Kadar, Masne; Ibrahim, Suhaili; Razaob, Nor Afifi; Chai, Siaw Chui; Harun, Dzalani
2018-02-01
The Lawton Instrumental Activities of Daily Living Scale is a tool often used to assess independence among elderly at home. Its suitability to be used with the elderly population in Malaysia has not been validated. This current study aimed to assess the validity and reliability of the Lawton Instrumental Activities of Daily Living Scale - Malay Version to Malay speaking elderly in Malaysia. This study was divided into three phases: (1) translation and linguistic validity involving both forward and backward translations; (2) establishment of face validity and content validity; and (3) establishment of reliability involving inter-rater, test-retest and internal consistency analyses. Data used for these analyses were obtained by interviewing 65 elderly respondents. Percentages of Content Validity Index for 4 criteria were from 88.89 to 100.0. The Cronbach α coefficient for internal consistency was 0.838. Intra-class Correlation Coefficient of inter-rater reliability and test-retest reliability was 0.957 and 0.950 respectively. The result shows that the Lawton Instrumental Activities of Daily Living Scale - Malay Version has excellent reliability and validity for use with the Malay speaking elderly people in Malaysia. This scale could be used by professionals to assess functional ability of elderly who live independently in community. © 2018 Occupational Therapy Australia.
THE INFLUENCE OF PRIVACY REGULATION ON URBAN MALAY FAMILIES LIVING IN TERRACE HOUSING
Directory of Open Access Journals (Sweden)
Ahmad Ahmad Hashim
2008-07-01
Full Text Available This paper reports on behavioral norms and territoriality as part of behavioral and environmental mechanisms used to regulate privacy among urban Malay families living in terrace housing. In-depth interview was employed involving 11 case studies of Malay families living in three-bedroom two-storey terrace housings in the urban areas. Findings indicate that while most of the behavioral norms employed to regulate privacy are consistent with Malay cultural norms and religious belief, there are a few which are not consistent due to the constraint of terrace housing. Defined territory and the need to respect the neighbors’ privacy are found to indirectly affect community intimacy among Malay families living in terrace housings.
Population genetic structure of peninsular Malaysia Malay sub-ethnic groups.
Hatin, Wan Isa; Nur-Shafawati, Ab Rajab; Zahri, Mohd-Khairi; Xu, Shuhua; Jin, Li; Tan, Soon-Guan; Rizman-Idid, Mohammed; Zilfalil, Bin Alwi
2011-04-05
Patterns of modern human population structure are helpful in understanding the history of human migration and admixture. We conducted a study on genetic structure of the Malay population in Malaysia, using 54,794 genome-wide single nucleotide polymorphism genotype data generated in four Malay sub-ethnic groups in peninsular Malaysia (Melayu Kelantan, Melayu Minang, Melayu Jawa and Melayu Bugis). To the best of our knowledge this is the first study conducted on these four Malay sub-ethnic groups and the analysis of genotype data of these four groups were compiled together with 11 other populations' genotype data from Indonesia, China, India, Africa and indigenous populations in Peninsular Malaysia obtained from the Pan-Asian SNP database. The phylogeny of populations showed that all of the four Malay sub-ethnic groups are separated into at least three different clusters. The Melayu Jawa, Melayu Bugis and Melayu Minang have a very close genetic relationship with Indonesian populations indicating a common ancestral history, while the Melayu Kelantan formed a distinct group on the tree indicating that they are genetically different from the other Malay sub-ethnic groups. We have detected genetic structuring among the Malay populations and this could possibly be accounted for by their different historical origins. Our results provide information of the genetic differentiation between these populations and a valuable insight into the origins of the Malay sub-ethnic groups in Peninsular Malaysia.
Population Genetic Structure of Peninsular Malaysia Malay Sub-Ethnic Groups
Hatin, Wan Isa; Nur-Shafawati, Ab Rajab; Zahri, Mohd-Khairi; Xu, Shuhua; Jin, Li; Tan, Soon-Guan; Rizman-Idid, Mohammed; Zilfalil, Bin Alwi
2011-01-01
Patterns of modern human population structure are helpful in understanding the history of human migration and admixture. We conducted a study on genetic structure of the Malay population in Malaysia, using 54,794 genome-wide single nucleotide polymorphism genotype data generated in four Malay sub-ethnic groups in peninsular Malaysia (Melayu Kelantan, Melayu Minang, Melayu Jawa and Melayu Bugis). To the best of our knowledge this is the first study conducted on these four Malay sub-ethnic groups and the analysis of genotype data of these four groups were compiled together with 11 other populations' genotype data from Indonesia, China, India, Africa and indigenous populations in Peninsular Malaysia obtained from the Pan-Asian SNP database. The phylogeny of populations showed that all of the four Malay sub-ethnic groups are separated into at least three different clusters. The Melayu Jawa, Melayu Bugis and Melayu Minang have a very close genetic relationship with Indonesian populations indicating a common ancestral history, while the Melayu Kelantan formed a distinct group on the tree indicating that they are genetically different from the other Malay sub-ethnic groups. We have detected genetic structuring among the Malay populations and this could possibly be accounted for by their different historical origins. Our results provide information of the genetic differentiation between these populations and a valuable insight into the origins of the Malay sub-ethnic groups in Peninsular Malaysia. PMID:21483678
THE INFLUENCE OF PRIVACY REGULATION ON URBAN MALAY FAMILIES LIVING IN TERRACE HOUSING
Ahmad Hariza Hashim; Zaiton Abdul Rahim
2008-01-01
This paper reports on behavioral norms and territoriality as part of behavioral and environmental mechanisms used to regulate privacy among urban Malay families living in terrace housing. In-depth interview was employed involving 11 case studies of Malay families living in three-bedroom two-storey terrace housings in the urban areas. Findings indicate that while most of the behavioral norms employed to regulate privacy are consistent with Malay cultural norms and religious belief, there are a...
Tay, Chin Yen; Mitchell, Hazel; Dong, Quanjiang; Goh, Khean-Lee; Dawes, Ian W; Lan, Ruiting
2009-06-19
Helicobacter pylori is a major gastric bacterial pathogen. This pathogen has been shown to follow the routes of human migration by their geographical origin and currently the global H. pylori population has been divided into six ancestral populations, three from Africa, two from Asia and one from Europe. Malaysia is made up of three major ethnic populations, Malay, Chinese and Indian, providing a good population for studying recent H. pylori migration and admixture. Seventy eight H. pylori isolates, including 27 Chinese, 35 Indian and 16 Malay isolates from Malaysia were analysed by multilocus sequence typing (MLST) of seven housekeeping genes and compared with the global MLST data. STRUCTURE analysis assigned the isolates to previously identified H. pylori ancestral populations, hpEastAsia, hpAsia2 and hpEurope, and revealed a new subpopulation, hspIndia, within hpAsia2. Statistical analysis allowed us to identify population segregation sites that divide the H. pylori populations and the subpopulations. The majority of Malay isolates were found to be grouped together with Indian isolates. The majority of the Malay and Indian H. pylori isolates share the same origin while the Malaysian Chinese H. pylori is distinctive. The Malay population, known to have a low infection rate of H. pylori, was likely to be initially H. pylori free and gained the pathogen only recently from cross infection from other populations.
Hoh, Boon-Peng; Deng, Lian; Julia-Ashazila, Mat Jusoh; Zuraihan, Zakaria; Nur-Hasnah, Ma'amor; Nur-Shafawati, Ab Rajab; Hatin, Wan Isa; Endom, Ismail; Zilfalil, Bin Alwi; Khalid, Yusoff; Xu, Shuhua
2015-07-22
Fine scale population structure of Malays - the major population in Malaysia, has not been well studied. This may have important implications for both evolutionary and medical studies. Here, we investigated the population sub-structure of Malay involving 431 samples collected from all states from peninsular Malaysia and Singapore. We identified two major clusters of individuals corresponding to the north and south peninsular Malaysia. On an even finer scale, the genetic coordinates of the geographical Malay populations are in correlation with the latitudes (R(2) = 0.3925; P = 0.029). This finding is further supported by the pairwise FST of Malay sub-populations, of which the north and south regions showed the highest differentiation (FST [North-south] = 0.0011). The collective findings therefore suggest that population sub-structure of Malays are more heterogenous than previously expected even within a small geographical region, possibly due to factors like different genetic origins, geographical isolation, could result in spurious association as demonstrated in our analysis. We suggest that cautions should be taken during the stage of study design or interpreting the association signals in disease mapping studies which are expected to be conducted in Malay population in the near future.
Yahya, Padillah; Sulong, Sarina; Harun, Azian; Wan Isa, Hatin; Ab Rajab, Nur-Shafawati; Wangkumhang, Pongsakorn; Wilantho, Alisa; Ngamphiw, Chumpol; Tongsima, Sissades; Zilfalil, Bin Alwi
2017-09-01
Malay, the main ethnic group in Peninsular Malaysia, is represented by various sub-ethnic groups such as Melayu Banjar, Melayu Bugis, Melayu Champa, Melayu Java, Melayu Kedah Melayu Kelantan, Melayu Minang and Melayu Patani. Using data retrieved from the MyHVP (Malaysian Human Variome Project) database, a total of 135 individuals from these sub-ethnic groups were profiled using the Affymetrix GeneChip Mapping Xba 50-K single nucleotide polymorphism (SNP) array to identify SNPs that were ancestry-informative markers (AIMs) for Malays of Peninsular Malaysia. Prior to selecting the AIMs, the genetic structure of Malays was explored with reference to 11 other populations obtained from the Pan-Asian SNP Consortium database using principal component analysis (PCA) and ADMIXTURE. Iterative pruning principal component analysis (ipPCA) was further used to identify sub-groups of Malays. Subsequently, we constructed an AIMs panel for Malays using the informativeness for assignment (I n ) of genetic markers, and the K-nearest neighbor classifier (KNN) was used to teach the classification models. A model of 250 SNPs ranked by I n , correctly classified Malay individuals with an accuracy of up to 90%. The identified panel of SNPs could be utilized as a panel of AIMs to ascertain the specific ancestry of Malays, which may be useful in disease association studies, biomedical research or forensic investigation purposes. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Dawes Ian W
2009-06-01
Full Text Available Abstract Background Helicobacter pylori is a major gastric bacterial pathogen. This pathogen has been shown to follow the routes of human migration by their geographical origin and currently the global H. pylori population has been divided into six ancestral populations, three from Africa, two from Asia and one from Europe. Malaysia is made up of three major ethnic populations, Malay, Chinese and Indian, providing a good population for studying recent H. pylori migration and admixture. Results Seventy eight H. pylori isolates, including 27 Chinese, 35 Indian and 16 Malay isolates from Malaysia were analysed by multilocus sequence typing (MLST of seven housekeeping genes and compared with the global MLST data. STRUCTURE analysis assigned the isolates to previously identified H. pylori ancestral populations, hpEastAsia, hpAsia2 and hpEurope, and revealed a new subpopulation, hspIndia, within hpAsia2. Statistical analysis allowed us to identify population segregation sites that divide the H. pylori populations and the subpopulations. The majority of Malay isolates were found to be grouped together with Indian isolates. Conclusion The majority of the Malay and Indian H. pylori isolates share the same origin while the Malaysian Chinese H. pylori is distinctive. The Malay population, known to have a low infection rate of H. pylori, was likely to be initially H. pylori free and gained the pathogen only recently from cross infection from other populations.
FTO variants are associated with obesity in the Chinese and Malay populations in Singapore.
Tan, Jonathan T; Dorajoo, Rajkumar; Seielstad, Mark; Sim, Xue Ling; Ong, Rick Twee-Hee; Chia, Kee Seng; Wong, Tien Yin; Saw, Seang Mei; Chew, Suok Kai; Aung, Tin; Tai, E-Shyong
2008-10-01
Association between genetic variants at the FTO locus and obesity has been consistently observed in populations of European ancestry and inconsistently in non-Europeans. The aim of this study was to examine the effects of FTO variants on obesity and type 2 diabetes in Southeast Asian populations. We examined associations between nine previously reported FTO single nucleotide polymorphisms (SNPs) with obesity, type 2 diabetes, and related traits in 4,298 participants (2,919 Chinese, 785 Malays, and 594 Asian Indians) from the 1998 Singapore National Health Survey (NHS98) and 2,996 Malays from the Singapore Malay Eye Study (SiMES). All nine SNPs exhibited strong linkage disequilibrium (r(2) = 0.6-0.99), and minor alleles were associated with obesity in the same direction as previous studies with effect sizes ranging from 0.42 to 0.68 kg/m(2) (P Chinese, 0.65 to 0.91 kg/m(2) (P Malays, and 0.52 to 0.64 kg/m(2) (P Malays after adjustment for age, sex, smoking, alcohol consumption, and exercise. The variants were also associated with type 2 diabetes, though not after adjustment for BMI (with the exception of the SiMES Malays: odds ratio 1.17-1.22; P Chinese and Malays in Singapore. Our data do not support the hypothesis that differences in allele frequency or genetic architecture underlie the lack of association observed in some populations of Asian ancestry. Examination of gene-environment interactions involving variants at this locus may provide further insights into the role of FTO in the pathogenesis of human obesity and diabetes.
Manaf, Siti M; NurWaliyuddin, Hanis Z A; Panneerchelvam, Sundararajulu; Zafarina, Zainuddin; Norazmi, Mohd N; Chambers, Geoffrey K; Edinur, Hisham A
2015-10-01
Human neutrophil antigens (HNA) are polymorphic and immunogenic proteins involved in the pathogenesis of neonatal alloimmune neutropenia, transfusion-related acute lung injury (TRALI) and transfusion-related alloimmune neutropenia. The characterisation of HNA at a population level is important for predicting the risk of alloimmunisation associated with blood transfusion and gestation and for anthropological studies. Blood samples from 192 healthy, unrelated Malays were collected and genotyped using polymerase chain reaction-sequence specific primers (HNA-1, -3, -4) and polymerase chain reaction-restriction fragment length polymorphisms (HNA-5). The group comprised 30 Banjar, 37 Bugis, 51 Champa, 39 Jawa and 35 Kelantan Malays. The most common HNA alleles in the Malays studied were HNA-1a (0.641-0.765), -3a (0.676-0.867), -4a (0.943-1.000) and -5a (0.529-0.910). According to principal coordinate plots constructed using HNA allele frequencies, the Malay sub-ethnic groups are closely related and grouped together with other Asian populations. The risks of TRALI or neonatal neutropenia were not increased for subjects with HNA-1, -3 and -4 loci even for donor and recipient or pairs from different Malay sub-ethnic groups. Nonetheless, our estimates showed significantly higher risks of HNA alloimmunisation during pregnancy and transfusion between Malays and other genetically differentiated populations such as Africans and Europeans. This study reports HNA allele and genotype frequencies for the five Malay sub-ethnic groups living in Peninsular Malaysia for the first time. These Malay sub-ethnic groups show closer genetic relationships with other Asian populations than with Europeans and Africans. The distributions of HNA alleles in other lineages of people living in Malaysia (e.g. Chinese, Indian and Orang Asli) would be an interesting subject for future study.
Anthropometric Measurements of the Human Distal Femur: A Study of the Adult Malay Population
Hussain, Fitdriyah; Abdul Kadir, Mohammed Rafiq; Zulkifly, Ahmad Hafiz; Sa'at, Azlin; Aziz, Azian Abd.; Hossain, Md. Golam; Kamarul, T.; Syahrom, Ardiyansyah
2013-01-01
The distal femurs of 100 subjects (50 men, 50 women) from the Malay population aged between 19 and 38 years were scanned to measure the anterior-posterior (AP) and medial-lateral (ML) width. The mean AP values were 64.02 ± 3.38 mm and 57.33 ± 3.26 mm for men and women, respectively, and the mean ML values were 74.91 ± 3.52 mm and 64.53 ± 3.07 mm. We compared our data to that published previously for the Chinese and Indian populations. It was found that the Malay population had smaller distal femur than that of the Chinese but was larger than that of the Indian population (P population, the variations in different Asian ethnicities may need to be considered when designing the appropriate knee implant. PMID:24294597
Anthropometric Measurements of the Human Distal Femur: A Study of the Adult Malay Population
Directory of Open Access Journals (Sweden)
Fitdriyah Hussain
2013-01-01
Full Text Available The distal femurs of 100 subjects (50 men, 50 women from the Malay population aged between 19 and 38 years were scanned to measure the anterior-posterior (AP and medial-lateral (ML width. The mean AP values were 64.02 ± 3.38 mm and 57.33 ± 3.26 mm for men and women, respectively, and the mean ML values were 74.91 ± 3.52 mm and 64.53 ± 3.07 mm. We compared our data to that published previously for the Chinese and Indian populations. It was found that the Malay population had smaller distal femur than that of the Chinese but was larger than that of the Indian population (P < 0.05. In conclusion, although it is well established that Asians have a smaller distal femur size than that of the Western population, the variations in different Asian ethnicities may need to be considered when designing the appropriate knee implant.
Anthropometric measurements of the human distal femur: a study of the adult Malay population.
Hussain, Fitdriyah; Abdul Kadir, Mohammed Rafiq; Zulkifly, Ahmad Hafiz; Sa'at, Azlin; Aziz, Azian Abd; Hossain, Golam; Kamarul, T; Syahrom, Ardiyansyah
2013-01-01
The distal femurs of 100 subjects (50 men, 50 women) from the Malay population aged between 19 and 38 years were scanned to measure the anterior-posterior (AP) and medial-lateral (ML) width. The mean AP values were 64.02 ± 3.38 mm and 57.33 ± 3.26 mm for men and women, respectively, and the mean ML values were 74.91 ± 3.52 mm and 64.53 ± 3.07 mm. We compared our data to that published previously for the Chinese and Indian populations. It was found that the Malay population had smaller distal femur than that of the Chinese but was larger than that of the Indian population (P < 0.05). In conclusion, although it is well established that Asians have a smaller distal femur size than that of the Western population, the variations in different Asian ethnicities may need to be considered when designing the appropriate knee implant.
Bai, Jordan; Abdul-Rahman, Muhammad Farid; Rifkin-Graboi, Anne; Chong, Yap-Seng; Kwek, Kenneth; Saw, Seang-Mei; Godfrey, Keith M; Gluckman, Peter D; Fortier, Marielle V; Meaney, Michael J; Qiu, Anqi
2012-01-01
We studied a sample of 75 Chinese, 73 Malay, and 29 Indian healthy neonates taking part in a cohort study to examine potential differences in neonatal brain morphology and white matter microstructure as a function of ethnicity using both structural T2-weighted magnetic resonance imaging (MRI) and diffusion tensor imaging (DTI). We first examined the differences in global size and morphology of the brain among the three groups. We then constructed the T2-weighted MRI and DTI atlases and employed voxel-based analysis to investigate ethnic differences in morphological shape of the brain from the T2-weighted MRI, and white matter microstructure measured by fractional anisotropy derived from DTI. Compared with Malay neonates, the brains of Indian neonates' tended to be more elongated in anterior and posterior axis relative to the superior-inferior axis of the brain even though the total brain volume was similar among the three groups. Although most anatomical regions of the brain were similar among Chinese, Malay, and Indian neonates, there were anatomical variations in the spinal-cerebellar and cortical-striatal-thalamic neural circuits among the three populations. The population-related brain regions highlighted in our study are key anatomical substrates associated with sensorimotor functions.
Inheritance pattern of lip prints among Malay population: A pilot study.
George, Renjith; Nora Afandi, Nurulain Syafinaz Binti; Zainal Abidin, Siti Nur Hayati Binti; Binti Ishak, Nur Ismawani; Soe, Htoo Htoo Kyaw; Ismail, Abdul Rashid Hj
2016-04-01
We assessed the resemblance of lip print patterns between parents and biological offspring in families of 31 Malay students as well as the distribution of different types of lip print in the study group. Only a few studies have successfully established the inheritance pattern of lip prints. Such studies can be population specific and need to be conducted in various populations. No such study have been conducted in Malay population in Malaysia, according to our knowledge. Present study was carried out to ascertain whether there is any inherence pattern in lip prints and thereby to investigate the potential role of lip prints in personal identification. We found 58.06% resemblance of lip print patterns between the parents and their biological offspring in our study. The influence of heredity in lip print pattern is still a new concept and there is lack of concrete evidence. The data from our study shows that there is potential influence of inheritance in the lip print patterns among the family members. Further researches involving larger samples size are suggested to derive more reliable and accurate results. The most common lip print pattern among the study group is type I (29.84%) followed by type II (23.12%), type III (22.45%), type I' (13.44%), type IV (9.54%) and type V (1.61%). Racial variations in lip print patterns and their prevalence may serve as an aid in forensic identification and crime scene investigation. The results of this pilot study will help in establishing guidelines for future researches on lip print analysis in Malaysia. Lip print patterns are unique and individualistic. However, there are some similarities in basic patterns of lip prints between family members which may be attributed to influence of inheritance. 1. To determine the inheritance pattern of lip prints among Malay family members of the student. 2. To identify the distribution of different types of lip prints among Malay population. and Observational pilot study. Lip prints of 124
Nur Hidayahtuljamilah Ramli
2012-01-01
The traditional Malay house is one of the richest components of Malay’s cultural heritage in Malaysia. Generally, the traditional Malay house is a reflection of the Malay community’s way of living. With greater global awareness of the environment and a renewed perspective on contemporary Malaysian architecture, architects and designers are once again looking for tropical solutions in building design. One of the main characteristics of traditional Malay house is that they are designed with a d...
Zainol Abidin, Nurdiana; Brown, Wendy J; Clark, Bronwyn; Muhamed, Ahmad Munir Che; Singh, Rabindarjeet
2016-10-01
We evaluated feasibility of physical activity measurement by accelerometry among older Malay adults living in semi-rural areas in Malaysia. Results showed that 95% of 146 participants (aged [SD] 67.6 [6.4] years) were compliant in wearing the accelerometer for at least five days. Fifteen participants were asked for re-wear the accelerometer because they did not have enough valid days during the first assessment. Participants wore the accelerometer an average of 15.3 hr in a 24-hr day, with 6.5 (1.2) valid wear days. No significant difference in valid wear day and time was found between men and women. Participants who are single provide more valid wear days compared with married participants (p < .05), and participants with higher levels of education provide longer periods of accelerometer wearing hours (p < .01). Eighty-seven percent of participants reported 'no issues' with wearing the meter. This study suggests that accelerometry is a feasible method to assess the physical activity level among older Malay adults living in semi-rural areas.
Bhuvanendran, Saatheeyavaane; Hussin, Hani M; Meran, Lila P; Anthony, Amy A; Zhang, Leilei; Burch, Lauranell H; Phua, Kia K; Ismail, Asma; Balaram, Prabha
2011-09-01
Typhoid fever is a major health problem with frequent outbreaks in Kelantan, Malaysia. Prevalence of TLR4 gene polymorphisms varies with ethnic groups (0-20%) and predisposean individual to gram-negative infections. The prevalence rate of TLR4 Asp299Gly and Thr399lle polymorphisms in the Malay population or the influence of these on typhoid fever susceptibility is not yet reported. 250 normal and 304 susceptible Malay individuals were investigated for these polymorphisms using allele-specific PCR and analysed for its association with typhoid fever susceptibility. The total prevalence of polymorphisms in the normal population was 4.8% in comparison to 12.5% in the susceptible population (p = 0.002). An increased frequency of both polymorphisms was observed in the susceptible population (p population and suggests that these polymorphisms confer a higher risk for typhoid, infection. The higher incidence of typhoid fever in Kelantan could be attributed to the higher percentage of Malays (95%) in this state. In order to reduce the incidence of this disease, people with these polymorphisms, can be prioritised for prophylactic strategies. Copyright © 2011 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Jerome, Collin
2012-01-01
This thesis examines Malay identity construction by focusing on the complex processes of self-identification among queer-identified Malays living in Malaysia and beyond. By analysing representations of queer Malays in the works of contemporary Malaysian Malay writers, scholars, and filmmakers, as well as queer Malays on the internet and in the diaspora, the thesis demonstrates how self-identifying gay, lesbian, bisexual, and transgendered Malays create and express their identities, and the wa...
DEFF Research Database (Denmark)
Bakker, P.
2003-01-01
Malay as a military contact language during the second world war. Structure, simplification, pidginisation......Malay as a military contact language during the second world war. Structure, simplification, pidginisation...
D1S80 (pMCT118) allele frequencies in a Malay population sample from Malaysia.
Koh, C L; Lim, M E; Ng, H S; Sam, C K
1997-01-01
The D1S80 allele frequencies in 124 unrelated Malays from the Malaysian population were determined and 51 genotypes and 19 alleles were encountered. The D1S80 frequency distribution met Hardy-Weinberg expectations. The observed heterozygosity was 0.80 and the power of discrimination was 0.96.
Rusli, B N; Amrina, K; Trived, S; Loh, K P; Shashi, M
2017-10-01
The 21-item English version of the Depression Anxiety Stress Scale (DASS-21) has been proposed as a method for assessing self-perceived depression, anxiety and stress over the past week in various clinical and nonclinical populations. Several Malay versions of the DASS-21 have been validated in various populations with varying success. One particular Malay version has been validated in various occupational groups (such as nurses and automotive workers) but not among male clinic outpatient attendees in Malaysia. To validate the Malay version of the DASS-21 (Malay-DASS-21) among male outpatient clinic attendees in Johor. A validation study with a random sample of 402 male respondents attending the outpatient clinic of a major public outpatient clinic in Johor Bahru and Segamat was carried out from January to March 2016. Construct validity of the Malay-DASS-21 was examined using Exploratory Factor Analysis (KMO = 0.947; Bartlett's test of sphericity is significant, pDASS- 21 and the internal consistency reliability using Cronbach's alpha. Construct validity of the Malay-DASS-21 based on eigenvalues and factor loadings to confirm the three factor structure (depression, anxiety, and stress) was acceptable. The internal consistency reliability of the factor construct was very impressive with Cronbach's alpha values in the range of 0.837 to 0.863. The present study showed that the Malay- DASS-21 has acceptable psychometric construct and high internal consistency reliability to measure self-perceived depression, anxiety and stress over the past week in male outpatient clinic attendees in Johor. Further studies are necessary to revalidate the Malay-DASS-21 across different populations and cultures, and using confirmatory factor analyses.
Implementation of Traditional Malay Design Values in Contemporary Malay Houses
Directory of Open Access Journals (Sweden)
Elham Hosseini
2016-05-01
Full Text Available Traditional houses are the most essential architectural experience that is in harmony with the people's culture, beliefs, environment and lifestyles. The development of design values in contemporary architecture by tracking traditional design values in architecture paves the way for arguments concerning the implementation of authentic Malay traditional house design values in contemporary Malay houses. In addition, it is hypothesized that the Malay traditional houses theoretically provide a constructive innovative framework for the design performance of the contemporary Malay house. In this research, data was compiled through field observation and documentary review. The evidence revealed that Malay traditional houses convey a concrete message of richness encompassing architectural design values and theoretical propositions. The credibility of the results was improved and confirmed by a confluence of evidence via a confirmation process. The findings suggested that there is a rich source of subjective support, lending proof to the premise of the research investigation. The research has highlighted the significance of traditional architectural design values towards innovative design in the architecture of contemporary Malay houses as a workable pattern for use in the design of contemporary architecture.
Rosman, Mohamad; Wong, Tien Y; Tay, Wan-Ting; Tong, Louis; Saw, Seang-Mei
2009-08-01
To describe the prevalence and the risk factors of undercorrected refractive error in an adult urban Malay population. This population-based, cross-sectional study was conducted in Singapore in 3280 Malay adults, aged 40 to 80 years. All individuals were examined at a centralized clinic and underwent standardized interviews and assessment of refractive errors and presenting and best corrected visual acuities. Distance presenting visual acuity was monocularly measured by using a logarithm of the minimum angle of resolution (logMAR) number chart at a distance of 4 m, with the participants wearing their "walk-in" optical corrections (spectacles or contact lenses), if any. Refraction was determined by subjective refraction by trained, certified study optometrists. Best corrected visual acuity was monocularly assessed and recorded in logMAR scores using the same test protocol as was used for presenting visual acuity. Undercorrected refractive error was defined as an improvement of at least 0.2 logMAR (2 lines equivalent) in the best corrected visual acuity compared with the presenting visual acuity in the better eye. The mean age of the subjects included in our study was 58 +/- 11 years, and 52% of the subjects were women. The prevalence rate of undercorrected refractive error among Singaporean Malay adults in our study (n = 3115) was 20.4% (age-standardized prevalence rate, 18.3%). More of the women had undercorrected refractive error than the men (21.8% vs. 18.8%, P = 0.04). Undercorrected refractive error was also more common in subjects older than 50 years than in subjects aged 40 to 49 years (22.6% vs. 14.3%, P Malay adults with refractive errors was higher than that of the Singaporean Chinese adults with refractive errors. Undercorrected refractive error is a significant cause of correctable visual impairment among Singaporean Malay adults, affecting one in five persons.
Moy, Foong Ming
2011-09-02
Vitamin D status is influenced by sun exposure, geographic latitude, daily outdoor activities, body surface exposed to sunlight and dietary intakes. Malaysia, is sunny all year round. However, the vitamin D status of this population especially among the healthy and free living adults is not known. Therefore a study of vitamin D status and associated factors was initiated among an existing Malay cohort in Kuala Lumpur. A total of 380 subjects were sampled to have their vitamin D status assessed using 25-hydroxyvitamin D (25(OH)D). A short questionnaire enquiring socio-demographic characteristics, exposure to sunlight and clothing style was administered. Their mean age was 48.5±5.2years and the mean 25(OH)D for males and females were 56.2±18.9nmol/L and 36.2±13.4nmol/L respectively. There were significant positive correlation for sun exposure score (r=0.27, pobesity, lifestyle behaviours and clothing style are directly associated with our participants especially females' low vitamin D status. Copyright © 2011 Elsevier B.V. All rights reserved.
Psychometric Evaluation of the Malay Satisfaction with Life Scale
Swami, Viren; Chamorro-Premuzic, Tomas
2009-01-01
The Satisfaction With Life Scale (SWLS) is one of the most widely used scales for the measurement of subjective well-being across the globe, but no satisfactory version exists for use among Malay-speaking populations. The present study reports on the translation of a new Malay SWLS and examines its psychometric properties in a community sample of…
Implementation of Traditional Malay Design Values in Contemporary Malay Houses
Elham Hosseini; Gurupiah Mursib; Raja Nafida Raja Shahminan
2016-01-01
Traditional houses are the most essential architectural experience that is in harmony with the people's culture, beliefs, environment and lifestyles. The development of design values in contemporary architecture by tracking traditional design values in architecture paves the way for arguments concerning the implementation of authentic Malay traditional house design values in contemporary Malay houses. In addition, it is hypothesized that the Malay traditional houses theoretically provide a co...
Directory of Open Access Journals (Sweden)
M. K. A. Rosli
2014-01-01
Full Text Available Three species of otter can be found throughout Malay Peninsula: Aonyx cinereus, Lutra sumatrana, and Lutrogale perspicillata. In this study, we focused on the A. cinereus population that ranges from the southern and the east coast to the northern regions of Malay Peninsula up to southern Thailand to review the relationships between the populations based on the mitochondrial D-loop region. Forty-eight samples from six populations were recognized as Johor, Perak, Terengganu, Kelantan, Ranong, and Thale Noi. Among the 48 samples, 33 were identified as A. cinereus, seven as L. sumatrana, and eight as L. perspicillata. Phylogenetically, two subclades formed for A. cinereus. The first subclade grouped all Malay Peninsula samples except for samples from Kelantan, and the second subclade grouped Kelantan samples with Thai sample. Genetic distance analysis supported the close relationships between Thai and Kelantan samples compared to the samples from Terengganu and the other Malaysian states. A minimum-spanning network showed that Kelantan and Thailand formed a haplogroup distinct from the other populations. Our results show that Thai subspecies A. cinereus may have migrated to Kelantan from Thai mainland. We also suggest the classification of a new subspecies from Malay Peninsula, the small-clawed otter named A. cinereus kecilensis.
Rosli, M K A; Syed-Shabthar, S M F; Abdul-Patah, P; Abdul-Samad, Z; Abdul, S N; Burhanuddin, M N; Zulkifli, N A; Shukor, M N; Budsabong, K; Changtragoon, S; Sekiguchi, T; Sasaki, H; Md-Zain, B M
2014-01-01
Three species of otter can be found throughout Malay Peninsula: Aonyx cinereus, Lutra sumatrana, and Lutrogale perspicillata. In this study, we focused on the A. cinereus population that ranges from the southern and the east coast to the northern regions of Malay Peninsula up to southern Thailand to review the relationships between the populations based on the mitochondrial D-loop region. Forty-eight samples from six populations were recognized as Johor, Perak, Terengganu, Kelantan, Ranong, and Thale Noi. Among the 48 samples, 33 were identified as A. cinereus, seven as L. sumatrana, and eight as L. perspicillata. Phylogenetically, two subclades formed for A. cinereus. The first subclade grouped all Malay Peninsula samples except for samples from Kelantan, and the second subclade grouped Kelantan samples with Thai sample. Genetic distance analysis supported the close relationships between Thai and Kelantan samples compared to the samples from Terengganu and the other Malaysian states. A minimum-spanning network showed that Kelantan and Thailand formed a haplogroup distinct from the other populations. Our results show that Thai subspecies A. cinereus may have migrated to Kelantan from Thai mainland. We also suggest the classification of a new subspecies from Malay Peninsula, the small-clawed otter named A. cinereus kecilensis.
Influence of culture on ornament of the traditional architecture in Medan (Malay Deli Sultanate)
Nawawiy Loebis, M.; Ginting, Nurlisa; Simanjuntak, Haryanto; Jamaluddin, Fattah
2018-03-01
During the Dutch colonialism, Malay Deli Sultanate was dominant and big which now their superiority was destroyed by Social Revolution. At that time, Malay people live in the peak of glory and civilization resulting in their growing culture. The purpose of research is to find the influence of culture in Malay Deli ornaments as a part of Architecture. Data obtained with literatures study and observation. The data was analysed using qualitative method to describe the phenomenon occur between variables. The aim of this research is identifying any culture influences ornaments in architecture. Such as Islam influences Malay ornament on the building and ornament division between the noble and people. The research result is the culture such as language, religion have influence on ornaments in Malay Deli architecture.
The prevalence and types of glaucoma in malay people: the Singapore Malay eye study.
Shen, Sunny Y; Wong, Tien Y; Foster, Paul J; Loo, Jing-Liang; Rosman, Mohamad; Loon, Seng-Chee; Wong, Wan Ling; Saw, Seang-Mei; Aung, Tin
2008-09-01
To assess the prevalence and types of glaucoma in an Asian Malay population. The Singapore Malay Eye Study is a population-based, cross-sectional survey that examined 3280 (78.7% response) persons aged 40 to 80 years. Participants underwent a standardized clinical examination including slit-lamp biomicroscopy, Goldmann applanation tonometry, and dilated optic disc assessment. Participants who were suspected to have glaucoma also underwent visual field examination (24-2 SITA standard, Humphrey Visual Field Analyzer II), gonioscopy, and repeat applanation tonometry. Glaucoma was defined according to International Society for Geographical and Epidemiologic Ophthalmology criteria. Of the 3280 participants, 150 (4.6%) had diagnosed glaucoma, giving an age- and sex-standardized prevalence of 3.4% (95% confidence interval [CI], 3.3%-3.5%). The age- and sex-standardized prevalence of primary open-angle glaucoma was 2.5% (95% CI, 2.4%-2.6%), primary angle-closure glaucoma 0.12% (95% CI, 0.10%-0.14%), and secondary glaucoma 0.61% (95% CI, 0.59%-0.63%). Of the 150 glaucoma cases, only 12 (8%) had a previous known history of glaucoma. Twenty-seven (18%) eyes had low vision (based on best corrected visual acuity logarithm of the minimal angle of resolution [logMAR] >0.30 to /=1.00). The prevalence of glaucoma among Malay persons 40 years of age and older in Singapore is 3.4%, comparable to ethnic Chinese people in Singapore and other racial/ethnic groups in Asia. As in Chinese, Caucasians, and African people, primary open-angle glaucoma was the main form of glaucoma in this population. More than 90% of glaucoma cases were previously undetected.
Directory of Open Access Journals (Sweden)
Retno W. Susilowati
2017-05-01
Full Text Available Background: Arylamine N-acetyltransferase 2 (NAT2 polymorphism was previously reported to have association with the risk of drug toxicities and the development of various diseases. Previous research on the Indonesian population, especially Javanese and Sundanese, showed that there were 33% NAT2 slow acetylator phenotype. The aim of this study was to map the NAT2 variation in the Malay ethnic to gain a deeper insight into NAT2 haplotypic composition in this ethnic.Methods: 50 healthy samples from the Indonesian Malay ethnic were obtained. They were interviewed about their ethnic backgrounds for the last three generations. DNA was extracted from peripheral blood and NAT2 genotyping was done using the PCR direct Sequencing. Data were compiled according to the genotype and allele frequencies estimated from the observed numbers of each specific allele. Haplotype reconstruction was performed using PHASE v2.1.1 software.Results: We found 7 haplotypes consisting of 6 SNPs and 14 NAT2 genotype variations in Indonesian Malay population. The most frequent allele was NAT2*6A (38% which was classified as a slow acetylator allele. According to bimodal distribution, the predicted phenotype of the Malay population was composed of 62% rapid acetylator and 38% slow acetylator. According to trimodal distribution, the predicted phenotypes for rapid, intermediate and slow acetylators were 10%, 52% and 38% respectively.Conclusion: Our result indicates the presence of the allelic distribution and revealed the most frequent acetylator status and phenotype for the Indonesian Malay population. The result of this study will be helpful for future epidemiological or clinical studies and for understanding the genetic basis of acetylation polymorphism in Indonesia.
Hassan, Mohd Nazri; Mohd Noor, Noor Haslina; Johan Noor, Shah Reza; Sukri, Salamah Ahmad; Mustafa, Rapiaah; Luc Aster, Hans Van Rostenberghe
2014-01-01
Background: Maternal red blood cell (RBC) alloimmunization may lead to production of harmful antibodies that result in hemolytic disease of fetus and newborn (HDFN). There is insufficient data on the prevalence of HDFN due to RBC alloantibodies in the Malay neonatal population. Aim: The aim of this study was to determine the incidence of HDFN in the Malay neonatal population due to clinically significant RBC alloantibodies. Subjects and Methods: A cross sectional study was conducted in Transfusion Medicine Unit, Hospital Universitiy Sains Malaysia over one year period from January to December 2009. A total of 5163 Malay pregnant women who attended labor room for delivery were collected and analyzed prospectively. The blood samples were subjected to the standard immunohematological procedure for RBC antibody screening and identification using reagents of Diamed-ID Gel microtyping system. All the newborns with RBC alloantibody were investigated for the evidence of HDFN. Results: Thirty (0.58%) women were found to have clinically significant RBC alloantibodies. Most of the alloantibodies belonged to Rhesus (Rh) system (56.7%) where anti-E (33.3%) was the most common followed by anti-D (10.0%). Rh antibodies were the main cause of HDFN in fourteen (0.27%) neonates. Anti-D and anti-c were identified to cause moderate to very severe HDFN. Conclusions: With the low prevalence of clinically significant RBC alloantibodies and HDFN, routine antenatal antibody screening practice may not be advised as a routine practice at present, preferably reserved for those women of RhD negative or with history of HDFN, significantly of those attributed to anti-c. PMID:25161351
Boycott or Buycott? Malay Middle-Class Consumption Post-9/11
DEFF Research Database (Denmark)
Fischer, Johan
2007-01-01
Much current anti-consumerist and anti-globalisation discourse identifies boycotting as an immensely powerful force. Religious and secular activists alike promote consumer boycotts as a type of practised resistance that promises to break US economic, military and cultural hegemony. Obviously...... in Malaysia in the wake of 9/11. I shall show how this issue evokes a wide range of contestations and paradoxes in the everyday lives of suburban Malay Muslim middle-class families. Most of all, the boycott confronts divergent Malay middle-class groups with the problem of how to translate intentionality...
Directory of Open Access Journals (Sweden)
Mohd Nazri Hassan
2014-01-01
Full Text Available Background: Maternal red blood cell (RBC alloimmunization may lead to production of harmful antibodies that result in hemolytic disease of fetus and newborn (HDFN. There is insufficient data on the prevalence of HDFN due to RBC alloantibodies in the Malay neonatal population. Aim: The aim of this study was to determine the incidence of HDFN in the Malay neonatal population due to clinically significant RBC alloantibodies. Subjects and Methods: A cross sectional study was conducted in Transfusion Medicine Unit, Hospital Universitiy Sains Malaysia over one year period from January to December 2009. A total of 5163 Malay pregnant women who attended labor room for delivery were collected and analyzed prospectively. The blood samples were subjected to the standard immunohematological procedure for RBC antibody screening and identification using reagents of Diamed-ID Gel microtyping system. All the newborns with RBC alloantibody were investigated for the evidence of HDFN. Results: Thirty (0.58% women were found to have clinically significant RBC alloantibodies. Most of the alloantibodies belonged to Rhesus (Rh system (56.7% where anti-E (33.3% was the most common followed by anti-D (10.0%. Rh antibodies were the main cause of HDFN in fourteen (0.27% neonates. Anti-D and anti-c were identified to cause moderate to very severe HDFN . Conclusions: With the low prevalence of clinically significant RBC alloantibodies and HDFN, routine antenatal antibody screening practice may not be advised as a routine practice at present, preferably reserved for those women of RhD negative or with history of HDFN, significantly of those attributed to anti-c.
The effectiveness of traditional Malay massage: A narrative review
Directory of Open Access Journals (Sweden)
Nurhanisah Sejari
2014-01-01
Full Text Available The traditional Malay massage (TMM, also known locally as urut Melayu, is one of the fields of traditional and complementary medicine. The practices and understanding are originally related to Malay culture in selected hospitals under the Ministry of Health since 2007. This study is to review the available evidence on the effectiveness of TMM as an alternative therapeutic approach to various conditions. An online electronic search in databases (Ovid™ , Scopus, EMBASE and PubMed was performed using keywords such as Malay massage and urut Melayu. Documents including case studies, case reports, and research studies were examined and analyzed. Two case studies and one qualitative research study about TMM for chronic diseases were explored. It was reported that the majority of those having chronic diseases sought TMM as an alternative treatment to improve mobility and quality of life. The second case study explored the effectiveness of TMM for a postpartum stroke patient, and there was improvement of physical function, mobility and optimizing the activity of daily living for this patient. The third article provided treatment-seeking behavior of poststroke patients and their TMM practitioners. From their interviews with 17 volunteers, they reported that Malay massage is very helpful for their body conditions after stroke due to high blood pressure and postdelivery complications. The patients revealed that TMM has provided them positive, beneficial effects. The review indicated that TMM could serve as an alternative treatment for those having chronic diseases, postpartum stroke and poststroke conditions. Therefore, the current review highlights the role TMM has in view of positive, beneficial effects to improve and optimize mobility, physical function, activity, daily living and quality of life.
Phoon, Hooi San; Abdullah, Anna Christina; Lee, Lay Wah; Murugaiah, Puvaneswary
2014-05-01
To date, there has been little research done on phonological acquisition in the Malay language of typically developing Malay-speaking children. This study serves to fill this gap by providing a systematic description of Malay consonant acquisition in a large cohort of preschool-aged children between 4- and 6-years-old. In the study, 326 Malay-dominant speaking children were assessed using a picture naming task that elicited 53 single words containing all the primary consonants in Malay. Two main analyses were conducted to study their consonant acquisition: (1) age of customary and mastery production of consonants; and (2) consonant accuracy. Results revealed that Malay children acquired all the syllable-initial and syllable-final consonants before 4;06-years-old, with the exception of syllable-final /s/, /h/ and /l/ which were acquired after 5;06-years-old. The development of Malay consonants increased gradually from 4- to 6 years old, with female children performing better than male children. The accuracy of consonants based on manner of articulation showed that glides, affricates, nasals, and stops were higher than fricatives and liquids. In general, syllable-initial consonants were more accurate than syllable-final consonants while consonants in monosyllabic and disyllabic words were more accurate than polysyllabic words. These findings will provide significant information for speech-language pathologists for assessing Malay-speaking children and designing treatment objectives that reflect the course of phonological development in Malay.
Replication of 13 obesity loci among Singaporean Chinese, Malay and Asian-Indian populations.
Dorajoo, R; Blakemore, A I F; Sim, X; Ong, R T-H; Ng, D P K; Seielstad, M; Wong, T-Y; Saw, S-M; Froguel, P; Liu, J; Tai, E-S
2012-01-01
Recent genome-wide association studies (GWAS) have identified 38 obesity-associated loci among European populations. However, their contribution to obesity in other ethnicities is largely unknown. We utilised five GWAS (N=10 482) from Chinese (three cohorts, including one with type 2 diabetes and another one of children), Malay and Indian ethnic groups from Singapore. Data sets were analysed individually and subsequently in combined meta-analysis for Z-score body-mass index (BMI) associations. Variants at the FTO locus showed the strongest associations with BMI Z-score after meta-analysis (P-values 1.16 × 10(-7)-7.95 × 10(-7)). We further detected associations with nine other index obesity variants close to the MC4R, GNPDA2, TMEM18, QPCTL/GIPR, BDNF, ETV5, MAP2K5/SKOR1, SEC16B and TNKS/MSRA loci (meta-analysis P-values ranging from 3.58 × 10(-4)-1.44 × 10(-2)). Three other single-nucleotide polymorphisms (SNPs) from CADM2, PTBP2 and FAIM2 were associated with BMI (P-value ≤ 0.0418) in at least one dataset. The neurotrophin/TRK pathway (P-value=0.029) was highlighted by pathway-based analysis of loci that had statistically significant associations among Singaporean populations. Our data confirm the role of FTO in obesity predisposition among Chinese, Malays and Indians, the three major Asian ethnic groups. We additionally detected associations for 12 obesity-associated SNPs among Singaporeans. Thus, it is likely that Europeans and Asians share some of the genetic predisposition to obesity. Furthermore, the neurotrophin/TRK signalling may have a central role for common obesity among Asians.
Catquest-9SF questionnaire: validation of Malay and Chinese-language versions using Rasch analysis.
Adnan, Tassha Hilda; Mohamed Apandi, Mokhlisoh; Kamaruddin, Haireen; Salowi, Mohamad Aziz; Law, Kian Boon; Haniff, Jamaiyah; Goh, Pik Pin
2018-01-05
Catquest questionnaire was originally developed in Swedish to measure patients' self-assessed visual function to evaluate the benefit of cataract surgery. The result of the Rasch analysis leading to the creation of the nine-item short form of Catquest, (Catquest-9SF), and it had been translated and validated in English. The aim is therefore to evaluate the translated Catquest-9SF questionnaire in Malay and Chinese (Mandarin) language version for measuring patient-reported visual function among cataract population in Malaysia. The English version of Catquest-9SF questionnaire was translated and back translated into Malay and Chinese languages. The Malay and Chinese translated versions were self-administered by 236 and 202 pre-operative patients drawn from a cataract surgery waiting list, respectively. The translated Catquest-9SF data and its four response options were assessed for fit to the Rasch model. The Catquest-9SF performed well in the Malay and Chinese translated versions fulfilling all criteria for valid measurement, as demonstrated by Rasch analysis. Both versions of questionnaire had ordered response thresholds, with a good person separation (Malay 2.84; and Chinese 2.59) and patient separation reliability (Malay 0.89; Chinese 0.87). Targeting was 0.30 and -0.11 logits in Malay and Chinese versions respectively, indicating that the item difficulty was well suited to the visual abilities of the patients. All items fit a single overall construct (Malay infit range 0.85-1.26, outfit range 0.73-1.13; Chinese infit range 0.80-1.51, outfit range 0.71-1.36), unidimensional by principal components analysis, and was free of Differential Item Functioning (DIF). These results support the good overall functioning of the Catquest-9SF in patients with cataract. The translated questionnaire to Malay and Chinese-language versions are reliable and valid in measuring visual disability outcomes in the Malaysian cataract population.
Health Information in Malay (Bahasa Malaysia)
... You Are Here: Home → Multiple Languages → Malay (Bahasa Malaysia) URL of this page: https://medlineplus.gov/languages/malay.html Health Information in Malay (Bahasa Malaysia) To use the sharing features on this page, ...
Hashim, Azlina N; Yusof, Zamros Y M; Esa, Rashidah
2015-11-25
The Early Childhood Oral Health Impact Scale (ECOHIS) is used to assess oral impacts on the quality of life of preschool aged children and their families. The objective of this study was to perform a cross-cultural adaptation of the ECOHIS into Malay and assess its psychometric properties. The cross-cultural adaptation of ECOHIS into Malay comprised of translating the ECOHIS into the Malay language (Malay-ECOHIS) by experts followed by face validation of the Malay-ECOHIS by a group of mothers. The Malay-ECOHIS was back translated into English and this was compared with the original ECOHIS. Minor changes were made to the Malay-ECOHIS before it was finalised. The Malay-ECOHIS' psychometric properties were assessed in terms of construct, convergent and discriminant validity as well as internal and test-retest reliability based on two separate studies involving 127 parents of 4-6 year old preschool children followed by oral examinations of 860 preschool children from 25 kindergartens from two districts in Selangor state, Malaysia. Non-parametric statistics were used to assess the relationships between the Malay-ECOHIS and the subjective and clinical outcome measures. The Cronbach's alpha was 0.83 and the weighted Kappa was 0.95 (intraclass correlation = 0.94). The Malay-ECOHIS demonstrated significant associations with different subjective and normative measures, i.e. levels of oral health satisfaction, perceived oral health status, perceived oral health need, toothache experience, pattern of dental attendance, and caries status of preschool children. These significant associations supported its construct, convergent and discriminant validity as well as internal and test-retest reliability. This study showed that the Malay-ECOHIS is a valid and reliable instrument to assess the negative impacts of oral disorders/conditions on the quality of life of 4-6 year old preschool children and their families in Malaysia.
Comparing physical activity of Malaysian Malay men before, during ...
African Journals Online (AJOL)
during this time of the year, most Muslims will live an inactive and sedentary lifestyle. However, no empirical data exist to substantiate this assumption among Malay Muslims. Study showed that minimum of 10,000 steps per day is required to achieve an active lifestyle status. The active lifestyle status is recommended ...
A whole genome analyses of genetic variants in two Kelantan Malay individuals.
Wan Juhari, Wan Khairunnisa; Md Tamrin, Nur Aida; Mat Daud, Mohd Hanif Ridzuan; Isa, Hatin Wan; Mohd Nasir, Nurfazreen; Maran, Sathiya; Abdul Rajab, Nur Shafawati; Ahmad Amin Noordin, Khairul Bariah; Nik Hassan, Nik Norliza; Tearle, Rick; Razali, Rozaimi; Merican, Amir Feisal; Zilfalil, Bin Alwi
2014-12-01
The sequencing of two members of the Royal Kelantan Malay family genomes will provide insights on the Kelantan Malay whole genome sequences. The two Kelantan Malay genomes were analyzed for the SNP markers associated with thalassemia and Helicobacter pylori infection. Helicobacter pylori infection was reported to be low prevalence in the north-east as compared to the west coast of the Peninsular Malaysia and beta-thalassemia was known to be one of the most common inherited and genetic disorder in Malaysia. By combining SNP information from literatures, GWAS study and NCBI ClinVar, 18 unique SNPs were selected for further analysis. From these 18 SNPs, 10 SNPs came from previous study of Helicobacter pylori infection among Malay patients, 6 SNPs were from NCBI ClinVar and 2 SNPs from GWAS studies. The analysis reveals that both Royal Kelantan Malay genomes shared all the 10 SNPs identified by Maran (Single Nucleotide Polymorphims (SNPs) genotypic profiling of Malay patients with and without Helicobacter pylori infection in Kelantan, 2011) and one SNP from GWAS study. In addition, the analysis also reveals that both Royal Kelantan Malay genomes shared 3 SNP markers; HBG1 (rs1061234), HBB (rs1609812) and BCL11A (rs766432) where all three markers were associated with beta-thalassemia. Our findings suggest that the Royal Kelantan Malays carry the SNPs which are associated with protection to Helicobacter pylori infection. In addition they also carry SNPs which are associated with beta-thalassemia. These findings are in line with the findings by other researchers who conducted studies on thalassemia and Helicobacter pylori infection in the non-royal Malay population.
The contemporary Malay Cultural and architecture in Medan City
Nawawiy Loebis, M.; Nirfalini Aulia, Dwira; Asdiana; Tuah Aditya Saragih, Jhon
2018-03-01
Malay is one of the identity of the city of Medan. Especially the Malay kingdom that has an important role in the history of the city of Medan and the river Deli. Some relics of the Malay kingdom in the form of buildings with Malay architecture that made the tourist area. In this modern era, many buildings are designed contemporary and leave behind a cultural background, especially Malay architecture. The research methodology used is qualitative methodology by way of observation and interviews with informants who are Malay people still in Medan city. And the distribution of questionnaires to the Malay community. The variables tested are, location and environment, language, technology, organizational livelihood system, the arts, and religious system. This study aims to determine the contemporary Malay culture and architecture prevailing in today’s Malay society.
A PERSPECTIVE OF MALAY QUATRAIN IN MEDIA TECHNOLOGY
Arbaie SUJUD; Nik Rafidah NIK AFFENDI; Normaliza ABD RAHIM; Siti Nur ALIAA ROSLAN
2012-01-01
Malay quatrain has been introduced since long time ago among the Malay communities. It has also been used until today in formal ceremonies like the weddings, meetings and speeches. The Malay quatrain has also been taught in schools in order to inculcate the culture among children at young age. Therefore, this study ascertains the perspective of Malay quatrain in the media technology. The objectives of the study were to identify the types of Malay quatrain favored by the students and discuss t...
A PERSPECTIVE OF MALAY QUATRAIN IN MEDIA TECHNOLOGY
Directory of Open Access Journals (Sweden)
Arbaie SUJUD
2012-06-01
Full Text Available Malay quatrain has been introduced since long time ago among the Malay communities. It has also been used until today in formal ceremonies like the weddings, meetings and speeches. The Malay quatrain has also been taught in schools in order to inculcate the culture among children at young age. Therefore, this study ascertains the perspective of Malay quatrain in the media technology. The objectives of the study were to identify the types of Malay quatrain favored by the students and discuss the interactions of the students during the process of learning. The samples of the study involved 20 volunteered subjects from a school in Malaysia. The subjects were nine year olds male and female students. The subjects were given a website which consists of Malay quatrain activities. The Malay quatrains consisted of moral values that were able to be understood among the students. The subjects were in pairs and they were to try out the website and discuss their opinion about the Malay quatrain. The interactions among the subjects were taped and selected interactions related to the study were analyzed. The discourse analysis method was used to analyze the interactions. The results of the study revealed that the subjects would prefer the Malay quatrain which has the value of love among family members, friends and teachers. It is hoped that future research concentrates on the use the Malay quatrain with aesthetic values among children at primary schools.
Wan Syafawati, W U; Norhalifah, H K; Zefarina, Z; Zafarina, Z; Panneerchelvam, S; Norazmi, M N; Chambers, G K; Edinur, H A
2015-10-01
The major aims of this study are to characterise and compile allelic data of human platelet antigen (HPA)-1 to -6 and -15 systems in five Malay sub-ethnic groups in Peninsular Malaysia. HPAs are polymorphic glycoproteins expressed on the surface of platelet membranes and are genetically differentiated across ethnogeographically unrelated populations. Blood samples were obtained with informed consent from 192 volunteers: Banjar (n = 30), Bugis (n = 37), Champa (n = 51), Jawa (n = 39) and Kelantan (n = 35). Genotyping was done using polymerase chain reaction-sequence specific primer method. In general, frequencies of HPAs in the Malay sub-ethnic groups are more similar to those in Asian populations compared with other more distinct populations such as Indians, Australian Aborigines and Europeans. This study provides the first HPA datasets for the selected Malay sub-ethnic groups. Subsequent analyses including previously reported HPA data of Malays, Chinese and Indians revealed details of the genetic relationships and ancestry of various sub-populations in Peninsular Malaysia. Furthermore, the comprehensive HPA allele frequency information from Peninsular Malaysia provided in this report has potential applications for future study of diseases, estimating risks associated with HPA alloimmunization and for developing an efficient HPA-typed donor recruitment strategy. © 2015 British Blood Transfusion Society.
Semantic-based Ontology for Malay Qur'an Reader
Ahmad, ND; Bennett, B; Atwell, ES
2016-01-01
The Quran has been translated into various languages around the world by Muslim experts. One of them is in Malay. There are numerous applications built to facilitate the retrieval of knowledge from the Malay Qur’an. However, there are limited resources and tools that are available or made accessible for the research on Malay Qur’an. Furthermore, there are several issues that need to be considered when dealing with Malay Qur’an translation; such as ambiguities of words, lack of equivalence wor...
