share the risk of bad debits, which may potentially spread a bank's liquidity problems through the network of banks. Our agent-based model sheds light on the correlation between bankruptcy cascades and the endogenous economic cycle of booms and recessions. It also demonstrates the serious trade-off between, on the one hand, reducing risks of individual banks by sharing them and, on the other hand, creating systemic risks through credit-related interlinkages of banks. As a result of our study, the dynamics underlying the meltdown of financial markets in 2008 becomes much better understandable.

  8. Lens Coupled Quantum Cascade Laser

    Science.gov (United States)

    Hu, Qing (Inventor); Lee, Alan Wei Min (Inventor)

    2013-01-01

    Terahertz quantum cascade (QC) devices are disclosed that can operate, e.g., in a range of about 1 THz to about 10 THz. In some embodiments, QC lasers are disclosed in which an optical element (e.g., a lens) is coupled to an output facet of the laser's active region to enhance coupling of the lasing radiation from the active region to an external environment. In other embodiments, terahertz amplifier and tunable terahertz QC lasers are disclosed.

  9. Plant protein kinase genes induced by drought, high salt and cold stresses

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Drought, high salt and cold are three different kinds of environment stresses that severely influence the growth, development and productivity of crops. They all decrease the water state of plant cells, and consequently result in the harm of plant from water deficit. Several genes encoding protein kinases and induced by drought, high salt and low temperature have been isolated from Arabidopsis. These protein kinases include receptor protein kinase (RPK), MAP kinases, ribosomal-protein kinases and transcription-regulation protein kinase. The expression features of these genes and the regulatory roles of these protein kinases in stress response and signal transduction are discussed.

  10. Cytokine-induced activation of Mixed Lineage Kinase 3 requires TRAF2 and TRAF6

    OpenAIRE

    Korchnak, Amanda C.; Zhan, Yu; Aguilar, Michael T.; Chadee, Deborah N.

    2009-01-01

    Mixed Lineage Kinase 3 (MLK3) is a mitogen-activated protein kinase kinase kinase (MAP3K) that activates multiple mitogen activated protein kinase (MAPK) pathways in response to growth factors, stresses and the pro-inflammatory cytokine, tumor necrosis factor (TNF). MLK3 is required for optimal activation of stress activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) signaling by TNF, however, the mechanism by which MLK3 is recruited and activated by the TNF receptor remains poorly und...

  11. Mass spectrometry and site-directed mutagenesis identify several autophosphorylated residues required for the activity of PrkC, a Ser/Thr kinase from Bacillus subtilis

    DEFF Research Database (Denmark)

    Madec, Edwige; Stensballe, Allan; Kjellström, Sven

    2003-01-01

    We have shown recently that PrkC, which is involved in developmental processes in Bacillus subtilis, is a Ser/Thr kinase with features of the receptor kinase family of eukaryotic Hanks kinases. In this study, we expressed and purified from Escherichia coli the cytoplasmic domain of PrkC containing......C signalling cascade or for coupling to other signalling pathways. This is the first structure-function analysis of a bacterial receptor-like kinase of the Hanks family....

  12. Global mapping of protein phosphorylation events identifies Ste20, Sch9 and the cell-cycle regulatory kinases Cdc28/Pho85 as mediators of fatty acid starvation responses in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Pultz, Dennis; Bennetzen, Martin V; Rødkær, Steven Vestergaard

    2012-01-01

    Synthesis, degradation, and metabolism of fatty acids are strictly coordinated to meet the nutritional and energetic needs of cells and organisms. In the absence of exogenous fatty acids, proliferation and growth of the yeast Saccharomyces cerevisiae depends on endogenous synthesis of fatty acids...... identified as being regulated in a temporal manner in response to inhibition of fatty acid synthesis by cerulenin. By bioinformatic analysis of these phosphorylation events, we have identified the cell cycle kinases Cdc28 and Pho85, the PAK kinase Ste20 as well as the protein kinase Sch9 as central mediators...

  13. Turbulence: does energy cascade exist?

    CERN Document Server

    Josserand, Christophe; Lehner, Thierry; Pomeau, Yves

    2016-01-01

    To answer the question whether a cascade of energy exists or not in turbulence, we propose a set of correlation functions able to test if there is an irreversible transfert of energy, step by step, from large to small structures. These tests are applied to real Eulerian data of a turbulent velocity flow, taken in the wind grid tunnel of Modane, and also to a prototype model equation for wave turbulence. First we demonstrate the irreversible character of the flow by using multi-time correlation function at a given point of space. Moreover the unexpected behavior of the test function leads us to connect irreversibility and finite time singularities (intermittency). Secondly we show that turbulent cascade exists, and is a dynamical process, by using a test function depending on time and frequency. The cascade shows up only in the inertial domain where the kinetic energy is transferred more rapidly (on average) from the wavenumber $k_{1}$ to $k_{2}$ than from $k_{1}$ to $k'_{2}$ larger than $k_{2}$.

  14. Control of Cascaded Multilevel Inverters

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    Abstract-A new type of multilevel inverter is introduced which is created by cascading two three-phase three-level inverters using the load connection, but requires only one DC voltage source. This new inverter can operateas a seven-level inverter and naturally splits the power conversion into a higher-voltage lower-frequency inverter and a lower-voltage higher-fre-quency inverter. This type of system presents particular advantages to Naval ship propulsion systems which rely on high power quality, survivable drives. New control methods are described involving both joint and separate control of the individual three-level inverters. Simulation resuits demonstrate the effectiveness of both controls. A laboratory set-up at the Naval Surface Warfare Center power electronics laboratory was used to validate the proposed joint-inverter control. Due to the effect of compounding levels in the cascaded inverter, a high number of levels are available resulting in a voltage THD of 9% (without filtering). Index Terms-Cascaded inverter, multilevel inverter, three-level inverter.

  15. An ant colony based resilience approach to cascading failures in cluster supply network

    Science.gov (United States)

    Wang, Yingcong; Xiao, Renbin

    2016-11-01

    Cluster supply chain network is a typical complex network and easily suffers cascading failures under disruption events, which is caused by the under-load of enterprises. Improving network resilience can increase the ability of recovery from cascading failures. Social resilience is found in ant colony and comes from ant's spatial fidelity zones (SFZ). Starting from the under-load failures, this paper proposes a resilience method to cascading failures in cluster supply chain network by leveraging on social resilience of ant colony. First, the mapping between ant colony SFZ and cluster supply chain network SFZ is presented. Second, a new cascading model for cluster supply chain network is constructed based on under-load failures. Then, the SFZ-based resilience method and index to cascading failures are developed according to ant colony's social resilience. Finally, a numerical simulation and a case study are used to verify the validity of the cascading model and the resilience method. Experimental results show that, the cluster supply chain network becomes resilient to cascading failures under the SFZ-based resilience method, and the cluster supply chain network resilience can be enhanced by improving the ability of enterprises to recover and adjust.

  16. Collective influence maximization in threshold models of information cascading with first-order transitions

    CERN Document Server

    Pei, Sen; Shaman, Jeffrey; Morone, Flaviano; Makse, Hernán A

    2016-01-01

    In spreading dynamics in social networks, there exists an optimal set of influencers whose activation can induce a global-scale cascade of information. To find the optimal, or minimal, set of spreaders, a method based on collective influence theory has been proposed for spreading dynamics with a continuous phase transition that can be mapped to optimal percolation. However, when it comes to diffusion processes exhibiting a first-order, or discontinuous transition, identifying the set of optimal spreaders with a linear algorithm for large-scale networks still remains a challenging task. Here we address this issue by exploring the collective influence in general threshold models of opinion cascading. Our analysis reveals that the importance of spreaders is fixed by the subcritical paths along which cascades propagate: the number of subcritical paths attached to each spreader determines its contribution to global cascades. The concept of subcritical path allows us to introduce a linearly scalable algorithm for m...

  17. The Crystal Structure of Cancer Osaka Thyroid Kinase Reveals an Unexpected Kinase Domain Fold*

    Science.gov (United States)

    Gutmann, Sascha; Hinniger, Alexandra; Fendrich, Gabriele; Drückes, Peter; Antz, Sylvie; Mattes, Henri; Möbitz, Henrik; Ofner, Silvio; Schmiedeberg, Niko; Stojanovic, Aleksandar; Rieffel, Sebastien; Strauss, André; Troxler, Thomas; Glatthar, Ralf; Sparrer, Helmut

    2015-01-01

    Macrophages are important cellular effectors in innate immune responses and play a major role in autoimmune diseases such as rheumatoid arthritis. Cancer Osaka thyroid (COT) kinase, also known as mitogen-activated protein kinase kinase kinase 8 (MAP3K8) and tumor progression locus 2 (Tpl-2), is a serine-threonine (ST) kinase and is a key regulator in the production of pro-inflammatory cytokines in macrophages. Due to its pivotal role in immune biology, COT kinase has been identified as an attractive target for pharmaceutical research that is directed at the discovery of orally available, selective, and potent inhibitors for the treatment of autoimmune disorders and cancer. The production of monomeric, recombinant COT kinase has proven to be very difficult, and issues with solubility and stability of the enzyme have hampered the discovery and optimization of potent and selective inhibitors. We developed a protocol for the production of recombinant human COT kinase that yields pure and highly active enzyme in sufficient yields for biochemical and structural studies. The quality of the enzyme allowed us to establish a robust in vitro phosphorylation assay for the efficient biochemical characterization of COT kinase inhibitors and to determine the x-ray co-crystal structures of the COT kinase domain in complex with two ATP-binding site inhibitors. The structures presented in this study reveal two distinct ligand binding modes and a unique kinase domain architecture that has not been observed previously. The structurally versatile active site significantly impacts the design of potent, low molecular weight COT kinase inhibitors. PMID:25918157

  18. The cystic fibrosis transmembrane recruiter the alter ego of CFTR as a multi-kinase anchor.

    Science.gov (United States)

    Mehta, Anil

    2007-11-01

    This review focuses on a newly discovered interaction between protein kinases involved in cellular energetics, a process that may be disturbed in cystic fibrosis for unknown reasons. I propose a new model where kinase-mediated cellular transmission of energy provides mechanistic insight to a latent role of the cystic fibrosis transmembrane conductance regulator (CFTR). I suggest that CFTR acts as a multi-kinase recruiter to the apical epithelial membrane. My group finds that, in the cytosol, two protein kinases involved in cell energy homeostasis, nucleoside diphosphate kinase (NDPK) and AMP-activated kinase (AMPK), bind one another. Preliminary data suggest that both can also bind CFTR (function unclear). The disrupted role of this CFTR-kinase complex as 'membrane transmitter to the cell' is proposed as an alternative paradigm to the conventional ion transport mediated and CFTR/chloride-centric view of cystic fibrosis pathogenesis. Chloride remains important, but instead, chloride-induced control of the phosphohistidine content of one kinase component (NDPK, via a multi-kinase complex that also includes a third kinase, CK2; formerly casein kinase 2). I suggest that this complex provides the necessary near-equilibrium conditions needed for efficient transmission of phosphate energy to proteins controlling cellular energetics. Crucially, a new role for CFTR as a kinase controller is proposed with ionic concentration acting as a signal. The model posits a regulatory control relay for energy sensing involving a cascade of protein kinases bound to CFTR.

  19. Energy cascades in the upper ocean

    Institute of Scientific and Technical Information of China (English)

    Ray Q.Lin; Scott Chubb

    2006-01-01

    Wave-wave interactions cause energy cascades. These are the most important processes in the upper ocean because they govern wave-growth and dissipation. Through indirect cascades, wave energy is transferred from higher frequencies to lower frequencies, leading to wave growth. In direct cascades, energy is transferred from lower frequencies to the higher frequencies, which causes waves to break, and dissipation of wave energy. However, the evolution and origin of energy cascade processes are still not fully understood. In particular, for example, results from a recent theory (Kalmykov, 1998) suggest that the class I wave-wave interactions (defined by situations involving 4-, 6-, 8-, etc, even numbers of resonantly interacting waves) cause indirect cascades, and Class II wave-wave interactions (involving, 5-, 7-, 9-, etc, .., odd numbers of waves) cause direct cascades. In contrast to this theory, our model results indicate the 4-wave interactions can cause significant transfer of wave energy through both direct and indirect cascades. In most situations, 4-wave interactions provide the major source of energy transfer for both direct cascades and indirect cascades, except when the wave steepness is larger than 0.28. Our model results agree well with wave measurements, obtained using field buoy data (for example, Lin and Lin, 2002). In particular, in these observations, asymmetrical wave-wave interactions were studied. They found that direct and indirect cascades both are mainly due to the 4-wave interactions when wave steepness is less than 0.3.

  20. Induction of ERK-kinase signalling triggers morphotype-specific killing of Candida albicans filaments by human neutrophils.