Tradition and modernity in Malay society (1830s-1930s
Directory of Open Access Journals (Sweden)
Khoo Kay Kim
2011-06-01
Full Text Available This study attempts to explicate what happened to the Malays between the turn of the 20th century and the beginning of World War II. This is important to underscore the fact that, contrary to general impressions, Islam did not hold back the progress of the Malays, and that even before World War II, major changes were taking place in Malay society. Modernity in Malay society began to emerge even before World War I. Although the intrusion of British administration to a great extent contributed to socio-economic changes in many parts of the Malay Peninsula, the Muslim intelligentsia were indefatigably urging the Malays to be sensitive to their environment; and one way of keeping abreast of change was to expose themselves to modern education. Malay journalism, Malay literature and the frequent exchange of ideas in the Malay media were characteristics of Malay society beginning from the early 20th century. Politics then was not yet to the fore. As in other societies, there were also conservative elements within that placed obstacles in the way of those who tirelessly pursued change from tradition to modernity.
Blended Design Approach of Long Span Structure and Malay Traditional Architecture
Sundari, Titin
2017-12-01
The growing population in the world is so fast, which is followed by the increasing need of some new and large activities. Architects face the problem on how to facilitate buildings with various activities such as for large meeting, conference, indoors gymnasium and sports, and many others. The long span structure of building is one of the solutions to solve that problem. Generally, large buildings which implemented this structure will look as a technological, modern and futuristic ones or even neo futuristic performance. But on the other hand, many people still want to enjoy the specific and unique senses of local traditional architecture. So is the Malay people who want an easy pleasant large facilities which can be fulfilled by implementing modern long span building structure technology. In the same time, their unique sense of Malay traditional architecture can still be maintained. To overcome this double problems of design, it needs a blended design approach of long span structure and Malay Traditional Architecture.
A Glimpse of Chinese-Malay Literature
Directory of Open Access Journals (Sweden)
Cendrawaty Tjong
2007-11-01
Full Text Available Chinese-Malay literature begans in the end of 19th century. The beginning of this period was known from the works depicted Classical-Malay literature. In the development, due to the booming of publication houses and newspaper agencies, this school of literature flourished. The origin of this period was closely related to Chinese-descendants, background and history. The long history, the big numbers of works and the miscellaneous contents of the works were the characteristics of this period. Chinese-Malay literature period was the period highlighted with typical Chinese-Indonesian society.
The Dynamics of Malay Culture in West Kalimantan in the 20th Century
Ahyat, Ita Syamtasiyah
2014-01-01
There are various Malay communities in West Kalimantan, which can be divided into two broad categories: (1) Malay migrants from outside Kalimantan (West Kalimantan) or contemporary Malays and (2) local Malays or native Malays who are considered as indigenous Malays. Contemporary Malays are Malay people who came from various areas in Sumatra, Riau Islands, Malay peninsula, East Malaysia (Serawak and Sabah States), and Brunei Darussalam. This paper aims to reconstruct the dynamics of Malay cult...
Apalasamy, Yamunah Devi; Ming, Moy Foong; Rampal, Sanjay; Bulgiba, Awang; Mohamed, Zahurin
2015-03-01
Recent findings have shown that the rs1042714 (Gln27Glu) single-nucleotide polymorphism (SNP) on the β2-adrenoceptor gene may predispose to obesity. The findings from other studies carried on different populations, however, have been inconsistent. The authors investigated the association between the rs1042714 SNP with obesity-related parameters. DNA of 672 Malaysian Malays was analyzed using real-time polymerase chain reaction. Univariate and multivariate linear regression analyses revealed significant associations between rs1042714 and diastolic blood pressure in the pooled Malaysian Malay subjects under additive and recessive models. After gender stratification, however, a significant association was found between the rs1042714 and triglyceride and the rs1042714 and log-transformed high-density lipoprotein cholesterol levels in Malaysian Malay men. No significant association was found between the SNP and log-transformed body mass index. This polymorphism may have an important role in the development of obesity-related traits in Malaysian Malays. Gender is an effect modifier for the effect of the rs1042714 polymorphism on obesity-related traits in Malaysian Malays. © 2011 APJPH.
Rule-based Approach on Extraction of Malay Compound Nouns in Standard Malay Document
Abu Bakar, Zamri; Kamal Ismail, Normaly; Rawi, Mohd Izani Mohamed
2017-08-01
Malay compound noun is defined as a form of words that exists when two or more words are combined into a single syntax and it gives a specific meaning. Compound noun acts as one unit and it is spelled separately unless an established compound noun is written closely from two words. The basic characteristics of compound noun can be seen in the Malay sentences which are the frequency of that word in the text itself. Thus, this extraction of compound nouns is significant for the following research which is text summarization, grammar checker, sentiments analysis, machine translation and word categorization. There are many research efforts that have been proposed in extracting Malay compound noun using linguistic approaches. Most of the existing methods were done on the extraction of bi-gram noun+noun compound. However, the result still produces some problems as to give a better result. This paper explores a linguistic method for extracting compound Noun from stand Malay corpus. A standard dataset are used to provide a common platform for evaluating research on the recognition of compound Nouns in Malay sentences. Therefore, an improvement for the effectiveness of the compound noun extraction is needed because the result can be compromised. Thus, this study proposed a modification of linguistic approach in order to enhance the extraction of compound nouns processing. Several pre-processing steps are involved including normalization, tokenization and tagging. The first step that uses the linguistic approach in this study is Part-of-Speech (POS) tagging. Finally, we describe several rules-based and modify the rules to get the most relevant relation between the first word and the second word in order to assist us in solving of the problems. The effectiveness of the relations used in our study can be measured using recall, precision and F1-score techniques. The comparison of the baseline values is very essential because it can provide whether there has been an improvement
Directory of Open Access Journals (Sweden)
Muhammad ʿUthman EI-Muhammady
2002-12-01
Full Text Available ‘Allāmah Dr. Muhammad Iqbal has attracted the attention of the Malay World as well as the Muslims in Southeast Asia. His prose works like The Reconstruction and his poetic compositions like Asrar-i-Khudi, Shikwah wa Jawab-i-Shikwah and others have been read and translated into Bahasa Melayu and Bahasa Indonesia. Most Indonesian and Malay front ranking leaders were influenced by his ideal of serving the cause of the Ummah. They used Iqbal's argument to mobilize the Muslims for reforms of their respective societies in particular in Malaysia and Indonesia.
Sex hormones in Malay and Chinese men in Malaysia: are there age and race differences?
Chin, Kok-Yong; Soelaiman, Ima-Nirwana; Mohamed, Isa Naina; Ahmad, Fairus; Ramli, Elvy Suhana Mohd; Aminuddin, Amilia; Ngah, Wan Zurinah Wan
2013-01-01
Variations in the prevalence of sex-hormone-related diseases have been observed between Asian ethnic groups living in the same country; however, available data concerning their sex hormone levels are limited. The present study aimed to determine the influence of ethnicity and age on the sex hormone levels of Malay and Chinese men in Malaysia. A total of 547 males of Malay and Chinese ethnicity residing in the Klang Valley Malaysia underwent a detailed screening, and their blood was collected for sex hormones analyses. Testosterone levels were normally distributed in the men (total, free and non-sex hormone-binding globulin (SHBG) bound fractions), and significant ethnic differences were observed (pChinese men starting at age 40. Small but significant differences in testosterone levels existed between Malay and Chinese males. Significant age and race differences existed in estradiol levels. These differences might contribute to the ethnic group differences in diseases related to sex hormones, which other studies have found in Malaysia.
The Dynamics of Malay Culture in West Kalimantan in the 20th Century
Directory of Open Access Journals (Sweden)
Ita Syamtasiyah Ahyat
2014-08-01
Full Text Available There are various Malay communities in West Kalimantan, which can be divided into two broad categories: (1 Malay migrants from outside Kalimantan (West Kalimantan or contemporary Malays and (2 local Malays or native Malays who are considered as indigenous Malays. Contemporary Malays are Malay people who came from various areas in Sumatra, Riau Islands, Malay peninsula, East Malaysia (Serawak and Sabah States, and Brunei Darussalam. This paper aims to reconstruct the dynamics of Malay culture in West Kalimantan. This historiographical project is undertaken by applying historical method which consists of several main steps: searching for relevant sources, selecting the sources, interpreting the sources, and reconstructing events as relevant to the main topic. Bibliography consists of local sources, documents, and works of foreign scholars which are relevant to the topic.
Screening of some Malay medicated oils for antimicrobial activity
Directory of Open Access Journals (Sweden)
Khalid Khalisanni
2010-01-01
Full Text Available Oils from six Malay medicated oils, used traditionally in the treatment of infectious and septic diseases in humans, were tested for their antimicrobial property. The aim was to evaluate the antimicrobial properties of six Malay medicated oils against certain microbial isolates. Locally available Malay medicated oils were checked for their antimicrobial activities using six species of bacteria: E. coli, Salmonella spp., Klebsiella pneumoniae, Staphylococcus aureus, Streptococcus, Bacillus subtilis and 2 fungi with 1 yeast (Aspergillus niger, Penicillum spp. and Candida albicans. Clove oil showed the highest antibacterial activity followed, respectively, by 'bunga merah', cajaput, nutmeg, lemon grass and 'gamat' oil. Clove oil and lemon grass showed anticandidal activity. The Malay medicated oil studies did not show any antifungal activity. The study shows that Malay medicated oils, like antibiotics, have antimicrobial activities against some microorganisms.
Genetic association of SNPs in the FTO gene and predisposition to obesity in Malaysian Malays
International Nuclear Information System (INIS)
Apalasamy, Y.D.; Ming, M.F.; Rampal, S.; Bulgiba, A.; Mohamed, Z.
2012-01-01
The common variants in the fat mass- and obesity-associated (FTO) gene have been previously found to be associated with obesity in various adult populations. The objective of the present study was to investigate whether the single nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) blocks in various regions of the FTO gene are associated with predisposition to obesity in Malaysian Malays. Thirty-one FTO SNPs were genotyped in 587 (158 obese and 429 non-obese) Malaysian Malay subjects. Obesity traits and lipid profiles were measured and single-marker association testing, LD testing, and haplotype association analysis were performed. LD analysis of the FTO SNPs revealed the presence of 57 regions with complete LD (D' = 1.0). In addition, we detected the association of rs17817288 with low-density lipoprotein cholesterol. The FTO gene may therefore be involved in lipid metabolism in Malaysian Malays. Two haplotype blocks were present in this region of the FTO gene, but no particular haplotype was found to be significantly associated with an increased risk of obesity in Malaysian Malays
Genetic association of SNPs in the FTO gene and predisposition to obesity in Malaysian Malays
Energy Technology Data Exchange (ETDEWEB)
Apalasamy, Y.D. [Pharmacogenomics Laboratory, Department of Pharmacology, Faculty of Medicine, University of Malaya, Kuala Lumpur (Malaysia); Ming, M.F.; Rampal, S.; Bulgiba, A. [Julius Centre University of Malaya, Department of Social and Preventive Medicine, Faculty of Medicine, University of Malaya, Kuala Lumpur (Malaysia); Mohamed, Z. [Pharmacogenomics Laboratory, Department of Pharmacology, Faculty of Medicine, University of Malaya, Kuala Lumpur (Malaysia)
2012-08-24
The common variants in the fat mass- and obesity-associated (FTO) gene have been previously found to be associated with obesity in various adult populations. The objective of the present study was to investigate whether the single nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) blocks in various regions of the FTO gene are associated with predisposition to obesity in Malaysian Malays. Thirty-one FTO SNPs were genotyped in 587 (158 obese and 429 non-obese) Malaysian Malay subjects. Obesity traits and lipid profiles were measured and single-marker association testing, LD testing, and haplotype association analysis were performed. LD analysis of the FTO SNPs revealed the presence of 57 regions with complete LD (D' = 1.0). In addition, we detected the association of rs17817288 with low-density lipoprotein cholesterol. The FTO gene may therefore be involved in lipid metabolism in Malaysian Malays. Two haplotype blocks were present in this region of the FTO gene, but no particular haplotype was found to be significantly associated with an increased risk of obesity in Malaysian Malays.
Genetic association of SNPs in the FTO gene and predisposition to obesity in Malaysian Malays
Directory of Open Access Journals (Sweden)
Y.D. Apalasamy
2012-12-01
Full Text Available The common variants in the fat mass- and obesity-associated (FTO gene have been previously found to be associated with obesity in various adult populations. The objective of the present study was to investigate whether the single nucleotide polymorphisms (SNPs and linkage disequilibrium (LD blocks in various regions of the FTO gene are associated with predisposition to obesity in Malaysian Malays. Thirty-one FTO SNPs were genotyped in 587 (158 obese and 429 non-obese Malaysian Malay subjects. Obesity traits and lipid profiles were measured and single-marker association testing, LD testing, and haplotype association analysis were performed. LD analysis of the FTO SNPs revealed the presence of 57 regions with complete LD (D’ = 1.0. In addition, we detected the association of rs17817288 with low-density lipoprotein cholesterol. The FTO gene may therefore be involved in lipid metabolism in Malaysian Malays. Two haplotype blocks were present in this region of the FTO gene, but no particular haplotype was found to be significantly associated with an increased risk of obesity in Malaysian Malays.
Lee, Yi Chuan; Chan, Soh Ha; Ren, Ee Chee
2008-11-01
Killer cell immunoglobulin-like receptors (KIR) gene frequencies have been shown to be distinctly different between populations and contribute to functional variation in the immune response. We have investigated KIR gene frequencies in 370 individuals representing three Asian populations in Singapore and report here the distribution of 14 KIR genes (2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DL1, 3DL2, 3DL3, 3DS1) with two pseudogenes (2DP1, 3DP1) among Singapore Chinese (n = 210); Singapore Malay (n = 80), and Singapore Indian (n = 80). Four framework genes (KIR3DL3, 3DP1, 2DL4, 3DL2) and a nonframework pseudogene 2DP1 were detected in all samples while KIR2DS2, 2DL2, 2DL5, and 2DS5 had the greatest significant variation across the three populations. Fifteen significant linkage patterns, consistent with associations between genes of A and B haplotypes, were observed. Eighty-four distinct KIR profiles were determined in our populations, 38 of which had not been described in other populations. KIR haplotype studies were performed using nine Singapore Chinese families comprising 34 individuals. All genotypes could be resolved into corresponding pairs of existing haplotypes with eight distinct KIR genotypes and eight different haplotypes. The haplotype A2 with frequency of 63.9% was dominant in Singapore Chinese, comparable to that reported in Korean and Chinese Han. The A haplotypes predominate in Singapore Chinese, with ratio of A to B haplotypes of approximately 3:1. Comparison with KIR frequencies in other populations showed that Singapore Chinese shared similar distributions with Chinese Han, Japanese, and Korean; Singapore Indian was found to be comparable with North Indian Hindus while Singapore Malay resembled the Thai.
Sex hormones in Malay and Chinese men in Malaysia: are there age and race differences?
Directory of Open Access Journals (Sweden)
Kok-Yong Chin
2013-01-01
Full Text Available OBJECTIVES: Variations in the prevalence of sex-hormone-related diseases have been observed between Asian ethnic groups living in the same country; however, available data concerning their sex hormone levels are limited. The present study aimed to determine the influence of ethnicity and age on the sex hormone levels of Malay and Chinese men in Malaysia. METHODS: A total of 547 males of Malay and Chinese ethnicity residing in the Klang Valley Malaysia underwent a detailed screening, and their blood was collected for sex hormones analyses. RESULTS: Testosterone levels were normally distributed in the men (total, free and non-sex hormone-binding globulin (SHBG bound fractions, and significant ethnic differences were observed (p<0.05; however, the effect size was small. In general, testosterone levels in males began to decline significantly after age 50. Significant ethnic differences in total, free and non-SHBG bound fraction estradiol levels were observed in the 20-29 and 50-59 age groups (p<0.05. The estradiol levels of Malay men decreased as they aged, but they increased for Chinese men starting at age 40. CONCLUSIONS: Small but significant differences in testosterone levels existed between Malay and Chinese males. Significant age and race differences existed in estradiol levels. These differences might contribute to the ethnic group differences in diseases related to sex hormones, which other studies have found in Malaysia.
Sex hormones in Malay and Chinese men in Malaysia: are there age and race differences?
Directory of Open Access Journals (Sweden)
Kok-Yong Chin
Full Text Available OBJECTIVES: Variations in the prevalence of sex-hormone-related diseases have been observed between Asian ethnic groups living in the same country; however, available data concerning their sex hormone levels are limited. The present study aimed to determine the influence of ethnicity and age on the sex hormone levels of Malay and Chinese men in Malaysia. METHODS: A total of 547 males of Malay and Chinese ethnicity residing in the Klang Valley Malaysia underwent a detailed screening, and their blood was collected for sex hormones analyses. RESULTS: Testosterone levels were normally distributed in the men (total, free and non-sex hormone-binding globulin (SHBG bound fractions, and significant ethnic differences were observed (p<0.05; however, the effect size was small. In general, testosterone levels in males began to decline significantly after age 50. Significant ethnic differences in total, free and non-SHBG bound fraction estradiol levels were observed in the 20-29 and 50-59 age groups (p<0.05. The estradiol levels of Malay men decreased as they aged, but they increased for Chinese men starting at age 40. CONCLUSIONS: Small but significant differences in testosterone levels existed between Malay and Chinese males. Significant age and race differences existed in estradiol levels. These differences might contribute to the ethnic group differences in diseases related to sex hormones, which other studies have found in Malaysia.
Comparative study on corpus development for Malay investment ...
African Journals Online (AJOL)
Comparative study on corpus development for Malay investment fraud detection in website. ... Journal of Fundamental and Applied Sciences ... The aim of this research is to develop a corpus for Malay investment fraud so that it can be used in ...
1948 AND THE COLD WAR IN MALAYA: SAMPLINGS OF MALAY REACTIONS
Directory of Open Access Journals (Sweden)
Abdul Rahman Haji Ismail
2009-01-01
Full Text Available This paper is a preliminary report of an on-going research on the reactions of the Malays in Malaya to the coming of the Cold War to the region, with particular reference to the importance of the year 1948. For the majority of the Malays, the Cold War was most popularly associated with the Emergency, which British authorities had declared in the effort to quell the armed uprising mounted by the MCP. The vast majority of Malays in Malaya were not interested in the on-going Cold War between the Western bloc led by the United States on the side the Eastern bloc led by the Soviet Union on the other. The preoccupations of the Malays during the immediate post-Pacific War period was nationalism and the concomitant effort to gain independence for Malaya from Britain. In particular, they had been rather anxious that the Malays, who were the native of the land, were not robbed of the custodianship over Malaya and political privileges of the Malays in independent Malaya. Consumed with these issues, the Malays had little interests in external affairs. It was perhaps the lack of Malay support that foredoomed the fate of communism in Malaya.
The application of Malay wood carving on contemporary architecture in Malaysia
Directory of Open Access Journals (Sweden)
Nila Inangda Manyam Keumala Daud
2012-12-01
Full Text Available Malay wood carving has been identified as one of the most important element in Malay Traditional Architecture. The application of this special element has its own philosophy and its purpose was meant to enrich the architecture character values. Issues are currently raised that the application of the Malay wood carving on contemporary architecture in Malaysia has ignored its unique original concept and philosophy. This indicate that the development of Malay Wood Carving requires attention and need more encouragement in order to catch up with the vast development of architecture in Malaysia, and overcome the problem of introducing more meaningful Malay wood carving in contemporary architecture building. A research has been conducted to investigate the thread of the development and application of Malay wood carving in contemporary architecture based on case study of a five star hotel in Kuala Lumpur.
Affixes, Austronesian and iconicity in Malay
Directory of Open Access Journals (Sweden)
Geoffrey Benjamin
2009-10-01
Full Text Available Explanations are offered for the puzzling differences between the forms and meanings of the Malay affixes and those of the broader Austronesian affixal system from which they derive. Oral-gesture iconicity is involved in the encoding of meanings that have both language-internal and social significance. The various verbal prefixes can be analysed both historically and iconically as different combinations of (1 a labial series (m , b , p indicating ‘source orientation’ with (2 r ‘iterative’ and (3 ( N ‘process marker’. The full range of forms becomes apparent only if a sufficiently wide range of Malay and Malayic speech-varieties, both ancient and modern, are brought to bear on the discussion. The different meanings and functions associated with the various prefixes are motivated by the different semantic concerns engendered by the social and cultural circumstances peculiar to each of the speech-varieties.
Evaluation of Psychometric Properties of the Malay Version ...
African Journals Online (AJOL)
Evaluation of Psychometric Properties of the Malay Version Perceived Stress Scale in Two Occupational Settings In Malaysia. ... Statistical analysis was carried out using statistical package for the social sciences version 16 (SPSS, Chicago, IL, USA) software. Results: Analysis yielded two factor structure of the Malay version ...
Past and present practices of the Malay food heritage and culture in Malaysia
Directory of Open Access Journals (Sweden)
Mohd Nazri Abdul Raji
2017-12-01
Full Text Available Malay heritage varies from north to south; however, there are various similarities and differences. Essentially, Malay heritage food is influenced by a myriad of cultures, such as Arab, Indian, Chinese, Siamese, Javanese, Minangkabau, and others. Different regions in Malaysia are known for their unique or signature dishes, such as beef rendang, laksa, nasi lemak, and tapai. Indeed, it is noted that Malay food is identical in terms of its spiciness. This can be seen from the prepreparation, methods of cooking, and availability and use of prominent ingredients, such as local aromatic herbs and spices. This article highlights the regional Malay food, past and present practices of Malay food culture, and characteristics of Malay food. In addition, this article also discusses the different occasions and table etiquette practices among Malay communities. The reported findings are expected to contribute to the literature on food culture, specifically in Malay heritage food.
Fok, Doris; Aris, Izzuddin M.; Ho, Jiahui; Lim, Sok Bee; Chua, Mei Chien; Pang, Wei Wei; Saw, Seang-Mei; Kwek, Kenneth; Godfrey, Keith M.; Kramer, Michael S.; Chong, Yap Seng
2016-01-01
Background Confinement (restrictions placed on diet and practices during the month right after delivery) represents a key feature of Asian populations. Few studies however, have focused specifically on ethnic differences in confinement practices. This study assesses the confinement practices of three ethnic groups in a multi-ethnic Asian population. Methods Participants were part of a prospective birth cohort study that recruited 1247 pregnant women (57.2% Chinese, 25.5% Malay, 17.3% Indian) during their first trimester. 1220 participants were followed up 3-weeks postpartum at home when questionnaires were administered to ascertain the frequency of adherence to the following confinement practices: showering; confinement-specific meals; going out with or without the baby; choice of caregiver assistance; and the use of massage therapy. Results Most participants reported that they followed confinement practices during the first three weeks post-partum (Chinese: 96.4%, Malay: 92.4%, Indian: 85.6%). Chinese and Indian mothers tended to eat more special confinement diets than Malay mothers (ppractices, but the three Asian ethnic groups differed in specific confinement practices. Future studies should examine whether ethnic differences persist in later child-rearing practices. PMID:27018256
Stemming Malay Text and Its Application in Automatic Text Categorization
Yasukawa, Michiko; Lim, Hui Tian; Yokoo, Hidetoshi
In Malay language, there are no conjugations and declensions and affixes have important grammatical functions. In Malay, the same word may function as a noun, an adjective, an adverb, or, a verb, depending on its position in the sentence. Although extensively simple root words are used in informal conversations, it is essential to use the precise words in formal speech or written texts. In Malay, to make sentences clear, derivative words are used. Derivation is achieved mainly by the use of affixes. There are approximately a hundred possible derivative forms of a root word in written language of the educated Malay. Therefore, the composition of Malay words may be complicated. Although there are several types of stemming algorithms available for text processing in English and some other languages, they cannot be used to overcome the difficulties in Malay word stemming. Stemming is the process of reducing various words to their root forms in order to improve the effectiveness of text processing in information systems. It is essential to avoid both over-stemming and under-stemming errors. We have developed a new Malay stemmer (stemming algorithm) for removing inflectional and derivational affixes. Our stemmer uses a set of affix rules and two types of dictionaries: a root-word dictionary and a derivative-word dictionary. The use of set of rules is aimed at reducing the occurrence of under-stemming errors, while that of the dictionaries is believed to reduce the occurrence of over-stemming errors. We performed an experiment to evaluate the application of our stemmer in text mining software. For the experiment, text data used were actual web pages collected from the World Wide Web to demonstrate the effectiveness of our Malay stemming algorithm. The experimental results showed that our stemmer can effectively increase the precision of the extracted Boolean expressions for text categorization.
IDENTIFYING MOTIVATION FACTOR INVOLVEMENT OF SARAWAK MALAY WOMEN ENTREPRENEUR
Directory of Open Access Journals (Sweden)
Masyantie Mohamad
2016-03-01
Full Text Available Sarawak multilayered cake among Sarawak product signature famous among the local as well as international tourist visiting Sarawak. In fact, Sarawak Malay women entrepreneurs have become very necessary players in the entrepreneurial field specifically in this cottage industries from the early introduction of this business, they have facing various problem in this businesses. Thus, this research aims to build an understanding of motivational factor that encourage Sarawak Malay women entrepreneurial experiences especially in multilayered cake businesses. Using qualitative methods, this research aims to identify the entrepreneurial motivations factors; with regards to start-up motivation by Sarawak Malay women. The finding shows that the motivations that influence Malay women within Kuching, Sarawak areas to start and grow their business are involve self-driven and context driven that motivate them involve in multilayered cakes businesses.
The Ornamental Design of Traditional Malay Utensils (Kukuran in Peninsula Malaysia
Directory of Open Access Journals (Sweden)
Md Yusoff Zulkfli bin
2016-01-01
Full Text Available Woodcarving is a significant craft in Malay society that reflects the local traditions and customs. It is a manifestation of craftsmen artistic skills and intutitive ideas into a piece of wood. It is also manifestation of the creative process of imitation, denaturalization, stylization and abstraction. Historically, the Malay craftsmen have created many attractive traditional art forms and one of it is the coconut graters (kukuran. The ornamental carved kukuran is closely related to its Malay woodcarving tradition and philosophy. The aim of this paper is to illustrate this tradition of the great traditional Malay kukuran, the testiment of its time through its visual characteristics and design composition. This study presents an analysis of six kukuran, which were gathered from the state museums in Peninsular Malaysia. The discussion is focused on the formalistic and iconology aspects of the kukuran carving ornaments. The finding briefly shows the fusion of Malay concept of beauty, Malay culture and the understanding of Islam had been manifested in these domestic utensils - the ornamental kukuran
Being Modern, Malay, and Muslim in the Movies
Directory of Open Access Journals (Sweden)
Gordon Thomas Gray
2015-07-01
Full Text Available Serious analyses of media, especially popular media, and how those media are being negotiated can provide insight into broader social and political change. Media provide us with an arena where global meta-forces - globalization, politics, economics, etc. - intersect with daily life. Analyzing wider social and political-economic issues in Malaysian politics using Malay language cinema as a media example illustrates this point. In this paper the role of Malay language cinema as being both a catalyst for and receiver of Malay lower middle class dissatisfactions with authority, especially in terms of the Malaysian government’s attempts at religious authority, bring new insights into the intersection between media, politics, religion, and society in Malaysia.
Saudara (1928-1941: Continuity and Change in the Malay Society
Directory of Open Access Journals (Sweden)
Wan Suhana Wan Sulong
2006-12-01
Full Text Available Abstract: A content analysis of Saudara, published in the Straits Settlement of Penang between 1928 and 1941, shows the development of Malay social, political and religious thinking in a crucial period of transition in Malay society. The analysis of various issues debated in this newspaper contributed to the social history of Malaya and of the Malay community within Malaya. The issues raised in Saudara are echoed in contemporary Malaysia with varying emphasis and elements.
Association of Serum Adiponectin Levels with Metabolic Syndrome Risk Factors in Malay Adults
Directory of Open Access Journals (Sweden)
Nur Firdaus Isa
2017-09-01
Full Text Available Introduction: This study aimed to investigate the relationship between serum adiponectin and metabolic syndrome in adults living in rural Malaysia. Methods: A total of 299 Malay adults (men=124; women = 175 with a mean age 48.8 (11.7 years were recruited. Measurements for waist circumference and blood pressure were taken before drawing an overnight fasting blood samples. Biochemical tests for triglycerides, HDL cholesterol, glucose and serum adiponectin concentration were measured. Results: Our results show that the adiponectin level in the subjects with metabolic syndrome was significantly lower than those without metabolic syndrome (p < 0.05. Among the metabolic syndrome risk factors, adiponectin level was significantly associated with hypertriglyceridemia and reduced HDL cholesterol (p < 0.001. Conclusion: The outcome from this study which highlights the association of hypoadiponectinemia with risk factors of metabolic syndrome in Malay adults, suggests that the reduced level of adiponectin may play a pivotal role in the development of metabolic syndrome in this ethnic group.
Psychometric properties of the Drive for Muscularity Scale in Malay men.
Swami, Viren; Barron, David; Lau, Poh Li; Jaafar, Jas Laile
2016-06-01
The Drive for Muscularity Scale (DMS) is a widely used measure in studies of men's body image, but few studies have examined its psychometric properties outside English-speaking samples. Here, we assessed the factor structure of a Malay translation of the DMS. A community sample of 159 Malay men from Kuala Lumpur, Malaysia, completed the DMS, along with measures of self-esteem, body appreciation, and muscle discrepancy. Exploratory factor analysis led to the extraction of two factors, differentiating attitudes from behaviours, which mirrors the parent scale. Both factors also loaded on to a higher-order drive for muscularity factor. The subscales of the Malay DMS had adequate internal consistencies and good convergent validity, insofar as significant relationships were reported with self-esteem, body appreciation, muscle discrepancy, and body mass index. These results indicate that the Malay DMS has acceptable psychometric properties and can be used to assess body image concerns in Malay men. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Otto F. von Feigenblatt
2011-01-01
Full Text Available This article provides a public policy analysis of governance in the provinces populated by the Malay ethnonationality in the South of Thailand. Important stakeholders are identified as well as important sociopolitical environmental factors. The final sections of the paper present a proposal for a new governance structure for the Muslim South of Thailand taking into consideration the social, cultural, and economic context as well as the wellbeing and right to self-determination of the local population. This study concludes that considerable economic, political, and social opportunities for development are being lost in the South of Thailand due to misguided governance policies. --- Dieser Artikel stellt eine politische Analyse von Governance in den von der nationalen Minderheit der Malaien bewohnten Provinzen in Südthailand vor. Zunächst werden zentrale InteressensvertreterInnen und soziopolitische Faktoren identifiziert. Anschließend diskutiert der Autor einen Vorschlag für eine neue Governancestruktur, die soziale, kulturelle und wirtschaftliche Kontexte ebenso beachtet wie die Bedürfnisse und das Recht zur Selbstbestimmung der lokalen Bevölkerung. Der Beitrag konkludiert, dass beträchtliche Möglichkeiten zur wirtschaftlichen, politischen und sozialen Entwicklung aufgrund von fehlgeleiteten Politiken ausgelassen wurden.
Translation and Validation of the Malay Subjective Happiness Scale
Swami, Viren
2008-01-01
The Subjective Happiness Scale (Lyubomirsky and Lepper, "Social Indicators Research," 46, 137-155, 1999) is a brief measure for assessing subjective happiness. The reliability and validity of the Malay version of the Subjective Happiness Scale was investigated in a community sample of 290 Chinese and 227 Malays in Malaysia. Results…
Tobacco and the Malays: ethnicity, health and the political economy of tobacco in Malaysia.
Barraclough, Simon; Morrow, Martha
2017-04-01
To identify the historical nexus between Malaysia's largest and politically dominant ethnic group and the political economy of tobacco, and to consider the implications of this connection for tobacco control. Primary and secondary documentary sources in both English and Malay were analysed to illuminate key events and decisions, and the discourse of industry and government. Sources included: speeches by Malaysian political and industry actors; tobacco industry reports, press releases and websites; government documents; World Health Organization (WHO) tobacco control literature; and press reports. Malays have the highest smoking prevalence among Malaysia's major ethnic groups. The tobacco industry has consistently been promoted as furthering Malay economic development. Malays play the major role in growing and curing. Government-owned Malay development trusts have been prominent investors in tobacco corporations, which have cultivated linkages with the Malay elite. The religious element of Malay ethnicity has also been significant. All Malays are Muslim, and the National Fatwa Council has declared smoking to be haram (forbidden); however, the Government has declined to implement this ruling. Exaggerated claims for the socio-economic benefits of tobacco production, government investment and close links between tobacco corporations and sections of the Malay elite have created a conflict of interest in public policy, limited the focus on tobacco as a health policy issue among Malays and retarded tobacco control policy. More recently, ratification of the WHO Framework Convention on Tobacco Control, regional free trade policies reducing the numbers of growers, concerns about smoking from an Islamic viewpoint, and anxieties about the effects of smoking upon youth have increasingly challenged the dominant discourse that tobacco furthers Malay interests. Nevertheless, the industry remains a formidable political and economic presence in Malaysia that is likely to continue to
Effectiveness of Smartphone Application for the Development of Youth Anthusiasm to Malay Culture
Asril, Elvira; Fajrizal; Wiza, Fana
2017-12-01
This study will measure the effectiveness of Malay cultural applications, by socializing Melayu.com web, then distributing questionnaires to them (young people / high school students), and will be able to find out what features are of interest to them. With this smartphone introduction application of Malay culture, it is expected to increase young enthusiasm towards Malay culture which is really beautiful if it is known and understood. After the socialization of 30 high school students, the results obtained that they are less interested in the application. Because it is not user friendly, not interactive and rigid. Eventhough they have interest in this Malay culture, they have not found an app or media that can attract attention. Thus, they ask if the application of Malay culture can add game content later, eg War games using background and other elements related to Malay culture.
The Malay Enclave of Kampong Bharu as a Living Tradition: A place of uncertainty
Directory of Open Access Journals (Sweden)
Norsidah Ujang
2016-06-01
Full Text Available In the case of Asian cities, poor redevelopment process has often resulted in the loss of historic urban fabric. Kampong Bharu is a traditional Malay settlement in the heart of the Kuala Lumpur city, holds a unique case of a struggle to preserve its local identity. This paper reviews the scenario regarding the enclave in light of the current redevelopment proposal. Reviews of literature and analysis of recent reports indicated that the future of the enclave is in the state of uncertainty. People oriented planning based upon a deep understanding of culture and tradition could bring about a natural approach towards a definitive redevelopment initiatives.
Chang, Yuet Meng; Perumal, Revathi; Keat, Phoon Yoong; Kuehn, Daniel L C
2007-03-22
We have analyzed 16 Y-STR loci (DYS456, DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385a/b, DYS393, DYS391, DYS439, DYS635 or Y-GATA C4, DYS392, Y-GATA H4, DYS437, DYS438 and DYS448) from the non-recombining region of the human Y-chromosome in 980 male individuals from three main ethnic populations in Malaysia (Malay, Chinese, Indian) using the AmpFlSTR((R)) Y-filertrade mark (Applied Biosystems, Foster City, CA). The observed 17-loci haplotypes and the individual allele frequencies for each locus were estimated, whilst the locus diversity, haplotype diversity and discrimination capacity were calculated in the three ethnic populations. Analysis of molecular variance indicated that 88.7% of the haplotypic variation is found within population and 11.3% is between populations (fixation index F(ST)=0.113, p=0.000). This study has revealed Y-chromosomes with null alleles at several Y-loci, namely DYS458, DYS392, DYS389I, DYS389II, DYS439, DYS448 and Y-GATA H4; and several occurrences of duplications at the highly polymorphic DYS385 loci. Some of these deleted loci were in regions of the Y(q) arm that have been implicated in the occurrence of male infertility.
Gender messages in contemporary popular Malay songs
Directory of Open Access Journals (Sweden)
Collin Jerome
2013-07-01
Full Text Available Gender has been an important area of research in the field of popular music studies. Numerous scholars have found that contemporary popular music functions as a locus of diverse constructions and expressions of gender. While most studies focus on content analyses of popular music, there is still a need for more research on audience’s perception of popular music’s messages. This study examined adult Malay listeners’ perceptions of gender messages in contemporary Malay songs. A total of 16 contemporary Malay songs were analysed using Fairclough’s (1992 method of text analysis. The content of the songs that conveyed messages about gender were the basis for analysis. The results showed that the messages revolve mainly around socially constructed gender roles and expectations in romantic relationships. Gender stereotypes are also used in the songs to reinforce men’s and women’s roles in romantic relationships. The results also showed that, while listeners acknowledge the songs’ messages about gender, their own perceptions of gender and what it means to be a gendered being in today’s world are neither represented nor discussed fully in the songs analysed. It is hoped the findings from this, particularly the mismatch between projected and perceived notions of gender, contribute to the field of popular Malay music studies in particular, and popular music studies in general where gender messages in popular songs and their influence on listeners’ perceptions of their own gender is concerned.
Permanent dentition occlusion in Chinese, Indian and Malay groups in Malaysia.
Woon, K C; Thong, Y L; Abdul Kadir, R
1989-03-01
This survey outlines the proportion of the various features of occlusion in the permanent dentition of the three ethnic races, Chinese, Malay and Indian in Malaysia. The mean age of the high school children surveyed was 16.4 years. The Chinese and Malays had almost similar distribution of the different types of occlusion. There was a significantly higher prevalence of Class III occlusion among the Chinese and Malays as compared to the Indians. In addition, an edge to edge incisor relationship seemed to be a norm in the Chinese (54%) and Malays (50%) whilst the overjet of between 2-4 mm and the overbite of between 1/3 to 2/3 was more normal to Indians (50%). A crowded dentition was also a norm for the three races.
Maran, Sathiya; Lee, Yeong Yeh; Xu, Shu Hua; Raj, Mahendra Sundramoorthy; Abdul Majid, Noorizan; Choo, Keng Ee; Zilfalil, Bin Alwi; Graham, David Y
2013-04-01
To identify gene polymorphisms that differ between Malays, Han Chinese and South Indians, and to identify candidate genes for the investigation of their role in protecting Malays from Helicobacter pylori (H. pylori) infection. Malay participants born and residing in Kelantan with a documented absence of H. pylori infection were studied. Venous blood was used for genotyping using the Affymetrix 50K Xba I kit. CEL files from 141 Han Chinese and 76 South Indians were analyzed to compare their allele frequency with that of the Malays using fixation index (FST ) calculation. The single nucleotide polymorphisms (SNPs) with the highest allele frequency (outliers) were then examined for their functional characteristics using F-SNP software and the Entrez Gene database. In all, 37 Malays were enrolled in the study; of whom 7 were excluded for low genotyping call rates. The average FST estimated from the genome-wide data were 0.038 (Malays in Kelantan vs the South Indians), 0.015 (Malays in Kelantan vs Han Chinese) and 0.066 (Han Chinese vs South Indians), respectively. The outlier gene variants present in Malays with functional characteristics were C7orf10 (FST 0.29988), TSTD2 (FST 0.43278), SMG7 (FST 0.29877) and XPA (FST 0.43393 and 0.43644). Genetic variants possibly related to protection against H. pylori infection in ethnic Malays from the north-eastern region of Peninsular Malaysia were identified for testing in subsequent trials among infected and uninfected Malays. © 2012 The Authors. Journal of Digestive Diseases © 2012 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.
Ibrahim, Norlinah M; Shohaimi, Shamarina; Chong, Heng-Thay; Rahman, Abdul Hamid Abdul; Razali, Rosdinom; Esther, Ebernezer; Basri, Hamidon B
2009-01-01
In view of the differing sensitivity and specificity of the Mini-Mental State Examination (MMSE) in the non-English-speaking populations, we conducted the first validation study of the Malay version (M-MMSE) in Malaysia among 300 subjects (from the community and outpatient clinics). Three versions were used: M-MMSE-7 (serial 7), M-MMSE-3 (serial 3) and M-MMSE-S (spell 'dunia' backwards). Dementia was assessed using the criteria of the Diagnostic and Statistical Manual of Mental Disorders IV. The optimal cutoff scores were obtained from the receiver operating characteristics curves. Seventy-three patients (24.3%) had dementia and 227 (75.7%) were controls. Three hundred patients completed the M-MMSE-7, 160 the M-MMSE-3 and 145 the M-MMSE-S. All 3 versions were valid and reliable in the diagnosis of dementia. The optimal cutoff scores varied with each version and gender. In the control group, significant gender differences were observed in the patients with the lowest educational status. Increasing educational levels significantly improved the M-MMSE performance in both genders. All 3 versions of the M-MMSE are valid and reliable as a screening tool for dementia in the Malaysian population, but at different cutoff scores. In those with the lowest educational background, gender-adjusted cutoff scores should be applied. Copyright 2009 S. Karger AG, Basel.
The Compositae of the Malay Archipelago. I. Vernonieae and Eupatorieae
Koster, Joséphine Th.
1935-01-01
The region, from which the Vernonieae and the Eupatorieae have been worked out, includes the Greater Sunda Islands, the Lesser Sunda Islands and the Moluccas. It is a well-known fact, that the Malay Peninsula and the Philippines have a flora, which is related to that of the Malay Archipelago, sensu
A new species of Dalbergia (Leguminosae from Malay Peninsula
Directory of Open Access Journals (Sweden)
Bambang - Sunarno
2003-12-01
Full Text Available SUNARNO, BAMBANG & OHASHI, HIROSHI. 2002. A new species of Dalbergia (Leguminosae from Malay Peninsula. Reinwardtia 12(1: 117–119. ⎯ A new species, Dalbergia johoriensis from the Malay Peninsula is described. It is close to D. rostrata and D. havilandii but readily distinguished by the grooved midrib beneath, flowers with narrower standard and wings and style hairy in the lower part.
Ganasegeran, Kurubaran; Selvaraj, Kamaraj; Rashid, Abdul
2017-08-01
The six item Confusion, Hubbub and Order Scale (CHAOS-6) has been validated as a reliable tool to measure levels of household disorder. We aimed to investigate the goodness of fit and reliability of a new Malay version of the CHAOS-6. The original English version of the CHAOS-6 underwent forward-backward translation into the Malay language. The finalised Malay version was administered to 105 myocardial infarction survivors in a Malaysian cardiac health facility. We performed confirmatory factor analyses (CFAs) using structural equation modelling. A path diagram and fit statistics were yielded to determine the Malay version's validity. Composite reliability was tested to determine the scale's reliability. All 105 myocardial infarction survivors participated in the study. The CFA yielded a six-item, one-factor model with excellent fit statistics. Composite reliability for the single factor CHAOS-6 was 0.65, confirming that the scale is reliable for Malay speakers. The Malay version of the CHAOS-6 was reliable and showed the best fit statistics for our study sample. We thus offer a simple, brief, validated, reliable and novel instrument to measure chaos, the Skala Kecelaruan, Keriuhan & Tertib Terubahsuai (CHAOS-6) , for the Malaysian population.
Elyana, Fatin Nur; Al-Mekhlafi, Hesham M; Ithoi, Init; Abdulsalam, Awatif M; Dawaki, Salwa; Nasr, Nabil A; Atroosh, Wahib M; Abd-Basher, Mohamad Hafiz; Al-Areeqi, Mona A; Sady, Hany; Subramaniam, Lahvanya R; Anuar, Tengku Shahrul; Lau, Yee Ling; Moktar, Norhayati; Surin, Johari
2016-07-16
demonstrates that IPIs are highly prevalent in rural Terengganu, Malaysia. Community awareness about IPIs was found to be imperative in protecting Malay children from these infections. An integrated control programme for the prevention and control of IPIs is highly recommended for these communities, with a special emphasis on the Orang Asli population.
Malay divorce in Peninsular Malaysia: the near-disappearance of an institution.
Tan, P C; Jones, G W
1990-01-01
The authors explore factors affecting the sharp decline in divorce rates among the Malay population of Peninsular Malaysia during the period 1950-1985. They consider the rise in marriage age, trends away from arranged marriage and polygamy, and the contributions of Islamic reform movements and women's groups. The focus is on the changes in attitudes toward marriage and divorce. Data are from the 1981-1982 Study on Marriage and Marital Dissolution in Peninsular Malaysia. Appendixes containing laws and statutes concerning divorce are included.
Malay Pop: Mass Media Hegemony in Indonesia Popular Music
Directory of Open Access Journals (Sweden)
Abdul Aziz Turhan Kariko
2009-11-01
Full Text Available Article discusses the domination of Malay pop music through textual analysis of songs, observation of musical programs, and interviews with important figures. The research data were obtained by library research and analyzed through a critical theory approach to gain an understanding of the text and its effects. The article concludes that Malay pop contains a strong uniformity which may be termed a phenomenon in the context of the culture industry, while also being dominant because of its legitimacy created by the media. The nature of Malay pop is also very profitable for those participating in it, therefore the spirit of capitalism was also quite dominant in this context. There is also resistance from the indie music movement, and its attempts to fight regressive qualities of music that are legitimized in the mainstream mass media.
Hashim, Syaratul-Emma; Tan, Hui-Ken; Wan-Hazabbah, W H; Ibrahim, Mohtar
2008-11-01
Refractive error remains one of the primary causes of visual impairment in children worldwide, and the prevalence of refractive error varies widely. The objective of this study was to determine the prevalence of refractive error and study the possible associated factors inducing refractive error among primary school children of Malay ethnicity in the suburban area of Kota Bharu, Kelantan, Malaysia. A school-based cross-sectional study was performed from January to July 2006 by random selection on Standard 1 to Standard 6 students of 10 primary schools in the Kota Bharu district. Visual acuity assessment was measured using logMAR ETDRS chart. Positive predictive value of uncorrected visual acuity equal or worse than 20/40, was used as a cut-off point for further evaluation by automated refraction and retinoscopic refraction. A total of 840 students were enumerated but only 705 were examined. The prevalence of uncorrected visual impairment was seen in 54 (7.7%) children. The main cause of the uncorrected visual impairment was refractive error which contributed to 90.7% of the total, and with 7.0% prevalence for the studied population. Myopia is the most common type of refractive error among children aged 6 to 12 years with prevalence of 5.4%, followed by hyperopia at 1.0% and astigmatism at 0.6%. A significant positive correlation was noted between myopia development with increasing age (P <0.005), more hours spent on reading books (P <0.005) and background history of siblings with glasses (P <0.005) and whose parents are of higher educational level (P <0.005). Malays in suburban Kelantan (5.4%) have the lowest prevalence of myopia compared with Malays in the metropolitan cities of Kuala Lumpur (9.2%) and Singapore (22.1%). The ethnicity-specific prevalence rate of myopia was the lowest among Malays in Kota Bharu, followed by Kuala Lumpur, and is the highest among Singaporean Malays. Better socio-economic factors could have contributed to higher myopia rates in the
Malay Childhood, Temperament and Individuality.
Banks, Ellen
This study of children in a Malay community assesses the cross-cultural validity of one conceptualization of temperament, identifies cultural differences in child rearing practices and beliefs, and explores parents' recognition of individual differences emerging in early childhood. The community studied consisted of three villages located about 20…
MALAY POP: MASS MEDIA HEGEMONY IN INDONESIA POPULAR MUSIC
Abdul Aziz Turhan Kariko
2009-01-01
Article discusses the domination of Malay pop music through textual analysis of songs, observation of musical programs, and interviews with important figures. The research data were obtained by library research and analyzed through a critical theory approach to gain an understanding of the text and its effects. The article concludes that Malay pop contains a strong uniformity which may be termed a phenomenon in the context of the culture industry, while also being dominant because of its legi...
Past and present practices of the Malay food heritage and culture in Malaysia
Mohd Nazri Abdul Raji; Shahrim Ab Karim; Farah Adibah Che Ishak; Mohd Mursyid Arshad
2017-01-01
Malay heritage varies from north to south; however, there are various similarities and differences. Essentially, Malay heritage food is influenced by a myriad of cultures, such as Arab, Indian, Chinese, Siamese, Javanese, Minangkabau, and others. Different regions in Malaysia are known for their unique or signature dishes, such as beef rendang, laksa, nasi lemak, and tapai. Indeed, it is noted that Malay food is identical in terms of its spiciness. This can be seen from the prepreparation, me...
Current status of coronary risk factors among rural Malays in Malaysia.
Nawawi, Hapizah M; Nor, Idris M; Noor, Ismail M; Karim, Norimah A; Arshad, Fatimah; Khan, Rahmattullah; Yusoff, Khalid
2002-02-01
Coronary heart disease (CHD) is the leading cause of death in Malaysia, despite its status as a developing country. The rural population is thought to be at low risk. To investigate the prevalence of risk factors and global risk profile among rural Malays in Malaysia. We studied 609 rural Malay subjects (346 females, 263 males; age range 30-65 years). Blood pressure (BP), body mass index (BMI), waist-hip ratio (WHR), smoking habits and family history of premature CHD were documented. Fasting blood samples were analysed for serum lipids, lipoprotein (a), plasma glucose and fibrinogen. Oral glucose tolerance tests were performed using 75 g anhydrous glucose. The prevalence of hypercholesterolaemia for total cholesterol concentrations of > or = 5.2, > or =6.5 and > or =7.8 mmol/l were 67.3, 30.5 and 11.8% respectively. There was a high prevalence of low serum high-density lipoprotein cholesterol (13.1%), hypertension (30.3%), smokers (24.4%), diabetes (6.4%), impaired fasting glucose or glucose tolerance (13.9%), overweight or obesity (44.7%) and increased WHR (48.5%). Global risk assessment showed that 67.3% of the study population were at risk, with 15.9, 18.9 and 32.5% in the mild, moderate and high risk categories respectively. Prevalence of risk factors was high in the rural population. Global risk assessment showed a high-risk profile with two-thirds being at risk, and one-third being categorized into the high-risk group. Although rural communities were considered at low risk of developing CHD, this is changing fast, possibly due to the rapid socio-economic development, in addition to underlying genetic predisposition.
Nagammai, Thiagarajan; Mohazmi, Mohamed; Liew, Su May; Chinna, Karuthan; Lai, Pauline Siew Mei
2015-08-01
To assess the validity and reliability of the Malay version of the Quality of Life (QOL) Questionnaire of the European Foundation for Osteoporosis (QUALEFFO-41) in Malaysia. The QUALEFFO-41 was translated from English to Malay and administered to 215 post-menopausal osteoporotic women ≥50 years who could understand Malay, at baseline and 4 weeks. The SF-36 was administered at baseline to assess convergent validity. To assess discriminative validity, patients with and without back pain were recruited. Confirmatory factor analysis showed that the QUALEFFO-41 had five domains. Good internal consistency was seen in all domains (0.752-0.925) except for the social activity domain (0.692). Test-retest reliability showed adequate correlation for all items (0.752-0.964, p Malaysia. To enable the QUALEFFO-41 to be used in a multiracial population, further studies should look into validating other versions of the QUALEFFO-41 in Malaysia.
The Nearly Forgotten Malay Folklore: Shall We Start with the Software?
Abd Rahim, Normaliza
2014-01-01
The study focuses on the nearly forgotten Malay folklore in Malaysia. The objectives of the study were to identify and discuss the types of Malay folklore among primary school learners. The samples of the study were 100 male and female students at schools in Selangor. The samples were picked at random from several schools and they were given…
An acoustic investigation of Arabic vowels pronounced by Malay speakers
Directory of Open Access Journals (Sweden)
Ali Abd Almisreb
2016-04-01
Full Text Available In Malaysia, Arabic language is spoken, and commonly used among the Malays. Malays use Arabic in their daily life, such as during performing worship. Hence, in this paper, some of the Arabic vowels attributes are investigated, analyzed and initial findings are presented based on tokens articulated by Malay speakers as we can consider the spoken Arabic by Malays as one of the Arabic dialects. It is known that in Arabic language there are 28 consonants and 6 main vowels. Firstly, the duration, variability, and overlapping attributes are highlighted based on syllables of Consonant–Vowel with each syllable representing every Arabic consonant with the corresponding vowels. Next, the dispersion of each vowel is examined to be compared with each other along with the variability among vowels that may cause overlapping between vowels in the vowel-space. Results showed that the vowel overlapping occurred between short vowels and their long counterpart vowels. Furthermore, an investigation of the Arabic vowel duration is addressed as well, and duration analysis for all the vowels is discussed, followed by the analysis for each vowel separately. In addition, a comparison between long and short vowels is presented as well as comparison between high and low vowel is carried out.
A Psychometric Properties of the Malay-version Police Stress Questionnaire
IRNIZA, Rasdi; EMILIA, Zainal Abidin; MUHAMMAD SALILUDDIN, Suhainizam; NIZAM ISHA, Ahmad Shahrul
2014-01-01
Background: Police Stress Questionnaire (PSQ) was developed to measure police-specific stressors. The present study was the first to have translated the PSQ to Malay. This study aims to test the reliability, construct validity, and component structure of the Malay-version PSQ. Methods: A set of survey consisted of the Malay-version PSQ, General Health Questionnaire (GHQ-12), Job Content Questionnaire (JCQ), Global Stress Questionnaire (GSQ) and General Self-rated Health (GSRH) were distributed to 300 traffic police officers in Kuala Lumpur and all traffic police officers in a few districts of Pahang and Negeri Sembilan. Results: The response rate was 65.5% (N = 262). The reported Cronbach’s alpha coefficient was 0.93 for Operational PSQ (PSQ-Op) and 0.94 for Organisational PSQ (PSQ-Org). Findings indicated that the PSQ had positive construct validity with the GSRH, GSQ, and GHQ. After excluding four factors related to lifestyles, all police-specific stressors were highly loaded (0.50) in one component. Conclusion: It is confirmed that the Malay-version PSQ, excluding the four factors related to lifestyle, was uni-dimensional, reliable, and a valid questionnaire. This study proffers a potentially better instrument for assessing the stressors among Malaysian police. PMID:25977621
Chew, Boon-How; Vos, Rimke C; Heijmans, Monique; Shariff Ghazali, Sazlina; Fernandez, Aaron; Rutten, Guy E H M
2017-01-01
BACKGROUND: Illness perceptions involve the personal beliefs that patients have about their illness and may influence health behaviours considerably. Since an instrument to measure these perceptions for Malay population in Malaysia is lacking, we translated and examined the psychometric properties
Chew, B.H.; Vos, R.; Heijmans, M.; Metzendorf, M.I.; Scholten, R.J.P.M.; Rutten, G.E.H.M.
2017-01-01
Background: Illness perceptions involve the personal beliefs that patients have about their illness and may influence health behaviours considerably. Since an instrument to measure these perceptions for Malay population in Malaysia is lacking, we translated and examined the psychometric properties
Translation and validation of the Malay Acceptance of Cosmetic Surgery Scale.
Swami, Viren
2010-09-01
The present study examined the psychometric properties of a Malay translation of the Acceptance of Cosmetic Surgery Scale (ACSS; Henderson-King & Henderson-King, 2005). A total of 373 Malaysian women completed the ACSS along with measures of ideal-actual weight discrepancy, body appreciation, sociocultural attitudes toward appearance, self-esteem, life satisfaction, and demographics. Results showed that the Malay ACSS was best reduced to a two-factor solution, although an overall score of all 15 ACSS items showed the highest internal consistency. Results also showed that this overall score had good discriminant and divergent validity. It is expected that the availability of a Malay version of the ACSS will stimulate cross-cultural research on the acceptance of cosmetic surgery. Copyright © 2010 Elsevier Ltd. All rights reserved.
Sailing the Archipelago in a boat of rhymes Pantun in the Malay world
Directory of Open Access Journals (Sweden)
Muhammad Haji Salleh
2011-04-01
Full Text Available The extremely popular poetic form from Insular Southeast Asia, the pantun, travelled from its unknown source throughout the Malay Archipelago, first in Malay, then in the languages of Southeast Asia. In the ports and states where they were received, local colour, other idiosyncrasies, references, and linguistic characteristics have been added, and in fact, special forms with special names developed. This basic form is known, composed, and loved in at least 40 dialects of Malay, and 35 non-Malay languages, in the Peninsula and many of the islands of Malaysia and Indonesia. It spread through trade routes, ports, and also via diasporas and colonial economic projects which caused numerous peoples to move, who in turn brought the pantun along with them. It is now the most dynamic single literary form and has the longest history.
Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth
2006-10-01
In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.