    Science.gov (United States)

    Wozniok, Iwona; Hornbach, Anke; Schmitt, Corinna; Frosch, Matthias; Einsele, Hermann; Hube, Bernhard; Löffler, Jürgen; Kurzai, Oliver

    2008-03-01

    Candida albicans is among the most important fungal pathogens in humans. Morphological plasticity has been linked to its pathogenic potential as filamentous forms are associated with tissue invasion and infection. Here we show that human neutrophils discriminate between yeasts and filaments of C. albicans. Whereas filaments induced targeted motility, resulting in the establishment of close contact between neutrophils and fungal cells, yeast forms were largely ignored during coincubation. In transwell assays, C. albicans filaments induced significantly higher migratory activity in neutrophils than yeasts. Neutrophil motility based on actin rearrangement was essential for killing of C. albicans filaments but not involved in killing of yeast forms. Using inhibitors for MAP-kinase cascades, it was shown that recognition of C. albicans filaments by neutrophils is mediated via the MEK/ERK cascade and independent of JNK or p38 activation. Inhibition of the ERK signalling pathway abolished neutrophil migration induced by C. albicans filaments and selectively impaired the ability to kill this morphotype. These data show that invasive filamentous forms of C. albicans trigger a morphotype-specific activation of neutrophils, which is strongly dependent on neutrophil motility. Therefore, human neutrophils are capable of sensing C. albicans invasion and initiating an appropriate early immune response.

  1. A Comparison of Methods for Cascade Prediction

    CERN Document Server

    Guo, Ruocheng

    2016-01-01

    Information cascades exist in a wide variety of platforms on Internet. A very important real-world problem is to identify which information cascades can go viral. A system addressing this problem can be used in a variety of applications including public health, marketing and counter-terrorism. As a cascade can be considered as compound of the social network and the time series. However, in related literature where methods for solving the cascade prediction problem were proposed, the experimental settings were often limited to only a single metric for a specific problem formulation. Moreover, little attention was paid to the run time of those methods. In this paper, we first formulate the cascade prediction problem as both classification and regression. Then we compare three categories of cascade prediction methods: centrality based, feature based and point process based. We carry out the comparison through evaluation of the methods by both accuracy metrics and run time. The results show that feature based met...

  2. Disaster Mythology and Availability Cascades

    Directory of Open Access Journals (Sweden)

    Lisa Grow Sun

    2013-04-01

    Full Text Available Sociological research conducted in the aftermath of natural disasters has uncovered a number of “disaster myths” – widely shared misconceptions about typical post-disaster human behavior. This paper discusses the possibility that perpetuation of disaster mythology reflects an “availability cascade,” defined in prior scholarship as a “self-reinforcing process of collective belief formation by which an expressed perception triggers a chain reaction that gives the perception increasing plausibility through its rising availability in public discourse.” (Kuran and Sunstein 1999. Framing the spread of disaster mythology as an availability cascade suggests that certain tools may be useful in halting the myths’ continued perpetuation. These tools include changing the legal and social incentives of so-called “availability entrepreneurs” – those principally responsible for beginning and perpetuating the cascade, as well as insulating decision-makers from political pressures generated by the availability cascade. This paper evaluates the potential effectiveness of these and other solutions for countering disaster mythology. Las investigaciones sociológicas realizadas tras los desastres naturales han hecho evidentes una serie de “mitos del desastre”, conceptos erróneos ampliamente compartidos sobre el comportamiento humano típico tras un desastre. Este artículo analiza la posibilidad de que la perpetuación de los mitos del desastre refleje una “cascada de disponibilidad”, definida en estudios anteriores como un “proceso de auto-refuerzo de la formación de una creencia colectiva, a través del que una percepción expresada produce una reacción en cadena que hace que la percepción sea cada vez más verosímil, a través de una mayor presencia en el discurso público” (Kuran y Sunstein 1999. Enmarcar la propagación de los mitos del desastre como una cascada de disponibilidad sugiere que ciertas herramientas pueden ser

  3. Spray formation: an inverse cascade

    CERN Document Server

    Ling, Yue; Tryggvason, Gretar; zaleski, Stephane

    2015-01-01

    We present a study of droplet formation in a gas-liquid mixing layer using direct numerical simulation. It is seen that two mechanisms compete to generate the droplets: fingering at the tip of the waves and hole formation in the thin liquid sheet. The three dimensional liquid structures are much shorter than the longitudinal wavelength of the instability at the first instant of their formation. As time evolves, the structures evolves to larger and larger scales, in a way similar to the inverse cascade of length scales in droplet impact and impact crown formation.

  4. Novel protein kinase signaling systems regulating lifespan identified by small molecule library screening using Drosophila.

    Directory of Open Access Journals (Sweden)

    Stephen R Spindler

    Full Text Available Protein kinase signaling cascades control most aspects of cellular function. The ATP binding domains of signaling protein kinases are the targets of most available inhibitors. These domains are highly conserved from mammals to flies. Herein we describe screening of a library of small molecule inhibitors of protein kinases for their ability to increase Drosophila lifespan. We developed an assay system which allowed screening using the small amounts of materials normally present in commercial chemical libraries. The studies identified 17 inhibitors, the majority of which targeted tyrosine kinases associated with the epidermal growth factor receptor (EGFR, platelet-derived growth factor (PDGF/vascular endothelial growth factor (VEGF receptors, G-protein coupled receptor (GPCR, Janus kinase (JAK/signal transducer and activator of transcription (STAT, the insulin and insulin-like growth factor (IGFI receptors. Comparison of the protein kinase signaling effects of the inhibitors in vitro defined a consensus intracellular signaling profile which included decreased signaling by p38MAPK (p38, c-Jun N-terminal kinase (JNK and protein kinase C (PKC. If confirmed, many of these kinases will be novel additions to the signaling cascades known to regulate metazoan longevity.

  5. Novel protein kinase signaling systems regulating lifespan identified by small molecule library screening using Drosophila.

    Science.gov (United States)

    Spindler, Stephen R; Li, Rui; Dhahbi, Joseph M; Yamakawa, Amy; Sauer, Frank

    2012-01-01

    Protein kinase signaling cascades control most aspects of cellular function. The ATP binding domains of signaling protein kinases are the targets of most available inhibitors. These domains are highly conserved from mammals to flies. Herein we describe screening of a library of small molecule inhibitors of protein kinases for their ability to increase Drosophila lifespan. We developed an assay system which allowed screening using the small amounts of materials normally present in commercial chemical libraries. The studies identified 17 inhibitors, the majority of which targeted tyrosine kinases associated with the epidermal growth factor receptor (EGFR), platelet-derived growth factor (PDGF)/vascular endothelial growth factor (VEGF) receptors, G-protein coupled receptor (GPCR), Janus kinase (JAK)/signal transducer and activator of transcription (STAT), the insulin and insulin-like growth factor (IGFI) receptors. Comparison of the protein kinase signaling effects of the inhibitors in vitro defined a consensus intracellular signaling profile which included decreased signaling by p38MAPK (p38), c-Jun N-terminal kinase (JNK) and protein kinase C (PKC). If confirmed, many of these kinases will be novel additions to the signaling cascades known to regulate metazoan longevity.