Sedih sampai buta : Blindness, modernity and tradition in Malay films of the 1950s and 1960s
Directory of Open Access Journals (Sweden)
Timothy P. Barnard
2005-01-01
Full Text Available In the 1950s and 1960s Malaya/Malaysia was undergoing a tremendous amount of social change. One method of examining how this period was understood is through Malay film. A number of Malay writers and activists found work in the vibrant film industry of the Peninsula, which was centred on Singapore at the time, and proceeded to infuse many of the films with their ideas, hopes, and understandings of the society they saw around them. As part of these developments, and perhaps due to the phenomenon of repetition, blindness became a metaphor in a number of films to address the issue of modernity and tradition, and the tension between rural and urban. In films produced in the early 1950s blindness occurs among kampung-based characters, or among supporting players within the larger drama. Their blindness is usually caused or compounded by a sadness in their lives. In these films, an urban-based character attempts to arrange for an operation that will remedy the condition, but only after a character has had to deal with the underside of modernity. The use of blindness as a trope for moral/ethical failure is alien to traditional Malay culture. Thus, its use and repetition represent the external influences and ideas of modernity in Malay filmmaking of the period. While the city was frightening, it held the possibility of change for the better. Characters in these films had to deal first with the negative sides of such a life, but if they retained the positive traditional values of Malay culture, all would be well. By the early 1960s, however, after the promise of independence had transitioned to debates over merger, identity, and economic and social disruption, the metaphor of blindness had also shifted. Although technologycould cure the condition, the world that accompanied this technology was one that was unbearable. Unlike the earlier supporting characters facing a sightless life, it was now the main character who becomes blind in a manner that is
Psychological Distress and Lifestyle of Malay Medical Students
Directory of Open Access Journals (Sweden)
Hani Ramli Zafirah
2016-07-01
Full Text Available Background and Purpose: Medical education is a laborious program which may give negative consequences on the physical and psychological health of medical students. The aims of this study were to evaluate psychological distress among Malay medical students and to assess its relationship with their lifestyle.Methods: A cross-sectional study was conducted among 221 Malay medical students. Psychological distress and lifestyle were assessed using Depression, Anxiety and Stress Scale (DASS-21 and Health-Promoting Lifestyle Profile II (HPLPII respectively.Results: About 30.8% of Malay medical students had mild to extremely severe depressive symptoms, 62.9 % showed mild to extremely severe anxiety symptoms, and 34.9% of them had mild to extremely severe stress. The depressive subscale was significantly higher among female than male students (Z=-2.613, P=0.009. There was a significant negative correlation between total psychological distress and spiritual growth (r=-0.217, P=0.001. Depression was found not only negatively correlated with spiritual growth (r =-0.328, P=0.000 but also interpersonal relationship (r=-0.161, P=0.016. Stress was inversely correlated with physical activity (r =-0.172, P=0.011. Preclinical students had significantly better scores in health responsibility (Z=-2.301, P=0.021, interpersonal relationship (Z=-2.840, P=0.005, stress management (Z=-2.339, P=0.019, spiritual growth (Z=-2.483, P=0.013 and nutrition and diet (Z =-2.456, P=0.014 than clinical students.Conclusions: Malay medical students had significant symptoms that indicate psychological distress that related to their lifestyle. This warrants further psychiatric evaluation and management for them to be good and safe future doctors. Keywords: Depression, Anxiety, Stress, Lifestyle, Medical Students
Fields, Jason
2004-01-01
The data in this report is from the Annual Social and Economic Supplement (ASEC) to the 2003 Current Population Survey (CPS). The population represented (the population universe) in the ASEC is the civilian non institutionalized population living in the United States. Members of the Armed Forces living off post or with their families on post are…
Directory of Open Access Journals (Sweden)
M Rizal Abdul Manaf
Full Text Available Mental health problems are common in old age, but frequently remain undetected and untreated. Mental health problems in the elderly are the result of a complex interaction of social, psychological and biological factors. The aim of this study is to determine the prevalence of mental health problems (depression, anxiety, and emotional stress and their associated factors among the Malay elderly in a rural community of Perak, Malaysia.It was a cross-sectional study. The Malay elderly aged 60 years and above were selected through convenient sampling to give a total of 230 respondents. The Depression, Anxiety, and Stress Scale (DASS-21 was used to assess the symptoms of depression, anxiety, and stress. Bivariate analyses were performed using chi-square tests and multiple logistic regression analyses were conducted to determine the association between the factors and each of the mental health statuses assessed.The results showed that the prevalence of depression, anxiety, and stress among the elderly respondents was 27.8%, 22.6%, and 8.7%, respectively. The significant factors for depression were single elderly (Adjusted OR = 3.27, 95%CI 1.66, 6.44, living with family (Adjusted OR = 4.98, 95%CI 2.05, 12.10, and poor general health status (Adjusted OR = 2.28, 95%CI 1.20, 4.36. Living with family was the only significant factor for anxiety (Adjusted OR = 2.68, 95%CI 1.09, 6.57. There was no significant factor for stress.Depression and anxiety among the Malay elderly in the rural community were very worrying. More equity in health should be created or strengthened in order to intensify the opportunity to identify, diagnose, and treat those with mental health problems. Living arrangement in the rural community was an important factor that had influenced depression and anxiety. Therefore, further research is recommended for more comprehensive information, as a result of which appropriate intervention can be made.
Abdul Manaf, M Rizal; Mustafa, Madihah; Abdul Rahman, Mohd Rizam; Yusof, Khairul Hazdi; Abd Aziz, Noor Azah
2016-01-01
Mental health problems are common in old age, but frequently remain undetected and untreated. Mental health problems in the elderly are the result of a complex interaction of social, psychological and biological factors. The aim of this study is to determine the prevalence of mental health problems (depression, anxiety, and emotional stress) and their associated factors among the Malay elderly in a rural community of Perak, Malaysia. It was a cross-sectional study. The Malay elderly aged 60 years and above were selected through convenient sampling to give a total of 230 respondents. The Depression, Anxiety, and Stress Scale (DASS-21) was used to assess the symptoms of depression, anxiety, and stress. Bivariate analyses were performed using chi-square tests and multiple logistic regression analyses were conducted to determine the association between the factors and each of the mental health statuses assessed. The results showed that the prevalence of depression, anxiety, and stress among the elderly respondents was 27.8%, 22.6%, and 8.7%, respectively. The significant factors for depression were single elderly (Adjusted OR = 3.27, 95%CI 1.66, 6.44), living with family (Adjusted OR = 4.98, 95%CI 2.05, 12.10), and poor general health status (Adjusted OR = 2.28, 95%CI 1.20, 4.36). Living with family was the only significant factor for anxiety (Adjusted OR = 2.68, 95%CI 1.09, 6.57). There was no significant factor for stress. Depression and anxiety among the Malay elderly in the rural community were very worrying. More equity in health should be created or strengthened in order to intensify the opportunity to identify, diagnose, and treat those with mental health problems. Living arrangement in the rural community was an important factor that had influenced depression and anxiety. Therefore, further research is recommended for more comprehensive information, as a result of which appropriate intervention can be made.
Translation and validation of the Malay version of the Stroke Knowledge Test.
Sowtali, Siti Noorkhairina; Yusoff, Dariah Mohd; Harith, Sakinah; Mohamed, Monniaty
2016-04-01
To date, there is a lack of published studies on assessment tools to evaluate the effectiveness of stroke education programs. This study developed and validated the Malay language version of the Stroke Knowledge Test research instrument. This study involved translation, validity, and reliability phases. The instrument underwent backward and forward translation of the English version into the Malay language. Nine experts reviewed the content for consistency, clarity, difficulty, and suitability for inclusion. Perceived usefulness and utilization were obtained from experts' opinions. Later, face validity assessment was conducted with 10 stroke patients to determine appropriateness of sentences and grammar used. A pilot study was conducted with 41 stroke patients to determine the item analysis and reliability of the translated instrument using the Kuder Richardson 20 or Cronbach's alpha. The final Malay version Stroke Knowledge Test included 20 items with good content coverage, acceptable item properties, and positive expert review ratings. Psychometric investigations suggest that Malay version Stroke Knowledge Test had moderate reliability with Kuder Richardson 20 or Cronbach's alpha of 0.58. Improvement is required for Stroke Knowledge Test items with unacceptable difficulty indices. Overall, the average rating of perceived usefulness and perceived utility of the instruments were both 72.7%, suggesting that reviewers were likely to use the instruments in their facilities. Malay version Stroke Knowledge Test was a valid and reliable tool to assess educational needs and to evaluate stroke knowledge among participants of group-based stroke education programs in Malaysia.
Directory of Open Access Journals (Sweden)
Ziaulhaq Hidayat
2017-07-01
Full Text Available This article is an initial exploration of Indonesian Sufi, developed in the Malay world of Indonesia and Malaysia. The spread of this particular tariqa (sufi’s order relates specifically to the mandate received by Tuan Guru of TNKB, as its certified Shaykh, who then actively involved in the network acitivity by visiting the Malay Sultanate areas scattered in the Malay Peninsula. This research reveals the incorporation of some elements of different tariqas in the “form” of TNKB, such as Tariqa Shazaliyya and Tariqa Sammaniyya, as well as adaptation of local culture of Malays ethnic which become part of its unique ritual. Supported by the Sultan, TNKB has become the “official order” of Malay Sultanate, which covers area of Riau, Sumatera Utara (North Sumatera in Indonesia as well as Johor in Malaysia—with caliph as its “agent”.
Ethnic differences in quality of life in adolescents among Chinese, Malay and Indians in Singapore.
Ng, Tze Pin; Lim, Lionel Chee Chong; Jin, Aizhen; Shinfuku, N
2005-09-01
Health-related quality of life in adolescents and ethnic and cultural differences are not well characterized. We used the Quality of Life Questionnaire for Adolescents (QOLQA) to examine ethnic differences in reported QOL scores among Chinese, Malay and Indian ethnicities in Singapore. The 70-item QOLQA measuring five QOL domains (physical, psychological, independence, social and environmental) was administered to a random sample of 1363 school-children aged 10-15 years, representative of the ethnic composition of Singapore adolescents (Chinese 72%, Malays 20% and Indians 8%). Indians reported the highest overall QOL (mean 3.71 +/- SD 0.54) compared to Chinese (3.59 +/- 0.43), p Malays (3.58 +/- 0.44), p Chinese (3.55 +/- 0.54), p Chinese scored highest on physical and independence domains (3.97 +/- 0.54), p Malays (3.82 +/- 0.55). There were no statistically significant gender differences in QOL scores. QOL declined significantly from age 10 to 15 for overall score, psychological, physical (p Chinese (r = 0.39) or Malays (r = 0.39), Indians showed a higher correlation of psychological scores with physical score (r = 0.59) and with other domain scores. Significant ethnic differences in reported adolescent quality of life among Chinese, Malays and Indians in Singapore that are independent of socioeconomic and health status suggest important cultural differences.
The Malay Lexicon Project: a database of lexical statistics for 9,592 words.
Yap, Melvin J; Liow, Susan J Rickard; Jalil, Sajlia Binte; Faizal, Siti Syuhada Binte
2010-11-01
Malay, a language spoken by 250 million people, has a shallow alphabetic orthography, simple syllable structures, and transparent affixation--characteristics that contrast sharply with those of English. In the present article, we first compare the letter-phoneme and letter-syllable ratios for a sample of alphabetic orthographies to highlight the importance of separating language-specific from language-universal reading processes. Then, in order to develop a better understanding of word recognition in orthographies with more consistent mappings to phonology than English, we compiled a database of lexical variables (letter length, syllable length, phoneme length, morpheme length, word frequency, orthographic and phonological neighborhood sizes, and orthographic and phonological Levenshtein distances) for 9,592 Malay words. Separate hierarchical regression analyses for Malay and English revealed how the consistency of orthography-phonology mappings selectively modulates the effects of different lexical variables on lexical decision and speeded pronunciation performance. The database of lexical and behavioral measures for Malay is available at http://brm.psychonomic-journals.org/content/supplemental.
Risky sexual behaviors among Malay adolescents: a comparison with Chinese adolescents in Singapore.
Ng, Junice Y S; Wong, Mee-Lian
2017-07-01
Malays, with majority of the individuals being Muslim, form the largest ethnic group in Southeast Asia. This region is experiencing a rising incidence of HIV infections. Due to circumcision and prohibition of sex outside marriage, being Muslim was argued to be a protective factor against sexually transmitted infections (STI) and Human Immunodeficiency Virus (HIV). However, Malay adolescents were found to be more likely to contract chlamydia and gonorrhea than non-Malay adolescents in Singapore. Using a cross-sectional survey, we examined and compared safer sex knowledge, attitudes and self-efficacy, and sexual behaviors of 248 sexually active Malay adolescents with 384 Chinese adolescents aged 16-19 years in Singapore. Poisson regression, adjusted for socio-demographic characteristics, was used for modeling each dependent variable. Adjusted prevalence ratios (aPR) with 95% confidence intervals (CI) were obtained. On multivariate analysis, Malay adolescents were more likely to report marginally unfavorable attitude towards condom use (aPR 1.21 CI 1.00-1.48) and significantly lower confidence in using condoms correctly (aPR 1.24 CI 1.05-1.47) than Chinese adolescents. They were also more likely to report significantly younger first sex age (aPR 0.98 CI 0.96-1.00), never use of condoms for vaginal sex (aPR 1.32 CI 1.16-1.49) and anal sex (aPR 1.75 CI 1.11-2.76) and non-use of contraceptives at last sex (aPR 1.30 CI 1.17-1.45) than Chinese respondents. Malay males were less likely to buy sex (aPR 0.56 CI 0.37-0.85), but they reported higher likelihood of inconsistent condom use with female sex workers (aPR 2.24 CI 1.30-3.87). Malay ethnicity was associated with unfavorable condom use attitude and lower self-efficacy in using condoms, which was consistent with risky sexual behaviors such as non-use of condoms. Future research should use mixed methods to explore and identify cultural influences to these behaviors.
Mohammad Rahim Kamaluddin; Rohany Nasir; Wan Shahrazad Wan Sulaiman; Rozainee Khairudin; Zainah Ahmad Zamani
2017-01-01
Religious Orientation Scale-Revised (ROS-R) has been used increasingly as an important measure in psychology of religion based researches and widely administered in cross-cultural settings. Unfortunately, there is no valid and reliable ROS-R available in Malay language to assess religious orientations among Malaysians. With that in mind, the present study aims to validate and document the psychometric properties of Malay translated ROS-R (henceforth, M-ROS-R) among sample of Malay...
The Ornamental Design of Traditional Malay Utensils (Kukuran) in Peninsula Malaysia
Md Yusoff Zulkfli bin; Md Zain Dzul Haimi bin; Saniman Hamidon bin
2016-01-01
Woodcarving is a significant craft in Malay society that reflects the local traditions and customs. It is a manifestation of craftsmen artistic skills and intutitive ideas into a piece of wood. It is also manifestation of the creative process of imitation, denaturalization, stylization and abstraction. Historically, the Malay craftsmen have created many attractive traditional art forms and one of it is the coconut graters (kukuran). The ornamental carved kukuran is closely related to its Mala...
Psychometric Properties of the Drive for Muscularity Scale in Malay Men
Swami, Viren; Barron, David; Lau, Poh Li; Jaafar, Jas Laile
2016-01-01
The Drive for Muscularity Scale (DMS) is a widely used measure in studies of men’s body image, but few studies have examined its psychometric properties outside English-speaking samples. Here, we assessed the factor structure of a Malay translation of the DMS. A community sample of 159 Malay men from Kuala Lumpur, Malaysia, completed the DMS, along with measures of self-esteem, body appreciation, and muscle discrepancy. Exploratory factor analysis led to the extraction of two factors, differe...
Nurul-Fadhilah, Abdullah; Teo, Pey Sze; Foo, Leng Huat
2012-01-01
Food frequency questionnaire (FFQ) must be tailored to the target populations because dietary habits vary within the populations due to differences in cultural and lifestyles practices. Limited information is available to assess the validity of FFQ used among Malaysian adolescents. To construct the validity and reproducibility of a newly developed FFQ in assessing habitual nutrients intake over the past year of 170 Malay adolescent boys and girls in Kelantan, Malaysia. The FFQ that consisted of 124 food items was assessed, whereas three days of 24-hours dietary recalls (DR) was administered as the standard criteria method. Estimated mean intake for most nutrients assessed by the FFQ were higher as compared to the three DRs (pcross classification of quartile analysis showed that most nutrients were classified into the same or adjacent quartiles (median=52.7%). For the reproducibility of FFQ, the correlation of nutrients ranged from 0.43 for carotene to 0.86 for total fat intake (median=0.67), after adjusting for total energy intake. The newly developed dietary FFQ is a relatively good and valid tool in assessing habitual nutrients intake for the past year among Malay adolescents in Malaysia.
Population Genetics of Identifiler System in Malaysia.
Nakamura, Yasutaka; Samejima, Michinaga; Minaguchi, Kiyoshi; Nambiar, Phrabhakaran
2016-01-01
Short tandem repeat (STR) polymorphisms were investigated in 341 unrelated Malay individuals (218 males and 123 females) living in or around Kuala Lumpur by using a forensic analysts kit. The following STRs were targeted: D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, D5S818, and FGA. The purpose of this study was to elucidate population genetics in Malaysia and calculate statistical parameters for forensic and anthropological research. Data on these STRs in the target population were obtained and subjected to statistical analysis. Accordance with the Hardy-Weinberg equilibrium was proven for all the loci targeted. The combined power of discrimination was greater than 0.9999999999, indicating that this multiplex system is an excellent tool for forensic casework. The allele frequency in the data were weighed against that in four other local populations (Chinese, Iranian, Belgian, and African). The average coefficient of correlation was strongest in the order of Africa (0.092522), Belgium (0.264822), Iran (0.404363), and China (0.706661). These results are consistent with what is known about the anthropological history of and prehistoric human migration in the Malay region. We believe that these data offer a valuable anthropological resource, being applicable to the statistical evaluation of DNA evidence in human identification, as well as the determination of ethnicity in healthy populations.
Lim, K B; Jeevan, N H; Jaya, P; Othman, M I; Lee, Y H
2001-06-01
Allele frequencies for the nine STRs genetic loci included in the AmpFlSTR Profiler kit were obtained from samples of unrelated individuals comprising 139-156 Malays, 149-153 Chinese and 132-135 Indians, residing in Malaysia.
The Perception towards National Anti-Smoking Initiatives among Malay Male Smokers
Suriani ISMAIL; Muhamad Hanafiah JUNI; Kulanthayan KCMANI; Muhamad Suhainizam SALILUDDIN; Raja Ahmad ZAKWAN; Ling Rong TIONG
2015-01-01
Background: Global Adult Tobacco Survey (GATS), Malaysia 2011 reported that the prevalence of smoking was highest among Malays male i.e., 24.6% (CI:22.1,27.3). The aim of this study was to evaluate the perception of a group of smokers towards various national anti-smoking initiatives as well as its association with age and education level.Methods: The study was conducted in a randomly selected pre-dominantly Malay settlement in Malaysia using a validated self-administered questionnaire. The n...
Mahmud, Wan Mohd. Rushidi Wan; Awang, Amir; Mohamed, Mahmood Nazar
2003-01-01
Aim: To reevaluate the psychometric characteristics of the Malay version of the Edinburgh Postnatal Depression Scale among a sample of postpartum Malay women attending the Bakar Bata Health Center in Alor Setar, Kedah, North West of Peninsular Malaysia. Materials and methods: 64 women between 4 to 12 weeks postpartum were recruited for there validation study. They were given questionnaires on socio-demography, the 21-item Malay version of the Beck Depression Inventory II (BDI-II) and the 10-item Malay version of the Edinburgh Postnatal Depression Scale (EPDS). All the participants were later interviewed using the Hamilton Depression Rating Scale (HDRS-17) and the Composite International Diagnostic Interview (CIDI). All diagnoses were made based on the Tenth Edition of the International Classification of Diseases (ICD-10) Results: 9 women (14.1%) were diagnosed to have significant depression (7 mild depressive episodes and 2 moderate depressive episodes according to ICD-10). EPDS was found to have good internal consistency (Cronbach alpha =0.86) and split half reliability (Spearman split half coefficient = 0.83). The instrument also showed satisfactory discriminant and concurrent validity as evidenced by the statistically significant difference in EPDS scores between the depressed group and their non-depressed counterparts (Mann Whitney U test: 2 tailed p value Depression Scale in identifying postpartum depression among recently delivered Malay women attending the Bata Bata Health Center in Alor Setar, Kedah, North West of Peninsular Malaysia. PMID:23386800
The Characteristics Of Malay House Spatial Layout Of Pekanbaru In Accordance With Islamic Values
Samra, Boby
2017-12-01
House is not only is a place to get rest and do activities bu also treated as a pride for the Malay community. The values contained in the spatial layout of the house have specific meaning to the owners. This makes the Malay house becomes the symbol of pride to uphold the “tuah” and dignity of the owner. This research is conducted using qualitative approach through management and data management available through several methods such as observation, interview, documentation and group discussion. This is expected to provide understanding of the perception of Islam dealing with the characteristics of the spatial layout of the Malay house of Pekanbaru.
Gomez, Rapson; Vance, Alasdair
2008-01-01
This study examined differential symptom functioning (DSF) in ADHD symptoms across Malay and Chinese children in Malaysia. Malay (N = 571) and Chinese (N = 254) parents completed the Disruptive Behavior Rating Scale, which lists the DSM-IV ADHD symptoms. DSF was examined using the multiple indicators multiple causes (MIMIC) structural equation…
Al-Attas’ Philosophy of History on the Arrival and Proliferation of Islam in the Malay World
Directory of Open Access Journals (Sweden)
AZMUL FAHIMI KAMARUZAMAN
2016-12-01
Full Text Available This article examines the philosophy of history of Syed Muhammad Naquib al-Attas on the theory of the arrival and spread of Islam in the Malay world, particularly in his work ‘Historical Facts and Fictions’. This philosophy of history is consequent to al-Attas' critical research contained in his previous works such as ‘Preliminary Statement on a General Theory of The Islamization of the Malay-Indonesian Archipelago’ (1969, ‘Islam in the Malay History and Culture’ (1972 and ‘The Correct Date of the Terengganu Inscription’ (1972. This study analyses these works and his other works to look into the aspects of history and historiography contained in the philosophy of history of al-Attas on the arrival and spread of Islam in the Malay world in terms of their scope, sources and history methods. This study found that in terms of epistemology al-Attas has contributed in creating a theoretical framework and a novel approach to the philosophy of history of the history of Islam in the Malay world.
Hashim, Rohani
2017-01-01
This thesis is a study of the major Malay language comedy films written and directed in Singapore for the Shaw Brothers company, Malay Film Productions, by P. Ramlee, in the period 1957-1964, a period which is commonly regarded as the "Golden Age of the Malay Film Industry." Ramlee was born in Penang in 1929, and having established himself as a singer, songwriter, popular actor and scriptwriter, began his career as a film director in 1956, shortly before the Malay Federation achieved independ...
Ziaulhaq Hidayat; Muzakkir Syahrul
2017-01-01
This article is an initial exploration of Indonesian Sufi, developed in the Malay world of Indonesia and Malaysia. The spread of this particular tariqa (sufi’s order) relates specifically to the mandate received by Tuan Guru of TNKB, as its certified Shaykh, who then actively involved in the network acitivity by visiting the Malay Sultanate areas scattered in the Malay Peninsula. This research reveals the incorporation of some elements of different tariqas in the “form” of TNKB, such as Tariq...
Guan, Ng Chong; Isa, Saramah Mohammed; Hashim, Aili Hanim; Pillai, Subash Kumar; Harbajan Singh, Manveen Kaur
2015-03-01
The use of the Internet has been increasing dramatically over the decade in Malaysia. Excessive usage of the Internet has lead to a phenomenon called Internet addiction. There is a need for a reliable, valid, and simple-to-use scale to measure Internet addiction in the Malaysian population for clinical practice and research purposes. The aim of this study was to validate the Malay version of the Internet Addiction Test, using a sample of 162 medical students. The instrument displayed good internal consistency (Cronbach's α = .91), parallel reliability (intraclass coefficient = .88, P students with and without Internet dependence. Principal component analysis with varimax rotation identified a 5-factor model. The Malay version of the Internet Addiction Test appeared to be a valid instrument for assessing Internet addiction in Malaysian university students. © 2012 APJPH.
Baharudin, Mazlina; Ikhsan, Siti Ajar
2016-01-01
The interesting teaching and learning of Malay languages is a challenging effort and need a relevant plan to the students' needs especially for the foreign students who already have the basic Indonesian Malay language variation that they have learned for four semesters in their own country, Germany. Therefore, the variety of teaching and learning…
Speech to Text Translation for Malay Language
Al-khulaidi, Rami Ali; Akmeliawati, Rini
2017-11-01
The speech recognition system is a front end and a back-end process that receives an audio signal uttered by a speaker and converts it into a text transcription. The speech system can be used in several fields including: therapeutic technology, education, social robotics and computer entertainments. In most cases in control tasks, which is the purpose of proposing our system, wherein the speed of performance and response concern as the system should integrate with other controlling platforms such as in voiced controlled robots. Therefore, the need for flexible platforms, that can be easily edited to jibe with functionality of the surroundings, came to the scene; unlike other software programs that require recording audios and multiple training for every entry such as MATLAB and Phoenix. In this paper, a speech recognition system for Malay language is implemented using Microsoft Visual Studio C#. 90 (ninety) Malay phrases were tested by 10 (ten) speakers from both genders in different contexts. The result shows that the overall accuracy (calculated from Confusion Matrix) is satisfactory as it is 92.69%.
Ali, Farhan
2016-01-01
Singaporean students generally perform very well in international tests of mathematics and science. Nonetheless, in multi-cultural Singapore, there exist gaps with the Malays, a minority group in Singapore, systematically lagging behind the other ethnic groups of the Chinese and Indians in many educational performance indicators. While there have…
Cheung, Yin Bun; Yeo, Khung Keong; Chong, Kok Joon; Khoo, Eric Yh; Wee, Hwee Lin
2017-12-01
The World Health Organization Quality of Life (WHOQOL-BREF) questionnaire is a 26-item questionnaire that evaluates 4 domains of quality of life (QoL), namely Physical, Psychological, Social Relationships and Environment. This study aimed to evaluate the validity and reliability of the WHOQOL-BREF among Singapore residents aged 21 and above. We recruited participants from the general population by using multistage cluster sampling and participants from 2 hospitals by using convenience sampling. Participants completed either English, Chinese or Malay versions of the WHOQOL-BREF and the EuroQoL 5 Dimension 5 Levels (EQ-5D-5L) questionnaires. Confirmatory factor analysis, known-group validity, internal consistency (Cronbach's alpha) and test-retest reliability using the intraclass correlation coefficient (ICC) were performed. Data from 1316 participants were analysed (Chinese: 46.9%, Malay: 41.0% and Indian: 11.7%; 57.5% mean, mean standard deviation [SD, range] age: 51.9 [15.68, 24 to 90] years); 154 participants took part in the retest in various languages (English: 60, Chinese: 49 and Malay: 45). Tucker-Lewis Index (TLI) was 0.919, 0.913 and 0.909 for the English, Chinese and Malay versions, respectively. Cronbach's alpha exceeded 0.7 and ICC exceeded 0.4 for all domains in all language versions. The WHOQOL-BREF is valid and reliable for assessing QoL in Singapore. Model fit is reasonable with room for improvement.
Linguistic Alternants and Code Selection in Baba Malay.
Pakir, Anne
1989-01-01
Provides a brief account and explanation of the phenomenon of language use among the Baba community, which uses Hokkien, Malay, and English in the process of code selection and code mixing/switching. Data are drawn from recordings of conversation of the Babas and Nyonyas. (Author/OD)
Chu, Anne H Y; Moy, F M
2014-03-01
Metabolic syndrome is a highly prevalent health problem within the adult population in developing countries. We aimed to study the association of physical activity levels and metabolic risk factors among Malay adults in Malaysia. Cross-sectional. Body mass index, waist circumference, and systolic/diastolic blood pressure, fasting blood glucose, fasting triglyceride and high-density lipoprotein cholesterol levels were measured in 686 Malay participants (aged 35-74 years). Self-reported physical activity was obtained with the validated International Physical Activity Questionnaire (Malay version) and categorized into low, moderate or high activity levels. Individuals who were classified as overweight and obese predominated (65.6%). On the basis of the modified NCEP ATP III criteria, metabolic syndrome was diagnosed in 31.9% of all participants, of whom 46.1% were men and 53.9% were women. The prevalence of metabolic syndrome among participants with low, moderate or high activity levels was 13.3%, 11.7% and 7.0%, respectively (p<0.001). Statistically significant negative associations were found between a number of metabolic risk factors and activity categories (p<0.05). The odds ratios for metabolic syndrome in the moderate and high activity categories were 0.42 (95% CI: 0.27-0.65) and 0.52 (95% CI: 0.35-0.76), respectively, adjusted for gender. Moderate and high activity levels were each associated with reduced odds for metabolic syndrome independent of gender. Although a slightly lower prevalence of metabolic syndrome was associated with high activity than with moderate activity, potential health benefits were observed when moderate activity was performed. Copyright © 2013 Sports Medicine Australia. All rights reserved.
Baharudin, Mazlina; Sadik, Azlina Md
2016-01-01
This paper will highlight successful teaching techniques used in class in teaching the Malay Language 1 course in Universiti Sains Malaysia (USM). The course is to equip foreign students for their studies and also as means of basic communication with the locals in Malaysia. In Malaysia, the emphasis in Malay language teaching are focused to…
Grammatical Relations and Grammatical Categories in Malay; the Indonesian Prefix MeN- Revisited
Tjia, Johnny
2015-01-01
The lexical roots of Malay are flexible with regard to their grammatical categories, which presents a problem in providing grammatical evidence for their category determination. This paper attempts to propose the use of affixes as one way to deal with the issue. Data from Indonesian and Ambon (Malay) language are among others given for clarification. The grammatical evidence from Indonesian active meN-, together with other affixes, are revisited as they can contribute to our understanding of ...
Lee, Chee Kean; Tan, Tiam Siong; Chan, Chris Yin Wei; Kwan, Mun Keong
2017-04-01
Clinical imaging study. To study the surgical morphometry of C1 and C2 vertebrae in Chinese, Indian, and Malay patients. C1 lateral mass and C2 pedicle screw fixation is gaining popularity. However, there is a lack of C1-C2 morphometric data for the Asian population. Computed tomography analysis of 180 subjects (60 subjects each belonging to Chinese, Indian, and Malay populations) using simulation software was performed. Length and angulations of C1 lateral mass (C1LM) and C2 pedicle (C2P) screws were assessed. The predicted C1LM screw length was between 23.2 and 30.2 mm. The safe zone of trajectories was within 11.0°±7.7° laterally to 29.1°±6.2° medially in the axial plane and 37.0°±10.2° caudally to 20.9°±7.8° cephalically in the sagittal plane. The shortest and longest predicted C2P screw lengths were 22.1±2.8 mm and 28.5±3.2 mm, respectively. The safe trajectories were from 25.1° to 39.3° medially in the axial plane and 32.3° to 45.9° cephalically in the sagittal plane. C1LM screw length was 23-30 mm with the axial safe zone from 11° laterally to 29° medially and sagittal safe zone at 21° cephalically. C2P screw length was 22-28 mm with axial safe zone from 26° to 40° medially and sagittal safe zone from 32° to 46° cephalically. These data serve as an important reference for Chinese, Indian, and Malay populations during C1-C2 instrumentation.
Directory of Open Access Journals (Sweden)
Zulkifli MM
2017-07-01
Full Text Available INTRODUCTION: This study aimed to cross-culturally adapt a Malay version of Knee Injury and Osteoarthritis Outcome Score (KOOS and to evaluate its psychometric properties in patients with knee osteoarthritis (OA. MATERIALS AND METHODS: The English version KOOS was translated into a Malay version using forward and backward translation process, followed by face validity and content validity. Two hundred and twenty-six knee OA patients attending the Outpatient and Orthopaedic Clinics, Universiti Sains Malaysia Hospital, completed the Malay version KOOS. Construct validity using confirmatory factor analysis and internal reliability assessment were performed. RESULTS: The results showed that the original five-factor model with 42 items failed to achieve acceptable values of the goodness of fit indices, indicating poor model fit. A new five-factor model of 26 items demonstrated acceptable level of goodness of fit (comparative fit index= 0.929, incremental fit index= 0.930, Tucker Lewis fit index= 0.920, root mean square error of approximation= 0.073 and Chisquared/ degree of freedom= 2.183 indices to signify a model fit. The Cronbach’s alpha value for the new model ranged from 0.776 to 0.946. The composite reliability values of each construct ranged between 0.819 and 0.921, indicating satisfactory to high level of convergent validity. CONCLUSION: The five-factor model with 26 items in the Malay version of KOOS questionnaire demonstrated a good degree of goodness of fit and was found to be valid, reliable and simple as an assessment tool for symptoms, pain, activity of daily living, sports and recreational activity and quality of life for Malaysian adults suffering from knee osteoarthritis.
Business Lures Employed by Malay Kelantanese Entrepreneurs
Directory of Open Access Journals (Sweden)
Sahad Mohd Nizam
2018-01-01
Full Text Available The foundation of a successful business is essentially the level of consumer response to a product or service offered. Entrepreneurs’ abilitities to cater to their consumers’ needs are one of their secrets to success. Hence, the objective of this study is to uncover the secrets of business success, particularly the business lures that have helped Kelantan entrepreneurs to popularise products or services they offer. A qualitative approach was used to analyse the interview data according to themes. The study found five factors which determined the business success of the selected Malay Kelantanese entrepreneurs. These factors were: they were persistent in asking for help from Allah, they strived to be approachable entrepreneurs, and they cultivated positive entrepreneurial virtues such as having an honourable personality, being creative, and innovative, as well as being bold in their marketing strategy. Although the findings are not representative of all Malay entrepreneurs in Malaysia, this study can, however, serve as a source of reference to encourage other entrepreneurs to emulate the business success of the selected entrepreneurs. Apart from that, it can encourage awareness among the Muslim entrepreneurs, about the importance of managing a business in accordance with the Islamic laws
A cross-cultural study of request speech act: Iraqi and Malay students
Directory of Open Access Journals (Sweden)
Maryam Farnia
2014-08-01
Full Text Available Several studies have indicated that the range and linguistics expressions of external modifiers available in one language differ from those available in another language. The present study aims to investigate the cross-cultural differences and similarities with regards to the realization of request external modifications. To this end, 30 Iraqi and 30 Malay university students are selected as the participants of this study. Spencer-Oatey's (2008 rapport management theoretical framework is used to examine how face rapport is managed through the use of external modifications. The corpus consists of responses to a Discourse Completion Test (DCT consisting of eight situations. The questionnaires, adopted from Rose (1994, were distributed among Iraqi students and Malaysian Malay students studying at Universiti Sains Malaysia, Malaysia. The corpus were then analyzed based on Blum-Kulka, House and Kasper (1989 classification of external modifiers. The primary objective of this paper is to compare the effect of situational factors on the realization patterns of request modification between Iraqi and Malay university students .The findings are hoped to have implications for comparative cross-cultural and intercultural communication studies.
A Survey: Framework of an Information Retrieval for Malay Translated Hadith Document
Directory of Open Access Journals (Sweden)
Zulkefli Nurul Syeilla Syazhween
2017-01-01
Full Text Available This paper reviews and analyses the limitation of the existing method used in the IR process in retrieving Malay Translated Hadith documents related to the search request. Traditional Malay Translated Hadith retrieval system has not focused on semantic extraction from text. The bag-of-words representation ignores the conceptual similarity of information in the query text and documents, which produce unsatisfactory retrieval results. Therefore, a more efficient IR framework is needed. This paper claims that the significant information extraction and subject-related information are actually important because the clues from this information can be used to search and find the relevance document to a query. Also, unimportant information can be discarded to represent the document content. So, semantic understanding of query and document is necessary to improve the effectiveness and accuracy of retrieval results for this domain study. Therefore, advance research is needed and it will be experimented in the future work. It is hoped that it will help users to search and find information regarding to the Malay Translated Hadith document.
Grammatical relations and grammatical categories in Malay; The Indonesian prefix meN- revisited
Directory of Open Access Journals (Sweden)
Johnny Tjia
2015-04-01
Full Text Available The lexical roots of Malay are flexible with regard to their grammatical categories, which presents a problem in providing grammatical evidence for their category determination. This paper attempts to propose the use of affixes as one way to deal with the issue. Data from Indonesian and Ambon (Malay language are among others given for clarification. The grammatical evidence from Indonesian active meN-, together with other affixes, are revisited as they can contribute to our understanding of the matter.
Asmuri, Siti Noraini; Brown, Ted; Broom, Lisa J
2016-07-01
Valid translations of time use scales are needed by occupational therapists for use in different cross-cultural contexts to gather relevant data to inform practice and research. The purpose of this study was to describe the process of translating, adapting, and validating the Time Use Diary from its current English language edition into a Malay language version. Five steps of the cross-cultural adaptation process were completed: (i) translation from English into the Malay language by a qualified translator, (ii) synthesis of the translated Malay version, (iii) backtranslation from Malay to English by three bilingual speakers, (iv) expert committee review and discussion, and (v) pilot testing of the Malay language version with two participant groups. The translated version was found to be a reliable and valid tool identifying changes and potential challenges in the time use of older adults. This provides Malaysian occupational therapists with a useful tool for gathering time use data in practice settings and for research purposes.
Robson, Noorzurani; Bond, Alyson; Wolff, Kim
2013-01-01
There is evidence that smoking behaviour differs by ethnicity. This study aims to compare smoking behaviour characteristics between Caucasian and Malay smokers. A cross sectional survey, involving 175 smokers attending smoking cessation clinics at the Institute of Psychiatry, London, United Kingdom and University Malaya, Kuala Lumpur, Malaysia between May 2005 and February 2007. Data on demographics, smoking history, nicotine dependence and smoking behaviour were collected. All participants were males, mean age 30.7 ± 10.3 years. Caucasians initiated smoking significantly earlier (mean age 14.8 ± 2.8 years) (p = 0.001) and smoked regularly significantly earlier (mean age 17.3 ± 3.5) (p = 0.003) than Malays (mean starting age 16.9 ± 4.4 years and mean age regular use 19.5 ± 4.5 years), respectively. Caucasians smoked less for social integration than Malays (p = 0.03) but smoked more for regulation of negative affect than Malays (p = 0.008) and smoked more for hedonism than Malays (p < 0.001). Malays smoke as a means of socially integrating. This has important public health implications. Social reasons and the social environment play a role in smoking uptake, smoking maintenance and smoking cessation and this should be borne in mind for strategies planning to promote smoking cessation. Copyright © 2013 Elsevier Inc. All rights reserved.
Conceptual Framework: Development of Interactive Reading Malay Language Learning System (I-ReaMaLLS
Directory of Open Access Journals (Sweden)
Ismail Nurulisma
2018-01-01
Full Text Available Reading is very important to access knowledge. Reading skills starts during preschool level no matter of the types of languages. At present, there are many preschool children who are still unable to recognize letters or even words. This leads to the difficulties in reading. Therefore, there is a need of intervention in reading to overcome such problems. Thus, technologies were adapted in enhancing learning skills, especially in learning to read among the preschool children. Phonological is one of the factors to be considered to ensure a smooth of transition into reading. Phonological concept enables the first learner to easily learn reading such to learn reading Malay language. The medium of learning to read Malay language can be assisted via the supportive of multimedia technology to enhance the preschool children learning. Thus, an interactive system is proposed via a development of interactive reading Malay language learning system, which is called as I-ReaMaLLS. As a part of the development of I-ReaMaLLS, this paper focus on the development of conceptual framework in developing interactive reading Malay language learning system (I-ReaMaLLS. I-ReaMaLLS is voice based system that facilitates the preschool learner in learning reading Malay language. The conceptual framework of developing I-ReaMaLLS is conceptualized based on the initial study conducted via methods of literature review and observation with the preschool children, aged 5 – 6 years. As the result of the initial study, research objectives have been affirmed that finally contributes to the design of conceptual framework for the development of I-ReaMaLLS.
Validation of the Malay version of the Amsterdam Preoperative Anxiety and Information Scale (APAIS).
Mohd Fahmi, Z; Lai, L L; Loh, P S
2015-08-01
Preoperative anxiety is a significant problem worldwide that may affect patients' surgical outcome. By using a simple and reliable tool such as the Amsterdam Preoperative Anxiety and Information Scale (APAIS), anaesthesiologists would be able to assess preoperative anxiety adequately and accurately. The purpose of this study was to develop and validate the Malay version of APAIS (Malay-APAIS), and assess the factors associated with higher anxiety scores. The authors performed forward and backward translation of APAIS into Malay and then tested on 200 patients in the anaesthetic clinic of University Malaya Medical Centre. Psychometric analysis was performed with factor analysis, internal consistency and correlation with Spielberger's State-Trait Anxiety Inventory (STAI-state). A good correlation was shown with STAI-state (r = 0.59). Anxiety and need for information both emerged with high internal consistency (Cronbach's alpha 0.93 and 0.90 respectively). Female gender, surgery with a higher risk and need for information were found to be associated with higher anxiety scores. On the other hand, previous experience with surgery had lower need for information. The Malay-APAIS is a valid and reliable tool for the assessment of patients' preoperative anxiety and their need for information. By understanding and measuring patient's concerns objectively, the perioperative management will improve to a much higher standard of care.
Mohd Natar, Ahmad Kamal; Nagappan, Rajendran; Ainuddin, Husna Ahmad; Masuri, Ghazali; Thanapalan, Chandra Kannan K.
2015-01-01
Current cognitive screening tests are difficult to use due to their deficit in cultural and conceptual significance and translation into other languages. The purpose of this study was to translate the Loewenstein Occupational Therapy Cognitive Assessment for Geriatrics (LOTCA-G) into Malay language and test its reliability and validity for…
ISLAM IN SOUTH THAILAND: ACCULTURATION OF ISLAM IN THE MALAY CULTURE
Directory of Open Access Journals (Sweden)
Suryadi Suryadi
2017-03-01
Full Text Available In the perspective of history, the religious and cultural system of Patani Malays in Southern Thailand have underground evolution development stages from animism and dynamism to Hinduism and Buddhism. This ‘’old’’ culture has been handed down into the traditions and values as well as the mindset of the present day life and culture of the Patani Malays. The arrival of Islam has brought chnges in the religious and cultural system of the Patani Malays. The Patani’s worldview was formerly based on the religious and cultural system of animism, dynamism, Hinduism, and Buddhism in the term of their customs and traditions. This study examines the process of inculturation of Islamic values into Patani malay’s culture in Southern Thailand. This study used a descriptive-analytical method and an historical-anthropological approach. This study researches the Patani malay’s religious system and culture as manifested in their everyday life and the dynamic relationship of Islamic values and local culture. In so doing, the study can describe and analyze the development of Islamic Values and Patani Malay’s culture have eventually facilitated the process of its inculturation into Patani Malay’s religious system and culture. Keywords: The religious systems, Islamic values, culture, inculturation.
Dixon, L. Quentin; Chuang, Hui-Kai; Quiroz, Blanca
2012-01-01
To test the lexical restructuring hypothesis among bilingual English-language learners, English phonological awareness (PA), English vocabulary and ethnic language vocabulary (Mandarin Chinese, Malay or Tamil) were assessed among 284 kindergarteners (168 Chinese, 71 Malays and 45 Tamils) in Singapore. A multi-level regression analysis showed that…
Subramaniam, Kavitha; Low, Wah Yun; Chinna, Karuthan; Chin, Kin Fah; Krishnaswamy, Saroja
2017-08-01
This study aims to investigate the psychometric properties of the Malay version of the Dutch Eating Behaviour Questionnaire (DEBQ) among Malaysian adults. The Malay version of the DEBQ instrument was administered to 398 outpatients (269 women and 129 men) at the University of Malaya Medical Centre (UMMC). Confirmatory Factor Analysis (CFA) was conducted to study the construct validity of the instrument. Composite reliability coefficient, Raykov's rho, was used to determine the internal consistency. The proposed three-factor structure for the DEBQ instrument was appropriate, although three items (Items 21, 14 and 27) showed problematic loadings with inappropriate model fit and were removed. The modified version had an appropriate model fit χ 2 /df = 2.129, TLI = 0.908, CFI = 0.918, RMSEA = 0.053 (90%CI = 0.048-0.058), close-fit P -value = 0.136 and satisfactory internal consistency of 0.914 for emotional eating scale, 0.819 for external eating scale and 0.856 for restrained eating scale. The Malay version of the DEBQ is a valid instrument to study eating behaviour traits among Malaysian adults. Further research is warranted to determine if Items 14 and 27 are appropriate for the Malaysian population.
Validation study of the Leeds Dyspepsia Questionnaire in a multi-ethnic Asian population.
Mahadeva, Sanjiv; Chan, Wah-Kheong; Mohazmi, Mohammed; Sujarita, Ramanujam; Goh, Khean-Lee
2011-11-01
Outcome measures for clinical trials in dyspepsia require an assessment of symptom response. There is a lack of validated instruments assessing dyspepsia symptoms in the Asian region. We aimed to translate and validate the Leeds Dyspepsia Questionnaire (LDQ) in a multi-ethnic Asian population. A Malay and culturally adapted English version of the LDQ were developed according to established protocols. Psychometric evaluation was performed by assessing the validity, internal consistency, test-retest reliability and responsiveness of the instruments in both primary and secondary care patients. Between April and September 2010, both Malay (n=166) and Malaysian English (n=154) versions were assessed in primary and secondary care patients. Both language versions were found to be reliable (internal consistency was 0.80 and 0.74 (Cronbach's α) for Malay and English, respectively; spearman's correlation coefficient for test-retest reliability was 0.98 for both versions), valid (area under receiver operating curve for accuracy of diagnosing dyspepsia was 0.71 and 0.77 for Malay and English versions, respectively), discriminative (median LDQ score discriminated between primary and secondary care patients in Malay (11.0 vs 20.0, PAsian population with dyspepsia. © 2011 Journal of Gastroenterology and Hepatology Foundation and Blackwell Publishing Asia Pty Ltd.
Origin of the flora of the Malay Peninsula
Ridley, H.N.
1937-01-01
In my work on the Malay Peninsula, I included such plants as were known from the districts of North Kedah, Perlis and Setul. Botanically however, the Malayan flora ceases at a line running from a little north of Kedah peak Lat. 6.5, to Kota Bahru in North Kelantan Lat. 6.10. It is in fact
Directory of Open Access Journals (Sweden)
T. Nataraja Moorthy
2015-03-01
Full Text Available One of the valuable physical evidence that a suspect leaves unintentionally at a crime scene is likely to include footprints. Physical evidence needs to be utilized to express individual characteristics. Very keen analysis of footprints can provide useful information to establish personal identity and ease the crime investigation. The present study aims to analyze and describe the individual characteristics of footprints of Malaysian Malays from a forensic perspective in a sample of 400 adult Malay participants consisting of 200 males and 200 females. The footprints were collected using an inkless shoe print kit (Carolina, USA. Various features of the toes, humps in the toe line, phalange marks, flatfoot condition, pits, cracks, corns, etc., were investigated. The frequency of these characteristics was recorded. The frequency of the fibularis-type foot is the highest, followed by the tibialis-type, the intermediate-type and the midularis-type is found to have the least frequency in both the sexes. This sequence is found to be different from the sequence observed in the north Indian population. Two humps have been found most often in male footprints followed by three humps and zero hump is found to be the least frequent. While in female footprints, three humps have been found, most often followed by two humps and zero hump is found to be the least frequent. Other identifying features are also highlighted using illustrations. This trait shows bilateral variation. The morphological length of toes and some other features in this study are found to be different from footprints of Indian Tamils, North Indian Gujjars and the Thai population.
Multi-layered population structure in Island Southeast Asians
Mörseburg, Alexander; Pagani, Luca; Ricaut, Francois-Xavier; Yngvadottir, Bryndis; Harney, Eadaoin; Castillo, Cristina; Hoogervorst, Tom; Antao, Tiago; Kusuma, Pradiptajati; Brucato, Nicolas; Cardona, Alexia; Pierron, Denis; Letellier, Thierry; Wee, Joseph; Abdullah, Syafiq; Metspalu, Mait; Kivisild, Toomas
2016-01-01
The history of human settlement in Southeast Asia has been complex and involved several distinct dispersal events. Here, we report the analyses of 1825 individuals from Southeast Asia including new genome-wide genotype data for 146 individuals from three Mainland Southeast Asian (Burmese, Malay and Vietnamese) and four Island Southeast Asian (Dusun, Filipino, Kankanaey and Murut) populations. While confirming the presence of previously recognised major ancestry components in the Southeast Asian population structure, we highlight the Kankanaey Igorots from the highlands of the Philippine Mountain Province as likely the closest living representatives of the source population that may have given rise to the Austronesian expansion. This conclusion rests on independent evidence from various analyses of autosomal data and uniparental markers. Given the extensive presence of trade goods, cultural and linguistic evidence of Indian influence in Southeast Asia starting from 2.5 kya, we also detect traces of a South Asian signature in different populations in the region dating to the last couple of thousand years. PMID:27302840
Ethnicity and Accommodation: Malay-Chinese Relations in Kelantan, Malaysia.
Raybeck, Douglas
1980-01-01
Argues that despite antipathy toward the Chinese manifested at state and urban levels, the Malay-Chinese relations at the village level in Kelantan, Malaysia, are better than corresponding relationships in the country's more developed states. Suggests both cultural and political reasons for the success of the Chinese group. (Author/GC)
The magmatism and metamorphism at the Malayer area, Western Iran
Ahadnejad, V.; Valizadeh, M. V.; Esmaeily, D.
2009-04-01
The Malayer area is located in the NW-SE aligned Sanandaj-Sirjan metamorphic belt, western Iran and consists mainly of Mesozoic schists so-called Hamadan Phyllites, Jurassic to Tertiary intrusive rocks and related contact metamorphic aureoles, aplites and pegmatites. The Sanandj-Sirjan Zone is produced by oblique collisional event between Arabian plate and Central Iran microcontinent. Highest level of regional metamorphism in the area is greenschist facies and injection of felsic magmas is caused contact metamorphism. Magmatism is consist of a general northwest trend large felsic to intermediate intrusive bodies. The main trend of structural features i.e. faults, fractures and other structural features is NW-SE. The Malayer granitoid complex is ellipsoid in shape and has NW-SE foliation especially at the corners of the intrusions. Petrography of the magmatic rocks revealed recrystallization of quartz and feldspars, bending of biotite, and aligment of minerals paralle to the main trend of magmatic and metamorphic country rocks. These indicated that intrusion of felsic magma is coincide to the regional metamorphism and is syn-tectoinc. Non-extensive contact metamorphism aureoles and rareness of pegmatite and aplite in the area are interpreted as injection of felsic magmas into the high-strain metamorphic zone. The regional metamorphic rocks mainly consist of meta-sandstone, slate, phyllite, schist. These gray to dark metasedimentary rocks are consist of quartz, muscovite, turmaline, epidote, biotite and chlorite. Sheeted minerals form extended schistosity and study of porphyroblast-matrix relationships shows that injection of granitic magma into the country rocks is syn to post-tectonic. Syn-tectonic indicating porphyroblast growth synchronous with the development of the external fabric. The thermal contact area of the granite can be observed in the contact margin of granite and regional metamorphic rocks, where it produced hornfelses, andalusit-garnet schists and
Directory of Open Access Journals (Sweden)
Yusof Zamros YM
2012-06-01
Full Text Available Abstract Background The study aimed to develop and test a Malay version of the Child-OIDP index, evaluate its psychometric properties and report on the prevalence of oral impacts on eight daily performances in a sample of 11–12 year old Malaysian schoolchildren. Methods The Child-OIDP index was translated from English into Malay. The Malay version was tested for reliability and validity on a non-random sample of 132, 11–12 year old schoolchildren from two urban schools in Kuala Lumpur. Psychometric analysis of the Malay Child-OIDP involved face, content, criterion and construct validity tests as well as internal and test-retest reliability. Non-parametric statistical methods were used to assess relationships between Child-OIDP scores and other subjective outcome measures. Results The standardised Cronbach’s alpha was 0.80 and the weighted Kappa was 0.84 (intraclass correlation = 0.79. The index showed significant associations with different subjective measures viz. perceived satisfaction with mouth, perceived needs for dental treatment, perceived oral health status and toothache experience in the previous 3 months (p Conclusion This study indicated that the Malay Child-OIDP index is a valid and reliable instrument to measure the oral impacts of daily performances in 11–12 year old urban schoolchildren in Malaysia.
Liang, Seng; Singh, Manjit; Gam, Lay-Harn
Breast cancer is a leading cause of worldwide mortality in females. In Malaysia, breast cancer is the most commonly diagnosed cancer in women. Of these, the Chinese had the most number of breast cancer cases, followed by the Indian and the Malay. The most common type of breast cancer is infiltrating ductal carcinoma (IDC). A proteomic approach was used to identify protein profile changes in cancerous tissues compared with the normal tissues, the tissues were collected from patients of three different ethnicities, i.e. Chinese, Malay and Indian. Ten differentially expressed hydrophobic proteins were identified. We had evaluated the potential of these proteins as biomarker for infiltrating ducal carcinoma (IDC) and the ethnic-specific expression of these proteins was also determined. The data showed that peroxiredoxin-2, heat shock protein 60, protein disulfide isomerase and calreticulin may serve as ethnic-related potential markers for either one or combination of Chinese, Malay and Indian cohorts as their expression levels were significantly high in the cancerous tissues compared to the normal tissues in the ethnic group tested.
Malaysia: where big is still better. For Malays, large families are part of the plan.
1993-11-03
The benefits of various-sized families in Malaysia were discussed by several women and supplemented with official statements on family planning (FP). The Director of the National Population and Family Development, Dr. Raj Karim, advised that maternal health is jeopardized when women have more than five children. About 30% of reproductive age women in Malaysia have five or more children. A Federation of FP Associations spokesperson agreed that women should be advised of the dangers of bearing over five children, of the importance of spacing births two to four years apart, and of the ideal age of childbearing (21-39 years). The government lacks an official policy on family size. The government position is, however, compatible with Islamic teachings on spacing in order to protect the health of the mother and child. Islamic law does not permit sterilization or abortion. The "fatwas" of Islamic teaching may have been misconstrued by those not using any form of contraception. Dr. Karim, who has five children, reported that having a large family can be difficult for a woman with a job, a career, and a husband or when both parents work. Most Malays desire large families. The average Malay family size was 4.1 children in 1990; Malaysian Chinese have fertility of 2.3 children and Malaysian Indians have 2.6 children. People say that the benefits outweigh the hardships of a large family.
Directory of Open Access Journals (Sweden)
Mazlina Baharudin
2016-06-01
Full Text Available The interesting teaching and learning of Malay languages is a challenging effort and need a relevant plan to the students’ needs especially for the foreign students who already have the basic Indonesian Malay language variation that they have learned for four semesters in their own country, Germany. Therefore, the variety of teaching and learning strategies should be considered by the teachers to make teaching and learning become interesting, effective and not boring. Basic effectiveness of a language program was the factors of socio-culture, the style of teaching and learning, the students, and the characteristics of the program. This paper however focused on the socio-cultural factors (learning of cultures and the activities program that enable to generate excitement and effectiveness in the teaching and learning of Malay language as a foreign language. In the teaching and learning process found that the more we gave the activities to the students, the more the students acquired the meaning of the lessons. In this study, the selected respondents were the two groups of students from TWG, Konstanz, Germany who have followed the Malay Language and Culture Program in the Languages, Literacies and Translation Center, University of Sains Malaysia, Penang, in 2011. The first group was started in March to June, and the second group in September to November. The research was based on formal and informal observations and interviews. This paper also discussed about the outdoor activities program used as curriculum in the teaching and learning process that gives an interesting environment to foreign students
Translation and validation of the Malay version of the Stroke Knowledge Test
Directory of Open Access Journals (Sweden)
Siti Noorkhairina Sowtali
2016-04-01
Conclusions: Malay version Stroke Knowledge Test was a valid and reliable tool to assess educational needs and to evaluate stroke knowledge among participants of group-based stroke education programs in Malaysia.
Heidari, Farzad; Vasudevan, Ramachandran; Mohd Ali, Siti Zubaidah; Ismail, Patimah; Etemad, Ali; Pishva, Seyyed Reza; Othman, Fauziah; Abu Bakar, Suhaili
2015-12-01
Several studies show that the insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene has been associated with hypertension in various populations. The present study sought to determine the association of the I/D gene polymorphism among Malay male essential hypertensive subjects in response to ACE inhibitors (enalapril and lisinopril). A total of 72 patients with newly diagnosed hypertension and 72 healthy subjects were recruited in this study. Blood pressure was recorded from 0 to 24 weeks of treatment with enalapril or lisinopril. Genotyping of the I/D polymorphism was carried out using a standard PCR method. Statistically significant association of the D allele of the ACE gene was observed between the case and control subjects (p ACE gene. Patients carrying the DD genotype had higher blood pressure-lowering response when treated with ACE inhibitors enalapril or lisinopril than those carrying ID and II genotypes, suggesting that the D allele may be a possible genetic marker for essential hypertension among Malay male subjects. © The Author(s) 2014.
Gomez, Rapson
2014-04-01
The study examined the measurement equivalence for teacher ratings across Malaysian Malay, Chinese and Indian children. Malaysian teachers completed ratings of the ODD symptoms for 574 Malay, 247 Chinese and 98 Indian children. The results supported the equivalences for the configural, metric, and error variances models, and the equivalences for ODD latent variances and mean scores. Together, these findings suggest good support for measurement and structural equivalences of the ODD symptoms across these ethnic groups. The theoretical and clinical implications of the findings for cross-cultural equivalence of the ODD symptoms are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.
Shahar, Suzana; Kamaruddin, Norshafarina Shari; Badrasawi, Manal; Sakian, Noor Ibrahim Mohamed; Abd Manaf, Zahara; Yassin, Zaitun; Joseph, Leonard
2013-01-01
Sarcopenia, characterized as muscle loss that occurs with aging, is a major health problem in an aging population, due to its implications on mobility, quality of life, and fall risk. Protein supplementation could improve the physical fitness by increasing protein anabolism, and exercise has a documented evidence of positive effect on functional status among the elderly. However, the combined effect of both protein supplementation and exercise has not been investigated among sarcopenic elderly in the Asian population. Thus, this study aimed to determine the effectiveness of exercise intervention and protein supplementation either alone or in combination for 12 weeks, on body composition, functional fitness, and oxidative stress among elderly Malays with sarcopenia. Sixty five sarcopenic elderly Malays aged 60-74 years were assigned to the control group, exercise group (ExG), protein supplementation group (PrG), or the combination of exercise and protein supplementation group. A significant interaction effect between body weight and body mass index (BMI) was observed, with the PrG (-2.1% body weight, -1.8% BMI) showing the highest reductions. Further, there was a decrease in % body fat (-4.5%) and an increase in fat-free mass (kg) (+5.7%) in the ExG after 12 weeks (P exercise program was found to improve muscle strength and body composition, while protein supplementation reduced body weight and increased upper body strength, among sarcopenic elderly in Malaysia.
Directory of Open Access Journals (Sweden)
Ahmad Murad Merican
2006-01-01
Full Text Available The representation and embodiment of Malay identity are certainly complex. How we know ourselves and how we have selected that knowledge determine the facts accumulated about us. What do the Malays make out of media? One assumption says that the Malays are averse to print and more attuned to orality and aurality. There is nevertheless also the category of baca, membaca and cerita which may not fit within the understanding of the European mind. Locating the categories of communication and media in the contexts of meaning, culture and thought may illustrate that the Malays do not share Euro-American presuppositions; at the same time, however, efforts to localise and indigenise the minda, concepts and practices only reattach them to the matrix of globalised modernity. Who represents what? Who represents media to Malay thought? What is being represented and at what levels?
Directory of Open Access Journals (Sweden)
Boluwaji Oshodi
2013-07-01
Full Text Available Acquiring a language begins with the knowledge of its sounds system which falls under the branch of linguistics known as phonetics. The knowledge of the sound system becomes very important to prospective learners particularly L2 learners whose L1 exhibits different sounds and features from the target L2 because this knowledge is vital in order to internalise the correct pronunciation of words. This study examined and contrasted the sound systems of Yorùbá a Niger-Congo language spoken in Nigeria to that of Malay (Peninsular variety, an Austronesian language spoken in Malaysia with emphasis on the areas of differences. The data for this study were collected from ten participants; five native female Malay speakers who are married to Yorùbá native speakers but live in Malaysia and five Yorùbá native speakers who reside in Nigeria. The findings revealed that speakers from both sides have difficulties with sounds and features in the L2 which are not attested in their L1 and they tended to substitute them for similar ones in their L1 through transfer. This confirms the fact that asymmetry between the sound systems of L1 and L2 is a major source of error in L2 acquisition.
Directory of Open Access Journals (Sweden)
Erdianto
2015-01-01
Full Text Available Implementation of the principle of legality in criminal law enforcement Indonesia in fact has caused some problems in the case and piling them over the prison capacity. It is necessary to find a model that is based on the completion of criminal cases and restorative local wisdom . One model that is “tepung tawar” in Malay society . Through empirical legal research found that the model completion of minor criminal matters in the Malay community is not united in procession “tepuk tepung tawar” but in other models, namely the density “ninik mamak” or different with “tepung tawar” practices applied in Jambi and South Sumatra , but the settlement of disputes and several criminal cases in the Malay community is also done with a model of restorative approaches .
Validation of a Malay Version of the Smartphone Addiction Scale among Medical Students in Malaysia.
Directory of Open Access Journals (Sweden)
Siew Mooi Ching
Full Text Available This study was initiated to determine the psychometric properties of the Smart Phone Addiction Scale (SAS by translating and validating this scale into the Malay language (SAS-M, which is the main language spoken in Malaysia. This study can distinguish smart phone and internet addiction among multi-ethnic Malaysian medical students. In addition, the reliability and validity of the SAS was also demonstrated.A total of 228 participants were selected between August 2014 and September 2014 to complete a set of questionnaires, including the SAS and the modified Kimberly Young Internet addiction test (IAT in the Malay language.There were 99 males and 129 females with ages ranging from 19 to 22 years old (21.7±1.1 included in this study. Descriptive and factor analyses, intra-class coefficients, t-tests and correlation analyses were conducted to verify the reliability and validity of the SAS. Bartlett's test of sphericity was significant (p <0.01, and the Kaiser-Mayer-Olkin measure of sampling adequacy for the SAS-M was 0.92, indicating meritoriously that the factor analysis was appropriate. The internal consistency and concurrent validity of the SAS-M were verified (Cronbach's alpha = 0.94. All of the subscales of the SAS-M, except for positive anticipation, were significantly related to the Malay version of the IAT.This study developed the first smart phone addiction scale among medical students. This scale was shown to be reliable and valid in the Malay language.
Devi, C R Beena; Tang, Tieng Swee; Corbex, Marilys
2012-12-15
We determined the incidences of the estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2) subtypes among breast cancer cases in Sarawak, Malaysia and their correlation with various risk factors in the three ethnic groups: Chinese, Malay and native. Subtype status was ascertained for 1,034 cases of female breast cancer (93% of all cases diagnosed since 2003), and the age-standardized incidence rates (ASRs) of each subtype were inferred. Case-case comparisons across subtypes were performed for reproductive risk factors. We found 48% luminal A (ER+/PR+/HER2-), 29% triple-negative (ER-/PR-/HER2-), 12% triple-positive (ER+/PR+/HER2+) and 11% HER2-overexpressing (ER-/PR-/HER2+) subtypes, with ASRs of 10.6, 6.0, 2.8 and 2.8 per 100,000, respectively. The proportions of subtypes and ASRs differed significantly by ethnic groups: HER2-positive cases were more frequent in Malays (29%; 95% CI [23;35]) than Chinese (22%; [19;26] and natives (21%; [16;26]); triple-negative cases were less frequent among Chinese (23%; [20;27]) than Malays (33%; [27;39]) and natives (37%; [31;43]). The results of the case-case comparison were in accordance with those observed in western case series. Some uncommon associations, such as between triple-negative subtype and older age at menopause (OR, 1.59; p < 0.05), were found. The triple-negative and HER2+ subtypes predominate in our region, with significant differences among ethnic groups. Our results support the idea that the risk factors for different subtypes vary markedly. Westernized populations are more likely to have factors that increase the risk for the luminal A type, while risk factors for the triple-negative type are more frequent in local populations. Copyright © 2012 UICC.
Directory of Open Access Journals (Sweden)
Foong Ming Moy
Full Text Available To establish the prevalence of voice disorder using the Malay-Voice Handicap Index 10 (Malay-VHI-10 and to study the determinants, quality of life, depression, anxiety and stress associated with voice disorder among secondary school teachers in Peninsular Malaysia.This study was divided into two phases. Phase I tested the reliability of the Malay-VHI-10 while Phase II was a cross-sectional study with two-stage sampling. In Phase II, a self-administered questionnaire was used to collect socio-demographic and teaching characteristics, depression, anxiety and stress scale (Malay version of DASS-21; and health-related quality of life (Malay version of SF12-v2. Complex sample analysis was conducted using multivariate Poisson regression with robust variance.In Phase I, the Spearman correlation coefficient and Cronbach alpha for total VHI-10 score was 0.72 (p 11. Compared to Malays, a greater proportion of ethnic Chinese teachers reported voice disorder while ethnic Indian teachers were less likely to report this problem. There was a higher prevalence ratio (PR of voice disorder among single or divorced/widowed teachers. Teachers with voice disorder were more likely to report higher rates of absenteeism (PR: 1.70, 95% CI 1.33, 2.19, lower quality of life with lower SF12-v2 physical (0.98, 95% CI 0.96, 0.99 and mental (0.97, 95% CI 0.96, 0.98 component summary scales; and higher anxiety levels (1.04, 95% CI 1.02, 1.06.The Malay-VHI-10 is valid and reliable. Voice disorder was associated with increased absenteeism, marginally associated with reduced health-related quality of life as well as increased anxiety among teachers.
Population mobility in Peninsular Malaysia.
Jones, G W; Sidh, M S
1979-12-01
1970 census materials were used to analyze migration patterns in Peninsular Malaysia. Inter-state migration patterns were analyzed by comparing birth place and current place of residence data, and inter-district and intra-district migration patterns were assessed using information on previous and current place of residence. The proportion of inter-state migrants in the total population increased from 4.7%-10.9% from 1947-1970. 53% of the inter-state migrants were Malays, 33% were Chinese, and 13% were Indian. The states of Selangor and Pahang had the highest net migration gains and Perak had the highest number of out-migrants. Selangor attracted migrants because it was a major industrial, administrative and educational center. Migrants were attracted to Pahang because of recent efforts by the government to promote agricultural development in the state. Areas which showed a net migration loss were experiencing slow economic growth. 48.4% of the inter-state migrants migrated to either rural or suburban areas, 26% moved to cities with populations of 75,000 or more, and 26% moved to towns with populations of 1000-10,000. 48.6% of the inter-state migrants were females. When all types of internal migration were taken into account it was estimated that approximately 30% of the population had moved at some point in their life time. During the early 1900s, Peninsular Malaysia received many immigrants from China, India, and other countries, and the Chinese became the dominant group in many urban areas and in many economic sectors. In 1950 the government, fearing that the Malays would become a minority group in their own country, halted international immigration. The recent increase in internal migration has contributed toward equalizing the influence and power of the Chinese and the Malays in urban areas and in various economic sectors.
Hijová, Emília; Gecková, Andrea Madarasová; Babinská, Ingrid
2014-03-01
Living in Roma settlements is associated with worse health in comparison with the majority population; this might be partially explained by socioeconomic disadvantages as well as cultural differences, including lifestyle. Eating habits represent an important part of lifestyle closely related to primary causes of morbidity and mortality, such as cardiovascular diseases, metabolic diseases or cancers. The eating habits of the population living in Roma settlements in comparison with those of the majority population were explored using the cross-sectional epidemiological HepaMeta study conducted in 2011. A representative sample of Roma (n = 452, mean age = 34.7; 35.2% men) and non-Roma (n = 403, mean age = 33.5; 45.9% men) aged 18-55 years living in the Kosice region were asked about breakfasting and recent consumption of fruits, vegetables, dairy products, meat products, meat, farinaceous dishes, and soft drinks. A logistic regression model was used separately for male and female participants. The population living in Roma settlements reported the recent consumption of fruit, vegetables and dairy products significantly less frequently in comparison with the majority population. Moreover, Roma females, in comparison with non-Roma females, reported significantly more frequently the consumption of meat and soft drinks. No differences were found between Roma and non-Roma in the consumption of meat products and farinaceous dishes. The population living in Roma settlements reported more frequently unhealthy eating habits in comparison with the majority population; this might contribute to worse health status of this population. The differences might be attributed to cultural differences between ethnic as well as socioeconomic groups, reduced availability of certain food items due to segregation or poverty and lower health literacy.
Rohmanu, Abid
2016-01-01
This study is to see the level of acculturation of Javanese and Malay Islams in Javanese community wedding at Selangor Malaysia. According to the theory of culture, each culture has a uniqueness, as a individual uniqueness. The unique culture of Javanese ethnic wedding in Selangor is believed to be a process of negotiation between Malay and Javanese culture.. Acculturation theory is used in this research to explain and understand the reality of that culture. The study concluded that ethnic we...
Directory of Open Access Journals (Sweden)
Abid Rohmanu
2016-06-01
Full Text Available This study is to see the level of acculturation of Javanese and Malay Islams in Javanese community wedding at Selangor Malaysia. According to the theory of culture, each culture has a uniqueness, as a individual uniqueness. The unique culture of Javanese ethnic wedding in Selangor is believed to be a process of negotiation between Malay and Javanese culture.. Acculturation theory is used in this research to explain and understand the reality of that culture. The study concluded that ethnic wedding traditions of Javanese Islam in Selangor pointed to the high level of acculturation. The acculturation leads to a “substitution” and “syncretism”. The substitution refers to the meaning that the Javanese tradition for the most replaced with new cultures (Malay. Acculturation can also be said as a cultural syncretism, the mixing of these two cultures into a new culture that are distinctive.Copyright (c 2016 by KARSA. All right reserved DOI: 10.19105/karsa.v24i1.1008
Validation of a Malay Version of the Smartphone Addiction Scale among Medical Students in Malaysia.
Ching, Siew Mooi; Yee, Anne; Ramachandran, Vasudevan; Sazlly Lim, Sazlyna Mohd; Wan Sulaiman, Wan Aliaa; Foo, Yoke Loong; Hoo, Fan Kee
2015-01-01
This study was initiated to determine the psychometric properties of the Smart Phone Addiction Scale (SAS) by translating and validating this scale into the Malay language (SAS-M), which is the main language spoken in Malaysia. This study can distinguish smart phone and internet addiction among multi-ethnic Malaysian medical students. In addition, the reliability and validity of the SAS was also demonstrated. A total of 228 participants were selected between August 2014 and September 2014 to complete a set of questionnaires, including the SAS and the modified Kimberly Young Internet addiction test (IAT) in the Malay language. There were 99 males and 129 females with ages ranging from 19 to 22 years old (21.7±1.1) included in this study. Descriptive and factor analyses, intra-class coefficients, t-tests and correlation analyses were conducted to verify the reliability and validity of the SAS. Bartlett's test of sphericity was significant (p addiction scale among medical students. This scale was shown to be reliable and valid in the Malay language.
Oscandar, Fahmi; Malinda, Yuti; Azhari, H.; Murniati, Nani; Yeh Ong, Sing; Subiyanto; Supian, Sudradjat
2018-01-01
In this paper, Cervical Vertebral Maturation method was used to assess the mandibular growth in Deutero-Malay sub race. Twenty eight laterals Cephalometric radiographs of Deutero-Malay sub race aged 9-15 were observed. The observation used stratified random sampling by measuring the quantitative and qualitative assessment of the 2nd through 4th cervical vertebra of the subjects. It produced the diagram of developmental stages of cervical vertebrae for Deutero-Malay sub race. The diagram can be used to determine mandibular growth in term of qualitative by matching the shape of cervical vertebrae. It was obtained that the Cervical Vertebral Maturation method can be used to assess mandibular growth in Deutero-Malay sub race by matching the shape of cervical vertebrae to the diagram of developmental stages of cervical vertebrae. In addition, Cervical Vertebral Maturation method can be used to identification person’s age.
Unravelling the genetic history of Negritos and indigenous populations of Southeast Asia.
Aghakhanian, Farhang; Yunus, Yushima; Naidu, Rakesh; Jinam, Timothy; Manica, Andrea; Hoh, Boon Peng; Phipps, Maude E
2015-04-14
Indigenous populations of Malaysia known as Orang Asli (OA) show huge morphological, anthropological, and linguistic diversity. However, the genetic history of these populations remained obscure. We performed a high-density array genotyping using over 2 million single nucleotide polymorphisms in three major groups of Negrito, Senoi, and Proto-Malay. Structural analyses indicated that although all OA groups are genetically closest to East Asian (EA) populations, they are substantially distinct. We identified a genetic affinity between Andamanese and Malaysian Negritos which may suggest an ancient link between these two groups. We also showed that Senoi and Proto-Malay may be admixtures between Negrito and EA populations. Formal admixture tests provided evidence of gene flow between Austro-Asiatic-speaking OAs and populations from Southeast Asia (SEA) and South China which suggest a widespread presence of these people in SEA before Austronesian expansion. Elevated linkage disequilibrium (LD) and enriched homozygosity found in OAs reflect isolation and bottlenecks experienced. Estimates based on Ne and LD indicated that these populations diverged from East Asians during the late Pleistocene (14.5 to 8 KYA). The continuum in divergence time from Negritos to Senoi and Proto-Malay in combination with ancestral markers provides evidences of multiple waves of migration into SEA starting with the first Out-of-Africa dispersals followed by Early Train and subsequent Austronesian expansions. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Diabetes quality of life perception in a multiethnic population.
Goh, S G K; Rusli, B N; Khalid, B A K
2015-07-01
The aim of this study was to determine ethnic differences and predictors of the perception of quality of life (QOL) in a multiethnic Malaysian population with type 2 diabetes. A population-based cross-sectional study was done in three different states in Malaysia. The Asian Diabetes Quality of Life (AsianDQOL) tool specific for type 2 diabetes is the primary outcome tool. One-way analysis of covariance was undertaken to examine ethnic differences on the total and component AsianDQOL scores controlling for important covariates. Stepwise multiple linear regression models were used for selecting predictors for the AsianDQOL score with stratification for ethnicity and language. A total of 647 subjects (338 Malays, 160 Chinese and 149 Indians) were recruited. Chinese scored significantly lower (78.1 ± 11.6) on the AsianDQOL (total) score compared to Malays (81.4 ± 9.0) and Indians (81.5 ± 9.2) (F = 3.060, p = 0.049, η (2) = 0.02). Likewise, Chinese scored significantly lower (21.0 ± 4.3) on the AsianDQOL (diet) score compared to Malays (22.8 ± 3.6) and Indians (22.5 ± 3.7) (F = 4.96, p = 0.008, η (2) = 0.04). The main predictors of AsianDQOL (total) score for the English language group of different ethnicities were sexual dysfunction (-4.5), having visual problems (-3.7), female (-2.8) and glycemic control (-1.6). Sexual dysfunction was negatively correlated with QOL in Malay, Chinese ethnic group and Indian ethnic groups. The perception of AsianDQOL is different across ethnic groups and languages spoken. Significant differences in the English-speaking group and the non-English-speaking group are detected within the same ethnicity. Sexual dysfunction severely impacts AsianDQOL in a multiethnic Asian population and remains an important determinant regardless of ethnicity and language.
Directory of Open Access Journals (Sweden)
Shafie Asrul A
2010-05-01
Full Text Available Abstract Background The purpose of the linguistic validation of the Wisconsin Smoking Withdrawal Scale (WSWS was to produce a translated version in Malay language which was "conceptually equivalent" to the original U.S. English version for use in clinical practice and research. Methods A seven-member translation committee conducted the translation process using the following methodology: production of two independent forward translations; comparison and reconciliation of the translations; backward translation of the first reconciled version; comparison of the original WSWS and the backward version leading to the production of the second reconciled version; pilot testing and review of the translation, and finalization. Results Linguistic and conceptual issues arose during the process of translating the instrument, particularly pertaining to the title, instructions, and some of the items of the scale. In addition, the researchers had to find culturally acceptable equivalents for some terms and idiomatic phrases. Notable among these include expressions such as "irritability", "feeling upbeat", and "nibbling on snacks", which had to be replaced by culturally acceptable expressions. During cognitive debriefing and clinician's review processes, the Malay translated version of WSWS was found to be easily comprehensible, clear, and appropriate for the smoking withdrawal symptoms intended to be measured. Conclusions We applied a rigorous translation method to ensure conceptual equivalence and acceptability of WSWS in Malay prior to its utilization in research and clinical practice. However, to complete the cultural adaptation process, future psychometric validation is planned to be conducted among Malay speakers.
Directory of Open Access Journals (Sweden)
Maskanah Mohammad Lotfie
2017-09-01
Full Text Available Malay is a language from the Austronesian family and unlike the Indo-European-originated English, it does not generally have inflectional temporal markers. Investigating this from a cross-linguistics - influence perspective, differences between the languages could mean difficulties for Malay speakers to acquire features of English. The objectives of this study are to investigate Malay speakers’ pronunciation of the English language –ed allomorphs – [d], [t] and [ɪd]/[əd] – and the relationship between the morphophonological forms and two types of linguistic knowledge, one of which is implicit while the other is explicit. Data were collated from fifty participants who are social science undergraduates and English majors who speak English as a second language. Four instruments were used to gauge the respondents’ verbal use of –ed allomorphs as well as their implicit and explicit knowledge of the allomorphs. Results indicate that the students’ verbal usage of the target items either lacks approximation to Standard English pronunciation or is largely dropped altogether. Results also suggest a moderate relationship between implicit and explicit knowledge of the allomorphs and their verbal production by Malay speakers of English. The finding illuminates acquisition problem of English language speakers whose mother tongue does not share similar inflectional markers. Pedagogical solutions can help learners of the English language to approximate Standard English and in the long run, enhance effective communication and increase chances of employability.
Stability in Chinese and Malay heritage languages as a source of divergence
Aalberse, S.; Moro, F.; Braunmüller, K.; Höder, S.; Kühl, K.
2014-01-01
This article discusses Malay and Chinese heritage languages as spoken in the Netherlands. Heritage speakers are dominant in another language and use their heritage language less. Moreover, they have qualitatively and quantitatively different input from monolinguals. Heritage languages are often
Stability in Chinese and Malay heritage languages as a source of divergence
Aalberse, S.; Moro, F.R.; Braunmüller, K.; Höder, S.; Kühl, K.
2015-01-01
This article discusses Malay and Chinese heritage languages as spoken in the Netherlands. Heritage speakers are dominant in another language and use their heritage language less. Moreover, they have qualitatively and quantitatively different input from monolinguals. Heritage languages are often
Al-Dubai, Sar; Ganasegeran, K; Barua, A; Rizal, Am; Rampal, Kg
2014-07-01
The 10-item version of Perceived Stress Scale (PSS-10) is a widely used tool to measure stress. The Malay version of the PSS-10 has been validated among Malaysian Medical Students. However, studies have not been conducted to assess its validity in occupational settings. The aim of this study is to assess the psychometric properties of the Malay version of the PSS-10 in two occupational setting in Malaysia. This study was conducted among 191 medical residents and 513 railway workers. An exploratory factor analysis was performed using the principal component method with varimax rotation. Correlation analyses, Kaiser-Meyer-Olkin, Bartlett's test of Sphericity and Cronbach's alpha were obtained. Statistical analysis was carried out using statistical package for the social sciences version 16 (SPSS, Chicago, IL, USA) software. Analysis yielded two factor structure of the Malay version of PSS-10 in both occupational groups. The two factors accounted for 59.2% and 64.8% of the variance in the medical residents and the railway workers respectively. Factor loadings were greater than 0.59 in both occupational groups. Cronbach's alpha co-efficient was 0.70 for medical residents and 0.71 for railway workers. The Malay version of PSS-10 had adequate psychometric properties and can be used to measure stress among occupational settings in Malaysia.
Genomic copy number variations in three Southeast Asian populations.
Ku, Chee-Seng; Pawitan, Yudi; Sim, Xueling; Ong, Rick T H; Seielstad, Mark; Lee, Edmund J D; Teo, Yik-Ying; Chia, Kee-Seng; Salim, Agus
2010-07-01
Research on the role of copy number variations (CNVs) in the genetic risk of diseases in Asian populations has been hampered by a relative lack of reference CNV maps for Asian populations outside the East Asians. In this article, we report the population characteristics of CNVs in Chinese, Malay, and Asian Indian populations in Singapore. Using the Illumina Human 1M Beadchip array, we identify 1,174 CNV loci in these populations that corroborated with findings when the same samples were typed on the Affymetrix 6.0 platform. We identify 441 novel loci not previously reported in the Database of Genomic Variations (DGV). We observe a considerable number of loci that span all three populations and were previously unreported, as well as population-specific loci that are quite common in the respective populations. From this we observe the distribution of CNVs in the Asian Indian population to be considerably different from the Chinese and Malay populations. About half of the deletion loci and three-quarters of duplication loci overlap UCSC genes. Tens of loci show population differentiation and overlap with genes previously known to be associated with genetic risk of diseases. One of these loci is the CYP2A6 deletion, previously linked to reduced susceptibility to lung cancer. (c) 2010 Wiley-Liss, Inc.
Choo, S C; Loh, S P; Khor, G L; Sabariah, M N; Rozita, R
2011-08-01
Methylenetetrahydrofolate reductase (MTHFR) C677T is involved in folate and homocysteine metabolism. Disruption in the activity of this enzyme will alter their levels in the body. This study assessed MTHFR C677T polymorphism and its relationship with serum homocysteine and B-vitamins levels in a sample of Chinese and Malays subjects in UPM, Serdang. One hundred subjects were randomly selected from among the university population. Folate, vitamin B12, B6, and homocysteine levels were determined using MBA, ECLIA, and HPLC, respectively. PCR coupled with HinfI digestion was used for detection of MTHFR C677T polymorphism. The frequency of T allele was higher in the Chinese subjects (0.40) compared to the Malay (0.14). Folate, vitamin B12 and B6 levels were highest in the wild genotype in both ethnic groups. Subjects with heterozygous and homozygous genotype showed the highest homocysteine levels. The serum folate and homocysteine were mainly affected by homozygous genotype. MTHFR C677T polymorphism plays an important role in influencing the folate and homocysteine metabolism.
Prevalence, Correlates, and Impact of Uncorrected Presbyopia in a Multiethnic Asian Population.
Kidd Man, Ryan Eyn; Fenwick, Eva Katie; Sabanayagam, Charumathi; Li, Ling-Jun; Gupta, Preeti; Tham, Yih-Chung; Wong, Tien Yin; Cheng, Ching-Yu; Lamoureux, Ecosse Luc
2016-08-01
To examine the prevalence, correlates, and impact of uncorrected presbyopia on vision-specific functioning (VF) in a multiethnic Asian population. Population-based cross-sectional study. We included 7890 presbyopic subjects (3909 female; age range, 40-86 years) of Malay, Indian, and Chinese ethnicities from the Singapore Epidemiology of Eye Disease study. Presbyopia was classified as corrected and uncorrected based on self-reported near correction use. VF was assessed with the VF-11 questionnaire validated using Rasch analysis. Multivariable logistic and linear regression models were used to investigate the associations of sociodemographic and clinical parameters with uncorrected presbyopia, and its impact on VF, respectively. As myopia may mitigate the impact of noncorrection, we performed a subgroup analysis on myopic subjects only (n = 2742). In total, 2678 of 7890 subjects (33.9%) had uncorrected presbyopia. In multivariable models, younger age, male sex, Malay and Indian ethnicities, presenting distance visual impairment (any eye), and lower education and income levels were associated with higher odds of uncorrected presbyopia (all P Malay and Indian ethnicities are needed. Copyright © 2016 Elsevier Inc. All rights reserved.
The first Malay language storytelling text-to-speech (TTS) corpus for ...
African Journals Online (AJOL)
speech annotations are described in detail in accordance to baseline work. The stories were recorded in two speaking styles that are neutral and storytelling speaking style. The first. Malay language storytelling corpus is not only necessary for the development of a storytelling text-to-speech (TTS) synthesis. It is also ...
Nigerian Immigrant Population in Spain Is Little Sensitized to Living-Related Kidney Donation.
Ríos, A; Carrillo, J; López-Navas, A I; Ayala, M A; Garrido, G; Sebastián, M J; Martínez-Alarcón, L; Ramis, G; Hernández, A M; Ramírez, P; Parrilla, P
2018-03-01
The Nigerian population is an emerging group in Spain and in Europe, but their sensitization toward living kidney donation has not been studied. The aim of this work was to analyze the attitude toward related renal donation while alive among the population born in Nigeria resident in Spain. A population older than 15 years born in Nigeria and resident in Spain, stratified by age and sex, was studied with the use of the attitude questionnaire about living kidney donation, "PCID-DVR-Ríos." People were randomly selected based on stratification. African immigration support associations advised on the location of potential respondents. Completion of the questionnaire was anonymous and self-administered. Verbal consent was requested to assist in the study. Statistical methods included Student t test, χ 2 , Fisher exact test, and logistic regression analysis. A total of 179 respondents were included in the study: 70% (n = 125) were in favor of living-related kidney donation, and 30% (n = 54) remained against or undecided. This attitude was associated with different psychosocial factors: marital status (P = .001), having offspring (P = .029), risk assessment of live donation (P donation (P donation and/or transplantation (P donation (P donation and/or transplantation (odds ratio, 8.064) persisted as the main related factor. The Nigerian immigrant population in Spain has a less favorable attitude toward living kidney donation than the native western European and Spanish population. Copyright © 2017 Elsevier Inc. All rights reserved.
How close do we live to water? A global analysis of population distance to freshwater bodies.
Directory of Open Access Journals (Sweden)
Matti Kummu
Full Text Available Traditionally, people have inhabited places with ready access to fresh water. Today, over 50% of the global population lives in urban areas, and water can be directed via tens of kilometres of pipelines. Still, however, a large part of the world's population is directly dependent on access to natural freshwater sources. So how are inhabited places related to the location of freshwater bodies today? We present a high-resolution global analysis of how close present-day populations live to surface freshwater. We aim to increase the understanding of the relationship between inhabited places, distance to surface freshwater bodies, and climatic characteristics in different climate zones and administrative regions. Our results show that over 50% of the world's population lives closer than 3 km to a surface freshwater body, and only 10% of the population lives further than 10 km away. There are, however, remarkable differences between administrative regions and climatic zones. Populations in Australia, Asia, and Europe live closest to water. Although populations in arid zones live furthest away from freshwater bodies in absolute terms, relatively speaking they live closest to water considering the limited number of freshwater bodies in those areas. Population distributions in arid zones show statistically significant relationships with a combination of climatic factors and distance to water, whilst in other zones there is no statistically significant relationship with distance to water. Global studies on development and climate adaptation can benefit from an improved understanding of these relationships between human populations and the distance to fresh water.
Gomez, Rapson; Vance, Alasdair
2008-08-01
This study examined differential symptom functioning (DSF) in ADHD symptoms across Malay and Chinese children in Malaysia. Malay (N=571) and Chinese (N=254) parents completed the Disruptive Behavior Rating Scale, which lists the DSM-IV ADHD symptoms. DSF was examined using the multiple indicators multiple causes (MIMIC) structural equation modeling procedure. Although DSF was found for a single inattention (IA) symptom and three hyperactivity-impulsivity (HI) symptoms, all these differences had low effect sizes. Controlling for these DSF, Chinese children had higher IA and HI latent factor scores. However the effect sizes were small. Together, these findings suggest adequate support for invariance of the ADHD symptoms across these ethno-cultural groups. The implications of the findings for cross-cultural invariance of the ADHD symptoms are discussed.
From the streets to assisted living: perceptions of a vulnerable population.
Decker, Susan; Cary, Patricia; Krautscheid, Lorretta
2006-06-01
The rapid growth of assisted-living facilities is paralleled by the necessity to understand the needs of the people living in them. A hallmark challenge for individuals who are poor and disabled, and often marginalized from mainstream society, is maintaining integrity and being a whole person, rather than a sum of broken parts. A key to maintaining this integrity is the ability to find stable housing and support systems. The inner-city assisted-living facility in this study is unique in that all of its residents are funded by Medicaid. The residents have complex needs related to histories of homelessness, mental illness, drug and/or alcohol addiction, and chronic illness. The purpose of this study was to explore the needs of this vulnerable population as they adapt to a new home and a new concept of assisted, yet independent, living. Structured interviews with key informants and oral survey questionnaires with residents provided quantitative and qualitative data about physical and mental health status, social support, perception of control, psychological wellbeing, and life satisfaction. This study provided valuable insights into the challenges inherent in providing a high quality of life in assisted living for a vulnerable population with diverse needs.
Strategies to reduce exclusion among populations living in urban slum settlements in Bangladesh.
Rashid, Sabina Faiz
2009-08-01
The health and rights of populations living in informal or slum settlements are key development issues of the twenty-first century. As of 2007, the majority of the world's population lives in urban areas. More than one billion of these people, or one in three city-dwellers, live in inadequate housing with no or a few basic resources. In Bangladesh, urban slum settlements tend to be located in low-lying, flood-prone, poorly-drained areas, having limited formal garbage disposal and minimal access to safe water and sanitation. These areas are severely crowded, with 4-5 people living in houses of just over 100 sq feet. These conditions of high density of population and poor sanitation exacerbate the spread of diseases. People living in these areas experience social, economic and political exclusion, which bars them from society's basic resources. This paper overviews policies and actions that impact the level of exclusion of people living in urban slum settlements in Bangladesh, with a focus on improving the health and rights of the urban poor. Despite some strategies adopted to ensure better access to water and health, overall, the country does not have a comprehensive policy for urban slum residents, and the situation remains bleak.
Strategies to Reduce Exclusion among Populations Living in Urban Slum Settlements in Bangladesh
2009-01-01
The health and rights of populations living in informal or slum settlements are key development issues of the twenty-first century. As of 2007, the majority of the world's population lives in urban areas. More than one billion of these people, or one in three city-dwellers, live in inadequate housing with no or a few basic resources. In Bangladesh, urban slum settlements tend to be located in low-lying, flood-prone, poorly-drained areas, having limited formal garbage disposal and minimal access to safe water and sanitation. These areas are severely crowded, with 4–5 people living in houses of just over 100 sq feet. These conditions of high density of population and poor sanitation exacerbate the spread of diseases. People living in these areas experience social, economic and political exclusion, which bars them from society's basic resources. This paper overviews policies and actions that impact the level of exclusion of people living in urban slum settlements in Bangladesh, with a focus on improving the health and rights of the urban poor. Despite some strategies adopted to ensure better access to water and health, overall, the country does not have a comprehensive policy for urban slum residents, and the situation remains bleak. PMID:19761090
Rosman, Fuziah; Alias, Norlidah; Rahman, Mohd Nazri Abdul; Dewitt, Dorothy
2015-01-01
This study aims at reviewing the curriculum design by including video games in the implementation of the Malay language course at an Institute of Higher Learning. The objective of this study is to obtain expert opinion on the expected manner of implementation of video games in learning the Malay language. The Fuzzy Delphi technique (FDM) is used…
Ancestry prediction in Singapore population samples using the Illumina ForenSeq kit.
Ramani, Anantharaman; Wong, Yongxun; Tan, Si Zhen; Shue, Bing Hong; Syn, Christopher
2017-11-01
The ability to predict bio-geographic ancestry can be valuable to generate investigative leads towards solving crimes. Ancestry informative marker (AIM) sets include large numbers of SNPs to predict an ancestral population. Massively parallel sequencing has enabled forensic laboratories to genotype a large number of such markers in a single assay. Illumina's ForenSeq DNA Signature Kit includes the ancestry informative SNPs reported by Kidd et al. In this study, the ancestry prediction capabilities of the ForenSeq kit through sequencing on the MiSeq FGx were evaluated in 1030 unrelated Singapore population samples of Chinese, Malay and Indian origin. A total of 59 ancestry SNPs and phenotypic SNPs with AIM properties were selected. The bio-geographic ancestry of the 1030 samples, as predicted by Illumina's ForenSeq Universal Analysis Software (UAS), was determined. 712 of the genotyped samples were used as a training sample set for the generation of an ancestry prediction model using STRUCTURE and Snipper. The performance of the prediction model was tested by both methods with the remaining 318 samples. Ancestry prediction in UAS was able to correctly classify the Singapore Chinese as part of the East Asian cluster, while Indians clustered with Ad-mixed Americans and Malays clustered in-between these two reference populations. Principal component analyses showed that the 59 SNPs were only able to account for 26% of the variation between the Singapore sub-populations. Their discriminatory potential was also found to be lower (G ST =0.085) than that reported in ALFRED (F ST =0.357). The Snipper algorithm was able to correctly predict bio-geographic ancestry in 91% of Chinese and Indian, and 88% of Malay individuals, while the success rates for the STRUCTURE algorithm were 94% in Chinese, 80% in Malay, and 91% in Indian individuals. Both these algorithms were able to provide admixture proportions when present. Ancestry prediction accuracy (in terms of likelihood ratio
Merli, Claudia
2011-12-01
This paper examines fatherhood among the Malay Muslims of Southern Thailand (representing a minority at the national level, but constituting the majority population in the region). Traditional practices related to birth and the postpartum period are upheld as a marker of ethnic and religious identity by such groups. Building on the concept of patrescence as 'becoming a father', proposed by Dana Raphael, the data presented show how the process of assuming fatherhood develops during pregnancy and continues after birth through a series of ritual practices in which a man contributes to female postpartum practices. The medicalisation of birth in synergy with recent literalist interpretations of Islam has impacted on these practices, making it difficult to comply with the ritual burial of the afterbirth, which constitutes the cosmological and physical anchoring of individual and ethnic identity to the soil.
Makbul, Ika Aida Aprilini; Daud, Norlida Mat; Aziz, Nurul Azrianti Abdul; Yahya, Noor Fairuzi Suhana
2016-11-01
Sufficient intake of calcium during childhood is very important to ensure an optimal growth and strong bones development. However, lactose intolerance (LI) may limit the intake of milk and dairy products due to the inability of the body to digest lactose to its constituents, glucose and galactose. Children in rural area were a major concern as they are commonly associated with an inadequate intake of nutrients. Hence, the objectives of this study are to determine the prevalence of LI among Malay and Orang Asli female children in rural Selangor and its association with bone mineral density (BMD). A total of 65 (39 Malay, 26 Orang Asli) female primary school students with a mean age of 10.4 ± 0.6 years old underwent hydrogen breath test and lactose tolerance test (LTT) during fasting and after ingestion of 25g lactose solution. A Wong Baker Face Pain Rating Scale (WBFPRS) was used to assess the presence of gastrointestinal (GI) symptoms during the study. LI symptoms are defined when breath H2 levels exceed 20 ppm above baseline values, an increase of postprandial blood glucose (PBG) levels of less than 1.1 mmol/L and GI symptom score is more or equal than score 2. BMD was measured in the calcaneus using QUS-2 Ultrasonometer. The result showed that 35 subjects (15 Malay, 20 Orang Asli) had a positive breath test (>20ppm). A total of 74.4% Malay and 88.5% Orang Asli children had an increase of PBG of less than 1.1 mmol/L. Both groups have low percentage (35.9 % Malay, 34.6 % Orang Asli) of GI symptoms. A total of 20.0% children (n=13, Malay=4, Orang Asli=9) was found to experience LI. Orang Asli children showed a significantly higher (p<0.001) BMD (95.7 ± 11.0 dB/MHz) compared to Malay children (71.7 ± 8.6 dB/MHz). The result shown there is an association between LI with BMD (p=0.031). Hence, LI does affect in decreasing an individual BMD. In conclusion, the prevalence of LI among female children in rural Selangor is low. However, the relationship between LI and BMD
Ee, Su Im; Loh, Siew Yim; Chinna, Karuthan; Marret, Mary J
2016-01-01
To translate, culturally adapt, and examine psychometric properties of the Malay version Short Sensory Profile (SSP-M). Pretesting (n = 30) of the original English SSP established its applicability for use with Malaysian children aged 3-10 years. This was followed by the translation and cross-cultural adaptation of the SSP-M. Two forward and two back translations were compared and reviewed by a committee of 10 experts who validated the content of the SSP-M, before pilot testing (n = 30). The final SSP-M questionnaire was completed by 419 parents of typically developing children aged 3-10 years. Cronbach's alpha of each section of the SSP-M ranged from 0.73 to 0.93 and the intraclass correlation coefficient (ICC) indicated good reliability (0.62-0.93). The seven factor model of the SSP-M had an adequate fit with evidence of convergent and discriminant validity. We conclude that the SSP-M is a valid and reliable screening tool for use in Malaysia with Malay-speaking parents of children aged 3-10 years. The SSP-M enables Malay-speaking parents to answer the questionnaire with better reliability, and provides occupational therapists with a valid tool to screen for sensory processing difficulties.
Gecková, Andrea Madarasová; Babinská, Ingrid; Bobáková, Daniela; Veselská, Zuzana Dankulincová; Bosáková, Lucia; Kolarcik, Peter; Jarcuska, Peter; Pella, Daniel; Halánová, Monika
2014-03-01
The aim of this study was to compare socioeconomic characteristics of the Roma population living in Roma settlements with the majority population. Moreover, it was aimed to assess socioeconomic differences in health and health-related behaviour within the population living in Roma settlements. Data from the cross-sectional HepaMeta study conducted in Slovakia in 2011 were used. The sample consisted of 452 Roma (mean age = 34.7; 35.2% men) and 403 non-Roma (mean age = 33.5; 45.9% men) respondents. Roma in selected settlements were recruited by local Roma community workers. Respondents from the major population were randomly selected from a list of patients from general practitioners. Data were collected via questionnaire, anthropometric measures and analysed blood samples. Differences in socioeconomic characteristics between the population living in Roma settlements and the majority population were tested using the chi-square test. The contribution of selected socioeconomic characteristics on health and health-related behaviour of the population living in Roma settlements was assessed by logistic regression models adjusted for age and gender. The population living in Roma settlements is characterised by significantly lower socioeconomic standards, and the living conditions are significantly worse compared with the majority. With few exceptions, the study did not confirm any significant association between socioeconomic indicators and health and health-related behaviour within the population living in Roma settlements. The deteriorating effect of living in Roma settlement on health and health-related behaviour seems to be immense regardless differences in socioeconomic characteristics or living condition within the settlement population.
Sandhu, Sukhvinder Singh; Ismail, Noor Hassim; Rampal, Krishna Gopal
2015-11-01
The Perceived Stress Scale-10 (PSS-10) is widely used to assess stress perception. The aim of this study was to translate the original PSS-10 into Malay and assess the reliability and validity of the Malay version among nurses. The Malay version of the PSS-10 was distributed among 229 nurses from four government hospitals in Selangor State. Test-retest reliability and concurrent validity was conducted with 25 nurses with the Malay version of the Depression Anxiety Stress Scales (DASS) 21. Cronbach's alpha, confirmatory factor analysis (CFA), intraclass correlation coefficient and Pearson's r correlation coefficient were used to determine the psychometric properties of the Malay PSS-10. Two factor components were yielded through exploratory factor analysis with eigenvalues of 3.37 and 2.10, respectively. Both of the factors accounted for 54.6% of the variance. CFA yielded a two-factor structure with satisfactory goodness-of-fit indices [x 2 /df = 2.43; comparative fit index (CFI) = 0.92, goodness-of-fit Index (GFI) = 0.94; standardised root mean square residual (SRMR) = 0.07 and root mean square error of approximation (RMSEA) = 0.08 (90% CI = 0.07-0.09)]. The Cronbach's alpha coefficient for the total items was 0.63 (0.82 for factor 1 and 0.72 for factor 2). The intraclass correlation coefficient (ICC) was 0.81 (95% CI: 0.62-0.91) for test-retest reliability testing after seven days. The total score and the negative component of the PSS-10 correlated significantly with the stress component of the DASS-21: (r = 0.61, P < 0.001) and (r = 0.56, P < 0.004), respectively. The Malay version of the PSS-10 demonstrated a satisfactory level of validity and reliability to assess stress perception. Therefore, this questionnaire is valid in assessing stress perception among nurses in Malaysia.
The first Malay database toward the ethnic-specific target molecular variation.
Halim-Fikri, Hashim; Etemad, Ali; Abdul Latif, Ahmad Zubaidi; Merican, Amir Feisal; Baig, Atif Amin; Annuar, Azlina Ahmad; Ismail, Endom; Salahshourifar, Iman; Liza-Sharmini, Ahmad Tajudin; Ramli, Marini; Shah, Mohamed Irwan; Johan, Muhammad Farid; Hassan, Nik Norliza Nik; Abdul-Aziz, Noraishah Mydin; Mohd Noor, Noor Haslina; Nur-Shafawati, Ab Rajab; Hassan, Rosline; Bahar, Rosnah; Zain, Rosnah Binti; Yusoff, Shafini Mohamed; Yusoff, Surini; Tan, Soon Guan; Thong, Meow-Keong; Wan-Isa, Hatin; Abdullah, Wan Zaidah; Mohamed, Zahurin; Abdul Latiff, Zarina; Zilfalil, Bin Alwi
2015-04-30
The Malaysian Node of the Human Variome Project (MyHVP) is one of the eighteen official Human Variome Project (HVP) country-specific nodes. Since its inception in 9(th) October 2010, MyHVP has attracted the significant number of Malaysian clinicians and researchers to participate and contribute their data to this project. MyHVP also act as the center of coordination for genotypic and phenotypic variation studies of the Malaysian population. A specialized database was developed to store and manage the data based on genetic variations which also associated with health and disease of Malaysian ethnic groups. This ethnic-specific database is called the Malaysian Node of the Human Variome Project database (MyHVPDb). Currently, MyHVPDb provides only information about the genetic variations and mutations found in the Malays. In the near future, it will expand for the other Malaysian ethnics as well. The data sets are specified based on diseases or genetic mutation types which have three main subcategories: Single Nucleotide Polymorphism (SNP), Copy Number Variation (CNV) followed by the mutations which code for the common diseases among Malaysians. MyHVPDb has been open to the local researchers, academicians and students through the registration at the portal of MyHVP ( http://hvpmalaysia.kk.usm.my/mhgvc/index.php?id=register ). This database would be useful for clinicians and researchers who are interested in doing a study on genomics population and genetic diseases in order to obtain up-to-date and accurate information regarding the population-specific variations and also useful for those in countries with similar ethnic background.
Khairullah, Shasha; Mahadeva, Sanjiv
2017-05-25
We aimed to adapt, translate and validate the Chronic Liver Disease Questionnaire (CLDQ) in Malaysian patients with chronic liver diseases of various aetiologies. Tertiary level teaching institution in Malaysia. The validation process involved 211 adult patients (English language n=101, Malay language n=110) with chronic liver disease. Characteristics of the study subjects were as follows: mean (SD) age was 56 (12.8) years, 58.3% were male and 41.7% female. The inclusion criteria were patients 18 years or older with chronic hepatitis and/or liver cirrhosis of any aetiology. The exclusion criteria were as follows: presence of hepatic encephalopathy, ongoing treatment with interferon and presence of other chronic conditions that have an impact on health-related quality of life (HRQOL). A cross-sectional study was conducted. Cultural adaptation of the English version of the CLDQ was performed, and a Malay version was developed following standard forward-backward translation by independent native speakers. Psychometric properties of both versions were determined by assessing their internal consistency, test-retest reliability and discriminant and convergent validity. Cronbach's alpha for internal consistency across the various domains of the CLDQ was 0.95 for the English version and 0.92 for the Malay version. Test-retest analysis showed excellent reliability with an intraclass correlation coefficient of 0.89 for the English version and 0.93 for the Malay version. The average scores of both the English and Malay versions of the CLDQ demonstrated adequate discriminant validity by differentiating between non-cirrhosis (English 6.3, Malay 6.1), compensated cirrhosis (English 5.6, Malay 6.0) and decompensated cirrhosis (English 5.1, Malay 4.9) (p<0.001). Convergent validity showed that correlation was fair between the English (ρ=0.59) and Malay (p=0.47) CLDQ versions with the EQ-5D, a generic HRQOL instrument. The English and Malay versions of the CLDQ are reliable and
Acquisition of Malay Word Recognition Skills: Lessons from Low-Progress Early Readers
Lee, Lay Wah; Wheldall, Kevin
2011-01-01
Malay is a consistent alphabetic orthography with complex syllable structures. The focus of this research was to investigate word recognition performance in order to inform reading interventions for low-progress early readers. Forty-six Grade 1 students were sampled and 11 were identified as low-progress readers. The results indicated that both…
Grief Experience of Bereaved Malay/Muslim Youths in Singapore: The Spiritual Dimension
Hassan, Murshidah; Mehta, Kalyani
2010-01-01
This article is based on a qualitative study conducted in Singapore which examined different coping mechanisms engaged by Malay/Muslim bereaved youths following parental death. The research applied the revised Transactional Model of Stress and Coping as well as the Adolescent Coping Scale as a theoretical framework for analysing findings. Of the…
Directory of Open Access Journals (Sweden)
Amin Abdullah
2017-12-01
Full Text Available The phenomenon of socio-political-religious life in the Middle East is a complete contrast to the socio-political-religious life in Southeast Asia, particularly in Indonesia and in Malay world in general. The changing of socio-political leadership in Indonesia from the New Order to Reformation Order (1998 is relatively smooth, followed by the violence-free legislative election and the presidential election in 2004, 2009, and 2014. Meanwhile, the changing of socio-political leadership in the Middle East countries (the Arab Spring are always overshadowed and followed by socio-political conflict and religious violence causing a lot of casualties. Socio-political life of the Muslim communities in Indonesia and in Malay world takes a different path from the Middle Eastern societies, and also form South Asia. Over the leadership transition in Indonesia, which is Islam as the majority, it can be run peacefully without violence and casualties. This paper will review the Indonesian Muslim intellectuals’ contribution—as an integral part of Malay world—to the development of Southeast Asian Islamic thoughts and its contribution in framing moderate-progressive Muslim in Malay world in caring for diversity, inclusion, openness, peace and harmony in the current global world.
Directory of Open Access Journals (Sweden)
Khadije Rahmati
2017-05-01
Full Text Available Background Transmission of infectious agents, such as parasites, is associated with consumption of raw vegetables. Thus, the health of vegetables reflects the health status of a region. Objectives Due to considerable parasitic contamination in Hamadan province and lack of information about health of vegetables in this region, this study was conducted in Malayer city, west of Iran. Methods This investigation was a cross-sectional study carried out on 383 samples of different vegetables including leek, parsley, coriander, radish, spring onion, tarragon, basil, mint, cress, and savory. The samples were randomly collected from 38 farms around Malayer city and subjected to parasitic contamination analysis using sedimentation and floatation methods. Results The results showed that 14.6% of the vegetable samples were contaminated with various pathogenic (5.2% and non-pathogenic (9.4% parasites including protozoan cyst (3.7%, worm eggs (3.9%, and free-living larvae (7%. Giardia intestinalis (1.3% and Entamoeba coli (2.3% were the only protozoa that were detected in the samples. Frequencies of worm egg contamination were 1.6% for Taenia/Echinococcus spp., 0.5% for Dicrocoelium dendriticum, 0.8% for Toxocara spp., 0.5% for Hymenolepis nana, 0.3% for Trichostrongylus spp., and 0.3% for Fasciola spp. Leek was the most contaminated vegetable (31.7%, although there was no contamination in tarragon (P < 0.001. Significant relationships were observed between parasitic contamination and fertilizer (P = 0.018 and water consumption (P < 0.001 used in the farm vegetables. Conclusions The results demonstrate the potential role of raw vegetables consumption in the transmission of parasitic infections in the area. Therefore, it is recommended for some necessary hygienic measures to be applied to increase the public health of the community.
Liberalism in the Islamic World and its influence in the Malay Archipelago: Model in Indonesia
Directory of Open Access Journals (Sweden)
Abbas Mansur Tamam
2014-06-01
Full Text Available Liberalism means here Orientalist attempt to attract even Islam conformity with the principles of Western liberalism in form and substance. Hence Zhardha in the Islamic world have to do Orientalism, which under his leadership became the U.S. currently wants Islam that corresponds to the values of modernity and secularism and Western liberalism. And this phenomenon coincides appearance in the Islamic world with its appearance Malay archipelago and Indonesia to face particular Alholanda since colonial days, and then taking this trend develops even have an influence on contemporary history in these islands. So this includes talking on two things: Orientalist role for the emergence of liberalism in the Islamic world, and its influence in the Malay islands.
Crossing Borders: The Linguistic Practices of Aspiring Bilinguals in the Malay Community
Rajadurai, Joanne
2011-01-01
This paper reports on a study of Malay learners of English in Malaysia as they attempt to extend their use of English outside the classroom and thus participate in new linguistic practices. Using a multiple case study approach, the study examines the narrative accounts of learners generated through student journals and focus group discussions.…
The Influence of Personal History on Preservice Malay, Tamil and Chinese Teacher Training.
Bodycott, Peter
1997-01-01
This study explored the influence of personal history on preservice teachers' construction of the ideal language teacher. Written biographies and metaphors and personal construct interviews with Chinese, Tamil, and Malay preservice language teachers indicated that they entered teacher education with unique, well-developed constructs of the ideal…
Ríos, A; López-Navas, A I; Sánchez, Á; Martínez-Alarcón, L; Ayala, M A; Garrido, G; Sebastián, M J; Ramis, G; Hernández, A M; Ramírez, P; Parrilla, P
2018-03-01
Living kidney donation is currently the most important kidney donor source in Latin America, and it is necessary to further increase its rates. To analyze the attitude toward living kidney donation among the Santiago de Cuba's population and to determine the sociopersonal factors with which it is associated. The population over 15 years old residing in Santiago de Cuba, stratified by sex and age, was screened. The "PCID-LKD Ríos" attitude questionnaire toward living kidney donation was administered to a random selection of the people surveyed according to the stratification and the census data. The completion was anonymized and self-administered. Verbal consent was obtained. The study was completed by 445 people, of whom the 86% (n = 389) were in favor of living related kidney donation. This attitude is associated with the level of education (P donation (P = .006); attitude toward cadaveric organ donation (P donation (P = .001); religious beliefs (P = .001); and assessment of the risk of living kidney donation (P donation; (3) carrying out of prosocial activities; and (4) risk assessment of living donation. Living related donation is very well accepted among the Santiago de Cuba's population. Copyright © 2017 Elsevier Inc. All rights reserved.
Ensuring the population living safety in the contaminated areas
Directory of Open Access Journals (Sweden)
S. I. Voronov
2016-01-01
Full Text Available The state policy of the Russian Federation to ensure population, living in the contaminated areas, life safety is implemented by means of federal programs.12 programs for overcoming the Chernobyl accident consequences, children’s population protection and housing provision for the Chernobyl accident liquidators are adopted and realized during this time. Total financing amount from the federal budget is more than 9,2 billion rubles. The main efforts are directed to create necessary infrastructure in settlements, development and deployment rehabilitation measures for agricultural lands and forests, creation of radiation situation monitoring systems, increase housekeeping safety culture in the contaminated territories, informational support and social and psychological rehabilitation of the population. Within the state programs are developing complex systems of a radiation situation monitoring in 12 subjects of the Russian Federation. Experts training for the outreach work with population, concerning radiation safety, increasing population knowledge level about radiation in a format of seminars, conferences, with use of online technologies is provided. The project on creation the uniform interdepartmental information system on overcoming radiation accidents aftermath, integrating the operating information systems of The Ministry of the Russian Federation for Civil Defence, Emergencies and Elimination of Consequences of Natural Disasters, Federal Service for Hydrometeorology and Environmental Monitoring, the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing and the Russian Academy of Sciences is realized.However, the problem of overcoming the radiation accidents aftermath remains relevant up to date.In 14 subjects of the Russian Federation there are territories contaminated by radioactive materials as a result of the Chernobyl accident where more than 1,5 million people live.
Chan, Mark Y; Tan, Karen; Tan, Huay-Cheem; Huan, Pei-Tee; Li, Bei; Phua, Qian-Hui; Lee, Hong-Kai; Lee, Chi-Hang; Low, Adrian; Becker, Richard C; Ong, Wen-Chong; Richards, Mark A; Salim, Agus; Tai, E-Shyong; Koay, Evelyn
2012-04-01
AIM, MATERIALS & METHODS: We investigated the functional significance of CYP2C19*2, *3, *17 and PON1 Q192R SNPs in 89 consecutive Asian patients on clopidogrel treatment and the prevalence of functionally significant polymorphisms among 300 Chinese, Malays and Asian Indians. Both CYP2C19 loss-of-function alleles (*2 or *3) were associated with higher platelet reactivity while the CYP2C19 gain-of-function allele (*17) had lower platelet reactivity. For PON1, the median PRI was not significantly different between the QQ, QR and RR groups. The allele frequencies of CYP2C19*2, CYP2C19*3 and CYP2C19*17 were 0.280, 0.065 and 0.010 (rare) for Chinese, 0.310, 0.050 and 0.025 for Malays, and 0.375, 0.010 (rare) and 0.165 for Indians, respectively. Our data suggest that genotyping studies to investigate clopidogrel response should include CYP2C19*2 and *3 but not *17 polymorphisms in Chinese, and CYP2C19*2 and *17 polymorphisms but not *3 in Indians. All three polymorphisms should preferably be genotyped in Malays.