  6. Lateral Modes in Quantum Cascade Lasers

    Directory of Open Access Journals (Sweden)

    Gregory C. Dente

    2016-03-01

    Full Text Available We will examine the waveguide mode losses in ridge-guided quantum cascade lasers. Our analysis illustrates how the low-loss mode for broad-ridge quantum cascade lasers (QCLs can be a higher-order lateral waveguide mode that maximizes the feedback from the sloped ridge-wall regions. The results are in excellent agreement with the near- and far-field data taken on broad-ridge-guided quantum cascade lasers processed with sloped ridge walls.

  7. Cascades on clique-based graphs

    CERN Document Server

    Hackett, Adam

    2013-01-01

    We present an analytical approach to determining the expected cascade size in a broad range of dynamical models on the class of highly-clustered random graphs introduced in [J. P. Gleeson, Phys. Rev. E 80, 036107 (2009)]. A condition for the existence of global cascades is also derived. Applications of this approach include analyses of percolation, and Watts's model. We show how our techniques can be used to study the effects of in-group bias in cascades on social networks.

  8. Staphylococcal PknB as the First Prokaryotic Representative of the Proline-Directed Kinases

    NARCIS (Netherlands)

    Miller, Malgorzata; Donat, Stefanie; Rakette, Sonja; Stehle, Thilo; Kouwen, Thijs R. H. M.; Diks, Sander H.; Dreisbach, Annette; Reilman, Ewoud; Gronau, Katrin; Becher, Doerte; Peppelenbosch, Maikel P.; van Dijl, Jan Maarten; Ohlsen, Knut

    2010-01-01

    In eukaryotic cell types, virtually all cellular processes are under control of proline-directed kinases and especially MAP kinases. Serine/threonine kinases in general were originally considered as a eukaryote-specific enzyme family. However, recent studies have revealed that orthologues of eukaryo

  9. WHISTLER TURBULENCE FORWARD CASCADE VERSUS INVERSE CASCADE: THREE-DIMENSIONAL PARTICLE-IN-CELL SIMULATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Ouliang [Oracle Corporation, Redwood Shores, CA (United States); Gary, S. Peter [Space Science Institute, Boulder, CO (United States); Wang, Joseph, E-mail: ouliang@usc.edu, E-mail: pgary@lanl.gov, E-mail: josephjw@usc.edu [University of Southern California, Los Angeles, CA (United States)

    2015-02-20

    We present the results of the first fully three-dimensional particle-in-cell simulations of decaying whistler turbulence in a magnetized, homogeneous, collisionless plasma in which both forward cascades to shorter wavelengths, and inverse cascades to longer wavelengths are allowed to proceed. For the electron beta β {sub e} = 0.10 initial value considered here, the early-time rate of inverse cascade is very much smaller than the rate of forward cascade, so that at late times the fluctuation energy in the regime of the inverse cascade is much weaker than that in the forward cascade regime. Similarly, the wavevector anisotropy in the inverse cascade regime is much weaker than that in the forward cascade regime.

  10. Unsteady transonic flow over cascade blades

    Science.gov (United States)

    Surampudi, S. P.; Adamczyk, J. J.

    1986-01-01

    An attempt is made to develop an efficient staggered cascade blade unsteady aerodynamics model for the neighborhood of March 1, representing the blade row by a rectilinear two-dimensional cascade of thin, flat plate airfoils. The equations of motion are derived on the basis of linearized transonic small perturbation theory, and an analytical solution is obtained by means of the Wiener-Hopf procedure. Making use of the transonic similarity law, the results obtained are compared with those of other linearized cascade analyses. A parametric study is conducted to find the effects of reduced frequency, stagger angle, solidity, and the location of the pitching axis on cascade stability.

  11. Contingency Analysis of Cascading Line Outage Events

    Energy Technology Data Exchange (ETDEWEB)

    Thomas L Baldwin; Magdy S Tawfik; Miles McQueen

    2011-03-01

    As the US power systems continue to increase in size and complexity, including the growth of smart grids, larger blackouts due to cascading outages become more likely. Grid congestion is often associated with a cascading collapse leading to a major blackout. Such a collapse is characterized by a self-sustaining sequence of line outages followed by a topology breakup of the network. This paper addresses the implementation and testing of a process for N-k contingency analysis and sequential cascading outage simulation in order to identify potential cascading modes. A modeling approach described in this paper offers a unique capability to identify initiating events that may lead to cascading outages. It predicts the development of cascading events by identifying and visualizing potential cascading tiers. The proposed approach was implemented using a 328-bus simplified SERC power system network. The results of the study indicate that initiating events and possible cascading chains may be identified, ranked and visualized. This approach may be used to improve the reliability of a transmission grid and reduce its vulnerability to cascading outages.

  12. Single-Seed Cascades on Clustered Networks

    CERN Document Server

    McSweeney, John K

    2015-01-01

    We consider a dynamic network cascade process developed by Watts applied to a random networks with a specified amount of clustering, belonging to a class of random networks developed by Newman. We adapt existing tree-based methods to formulate an appropriate two-type branching process to describe the spread of a cascade started with a single active node, and obtain a fixed-point equation to implicitly express the extinction probability of such a cascade. In so doing, we also recover a special case of a formula of Hackett et al. giving conditions for certain extinction of the cascade.

  13. Identification of Geologic Contrasts from Landscape Dissection Pattern: an Application to Cascade Range, Oregon

    Science.gov (United States)

    Luo, W.; Stepinski, T. F.

    2007-12-01

    In this study we demonstrate the plausibility of inferring the spatial variability of geology from topographically derived landscape dissection patterns. This enables surveying large regions for spatial variability in geology, for which direct remote sensing is not feasible, by studying variability in dissection pattern, a feature extracted straight off from remotely sensed topography. Dissection pattern is obtained automatically by a novel algorithm, especially designed to delineate the valleys with high accuracy in order to reflect spatial variability in dissection density. The dissection pattern is encapsulated by a continuous map of drainage density, a raster variable best suited for showing spatial variability of dissection. Such a map, constructed for the study area in the Cascade Range, Oregon, shows a sharp discontinuity in the dissection pattern, indicating change in underlying geology. We also check for climate and the local and regional slopes as possible factors controlling the dissection pattern, but geology has been found to be the dominant controlling factor on the basis of statistical analysis. As it happens the dissection contrast coincides with the boundary between the Western and High Cascades, two geologic provinces with different ages and rock types. Older and less permeable Western Cascades are associated with denser dissection pattern, whereas the younger and more permeable High Cascades correspond to less dissected pattern. We envision applying our mapping method to locations where remotely sensed topography is the only available data, and the generated map could be used to extract previously unknown geologic or environmental information.