Directory of Open Access Journals (Sweden)
Maisarah Jalalonmuhali
2017-01-01
Full Text Available Aim. To validate the accuracy of estimated glomerular filtration rate (eGFR equations in Malay population attending our hospital in comparison with radiolabeled measured GFR. Methods. A cross-sectional study recruiting volunteered patients in the outpatient setting. Chromium EDTA (51Cr-EDTA was used as measured GFR. The predictive capabilities of Cockcroft-Gault equation corrected for body surface area (CGBSA, four-variable Modification of Diet in Renal Disease (4-MDRD, and Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI equations were calculated. Results. A total of 51 subjects were recruited with mean measured GFR 42.04 (17.70–111.10 ml/min/1.73 m2. Estimated GFR based on CGBSA, 4-MDRD, and CKD-EPI were 40.47 (16.52–115.52, 35.90 (14.00–98.00, and 37.24 (14.00–121.00, respectively. Higher accuracy was noted in 4-MDRD equations throughout all GFR groups except for subgroup of GFR ≥ 60 ml/min/1.73 m2 where CGBSA was better. Conclusions. The 4-MDRD equation seems to perform better in estimating GFR in Malay CKD patients generally and specifically in the subgroup of GFR < 60 ml/min/1.73 m2 and both BMI subgroups.
Upholding the Malay Language and Strengthening the English Language Policy: An Education Reform
Yamat, Hamidah; Umar, Nur Farita Mustapa; Mahmood, Muhammad Ilyas
2014-01-01
Today's global economy and dependency on technology has led to educational reforms in Malaysia, which includes language policies; namely the Upholding the Malay Language, and Strengthening the English Language ("MBMMBI") policy. This policy underpins the project presented and discussed in this paper; on the development of a bilingual…
Babinská, Ingrid; Gecková, Andrea Madarasová; Jarcuska, Peter; Pella, Daniel; Mareková, Mária; Stefková, Gabriela; Veselská, Zuzana Dankulincová
2014-03-01
Several studies have revealed a high prevalence of risk factors associated with unhealthy lifestyle among individuals with lower socioeconomic status. In Slovakia, one of the most socially and health-disadvantaged groups is the Roma minority. The aim of this study is to explore differences in physical activity, smoking and alcohol consumption between the population living in Roma settlements and the majority population in Slovakia. Data from the cross-sectional epidemiological HepaMeta study conducted in Slovakia in 2011 were used. The sample consisted of 452 Roma (mean age = 34.7; 35.2% men) and 403 non-Roma (mean age = 33.5; 45.9% men) respondents. The differences in health-related behaviour between the population living in Roma settlements and the majority population were analysed using logistic models separately for males and females. These data show a clear difference between the population living in Roma settlements and the majority population with regard to leisure-time physical activity (only in women) and smoking, although not alcohol consumption. The prevalence of leisure-time physical activities such as walking or some other type of sport was significantly lower among Roma women than among non-Roma women. Men and women living in Roma settlements are more likely to smoke on a daily basis and they are heavier smokers in comparison with the majority population. HepaMeta study did not find differences in alcohol consumption between the Roma and non-Roma men. However, Roma women reported less frequent recent drinking and binge-drinking of 6 or more doses of alcohol on a single occasion. The higher prevalence of unhealthy lifestyle activities among Roma seem to contribute to these inequalities in cardiovascular diseases morbidity and mortality in comparison with the majority population.
Prevalence and Determinants of Suboptimal Vitamin D Levels in a Multiethnic Asian Population.
Man, Ryan Eyn Kidd; Li, Ling-Jun; Cheng, Ching-Yu; Wong, Tien Yin; Lamoureux, Ecosse; Sabanayagam, Charumathi
2017-03-22
This population-based cross-sectional study examined the prevalence and risk factors of suboptimal vitamin D levels (assessed using circulating 25-hydroxycholecalciferol (25(OH)D)) in a multi-ethnic sample of Asian adults. Plasma 25(OH)D concentration of 1139 Chinese, Malay and Indians (40-80 years) were stratified into normal (≥30 ng/mL), and suboptimal (including insufficiency and deficiency, 65 years), Malay and Indian ethnicities (compared to Chinese ethnicity), and higher body mass index, HbA1c, education and income levels were associated with suboptimal 25(OH)D concentration ( p < 0.05). In a population-based sample of Asian adults, approximately 75% had suboptimal 25(OH)D concentration. Targeted interventions and stricter reinforcements of existing guidelines for vitamin D supplementation are needed for groups at risk of vitamin D insufficiency/deficiency.
Wo, Su Woan; Lai, Pauline Siew Mei; Ong, Lai Choo; Low, Wah Yun; Lim, Kheng Seang; Tay, Chee Giap; Wong, Chee Piau; Ranjini, Sivanesom
2015-04-01
We aimed to cross-culturally adapt the parent-proxy Health-Related Quality of Life Measure for Children with Epilepsy (CHEQOL-25) into Malay and to determine its validity and reliability among parents of children with epilepsy in Malaysia. The English version of the parent-proxy CHEQOL-25 was translated according to international guidelines to Malay. Content validity was verified by an expert panel and piloted in five parents of children with epilepsy (CWE). The Malay parent-proxy CHEQOL-25 was then administered to 40 parents of CWE, aged 8-18years from two tertiary hospitals, at baseline and 2weeks later. Parents were also required to complete the Malay PedsQL™ 4.0 so that convergent validity could be assessed. Hypothesis testing was assessed by correlating the individual subscales in the parent-proxy CHEQOL-25 with epilepsy severity, the number of anticonvulsants, and the number of close friends. Participants from the pilot study did not encounter any problems in answering the final translated Malay parent-proxy CHEQOL-25. Hence, no further modifications were made. Cronbach's α for each subscale of the Malay parent-proxy CHEQOL-25 ranged from 0.67 to 0.83. The intraclass correlation coefficient for all items at test-retest ranged from 0.70 to 0.94. Both the CHEQOL-25 and the PedsQL™ 4.0 showed good correlation in the social and emotional subscales (r=0.598, p=0.002 and r=0.342, p=0.031, respectively). The severity of epilepsy, higher number of antiepileptic drug(s), poorer cognitive ability of the child, lower number of close friends, and lesser amount of time spent with friends were significantly associated with poorer health-related quality of life. The Malay parent-proxy CHEQOL-25 was found to be a valid and reliable instrument to assess parents' perceived HRQOL of their CWE in Malaysia. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Melvin Khee-Shing Leow
Full Text Available HRQoL is an important outcome to guide and promote healthcare. Clinical and socioeconomic factors may influence HRQoL according to ethnicity.A multiethnic cross-sectional national cohort (N = 7198 of the Singapore general population consisting of Chinese (N = 4873, Malay (N = 1167 and Indian (N = 1158 adults were evaluated using measures of HRQoL (SF-36 version 2, family functioning, health behaviours and clinical/laboratory assessments. Multiple regression analyses were performed to identify determinants of physical and mental HRQoL in the overall population and their potential differential effects by ethnicity. No a priori hypotheses were formulated so all interaction effects were explored.HRQoL levels differed between ethnic groups. Chinese respondents had higher physical HRQoL (PCS than Indian and Malay participants (p<0.001 whereas mental HRQoL (MCS was higher in Malay relative to Chinese participants (p<0.001. Regressions models explained 17.1% and 14.6% of variance in PCS and MCS respectively with comorbid burden, income and employment being associated with lower HRQoL. Age and family were associated only with MCS. The effects of gender, stroke and musculoskeletal conditions on PCS varied by ethnicity, suggesting non-uniform patterns of association for Chinese, Malay and Indian individuals.Differences in HRQoL levels and determinants of HRQoL among ethnic groups underscore the need to better or differentially target population segments to promote well-being. More work is needed to explore HRQoL and wellness in relation to ethnicity.
Sazlina, Shariff-Ghazali; Browning, Colette Joy; Yasin, Shajahan
2012-01-01
Introduction Like many countries Malaysia is facing an increase in the number of people with type 2 diabetes mellitus diabetes (T2DM) and modifiable lifestyle factors such as sedentary behaviour are important drivers of this increase. The level of physical activity is low among elderly Malay people. In Malaysia, strategies to promote physical activity in elderly Malay people with T2DM are not well documented in the research literature. This paper discusses an intervention to increase physical activity in elderly Malay people with T2DM. The aim of our study was to evaluate the effectiveness of personalised feedback alone and in combination with peer support in promoting and maintaining physical activity in comparison with usual care. Methods and analysis A three-arm randomised controlled trial will be conducted among sedentary Malay adults aged 60 years and above with T2DM attending an urban primary healthcare clinic in Malaysia. The participants will be randomised into three groups for a 12-week intervention with a follow-up at 24 and 36 weeks to assess adherence. The primary outcome of this study is pedometer-determined physical activity. Glycaemic and blood pressure control, body composition, cardiorespiratory fitness, balance, lipid profile, health-related quality of life, psychological well-being, social support and self-efficacy for exercise are the secondary measures. Linear mixed models will be used to determine the effect of the intervention over time and between groups. Ethical and dissemination The Monash University Human Research Ethics Committee and the Malaysian Ministry of Health's Medical Research Ethics Committee approved this protocol. The findings of this study will be presented at international conferences and published in peer-reviewed journals. Trial registration This study protocol has been registered with the Malaysian National Medical Research Registry and with the Current Controlled Trial Ltd (http
Sazlina, Shariff-Ghazali; Browning, Colette Joy; Yasin, Shajahan
2012-01-01
Like many countries Malaysia is facing an increase in the number of people with type 2 diabetes mellitus diabetes (T2DM) and modifiable lifestyle factors such as sedentary behaviour are important drivers of this increase. The level of physical activity is low among elderly Malay people. In Malaysia, strategies to promote physical activity in elderly Malay people with T2DM are not well documented in the research literature. This paper discusses an intervention to increase physical activity in elderly Malay people with T2DM. The aim of our study was to evaluate the effectiveness of personalised feedback alone and in combination with peer support in promoting and maintaining physical activity in comparison with usual care. A three-arm randomised controlled trial will be conducted among sedentary Malay adults aged 60 years and above with T2DM attending an urban primary healthcare clinic in Malaysia. The participants will be randomised into three groups for a 12-week intervention with a follow-up at 24 and 36 weeks to assess adherence. The primary outcome of this study is pedometer-determined physical activity. Glycaemic and blood pressure control, body composition, cardiorespiratory fitness, balance, lipid profile, health-related quality of life, psychological well-being, social support and self-efficacy for exercise are the secondary measures. Linear mixed models will be used to determine the effect of the intervention over time and between groups. ETHICAL AND DISSEMINATION: The Monash University Human Research Ethics Committee and the Malaysian Ministry of Health's Medical Research Ethics Committee approved this protocol. The findings of this study will be presented at international conferences and published in peer-reviewed journals. This study protocol has been registered with the Malaysian National Medical Research Registry and with the Current Controlled Trial Ltd (http://www.controlled-trials.com/ISRCTN71447000/).
Variation in the local population dynamics of the short-lived Opuntia macrorhiza (Cactaceae).
Haridas, C V; Keeler, Kathleen H; Tenhumberg, Brigitte
2015-03-01
Spatiotemporal variation in demographic rates can have profound effects for population persistence, especially for dispersal-limited species living in fragmented landscapes. Long-term studies of plants in such habitats help with understanding the impacts of fragmentation on population persistence but such studies are rare. In this work, we reanalyzed demographic data from seven years of the short-lived cactus Opuntia macrorhiza var. macrorhiza at five plots in Boulder, Colorado. Previous work combining data from all years and all plots predicted a stable population (deterministic log lamda approximately 0). This approach assumed that all five plots were part of a single population. Since the plots were located in a suburban-agricultural interface separated by highways, grazing lands, and other barriers, and O. macrorhiza is likely dispersal limited, we analyzed the dynamics of each plot separately using stochastic matrix models assuming each plot represented a separate population. We found that the stochastic population growth rate log lamdaS varied widely between populations (log lamdaS = 0.1497, 0.0774, -0.0230, -0.2576, -0.4989). The three populations with the highest growth rates were located close together in space, while the two most isolated populations had the lowest growth rates suggesting that dispersal between populations is critical for the population viability of O. macrorhiza. With one exception, both our prospective (stochastic elasticity) and retrospective (stochastic life table response experiments) analysis suggested that means of stasis and growth, especially of smaller plants, were most important for population growth rate. This is surprising because recruitment is typically the most important vital rate in a short-lived species such as O. macrorhiza. We found that elasticity to the variance was mostly negligible, suggesting that O. macrorhiza populations are buffered against large temporal variation. Finally, single-year elasticities to means
Hussein, Z; Eaves, C J; Hutchinson, D B; Canfield, C J
1996-11-01
1. The pharmacokinetics of proguanil were evaluated in patients with acute P. falciparum malaria receiving concomitantly proguanil hydrochloride and atovaquone. The population consisted of 203 Blacks, 112 Orientals and 55 Malays; 274 males and 96 females. Of the 370 patients, 114 and 256 patients were classified as 'poor' and 'extensive' metabolizers of proguanil, respectively. Body weight and age ranged between 11-110 kg and 3-65 years, respectively. 2. A one compartment model with first-order absorption and elimination was fitted to proguanil plasma concentration-time profiles, using non-linear mixed effect modelling (NONMEM). 3. Oral clearance (CLo) showed a 0.785 power relationship with body weight and was 13% higher in Orientals than Blacks and Malays and 17% lower in 'poor' than 'extensive' metabolizers. According to the mean weight of each population, the final population estimates of CLo in Blacks, Orientals and Malays who are 'extensive' metabolizers were 54.0, 61.5 and 64.3 l h-1, respectively. Age, gender and dose had no significant effects on CLo. 4. Apparent volume of distribution (V/F) showed a 0.88 power relationship with body weight. The final population estimates were 562 and 1629 l in children ( 15 years, respectively, who had a mean body weight of 22.6 and 54.8 kg, respectively. The effect of other covariates on V/F was not examined. 5. The final magnitudes of interpatient variability in CLo and V/F were relatively low at 22.5 and 17.0%, respectively. 6. Population pharmacokinetic parameter estimates in Black, Oriental and Malay patients with acute P. falciparum malaria are in good agreement with results of pharmacokinetic studies in healthy Caucasian volunteers. In view of the 30-50% residual variability in proguanil plasma concentrations, the slight effects of Orientals and 'poor' metabolizers on CLo are unlikely to be clinically significant. Hence, dose recommendation will be solely based on body weight.
Directory of Open Access Journals (Sweden)
Xavier Luffin
2008-12-01
Full Text Available In the context of the White and Christian-dominated Afrikaans language movements, followed by apartheid, little attention has been paid to an Afrikaans literary variety used among Muslim Cape Coloureds, a group often referred to as ‘Cape Malays’. Descending mainly from Asian slaves brought by the Verenigde Oost-Indische Compagnie (VOC, Dutch East India Company, and bearing the marks of cohabitation with non-Asian populations at the Cape, the Cape Malays at an early stage developed a distinct religious culture through their adherence to Islam, as well as a distinct Cape Dutch linguistic identity through their connections with the Dutch East Indies and the Islamic world. These cultural idiosyncrasies found expression in a local literature, religious and (more rarely secular, using as a medium a variety of Cape Dutch/Afrikaans written either in the Arabic alphabet or in the Roman alphabet.
Belief in supernatural causes of mental illness among Malay patients: impact on treatment.
Razali, S M; Khan, U A; Hasanah, C I
1996-10-01
The concept of aetiology of mental illness in 134 Malay patients was investigated by means of a 20-item checklist. About 53% of the patients attributed their illnesses to supernatural agents. Witchcraft and possession by evil spirits were regarded as common causes of illness. The number of patients who believed in supernatural causes of their mental illness was significantly higher among those who had consulted bomohs (Malay traditional healers) than among those who had not consulted them. The belief that mental illness is caused by supernatural agents is firmly held by bomohs, who reinforce this notion in those who seek their advice. Belief in supernatural causes of mental illness was not significantly associated with age, gender, level of education or occupation of the patients. Patients who believed in supernatural causes of mental illness were also found to show poor drug compliance, and the number of such patients at 6 months follow-up was significantly lower than the corresponding figure for those who did not believe in supernatural causes. The importance of understanding the patients' cultural background when treating psychiatric patients is highlighted.
Public knowledge and beliefs about depression among urban and rural Malays in Malaysia.
Swami, Viren; Loo, Phik-Wern; Furnham, Adrian
2010-09-01
This study examined knowledge and beliefs about depression among Malaysian Malays varying in socioeconomic status. A total of 153 urban and 189 rural participants completed a questionnaire in which they had to identify two cases of depression and rate a series of items about the causes and best treatments for depression. Results showed that urban participants were more likely to use psychiatric labels ('depression') for the two vignettes, whereas rural participants tended to use more generic terms ('emotional stress'). Principal components analysis (PCA) showed that beliefs about the causes of depression factored into five components, of which stressful life events was most strongly endorsed by both groups. PCA of treatment items revealed four stable components, of which religious factors were most strongly endorsed. There were also a number of significant between-group differences in the endorsement of these factors (eta(p) (2) = .03-.11), with rural participants generally rating supernatural and religious factors more strongly than urban Malays. These results are discussed in relation to mental health literacy programmes in Malaysia.
Quek, S C; Low, P S; Saha, N; Heng, C K
2006-11-01
Factor VII (FVII) is an independent risk factor for coronary artery disease. Three polymorphisms of the factor VII gene (F7) were studied in a group of healthy newborns comprising 561 Chinese, 398 Malays and 226 Asian Indians from Singapore. The allele frequencies of 3 polymorphisms (R353Q, Promoter 0/10bp Del/Ins and Intron 7) in the FVII gene were ascertained through genotyping by polymerase chain reaction and restriction digestion of amplified fragments. In Chinese the minor allele frequencies are Q: 0.04, Ins: 0.03, R7: 0.44; Malays, Q: 0.06, Ins: 0.10, R7: 0.41; and Indians, Q: 0.25, Ins: 0.23, R7: 0.43. Strong linkage disequilibrium (Delta > 0.7) is observed between the 0/10 bp and the R353Q sites in all ethnic groups. We conclude that: (i) the prevalence of the minor Q and Ins alleles of the R353Q and 0/10 bp polymorphisms are significantly higher in the Indian newborns than the Chinese and Malays; (ii) the Q allele is significantly associated (p = 0.01) with a lower plasma FVII coagulant level in the Indian and Malay neonates; and this polymorphism explains up to 3.8% of the variance in FVII coagulant levels; (iii) there is no significant difference in allele frequencies of the three polymorphisms between neonates with and without family histories of CAD.
Ethical Concerns About Human Genetic Enhancement in the Malay Science Fiction Novels.
Isa, Noor Munirah; Hj Safian Shuri, Muhammad Fakhruddin
2018-02-01
Advancements in science and technology have not only brought hope to humankind to produce disease-free offspring, but also offer possibilities to genetically enhance the next generation's traits and capacities. Human genetic enhancement, however, raises complex ethical questions, such as to what extent should it be allowed? It has been a great challenge for humankind to develop robust ethical guidelines for human genetic enhancement that address both public concerns and needs. We believe that research about public concerns is necessary prior to developing such guidelines, yet the issues have not been thoroughly investigated in many countries, including Malaysia. Since the novel often functions as a medium for the public to express their concerns, this paper explores ethical concerns about human genetic enhancement expressed in four Malay science fiction novels namely Klon, Leksikon Ledang, Transgenesis Bisikan Rimba and Transgenik Sifar. Religion has a strong influence on the worldview of the Malays therefore some concerns such as playing God are obviously religious. Association of the negative image of scientists as well as the private research companies with the research on human genetic enhancement reflects the authors' concerns about the main motivations for conducting such research and the extent to which such research will benefit society.
Lim, Hui W; Wells, Bill; Howard, Sara
2015-01-01
Early child multilingual acquisition is under-explored. Using a cross-sectional study approach, the present research investigates the rate of multilingual phonological acquisition of English-Mandarin-Malay by 64 ethnic Chinese children aged 2;06-4;05 in Malaysia--a multiracial-multilingual country of Asia. The aims of the study are to provide clinical norms for speech development in the multilingual children and to compare multilingual acquisition with monolingual and bilingual acquisition. An innovative multilingual phonological test which adopts well-defined scoring criteria drawing upon local accents of English, Mandarin and Malay is proposed and described in this article. This procedure has been neglected in the few existing Chinese bilingual phonological acquisition studies resulting in peculiar findings. The multilingual children show comparable phonological acquisition milestones to that of monolingual and bilingual peers acquiring the same languages. The implications of the present results are discussed. The present findings contribute to the development of models and theories of child multilingual acquisition.
Resende, Ana; Amorim, António; da Silva, Cláudia Vieira; Ribeiro, Teresa; Porto, Maria João; Costa Santos, Jorge; Afonso Costa, Heloísa
2017-01-01
Twenty-two autosomal short tandem repeats included in the PowerPlex® Fusion System Amplification kit (Promega Corporation) were genotyped in a population sample of 500 unrelated individuals from Cabo Verde living in Lisboa. Allelic frequency data and forensic and statistical parameters were calculated and evaluated in this work. The genetic relationship among immigrant population from Cabo Verde living in Lisboa and other populations, such as Brazilian and Angola immigrants living in Lisboa; Afro-Americans, Caucasians, Hispanics and Asians living in the USA and the population from Lisboa was assessed, and a multidimensional scaling plot was drown to show these results.
Directory of Open Access Journals (Sweden)
Jamaiyah H
2013-05-01
Full Text Available Introduction: Many studies reported poorer quality of life (QoL in youth with diabetes compared to healthy peers. One of the tools used is the Diabetes Quality of Life for Youth (DQoLY questionnaire in English. A validated instrument in Malay is needed to assess the perception of QoL among youth with diabetes in Malaysia. Objective: To translate the modified version, i.e., the DQoLY questionnaire,into Malay and determine its reliability and validity.Methods: Translation and back-translation were used. An expert panel reviewed the translated version for conceptual and content equivalence. The final version was then administered to youths with type 1 diabetes mellitus from the universities and Ministry of Health hospitals between August 2006 and September 2007. Reliability was analysed using Cronbach’s alpha, while validity was confirmed using concurrent validity (HbA1c and self-rated health score.Results: A total of 82 youths with type 1 diabetes (38 males aged 10-18 years were enrolled from eight hospitals. The reliability of overall questionnaire was 0.917, and the reliabilities of the three domains ranged from 0.832 to 0.867. HbA1c was positively correlated with worry (p=0.03. The self-rated health score was found to have significant negative correlation with the “satisfaction” (p=0.013 and “impact” (p=0.007 domains.Conclusion: The Malay translated version of DQoLY questionnaire was reliable and valid to be used among youths with type 2 diabetes in Malaysia.
Directory of Open Access Journals (Sweden)
Bulgiba Awang
2010-11-01
Full Text Available Abstract Background Metabolic Syndrome is associated with increased risk for type 2 diabetes and cardiovascular diseases. However, different diagnostic criteria have been recommended by different expert groups. In Malaysia, there is a lack of research comparing these different diagnostic criteria. Therefore, it is our aim to study the concordance between the IDF and the modified NCEP ATP III definitions of Metabolic Syndrome among a Malay cohort in Kuala Lumpur; and to demonstrate if all participants have the same cardiometabolic risks. Methods This was an analytical cross sectional study. Ethics approval was obtained and informed consent was given by all participants. Anthropometric measurements, blood pressure, fasting blood glucose and lipid profile were taken following standard protocols. Results Metabolic Syndrome was diagnosed in 41.4% and 38.2% participants using the modified NCEP and IDF criteria respectively. Among those diagnosed with Metabolic Syndrome by modified NCEP, 7.6% were missed by the IDF criteria. Participants diagnosed by the modified NCEP criteria had lower BMI and waist circumference but had higher cardiometabolic risks than those diagnosed with both criteria. Their blood pressure, glucose, total cholesterol and triglyceride were more adverse than the IDF group. This demonstrated that central obesity may not be a prerequisite for the development of increased cardiometabolic risks within this Malay cohort. Conclusion Metabolic syndrome is common in this Malay cohort regardless of the criterion used. The modified NCEP ATP III criteria may be more suitable in diagnosis of metabolic syndrome for this Malay cohort.
Proposing a Web-Based Tutorial System to Teach Malay Language Braille Code to the Sighted
Wah, Lee Lay; Keong, Foo Kok
2010-01-01
The "e-KodBrailleBM Tutorial System" is a web-based tutorial system which is specially designed to teach, facilitate and support the learning of Malay Language Braille Code to individuals who are sighted. The targeted group includes special education teachers, pre-service teachers, and parents. Learning Braille code involves memorisation…
Thyroid status and mortality in nonagenarians from long-lived families and the general population
DEFF Research Database (Denmark)
van Vliet, Nicolien A.; van der Spoel, Evie; Beekman, Marian
2017-01-01
(TSH), free thyroxine (fT4) and free triiodothyronine (fT3) were measured. In nonagenarians from long-lived families and from the general population, associations between thyroid parameters and mortality were similar. We found no interaction between study population and parameters of thyroid status...
THE COMPARISONS AND CONTRASTS BETWEEN ENGLISH AND MALAY LANGUAGES
Directory of Open Access Journals (Sweden)
Mohd Nazri Latiff Azmi
2016-06-01
Full Text Available English and Malay languages are categorized as popular languages in the world. However, both languages underwent different history and composition. This study investigates the languages in terms of history, phonology, loanwords, grammar, morphology and semantics. The purposes of studying the comparisons and contrasts of both languages are not only to analyze the uniqueness of the languages but also to identify the process of understanding the languages especially the view of second language learners. It is found that two languages come from different background; somehow they share similar characteristics such as the vowels sounds, loanwords and semantics. However, the learners face difficulty in learning both languages especially in pronunciations and spelling.
Directory of Open Access Journals (Sweden)
Wai Yew Yang
2017-01-01
Full Text Available Malaysia is experiencing a rise in the prevalence of childhood obesity. Evidence for the relationship between dietary intake and body weight among Malaysian children is limited, with the impact of energy intake misreporting rarely being considered. This paper describes the dietary intakes of urban Malay children in comparison to national recommendations and by weight status. This cross-sectional Family Diet Study (n = 236 was conducted in five national primary schools in Malaysia (August 2013–October 2014. Data on socio-demographics, anthropometrics, 24-h dietary recalls, and food habits were collected from Malay families, consisting of a child aged 8 to 12 years and their main caregiver(s. Multivariable analyses were used to assess dietary intake-body weight relationships. The plausibility of energy intake was determined using the Black and Cole method. Approximately three in 10 Malay children were found to be overweight or obese. The majority reported dietary intakes less than national recommendations. Children with obesity had the lowest energy intakes relative to body weight (kcal/kg compared to children in other weight categories (F = 36.21, p < 0.001. A positive moderate correlation between energy intake and weight status was identified (r = 0.53, p < 0.001 after excluding energy intake mis-reporters (n = 95, highlighting the need for the validation of dietary assessment in obesity-related dietary research in Malaysia.
Yang, Wai Yew; Burrows, Tracy; MacDonald-Wicks, Lesley; Williams, Lauren T; Collins, Clare E; Chee, Winnie Siew Swee; Colyvas, Kim
2017-01-20
Malaysia is experiencing a rise in the prevalence of childhood obesity. Evidence for the relationship between dietary intake and body weight among Malaysian children is limited, with the impact of energy intake misreporting rarely being considered. This paper describes the dietary intakes of urban Malay children in comparison to national recommendations and by weight status. This cross-sectional Family Diet Study ( n = 236) was conducted in five national primary schools in Malaysia (August 2013-October 2014). Data on socio-demographics, anthropometrics, 24-h dietary recalls, and food habits were collected from Malay families, consisting of a child aged 8 to 12 years and their main caregiver(s). Multivariable analyses were used to assess dietary intake-body weight relationships. The plausibility of energy intake was determined using the Black and Cole method. Approximately three in 10 Malay children were found to be overweight or obese. The majority reported dietary intakes less than national recommendations. Children with obesity had the lowest energy intakes relative to body weight (kcal/kg) compared to children in other weight categories (F = 36.21, p < 0.001). A positive moderate correlation between energy intake and weight status was identified ( r = 0.53, p < 0.001) after excluding energy intake mis-reporters ( n = 95), highlighting the need for the validation of dietary assessment in obesity-related dietary research in Malaysia.
Chia, Sin Eng; Mohamed Ali, Safiyya; Yap, Peng Huat Eric; Gan, Linda; Ong, Yeong Bing; Chia, Kee Seng
2009-03-01
Organophosphate (OP)-containing pesticides are widely used worldwide for domestic and industrial purposes. Studies on acute and chronic exposure to OPs have revealed numerous health effects attributed mainly to acetylcholinesterase (AChE) inhibition. The enzyme human serum paraoxonase (PON1) is involved in the detoxification of OP compounds. PON1 polymorphisms have been shown to affect susceptibility to OP exposure. We studied the effect of OP exposure on pest control workers and assessed the distribution of two common PON1 polymorphisms in our local population. The exposed group consisted of 103 workers from various pest control companies under the Singapore Pest Management Association while the 91 unexposed workers were from a lead stabilizer factory. For all workers, the mean age was 36.9 (20-70) years and the ethnic distribution was 38.1% Chinese, 44.3% Malay and 17.5% Indian. The mean+/-S.D. exposure duration among the pesticide workers was 10.4+/-8.4 years. The mean+/-S.D. RBC cholinesterase level was 18436.2+/-2078U/L and 18079.6+/-1576U/L for the exposed and unexposed groups, respectively (p=0.216). The mean+/-S.D. serum pseudocholinesterase was 11028.4+/-2867.4U/L and 9433.6+/-2022.6U/L in the exposed and unexposed groups, respectively (pChinese and Malays (266.5 and 266.3U/L, respectively) whereas that of the Indians was significantly lower (165.6U/L). Our study showed that cholinesterase levels among the exposed were not lower than those in the unexposed group. PON1 polymorphisms differed among ethnic groups, implying that ethnicity could be an important surrogate for identifying susceptible groups in case of OP exposure. Although OP poisoning is rare among occupationally exposed workers in Singapore, this information is useful for other developing countries that have large populations of Chinese, Malays and Indians where OP exposure could be very high especially in agricultural settings.
Muhammad, Noor Azimah; Shamsuddin, Khadijah; Omar, Khairani; Shah, Shamsul Azhar; Mohd Amin, Rahmah
2014-01-01
Parenting behaviour is culturally sensitive. The aims of this study were (1) to translate the Parental Bonding Instrument into Malay (PBI-M) and (2) to determine its factorial structure and validity among the Malaysian population. The PBI-M was generated from a standard translation process and comprehension testing. The validation study of the PBI-M was administered to 248 college students aged 18 to 22 years. Participants in the comprehension testing had difficulty understanding negative items. Five translated double negative items were replaced with five positive items with similar meanings. Exploratory factor analysis showed a three-factor model for the PBI-M with acceptable reliability. Four negative items (items 3, 4, 8, and 16) and item 19 were omitted from the final PBI-M list because of incorrect placement or low factor loading (parenting style. Confirmatory factor analysis may further support this finding. Malaysia, parenting, questionnaire, validity.
Directory of Open Access Journals (Sweden)
Sulaiman Dorloh
2016-02-01
Full Text Available The Wasatiyyah or moderation Institute for Peace and Development was initiated by the current Chularajmontri, Aziz Pithakkompon on 21th August 2014, with the aims of fostering harmony among the diverse ethnics in the country and providing a counter-balance to extremism and extremist as it is taking place in various parts of the world and promoting moderation and peace among Muslims in Thai society. The concept of wasatiyyah or moderation is appropriate to be highlighted and practiced in Thai society to curb extremist activities in all matters. Even though some negative perceptions were voiced by a few parties, but the actual intentions could result in a decline of racial strains, as being moderate has been the practice of the Malay community and its leaders for ages. In fact, this approach has contributed to the success of the Malay community in the Deep South in securing the Malay indentity from their Buddhist neighburs in the country, without having to resort to spilling a lot of blood. Based on previous research, it was observed that the concept of wasatiyyah had a great influence on the Malays, as it had a strong link with the Islamic values that have been embedded in the Malay community. The Islamic values are the main elements that shape the Malays’ conduct, and it is the results of interaction with social norms, for it has bred certain social values that include compromise, modesty, respect and cooperation as transpired when Malays interact among themselves or with other communities. The main goal for the institution to maintain peace and harmony in the society. Based on textual analysis, the study determines that the concept of wasatiyyah concept or moderation is part of the social values borne out of the Malays’ values based on Islamic teachings. Hence, the question is, to what extent does the wasatiyyah concept implemented in the institute. In order to answer the question above, this study has set two main objectives. First, to
Directory of Open Access Journals (Sweden)
Sulaiman Dorloh
2015-06-01
Full Text Available The Wasatiyyah or moderation Institute for Peace and Development was initiated by the current Chularajmontri, Aziz Pithakkompon on 21th August 2014, with the aims of fostering harmony among the diverse ethnics in the country and providing a counter-balance to extremism and extremist as it is taking place in various parts of the world and promoting moderation and peace among Muslims in Thai society. The concept of wasatiyyah or moderation is appropriate to be highlighted and practiced in Thai society to curb extremist activities in all matters. Even though some negative perceptions were voiced by a few parties, but the actual intentions could result in a decline of racial strains, as being moderate has been the practice of the Malay community and its leaders for ages. In fact, this approach has contributed to the success of the Malay community in the Deep South in securing the Malay indentity from their Buddhist neighburs in the country, without having to resort to spilling a lot of blood. Based on previous research, it was observed that the concept of wasatiyyah had a great influence on the Malays, as it had a strong link with the Islamic values that have been embedded in the Malay community. The Islamic values are the main elements that shape the Malays’ conduct, and it is the results of interaction with social norms, for it has bred certain social values that include compromise, modesty, respect and cooperation as transpired when Malays interact among themselves or with other communities. The main goal for the institution to maintain peace and harmony in the society. Based on textual analysis, the study determines that the concept of wasatiyyah concept or moderation is part of the social values borne out of the Malays’ values based on Islamic teachings. Hence, the question is, to what extent does the wasatiyyah concept implemented in the institute. In order to answer the question above, this study has set two main objectives. First
Noor, Norhayati Mohd; Aziz, Aniza Abd; Mostapa, Mohd Rosmizaki; Awang, Zainudin
2015-01-01
This study was designed to examine the psychometric properties of Malay version of the Inventory of Functional Status after Childbirth (IFSAC). A cross-sectional study. A total of 108 postpartum mothers attending Obstetrics and Gynaecology Clinic, in a tertiary teaching hospital in Malaysia, were involved. Construct validity and internal consistency were performed after the translation, content validity, and face validity process. The data were analyzed using Analysis of Moment Structure version 18 and Statistical Packages for the Social Sciences version 20. The final model consists of four constructs, namely, infant care, personal care, household activities, and social and community activities, with 18 items demonstrating acceptable factor loadings, domain to domain correlation, and best fit (Chi-squared/degree of freedom = 1.678; Tucker-Lewis index = 0.923; comparative fit index = 0.936; and root mean square error of approximation = 0.080). Composite reliability and average variance extracted of the domains ranged from 0.659 to 0.921 and from 0.499 to 0.628, respectively. The study suggested that the four-factor model with 18 items of the Malay version of IFSAC was acceptable to be used to measure functional status after childbirth because it is valid, reliable, and simple.
Directory of Open Access Journals (Sweden)
Fitmawati Fitmawati
2017-12-01
Full Text Available Obat pahit has been generally known and believed by Lingga Malay society as anti-aging agent. However, the study of Obat pahit is not scientifically proven. This research was aimed to prove immunomodulatory ability of Obat pahit potion from Lingga, Riau Archipelago. This study used white rats as an animal modelling, and Staphylococcus aureus as bacteria tester. The rats had been treated with aqueous Obat pahit extract from three TMPs on dose scales of 0.09, 0.18 and 0.27 mL/200g of body weight through oral administration for 7 days. Furthermore, on the 8th days, the experiment animals were injected by the preparation of bacteria tester through intraperitoneal administration in the amount of 0.5 mL/200 gram of body weigth and subsequently incubated for 1 hour after the injection. There were 2 observed parameters on this study, i.e efectivity and capacity of phagocytosis by leukocytes. The observation of leukocytes-phagocytocis activity was carried out by making a smear preparat samples of peritoneum fluid from rats. After the observation under microscope on a magnification of 100 times. The result was obtained the Obat pahit from Kalan PMT swere more effective on dose 2, while from SP4 and Linau TMPs were much more effective on dose 1. It is therefore, using these data of the results, the advanced doses scale of this Obat pahit would not be necessary. Obat pahit potion from Malay Lingga Malay Ethnic could become raw materials of immunomodulatory herbal medicine based on traditional knowledge. It also potentially as a standardized herbal.
The effect of faith-based smoking cessation intervention during Ramadan among Malay smokers
Ismail, Suriani; Abdul Rahman, Hejar; Abidin, Emelia Zainal; Isha, Ahmad Sharul Nizam; Abu Bakar, Sallehuddin; Zulkifley, Nur Aishah; Fuad, Ahmad Farhan Ahmad
2017-01-01
Objectives: To study the effects of a faith-based smoking cessation intervention during Ramadan among Malay male smokers working in public offices. Methods: This was a quasi-experimental study conducted during Ramadan 2015. The intervention was developed based on the constructs within the Theory of Planned Behaviour. The intervention intended to increase the intention and the perceived behaviour control to stop smoking among Muslim smokers during Ramadan. The outcomes measured were changes in...
Directory of Open Access Journals (Sweden)
Wenny Maya Arlena
2013-07-01
Full Text Available This study aims to describe the ethnic group or tribe is a group of people whose members identify themselves with one another, usually based on lineage are considered the same as culture, language, religion traits, behaviors, or biological. Ethnicity is a fundamental factor in human life, interactions and intrinsic property of a group. The method of research used content analysis approaches and ethnographic art. The results showed determination by mixing or races as “Peranakan”: for a mixture of Malay race with China, people who are determined according to their religion, for Malays in Malaysia it meant that the Muslim bumiputera, “the Mestis” for Hispanic mix by bumiputera. Upin Ipin-released on September 14, 2010 in Malaysia and produced by Les’ Copaque. The results of this study show Upin-Ipin filled with simplicity in bringing Islamic values, education, manners, and respect among fellow was meant for all people of good Malaysian nation or religion. Good relations between different cultures (Malay, Chinese, Indian were described in this animated film. Upin-Ipin animated movie brings the perfect image and message, ie, with different cultures can create a good relationship with the harmony of differences in unity and simplicity.
Daher, Aqil Mohammad; Ahmad, Syed Hassan; Winn, Than; Selamat, Mohd Ikhsan
2015-01-01
Few studies have employed the item response theory in examining reliability. We conducted this study to examine the effect of Rating Scale Categories (RSCs) on the reliability and fit statistics of the Malay Spiritual Well-Being Scale, employing the Rasch model. The Malay Spiritual Well-Being Scale (SWBS) with the original six; three and four newly structured RSCs was distributed randomly among three different samples of 50 participants each. The mean age of respondents in the three samples ranged between 36 and 39 years old. The majority was female in all samples, and Islam was the most prevalent religion among the respondents. The predominating race was Malay, followed by Chinese and Indian. The original six RSCs indicated better targeting of 0.99 and smallest model error of 0.24. The Infit Mnsq (mean square) and Zstd (Z standard) of the six RSCs were "1.1"and "-0.1"respectively. The six RSCs achieved the highest person and item reliabilities of 0.86 and 0.85 respectively. These reliabilities yielded the highest person (2.46) and item (2.38) separation indices compared to other the RSCs. The person and item reliability and, to a lesser extent, the fit statistics, were better with the six RSCs compared to the four and three RSCs.
Chen, Ling-Wei; Low, Yen Ling; Fok, Doris; Han, Wee Meng; Chong, Yap Seng; Gluckman, Peter; Godfrey, Keith; Kwek, Kenneth; Saw, Seang-Mei; Soh, Shu E; Tan, Kok Hian; Chong, Mary Foong Fong; van Dam, Rob M
2014-09-01
To examine changes in food consumption during pregnancy and the postpartum period in women of major Asian ethnic groups. Using interviewer-administered questionnaires, we assessed changes in food consumption during pregnancy (26-28 weeks' gestation) and the postpartum period (3 weeks after delivery) as compared with the usual pre-pregnancy diet. Singapore. Pregnant women (n 1027) of Chinese, Malay and Indian ethnicity (mean age 30·4 (SD 5·2) years) who participated in the Growing Up in Singapore Towards healthy Outcomes (GUSTO) study. During pregnancy, participants tended to increase their consumption of milk, fruit and vegetables and decrease their consumption of tea, coffee, soft drinks and seafood (all P postpartum period (Chinese: 94·8 %, Malay: 91·6 %, Indian: 79·6 %). During the postpartum period, participants tended to increase their consumption of fish and milk-based drinks and decrease their consumption of noodles, seafood, and chocolates and sweets (all P postpartum period. For example, most Chinese participants (87·2 %) increased their ginger consumption during the postpartum period as compared with smaller percentages of Malays (31·8 %) and Indians (40·8 %; P for ethnic difference postpartum period. Traditional beliefs should be considered in interventions to improve dietary intakes during these periods.
van Klinken, R D; Pichancourt, J B
2015-12-01
Long-lived plant species are highly valued environmentally, economically, and socially, but can also cause substantial harm as invaders. Realistic demographic predictions can guide management decisions, and are particularly valuable for long-lived species where population response times can be long. Long-lived species are also challenging, given population dynamics can be affected by factors as diverse as herbivory, climate, and dispersal. We developed a matrix model to evaluate the effects of herbivory by a leaf-feeding biological control agent released in Australia against a long-lived invasive shrub (mesquite, Leguminoseae: Prosopis spp.). The stage-structured, density-dependent model used an annual time step and 10 climatically diverse years of field data. Mesquite population demography is sensitive to source-sink dynamics as most seeds are consumed and redistributed spatially by livestock. In addition, individual mesquite plants, because they are long lived, experience natural climate variation that cycles over decadal scales, as well as anthropogenic climate change. The model therefore explicitly considered the effects of both net dispersal and climate variation. Herbivory strongly regulated mesquite populations through reduced growth and fertility, but additional mortality of older plants will be required to reach management goals within a reasonable time frame. Growth and survival of seeds and seedlings were correlated with daily soil moisture. As a result, population dynamics were sensitive to rainfall scenario, but population response times were typically slow (20-800 years to reach equilibrium or extinction) due to adult longevity. Equilibrium population densities were expected to remain 5% higher, and be more dynamic, if historical multi-decadal climate patterns persist, the effect being dampened by herbivory suppressing seed production irrespective of preceding rainfall. Dense infestations were unlikely to form under a drier climate, and required net
2015-05-21
suppression of the Malay insurgency, and the Indonesian counterinsurgency in East Timor. Despite the extensiveness of research on past...authorities embraced Central Asian customs in an attempt to build trust with the local population. In 1921, they undertook a wide-scale ethnographic
Bahri, Hossein; Mahadi, Tengku Sepora Tengku
2016-01-01
The present paper examines the use of Google Translate as a supplementary tool for helping international students at Universiti Sains Malaysia (USM) to learn and develop their knowledge and skills in learning Bahasa Malaysia (Malay Language). The participants of the study were 16 international students at the School of Languages, Literacies, and…
Ting, Su-Hie; Mahadhir, Mahanita
2009-01-01
This preliminary study examines the languages used by parents with their children in Malay, Chinese Foochow and Indian Tamil families to find out how the similarity or dissimilarity in parents' ethnic language influenced the choice of language transmitted to children and how far standard languages have permeated the family domain in Kuching City…
Rosdi, Rasmaizatul Akma; Mohd Yusoff, Narazah; Ismail, Rusli; Soo Choon, Tan; Saleem, Mohamed; Musa, Nurfadhlina; Yusoff, Surini
2016-09-01
CYP2C9 gene polymorphisms modulate inter-individual variations in the human body's responses to various endogenous and exogenous drug substrates. To date, little is known about the CYP2C9 gene polymorphisms among the aboriginal populations of the world, including those in Malaysia. To characterise and compare the CYP2C9 polymorphisms (CYP2C9*2, CYP2C9*3, CYP2C9*4 and CYP2C9*5) between one of Malaysia's aboriginal populations, Jahai, with the national major ethnic, Malay. To also compare the allele frequencies from these two populations with available data of other aboriginal populations around the world. The extracted DNA of 155 Jahais and 183 Malays was genotyped for CYP2C9 polymorphisms using a nested multiplex allele-specific polymerase chain reaction technique. The results were confirmed by DNA direct sequencing. Genotyping results revealed that CYP2C9*2, CYP2C9*4 and CYP2C9*5 were absent in Jahais, while only the latter two were absent in Malays. The CYP2C9*3 allelic frequency in Jahais was 36.2%, making them the most frequent carriers of the allele thus far reported in any ethnic group from Southeast Asia. The high frequency of CYP2C9*3 and the absence of CYP2C9*2 in Jahais suggest that genetic drift may be occurring in this ethnic group. This is the first study to determine the CYP2C9 polymorphisms in an aboriginal population in Malaysia.
Prevalence and factors associated with depressive symptoms in Malay women.
Din, Meriam Omar; Noor, Noraini M
2009-12-01
Due to a dearth of research on depressive symptoms in Malaysia, particularly in Malay women, a community study was conducted to examine the prevalence and factors associated with current depressive symptoms in rural and urban Malay women with low socioeconomic status. Four hundred eighty-seven women (N rural = 242, N urban = 245) were interviewed. Information on socio-demographic variables, potential risk factors (family history of mental health problems, lifetime major depressive symptoms, and current life stressors), and current depressive symptoms (measured by the Centre for Epidemiologic Studies Depression Scale, CES-D) was collected. The prevalence of current depressive symptoms (CES-D scores > or = 16) reported was 34.5%, while the prevalence of lifetime major depressive symptoms was 27.5%. A significantly higher rate of current depressive symptoms was observed in urban women compared to rural women, chi(2) (1, N = 487) = 3.99, p depressive symptoms. The results of the multiple hierarchical regression analysis indicated that three potential factors (family history of mental health problems, lifetime major depressive symptoms, and current life stressors) were positively associated with current depressive symptoms, accounting for 17.8% of the variance, over and above the socio-demographic variables. The prevalence of depressive symptoms reported in the study was comparable to past studies. Among the factors associated with current depressive symptoms, the single most important was lifetime major depressive symptoms, followed by current life stressors, and family history of mental health problems. Among the socio-demographic variables used, perceived health status was the most important. The factors associated with depressive symptoms found in this study are consistent with past findings in the West, implying the universality of the phenomenon and common factors related to depressive symptoms in women.
Mohamad Marzuki, Muhamad Fadhil; Yaacob, Nor Azwany; Yaacob, Najib Majdi
2018-05-14
A mobile app is a programmed system designed to be used by a target user on a mobile device. The usability of such a system refers not only to the extent to which product can be used to achieve the task that it was designed for, but also its effectiveness and efficiency, as well as user satisfaction. The System Usability Scale is one of the most commonly used questionnaires used to assess the usability of a system. The original 10-item version of System Usability Scale was developed in English and thus needs to be adapted into local languages to assess the usability of a mobile apps developed in other languages. The aim of this study is to translate and validate (with cross-cultural adaptation) the English System Usability Scale questionnaire into Malay, the main language spoken in Malaysia. The development of a translated version will allow the usability of mobile apps to be assessed in Malay. Forward and backward translation of the questionnaire was conducted by groups of Malay native speakers who spoke English as their second language. The final version was obtained after reconciliation and cross-cultural adaptation. The content of the Malay System Usability Scale questionnaire for mobile apps was validated by 10 experts in mobile app development. The efficacy of the questionnaire was further probed by testing the face validity on 10 mobile phone users, followed by reliability testing involving 54 mobile phone users. The content validity index was determined to be 0.91, indicating good relevancy of the 10 items used to assess the usability of a mobile app. Calculation of the face validity index resulted in a value of 0.94, therefore indicating that the questionnaire was easily understood by the users. Reliability testing showed a Cronbach alpha value of .85 (95% CI 0.79-0.91) indicating that the translated System Usability Scale questionnaire is a reliable tool for the assessment of usability of a mobile app. The Malay System Usability Scale questionnaire is a
Zourmand, Alireza; Ting, Hua-Nong; Mirhassani, Seyed Mostafa
2013-03-01
Speech is one of the prevalent communication mediums for humans. Identifying the gender of a child speaker based on his/her speech is crucial in telecommunication and speech therapy. This article investigates the use of fundamental and formant frequencies from sustained vowel phonation to distinguish the gender of Malay children aged between 7 and 12 years. The Euclidean minimum distance and multilayer perceptron were used to classify the gender of 360 Malay children based on different combinations of fundamental and formant frequencies (F0, F1, F2, and F3). The Euclidean minimum distance with normalized frequency data achieved a classification accuracy of 79.44%, which was higher than that of the nonnormalized frequency data. Age-dependent modeling was used to improve the accuracy of gender classification. The Euclidean distance method obtained 84.17% based on the optimal classification accuracy for all age groups. The accuracy was further increased to 99.81% using multilayer perceptron based on mel-frequency cepstral coefficients. Copyright © 2013 The Voice Foundation. Published by Mosby, Inc. All rights reserved.
Joseph, Cynthia
2006-01-01
This article uses the notion of resistance as an analytical tool, emphasizing its sociopolitical significance and multidimensionality, to understand the complex link between ways of being Malay, Chinese and Indian schoolgirls, schooling and the wider Malaysian society. The macro and micro dynamics of the Malaysian ethnoscape, namely the ethnic…
Chan, Mark Y; Shah, Bimal R; Gao, Fei; Sim, Ling Ling; Chua, Terrance; Tan, Huay Cheem; Yeo, Tiong Cheng; Ong, Hean Yee; Foo, David; Goh, Ping Ping; Surrun, Soondal K; Pieper, Karen S; Granger, Christopher B; Koh, Tian Hai; Salim, Agus; Tai, E Shyong
2011-08-01
Acute myocardial infarction (AMI) is a leading cause of mortality in Asia. However, quantitative risk scores to predict mortality after AMI were developed without the participation of Asian countries. We evaluated the performance of the Global Registry of Acute Coronary Events (GRACE) in-hospital mortality risk score, directly and after recalibration, in a large Singaporean cohort representing 3 major Asian ethnicities. The GRACE cohort included 11,389 patients, predominantly of European descent, hospitalized for AMI or unstable angina from 2002 to 2003. The Singapore cohort included 10,100 Chinese, 3,005 Malay, and 2,046 Indian patients hospitalized for AMI from 2002 to 2005.Using the original GRACE score, predicted in-hospital mortality was 2.4% (Chinese), 2.0% (Malay), and 1.6% (Indian). However, observed in-hospital mortality was much greater at 9.8% (Chinese), 7.6% (Malay), and 6.4% (Indian). The c statistic for Chinese, Malays, and Indians was 0.86, 0.86, and 0.84, respectively, and the Hosmer-Lemeshow statistic was 250, 56, and 41, respectively. Recalibration of the GRACE score, using the mean-centered constants derived from the Singapore cohort, did not change the c statistic but substantially improved the Hosmer-Lemeshow statistic to 90, 24, and 18, respectively. The recalibrated GRACE score predicted in-hospital mortality as follows: 7.7% (Chinese), 6.0% (Malay), and 5.2% (Indian). In this large cohort of 3 major Asian ethnicities, the original GRACE score, derived from populations outside Asia, underestimated in-hospital mortality after AMI. Recalibration improved risk estimation substantially and may help adapt externally developed risk scores for local practice. Copyright © 2011 Mosby, Inc. All rights reserved.
Validation of the Malay Version of the Inventory of Functional Status after Childbirth Questionnaire
Directory of Open Access Journals (Sweden)
Norhayati Mohd Noor
2015-01-01
Full Text Available Objective. This study was designed to examine the psychometric properties of Malay version of the Inventory of Functional Status after Childbirth (IFSAC. Design. A cross-sectional study. Materials and Methods. A total of 108 postpartum mothers attending Obstetrics and Gynaecology Clinic, in a tertiary teaching hospital in Malaysia, were involved. Construct validity and internal consistency were performed after the translation, content validity, and face validity process. The data were analyzed using Analysis of Moment Structure version 18 and Statistical Packages for the Social Sciences version 20. Results. The final model consists of four constructs, namely, infant care, personal care, household activities, and social and community activities, with 18 items demonstrating acceptable factor loadings, domain to domain correlation, and best fit (Chi-squared/degree of freedom = 1.678; Tucker-Lewis index = 0.923; comparative fit index = 0.936; and root mean square error of approximation = 0.080. Composite reliability and average variance extracted of the domains ranged from 0.659 to 0.921 and from 0.499 to 0.628, respectively. Conclusion. The study suggested that the four-factor model with 18 items of the Malay version of IFSAC was acceptable to be used to measure functional status after childbirth because it is valid, reliable, and simple.
Ahadnejad, Vahid; Hirt, Ann Marie; Valizadeh, Mohammad-Vali; Bokani, Saeed Jabbari
2011-04-01
The ammonium (NH4+) contents of the Malayer area (Western Iran) have been determined by using the colorimetric method on 26 samples from igneous and metamorphic rocks. This is the first analysis of the ammonium contents of Iranian metamorphic and igneous rocks. The average ammonium content of metamorphic rocks decreases from low-grade to high-grade metamorphic rocks (in ppm): slate 580, phyllite 515, andalusite schist 242. In the case of igneous rocks, it decreases from felsic to mafic igneous types (in ppm): granites 39, monzonite 20, diorite 17, gabbro 10. Altered granitic rocks show enrichment in NH4+ (mean 61 ppm). The high concentration of ammonium in Malayer granites may indicate metasedimentary rocks as protoliths rather than meta-igneous rocks. These granitic rocks (S-types) have high K-bearing rock-forming minerals such as biotite, muscovite and K-feldspar which their potassium could substitute with ammonium. In addition, the high ammonium content of metasediments is probably due to inheritance of nitrogen from organic matter in the original sediments. The hydrothermally altered samples of granitic rocks show highly enrichment of ammonium suggesting external sources which intruded additional content by either interaction with metasedimentary country rocks or meteoritic solutions.
MUHAMMAD, Noor Azimah; SHAMSUDDIN, Khadijah; OMAR, Khairani; SHAH, Shamsul Azhar; MOHD AMIN, Rahmah
2014-01-01
Background: Parenting behaviour is culturally sensitive. The aims of this study were (1) to translate the Parental Bonding Instrument into Malay (PBI-M) and (2) to determine its factorial structure and validity among the Malaysian population. Methods: The PBI-M was generated from a standard translation process and comprehension testing. The validation study of the PBI-M was administered to 248 college students aged 18 to 22 years. Results: Participants in the comprehension testing had difficulty understanding negative items. Five translated double negative items were replaced with five positive items with similar meanings. Exploratory factor analysis showed a three-factor model for the PBI-M with acceptable reliability. Four negative items (items 3, 4, 8, and 16) and item 19 were omitted from the final PBI-M list because of incorrect placement or low factor loading (overprotection factor. All the items loaded positively on their respective factors. Conclusion: The Malaysian population favoured positive items in answering questions. The PBI-M confirmed the three-factor model that consisted of care, autonomy and overprotection. The PBI-M is a valid and reliable instrument to assess the Malaysian parenting style. Confirmatory factor analysis may further support this finding. Keywords: Malaysia, parenting, questionnaire, validity PMID:25977634
Directory of Open Access Journals (Sweden)
Seng Liang
2010-01-01
Full Text Available Female breast cancer is one of the leading causes of female mortality worldwide. In Malaysia, breast cancer is the most commonly diagnosed cancer in women. Of the women in Malaysia, the Chinese have the highest number of breast cancer cases, followed by the Indian and the Malay. The most common type of breast cancer is infiltrating ductal carcinoma (IDC. A proteomic approach was applied in this study to identify changes in the protein profile of cancerous tissues compared with normal tissues from 18 patients; 8 Chinese, 6 Malay and 4 Indian were analysed. Twenty-four differentially expressed hydrophilic proteins were identified. We evaluated the potential of these proteins as biomarkers for infiltrating ductal carcinoma based on their ethnic-specific expressions. Three of the upregulated proteins, calreticulin, 14-3-3 protein zeta and 14-3-3 protein eta, were found to be expressed at a significantly higher level in the cancerous breast tissues when compared with the normal tissues in cases of infiltrating ductal carcinoma. The upregulation in expression was particularly dominant in the Malay cohort.
RELIGION, CULTURE AND LOCAL WISDOM IN THE DEATH RITUAL OF PONTIANAK MALAY SOCIETY
Directory of Open Access Journals (Sweden)
Sumarman Muhammad Djar’ie
2016-02-01
Full Text Available Death is inevitable and will occur to every living creature, including humans no mater what religion or belief they have; however, no one knows for sure when it happens. Humans can only predict death based on indicators that can be seen before it occurs. Still until now, there are many people who attempt to oppose death, even though in the end they have to admit that Allah is the Almighty. Therefore, no wonder if the death is still considered a tragedy rather than the culmination of happiness when humans finally harvest of deeds they have done all their life. In this light, death rituals are often accompanied by the tears of the family of the deceased, even some cry hard to express their pain as someone they love is gone, coupled with the arrival of relatives and acquaintances who mourn, and condolences as well as the phrase “inna lillâh wa inna ilaihi raji’ȗn”. A day of joy has turned into a day of sorrow, although it always ends with kendurian (gathering for remembering the dead, whose excitement is like that of selamatan (communal feast and syukuran (celebration of thankfulness. This paper tries to present the infiltration of religion and culture in the death ritual in Pontianak Malay community as an object of discussion of local wisdom by using mafhȗm mukhâlafah approach, to provide a new understanding of the meaning of death.
Saravanan, Vanithamani
2001-01-01
Surveyed groups of Chinese, Malay and Tamil families, their use of community languages or mother tongue, and their speaking, reading, and writing proficiency. Found that when parents' community language proficiency in speaking is lower they tend to choose English as preferred language. Children's language confidence affected their language choice.…
Directory of Open Access Journals (Sweden)
Shahar S
2013-10-01
Full Text Available Suzana Shahar,1 Norshafarina Shari Kamaruddin,2 Manal Badrasawi,1 Noor Ibrahim Mohamed Sakian,3 Zahara Abd Manaf,1 Zaitun Yassin,4 Leonard Joseph51Dietetic Programme, 2Biomedical Programme, 3Occupational Therapy Programme, School of Healthcare Sciences, Universiti Kebangsaan Malaysia, Jalan Raja Muda Abdul Aziz, Kuala Lumpur, 4Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Serdang, Selangor, 5Department of Physiotherapy, School of Healthcare Sciences, Universiti Kebangsaan Malaysia, Jalan Raja Muda Abdul Aziz, Kuala Lumpur, MalaysiaAbstract: Sarcopenia, characterized as muscle loss that occurs with aging, is a major health problem in an aging population, due to its implications on mobility, quality of life, and fall risk. Protein supplementation could improve the physical fitness by increasing protein anabolism, and exercise has a documented evidence of positive effect on functional status among the elderly. However, the combined effect of both protein supplementation and exercise has not been investigated among sarcopenic elderly in the Asian population. Thus, this study aimed to determine the effectiveness of exercise intervention and protein supplementation either alone or in combination for 12 weeks, on body composition, functional fitness, and oxidative stress among elderly Malays with sarcopenia. Sixty five sarcopenic elderly Malays aged 60-74 years were assigned to the control group, exercise group (ExG, protein supplementation group (PrG, or the combination of exercise and protein supplementation group. A significant interaction effect between body weight and body mass index (BMI was observed, with the PrG (-2.1% body weight, -1.8% BMI showing the highest reductions. Further, there was a decrease in % body fat (-4.5% and an increase in fat-free mass (kg (+5.7% in the ExG after 12 weeks (P < 0.05. The highest increments in lower and upper body strength were observed in the Pr
Petroleum systems of the Malay Basin Province, Malaysia
Bishop, Michele G.
2002-01-01
The offshore Malay Basin province is a Tertiary oil and gas province composed of a complex of half grabens that were filled by lacustrine shales and continental clastics.These deposits were overlain by clastics of a large delta system that covered the basin.Delta progradation was interupted by transgressions of the South China Sea to the southeast, which finally flooded the basin to form the Gulf of Thailand.Oil and gas from the Oligocene to Miocene lacustrine shales and Miocene deltaic coals is trapped primarily in anticlines formed by inversion of the half grabens during the late Miocene.Hydrocarbon reserves that have been discovered amount to 12 billion barrels of oil equivalent.The U.S. Geological Survey assessment of the estimated quantities of conventional oil, gas and condensate that have the potential to be added to reserves by the year 2025 for this province is 6.3 billion barrels of oil equivalent (BBOE) (U. S. Geological Survey World Energy Assessment Team, 2000).
Explosions in Semarang: Reading Malay tales in 1895
Directory of Open Access Journals (Sweden)
Henk Maier
2008-12-01
Full Text Available On the morning of 12 December 1895, a well-dressed young man enters the railway station in the city of Semarang. He purchases a ticket, walks around on the platform, and then gets on the train to Solo, ready for departure. Once the machine starts moving, the man looks out of the window, visibly confused. He turns to his fellow passengers, many of them unknown to him. In Malay, the language of travellers, he exchanges information, tells and hears stories, discusses issues of daily life, of himself, of the people who, out in the rice fields, on the roads, in the plantations, are staring at the roaring machine passing by. Now and then the man looks into his own heart again, losing himself in empty thoughts. And with every tick of his watch the landscape out there changes its appearance. And farmers and labourers stop their work, distracted by the awesome noise of the iron monster.
Child Care Services in Malaysia
Pheng, Liew Sau
2007-01-01
Malaysia is a multi-ethnic, multi-racial, and multi-religious country with a population of more than 25 million people who live in the Peninsular and the States of Sabah and Sarawak on Borneo Island. It is a harmonious and peaceful nation comprised of Malays, who are the ethnic majority, followed by Chinese, Indians, Ibans, Kadazandusuns, and…
Saw, Woei-Yuh; Tantoso, Erwin; Begum, Husna; Zhou, Lihan; Zou, Ruiyang; He, Cheng; Chan, Sze Ling; Tan, Linda Wei-Lin; Wong, Lai-Ping; Xu, Wenting; Moong, Don Kyin Nwe; Lim, Yenly; Li, Bowen; Pillai, Nisha Esakimuthu; Peterson, Trevor A; Bielawny, Tomasz; Meikle, Peter J; Mundra, Piyushkumar A; Lim, Wei-Yen; Luo, Ma; Chia, Kee-Seng; Ong, Rick Twee-Hee; Brunham, Liam R; Khor, Chiea-Chuen; Too, Heng Phon; Soong, Richie; Wenk, Markus R; Little, Peter; Teo, Yik-Ying
2017-09-21
The Singapore Integrative Omics Study provides valuable insights on establishing population reference measurement in 364 Chinese, Malay, and Indian individuals. These measurements include > 2.5 millions genetic variants, 21,649 transcripts expression, 282 lipid species quantification, and 284 clinical, lifestyle, and dietary variables. This concept paper introduces the depth of the data resource, and investigates the extent of ethnic variation at these omics and non-omics biomarkers. It is evident that there are specific biomarkers in each of these platforms to differentiate between the ethnicities, and intra-population analyses suggest that Chinese and Indians are the most biologically homogeneous and heterogeneous, respectively, of the three groups. Consistent patterns of correlations between lipid species also suggest the possibility of lipid tagging to simplify future lipidomics assays. The Singapore Integrative Omics Study is expected to allow the characterization of intra-omic and inter-omic correlations within and across all three ethnic groups through a systems biology approach.The Singapore Genome Variation projects characterized the genetics of Singapore's Chinese, Malay, and Indian populations. The Singapore Integrative Omics Study introduced here goes further in providing multi-omic measurements in individuals from these populations, including genetic, transcriptome, lipidome, and lifestyle data, and will facilitate the study of common diseases in Asian communities.
Model of external exposure of population living in the areas subjected to radioactive contamination
International Nuclear Information System (INIS)
Golikov, V.Yu.; Balonov, M.I.
2002-01-01
In the paper, we formulated the general approach to assessment of external doses to population living in contaminated areas (the model equation and the set of parameters). The model parameters were assessed on the basis of results of monitoring in the environment, phantom experiments, and social and demographic information obtained on the contaminated areas. Verification of model assessments performed by comparison with measurement results of individual external doses in inhabitants within the thermoluminescent dosimetry method have shown that differences in dose assessments within both methods does not exceed 1.5 times at a confidence level of 95%. In the paper, we present the results illustrating specific features of external dose formation in population living in the areas of Russia subjected to radioactive contamination due to nuclear tests at the Semipalatinsk test site, radioactive releases from the Mayak enterprise, and the Chernobyl accident. (author)
Anuar, Tengku Shahrul; Ghani, Mohamed Kamel Abdul; Azreen, Siti Nor; Salleh, Fatmah Md; Moktar, Norhayati
2013-02-22
Blastocystis has been described as the most common intestinal parasite in humans and has an increased impact on public health. However, the transmission of this parasite has not been conclusively determined. To contribute to a better comprehension of the epidemiology of this infection, a cross-sectional survey aimed at providing the first documented data on the prevalence and risk factors associated with Blastocystis infection was carried out among three Orang Asli tribes (Proto-Malay, Negrito and Senoi) in selected villages at Negeri Sembilan, Perak and Pahang, Peninsular Malaysia. Faecal samples were examined by formalin-ether sedimentation and trichrome staining techniques. Of 500 individuals, 20.4% (102) were detected positive for Blastocystis; 13.3% (20/150) of Proto-Malays, 21.6% (30/139) of Negritos and 24.7% (52/211) of Senois were positive for Blastocystis, respectively. The positive cases showed a decrease with increasing age and most of the positive cases were observed in individuals less than 15 years old. Multivariate analysis confirmed that drinking untreated water and the presence of other family members infected with Blastocystis were significant risk factors of infection among the three tribes and overall population studied. Essentially, the findings highlighted that Blastocystis infection is prevalent among Orang Asli communities in Malaysia. Further studies using molecular approaches to distinguish the subtype of Blastocystis is needed. The present study also revealed that this infection may be transmitted through waterborne and human-to-human contact. Therefore, interventions with the provision of clean water supply for the communities and health education especially to the parents are urgently required.
DEFF Research Database (Denmark)
Fyhn, Michael B.W.; Boldreel, Lars Ole; Nielsen, Lars H
2010-01-01
The Malay Basin represents one of the largest rift basins of SE Asia. Based on a comprehensive 2-D seismic database tied to wells covering mainly Vietnamese acreage, the evolution of the Vietnamese part of the basin is outlined and a new tectonic model is proposed for the development of the basin....... The Vietnamese part of the Malay Basin comprises a large and deep Paleogene pull-apart basin formed through Middle or Late Eocene to Oligocene left-lateral strike-slip along NNW-trending fault zones. The Tho Chu Fault Zone constitutes a significant Paleogene left-lateral strike-slip zone most likely associated......–Strending faults in the central part of the basin. However, the lack of inversion in Vietnamese territory only seems to merit a few kilometers of dextral inversion....
Risk of adverse birth outcomes in populations living near landfill sites
Elliott, Paul; Briggs, David; Morris, Sara; de Hoogh, Cornelis; Hurt, Christopher; Jensen, Tina Kold; Maitland, Ian; Richardson, Sylvia; Wakefield, Jon; Jarup, Lars
2001-01-01
Objective To investigate the risk of adverse birth outcomes associated with residence near landfill sites in Great Britain. Design Geographical study of risks of adverse birth outcomes in populations living within 2 km of 9565 landfill sites operational at some time between 1982 and 1997 (from a total of 19 196 sites) compared with those living further away. Setting Great Britain. Subjects Over 8.2 million live births, 43 471 stillbirths, and 124 597 congenital anomalies (including terminations). Main outcome measures All congenital anomalies combined, some specific anomalies, and prevalence of low and very low birth weight (<2500 g and <1500 g). Results For all anomalies combined, relative risk of residence near landfill sites (all waste types) was 0.92 (99% confidence interval 0.907 to 0.923) unadjusted, and 1.01 (1.005 to 1.023) adjusted for confounders. Adjusted risks were 1.05 (1.01 to 1.10) for neural tube defects, 0.96 (0.93 to 0.99) for cardiovascular defects, 1.07 (1.04 to 1.10) for hypospadias and epispadias (with no excess of surgical correction), 1.08 (1.01 to 1.15) for abdominal wall defects, 1.19 (1.05 to 1.34) for surgical correction of gastroschisis and exomphalos, and 1.05 (1.047 to 1.055) and 1.04 (1.03 to 1.05) for low and very low birth weight respectively. There was no excess risk of stillbirth. Findings for special (hazardous) waste sites did not differ systematically from those for non-special sites. For some specific anomalies, higher risks were found in the period before opening compared with after opening of a landfill site, especially hospital admissions for abdominal wall defects. Conclusions We found small excess risks of congenital anomalies and low and very low birth weight in populations living near landfill sites. No causal mechanisms are available to explain these findings, and alternative explanations include data artefacts and residual confounding. Further studies are needed to help differentiate between the various
Population Pressure, Global Living Standards, and the Promise of Space Solar Power
Strickland, John K., Jr.
2002-01-01
What many sincere environmentalists advocate: (severe restrictions on energy use, to reduce global warming), may actually end up being very harmful to the environment. Since 85 percent of the global energy use is derived from carbon based fossil fuels, this may seem to be a reasonable position. However, the proponents of energy use restrictions are ignoring some very important relationships. The greatest damage to the environment, in terms of species loss, is loss and/or human modification of habitat. The two greatest threats to habitat seem to be (1) population pressure and (2) logging. Logging does not necessarily permanently occupy the land, while either default squatter occupation or "colonization by policy" is often permanent. Increased population degrades the land by causing over- farming, and also creates an ever greater demand for raw materials and food resources. Poor people have no time nor money to think about or help save the environment. Therefore the greatest threat to species survival is human population growth and its frequent companion: poverty. There is an existing way to reduce population growth, and thus to reduce pressure on habitats, called "raising the standard of living". Wherever it succeeds, population growth slows rapidly. In many European countries, there would be a negative population growth if not for immigration. Personal energy use is closely correlated with living standards, and it is impossible to have a higher living standard without a higher degree of personal energy use. It would seem, however, that extending high living standards to the developing world would create an even greater demand for the use of fossil fuels. The solution to this dilemma can only be found in the use of very high capacity sources of non- fossil energy that do not significantly damage the environment. Are there sources of clean, economical energy with a large enough combined capacity to provide high living standards for the whole world, including those
Toward objective monitoring of ingestive behavior in free-living population.
Sazonov, Edward S; Schuckers, Stephanie A C; Lopez-Meyer, Paulo; Makeyev, Oleksandr; Melanson, Edward L; Neuman, Michael R; Hill, James O
2009-10-01
Understanding of eating behaviors associated with obesity requires objective and accurate monitoring of food intake patterns. Accurate methods are available for measuring total energy expenditure and its components in free-living populations, but methods for measuring food intake in free-living people are far less accurate and involve self-reporting or subjective monitoring. We suggest that chews and swallows can be used for objective monitoring of ingestive behavior. This hypothesis was verified in a human study involving 20 subjects. Chews and swallows were captured during periods of quiet resting, talking, and meals of varying size. The counts of chews and swallows along with other derived metrics were used to build prediction models for detection of food intake, differentiation between liquids and solids, and for estimation of the mass of ingested food. The proposed prediction models were able to detect periods of food intake with >95% accuracy and a fine time resolution of 30 s, differentiate solid foods from liquids with >91% accuracy, and predict mass of ingested food with >91% accuracy for solids and >83% accuracy for liquids. In earlier publications, we have shown that chews and swallows can be captured by noninvasive sensors that could be developed into a wearable device. Thus, the proposed methodology could lead to the development of an innovative new way of assessing human eating behavior in free-living conditions.
Chew, Boon-How; Vos, Rimke C; Heijmans, Monique; Shariff-Ghazali, Sazlina; Fernandez, Aaron; Rutten, Guy E H M
2017-08-03
Illness perceptions involve the personal beliefs that patients have about their illness and may influence health behaviours considerably. Since an instrument to measure these perceptions for Malay population in Malaysia is lacking, we translated and examined the psychometric properties of the Malay version of the Brief Illness Perception Questionnaire (MBIPQ) in adult patients with type 2 diabetes mellitus. The MBIPQ has nine items, all use a 0-10 response scale, except the ninth item about causal factors, which is an open-ended item. A standard procedure was used to translate and adapt the English BIPQ into Malay language. Construct validity was examined comparing item scores and scores on the Diabetes Management Self-Efficacy Scale, the Morisky Medication Adherence Scale, the World Health Organization Quality of Life-brief, the 9-item Patient Health Questionnaire, the 17-item Diabetes Distress Scale, HbA1c and the presence of complications. In addition, 2-week and 4-week test-retest reliability were studied. A total of 312 patients completed the MBIPQ. Out of this, 97 and 215 patients completed the 2- or 4-weeks test-retest reliability questionnaire, respectively. Moderate inter-items correlations were observed between illness perception dimensions (r = -0.31 to 0.53). MBIPQ items showed the expected correlations with self-efficacy (r = 0.35), medication adherence (r = 0.29), quality of life (r = -0.17 to 0.31) and depressive symptoms (r = -0.18 to 0.21). People with severe diabetes-related distress also were more concern (t-test = 4.01, p personal control (t-test = 2.07, p = 0.031). People with any diabetes-related complication perceived the consequences as more serious (t-test = 2.04, p = 0.044). The 2-week and 4-week test-retest reliabilities varied between ICC agreement 0.39 to 0.70 and 0.58 to 0.78, respectively. The psychometric properties of items in the MBIPQ are moderate. The MBIPQ showed good cross-cultural validity and moderate
Directory of Open Access Journals (Sweden)
Boon-How Chew
2017-08-01
Full Text Available Abstract Background Illness perceptions involve the personal beliefs that patients have about their illness and may influence health behaviours considerably. Since an instrument to measure these perceptions for Malay population in Malaysia is lacking, we translated and examined the psychometric properties of the Malay version of the Brief Illness Perception Questionnaire (MBIPQ in adult patients with type 2 diabetes mellitus. Methods The MBIPQ has nine items, all use a 0–10 response scale, except the ninth item about causal factors, which is an open-ended item. A standard procedure was used to translate and adapt the English BIPQ into Malay language. Construct validity was examined comparing item scores and scores on the Diabetes Management Self-Efficacy Scale, the Morisky Medication Adherence Scale, the World Health Organization Quality of Life-brief, the 9-item Patient Health Questionnaire, the 17-item Diabetes Distress Scale, HbA1c and the presence of complications. In addition, 2-week and 4-week test-retest reliability were studied. Results A total of 312 patients completed the MBIPQ. Out of this, 97 and 215 patients completed the 2- or 4-weeks test-retest reliability questionnaire, respectively. Moderate inter-items correlations were observed between illness perception dimensions (r = −0.31 to 0.53. MBIPQ items showed the expected correlations with self-efficacy (r = 0.35, medication adherence (r = 0.29, quality of life (r = −0.17 to 0.31 and depressive symptoms (r = −0.18 to 0.21. People with severe diabetes-related distress also were more concern (t-test = 4.01, p < 0.001 and experienced lower personal control (t-test = 2.07, p = 0.031. People with any diabetes-related complication perceived the consequences as more serious (t-test = 2.04, p = 0.044. The 2-week and 4-week test-retest reliabilities varied between ICCagreement 0.39 to 0.70 and 0.58 to 0.78, respectively. Conclusions The psychometric properties
Directory of Open Access Journals (Sweden)
Dewi Evie Ariadne Shinta
2017-01-01
Full Text Available This paper tries to extent a personal experience on an interesting discussion concerning the communication issues in Medan, North Sumatra. There is the inclination of the North Sumatrans to the news broadcasted by Kuala Lumpur and Medan’s tends to identify with its cultural similarities. For Jakarta is officially the center of political authority over the ‘Indonesian Malay Communities’, this dual cultural loyalty creates an imaginary phenomenon: ‘Two Suns’ in term of authoritative news resources that applies upon ‘One Firmament Culture’. This means that there is a divided news orientation among the Indonesian Malay Communities’ that put Jakarta and Kuala Lumpur in a tacit contestation. While until today this kind of contestation is still going on, the same features have brought me to the phenomenon of hierarchical communication structure. This vividly seen when we realize how lopsided is in nature the communication relations between the global authorities who have controlled the strategic means of communications as well as their contents with the rest of the world. For, in exception to technological matters, the Kuala Lumpurinclined of ‘the Indonesian Malay Communities’ in communication practices is based more on cultural aspects than their technical and political necessities words.
Simulation of Past Life: Controlling Agent Behaviors from the Interactions between Ethnic Groups
Lim , Chen-Kim; Cani , Marie-Paule; Galvane , Quentin; Pettré , Julien; Abdullah Zawawi , Talib
2013-01-01
International audience; Many efforts have been carried out in preserving the history and culture of Penang and also other regions of Malaysia since George Town was elected as a UNESCO living heritage city. This paper presents a method to simulate life in a local trading port in the 1800s, where various populations with very different social rules interacted with each other. These populations included Indian coolies, Malay vendors, British colonists and Chinese traders. The challenge is to mod...
Directory of Open Access Journals (Sweden)
Ali Almasi
2016-07-01
Full Text Available Hygiene disregarding and usage of contaminated tools leads to viral infections, fungal, bacterial and skin diseases, eczema, warts, tetanus and so on. Thus assessment of knowledge, attitudes and performance of barbers in order to ensure the security and public health is really necessary. This study is aimed at determining the knowledge, attitude and performance of female barbers in relation to job's environmental health in Malayer city. In present descriptive- analytical study, 75 female barbers sampling of Malayer city were selected by clusters – systematic method. The data were obtained through questionnaires for completion and checklist. Data analysis was performed using SPSS 21 statistical software. The result showed, 86.66% of people have attained correct awareness of regulations and 92.28% had positive attitude toward regulations and 86.38% of people in this study showed appropriate health practice. In order to, compare the average knowledge level in regard to parameters such as age, work experiences and income situation showed a statistically significant difference. In attitude and performance section, the difference between age and mentioned parameters was not statistically significant (P≥ 0.05. Despite the desirable level of knowledge, attitude and practice of barbers female in Malayer city, in order to improve the situation, to be better the presence of barbers in special guilds courses to train seriously.
Deurenberg-Yap, M.; Schmidt, G.; Staveren, van W.A.; Deurenberg, P.
2000-01-01
To study the relationship between body fat percentage and body mass index (BMI) in three different ethnic groups in Singapore (Chinese, Malays and Indians) in order to evaluate the validity of the BMI cut-off points for obesity. DESIGN: Cross-sectional study. SUBJECTS: Two-hundred and ninety-one
Aguilera, Inmaculada; Daponte, Antonio; Gil, Fernando; Hernández, Antonio F; Godoy, Patricia; Pla, Antonio; Ramos, Juan Luis
2008-12-15
The Ria of Huelva (south-west Spain) is one of the most polluted fluvial-estuarine systems in the world. Industrial activity delivers huge amounts of pollutants to the local environment, particularly heavy metals and arsenic. Here we aimed to determine urinary levels of As, Cd, Cr, Cu and Ni in a representative sample (n=857) of adults living in the Ria of Huelva. Levels were compared to those from a representative sample of 861 adults of the general urban population of Andalusia (southern Spain) and multiple regression models were developed to identify individual factors associated with urinary levels of these elements. Arsenic levels were significantly higher in the Ria of Huelva as compared to other Andalusian cities, whereas Cd and Ni levels were significantly lower. Despite these differences, levels in both groups were similar to the reference values reported in previous studies for general population. Age, gender, diet and lifestyle were the major factors contributing to the interindividual variation in urinary metals. In conclusion, despite living in a highly polluted area, the population of the Ria of Huelva failed to show higher urinary levels of the studied metals as compared to a reference urban population of the same region.
ISLAMIC ELEMENTS IN TRADITIONAL INDONESIAN AND MALAY THEATRE
Directory of Open Access Journals (Sweden)
Ghulam-Sarwar Yousof
2010-01-01
Full Text Available From the earliest times, traditional theatre in Southeast Asia has been shaped by a wide range of religious and cultural influences—those deriving from animism, Hinduism, Buddhism, Islam, as well as from Chinese and western traditions. The overwhelming influences, especially of Hinduism, have had the tendency to obscure contributions from the Middle- and Near-East. The view that Islam, with rare exceptions, prohibits performing arts has resulted in a negligence of these arts forms in Muslim societies with the possible exception of Indonesia. This paper highlights significant elements of Islamic culture that have shaped Indonesian and Malay traditional theatre through the adaptation of borrowed genres such as taziya, as well as locally created styles of shadow play (wayang kulit and the doll-puppet theatre (wayang golek; the use of important themes from Islamic literature, in particular thosederived from Hikayat Amir Hamza; as well as esoteric interpretationsof certain episodes originally derived from pre-Islamic sources,including the Mahabharata, in terms of Sufism to make them both highly meaningful and acceptable to Muslim audiences.
Directory of Open Access Journals (Sweden)
Polyana Campos Nunes
Full Text Available The purpose of this study was to evaluate the physico-chemical characteristics, bioactive compounds and antioxidant activity of Malay apple fruit (Syzygium malaccense grown in Brazil with regard to the geographical origin and its peel fractions and edible portion analyzed independently. Fruit diameter, weight, yield, and centesimal composition, ascorbic acid, reductive sugars, total soluble solids, pH and fiber content were determined. Total phenolics (1293 mg gallic acid equivalent/100 g and total anthocyanins (1045 mg/100 g contents were higher in the peel, with the major anthocyanin identified using HPLC-DAD-MS/MS as cyanidin 3-glucoside. Higher values for DPPH antiradical scavenging activity (47.52 μMol trolox equivalent antioxidant capacity/g and Ferric Reducing Antioxidant Potential (FRAP, 0.19 mM ferreous sulfate/g were also observed in the peel fraction. All extracts tested showed the ability to inhibit oxidation in the β-carotene/linoleic acid system. This study highlights the potential of Malay apple fruit as a good source of antioxidant compounds with potential benefits to human health.
Directory of Open Access Journals (Sweden)
I. G. Travnikova
2014-01-01
Full Text Available During the years passed after the Chernobyl accident we are carrying out monitoring of the radiation situation in the Sough-Western territories of the Bryansk region, contaminated with the long-living radionuclides which includes 137Сs concentration measurements in agricultural and natural foodstuffs, surveys of local populations on the structure and composition of the diet accompanied with 137Сs content measurements in the human body. In the article the obtained data is systematized on the food rations of the adult population of theBryansk region, on food rations dynamics in the first and following years after the accident, which is necessary for the correct estimation of internal exposure doses of the population living on the contaminated territories.
Moy, Foong-Ming; Bulgiba, Awang
2011-09-27
Vitamin D status, as indicated by 25-hydroxyvitamin D is inversely associated with adiposity, glucose homeostasis, lipid profiles, and blood pressure along with its classic role in calcium homeostasis and bone metabolism. It is also shown to be inversely associated with metabolic syndrome and cardiovascular diseases in western populations. However, evidence from the Asian population is limited. Therefore, we aim to study the prevalence of vitamin D insufficiency (obesity, HDL-cholesterol, diastolic blood pressure), insufficient Vitamin D status was significantly associated with 1-year age increments (OR: 0.93; 95% CI: 0.88, 0.98), being female (OR: 8.68; 95% CI: 5.08, 14.83) and abdominal obesity (OR: 2.57; 95% CI: 1.51, 4.39). Respondents with insufficient vitamin D were found to have higher odds of having Metabolic Syndrome (OR: 1.73; 95% CI: 1.02, 2.92) after adjusting for age and sex. Our results highlight the high prevalence of vitamin D insufficiency among Malay adults in Kuala Lumpur. Vitamin D insufficiency is independently associated with younger age, female sex and greater abdominal obesity. Vitamin D insufficiency is also associated with Metabolic Syndrome.
De Vries, Lourens
The topic of this article is the Malay gospel of Mark of 1629-1630 that was recently discovered in the library of Lincoln Cathedral in England, a gospel translated by Albert Corneliszoon Ruyl, employee of the voc. Ruyl's gospels of Matthew and Mark are the earliest attested Bible translations in
A Clinical Prediction Model for Postcardiac Surgery Atrial Fibrillation in an Asian Population.
Zhang, Wei; Liu, Weiling; Chew, Sophia T H; Shen, Liang; Ti, Lian Kah
2016-08-01
Postoperative atrial fibrillation (AF) is associated with increased morbidity, mortality, and resource utilization. Current prediction models for postoperative AF are based primarily on Western populations. In this study, we sought to develop a clinical prediction rule for postcardiac surgery AF for a multiethnic Asian population. Two thousand one hundred sixty-eight patients undergoing coronary artery bypass graft or valve surgery with cardiopulmonary bypass were prospectively enrolled in this observational study between August 2008 and July 2012 at Singapore's 2 national heart centers. Postoperative AF was defined as an irregularly irregular electrocardiogram rhythm without identifiable P wave after surgery and before hospital discharge that lasted more than an hour, or affected hemodynamics (ie, systolic blood pressure 120 minutes (OR, 1.92; 95% CI, 1.47-2.52, P Chinese ethnicity (Chinese versus Indian OR, 2.09; 95% CI, 1.28-3.41, P = 0.003) or Malay (Malay versus Indian OR, 2.43; 95% CI, 1.36-4.05, P = 0.002) to be independently associated with postoperative AF. The area under the receiver-operator characteristic curve of the model was 0.704 (95% CI, 0.674-0.734). Internal validation produced an area under the receiver-operator characteristic curve of 0.756 (95% CI, 0.690-0.821). Clinical risk factors for AF after cardiac surgery in an Asian population are similar to that reported from primarily Western populations, but specific ethnicity influences susceptibility.
Zourmand, Alireza; Mirhassani, Seyed Mostafa; Ting, Hua-Nong; Bux, Shaik Ismail; Ng, Kwan Hoong; Bilgen, Mehmet; Jalaludin, Mohd Amin
2014-07-25
The phonetic properties of six Malay vowels are investigated using magnetic resonance imaging (MRI) to visualize the vocal tract in order to obtain dynamic articulatory parameters during speech production. To resolve image blurring due to the tongue movement during the scanning process, a method based on active contour extraction is used to track tongue contours. The proposed method efficiently tracks tongue contours despite the partial blurring of MRI images. Consequently, the articulatory parameters that are effectively measured as tongue movement is observed, and the specific shape of the tongue and its position for all six uttered Malay vowels are determined.Speech rehabilitation procedure demands some kind of visual perceivable prototype of speech articulation. To investigate the validity of the measured articulatory parameters based on acoustic theory of speech production, an acoustic analysis based on the uttered vowels by subjects has been performed. As the acoustic speech and articulatory parameters of uttered speech were examined, a correlation between formant frequencies and articulatory parameters was observed. The experiments reported a positive correlation between the constriction location of the tongue body and the first formant frequency, as well as a negative correlation between the constriction location of the tongue tip and the second formant frequency. The results demonstrate that the proposed method is an effective tool for the dynamic study of speech production.
Khoo, Suan-Phaik; Yap, Adrian U Jin; Chan, Yiong Huak; Bulgiba, Awang M
2008-01-01
To develop a Malay-language version of the Axis II Research Diagnostic Criteria for Temporomandibular Disorders (RDC/TMD) through a formal translation/back-translation process and to summarize available data about the psychometric properties of the translated scales. To cross-culturally adapt the instrument, the RDC/TMD underwent translation using a forward-backward method. Subjects were recruited to test the congruency between translated and original versions of the RDC/TMD. The psychometric properties of 3 domains (Graded Chronic Pain Scale, Nonspecific Physical Symptoms, and Depression) of the RDC/TMD were examined, and the literature on this topic was reviewed. All the items scored 93% to 100% congruency. Cronbach's alphas for Graded Chronic Pain Scale, Nonspecific Physical Symptoms, and Depression were 0.77, 0.71, and 0.88, respectively (n = 40). The test-retest reliability of scores (intraclass correlation coefficient [ICC]) and levels (Spearman's rho) for these domains showed ICCs of 0.97, 0.94, and 0.95, respectively, with a lowest ICC value of 0.84 (n = 40); the Spearman's rho values were 0.93, 0.74, and 0.74, respectively. The discriminant validity between patients with pain symptoms (n = 40) and normal pain-free controls (n = 40) were statistically significant (P cultural adaptation of the RDC/TMD into the Malay language is suitable for use in Malaysia.
[Health risks in different living circumstances of mothers. Analyses based on a population study].
Sperlich, Stefanie
2014-12-01
The objective of this study was to determine the living circumstances ('Lebenslagen') in mothers which are associated with elevated health risks. Data were derived from a cross-sectional population based sample of German women (n = 3129) with underage children. By means of a two-step cluster analysis ten different maternal living circumstances were assessed which proved to be distinct with respect to indicators of socioeconomic position, employment status and family-related factors. Out of the ten living circumstances, one could be attributed to higher socioeconomic status (SES), while five were assigned to a middle SES and four to a lower SES. In line with previous findings, mothers with a high SES predominantly showed the best health while mothers with a low SES tended to be at higher health risk with respect to subjective health, mental health (anxiety and depression), obesity and smoking. However, there were important health differences between the different living circumstances within the middle and lower SES. In addition, varying health risks were found among different living circumstances of single mothers, pointing to the significance of family and job-related living conditions in establishing health risks. With this exploratory analysis strategy small-scale living conditions could be detected which were associated with specific health risks. This approach seemed particularly suitable to provide a more precise definition of target groups for health promotion. The findings encourage a more exrensive application of the concept of living conditions in medical sociology research as well as health monitoring.
Nguyen, Vy X; Detcharoen, Matsapume; Tuntiprapas, Piyalap; Soe-Htun, U; Sidik, Japar B; Harah, Muta Z; Prathep, Anchana; Papenbrock, Jutta
2014-04-30
The Indo-Pacific region has the largest number of seagrass species worldwide and this region is considered as the origin of the Hydrocharitaceae. Halophila ovalis and its closely-related species belonging to the Hydrocharitaceae are well-known as a complex taxonomic challenge mainly due to their high morphological plasticity. The relationship of genetic differentiation and geographic barriers of H. ovalis radiation was not much studied in this region. Are there misidentifications between H. ovalis and its closely related species? Does any taxonomic uncertainty among different populations of H. ovalis persist? Is there any genetic differentiation among populations in the Western Pacific and the Eastern Indian Ocean, which are separated by the Thai-Malay peninsula? Genetic markers can be used to characterize and identify individuals or species and will be used to answer these questions. Phylogenetic analyses of the nuclear ribosomal internal transcribed spacer region based on materials collected from 17 populations in the Western Pacific and the Eastern Indian Ocean showed that some specimens identified as H. ovalis belonged to the H. major clade, also supported by morphological data. Evolutionary divergence between the two clades is between 0.033 and 0.038, much higher than the evolutionary divergence among H. ovalis populations. Eight haplotypes were found; none of the haplotypes from the Western Pacific is found in India and vice versa. Analysis of genetic diversity based on microsatellite analysis revealed that the genetic diversity in the Western Pacific is higher than in the Eastern Indian Ocean. The unrooted neighbor-joining tree among 14 populations from the Western Pacific and the Eastern Indian Ocean showed six groups. The Mantel test results revealed a significant correlation between genetic and geographic distances among populations. Results from band-based and allele frequency-based approaches from Amplified Fragment Length Polymorphism showed that all
Directory of Open Access Journals (Sweden)
Anuar Tengku Shahrul
2013-02-01
Full Text Available Abstract Background Blastocystis has been described as the most common intestinal parasite in humans and has an increased impact on public health. However, the transmission of this parasite has not been conclusively determined. Methods To contribute to a better comprehension of the epidemiology of this infection, a cross-sectional survey aimed at providing the first documented data on the prevalence and risk factors associated with Blastocystis infection was carried out among three Orang Asli tribes (Proto-Malay, Negrito and Senoi in selected villages at Negeri Sembilan, Perak and Pahang, Peninsular Malaysia. Faecal samples were examined by formalin-ether sedimentation and trichrome staining techniques. Results Of 500 individuals, 20.4% (102 were detected positive for Blastocystis; 13.3% (20/150 of Proto-Malays, 21.6% (30/139 of Negritos and 24.7% (52/211 of Senois were positive for Blastocystis, respectively. The positive cases showed a decrease with increasing age and most of the positive cases were observed in individuals less than 15 years old. Multivariate analysis confirmed that drinking untreated water and the presence of other family members infected with Blastocystis were significant risk factors of infection among the three tribes and overall population studied. Conclusion Essentially, the findings highlighted that Blastocystis infection is prevalent among Orang Asli communities in Malaysia. Further studies using molecular approaches to distinguish the subtype of Blastocystis is needed. The present study also revealed that this infection may be transmitted through waterborne and human-to-human contact. Therefore, interventions with the provision of clean water supply for the communities and health education especially to the parents are urgently required.
Morris, S E; Thomson, A O; Jarup, L; de Hoogh, C; Briggs, D J; Elliott, P
2003-11-01
A recent study showed small excess risks of low birth weight, very low birth weight and certain congenital anomalies in populations living near landfill sites in Great Britain. The objective of the current study was to investigate the risk of adverse birth outcomes associated with residence near special waste landfill sites in Scotland. We studied risks of adverse birth outcomes in populations living within 2 km of 61 Scottish special waste landfill sites operational at some time between 1982 and 1997 compared with those living further away. 324,167 live births, 1,849 stillbirths, and 11,138 congenital anomalies (including terminations) were included in the study. Relative risks were computed for all congenital anomalies combined, some specific anomalies and prevalence of stillbirth and low and very low birth weight (special waste landfill sites was 0.96 (99% confidence interval 0.89 to 1.02) adjusted for confounders. Adjusted risks were 0.71 (0.36 to 1.42) for neural tube defects, 1.03 (0.85 to 1.26) for cardiovascular defects, 0.84 (0.58 to 1.22) for hypospadias and epispadias (with no excess of surgical corrections), 0.78 (0.27 to 2.23) for abdominal wall defects (1.32 (0.42-4.17) for hospital admissions), 1.22 (0.28 to 5.38) for surgical correction of gastroschisis and exomphalos and 1.01 (0.96 to 1.07) and 1.01 (0.90 to 1.15) for low and very low birth weight respectively. There was no excess risk of stillbirth. In conclusion, we found no statistically significant excess risks of congenital anomalies or low birth weight in populations living near special waste landfill sites in Scotland.
THE LEGAL FRAMEWORK FOR ENSURING THE STANDARDS OF THE LIVING STANDARDS OF THE POPULATION IN UKRAINE
Directory of Open Access Journals (Sweden)
Elena Levanda
2017-11-01
Full Text Available The purpose of the paper is legal base in the context of the system of ensuring standards of living standards of the population of Ukraine. Methodology. The analysis of normative – legal documents on the basic level of life of different population groups. The legislative field is investigated through the official web portal of the Verkhovna Rada of Ukraine, the State statistics service of Ukraine clarified the period from 1991 to the present. Results. Functioning laws of the last century – outdated, not consistent with the goals of social policy and the contemporary economy. It is important to modernize the laws, concerning basic living standards of the population to the country's foreign policy, according to the EU methodology. Apply state social standard as a tool for poverty reduction, and the perspective tool starter package with a guaranteed standard of living government to its citizens. The practical implications. Different stages of development of economy of independent Ukraine, laid the foundations of the legislative framework of normative documents concerning social protection of the population. A country's legal framework contains a set of laws belonging to the last century, policy and regulatory documents that comply with EU standards. In turn, the regulatory framework has tenedency to the modernization of laws that establish the guaranteed state social standards and guarantees for every citizen. Value/originality. Analysis of the legislative base, revealed the ineffectiveness of the law guaranteeing basic social standard to citizens. Understanding of the process of modernization of a relatively large part of the laws adopted in the last century.
Gill, Jagbir; Joffres, Yayuk; Rose, Caren; Lesage, Julie; Landsberg, David; Kadatz, Matthew; Gill, John
2018-04-01
The factors underlying the decline in living kidney donation in the United States since 2005 must be understood to inform strategies to ensure access to this option for future patients. Population-based estimates provide a better assessment of donation activity than do trends in the number of living donor transplants. Using data from the Scientific Registry of Transplant Recipients and the United States Census, we determined longitudinal changes in living kidney donation between 2005 and 2015, focusing on the effect of sex and income. We used multilevel Poisson models to adjust for differences in age, race, the incidence of ESRD, and geographic factors (including population density, urbanization, and daily commuting). During the study period, the unadjusted rate of donation was 30.1 and 19.3 per million population in women and men, respectively, and the adjusted incidence of donation was 44% higher in women (incidence rate ratio [IRR], 1.44; 95% confidence interval [95% CI], 1.39 to 1.49). The incidence of donation was stable in women (IRR, 0.95; 95% CI, 0.84 to 1.07) but declined in men (IRR, 0.75; 95% CI, 0.68 to 0.83). Income was associated with longitudinal changes in donation in both sexes, yet donation was stable in the highest two population income quartiles in women but only in the highest income quartile in men. In both sexes, living related donations declined, irrespective of income. In conclusion, living donation declined in men but remained stable in women between 2005 and 2015, and income appeared to have a greater effect on living donation in men. Copyright © 2018 by the American Society of Nephrology.
International Nuclear Information System (INIS)
Jin Hua; Yue Qingyu
1989-11-01
The measurement of ionization distribution caused by the cosmic ray ionizing components in the air, the survey of population distribution in geography and the investigation of total passengers taking air liners at the mainland of China have been completed. By taking the data from the census of the year 1986 and the population distribution of the mainland, considering the cosmic ray distribution with the height and referring the distribution of neutron flux density in cosmic ray, the population-weighted mean annual effective dose equivalent, which is obtained from 2017 counties and 353 cities, for inhabitants living in every provinces and municipalities directly under Central Government has been calculated. The collective dose equivalent produced by the external exposure of cosmic ray is also estimated when people are taking air liners. The results which are effected by the population distribution show that the annual effective dose equivalant received by the population of China from the cosmic ray is 28% lower than the population of the world. The most of Chinese people are living at the north hemisphere area having lower elevation and geomagnetic latitude, and 53.6% among them is in the area of elevation below 100 m and 91% is in the area of geomagnetic latitude below 30 deg N
Population trends and live birth rates associated with common ART treatment strategies.
Chambers, Georgina M; Wand, Handan; Macaldowie, Alan; Chapman, Michael G; Farquhar, Cynthia M; Bowman, Mark; Molloy, David; Ledger, William
2016-11-01
Have ART live birth rates improved in Australia over the last 12 years? There were striking improvements in per-cycle live birth rates observed for frozen/thaw embryo transfers, blastocyst transfer and single embryo transfer (SET), while live birth rates following ICSI were lower than IVF for non-male factor infertility in most years. ART and associated techniques have become the predominant treatment of infertility over the past 30 years in most developed countries. However, there are differences in ART laboratory and clinical practices, and success rates worldwide. Australia has one of the highest ART utilization rates and lowest multiple birth rates in the world, thus providing a unique setting to investigate the contribution of common ART strategies in an unrestricted population of patients to ART success rates. A retrospective cohort study of 585 065 ART treatment cycles performed in Australia between 2002 and 2013 using the Australian and New Zealand Assisted Reproduction Database (ANZARD). An unrestricted population of all women who underwent autologous ART treatment between 2002 and 2013. Visual descriptive analysis was used to assess the trends in ART procedures by the calendar years. Adjusted odds ratios (aORs) of a live birth for four common ART techniques were calculated after controlling for important confounders including female age, infertility diagnosis, stage of the embryo (blastocyst versus cleavage stage), type of embryo (fresh versus thawed), fertilization method (IVF versus ICSI) and number of embryos transferred (SET versus multiple embryos). The overall live birth rate per embryo transfer increased from 19.2% in 2002 to 23.3% in 2013 (21.9-24.3% for fresh embryo transfers and 14.6-23.3% for frozen/thaw embryo transfers). This occurred concurrently with an increase in SET from 29.7% to 78.9%, and an increase in the average age of women undergoing treatment from 35.0 to 35.9 years. Individuals who had a frozen/thaw embryo transfer cycle in 2002
Umair, Sana
2013-01-01
This dissertation combines two different elements of interest in International Marketing Research. The objective of this research is the comparison of global versus local brand within the context of ethnic marketing in the multicultural society of Malaysia. The product instant noodle in the category of ethnic food was chosen in the variant of Asam Laksa as the target sample focused specifically on Malay consumers. Comparison was done between Maggi (global) and Mamee (local). The sample compri...
Nishimoto, Yuka; Akiyama, Yuki; Shibasaki, Ryosuke
2016-06-01
Population explosion is considered to be one of the most crucial problems in the world. However, in Japan, the opposite problem: population decline has become serious now. Japanese population is estimated to decrease by twenty millions in 2040. This negative situation will cause to increase areas where many residents cannot make a daily living all over Japan because many convenience living facilities such as supermarkets, convenience stores and drugstores will be difficult to maintain their market area population due to future population decline. In our research, we used point data of convenience living facilities developed by address geocoding of digital telephone directory and point data of future population projection developed by distribution of Japanese official population projection data proportionally among the building volume of digital residential map, which can monitor building volumes all over Japan. In conclusion, we estimated that various convenience living facilities in Japan will shrink and close by population decline in near future. In particular, it is cleared that approximately 14.7% of supermarkets will be possible to withdraw all over Japan by 2040. In addition, it is cleared that over 40% of supermarkets in some countryside prefectures will be possible to withdraw by 2040. Thus, we estimated future distributions of convenience living facilities that cannot maintain their market area population due to future population decline. Moreover, we estimated the number of people that they will become inconvenience in buying fresh foods.
Directory of Open Access Journals (Sweden)
Y. Nishimoto
2016-06-01
Full Text Available Population explosion is considered to be one of the most crucial problems in the world. However, in Japan, the opposite problem: population decline has become serious now. Japanese population is estimated to decrease by twenty millions in 2040. This negative situation will cause to increase areas where many residents cannot make a daily living all over Japan because many convenience living facilities such as supermarkets, convenience stores and drugstores will be difficult to maintain their market area population due to future population decline. In our research, we used point data of convenience living facilities developed by address geocoding of digital telephone directory and point data of future population projection developed by distribution of Japanese official population projection data proportionally among the building volume of digital residential map, which can monitor building volumes all over Japan. In conclusion, we estimated that various convenience living facilities in Japan will shrink and close by population decline in near future. In particular, it is cleared that approximately 14.7% of supermarkets will be possible to withdraw all over Japan by 2040. In addition, it is cleared that over 40% of supermarkets in some countryside prefectures will be possible to withdraw by 2040. Thus, we estimated future distributions of convenience living facilities that cannot maintain their market area population due to future population decline. Moreover, we estimated the number of people that they will become inconvenience in buying fresh foods.
Up-to-date information about China's population and living standards.
1994-04-01
China's rate of natural increase was 11.45/1000 in 1993, as a result of the crude birth rate of 18.09/1000 and a crude death rate of 6.64/1000. The total population in 1993 was 1,185.17 million. There was an increase of 13.46 million between 1992 and 1993. Personal income increased by 28% to RMB 2337 yuan in 1993, which was a real growth of 10.2%. Rural income increased by 3.2% (adjusted for inflation to 921 yuan). The urban and rural gap widened and living standards declined for some populations. Urban unemployment was 2.6% in 1993, and 128,000 unemployed persons received some assistance. Employment increased to 150.4 million, which was an increase of 2.48 million workers. Private sector and state owned business employment increased. Wages increased by 21.1% to RMB 477 billion yuan for all workers. The average per person wage increased by 19.4% to RMB 3236 yuan. Living conditions as measured by total floor space improved for the urban and rural populations. Social welfare beds available also increased. 40.51 million people received relief funds in rural and urban areas. 31.5% of townships and towns had a social security system. 97,000 community service networks were established in 1993. The number of retired urban persons receiving old age pensions from the community increased. This constituted a change from retirees receiving pensions from their work units. The number of environmental protection workers amounted to 81,000 by the end of 1993. 2290 environmental monitoring stations employed 33,000 workers. 77 national natural reserves were secured by 1993, of which 10 are members of the Man and Biosphere International Protection Network. Standards have been established for assuring environmental quality in 313 ways. Soot control zones were established in 472 cities and numbered 2935. Environmental noise control zones in 363 cities were established; the zones numbered 1774 and covered 3689 sq. miles. 5737 projects were established dealing with environmental
Corella, Alfons; Bert, Francesc; Pérez-Pérez, Alejandro; Gené, Manel; Turbón, Daniel
2007-01-01
Chimane, Moseten Aymara and Quechua are Amerindian populations living in the Bolivian Piedmont, a characteristic ecoregion between the eastern slope of the Andean mountains and the Amazonian Llanos de Moxos. In both neighbouring areas, dense and complex societies have developed over the centuries. The Piedmont area is especially interesting from a human peopling perspective since there is no clear evidence regarding the genetic influence and peculiarities of these populations. This land has been used extensively as a territory of economic and cultural exchange between the Andes and Amazonia, however Chimane and Moseten populations have been sufficiently isolated from their neighbour groups to be recognized as distinct populations. Genetic information suggests that evolutionary processes, such as genetic drift, natural selection and genetic admixture have formed the history of the Piedmont populations. The objective of this study is to characterize the genetic diversity of the Piedmont populations, analysing the sequence variability of the HVR-I control region in the mitochondrial DNA (mtDNA). Haplogroup mtDNA data available from the whole of Central and South America were utilized to determine the relationship of the Piedmont populations with other Amerindian populations. Hair pulls were obtained in situ, and DNA from non-related individuals was extracted using a standard Chelex 100 method. A 401 bp DNA fragment of HVR-I region was amplified using standard procedures. Two independent 401 and 328 bp DNA fragments were sequenced separately for each sample. The sequence analyses included mismatch distribution and mean pairwise differences, median network analyses, AMOVA and principal component analyses. The genetic diversity of DNA sequences was measured and compared with other South Amerindian populations. The genetic diversity of 401 nucleotide mtDNA sequences, in the hypervariable Control Region, from positions 16 000-16 400, was characterized in a sample of 46
Directory of Open Access Journals (Sweden)
Pedro Henrique Santos
Full Text Available Summary The aim of this study was to evaluate the rheological behavior of malay apple, a traditional Amazonian fruit with high bioactive properties, at different temperatures and soluble solids concentrations. The experiments were carried out in a Brookfield R/S Plus rheometer with concentric cylinders geometry. Power Law, Herschel-Bulkley, Mizrahi-Berk, and Sisko rheological models were fitted to the experimental data. The malay apple juice (pulp and skin showed a pseudoplastic behavior for all temperatures and concentrations with flow behavior indexes lower than 1. The temperature effect on the samples’ apparent viscosity was analyzed by the Arrhenius equation. The activation energy increased with a decrease in the soluble solids concentration, showing that the lower the concentration, the greater the temperature influence on the apparent viscosity. The soluble solids effect was described by the exponential equation. The exponential factor increased with the temperature increasing, showing that the higher the temperature, the greater the effect of the soluble solids concentration on samples’ apparent viscosity. Finally, a triparametric mathematical model combining temperature, concentration, and shear rate was proposed aiming to evaluate its effects on the samples’ apparent viscosity and has accurately adjusted to the data with high correlation index R2.
Directory of Open Access Journals (Sweden)
A. Taravat
2014-10-01
Full Text Available Public spaces accessibility has become one of the important factors in urban planning. Therefore, considerable attention has been given to measure accessibility to public spaces on the UK, US and Canada, but there are few studies outside the anglophone world especially in developing countries such as Iran. In this study an attempt has been made to measure objective accessibility to public spaces (parks, school, library and administrative using fuzzy majority GIS-based multicriteria decision analysis. This method is for defining the priority for distribution of urban facilities and utilities as the first step towards elimination of social justice. In order to test and demonstrate the presented model, the comprehensive plan of Malayer city has been considered for ranking in three objectives and properties in view of index per capital (Green space, sport facilities and major cultural centers like library and access index. The results can be used to inform the local planning process and the GIS approach can be expanded into other local authority domains. The results shows that the distribution of facilities in Malayer city has followed on the base of cost benefit law and the human aspect of resource allocation programming of facilities (from centre to suburbs of the city.
Taravat, A.; Yari, A.; Rajaei, M.; Mousavian, R.
2014-10-01
Public spaces accessibility has become one of the important factors in urban planning. Therefore, considerable attention has been given to measure accessibility to public spaces on the UK, US and Canada, but there are few studies outside the anglophone world especially in developing countries such as Iran. In this study an attempt has been made to measure objective accessibility to public spaces (parks, school, library and administrative) using fuzzy majority GIS-based multicriteria decision analysis. This method is for defining the priority for distribution of urban facilities and utilities as the first step towards elimination of social justice. In order to test and demonstrate the presented model, the comprehensive plan of Malayer city has been considered for ranking in three objectives and properties in view of index per capital (Green space, sport facilities and major cultural centers like library and access index). The results can be used to inform the local planning process and the GIS approach can be expanded into other local authority domains. The results shows that the distribution of facilities in Malayer city has followed on the base of cost benefit law and the human aspect of resource allocation programming of facilities (from centre to suburbs of the city).
Ethnic differences in parents' coresidence with adult children in peninsular Malaysia.
Chan, A; Davanzo, J
1996-03-01
This study examines how benefits, costs, opportunities, and preferences affect ethnic differences in parent-child coresidence in Malaysia. The conceptual model is described in greater detail in a companion paper. Data were obtained from the senior sample of the Second Malaysian Family Life Survey of 1988-89. The nationally representative sample includes 1229 persons aged over 50 years living in private households. Retirement age in Malaysia is 45 years for women and 55 years for men. Ethnicity includes Malay, Chinese, and Indians. Adult children are aged 20 years and older. The analysis pertains to 802 married and 427 unmarried seniors. Chinese tended to live in the most expensive areas and urban areas. Malays tended to live in the least expensive areas and rural areas. Health perception ranged from good to fair to poor. About 20% of married seniors had wives aged under 50 years. Income refers to average monthly unearned income, excluding transfers from other households or public sources. The relative roles of ethnic differences in each explanatory variable are estimated. Findings indicate that the higher incidence of remarriage and lower housing costs for married Malays explain their lower coresidence rates. The poorer health of Indians and better health of Malays also explain coresidence differences for the married. The higher incidence of daughter-only families among Malays explains coresidence differences. The explanatory variables of remarriage, housing costs, health, and daughter-only families explain little for the unmarried. Among the unmarried and the married, older age was associated with greater coresidence for the Chinese only. Chinese and Malay coresidence declined with increased educational levels. Coresidence rates were lower for Malays and higher for Indians.
Directory of Open Access Journals (Sweden)
ABDULLAH HASSAN
2009-01-01
Full Text Available This article discusses the relationship between the Malay language and the identity of the individual and the race, particularly in relation to the Malays in Malaysia. The identity of an individual and a race is defined from a philosophical perspective and cross-referenced with definitions by sociologists, historians and social scientists. Based on this, it is concluded that there are five elements that shape the identity of a race, that is, the same ancestry, language, culture, religion, and locale. Whilst there are elemental structures that undergird an identity, there are factors that can cause an identity to change. This is discussed in light of a few hypotheses that the present article argues can generate change in the identity of a race. The article concludes that the change in the identity of an individual or a race happens when there is change in the language that is used.
Anatomic Variation in Morphometry of Human Coracoid Process among Asian Population.
Fathi, Manal; Cheah, Pike-See; Ahmad, Umar; Nasir, M Nizlan; San, Aye Aye; Abdul Rahim, Ezamin; Hussin, Paisal; Mahmud, Rozi; Othman, Fauziah
2017-01-01
Ethnic origin plays an important role in bone morphometry. Studies examining the influence of coracoid process have focused primarily on adults and have not included people from diverse Asian ethnic backgrounds. Our goal was to explore ethnic differences in morphometry of coracoid among Asian population. We performed morphometric measurements of coracoid process on cadaveric shoulders and shoulder CT scans from 118 specimens. The cadaveric sample included Indian (46%), Chinese (27%), and Myanmarese (27%) subjects, while the CT scans sample included Chinese (67%) and Malay (33%) subjects. The morphometric measurements were performed using digital caliper and software developed at Golden Horses Health Sanctuary (GHHS). In the Indian cadaveric shoulders, the coracoid process is better developed than the other groups with the exception of the tip width of coracoid process. There are significant differences in almost all measurements ( P Chinese than Malay subjects when stratified by sex ( P < 0.05). Moreover, in all morphometric measurements, the females had smaller measurements than males ( P < 0.05). Understanding such differences is important in anatomy, forensic and biological identity, and orthopaedic and shoulder surgeries.