  14. Identification of geologic contrasts from landscape dissection pattern: An application to the Cascade Range, Oregon, USA

    Science.gov (United States)

    Luo, Wei; Stepinski, Tomasz

    2008-07-01

    This paper demonstrates the plausibility of inferring the spatial variability of geology from topographically derived landscape dissection patterns. This enables surveying large regions for spatial variability in geology, for which direct remote sensing is not feasible, by studying variability in dissection pattern, a feature extracted straight off from digital elevation model data. Dissection pattern is obtained automatically by a novel algorithm, especially designed to delineate the valleys with high accuracy in order to reflect spatial variability in dissection density. The dissection pattern is encapsulated by a continuous map of drainage density, a raster variable best suited for showing spatial variability of dissection. Such a map, constructed for the study area in the Cascade Range, Oregon, USA, shows a sharp discontinuity in the dissection pattern, indicating change in underlying geology. Possible factors controlling the dissection pattern such as climate, local and regional slopes, vegetation, and geology are examined, and geology has been found to be the dominant controlling factor. The dissection contrast coincides with the boundary between the Western and High Cascades, two geologic provinces with different rock ages and types. The older and less permeable Western Cascades are associated with denser dissection pattern, whereas the younger and more permeable High Cascades correspond to less dissected pattern. This new mapping method can be applied to locations where topography is the only readily available data, and the generated map could be used to extract previously unknown geologic or environmental information.

  15. Time evolution of cascade decay

    CERN Document Server

    Boyanovsky, Daniel

    2014-01-01

    We study non-perturbatively the time evolution of cascade decay for generic fields $\\pi \\rightarrow \\phi_1\\phi_2\\rightarrow \\phi_2\\chi_1\\chi_2$ and obtain the time dependence of amplitudes and populations for the resonant and final states. We analyze in detail the different time scales and the manifestation of unitary time evolution in the dynamics of production and decay of resonant intermediate and final states. The probability of occupation (population) ``flows'' as a function of time from the initial to the final states. When the decay width of the parent particle $\\Gamma_\\pi$ is much larger than that of the intermediate resonant state $\\Gamma_{\\phi_1}$ there is a ``bottleneck'' in the flow, the population of resonant states builds up to a maximum at $t^* = \\ln[\\Gamma_\\pi/\\Gamma_{\\phi_1}]/(\\Gamma_\\pi-\\Gamma_{\\phi_1})$ nearly saturating unitarity and decays to the final state on the longer time scale $1/\\Gamma_{\\phi_1}$. As a consequence of the wide separation of time scales in this case the cascade decay ...

  16. Multifunctional Cascaded Metamaterials: Integrated Transmitarrays

    Science.gov (United States)

    Elsakka, Amr A.; Asadchy, Viktar S.; Faniayeu, Ihar A.; Tcvetkova, Svetlana N.; Tretyakov, Sergei A.

    2016-10-01

    Control of electromagnetic waves using engineered materials is very important in a wide range of applications, therefore there is always a continuous need for new and more efficient solutions. Known natural and artificial materials and surfaces provide a particular functionality in the frequency range they operate but cast a "shadow" and produce reflections at other frequencies. Here, we introduce a concept of multifunctional engineered materials that possess different predetermined functionalities at different frequencies. Such response can be accomplished by cascading metasurfaces (thin composite layers) that are designed to perform a single operation at the desired frequency and are transparent elsewhere. Previously, out-of-band transparent metasurfaces for control over reflection and absorption were proposed. In this paper, to complete the full set of functionalities for wave control, we synthesize transmitarrays that tailor transmission in a desired way, being "invisible" beyond the operational band. The designed transmitarrays for wavefront shaping and anomalous refraction are tested numerically and experimentally. To demonstrate our concept of multifunctional engineered materials, we have designed a cascade of three metasurfaces that performs three different functions for waves at different frequencies. Remarkably, applied to volumetric metamaterials, our concept can enable a single composite possessing desired multifunctional response.

  17. Protein kinases: mechanisms and downstream targets in inflammation-mediated obesity and insulin resistance.

    Science.gov (United States)

    Nandipati, Kalyana C; Subramanian, Saravanan; Agrawal, Devendra K

    2017-02-01

    Obesity-induced low-grade inflammation (metaflammation) impairs insulin receptor signaling. This has been implicated in the development of insulin resistance. Insulin signaling in the target tissues is mediated by stress kinases such as p38 mitogen-activated protein kinase, c-Jun NH2-terminal kinase, inhibitor of NF-kB kinase complex β (IKKβ), AMP-activated protein kinase, protein kinase C, Rho-associated coiled-coil containing protein kinase, and RNA-activated protein kinase. Most of these kinases phosphorylate several key regulators in glucose homeostasis. The phosphorylation of serine residues in the insulin receptor and IRS-1 molecule results in diminished enzymatic activity in the phosphatidylinositol 3-kinase (PI3K)/Akt pathway. This has been one of the key mechanisms observed in the tissues that are implicated in insulin resistance especially in type 2 diabetes mellitus (T2-DM). Identifying the specific protein kinases involved in obesity-induced chronic inflammation may help in developing the targeted drug therapies to minimize the insulin resistance. This review is focused on the protein kinases involved in the inflammatory cascade and molecular mechanisms and their downstream targets with special reference to obesity-induced T2-DM.

  18. Revised tephra volumes for Cascade Range volcanoes

    Science.gov (United States)

    Nathenson, Manuel

    2017-07-01

    Isopach maps from tephra eruptions from Mount St. Helens were reported in Carey et al. (1995) and for tephra eruptions from Glacier Peak in Gardner et al. (1998). For exponential thinning, the isopach data only define a single slope on a log thickness versus square root of area plot. Carey et al. (1995) proposed a model that was used to estimate a second slope, and volumes were presented in both studies using this model. A study by Sulpizio (2005) for estimating the second slope and square root of area where the lines intersect involves a systematic analysis of many eruptions to provide correlation equations. The purpose of this paper is to recalculate the volumes of Cascades eruptions and compare results from the two methods. In order to gain some perspective on the methods for estimating the second slope, we use data for thickness versus distance beyond the last isopach that are available for some of the larger eruptions in the Cascades. The thickness versus square root of area method is extended to thickness versus distance by developing an approximate relation between the two assuming elliptical isopachs with the source at one of the foci. Based on the comparisons made between the Carey et al. (1995) and Sulpizio (2005) methods, it is felt that the later method provides a better estimate of the second slope. For Mount St. Helens, the estimates of total volume using the Sulpizio (2005) method are generally smaller than those using the Carey et al. (1995) method. For the volume estimates of Carey et al. (1995), the volume of the May 18, 1980, eruption of Mount St. Helens is smaller than six of the eight previous eruptions. With the new volumes using the Sulpizio (2005) method, the 1980 eruption is smaller in volume than the upper end of the range for only three of the layers (Wn, Ye, and Yn) and is the same size as layer We. Thus the 1980 eruption becomes representative of the mid-range of volumes rather than being in the lower range.