Cheong, A T; Tong, S F; Sazlina, S G
2015-01-01
Hill-Bone compliance to high blood pressure therapy scale (HBTS) is one of the useful scales in primary care settings. It has been tested in America, Africa and Turkey with variable validity and reliability. The aim of this paper was to determine the validity and reliability of the Malay version of HBTS (HBTS-M) for the Malaysian population. HBTS comprises three subscales assessing compliance to medication, appointment and salt intake. The content validity of HBTS to the local population was agreed through consensus of expert panel. The 14 items used in the HBTS were adapted to reflect the local situations. It was translated into Malay and then back-translated into English. The translated version was piloted in 30 participants. This was followed by structural and predictive validity, and internal consistency testing in 262 patients with hypertension, who were on antihypertensive agent(s) for at least 1 year in two primary healthcare clinics in Kuala Lumpur, Malaysia. Exploratory factor analyses and the correlation between HBTS-M total score and blood pressure were performed. The Cronbach's alpha was calculated accordingly. Factor analysis revealed a three-component structure represented by two components on medication adherence and one on salt intake adherence. The Kaiser-Meyer-Olkin statistic was 0.764. The variance explained by each factors were 23.6%, 10.4% and 9.8%, respectively. However, the internal consistency for each component was suboptimal with Cronbach's alpha of 0.64, 0.55 and 0.29, respectively. Although there were two components representing medication adherence, the theoretical concepts underlying each concept cannot be differentiated. In addition, there was no correlation between the HBTS-M total score and blood pressure. HBTS-M did not conform to the structural and predictive validity of the original scale. Its reliability on assessing medication and salt intake adherence would most probably to be suboptimal in the Malaysian primary care setting.
Li, Zhenghui; Zhang, Jian; Zhang, Hantao; Lin, Ziqing; Ye, Jian
2018-05-01
Short tandem repeats (STRs) play a vitally important role in forensics. Population data is needed to improve the field. There is currently no large population data-based data set in Chamdo Tibetan. In our study, the allele frequencies and forensic statistical parameters of 18 autosomal STR loci (D5S818, D21S11, D7S820, CSF1PO, D2S1338, D3S1358, VWA, D8S1179, D16S539, PentaE, TPOX, TH01, D19S433, D18S51, FGA, D6S1043, D13S317, and D12S391) included in the DNATyper™19 kit were investigated in 2249 healthy, unrelated Tibetan subjects living in Tibet Chamdo, Southwest China. The combined power of discrimination and the combined probability of exclusion of all 18 loci were 0.9999999999999999999998174 and 0.99999994704, respectively. Furthermore, the genetic relationship between our Tibetan group and 33 previously published populations was also investigated. Phylogenetic analyses revealed that the Chamdo Tibetan population is more closely related genetically with the Lhasa Tibetan group. Our results suggest that these autosomal STR loci are highly polymorphic in the Tibetan population living in Tibet Chamdo and can be used as a powerful tool in forensics, linguistics, and population genetic analyses.
Zainal, Nor Zuraida; Shuib, Norley; Bustam, Anita Zarina; Sabki, Zuraida Ahmad; Guan, Ng Chong
2013-01-01
Body image dissatisfaction among breast cancer survivors has been associated with psychological stress resultant from breast cancer and resultant surgery. This study aimed to examine the psychometric properties of the Malay Version of the Breast-Impact of Treatment Scale (MVBITS) and to investigate the associations of retained factors with the Hospital Anxiety and Depression Scale (HADS) and the Rosenberg Self-Esteem Scale (RSES). The MVBITS was 'forward-backward' translated from English to Malay and then administered to 70 female breast cancer patients who came to the Oncology Clinic of University Malaya Medical Centre, Kuala Lumpur, Malaysia to undergo chemotherapy. Principal component analysis (PCA) with varimax rotation was performed to explore the factor structure of the MVBITS. Associations of retained factors were estimated with reference to Spearman correlation coefficients. The internal consistency reliability of MVBITS was good (Cronbach's alpha 0.945) and showed temporal stability over a 3-week period. Principal component analysis suggested two factors termed as 'Intrusion' and 'Avoidance' domains. These factors explained 70.3% of the variance. Factor 1 comprised the effects of breast cancer treatment on the emotion and thought, while Factor 2 informed attempts to limit exposure of the body to self or others. The Factor 1 of MVBITS was positively correlated with total, depression and anxiety sub-scores of HADS. Factor 2 was positively correlated with total and anxiety sub-scores of HADS. MVBITS was also positively correlated with the RSES scores. The results showed that the Malay Version of Breast-Impact of Treatment Scale possesses satisfactory psychometric properties suggesting that this instrument is appropriate for assessment of body change stress among female breast cancer patients in Malaysia.
Yang, P L S; Lu, Y; Khoo, C M; Leow, M K S; Khoo, E Y H; Teo, A; Lee, Y S; Das De, S; Chong, Y S; Gluckman, P D; Tai, E S; Venkataraman, K; Ng, C M A
2013-11-01
Chinese men in Singapore have a higher incidence of hip fractures than Malay and Indian men. We investigated whether there were corresponding ethnic differences in peak bone mineral density (BMD) in young men and whether differences in body composition influenced peak BMD. This was a cross-sectional study of healthy volunteers in a tertiary medical center. A total of 100 Chinese, 82 Malay, and 80 Indian men aged 21 to 40 years, with body mass index between 18 and 30 kg/m(2) underwent dual-energy x-ray absorptiometry to assess BMD, lean mass (LM) and fat mass (FM), and magnetic resonance imaging to quantify abdominal subcutaneous and visceral adipose tissue. Multiple linear regression models, with adjustment for age and height (as a proxy for skeletal size), were used. Malay and Indian men had significantly higher BMD than Chinese men at the lumbar spine (Malay: B, 0.06 ± 0.02, P = .001; Indian: B, 0.03 ± 0.02, P = .049), femoral neck (Malay: B 0.04 ± 0.02, P = .034; Indian: B, 0.04 ± 0.02, P = .041), hip (Malay: B, 0.05 ± 0.02, P = .016; Indian: B, 0.06 ± 0.02, P = .001), and ultradistal radius (Malay: B, 0.03 ± 0.01, P Malay men at the femoral neck and in Indian men at the ultradistal radius. LM was an important independent determinant of BMD at all sites, whereas FM, subcutaneous adipose tissue, and visceral adipose tissue were not significantly associated with BMD at any site. Lower peak BMD in Chinese men may partly explain the higher fracture incidence in this ethnic group. Further studies are needed to elucidate the reasons for these ethnic differences in bone accumulation.
Chai, H C; Phipps, M E; Othman, I; Tan, L P; Chua, K H
2013-02-01
Human leukocyte antigen (HLA) antigens and genes have long been reported associated with systemic lupus erythematosus (SLE) susceptibility in many populations. With the advance in technologies such as genome-wide association studies, many newly discovered SLE-associated single-nucleotide polymorphisms (SNPs) have been reported in recent years. These include HLA-DRB1/HLA-DQA1 rs9271366 and HLA-DQB1/HLA-DQA2 rs9275328. Our aim was to investigate these SNPs in a Malaysian SLE cohort. SNPs rs9271366 and rs9275328 were screened across 790 Malaysian citizens from three ethnic groups (360 patients and 430 healthy volunteers) by Taqman SNP genotyping assays. Allele and genotyping frequencies, Hardy-Weinberg equilibrium, Fisher's exact test and odds ratio were calculated for each SNP and ethnic group. Linkage disequilibrium and interaction between the two SNPs were also evaluated. The minor allele G and its homozygous genotype GG of HLA-DRB1/HLA-DQA1 rs9271366 significantly increased the SLE susceptibility in Malaysian patients, including those of Malay and Chinese ethnicity (odds ratio (OR) > 1, p < 0.05). As for HLA-DQB1/HLA-DQA2 rs9275328, the minor allele T and the heterozygous genotype CT conferred protective effect to SLE in Malaysians, as well as in Malays and Chinese, by having OR < 1 and p value <0.05. Both SNPs did not show associations to SLE in Indians. D' and r (2) values for the two SNPs in LD analysis were 0.941 and 0.065, respectively, with haplotype GC and AT being significantly associated with SLE (p < 5.0 × 10(-4)) after 10,000 permutations were performed. The MDR test clustered the genotype combinations of GG and CC, and AG and CC of rs9271366 and rs9275328, accordingly, as high-risk group, and the two SNPs interacted redundantly by removing 1.96% of the entropy. Our findings suggest that in addition to some classical HLA variants, rs9271366 and rs9275328 are additional polymorphisms worth considering in the Malaysian and possibly in
International Nuclear Information System (INIS)
Vasconcellos, M.B.A.; Paletti, G.; Catharino, M.G.M.; Saiki, M.; Favaro, D.I.T.; Bode, P.; Ammerlaan, A.K.; Byrne, A.R.; Baruzzi, R.; Rodrigues, D.A.
2000-01-01
Biomonitoring of mercury contamination of Brazilian Indian population groups living in the Xingu Park, a reservation situated in the Amazonic region, has revealed very high levels of mercury in hair samples as compared to controls. Total mercury was determined by INAA in most of the tribes living in the Park and methylmercury was determined by CVAAS in samples with total mercury above 10 mg/kg. Due to the fact that selenium seems to protect animals against the toxic effects of methylmercury, it was considered also of interest to determine its concentrations in the hair samples with very high mercury levels. Selenium was determined by INAA via the short-lived radionuclide 77m Se (T 1/2 = 17.45 s). The correlations between selenium and mercury concentrations in Brazilian controls and in the Indian population groups are discussed. (author)
Isa, Siti Nor Ismalina; Ishak, Ismarulyusda; Rahman, Azriani Ab; Saat, Nur Zakiah Mohd; Din, Normah Che; Lubis, Syarif Husin; Ismail, Muhammad Faiz Mohd
2017-01-01
Background Caregivers of children with learning disabilities have been shown to experience increased stress and greater negative caregiving consequences than those with typically developing children. There remains a lack of studies focusing on stress and coping mechanisms among caregivers of a wider age group and diagnosis of individuals with disabilities in Asian countries. The current study examines levels of perceived stress and associated child and caregiver factors among caregivers of children with learning disabilities in the Malaysian context. An additional aim was to determine whether caregiver coping styles may be predictors of perceived stress. Methods The Malay version of the Perceived Stress Scale with 10 items and the Brief COPE Scale were administered to a sample of 190 Malay caregivers of children with learning disabilities registered with community-based rehabilitation centres in Kelantan, a state in Peninsular Malaysia. Multiple linear regression analysis was applied to determine the predictors of perceived stress. Results The mean total perceived stress score of caregivers was 16.96 (SD = 4.66). The most frequently used coping styles found among caregivers included religion, acceptance and positive reframing, while substance use and behavioural disengagement were least frequently used. Higher perceived stress was significantly predicted among caregivers with fewer children, frequent use of instrumental support and behavioural disengagement coping, and lack of emotional support and religious coping. Conclusion Findings indicate that the perceived stress levels among caregivers were significantly predicted by different coping styles. It is vital to help the caregivers improve their good coping styles in order to reduce their stress levels. PMID:28381931
Directory of Open Access Journals (Sweden)
Mohammad Rahim Kamaluddin
2017-08-01
Full Text Available Religious Orientation Scale-Revised (ROS-R has been used increasingly as an important measure in psychology of religion based researches and widely administered in cross-cultural settings. Unfortunately, there is no valid and reliable ROS-R available in Malay language to assess religious orientations among Malaysians. With that in mind, the present study aims to validate and document the psychometric properties of Malay translated ROS-R (henceforth, M-ROS-R among sample of Malaysian adults. This study commenced with Forward-Backward translations and was followed by content and face validities. Subsequently, a cross-sectional study was conducted among Malaysian adults (n = 226 using convenience sampling method for the purpose of construct and factorial validations. Later, construct and factorial validity was performed via Exploratory Factor Analysis using Principal Component Analysis with Varimax rotation. Finally, reliability testing was performed to determine the internal consistency of the items which was achieved using Cronbach’s Alpha coefficient method (α. The factor loading consisted of three factors with a total variance of 64.76%. The final version of M-ROS-R consisted of 14 items with Factor 1 (Intrinsic Orientation comprised of 8 items, Factor 2 (Extrinsic-Socially Orientated with 3 items while Factor 3 (Extrinsic-Personally Orientated constituted 3 items. The internal consistency values of the factors ranged between 0.68 and 0.86, indicating the scale is reliable. The intercorrelations between factors were also significant with each other. M-ROS-R was concluded as a valid and reliable scale to measure and assess religious orientations among Malaysians.
Isa, Siti Nor Ismalina; Ishak, Ismarulyusda; Rahman, Azriani Ab; Saat, Nur Zakiah Mohd; Din, Normah Che; Lubis, Syarif Husin; Ismail, Muhammad Faiz Mohd
2017-03-01
Caregivers of children with learning disabilities have been shown to experience increased stress and greater negative caregiving consequences than those with typically developing children. There remains a lack of studies focusing on stress and coping mechanisms among caregivers of a wider age group and diagnosis of individuals with disabilities in Asian countries. The current study examines levels of perceived stress and associated child and caregiver factors among caregivers of children with learning disabilities in the Malaysian context. An additional aim was to determine whether caregiver coping styles may be predictors of perceived stress. The Malay version of the Perceived Stress Scale with 10 items and the Brief COPE Scale were administered to a sample of 190 Malay caregivers of children with learning disabilities registered with community-based rehabilitation centres in Kelantan, a state in Peninsular Malaysia. Multiple linear regression analysis was applied to determine the predictors of perceived stress. The mean total perceived stress score of caregivers was 16.96 (SD = 4.66). The most frequently used coping styles found among caregivers included religion, acceptance and positive reframing, while substance use and behavioural disengagement were least frequently used. Higher perceived stress was significantly predicted among caregivers with fewer children, frequent use of instrumental support and behavioural disengagement coping, and lack of emotional support and religious coping. Findings indicate that the perceived stress levels among caregivers were significantly predicted by different coping styles. It is vital to help the caregivers improve their good coping styles in order to reduce their stress levels.
Zhang, Jian; Li, Zhenghui; Mo, Xiaoting; Ma, Wenhua; Zhang, Hantao; Lin, Ziqing; Ye, Jian
2018-03-10
There is currently no large population data-based data set in Kashgar Prefecture Uyghur. The allele frequencies of 18 autosomal short tandem repeat (STR) loci included in the DNATyper™ 19 kit were evaluated in 2600 Uyghur individuals living in Kashgar Prefecture, Northwest China. The values of combined power of discrimination (CPD) and combined probability of exclusion (CPE) of all 18 autosomal STR loci were 0.99999999999999999998235 and 0.99999998670, respectively. Phylogenetic analyses revealed that the Uyghur population has a closer relationship with the Xinjiang-Kazakh, Inner Mongolia-Mongolian, and other three Uyghur populations. In addition, our results are consistent with the hypothesis that Uyghur population is an admixture of Eastern Asian and European populations.
Deurenberg-Yap, M.; Schmidt, G.; Staveren, van W.A.; Hautvast, J.G.A.J.; Deurenberg, P.
2001-01-01
This cross-sectional study compared body fat percentage (BF€obtained from a four-compartment (4C) model with BF␏rom hydrometry (using 2H2O), dual-energy X-ray absorptiometry (DXA) and densitometry among the three main ethnic groups (Chinese, Malays and Indians) in Singapore, and determined the
Sua, Tan Yao; Ngah, Kamarudin; Darit, Sezali Md.
2013-01-01
This study surveys 200 Malay students enrolled in three Chinese primary schools in relation to three issues, i.e., parental choice of schooling, learning processes and inter-ethnic friendship patterns. The three issues are explored through a combination of quantitative and qualitative research methodologies. Parental expectations for their…
Directory of Open Access Journals (Sweden)
Phanintra Teeranon
2007-12-01
Full Text Available The F0 values of vowels following voiceless consonants are higher than those of vowels following voiced consonants; high vowels have a higher F0 than low vowels. It has also been found that when high vowels follow voiced consonants, the F0 values decrease. In contrast, low vowels following voiceless consonants show increasing F0 values. In other words, the voicing of initial consonants has been found to counterbalance the intrinsic F0 values of high and low vowels (House and Fairbanks 1953, Lehiste and Peterson 1961, Lehiste 1970, Laver 1994, Teeranon 2006. To test whether these three findings are applicable to a disyllabic language, the F0 values of high and low vowels following voiceless and voiced consonants were studied in a Malay dialect of the Austronesian language family spoken in Pathumthani Province, Thailand. The data was collected from three male informants, aged 30-35. The Praat program was used for acoustic analysis. The findings revealed the influence of the voicing of initial consonants on the F0 of vowels to be greater than that of the influence of vowel height. Evidence from this acoustic study shows the plausibility for the Malay dialect spoken in Pathumthani to become a tonal language by the influence of initial consonants rather by the influence of the high-low vowel dimension.
Paleomagnetic results from the upper silurian of the Shan-Thai-Malay Block, southwest Yunnan, China
Chen, Haihong; Zhong, Dalai; Heller, Friedrich; Dobson, Jon P.
77 paleomagnetic samples from the Upper Silurian reddish limestone and marlstone of the Shan-Thai-Malay block near Baoshan ( 99.1°E, 24.8°N ), western Yunnan, China, reveal a pre-folding remnant magnetization, with a mean direction of D=49.6°, I= -3.2°, k=9.7, a95=5.5°, corresponding a paleopole at 207.0°E, 36.8°N. These results, unlike the upper Paleozoic data with steeper inclinations published earlier, suggest that the block was located at equatorial latitude during late Silurian time, probably adjacent to the northern margin of Gondwanaland.
Directory of Open Access Journals (Sweden)
Mohd Azmarul A Aziz
2015-04-01
Full Text Available Introduction Semantic Feature Analysis (SFA is a treatment for lexical retrieval impairment in which participants are cued by providing semantic information regarding concepts they have difficulty with in naming tasks in an effort to facilitate accurate lexical retrieval (Boyle & Coelho, 1995. People with aphasia are commonly found to have naming deficits and speech-language therapists (SLTs face difficulties in providing an effective treatment method to treat this deficit. This study aims to examine the use of SFA to address naming deficits for nouns and verbs in a Malay patient (KM with non-fluent aphasia. Methods The following tests were administered to the subject pre- and post- treatment: 1 Boston Diagnostic Aphasia Examination (BDAE; 2 Malay Object and Action Test (MOAT; and 3 A series of comprehension and production assessments in Malay. Subject was asked to name 101 and 50 pictures from MOAT. The stimuli were coloured photograph pictures. Treatment and probe (untrained stimuli were selected from pictures that a subject could not name, yielding 40 nouns and 30 verbs. From these, 20 stimuli were randomly chosen as probe items and 20 as treatment stimuli (nouns, 15 treatment and 15 probes (verbs. For the treatment study, single subject A-B-A design was implemented. Three baseline sessions were completed prior to treatment initiation naming for both probe and treatment pictures. Subject attended once-weekly therapy sessions over 8 months. Probes assessing generalizations to untrained pictures were presented at 4th, 8th, and 12th and so on until the end of the programme. Results Results showed that KM’s ability to name trained and untrained picture stimuli improved for both nouns and verbs. KM demonstrated steady improvement in the SFA treatment of trained nouns and verbs: from 5% baseline accuracy to over 90% accuracy at treatment end for nouns and from 0% baseline accuracy to 90% accuracy at treatment end for verbs. Generalizations to
Teo, Eng Wah; Lee, Yuin Yi; Khoo, Selina; Morris, Tony
2015-04-09
Smoking tobacco is a major concern in Malaysia, with 23.1% of Malaysian adults smoking tobacco in 2012. Withdrawal symptoms and self-efficacy to quit smoking have been shown to have significant effects on the outcomes of smoking cessation. The Shiffman-Jarvik Withdrawal Scale (Psychopharmacology, 50: 35-39, 1976) and the Cessation Self-Efficacy Questionnaire (Cognitive Ther Res 5: 175-187, 1981) are two questionnaires that have been widely used in various smoking cessation research. The short SJWS consists of 15 items with five subscales: physical symptoms, psychological symptoms, stimulation/sedation, appetite, and cravings. The CSEQ is a 12-item questionnaire that assesses participant's self-efficacy to avoid smoking in various situations described in each item. The aim of this study was to translate and validate the Malay language version of the SJWS and the CSEQ. The SJWS and CSEQ were translated into the Malay language based on the back translation method. A total of 146 participants (25.08 ± 5.19 years) answered the translated questionnaires. Psychometrics properties such as reliability (internal consistency and test-retest) and validity (content validity, construct validity and face validity) were examined. Both questionnaires showed acceptable internal consistency; SJWS-M (α = 0.66) and CSEQ-M (α = 0.90) and good test-retest reliability; SJWS-M (r = 0.76) and the CSEQ-M (r = 0.80). SJWS-M (χ(2) = 15.964, GFI = 0.979, CFI = 1.000, RMSEA = 0.000, ChiSq/df = 0.939, AGFI = 0.933, TLI = 1.004, and NPI = 0.978) and CSEQ-M (of χ(2) = 35.16, GFI = 0.960, CFI = 0.999, RMSEA = 0.015, ChiSq/df = 1.034, AGFI = 0.908, TLI = 0.999, and NPI = 0.979) also showed good construct validity. Both questionnaires showed sufficient item to item convergent validity and item discriminant validity. Content validity was established (reassess) by experts in the field of psychology, culture and language whereas face validity was confirmed by smokers. The translated Malay
Ensuring living condition for ageing population by public–private partnership (PPP
Directory of Open Access Journals (Sweden)
Konjar Miha
2018-01-01
Full Text Available Lack of financial resources has become one of the main issues in fulfilling social and physical needs in urban development. The declining levels of public resources make the collaboration between public and private investors necessary. When facing the challenges of ageing population, shared investment may contribute to the appropriate development of sheltered housing to meet the goals of spatial planning as well as certain standards at the level of urban design. By ensuring appropriate living conditions for all generations such urban PPP projects may contribute to the fulfilment of the public interest. The paper presents practice of PPP implementation in Ljubljana, Slovenia, where local authority with the collaboration of private partners ensured more than 400 sheltered apartments in the last years. Examples show the extension of the idea from the 70s onwards in finding new models of housing for the aging population. The development of new models can be a good example of strengthening the cooperation between public and private partners in the field of urban development practice.
Ensuring living condition for ageing population by public-private partnership (PPP)
Konjar, Miha; Nikšič, Matej; Grom, Janez Peter; Mujkić, Sabina; Fikfak, Alenka
2018-03-01
Lack of financial resources has become one of the main issues in fulfilling social and physical needs in urban development. The declining levels of public resources make the collaboration between public and private investors necessary. When facing the challenges of ageing population, shared investment may contribute to the appropriate development of sheltered housing to meet the goals of spatial planning as well as certain standards at the level of urban design. By ensuring appropriate living conditions for all generations such urban PPP projects may contribute to the fulfilment of the public interest. The paper presents practice of PPP implementation in Ljubljana, Slovenia, where local authority with the collaboration of private partners ensured more than 400 sheltered apartments in the last years. Examples show the extension of the idea from the 70s onwards in finding new models of housing for the aging population. The development of new models can be a good example of strengthening the cooperation between public and private partners in the field of urban development practice.
Czech Academy of Sciences Publication Activity Database
Petrů, Tomáš
2016-01-01
Roč. 27, č. 1 (2016), s. 147-161. ISBN 979-10-320-0066-3. ISSN 1620-3224 Institutional support: RVO:68378009 Keywords : Persian language * culture * Malay World Subject RIV: AB - History http://moussons.revues.org/3572
Tan, Ngiap Chuan; Koh, Kim Hwee; Goh, Chin Chin; Koh, Yi Ling Eileen; Goh, Soo Chye Paul
2016-01-01
Dyslipidemia is the primary risk factor for arthrosclerosis. It is the most common chronic disease among the multiethnic Asian population in Singapore. Local national health survey has shown ethnic variability in achieving control of dyslipidemia. This study aimed to determine the proportion of patients in primary care, who achieved their low-density lipoprotein (LDL)-cholesterol treatment goals, stratified by the local major ethnic groups. It also evaluated the factors that affected their dyslipidemia control, including diet, exercise and medication usage. Research assistants administered questionnaires on adult patients with physician-diagnosed dyslipidemia to determine their views on diet, exercise, and medications in this cross-sectional study in 2 local primary care clinics. Their lipid profiles were retrieved from their laboratory reports in their electronic health records. Chi-square and Fisher exact tests were used for the categorical demographics and questionnaire variables, (P < .05: statistically significant). Logistic regression was performed using these significant variables to determine the adjusted odds of the ethnic groups. A total of 1093 eligible patients completed the questionnaires. The proportion of Chinese, Malay, and Indian patients who achieved LDL-cholesterol goals was 78.3%, 67.9%, and 68.5%, respectively. Among those who self-reported taking their favorite cholesterol-rich food occasionally when their cholesterol became controlled, 35.8% Indians failed to achieve treatment goals, compared to 20.1% Chinese and 30.9% Malay patients. Regular medication adherence was associated with 81.8% Chinese, 69.0% Malay, and 69.7% Indian reaching treatment goals. More Chinese met LDL-cholesterol treatment goals compared to Malays and Indians. Lipid-lowering medications enabled but smoking hindered their achievement of these treatment goals. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Mariana Brussoni
2016-05-01
Full Text Available Abstract Background Disparities in injury rates between Aboriginal and non-Aboriginal populations in British Columbia (BC are well established. Information regarding the influence of residence on disparities is scarce. We sought to fill these gaps by examining hospitalization rates for all injuries, unintentional injuries and intentional injuries across 24 years among i Aboriginal and total populations; ii populations living in metropolitan and non-metropolitan areas; and iii Aboriginal populations living on- and off-reserve. Methods We used data spanning 1986 through 2010 from BC’s universal health care insurance plan, linked to vital statistics databases. Aboriginal people were identified by insurance premium group and birth and death record notations, and their residence was determined by postal code. “On-reserve” residence was established by postal code areas associated with an Indian reserve or settlement. Health Service Delivery Areas (HSDAs were classified as “metropolitan” if they contained a population of at least 100,000 with a density of 400 or more people per square kilometre. We calculated the crude hospitalization incidence rate and the Standardized Relative Risk (SRR of hospitalization due to injury standardizing by gender, 5-year age group, and HSDA. We assessed cumulative change in SRR over time as the relative change between the first and last years of the observation period. Results Aboriginal metropolitan populations living off-reserve had the lowest SRR of injury (2.0, but this was 2.3 times greater than the general British Columbia metropolitan population (0.86. For intentional injuries, Aboriginal populations living on-reserve in non-metropolitan areas were at 5.9 times greater risk than the total BC population. In general, the largest injury disparities were evident for Aboriginal non-metropolitan populations living on-reserve (SRR 3.0; 2.5 times greater than the general BC non-metropolitan population (1
Internal exposure of populations to long-lived radionuclides released into the environment
International Nuclear Information System (INIS)
Balonov, M.I.
1997-01-01
This chapter discusses the events that led to the contamination of environments with the long-lived radionuclides of caesium, strontium and other elements, and to the internal exposure of populations living in contaminated areas. Among these events are radioactive releases into the river Techa from the Soviet nuclear weapons facility Mayak in 1949-1956, thermonuclear weapons test in the 1950s and 1960s, the Kyshtim and Windscale accidents in 1957, and the Chernobyl and Tomsk-7 accidents in 1986 and 1993, respectively. Methods of environmental monitoring and individual internal dose monitoring of inhabitants are described. These are based on measuring the content of radionuclides not only in the air, drinking water and local food products, but also in humans using whole-body counters and analysing excreta and autopsy samples. The dynamics of internal exposure of people of different ages to radionuclides of caesium, strontium and plutonium from the environment are considered. Examples of radionuclide distributions in the environment, and of individual/collective internal doses and related medical effects are presented. (Author)
Current radiological simulation and dose assessment on the population living in the Techa Basin
International Nuclear Information System (INIS)
Golikov, V.Yu.; Balonov, M.I.; Bruk, G.Ya.
2002-01-01
In the beginning of the fifties, planned releases of liquid radioactive wastes were performed from the radiochemical enterprise Mayak to the riverbed of the Techa river flowing in the area of the Chelyabinsk region. These releases caused high contamination of the riverbed and water meadows of the Techa river especially by 9 0S r and 1 37C s. After the termination of intensive releases, a part of the population living in the riverside settlements (15 settlements with total population of 72000 persons) was resettled from 1954-1962. Within the Chelyabinsk region, four inhabited settlements remained on the river: Muslyumovo, Brodokalmak, Russkaya Techa and Nizhnepetropavlovskoye with a total population of 9229 persons according to the census of 1989. The second, but much less significant, source of contamination to this environment was the dispersion and transport of contaminated sediments from Lake Karachay in 1967 [Romanov et al. 1995; Kryshev et al. 1998; Kravtsova et al. 1998]. The overall purpose of this work was determination of ways and estimation of current levels of exposure to population of two settlements, Muslyumovo and Brodokalmak, which is necessary for development of measures on radiation and social protection of population
Guerrier, Gilles; Zounoun, Malaïka; Delarosa, Olimpia; Defourny, Isabelle; Lacharite, Michelo; Brown, Vincent; Pedalino, Biagio
2009-01-01
Background Certain population groups have been rendered vulnerable in Chad because of displacement of more than 200,000 people over the last three years as a result of mass violence against civilians in the east of the country. The objective of the study was to assess mortality and nutritional patterns among displaced and non-displaced population living in camps, villages and a town in the Ouddaï and Salamat regions of Chad. Methodology Between May and October 2007, two stage, 30-cluster household surveys were conducted among 43,900 internally displaced persons (IDPs) living in camps in Ouaddai region (n = 898 households), among 19,400 non-displaced persons (NDPs) living in 42 villages in Ouaddai region (n = 900 households) and among 17,000 NDPs living in a small town in Salamat region (n = 901 households). Data collection included anthropometric measurements, measles vaccination rates and retrospective mortality. Crude mortality rate (CMR), mortality rate among children younger than 5 years (U5MR), causes of death and the prevalence of wasting (weight-for-height z score malnutrition rates (according to the WHO definition) among 904 IDP children, 956 NDPs children living in a village, 901 NDP children living in a town aged 6 to 59 months were 20.6% (95% CI, 17.9%–23.3%), 16.4% (95% CI, 14.0%–18.8%) and 10.1% (95% CI, 8.1%–12.2%) respectively. The study found a high mortality rate among IDPs and an elevated prevalence of wasting not only in IDP camps but also in villages located in the same region. The town-dweller population remains at risk of malnutrition. Appropriate contingency plans need to be made to ensure acceptable living standards for these populations. PMID:19956627
Time-Location Patterns of a Population Living in an Air Pollution Hotspot
International Nuclear Information System (INIS)
Wu, X.M.; Fan, Z.T.; Strickland, P.O.; Wu, X.M.; Fan, Z.T.; Strickland, P.O.
2010-01-01
This study characterized the time-location pattern of 107 residents living in air pollution hotspots, the Waterfront South and Cope wood/Davis Streets communities in Camden, NJ. Most residents in the two communities are minority and impoverished individuals. Results showed that employment status played the fundamental role in determining time-location patterns of this study population, and the variations of time-location pattern by season and by day-type were partially attributed to employment status. Compared to the National Human Activity Pattern Survey, the Camden cohort spent significantly more time outdoors (3.8 hours versus 1.8 hours) and less time indoors (19.4 hours versus 20.9 hours) than the general US population, indicating a higher risk of exposure to ambient air pollution for the Camden cohort. The findings of the study are important for understanding exposure routes and sources for the socio economically disadvantaged subgroup and ultimately help develop effective strategies to reduce community exposure to ambient air pollution in hotspots
Culture and Learner Beliefs: A Study of Three Malay Postgraduate Students
Directory of Open Access Journals (Sweden)
Faizah A Majid
2008-06-01
Full Text Available Culture influences how people experience. Although there is literature on how culture can influence adult learners’ orientation to learning, there is little on how culture influences the nature of successful learning amongst adults (Merriam and Mohamad, 2000. The purpose of this paper is to examine how cultural values influence a selected group of successful adult learners’ views on learning in the Malaysian education context. A qualitative research design was adopted to explore this question. Three postgraduates who had completed their studies on time were interviewed. Using the constant comparative method of data analysis (Wellington, 2000, five cultural values as identified by Abdullah (1996 and Hofstede (1991; collectivistic, religious, relationship-oriented, hierarchical, and face conscious were used to serve as the main themes in the analysis. In analysing the data, three cultural values emerged; religious, relationship-oriented and, collectivistic. These findings have implications for understanding how cultural values may influence adult Malay students’ views on learning.
Suwondo, Darmadi, Yunus, Mohd.
2017-11-01
Green campus program (GCP) is a policy to optimize the role of the University of Riau in implementing sustainable development. Green campus development is done by integrating Malay culture and conservation in every implementation of the program. We identify the biophysical, economic and socio-cultural characteristics as well as the problems encountered in the campus environment. This study uses desk study, survey, and focus group discussion (FGD). GCP analysis is divided into several stages, namely assess problem, design, implementation, monitor, evaluate and adjust. Bina Widya Campus of Universitas Riau has a good biodiversity of flora and fauna with species characteristics in lowland tropical forest ecosystems. Plant species of the Dipterocarpaceae family are the dominant species, whereas fauna is from reptile, leaves, and mammals. Efforts to maintain and enhance species diversity are undertaken by designing and constructing Arboretum and Ecoedupark for the ex situ conservation of flora and fauna. The enrichment of species is carried out by planting vegetation types that are closely related to Malay culture. On the other hand, the management of the green campus faces challenges in the diverse perceptions of stakeholders with low levels of academic participation. Economically the existence of the campus provides a multiplier effect on the emergence of various economic activities of the community around the campus. Implementation of green university campus of Riau University by integrating Melayu culture and conservation contributes to the creation of green open space which is increasingly widespread and able to support sustainable development, especially in Pekanbaru City.
Suzana, S; Boon, P C; Chan, P P; Normah, C D
2013-04-01
Malnutrition is a common phenomenon among the elderly and quite often related to psychosocial problems. The objective of this study was to determine malnutrition risk and its association with appetite, functional and psychosocial status among elderly Malays in an agricultural settlement, i.e. FELDA Sungai Tengi, Selangor. A cross-sectional study was conducted among 160 subjects (men = 36.2%), with a mean age of 65.0 +/- 3.9 years, who were interviewed to obtain information on malnutrition risk and appetite using Mini Nutritional Assessment Short Form and Simplified Nutritional Appetite Questionnaire, respectively. Functional status was determined using Instrumental Activities of Daily Living (IADL), Elderly Mobility Scale (EMS) and handgrip strength. Mini Mental Status Examination (MMSE), Geriatric Depression Scale and De Jong Gierveld Loneliness Scale were used to identify cognitive impairment, depressive symptoms and loneliness status of subjects respectively. A total of 42.5% of subjects were at risk of malnutrition and 61.2% had poor appetite. The mean scores of IADL and EMS were lower in subjects at risk of malnutrition, compared to those who were not at high risk (p risk was predicted by poor appetite, decreased functional status (IADL) and depression. Malnutrition risk was prevalent and associated with poor appetite, functional status and psychosocial problems among the elderly subjects. The psychosocial aspect should also be incorporated in nutrition intervention programmes in order to improve mental well-being and functional independancy.
Tan, Chuen Seng; Müller-Riemenschneider, Falk; Ng, Sheryl Hui Xian; Tan, Pei Zheng; Chan, Bernard P L; Tang, Kok-Foo; Ahmad, Aftab; Kong, Keng He; Chang, Hui Meng; Chow, Khuan Yew; Koh, Gerald Choon-Huat; Venketasubramanian, Narayanaswamy
2015-10-01
This study investigated trends in stroke incidence and case fatality overall and according to sex, age, ethnicity, and stroke subtype in a multiethnic Asian population. The Singapore Stroke Registry identifies all stroke cases in all public hospitals using medical claims, hospital discharge summaries, and death registry data. Age-standardized incidence rates and 28-day case-fatality rates were calculated for individuals aged ≥15 years between 2006 and 2012. To estimate the annual percentage change of the rates, a linear regression model was fitted to the log rates, and a Wald test was performed to test for trend. P values Chinese (-2.64; 95% CI, -3.15 to -2.13), Indians (-3.78; 95% CI, -5.93 to -1.58), and others (-12.73; 95% CI, -18.93 to -6.06) compared with Malays (2.58; 95% CI, 1.17 to 4.02); and in ischemic stroke subtype (ischemic: -2.43; 95% CI, -3.13 to -1.73; hemorrhagic: -1.02; 95% CI, -2.04 to 0.01). Subgroup-specific findings for case fatality were similar. This is the first countrywide hospital-based registry study in a multiethnic Asian population, and it revealed marked overall reductions in stroke incidence and case fatality. However, it also identified important population groups with less favorable trends, especially younger adults and those of Malay ethnicity. © 2015 American Heart Association, Inc.
Ríos, A; López-Navas, A I; De-Francisco, C; Sánchez, Á; Hernández, A M; Ramírez, P; Parrilla, P
2018-03-01
The attitude toward living kidney donation is important for certain promotion campaigns, however, there are few validated questionnaires in this regard. The aim of this work was to analyze the psychometric characteristics of the attitudes questionnaire about living renal donation, PCID-DVR-Ríos (Cuestionario del Proyecto Colaborativo Internacional Donante sobre Donación de Vivo Renal [Questionnaire of the International Collaborative Donor Project on Living Kidney Donation] developed by Dr Ríos) for the validation of the questionnaire in population of Spanish speakers. The sample studied represented the population >18 years of age, native and resident of Spain, stratified by age and sex. The measurement instrument was the PCID-DVR-Ríos questionnaire. Analysis of data was structured in several stages: an initial description of the data, exploratory factor analysis, item analysis, and internal consistency of the factors. The questionnaire consists of 11 items, distributed in 3 factors of 6, 3, and 2 items. This structure accounts for 63.995% of the total variance. By factors, the variance is distributed as follows: factor 1: 38.461%; factor 2: 14.228%; and factor 3: 11.306%. The analysis of items and internal consistency supported the trifactorial composition. Each factor is internally consistent (α1 = .80; α2 = .70; α3 = .55). The analyzed dimensions of the PCID-DVR Ríos questionnaire to analyze attitude toward living kidney donation showed a good fit in terms of factorial validity and internal consistency values. Copyright © 2017 Elsevier Inc. All rights reserved.
ZHUNUSSOVA T.; GROSCHE B.; APSALIKOV K.; BELIKHINA T.; PIVINA L.; MULDAGALIEV T.
2014-01-01
In the paper we have presented the possibilities of prospective cohort study of health status in the radiation exposed population living around the Semipalatinsk nuclear test site. It was substantiated the necessity of international cooperation of scientists from Kazakhstan, Europe, Japan and the United States for long-term study of radiation effects for the people and the environment.
Reconstructions of human history by mapping dental markers in living Eurasian populations
Kashibadze, Vera F.; Nasonova, Olga G.; Nasonov, Dmitry S.
2013-01-01
Using advances in gene geography and anthropophenetics, the phenogeographical method for anthropological research was initiated and developed using dental data. Statistical and cartographical analyses are provided for 498 living Eurasian populations. Mapping principal components supplied evidence for the phene pool structure in Eurasian populations, and for reconstructions of Homo sapiens history on the continent. Longitudinal variability seems to be the most important regularity revealed by principal components analysis (PCA) and mapping, indicating the division of the whole area into western and eastern main provinces. So, the most ancient scenario in the history of Eurasian populations developed from two perspective different groups: a western group related to ancient populations of West Asia and an eastern one rooted in ancestry in South and/or East Asia. In spite of the enormous territory and the revealed divergence, the populations of the continent have undergone wide scale and intensive timeespace interaction. Many details in the revealed landscapes are background to different historical events. Migrations and assimilation are two essential phenomena in Eurasian history: the widespread of the western combination through the whole continent to the Pacific coastline and the movement of the paradoxical combinations of eastern and western markers from South or Central Asia to the east and west. Taking into account that no additional eastern combinations in the total variation in Asian groups have been found, but that mixed or western markers' sets and that eastern dental characteristics are traced in Asia since Homo erectus, the assumption is made in favour of the hetero-level assimilation in the eastern province and of net-like evolution of H. sapiens.
Carrasco, Elena P; Pérez, Francisco B; Angel, Bárbara B; Albala, Cecilia B; Santos, J Luis M; Larenas, Gladys Y; Montalvo, Domingo V
2004-10-01
The prevalence of cardiovascular risk factors is increasing in aboriginal populations in Chile. To study the prevalence of obesity, type 2 diabetes and serum lipids in two aboriginal populations, Mapuche and Aymara, that were transferred from a rural to a urban environment. Two groups of subjects over 20 years were analyzed, Mapuche and Aymara. The Mapuche group was formed by 42 men and 105 women, living in four urban communities of Santiago, and an Aymara group formed by 42 men and 118 women, living in Arica, in Northern Chile. Anthropometric measurements, blood pressure, lipid profile, oral glucose tolerance test, fasting insulin and serum leptin were determined. The prevalence of type 2 diabetes was 6.9% in Aymara and 8.2% in Mapuche subjects. The frequency of glucose intolerance was similar in both groups, but greater among men. A total blood cholesterol over 200 mg/dl was observed in 43.1% of Aymara and 27.9% of Mapuche subjects (p Mapuche individuals, respectively (p= NS). The prevalence of type 2 diabetes and dyslipidemia in turban aboriginal populations is higher than that of their rural counterparts. A possible explanation for these results are changes in lifestyles that come along with urbanization, characterized by a high consumption of saturated fat and refined sugars and a low level of physical activity.
International Nuclear Information System (INIS)
Jin Hua; Yue Qingyu
1989-01-01
According to the distribution of cosmic ray ionization with altitude and latitude as well as the census information in all of our country (the end of the year 1986), the population-weighted mean annual effective dose equivalent received by the population living at mainland areas of China is estimated to be about 278 μSv, in which the ionizing component and the neutron component are 252 μSv and 26 μSv, respectively
Bailey, Phillippa K; Tomson, Charles Rv; Ben-Shlomo, Yoav
2013-01-01
Socioeconomic deprivation is associated with higher renal replacement therapy acceptance rates in the UK but lower rates of living kidney transplantation. This study examines donor-recipient relationship patterns with socioeconomic deprivation in the white population of England. Demographic characteristics of all white live renal transplant donors and recipients between 2001 and 2010 in England were analyzed. Patterns of donor-recipient relationship were analyzed to see whether they differed according to an ecological measure of socioeconomic status (Index of Multiple Deprivation). Group comparisons were performed using chi-square tests and multivariable logistic regression. Sources of living kidney transplants differed with deprivation (p Recipients living in poorer areas were more likely to receive a kidney from a sibling, child, and "other relative" donor and less likely from spouses/partners. Logistic regression suggested differences seen with spouse/partner donations with deprivation were explained by differences in the age and gender of the recipients. The source of living kidneys differs by level of area deprivation. Given the disparity in rates of living kidney transplants between the most and least socioeconomically deprived, there is a need to understand the reasons behind these observed relationship differences, with the aim of increasing transplantation rates in the most deprived. © 2013 John Wiley & Sons A/S.
Yew, Chee-Wei; Lu, Dongsheng; Deng, Lian; Wong, Lai-Ping; Ong, Rick Twee-Hee; Lu, Yan; Wang, Xiaoji; Yunus, Yushimah; Aghakhanian, Farhang; Mokhtar, Siti Shuhada; Hoque, Mohammad Zahirul; Voo, Christopher Lok-Yung; Abdul Rahman, Thuhairah; Bhak, Jong; Phipps, Maude E; Xu, Shuhua; Teo, Yik-Ying; Kumar, Subbiah Vijay; Hoh, Boon-Peng
2018-02-01
Southeast Asia (SEA) is enriched with a complex history of peopling. Malaysia, which is located at the crossroads of SEA, has been recognized as one of the hubs for early human migration. To unravel the genomic complexity of the native inhabitants of Malaysia, we sequenced 12 samples from 3 indigenous populations from Peninsular Malaysia and 4 native populations from North Borneo to a high coverage of 28-37×. We showed that the Negritos from Peninsular Malaysia shared a common ancestor with the East Asians, but exhibited some level of gene flow from South Asia, while the North Borneo populations exhibited closer genetic affinity towards East Asians than the Malays. The analysis of time of divergence suggested that ancestors of Negrito were the earliest settlers in the Malay Peninsula, whom first separated from the Papuans ~ 50-33 thousand years ago (kya), followed by East Asian (~ 40-15 kya), while the divergence time frame between North Borneo and East Asia populations predates the Austronesian expansion period implies a possible pre-Neolithic colonization. Substantial Neanderthal ancestry was confirmed in our genomes, as was observed in other East Asians. However, no significant difference was observed, in terms of the proportion of Denisovan gene flow into these native inhabitants from Malaysia. Judging from the similar amount of introgression in the Southeast Asians and East Asians, our findings suggest that the Denisovan gene flow may have occurred before the divergence of these populations and that the shared similarities are likely an ancestral component.
Hwa, Hsiao-Lin; Lee, James Chun-I; Chang, Yih-Yuan; Yin, Hsiang-Yi; Chen, Ya-Hui; Tseng, Li-Hui; Su, Yi-Ning; Ko, Tsang-Ming
2011-01-01
A 13 X-chromosomal short tandem repeat (STR) multiplex system (DXS6807, DXS8378, DSX9902, DXS7132, DXS9898, DXS6809, DXS6789, DXS7424, DXS101, GATA172D05, HPRTB, DXS8377, and DXS7423) was tested on 1,037 DNA samples from eight population groups currently living in Taiwan. Different distributions of the allelic frequencies in different populations were presented. DXS8377 and DXS101 were the two most polymorphic loci in these eight populations, whereas DXS7423 was the least informative marker in most of the populations studied. The genetic distances between the populations and the constructed phylogenetic tree revealed a long genetic distance between Asian and Caucasian populations as well as isolation of the Tao population. The phylogenetic tree grouped populations into clusters compatible with their ethnogeographic relationships. This 13 X-chromosomal short tandem repeat multiplex system offers a considerable number of polymorphic patterns in different populations. This system can be useful in forensic identification casework and ethnogeographic research.
NG, Chong Guan; CHIN, Soo Cheng; YEE, Anne Hway Ann; LOH, Huai Seng; SULAIMAN, Ahmad Hatim; Sherianne Sook Kuan, WONG; HABIL, Mohamed Hussain
2014-01-01
Background: The Snaith-Hamilton Pleasure Scale (SHAPS) is a self-assessment scale designed to evaluate anhedonia in various psychiatric disorders. In order to facilitate its use in Malaysian settings, our current study aimed to examine the validity of a Malay-translated version of the SHAPS (SHAPS-M). Methods: In this cross-sectional study, a total of 44 depressed patients and 82 healthy subjects were recruited from a university out-patient clinic. All participants were given both the Malay and English versions of the SHAPS, Fawcett-Clark Pleasure Scale (FCPS), General Health Questionnaire 12 (GHQ-12), and the Beck Depression Inventory (BDI) to assess their hedonic state, general mental health condition and levels of depression. Results: The results showed that the SHAPS-M has impressive internal consistency (α = 0.96), concurrent validity and good parallel-form reliability (intraclass coefficient, ICC = 0.65). Conclusion: In addition to demonstrating good psychometric properties, the SHAPS-M is easy to administer. Therefore, it is a valid, reliable, and suitable questionnaire for assessing anhedonia among depressed patients in Malaysia. PMID:25246837
Ng, Chong Guan; Chin, Soo Cheng; Yee, Anne Hway Ann; Loh, Huai Seng; Sulaiman, Ahmad Hatim; Sherianne Sook Kuan, Wong; Habil, Mohamed Hussain
2014-05-01
The Snaith-Hamilton Pleasure Scale (SHAPS) is a self-assessment scale designed to evaluate anhedonia in various psychiatric disorders. In order to facilitate its use in Malaysian settings, our current study aimed to examine the validity of a Malay-translated version of the SHAPS (SHAPS-M). In this cross-sectional study, a total of 44 depressed patients and 82 healthy subjects were recruited from a university out-patient clinic. All participants were given both the Malay and English versions of the SHAPS, Fawcett-Clark Pleasure Scale (FCPS), General Health Questionnaire 12 (GHQ-12), and the Beck Depression Inventory (BDI) to assess their hedonic state, general mental health condition and levels of depression. The results showed that the SHAPS-M has impressive internal consistency (α = 0.96), concurrent validity and good parallel-form reliability (intraclass coefficient, ICC = 0.65). In addition to demonstrating good psychometric properties, the SHAPS-M is easy to administer. Therefore, it is a valid, reliable, and suitable questionnaire for assessing anhedonia among depressed patients in Malaysia.
Zheng, D-J; Xie, L-S; Zhu, J-H; Zhang, Z-L
2012-09-01
Historical population bottlenecks and natural selection have important effects on the current genetic diversity and structure of long-lived trees. Dracaena cambodiana is an endangered, long-lived tree endemic to Hainan Island, China. Our field investigations showed that only 10 populations remain on Hainan Island and that almost all have been seriously isolated and grow in distinct habitats. A considerable amount of genetic variation at the species level, but little variation at the population level, and a high level of genetic differentiation among the populations with limited gene flow in D. cambodiana were detected using inter-simple sequence repeat (ISSR) and random amplified polymorphic DNA (RAPD) analyses. No significant correlation was found between genetic diversity and actual population size, as the genetic diversities were similar regardless of population size. The Mantel test revealed that there was no correlation between genetic and geographic distances among the 10 populations. The UPGMA, PCoA and Bayesian analyses showed that local adaptive divergence has occurred among the D. cambodiana populations, which was further supported by habitat-private fragments. We suggest that the current genetic diversity and population differentiation of D. cambodiana resulted from historical population bottlenecks and natural selection followed by historical isolation. However, the lack of natural regeneration of D. cambodiana indicates that former local adaptations with low genetic diversity may have been genetically weak and are unable to adapt to the current ecological environments. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.
Climate change and functional traits affect population dynamics of a long-lived seabird.
Jenouvrier, Stéphanie; Desprez, Marine; Fay, Remi; Barbraud, Christophe; Weimerskirch, Henri; Delord, Karine; Caswell, Hal
2018-07-01
Recent studies unravelled the effect of climate changes on populations through their impact on functional traits and demographic rates in terrestrial and freshwater ecosystems, but such understanding in marine ecosystems remains incomplete. Here, we evaluate the impact of the combined effects of climate and functional traits on population dynamics of a long-lived migratory seabird breeding in the southern ocean: the black-browed albatross (Thalassarche melanophris, BBA). We address the following prospective question: "Of all the changes in the climate and functional traits, which would produce the biggest impact on the BBA population growth rate?" We develop a structured matrix population model that includes the effect of climate and functional traits on the complete BBA life cycle. A detailed sensitivity analysis is conducted to understand the main pathway by which climate and functional trait changes affect the population growth rate. The population growth rate of BBA is driven by the combined effects of climate over various seasons and multiple functional traits with carry-over effects across seasons on demographic processes. Changes in sea surface temperature (SST) during late winter cause the biggest changes in the population growth rate, through their effect on juvenile survival. Adults appeared to respond to changes in winter climate conditions by adapting their migratory schedule rather than by modifying their at-sea foraging activity. However, the sensitivity of the population growth rate to SST affecting BBA migratory schedule is small. BBA foraging activity during the pre-breeding period has the biggest impact on population growth rate among functional traits. Finally, changes in SST during the breeding season have little effect on the population growth rate. These results highlight the importance of early life histories and carry-over effects of climate and functional traits on demographic rates across multiple seasons in population response to climate
Chin, Chee Tang; Gao, Fei; Keng, Felix Y J; Shah, Bimal R; Koh, Angela S; Tan, Ru San; Chua, Terrance S J
2014-12-01
Ischemic heart disease is growing by epidemic proportions in Asia. Among patients in Western populations with similar myocardial perfusion imaging (MPI) ischemia severity, ethnicity is independently associated with mortality. We aimed to determine the differential prognostic value of MPI abnormality severity among three major Asian ethnic groups. From 16,921 consecutive patients, we used summed stress score to define increasing abnormal scan severity groups (minimal, mild, moderate, and severe) among Chinese, Indian, and Malay patients. We determined mortality from the national death registry. Using multivariable Cox regression models, we examined the association between ethnicity and mortality. Chinese patients were older than Indians or Malays. Annual all-cause death rates increased with increasing abnormal scan severity in all three ethnicities. After adjustment, ethnicity was not associated with mortality. With Chinese as the reference group, adjusted hazard ratio and 95% CI for Malays and Indians were 1.29 (0.95-1.77) and 1.06 (0.74-1.50) in the minimally abnormal scan group, and 1.20 (0.75-1.91) and 0.82 (0.47-1.45) in the severely abnormal scan group, respectively. Mortality risk is related to the severity of scan abnormality and is independent of ethnicity in Asians. Our findings emphasize the continued utility of MPI in guiding risk stratification in Asia.
Directory of Open Access Journals (Sweden)
tengku winona Emelia
2017-07-01
Full Text Available The purpose of this study was conducted by the fact that the artistic of oral tradition cenggok-cenggok is almost extinct. This tradition is one of the Malay society Panai cultures that were once widespread in the community in Labuhanbatu. This tradition includes the noble values that can be positively applied in social life associated with their moral messages, beliefs, social norms, and the value of education which can be used formally or informally. A descriptive qualitative ethnographic approach was utilized in this current study. The focus on this research is the form of performance, text, and context. The results showed that the oral tradition cenggok-cenggok is a cultural communication event that has a dimension of social, cultural and aesthetic as a form of creativity that generates interaction between performer and audience in the play.
Hood, Julia E; Golden, Matthew R; Hughes, James P; Goodreau, Steven M; Siddiqi, Azfar-E-Alam; Buskin, Susan E; Hawes, Stephen E
2017-12-01
The transformation of HIV from a fatal disease to lifelong disease has resulted in an HIV-infected population that is growing and aging, placing new and increasing demands on public programs and health services. We used National HIV Surveillance System and US census data to project the demographic composition of the population of people living with diagnosed HIV (PLWDH) in the United States through 2045. The input parameters for the projections include: (1) census projections, (2) number of people with an existing HIV diagnosis in 2013, (3) number of new HIV diagnoses in 2013, and (4) death rate within the PLWDH population in 2013. Sex-, risk group-, and race-specific projections were estimated through an adapted Leslie Matrix Model for age-structured populations. Projections for 2013-2045 suggest that the number of PLWDH in the U.S. will consistently grow, from 917,294 to 1,232,054, though the annual growth rate will slow from 1.8% to 0.8%. The number of PLWDH aged 55 years and older will increase from 232,113 to 470,221. The number of non-Hispanic (NH) African Americans/Blacks and Hispanics is projected to consistently grow, shifting the racial/ethnic composition of the US PLWDH population from 32 to 23% NH-White, 42 to 38% NH-Black, and 20-32% Hispanic between 2013 and 2045. Given current trends, the composition of the PLWDH population is projected to change considerably. Public health practitioners should anticipate large shifts in the age and racial/ethnic structure of the PLWDH population in the United States.
Directory of Open Access Journals (Sweden)
D. S. Farrer
2012-11-01
Full Text Available From the 1960s the Malays of Singapore were mandated to relocate from kampung (village locations to “modern” concrete housing blocks. Their former villages, consisting of wooden houses built on stilts, were razed for concrete social housing, accompanied by a policy enforcing a rigorous ethnic quota “representative” of the multi-ethnic composition of Singapore. The mandatory “relocation” of the populace was packaged by the local state/media in social evolutionary terms as “progress.” Nowadays, people descended from the villages periodically reconvene at Malay weddings held across the Island. The weddings occur under the giant concrete housing blocks, utilizing the same space where Chinese funerals lay their dead. Wedding silat, a Malay martial art danced at weddings, is a rite of aggregation to welcome new family members, and acknowledge the realignment of wider kinship structures. The performance of wedding silat illuminates performance in relation to traditional and modern power structures. Given the colossal rationalization of Singapore, the physical extinction of the kampung, the Islamization of the Malays, and the general malaise of nostalgic disenchantment with the present, the performance of silat empowers Malays to re-enchant their world. In the process, to secure, preserve, and manufacture Malay identity, ritual performances reunite the scattered minority community in a reconstituted space, a virtual kampung.à partir des années 1960, les Malais de Singapour ont été mis dans l’obligation de se reloger de leurs villages traditionnels (kampung dans des constructions « modernes » en béton. Leurs villages d’origine – faits de maisons en bois sur pilotis – ont été rasés pour être remplacés par des logements sociaux en dur, le tout accompagné d’une politique rigoureuse de quotas représentatifs de la composition multi-ethnique de Singapour. Cette réinstallation forcée a été présentée en termes de
Population ecology and conservation of beetles and pseudoscorpions living in hollow oaks in Sweden
Ranius, T.