  19. Revised tephra volumes for Cascade Range volcanoes

    Science.gov (United States)

    Nathenson, Manuel

    2017-01-01

    Isopach maps from tephra eruptions from Mount St. Helens were reported in Carey et al. (1995) and for tephra eruptions from Glacier Peak in Gardner et al. (1998). For exponential thinning, the isopach data only define a single slope on a log thickness versus square root of area plot. Carey et al. (1995) proposed a model that was used to estimate a second slope, and volumes were presented in both studies using this model. A study by Sulpizio (2005) for estimating the second slope and square root of area where the lines intersect involves a systematic analysis of many eruptions to provide correlation equations. The purpose of this paper is to recalculate the volumes of Cascades eruptions and compare results from the two methods. In order to gain some perspective on the methods for estimating the second slope, we use data for thickness versus distance beyond the last isopach that are available for some of the larger eruptions in the Cascades. The thickness versus square root of area method is extended to thickness versus distance by developing an approximate relation between the two assuming elliptical isopachs with the source at one of the foci. Based on the comparisons made between the Carey et al. (1995) and Sulpizio (2005) methods, it is felt that the later method provides a better estimate of the second slope. For Mount St. Helens, the estimates of total volume using the Sulpizio (2005) method are generally smaller than those using the Carey et al. (1995) method. For the volume estimates of Carey et al. (1995), the volume of the May 18, 1980, eruption of Mount St. Helens is smaller than six of the eight previous eruptions. With the new volumes using the Sulpizio (2005) method, the 1980 eruption is smaller in volume than the upper end of the range for only three of the layers (Wn, Ye, and Yn) and is the same size as layer We. Thus the 1980 eruption becomes representative of the mid-range of volumes rather than being in the lower range.

  20. Human biliverdin reductase suppresses Goodpasture antigen-binding protein (GPBP) kinase activity: the reductase regulates tumor necrosis factor-alpha-NF-kappaB-dependent GPBP expression.

    Science.gov (United States)

    Miralem, Tihomir; Gibbs, Peter E M; Revert, Fernando; Saus, Juan; Maines, Mahin D

    2010-04-23

    The Ser/Thr/Tyr kinase activity of human biliverdin reductase (hBVR) and the expression of Goodpasture antigen-binding protein (GPBP), a nonconventional Ser/Thr kinase for the type IV collagen of basement membrane, are regulated by tumor necrosis factor (TNF-alpha). The pro-inflammatory cytokine stimulates kinase activity of hBVR and activates NF-kappaB, a transcriptional regulator of GPBP mRNA. Increased GPBP activity is associated with several autoimmune conditions, including Goodpasture syndrome. Here we show that in HEK293A cells hBVR binds to GPBP and down-regulates its TNF-alpha-stimulated kinase activity; this was not due to a decrease in GPBP expression. Findings with small interfering RNA to hBVR and to the p65 regulatory subunit of NF-kappaB show the hBVR role in the initial stimulation of GPBP expression by TNF-alpha-activated NF-kappaB; hBVR was not a factor in mediating GPBP mRNA stability. The interacting domain was mapped to the (281)CX(10)C motif in the C-terminal 24 residues of hBVR. A 7-residue peptide, KKRILHC(281), corresponding to the core of the consensus D(delta)-Box motif in the interacting domain, was as effective as the intact 296-residue hBVR polypeptide in inhibiting GPBP kinase activity. GPBP neither regulated hBVR expression nor TNF-alpha dependent NF-kappaB expression. Collectively, our data reveal that hBVR is a regulator of the TNF-alpha-GPBP-collagen type IV signaling cascade and uncover a novel biological interaction that may be of relevance in autoimmune pathogenesis.

  1. Domain compatibility in Ire1 kinase is critical for the Unfolded Protein Response

    OpenAIRE

    Poothong, Juthakorn; Sopha, Pattarawut; Kaufman, Randal J.; Tirasophon, Witoon

    2010-01-01

    The unfolded phrotein response is a mechanism to cope with endoplasmic reticulum stress. In Saccharomyces cerevisiae, Ire1 senses the stress and mediates a signaling cascade to upregulate responsive genes through an unusual HAC1 mRNA splicing. The splicing requires interconnected activity (kinase and endoribonuclease) of Ire1 to cleave HAC1 mRNA at the non-canonical splice sites before translation into Hac1 transcription factor. Analysis of the truncated kinase domain from Ire1 homologs revea...

  2. Mixed Lineage Kinase-c-Jun N-Terminal Kinase Axis: A Potential Therapeutic Target in Cancer.

    Science.gov (United States)

    Rana, Ajay; Rana, Basabi; Mishra, Rajakishore; Sondarva, Gautam; Rangasamy, Velusamy; Das, Subhasis; Viswakarma, Navin; Kanthasamy, Anumantha

    2013-09-01

    Mixed lineage kinases (MLKs) are members of the mitogen-activated protein kinase kinase kinase (MAP3K) family and are reported to activate MAP kinase pathways. There have been at least 9 members of the MLK family identified to date, although the physiological functions of all the family members are yet unknown. However, MLKs in general have been implicated in neurodegenerative diseases, including Parkinson and Alzheimer diseases. Recent reports suggest that some of the MLK members could play a role in cancer via modulating cell migration, invasion, cell cycle, and apoptosis. This review article will first describe the biology of MLK members and then discuss the current progress that relates to their functions in cancer.

  3. A redox-regulated tyrosine phosphorylation cascade in rat spermatozoa.

    Science.gov (United States)

    Lewis, B; Aitken, R J

    2001-01-01

    Rat spermatozoa from both the caput and cauda epididymidis were shown to generate superoxide anion (O2-.) both spontaneously and following stimulation with NAD(P)H. Caput spermatozoa gave a significantly greater O2- response to NADPH stimulation than caudal cells, whereas in both cell types the responses to exogenous NADPH and NADH were approximately equivalent. Analysis of H2O2 production revealed that this oxidant was generated only by caudal epididymal cells and only in these cells did the stimulation of reactive oxygen species (ROS) production with NADPH lead to an increase in tyrosine phosphorylation. Stimulation of ROS production with NADPH increased intracellular cyclic adenosine monophosphate (cAMP) levels in both caput and caudal epididymal cells, but only in caudal cells did cAMP stimulate tyrosine phosphorylation, in keeping with the NADPH results. On the basis of these findings we propose that tyrosine phosphorylation in rat spermatozoa is driven by ROS acting via 2 different but complementary mechanisms; O2-. stimulates tyrosine kinase activity indirectly through the elevation of intracellular cAMP while H2O2 acts directly on the kinase/phosphatase system, stimulating the former and inhibiting the latter. Zinc was examined as a potential regulator of this signal transduction cascade and was shown to suppress tyrosine phosphorylation in caput cells but to promote this activity in caudal spermatozoa, possibly through an inhibitory effect on tyrosine phosphatase activity. These results reveal the maturation of a redox-regulated, cAMP-mediated, signal transduction cascade during epididymal transit in the rat that is sensitive to zinc and plays a key role in the control of tyrosine phosphorylation events associated with capacitation.

  4. FLOODPLAIN, CASCADE COUNTY, MONTANA, USA

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — The Floodplain Mapping/Redelineation study deliverables depict and quantify the flood risks for the study area. The primary risk classifications used are the...

  5. Mutation analysis of mitogen activated protein kinase 1 gene in Indian cases of 46,XY disorder of sex development

    Directory of Open Access Journals (Sweden)

    Dhanjit Kumar Das

    2013-01-01

    Full Text Available Background: Determination of sex is the result of cascade of molecular events that cause undifferentiated bipotential gonad to develop as a testis or an ovary. A series of genes such as SRY, steroidogenic factor-1 (SF1, AR, SRD5 α, Desert hedgehog (DHH etc., have been reported to have a significant role in development of sex in the fetus and secondary sexual characteristics at the time of puberty. Recently, mitogen activated protein kinase kinase kinase 1 (MAP3K1 gene was found to be associated with 46, XY disorders of sex development (DSD. Aim: The present study is focused to identify mutations in MAP3K1 gene in the cohort of 10 Indian patients with 46,XY DSD including one family with two affected sisters. These patients were already screened for SRY, SF1 and DHH gene, but no mutation was observed in any of these genes. Materials and Methods: The entire coding regions of MAP3K1 were amplified and sequenced using the gene specific primers. Results and Discussions: Sequence analysis of MAP3K1 gene has revealed four variants including one missense, two silent and one deletion mutation. The missense mutation p.D806N was observed in four patients with hypospadias. Two patients showed the presence of silent mutation p.Q1028Q present in exon 14. Another silent mutation p.T428T was observed in a patient with gonadal dysgenesis. We have also observed one deletion mutation p. 942insT present in two patients. The pathogenicity of the missense mutation p.D806N was carried out using in-silico approach. Sequence homology analysis has revealed that the aspartate at 806 was found to be well-conserved across species, indicated the importance of this residue. The score for polyphen analysis of this mutation was found to be 0.999 indicating to be pathogenic mutation. Since, p.D806N mutation was found to be important residue; it might contribute to sexual development. We have reported the presence of mutations/polymorphism in MAP3K1 gene. All the mutations were

  6. A NOTE ON VECTOR CASCADE ALGORITHM

    Institute of Scientific and Technical Information of China (English)

    Qiu-hui Chen; Jin-zhao Liu; Wen-sheng Zhang

    2002-01-01

    The focus of this paper is on the relationship between accuracy of multivariate refinable vector and vector cascade algorithm. We show that, if the vector cascade algorithm (1.5) with isotropic dilation converges to a vector-valued function with regularity, then the initial function must satisfy the Strang-Fix conditions.

  7. DISTURBANCE ATTENUATION FOR UNCERTAIN NONLINEAR CASCADED SYSTEMS

    Institute of Scientific and Technical Information of China (English)

    BI Weiping; MU Xiaowu; SUN Yuqiang

    2004-01-01

    In present paper, the disturbance attenuation problem of uncertain nonlinear cascaded systems is studied. Based on the adding one power integrator technique and recursive design, a feedback controller that solves the disturbance attenuation problem is constructed for uncertain nonlinear cascaded systems with internal stability.

  8. Cascade Harvest’ red raspberry

    Science.gov (United States)

    Cascade Harvest’ is a new floricane fruiting raspberry cultivar (Rubus idaeus L.) jointly released by Washington State University (WSU), Oregon State University (OSU) and the U.S. Department of Agriculture (USDA). ‘Cascade Harvest’ produces a high yield of large, firm fruit suited to machine harves...

  9. Cascading costs: An economic nitrogen cycle

    Institute of Scientific and Technical Information of China (English)

    William R. Moomaw; Melissa B. L. Birch

    2005-01-01

    The chemical nitrogen cycle is becoming better characterized in terms of fluxes and reservoirs on a variety of scales. Galloway has demonstrated that reactive nitrogen can cascade through multiple ecosystems causing environmental damage at each stage before being denitrifled to N2. We propose to construct a parallel economic nitrogen cascade (ENC) in which economic impacts of nitrogen fluxes can be estimated by the costs associated with each stage of the chemical cascade. Using economic data for the benefits of damage avoided and costs of mitigation in the Chesapeake Bay basin, we have constructed an economic nitrogen cascade for the region. Since a single tonne of nitrogen can cascade through the system, the costs also cascade.Therefore evaluating the benefits of mitigating a tonne of reactive nitrogen released needs to consider the damage avoided in all of the ecosystems through which that tonne would cascade.The analysis reveals that it is most cost effective to remove a tonne of nitrogen coming from combustion since it has the greatest impact on human health and creates cascading damage through the atmospheric, terrestrial, aquatic and coastal ecosystems. We will discuss the implications of this analysis for determining the most cost effective policy option for achieving environmental quality goals.

  10. Cep-1347 (KT7515), a semisynthetic inhibitor of the mixed lineage kinase family.

    Science.gov (United States)

    Maroney, A C; Finn, J P; Connors, T J; Durkin, J T; Angeles, T; Gessner, G; Xu, Z; Meyer, S L; Savage, M J; Greene, L A; Scott, R W; Vaught, J L

    2001-07-06

    CEP-1347 (KT7515) promotes neuronal survival at dosages that inhibit activation of the c-Jun amino-terminal kinases (JNKs) in primary embryonic cultures and differentiated PC12 cells after trophic withdrawal and in mice treated with 1-methyl-4-phenyl tetrahydropyridine. In an effort to identify molecular target(s) of CEP-1347 in the JNK cascade, JNK1 and known upstream regulators of JNK1 were co-expressed in Cos-7 cells to determine whether CEP-1347 could modulate JNK1 activation. CEP-1347 blocked JNK1 activation induced by members of the mixed lineage kinase (MLK) family (MLK3, MLK2, MLK1, dual leucine zipper kinase, and leucine zipper kinase). The response was selective because CEP-1347 did not inhibit JNK1 activation in cells induced by kinases independent of the MLK cascade. CEP-1347 inhibition of recombinant MLK members in vitro was competitive with ATP, resulting in IC(50) values ranging from 23 to 51 nm, comparable to inhibitory potencies observed in intact cells. In addition, overexpression of MLK3 led to death in Chinese hamster ovary cells, and CEP-1347 blocked this death at doses comparable to those that inhibited MLK3 kinase activity. These results identify MLKs as targets of CEP-1347 in the JNK signaling cascade and demonstrate that CEP-1347 can block MLK-induced cell death.

  11. Multifunctional Cascaded Metamaterials: Integrated Transmitarrays

    CERN Document Server

    Elsakka, Amr A; Faniayeu, Ihar A; Tcvetkova, Svetlana N; Tretyakov, Sergei A

    2016-01-01

    Control of electromagnetic waves using engineered materials is very important in a wide range of applications, therefore there is always a continuous need for new and more efficient solutions. Known natural and artificial materials and surfaces provide a particular functionality in the frequency range they operate but cast a "shadow" and produce reflections at other frequencies. Here, we introduce a concept of multifunctional engineered materials that possess different predetermined functionalities at different frequencies. Such response can be accomplished by cascading metasurfaces (thin composite layers) that are designed to perform a single operation at the desired frequency and are transparent elsewhere. Previously, out-of-band transparent metasurfaces for control over reflection and absorption were proposed. In this paper, to complete the full set of functionalities for wave control, we synthesize transmitarrays that tailor transmission in a desired way, being "invisible" beyond the operational band. The...

  12. Network reconstruction from infection cascades

    CERN Document Server

    Braunstein, Alfredo

    2016-01-01

    Reconstructing propagation networks from observations is a fundamental inverse problem, and it's crucial to understand and control dynamics in complex systems. Here we show that it is possible to reconstruct the whole structure of an interaction network and to simultaneously infer the complete time course of activation spreading, relying just on single snapshots of a small number of activity cascades. The method, that we called Inverse Dynamics Network Reconstruction (IDNR), is shown to work successfully on several synthetic and real networks, inferring the networks and the sources of infection based on sparse observations, including single snapshots. IDNR is built on a Belief Propagation approximation, that has an impressive performance in a wide variety of topological structures. The method can be applied in absence of complete time-series data by providing a detailed modeling of the posterior distribution of trajectories conditioned to the observations. Furthermore, we show by experiments that the informat...

  13. Cascades in interdependent flow networks

    CERN Document Server

    Scala, Antonio; Caldarelli, Guido; D'Agostino, Gregorio

    2015-01-01

    We investigate the abrupt breakdown behavior of coupled distribution grids under load growth. This scenario mimics the ever-increasing customer demand and the foreseen introduction of energy hubs interconnecting the different energy vectors. We extend an analytical model of cascading behavior due to line overloads to the case of interdependent networks and find evidence of first order transitions due to the long-range nature of the flows. Our results indicate that the foreseen increase in the couplings between the grids has two competing effects: on the one hand, it increases the safety region where grids can operate without withstanding systemic failures; on the other hand, it increases the possibility of a joint systems' failure.

  14. Availability Cascades & the Sharing Economy

    DEFF Research Database (Denmark)

    Netter, Sarah

    2014-01-01

    In search of a new concept that will provide answers to as to how modern societies should not only make sense but also resolve the social and environmental problems linked with our modes of production and consumption, collaborative consumption and the sharing economy are increasingly attracting...... attention. This conceptual paper attempts to explain the emergent focus on the sharing economy and associated business and consumption models by applying cascade theory. Risks associated with this behavior will be especially examined with regard to the sustainability claim of collaborative consumption....... With academics, practitioners, and civil society alike having a shared history in being rather fast in accepting new concepts that will not only provide business opportunities but also a good conscience, this study proposes a critical study of the implications of collaborative consumption, before engaging...

  15. Availability Cascades & the Sharing Economy

    DEFF Research Database (Denmark)

    Netter, Sarah

    2015-01-01

    In search of a new concept that will provide answers to as to how modern societies should not only make sense but also resolve the social and environmental problems linked with our modes of production and consumption, collaborative consumption and the sharing economy are increasingly attracting...... attention. This conceptual paper attempts to explain the emergent focus on the sharing economy and associated business and consumption models by applying cascade theory. Risks associated with this behavior will be especially examined with regard to the sustainability claim of collaborative consumption....... With academics, practitioners, and civil society alike having a shared history in being rather fast in accepting new concepts that will not only provide business opportunities but also a good conscience, this study proposes a critical study of the implications of collaborative consumption, before engaging...

  16. Stochastic annealing simulation of cascades in metals

    Energy Technology Data Exchange (ETDEWEB)

    Heinisch, H.L.

    1996-04-01

    The stochastic annealing simulation code ALSOME is used to investigate quantitatively the differential production of mobile vacancy and SIA defects as a function of temperature for isolated 25 KeV cascades in copper generated by MD simulations. The ALSOME code and cascade annealing simulations are described. The annealing simulations indicate that the above Stage V, where the cascade vacancy clusters are unstable,m nearly 80% of the post-quench vacancies escape the cascade volume, while about half of the post-quench SIAs remain in clusters. The results are sensitive to the relative fractions of SIAs that occur in small, highly mobile clusters and large stable clusters, respectively, which may be dependent on the cascade energy.

  17. Restoration of E-cadherin Cell-Cell Junctions Requires Both Expression of E-cadherin and Suppression of ERK MAP Kinase Activation in Ras-Transformed Breast Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Quanwen Li

    2008-12-01

    Full Text Available E-cadherin is a main component of the cell-cell adhesion junctions that play a principal role in maintaining normal breast epithelial cell morphology. Breast and other cancers that have up-regulated activity of Ras are often found to have down-regulated or mislocalized E-cadherin expression. Disruption of E-cadherin junctions and consequent gain of cell motility contribute to the process known as epithelial-to-mesenchymal transition (EMT. Enforced expression of E-cadherin or inhibition of Ras-signal transduction pathway has been shown to be effective in causing reversion of EMT in several oncogene-transformed and cancer-derived cell lines. In this study, we investigated MCF10A human breast epithelial cells and derivatives that were transformed with either activated H-Ras or N-Ras to test for the reversion of EMT by inhibition of Ras-driven signaling pathways. Our results demonstrated that inhibition of mitogen-activated protein kinase (MAPK kinase, but not PI3-kinase, Rac, or myosin light chain kinase, was able to completely restore E-cadherin cell-cell junctions and epithelial morphology in cell lines with moderate H-Ras expression. In MCF10A cells transformed by a high-level expression of activated H-Ras or N-Ras, restoration of E-cadherin junction required both the enforced re