2002-01-01
This paper aims at giving a summary of recent research on the habitat requirements and population structure of beetles and pseudoscorpions living in old, hollow oaks in Sweden. An inventory of old oaks in pasture woodlands revealed that the species richness of beetles is higher at sites that are originally open and are still grazed. The trees in these plots are preferred for two reasons: they are more sun-exposed and have a larger trunk diameter. Many species are harmed by forest regrowth and...
Yang, W Y; Burrows, T; MacDonald-Wicks, L; Williams, L T; Collins, C E; Chee, W S S
2016-08-01
Childhood obesity is becoming more common as Malaysia experiences rapid nutrition transition. Current evidence related to parental influences on child dietary intake and body weight status is limited. The present study aimed to report, among Malay families, the prevalence of energy mis-reporting and dietary relationships within family dyads. The cross-sectional Family Diet Study (n = 236) was conducted at five primary schools in central of Peninsular Malaysia. Each family consisted of a Malay child, aged 8-12 years, and their main caregiver(s). Information on socio-demographics, dietary intake and anthropometry were collected. Correlations and regression analyses were used to assess dietary relationships within family dyads. Approximately 29.6% of the children and 75.0% parents were categorised as being overweight or obese. Intakes of nutrients and food groups were below the national recommended targets for majority of children and adults. A large proportion of energy intake mis-reporters were identified: mothers (55.5%), fathers (40.2%) and children (40.2%). Children's body mass index (BMI) was positively associated with parental BMI (fathers, r = 0.37; mothers, r = 0.34; P Malaysia. © 2016 The British Dietetic Association Ltd.
Anatomic Variation in Morphometry of Human Coracoid Process among Asian Population
Directory of Open Access Journals (Sweden)
Manal Fathi
2017-01-01
Full Text Available Ethnic origin plays an important role in bone morphometry. Studies examining the influence of coracoid process have focused primarily on adults and have not included people from diverse Asian ethnic backgrounds. Our goal was to explore ethnic differences in morphometry of coracoid among Asian population. We performed morphometric measurements of coracoid process on cadaveric shoulders and shoulder CT scans from 118 specimens. The cadaveric sample included Indian (46%, Chinese (27%, and Myanmarese (27% subjects, while the CT scans sample included Chinese (67% and Malay (33% subjects. The morphometric measurements were performed using digital caliper and software developed at Golden Horses Health Sanctuary (GHHS. In the Indian cadaveric shoulders, the coracoid process is better developed than the other groups with the exception of the tip width of coracoid process. There are significant differences in almost all measurements (P<0.05 between the ethnic groups. On the other hand, the morphometry of coracoid process from CT scans data is bigger in Chinese than Malay subjects when stratified by sex (P<0.05. Moreover, in all morphometric measurements, the females had smaller measurements than males (P<0.05. Understanding such differences is important in anatomy, forensic and biological identity, and orthopaedic and shoulder surgeries.
Directory of Open Access Journals (Sweden)
Henri Hartman
2014-11-01
Full Text Available Temporo Mandibular Joint Disorder (TMD could be caused by forward head posture. Articular sound/TMJ clicking is the most often sign and symptom for TMD that could happen in human being. The presence of TMD such as TMJ clicking would cause an imbalance masticatory system. The purpose of this research is to investigate TMJ clicking effects to masticatory performance. This research was cross-sectional study with a type of epidemiology survey. Subject were children aged 12-15 years old Deutero-Malay sub-races Live in Bandung and was taken using multi-stage random sampling technique. Subject; consisted of 24 children as control group and 28 children as TMJ clicking group. Both group were then checked for masticatory performance using multiple sieve method and 20x chewing of artificial test food. Mastication performance value represented by median particle size (MPS particle distribution (b for each group. MPS from TMJ clicking group (3.0571,SD=0.9990 showed higher value than control group (2.28958,SD=0.66838. Statistic analysis with t-test showed that there’s a significant result in both of group (pvalue=0,0024, α = 0,05. Conclussion, temporo mandibular joint clicking subject has lower masticatory performance.
DEFF Research Database (Denmark)
Petersen, H. I.; Sherwood, N.; Mathiesen, A.
2008-01-01
Several exploration wells have intersected a Cenozoic coal-bearing, fluvial-deltaic mudstone and sandstone succession in the northeastern Vietnamese part of the Malay Basin, and have successfully tested seismically identified direct hydrocarbon indicators (DHIs). The oil and gas/condensate discov......Several exploration wells have intersected a Cenozoic coal-bearing, fluvial-deltaic mudstone and sandstone succession in the northeastern Vietnamese part of the Malay Basin, and have successfully tested seismically identified direct hydrocarbon indicators (DHIs). The oil and gas...... for the uppermost Oligocene source rocks between 2Ma and present-day, which post-dates trap formation. Seismic facies patterns suggest that lacustrine oil-prone units are in he oil window in the same graben complex a few km NW of the investigated well, and these rocks are likely to be the source of the hydrocarbons....../condensate discovery ell 46-CN-1x encountered a _55m thick section of lacustrine mudstones having considerable potential as an oil source. Vitrinite reflectance (VR) measurements from these alginite-bearing rocks introduce several problems in thermal maturity evaluation, including associated VR suppression...
Correlates of anal sex roles among Malay and Chinese MSM in Kuala Lumpur, Malaysia.
Dangerfield, Derek T; Gravitt, Patti; Rompalo, Anne M; Tai, Raymond; Lim, Sin How
2016-03-01
Identifying roles for anal sex is an important issue for populations of MSM. We describe the prevalence of identifying as being 'top', 'bottom', 'versatile', or 'don't know/not applicable' among Malay and Chinese MSM in Kuala Lumpur, Malaysia, and behavioural outcomes according to these labels for sexual role identity. Data analysis was conducted on a survey administered during weekly outreach throughout Kuala Lumpur in 2012. Pearson's Chi square tests were used to compare demographic and behavioural characteristics of MSM who reported roles for anal sex. Binary logistic regression was used to explore the odds of behavioural outcomes among MSM who identified as 'bottom', 'versatile,' and 'don't know' compared to MSM who reported that 'top' was their sexual role. Labels for anal sex roles were significantly associated with condom use for last anal sex. Among MSM who used labels for anal sex roles, MSM who identified as 'bottom' had highest level of not using condoms for last anal sex (24.1%, p = .045). In binary logistic regression model, identifying as 'top' was significantly associated with reporting using a condom during last anal sex and reported consistent condom use for anal sex in the past six months (p = .039 and .017, respectively). With regard to sexual role identity, some MSM may be a part of a special subgroup of at-risk men to be targeted. Future research should evaluate the origins, meanings, and perceptions of these labels, and the developmental process of how these MSM identify with any of these categories. Research should also uncover condom use decision making with regard to these labels for sexual positioning. © The Author(s) 2016.
Population ecology and conservation of beetles and pseudoscorpions living in hollow oaks in Sweden
Directory of Open Access Journals (Sweden)
Ranius, T.
2002-01-01
Full Text Available This paper aims at giving a summary of recent research on the habitat requirements and population structure of beetles and pseudoscorpions living in old, hollow oaks in Sweden. An inventory of old oaks in pasture woodlands revealed that the species richness of beetles is higher at sites that are originally open and are still grazed. The trees in these plots are preferred for two reasons: they are more sun-exposed and have a larger trunk diameter. Many species are harmed by forest regrowth and, thus, to preserve the rarer saproxylic fauna it is important to continue the management of areas with old oaks. In four of thirteen species (Osmoderma eremita, Tenebrio opacus, Elater ferrugineus and Larca lata, the occupancy per tree were found to be significantly positively correlated with the number of trees in the stand. This finding is noteworthy as there is little scientific evidence available to support that saproxylic beetles suffer from habitat fragmentation. The population dynamics were investigated on a certain study species, O. eremita. The results suggest that the individuals of each tree could be seen as a local population, and the populations in all occupied trees in a stand together form a metapopulation.
Directory of Open Access Journals (Sweden)
Inayat Ur Rehman
2017-11-01
Full Text Available IntroductionSeveral tools have been developed to assess the severity of pruritus. In Malaysia, no tool has been validated to assess pruritus in patients with chronic kidney disease (CKD. Therefore, the aim of our study was to validate the Malay 5D itching scale (M5D-IS among patients with CKD in Malaysia.MethodThe English version of the 5D-IS was translated into Malay according to International Guidelines. Face and content validity was determined by an expert panel and pilot tested in patients with end-stage renal disease (ESRD. The M5D-IS was then validated in a tertiary hospital in Malaysia from May to June 2016. We recruited patients with (i.e., patients with ESRD and without pruritus (i.e., patients with stage 1–3 CKD (to determine if the M5D-IS could discriminate between the two groups, and administered the M5D-IS at baseline and 2 weeks later. Exploratory factor analysis was used to examine the construct validity. Internal consistency was assessed using Cronbach’s alpha and intraclass correlation coefficient was calculated to assess the reliability of the instrument.ResultsA total of 70 participants were recruited (response rate = 100%. The majority were males (51.4% and Malay (67.1%. Exploratory factor analysis revealed that the 5D-IS had 2-factor loadings: “daily routine activity” and “pattern of itching,” which explained 77.7% of the variance. The overall score of the M5D-IS, as well as for each domain, was significantly worse in participants with pruritus (9.83 ± 0.35, compared to those without pruritus (5.51 ± 0.93, p < 0.001. The overall Cronbach’s alpha for the M5D-IS was (0.861, indicating adequate internal consistency. At test–retest, the intraclass correlation coefficient was significantly correlated.ConclusionThe M5D-IS was found to be a valid and reliable instrument to assess pruritus among patients with CKD in Malaysia.
Deng, Lian; Hoh, Boon Peng; Lu, Dongsheng; Fu, Ruiqing; Phipps, Maude E; Li, Shilin; Nur-Shafawati, Ab Rajab; Hatin, Wan Isa; Ismail, Endom; Mokhtar, Siti Shuhada; Jin, Li; Zilfalil, Bin Alwi; Marshall, Christian R; Scherer, Stephen W; Al-Mulla, Fahd; Xu, Shuhua
2014-09-01
Peninsular Malaysia is a strategic region which might have played an important role in the initial peopling and subsequent human migrations in Asia. However, the genetic diversity and history of human populations--especially indigenous populations--inhabiting this area remain poorly understood. Here, we conducted a genome-wide study using over 900,000 single nucleotide polymorphisms (SNPs) in four major Malaysian ethnic groups (MEGs; Malay, Proto-Malay, Senoi and Negrito), and made comparisons of 17 world-wide populations. Our data revealed that Peninsular Malaysia has greater genetic diversity corresponding to its role as a contact zone of both early and recent human migrations in Asia. However, each single Orang Asli (indigenous) group was less diverse with a smaller effective population size (N(e)) than a European or an East Asian population, indicating a substantial isolation of some duration for these groups. All four MEGs were genetically more similar to Asian populations than to other continental groups, and the divergence time between MEGs and East Asian populations (12,000--6,000 years ago) was also much shorter than that between East Asians and Europeans. Thus, Malaysian Orang Asli groups, despite their significantly different features, may share a common origin with the other Asian groups. Nevertheless, we identified traces of recent gene flow from non-Asians to MEGs. Finally, natural selection signatures were detected in a batch of genes associated with immune response, human height, skin pigmentation, hair and facial morphology and blood pressure in MEGs. Notable examples include SYN3 which is associated with human height in all Orang Asli groups, a height-related gene (PNPT1) and two blood pressure-related genes (CDH13 and PAX5) in Negritos. We conclude that a long isolation period, subsequent gene flow and local adaptations have jointly shaped the genetic architectures of MEGs, and this study provides insight into the peopling and human migration
Stress associated with group living in a long-lived bird.
Selva, Nuria; Cortés-Avizanda, Ainara; Lemus, Jesús A; Blanco, Guillermo; Mueller, Thomas; Heinrich, Bernd; Donázar, José A
2011-08-23
Many long-lived avian species adopt life strategies that involve a gregarious way of life at juvenile and sub-adult stages and territoriality during adulthood. However, the potential associated costs of these life styles, such as stress, are poorly understood. We examined the effects of group living, sex and parasite load on the baseline concentration of faecal stress hormone (corticosterone) metabolites in a wild population of common ravens (Corvus corax). Corticosterone concentrations were significantly higher in non-breeding gregarious ravens than in territorial adults. Among territorial birds, males showed higher stress levels than their mates. Parasite burdens did not affect hormone levels. Our results suggest a key role of the social context in the stress profiles of the two population fractions, and that group living may be more energetically demanding than maintaining a territory. These findings have implications for understanding hormonal mechanisms under different life styles and may inspire further research on the link between hormone levels and selective pressures modulating gregarious and territorial strategies in long-lived birds. This journal is © 2011 The Royal Society
Raden Sanusi, H R; Werner, R
1985-01-01
The practitioners of traditional and indigenous medicine rely mainly upon medicinal plants and herbs for the preparation of therapeutic substances. The therapeutic properties of several medicinal plants and popular traditional medicine remedies are being investigated and validated. Present health care systems place people from developing countries in a dilemma. Countries can either continue providing a type of health care which cannot be extended to all in need or rethink and offer more inclusive types of medical care and delivery systems. Traditional medicine has a clear role to play in society, and even the World Health Organization supports the practice of traditional medicine to complement modern medicine. Traditional Malay medicine is the distillation of vast historical experience dating back more than 1000 years. It is often based upon observation, clinical trials, and experiments. The promotion and development of Malay traditional medicine can both foster dignity and self-confidence in communities through self-reliance, while considerably reducing the country's drug costs. The integrity and dignity of a people stems from self-respect and self-reliance. The practice of traditional medicine practitioners can help promote such conditions in many ways. It serves as an important focus for international technical cooperation and offers the potential for major breakthroughs in therapeutics and health care delivery. Effort should be taken to keep the practice of traditional medicine alive in Malaysia.
Construct validation of SF-36 Malay version among type 2 diabetes mellitus patients
Yap, Bee Wah; Jannoo, Zeinab; Razali, Nornadiah Mohd; Ghani, Nor Azura Md.; Lazim, Mohamad Alias
2015-02-01
The Short Form 36 (SF-36) is one of the most widely used generic health status measure. This study used the SF-36 Health Survey instrument to investigate the functional health and well-being of Malay Type 2 Diabetes Mellitus patients in Malaysia. The survey was carried out in three local hospitals in Selangor. The method of questionnaire administration was both self-administered and interviewer administered. A total of 354 questionnaires was returned, but only 295 questionnaires with no missing data were analyzed. Confirmatory Factor Analysis (CFA) was used to confirm the first-order and third-order CFA models. The higher order analyses included a third-order CFA models with two second-order factors (physical and mental component) and three second-order factors (physical, general well-being and mental health) and both showed satisfactory model fit indices. This study confirmed the multidimensional factor structure of the SF-36.
Wei See, Siao; Karthikeyan, Sathrugnan; Balasubramanian, Rajasekhar
2006-03-01
Food cooking using liquefied petroleum gas (LPG) has received considerable attention in recent years since it is an important source of particulate air pollution in indoor environments for non-smokers. Exposure to organic compounds such as polycyclic aromatic hydrocarbons (PAHs) contained in particles is of particular health concern since some of these compounds are suspected carcinogens. It is therefore necessary to chemically characterize the airborne particles emitted from gas cooking to assess their possible health impacts. In this work, the levels of fine particulate matter (PM(2.5)) and 16 priority PAHs were determined in three different ethnic commercial kitchens, specifically Chinese, Malay and Indian food stalls, where distinctive cooking methods were employed. The mass concentrations of PM(2.5) and PAHs, and the fraction of PAHs in PM(2.5) were the highest at the Malay stall (245.3 microg m(-3), 609.0 ng m(-3), and 0.25%, respectively), followed by the Chinese stall (201.6 microg m(-3), 141.0 ng m(-3), and 0.07%), and the Indian stall (186.9 microg m(-3), 37.9 ng m(-3), and 0.02%). This difference in the levels of particulate pollution among the three stalls may be attributed to the different cooking methods employed at the food stalls, the amount of food cooked, and the cooking time, although the most sensitive parameter appears to be the predominant cooking method used. Frying processes, especially deep-frying, produce more air pollutants, possibly due to the high oil temperatures used in such operations. Furthermore, it is found that frying, be it deep-frying at the Malay stall or stir-frying at the Chinese stall, gave rise to an abundance of higher molecular weight PAHs such as benzo[b]fluoranthene, indeno[1,2,3-cd]pyrene and benzo[g,h,i]perylene whereas low-temperature cooking, such as simmering at the Indian stall, has a higher concentration of lower molecular weight PAHs. In addition, the correlation matrices and diagnostic ratios of PAHs were
Directory of Open Access Journals (Sweden)
Rudini
2018-01-01
Full Text Available The purpose of this study is to model the migration of hydrocarbon using Geographic Information System (GIS. Understanding hydrocarbon migration is important since it can mean the difference between success and failure in oil and gas exploration project. The hydrocarbon migration modeling using geophysical method is still not accurate due to the limitations of available data. In recent years, GIS has emerged as a powerful tool for subsurface mapping and analysis. Recent studies have been carried out about the abilities of GIS to model hydrocarbon migration. Recent advances in GIS support the establishment and monitoring of prediction hydrocarbon migration. The concept, model, and calculation are based on the current geological situation. The spatial data of hydrocarbon reservoirs is determined by its geometry of lithology and geophysical attributes. Top of Group E horizon of north-east Malay basin was selected as the study area due to the occurrence of hydrocarbon migration. Spatial data and attributes data such as seismic data, wells log data and lithology were acquired and processed. Digital Elevation Model (DEM was constructed from the selected horizon as a result of seismic interpretation using the Petrel software. Furthermore, DEM was processed in ArcGIS as a base map to shown hydrocarbon migration in north-east Malay Basin. Finally, all the data layers were overlaid to produce a map of hydrocarbon migration. A good data was imported to verify the model is correct.
Rudini; Nasir Matori, Abd; Talib, Jasmi Ab; Balogun, Abdul-Lateef
2018-03-01
The purpose of this study is to model the migration of hydrocarbon using Geographic Information System (GIS). Understanding hydrocarbon migration is important since it can mean the difference between success and failure in oil and gas exploration project. The hydrocarbon migration modeling using geophysical method is still not accurate due to the limitations of available data. In recent years, GIS has emerged as a powerful tool for subsurface mapping and analysis. Recent studies have been carried out about the abilities of GIS to model hydrocarbon migration. Recent advances in GIS support the establishment and monitoring of prediction hydrocarbon migration. The concept, model, and calculation are based on the current geological situation. The spatial data of hydrocarbon reservoirs is determined by its geometry of lithology and geophysical attributes. Top of Group E horizon of north-east Malay basin was selected as the study area due to the occurrence of hydrocarbon migration. Spatial data and attributes data such as seismic data, wells log data and lithology were acquired and processed. Digital Elevation Model (DEM) was constructed from the selected horizon as a result of seismic interpretation using the Petrel software. Furthermore, DEM was processed in ArcGIS as a base map to shown hydrocarbon migration in north-east Malay Basin. Finally, all the data layers were overlaid to produce a map of hydrocarbon migration. A good data was imported to verify the model is correct.
Cole, Rebecca A.; Choudhury, Anindo; Nico, Leo G.; Griffin, Kathryn M.
2014-01-01
In Southeast Asia, swamp eels (Synbranchidae: Monopterus spp.) are a common source of human gnathostomiasis, a foodborne zoonosis caused by advanced third-stage larvae (AL3) of Gnathostoma spp. nematodes. Live Asian swamp eels are imported to US ethnic food markets, and wild populations exist in several states. To determine whether these eels are infected, we examined 47 eels from markets and 67 wild-caught specimens. Nematodes were identified by morphologic features and ribosomal intergenic transcribed spacer–2 gene sequencing. Thirteen (27.7%) M. cuchia eels from markets were infected with 36 live G. spinigerum AL3: 21 (58.3%) in liver; 7 (19.4%) in muscle; 5 (13.8%) in gastrointestinal tract, and 3 (8.3%) in kidneys. Three (4.5%) wild-caught M. albus eels were infected with 5 G. turgidum AL3 in muscle, and 1 G. lamothei AL3 was found in a kidney (both North American spp.). Imported live eels are a potential source of human gnathostomiasis in the United States.
Urrea Giraldo, Fernando; Rodríguez Sánchez, Diego Alejandro
2012-04-01
To describe the changes that occurred in some patterns of socio-demographic variables and in living conditions among the Nasa, Guambiana and Afrocolombian populations in the northern region of the Department of Cauca, and those occurring in two residential communities, one white-mestizo and one black, in Cali during the 1993-2005 period. This paper presents a descriptive study that analyzes several socio-demographic indicators from the census of 1993 and 2005, the specific data include: rate of juvenile dependency; total masculinity index; average size of the household; specific global and local birth rates, and infant mortality rates; life expectancy at birth; average years of schooling; health cover age status; and percentage of the population with unmet basic needs (UBN). In this way, it is possible to note differences in the course of socio-demographic evolution and in the standard of living trends in the differing populations under study. The Guambiana Indian population in the municipality of Silvia presents lower birth rates than the Nasa population, characterized by their seasonal birth rates. Differing from the pattern of the indigenous people of Northern Cauca, the Afro-Colombian population both from this region and from the population residing in the urban zones of Cali's tend to show similar socio-demographic patterns. Although there have been profound changes recorded during this period among these populations under study, the ethnic-racial inequalities and those of social class seem to persist. From this first diagnosis, attention is called to the need for a more adequate reproductive health policy to attend the specific needs presented by the indigenous population.
Neelakantan, Nithya; Whitton, Clare; Seah, Sharna; Koh, Hiromi; Rebello, Salome A.; Lim, Jia Yi; Chen, Shiqi; Chan, Mei Fen; Chew, Ling; van Dam, Rob M.
2016-01-01
Assessing habitual food consumption is challenging in multi-ethnic cosmopolitan settings. We systematically developed a semi-quantitative food frequency questionnaire (FFQ) in a multi-ethnic population in Singapore, using data from two 24-h dietary recalls from a nationally representative sample of 805 Singapore residents of Chinese, Malay and Indian ethnicity aged 18–79 years. Key steps included combining reported items on 24-h recalls into standardized food groups, developing a food list fo...
Koh, Victor; Cheung, Carol Y; Li, Xiang; Tian, Dechao; Wang, Jie Jin; Mitchell, Paul; Cheng, Ching-Yu; Wong, Tien Y
2016-01-01
To describe the prevalence of retinal vein occlusion (RVO) and its risk factors in a multi-ethnic Asian population. This population-based study of 10,033 participants (75.7% response rate) included Chinese, Indian and Malay persons aged 40 years and older. A comprehensive ophthalmic examination, standardized interviews and laboratory blood tests were performed. Digital fundus photographs were assessed for presence of RVO following the definitions used in the Blue Mountains Eye Study. Regression analysis models were constructed to study the relationship between ocular and systemic factors and RVO. Age-specific prevalence rates of RVO were applied to project the number of people affected in Asia from 2013 to 2040. The overall crude prevalence of RVO was 0.72% (n = 71; 95% confidence interval, CI, 0.54-0.87%). The crude prevalence of RVO was similar in Chinese, Indian and Malay participants (p = 0.865). In multivariable regression models, significant risk factors of RVO included increased age (odds ratio, OR, 1.03, 95% CI 1.01-1.06), hypertension (OR 3.65, 95% CI 1.61-8.31), increased serum creatinine (OR 1.04, 95% CI 1.01-1.06, per 10 mmol/L increase), history of heart attack (OR 2.25, 95% CI 1.11-4.54) and increased total cholesterol (OR 1.31, 95% CI 1.07-1.59, per 1 mmol/L increase). None of the ocular parameters were associated with RVO. RVO is estimated to affect up to 16 and 21 million people in Asia by 2020 and 2040, respectively. RVO was detected in 0.72% of a multi-ethnic Asian population aged 40-80 years in Singapore. The significant systemic risk factors of RVO are consistent with studies in white populations.
Population-based evaluation of the 'LiveLighter' healthy weight and lifestyle mass media campaign.
Morley, B; Niven, P; Dixon, H; Swanson, M; Szybiak, M; Shilton, T; Pratt, I S; Slevin, T; Hill, D; Wakefield, M
2016-04-01
The Western Australian (WA) 'LiveLighter' (LL) mass media campaign ran during June-August and September-October 2012. The principal campaign ad graphically depicts visceral fat of an overweight individual ('why' change message), whereas supporting ads demonstrate simple changes to increase activity and eat healthier ('how' to change message). Cross-sectional surveys among population samples aged 25-49 were undertaken pre-campaign (N= 2012) and following the two media waves (N= 2005 and N= 2009) in the intervention (WA) and comparison state (Victoria) to estimate the population impact of LL. Campaign awareness was 54% after the first media wave and overweight adults were more likely to recall LL and perceive it as personally relevant. Recall was also higher among parents, but equal between socio-economic groups. The 'why' message about health-harms of overweight rated higher than 'how' messages about lifestyle change, on perceived message effectiveness which is predictive of health-related intention and behaviour change. State-by-time interactions showed population-level increases in self-referent thoughts about the health-harms of overweight (P stereotypes of overweight individuals did not increase after LL aired. LL was associated with some population-level improvements in proximal and intermediate markers of campaign impact. However, sustained campaign activity will be needed to impact behaviour. © The Author 2016. Published by Oxford University Press.
Abdullah, Noraidatulakma; Borhanuddin, Boekhtiar; Patah, Afzan Effiza Abdul; Abdullah, Mohd Shaharom; Dauni, Andri; Kamaruddin, Mohd Arman; Shah, Shamsul Azhar
2018-01-01
Background. This study aimed to identify the factors of CAM usage for general health and to determine the factors associated with the usage of different types of CAM after the diagnosis of chronic diseases among The Malaysian Cohort participants. Methods. This was a cross-sectional study derived from The Malaysian Cohort (TMC) project, a prospective population-based cohort aged between 35 to 65 years old that recruited from April 2006 to September 2012. Association between the CAM usage and contributing factors were determined via logistic regression. Results. The sample were mostly female (58.1%), Malays (43.1%), came from urban (71.9%), aged 44 years and below (26.8%) and had secondary education (45.9%). The prevalence of CAM usage varied across diseases; 62.8% in cancer patients, 53.3% in hypercholesterolemia, 49.4% in hypertensives and 48.6% in diabetics. General CAM usage was greater among female (OR: 1.54, 95% CI: 1.49, 1.59), Chinese (OR: 1.15, 95% CI: 1.12, 1.19), those with higher education (OR: 3.12, 95% CI: 3.00, 3.25), urban residents (OR: 1.55, 95% CI: 1.50, 1.61) and older people (OR ranging from 1.15 to 1.75) while for post-diagnosis of chronic diseases usage, the odds were higher among those with lower education and living in rural areas. Conclusion. Health status, educational level, age, living location and types of chronic diseases were significant factors that influence CAM usage for the intent of either health maintenance or disease treatment. Further exploration on CAM safety and benefit are crucial to minimize the adverse effect and to ensure the efficacy of CAM product. PMID:29651870
Abdullah, Noraidatulakma; Borhanuddin, Boekhtiar; Patah, Afzan Effiza Abdul; Abdullah, Mohd Shaharom; Dauni, Andri; Kamaruddin, Mohd Arman; Shah, Shamsul Azhar; Jamal, Rahman
2018-01-01
This study aimed to identify the factors of CAM usage for general health and to determine the factors associated with the usage of different types of CAM after the diagnosis of chronic diseases among The Malaysian Cohort participants. This was a cross-sectional study derived from The Malaysian Cohort (TMC) project, a prospective population-based cohort aged between 35 to 65 years old that recruited from April 2006 to September 2012. Association between the CAM usage and contributing factors were determined via logistic regression. The sample were mostly female (58.1%), Malays (43.1%), came from urban (71.9%), aged 44 years and below (26.8%) and had secondary education (45.9%). The prevalence of CAM usage varied across diseases; 62.8% in cancer patients, 53.3% in hypercholesterolemia, 49.4% in hypertensives and 48.6% in diabetics. General CAM usage was greater among female (OR: 1.54, 95% CI: 1.49, 1.59), Chinese (OR: 1.15, 95% CI: 1.12, 1.19), those with higher education (OR: 3.12, 95% CI: 3.00, 3.25), urban residents (OR: 1.55, 95% CI: 1.50, 1.61) and older people (OR ranging from 1.15 to 1.75) while for post-diagnosis of chronic diseases usage, the odds were higher among those with lower education and living in rural areas. Health status, educational level, age, living location and types of chronic diseases were significant factors that influence CAM usage for the intent of either health maintenance or disease treatment. Further exploration on CAM safety and benefit are crucial to minimize the adverse effect and to ensure the efficacy of CAM product.
Directory of Open Access Journals (Sweden)
Bulgiba Awang
2011-09-01
Full Text Available Abstract Background Vitamin D status, as indicated by 25-hydroxyvitamin D is inversely associated with adiposity, glucose homeostasis, lipid profiles, and blood pressure along with its classic role in calcium homeostasis and bone metabolism. It is also shown to be inversely associated with metabolic syndrome and cardiovascular diseases in western populations. However, evidence from the Asian population is limited. Therefore, we aim to study the prevalence of vitamin D insufficiency ( Methods This is an analytical cross sectional study. A total of 380 subjects were sampled and their vitamins D status (25-hydroxyvitamin D, fasting blood glucose, full lipid profile were assessed using venous blood. Systolic and diastolic blood pressure, weight, height and waist circumference were measured following standard protocols. Socio-demographic data such as sex, age, smoking status etc were also collected. Data was analysed using t-test, chi-square test, General Linear Model and multiple logistic regression. Results Females made up 58% of the sample. The mean age of respondents was 48.5 (SD 5.2 years. Females had significantly lower mean Vitamin D levels (36.2; 95% CI: 34.5, 38.0 nmol/L compared to males (56.2; 95% CI: 53.2, 59.2 nmol/L. Approximately 41% and 87% of males and females respectively had insufficient ( Conclusions Our results highlight the high prevalence of vitamin D insufficiency among Malay adults in Kuala Lumpur. Vitamin D insufficiency is independently associated with younger age, female sex and greater abdominal obesity. Vitamin D insufficiency is also associated with Metabolic Syndrome.
International Nuclear Information System (INIS)
Lindholm, C.; Bersimbaev, R.I.; Dubrova, Y.E. EI KAUP; EI MAATA
2003-01-01
During the period between 1949 and 1989 nuclear weapon testing carried out at the Semipalatinsk Nuclear Test Site (STS) resulted in local fallout affecting the residents of Semipalatinsk, East Kazakhstan and Pavlodar districts of Kazakhstan and Altai region of Russia. The Semipalatinsk nuclear polygon in Kazakhstan has been the site for 470 nuclear tests, including 26 tests performed on the ground and 87 in the atmosphere. More than 1.5 million people living in the vicinity of the test site were repeatedly exposed to ionizing radiation. The paper reviews the study where the main objectives are: (1) to establish a biosample database of blood samples of families in three generations living close to the STS and control families in three generations from clean areas, (2) to determine the minisatellite mutation rates in the three generations of exposed people and the control families of the same ethinic origin living in non-contaminated areas, and (3) to determine the chromosomal translocation frequencies by FISH chromosome painting in the lymphocytes of the exposed and the control people in order to determine the radiation exposure. The aim of the study was to select the population living near to the STS and subjected to the greatest radiation exposure. Of particular interest was the first test of 29th of August 1949, as this was reported to have caused heavy fallout along a narrow trajectory extending north-east from Polygon, also covering parts of the Altai region of Russia and parts of Pavlodar and Karaganda regions in Kazakhstan
Lim, Cynthia C; Teo, Boon Wee; Ong, Peng Guan; Cheung, Carol Y; Lim, Su Chi; Chow, Khuan Yew; Meng, Chan Choon; Lee, Jeannette; Tai, E Shyong; Wong, Tien Y; Sabanayagam, Charumathi
2015-08-01
Few studies have examined the impact of chronic kidney disease (CKD) on adverse cardiovascular outcomes and deaths in Asian populations. We evaluated the associations of CKD with cardiovascular disease (CVD) and all-cause mortality in a multi-ethnic Asian population. Prospective cohort study of 7098 individuals who participated in two independent population-based studies involving Malay adults (n = 3148) and a multi-ethnic cohort of Chinese, Malay and Indian adults (n = 3950). CKD was assessed from CKD-EPI estimated glomerular filtration rate (eGFR) and urine albumin-to-creatinine ratio (UACR). Incident CVD (myocardial infarction, stroke and CVD mortality) and all-cause mortality were identified by linkage with national disease/death registries. Over a median follow-up of 4.3 years, 4.6% developed CVD and 6.1% died. Risks of both CVD and all-cause mortality increased with decreasing eGFR and increasing albuminuria (all p-trend <0.05). Adjusted hazard ratios (HR (95% confidence interval)) of CVD and all-cause mortality were: 1.54 (1.05-2.27) and 2.21 (1.67-2.92) comparing eGFR <45 vs ≥60; 2.81 (1.49-5.29) and 2.34 (1.28-4.28) comparing UACR ≥300 vs <30. The association between eGFR <60 and all-cause mortality was stronger among those with diabetes (p-interaction = 0.02). PAR of incident CVD was greater among those with UACR ≥300 (12.9%) and that of all-cause mortality greater among those with eGFR <45 (16.5%). In multi-ethnic Asian adults, lower eGFR and higher albuminuria were independently associated with incident CVD and all-cause mortality. These findings extend previously reported similar associations in Western populations to Asians and emphasize the need for early detection of CKD and intervention to prevent adverse outcomes. © The European Society of Cardiology 2014.
Women Living with HIV over Age of 65: Cervical Cancer Screening in a Unique and Growing Population
Directory of Open Access Journals (Sweden)
Alexandra Aserlind
2017-01-01
Full Text Available Objective. Women living with HIV are at increased risk of human papillomavirus (HPV infection, which can lead to cervical cancer. New guidelines recommend indefinite screening. The objective of this study is to describe cervical cancer screening practices and colposcopy results in a cohort of women living with HIV over age of 65 who were followed before the new guidelines. Comorbidities, sexually transmitted infections (STIs, and other risk factors were evaluated. Methods. We conducted a retrospective chart review on 75 women aged 65 or older living with HIV with at least one Pap smear. Results. The mean age of the cohort was 66.5 and at HIV diagnosis was 56. The majority of women were immunocompetent. 80% had serial Pap smears. Of these, 86% of 238 were negative or ASCUS. No women progressed to HSIL. 92% of colposcopies had negative or CIN I results. Three women were treated successfully for high-grade dysplasia. More than half of women had other STIs. 72% were screened for HPV; 50% were positive. Conclusion. The majority of women had negative and low-grade Pap smears. Questions remain regarding the utility of continued Pap screening and the added value of HPV testing in this unique population of older women living with HIV.
Shelly Arora; Srinivas Sulugodu Ramachandra; Fawzia Abdullah; Kalyan C Gundavarapu
2017-01-01
Introduction: Single-nucleotide polymorphisms (SNPs) in interleukin 1? (IL-1?) gene have been known to be associated with increased susceptibility to chronic periodontitis among various ethnic populations. SNPs are more commonly observed at loci + 3954 and ? 511. The aim of this study was to evaluate the role of IL-1? gene polymorphism at loci +3954 and ? 511, and its association with severe chronic generalized periodontitis among the ethnic Malay, Chinese, and Indians within the Malaysian po...
Directory of Open Access Journals (Sweden)
Eva E R Philipp
Full Text Available The bivalve Arctica islandica is extremely long lived (>400 years and can tolerate long periods of hypoxia and anoxia. European populations differ in maximum life spans (MLSP from 40 years in the Baltic to >400 years around Iceland. Characteristic behavior of A. islandica involves phases of metabolic rate depression (MRD during which the animals burry into the sediment for several days. During these phases the shell water oxygen concentrations reaches hypoxic to anoxic levels, which possibly support the long life span of some populations. We investigated gene regulation in A. islandica from a long-lived (MLSP 150 years German Bight population and the short-lived Baltic Sea population, experimentally exposed to different oxygen levels. A new A. islandica transcriptome enabled the identification of genes important during hypoxia/anoxia events and, more generally, gene mining for putative stress response and (anti- aging genes. Expression changes of a antioxidant defense: Catalase, Glutathione peroxidase, manganese and copper-zinc Superoxide dismutase; b oxygen sensing and general stress response: Hypoxia inducible factor alpha, Prolyl hydroxylase and Heat-shock protein 70; and c anaerobic capacity: Malate dehydrogenase and Octopine dehydrogenase, related transcripts were investigated. Exposed to low oxygen, German Bight individuals suppressed transcription of all investigated genes, whereas Baltic Sea bivalves enhanced gene transcription under anoxic incubation (0 kPa and, further, decreased these transcription levels again during 6 h of re-oxygenation. Hypoxic and anoxic exposure and subsequent re-oxygenation in Baltic Sea animals did not lead to increased protein oxidation or induction of apoptosis, emphasizing considerable hypoxia/re-oxygenation tolerance in this species. The data suggest that the energy saving effect of MRD may not be an attribute of Baltic Sea A. islandica chronically exposed to high environmental variability (oxygenation
Yang, Yuchen; Li, Jianfang; Yang, Shuhuan; Li, Xinnian; Fang, Lu; Zhong, Cairong; Duke, Norman C; Zhou, Renchao; Shi, Suhua
2017-01-18
A large-scale systematical investigation of the influence of Pleistocene climate oscillation on mangrove population dynamics could enrich our knowledge about the evolutionary history during times of historical climate change, which in turn may provide important information for their conservation. In this study, phylogeography of a mangrove tree Sonneratia alba was studied by sequencing three chloroplast fragments and seven nuclear genes. A low level of genetic diversity at the population level was detected across its range, especially at the range margins, which was mainly attributed to the steep sea-level drop and associated climate fluctuations during the Pleistocene glacial periods. Extremely small effective population size (Ne) was inferred in populations from both eastern and western Malay Peninsula (44 and 396, respectively), mirroring the fragility of mangrove plants and their paucity of robustness against future climate perturbations and human activity. Two major genetic lineages of high divergence were identified in the two mangrove biodiversity centres: the Indo-Malesia and Australasia regions. The estimated splitting time between these two lineages was 3.153 million year ago (MYA), suggesting a role for pre-Pleistocene events in shaping the major diversity patterns of mangrove species. Within the Indo-Malesia region, a subdivision was implicated between the South China Sea (SCS) and the remaining area with a divergence time of 1.874 MYA, corresponding to glacial vicariance when the emerged Sunda Shelf halted genetic exchange between the western and eastern coasts of the Malay Peninsula during Pleistocene sea-level drops. Notably, genetic admixture was observed in populations at the boundary regions, especially in the two populations near the Malacca Strait, indicating secondary contact between divergent lineages during interglacial periods. These interregional genetic exchanges provided ample opportunity for the re-use of standing genetic variation
Pandey, Madhav; Rajora, Om P
2012-04-05
Fine-scale or spatial genetic structure (SGS) is one of the key genetic characteristics of plant populations. Several evolutionary and ecological processes and population characteristics influence the level of SGS within plant populations. Higher fine-scale genetic structure may be expected in peripheral than core populations of long-lived forest trees, owing to the differences in the magnitude of operating evolutionary and ecological forces such as gene flow, genetic drift, effective population size and founder effects. We addressed this question using eastern white cedar (Thuja occidentalis) as a model species for declining to endangered long-lived tree species with mixed-mating system. We determined the SGS in two core and two peripheral populations of eastern white cedar from its Maritime Canadian eastern range using six nuclear microsatellite DNA markers. Significant SGS ranging from 15 m to 75 m distance classes was observed in the four studied populations. An analysis of combined four populations revealed significant positive SGS up to the 45 m distance class. The mean positive significant SGS observed in the peripheral populations was up to six times (up to 90 m) of that observed in the core populations (15 m). Spatial autocorrelation coefficients and correlograms of single and sub-sets of populations were statistically significant. The extent of within-population SGS was significantly negatively correlated with all genetic diversity parameters. Significant heterogeneity of within-population SGS was observed for 0-15 m and 61-90 m between core and peripheral populations. Average Sp, and gene flow distances were higher in peripheral (Sp = 0.023, σg = 135 m) than in core (Sp = 0.014, σg = 109 m) populations. However, the mean neighborhood size was higher in the core (Nb = 82) than in the peripheral (Nb = 48) populations. Eastern white cedar populations have significant fine-scale genetic structure at short distances. Peripheral populations have several
Holdsworth, Michelle; Nicolaou, Mary; Langøien, Lars Jørun; Osei-Kwasi, Hibbah Araba; Chastin, Sebastien F M; Stok, F Marijn; Capranica, Laura; Lien, Nanna; Terragni, Laura; Monsivais, Pablo; Mazzocchi, Mario; Maes, Lea; Roos, Gun; Mejean, Caroline; Powell, Katie; Stronks, Karien
2017-11-07
Some ethnic minority populations have a higher risk of non-communicable diseases than the majority European population. Diet and physical activity behaviours contribute to this risk, shaped by a system of inter-related factors. This study mapped a systems-based framework of the factors influencing dietary and physical activity behaviours in ethnic minority populations living in Europe, to inform research prioritisation and intervention development. A concept mapping approach guided by systems thinking was used: i. Preparation (protocol and terminology); ii. Generating a list of factors influencing dietary and physical activity behaviours in ethnic minority populations living in Europe from evidence (systematic mapping reviews) and 'eminence' (89 participants from 24 academic disciplines via brainstorming, an international symposium and expert review) and; iii. Seeking consensus on structuring, rating and clustering factors, based on how they relate to each other; and iv. Interpreting/utilising the framework for research and interventions. Similar steps were undertaken for frameworks developed for the majority European population. Seven distinct clusters emerged for dietary behaviour (containing 85 factors) and 8 for physical activity behaviours (containing 183 factors). Four clusters were similar across behaviours: Social and cultural environment; Social and material resources; Psychosocial; and Migration context. Similar clusters of factors emerged in the frameworks for diet and physical activity behaviours of the majority European population, except for 'migration context'. The importance of factors across all clusters was acknowledged, but their relative importance differed for ethnic minority populations compared with the majority population. This systems-based framework integrates evidence from both expert opinion and published literature, to map the factors influencing dietary and physical activity behaviours in ethnic minority groups. Our findings illustrate
Directory of Open Access Journals (Sweden)
Tun Nurul Aimi Mat Jaafar
Full Text Available BACKGROUND: DNA barcodes, typically focusing on the cytochrome oxidase I gene (COI in many animals, have been used widely as a species-identification tool. The ability of DNA barcoding to distinguish species from a range of taxa and to reveal cryptic species has been well documented. Despite the wealth of DNA barcode data for fish from many temperate regions, there are relatively few available from the Southeast Asian region. Here, we target the marine fish Family Carangidae, one of the most commercially-important families from the Indo-Malay Archipelago (IMA, to produce an initial reference DNA barcode library. METHODOLOGY/PRINCIPAL FINDINGS: Here, a 652 bp region of COI was sequenced for 723 individuals from 36 putative species of Family Carangidae distributed within IMA waters. Within the newly-generated dataset, three described species exhibited conspecific divergences up to ten times greater (4.32-4.82% than mean estimates (0.24-0.39%, indicating a discrepancy with assigned morphological taxonomic identification, and the existence of cryptic species. Variability of the mitochondrial DNA COI region was compared within and among species to evaluate the COI region's suitability for species identification. The trend in range of mean K2P distances observed was generally in accordance with expectations based on taxonomic hierarchy: 0% to 4.82% between individuals within species, 0% to 16.4% between species within genera, and 8.64% to 25.39% between genera within families. The average Kimura 2-parameter (K2P distance between individuals, between species within genera, and between genera within family were 0.37%, 10.53% and 16.56%, respectively. All described species formed monophyletic clusters in the Neighbour-joining phylogenetic tree, although three species representing complexes of six potential cryptic species were detected in Indo-Malay Carangidae; Atule mate, Selar crumenophthalmus and Seriolina nigrofasciata. CONCLUSION/SIGNIFICANCE: This
Access to Education in Peninsular Malaysia: Ethnicity, Social Class, and Gender.
Pong, Suet-ling
1995-01-01
Presents a comprehensive examination of the development of postindependent Malaysia's education policies. Compulsory education combined with sustained economic growth has produced a literate and upwardly mobile Malay population. Preferential policies for the Malays, however, have resulted in increased stratification and inequality among the…
Yusoff, Nasir; Low, Wah Yun; Yip, Cheng-Har
2011-01-01
The main objective of this paper is to examine the psychometric properties of the Malay Version of the Hospital Anxiety and Depression Scale (HADS), tested on 67 husbands of the women who were diagnosed with breast cancer. The eligible husbands were retrieved from the Clinical Oncology Clinic at three hospitals in Kuala Lumpur, Malaysia. Data was collected at three weeks and ten weeks following surgery for breast cancer of their wives. The psychometric properties of the HADS were reported based on Cronbach' alpha, Intraclass Correlation Coefficients (ICC), Effect Size Index (ESI), sensitivity and discriminity of the scale. Internal consistency of the scale is excellent, with Cronbach's alpha of 0.88 for Anxiety subscale and 0.79 for Depression subscale. Test-retest Intraclass Correlation Coefficient (ICC) is 0.35 and 0.42 for Anxiety and Depression Subscale, respectively. Small mean differences were observed at test-retest measurement with ESI of 0.21 for Anxiety and 0.19 for Depression. Non-significant result was revealed for the discriminant validity (mastectomy vs lumpectomy). The Malay Version of the HADS is appropriate to measure the anxiety and depression among the husbands of the women with breast cancer in Malaysia.
Population-based evaluation of the ‘LiveLighter’ healthy weight and lifestyle mass media campaign
Morley, B.; Niven, P.; Dixon, H.; Swanson, M.; Szybiak, M.; Shilton, T.; Pratt, I. S.; Slevin, T.; Hill, D.; Wakefield, M.
2016-01-01
The Western Australian (WA) ‘LiveLighter’ (LL) mass media campaign ran during June–August and September–October 2012. The principal campaign ad graphically depicts visceral fat of an overweight individual (‘why’ change message), whereas supporting ads demonstrate simple changes to increase activity and eat healthier (‘how’ to change message). Cross-sectional surveys among population samples aged 25–49 were undertaken pre-campaign (N = 2012) and following the two media waves (N = 2005 and N = 2009) in the intervention (WA) and comparison state (Victoria) to estimate the population impact of LL. Campaign awareness was 54% after the first media wave and overweight adults were more likely to recall LL and perceive it as personally relevant. Recall was also higher among parents, but equal between socio-economic groups. The ‘why’ message about health-harms of overweight rated higher than ‘how’ messages about lifestyle change, on perceived message effectiveness which is predictive of health-related intention and behaviour change. State-by-time interactions showed population-level increases in self-referent thoughts about the health-harms of overweight (P campaign impact. However, sustained campaign activity will be needed to impact behaviour. PMID:26956039
Stockins, B; Larenas, G; Charles, M; Standen, D; Espinoza, O; Illesca, M; Opazo, J A; Carrasco, B; Lanas, F; Davis, M
1998-11-01
Chilean aboriginal populations (Mapuche) predominantly live in the region of Araucanía, in the southern part of the country. Their cardiovascular risk factors have not been systematically assessed. To study the prevalence of cardiovascular risk factors in the Mapuche population. Blood pressure, weight, height, dietary habits, fasting serum total cholesterol, HDL cholesterol and triglycerides were measured in 1.948 adults living in 28 Mapuche communities. Thirteen percent of males and 16% of females had high blood pressure. Body mass index was 25.5 kg/m2 in males and 28.1 kg/m2 in females. Forty five percent of women and 24% of men were classified as obese. Mean serum total cholesterol was 186.7 +/- 9.6 mg/dl, HDL cholesterol was 58.7 +/- 30.7 mg/dl, total cholesterol/HDL cholesterol was 3.4 +/- 2 and triglycerides were 155.2 +/- 91.2 mg/dl. Twenty eight percent of males and 9.6% of females smoked. Mapuche individuals have higher levels of HDL cholesterol a better total cholesterol/HDL cholesterol ratio and lower frequency of smoking than non aboriginal Chileans subjects.
Chua, Jacqueline; Tham, Yih Chung; Liao, Jiemin; Zheng, Yingfeng; Aung, Tin; Wong, Tien Yin; Cheng, Ching-Yu
2014-10-01
To determine the ethnic differences in the distribution of intraocular pressure (IOP) and central corneal thickness (CCT) in a multi-ethnic Asian population by self-reported ethnicity and genetic ancestry. Population-based, cross-sectional study. A total of 10 033 adults (3353 Chinese, 3280 Malays, and 3400 Indians) aged >40 years. Participants underwent standardized systemic and ocular examinations and interviewer-administered questionnaires for risk factor assessment. The IOP readings were obtained by Goldmann applanation tonometry (Haag-Streit, Konig, Switzerland) before pupil dilation. The CCT was measured with ultrasound pachymetry. Genetic ancestry was derived using principal component (PC) analysis. Regression models were used to investigate the association of IOP and CCT with potential risk factors and genetic ancestry. Intraocular pressure and CCT. After excluding participants with a history of glaucoma surgery or medication, refractive surgery, corneal edema, or corneal dystrophy, IOP and CCT readings were available for 3251 Chinese, 3232 Malays, and 3317 Indians. The mean IOP readings in the Chinese, Malay, and Indian participants were 14.3±3.1, 15.3±3.7, and 15.8±2.9 mmHg, respectively (P Chinese, 6.2% in Malays, and 4% in Indians (P Malay and Indian participants on average had 0.81 and 1.43 mmHg higher IOP levels, respectively, than Chinese (P Chinese, 540.9±33.6 μm in Malays, and 540.4±33.6 μm in Indians (P Chinese, 68.5% in Malays, and 66.2% in Indians (P Chinese have the thickest CCT but lowest IOP among the 3 major ethnic groups. In addition, there is a higher proportion of Malays with IOP ≥21 mmHg and CCT Chinese or Indians. This disparity across ethnic groups should be taken into account by future studies investigating IOP and CCT as risk factors or diagnostic tests for glaucoma in Asian populations. Copyright © 2014 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.
Stress associated with group living in a long-lived bird
Selva, Nuria; Cortés-Avizanda, Ainara; Lemus, Jesús A.; Blanco, Guillermo; Mueller, Thomas; Heinrich, Bernd; Donázar, José A.
2011-01-01
Many long-lived avian species adopt life strategies that involve a gregarious way of life at juvenile and sub-adult stages and territoriality during adulthood. However, the potential associated costs of these life styles, such as stress, are poorly understood. We examined the effects of group living, sex and parasite load on the baseline concentration of faecal stress hormone (corticosterone) metabolites in a wild population of common ravens (Corvus corax). Corticosterone concentrations were ...
Chhatre, Vikram E.; Rajora, Om P.
2014-01-01
Marginal populations are expected to provide the frontiers for adaptation, evolution and range shifts of plant species under the anticipated climate change conditions. Marginal populations are predicted to show genetic divergence from central populations due to their isolation, and divergent natural selection and genetic drift operating therein. Marginal populations are also expected to have lower genetic diversity and effective population size (N e) and higher genetic differentiation than central populations. We tested these hypotheses using eastern white pine (Pinus strobus) as a model for keystone, long-lived widely-distributed plants. All 614 eastern white pine trees, in a complete census of two populations each of marginal old-growth, central old-growth, and central second-growth, were genotyped at 11 microsatellite loci. The central populations had significantly higher allelic and genotypic diversity, latent genetic potential (LGP) and N e than the marginal populations. However, heterozygosity and fixation index were similar between them. The marginal populations were genetically diverged from the central populations. Model testing suggested predominant north to south gene flow in the study area with curtailed gene flow to northern marginal populations. Signatures of natural selection were detected at three loci in the marginal populations; two showing divergent selection with directional change in allele frequencies, and one balancing selection. Contrary to the general belief, no significant differences were observed in genetic diversity, differentiation, LGP, and N e between old-growth and second-growth populations. Our study provides information on the dynamics of migration, genetic drift and selection in central versus marginal populations of a keystone long-lived plant species and has broad evolutionary, conservation and adaptation significance. PMID:24859159
Chhatre, Vikram E; Rajora, Om P
2014-01-01
Marginal populations are expected to provide the frontiers for adaptation, evolution and range shifts of plant species under the anticipated climate change conditions. Marginal populations are predicted to show genetic divergence from central populations due to their isolation, and divergent natural selection and genetic drift operating therein. Marginal populations are also expected to have lower genetic diversity and effective population size (Ne) and higher genetic differentiation than central populations. We tested these hypotheses using eastern white pine (Pinus strobus) as a model for keystone, long-lived widely-distributed plants. All 614 eastern white pine trees, in a complete census of two populations each of marginal old-growth, central old-growth, and central second-growth, were genotyped at 11 microsatellite loci. The central populations had significantly higher allelic and genotypic diversity, latent genetic potential (LGP) and Ne than the marginal populations. However, heterozygosity and fixation index were similar between them. The marginal populations were genetically diverged from the central populations. Model testing suggested predominant north to south gene flow in the study area with curtailed gene flow to northern marginal populations. Signatures of natural selection were detected at three loci in the marginal populations; two showing divergent selection with directional change in allele frequencies, and one balancing selection. Contrary to the general belief, no significant differences were observed in genetic diversity, differentiation, LGP, and Ne between old-growth and second-growth populations. Our study provides information on the dynamics of migration, genetic drift and selection in central versus marginal populations of a keystone long-lived plant species and has broad evolutionary, conservation and adaptation significance.
Sakiev, Kanat; Battakova, Sharbanu; Namazbaeva, Zulkiya; Ibrayeva, Lyazat; Otarbayeva, Maral; Sabirov, Zhanbol
2017-04-01
Background The Aral Sea crisis has led to harmful effects on human habitat. In recent years, mild cognitive impairment is a growing problem. Objectives This article provides the results of studying the neuropsychological state of residents living in the crisis zone of the Aral Sea region in the case of Shalkar city. We have provided an assessment of the neuropsychological state of examined population and determined the leading pathology in this region. Methods The survey sample included 344 persons of reproductive age from 21 to 45 years. We have obtained results in biochemical studies, indicating perturbations of proteometabolism and lipid metabolism. Results A correlation analysis showed dependence between a decrease of albumin and high-density lipoproteins, an increase of low-density lipoproteins and parameters of cognitive function. Conclusions The research suggests a high prevalence of cerebrovascular pathology among the population, changes in cognitive function parameters, long-term and short-term memory problems and high levels of depression.
International Nuclear Information System (INIS)
Beresford, N.A.; Voigt, G.; Wright, S.M.; Howard, B.J.; Barnett, C.L.; Prister, B.; Balonov, M.; Ratnikov, A.; Travnikova, I.; Gillett, A.G.; Mehli, H.; Skuterud, L.; Lepicard, S.; Semiochkina, N.; Perepeliantnikova, L.; Goncharova, N.; Arkhipov, A.N.
2001-01-01
Countermeasures have been effectively employed within intensive agricultural systems in areas of the Former Soviet Union (FSU) affected by the Chernobyl accident. However, ingestion doses continue to be elevated in some areas as a result of few foodstuffs which are collected from the wild or produced by the household. Forest fungi and berries, and milk from privately owned cattle are the most notable contributors to 137 Cs intakes amongst these foodstuffs. In this paper we consider advice which would help affected populations to both understand the importance of these exposure routes and to reduce their exposure. In addition to the potential radiological benefits, self-help schemes are highly cost-effective and likely to have a positive psychological influence on populations living within contaminated areas of the FSU. Evidence to suggest that the transfer of radiocaesium to cow milk is considerably higher in the FSU than within western Europe and North America is discussed
Culture Influence on the Perception of the Body Language by Arab and Malay Students
Directory of Open Access Journals (Sweden)
Marzieh Gordan
2013-11-01
Full Text Available Intercultural communication is applied for communicating with each other among the different cultures and traditions. It highlighted the problems which faced by different communities and organizations, the problems which are natural to the person like when the people face to new culture or tradition even the religious issues. So intercultural communication here is seeking for an answer between the different nations that how they communicate with each other when they face some problems in their tradition and culture. This one highlights how the people encode a message and how they interpret a message to each other. So here in this paper interaction is between students of Arabs and Malays from National University of Malaysia and it deals with their body language especially hand gestures. This paper is based on the Micheal Byram theory of language. In this quantitative research some questions will distribute among the students and the similarities and differences between their sign languages will be highlighted.
2012-01-01
Background Fine-scale or spatial genetic structure (SGS) is one of the key genetic characteristics of plant populations. Several evolutionary and ecological processes and population characteristics influence the level of SGS within plant populations. Higher fine-scale genetic structure may be expected in peripheral than core populations of long-lived forest trees, owing to the differences in the magnitude of operating evolutionary and ecological forces such as gene flow, genetic drift, effective population size and founder effects. We addressed this question using eastern white cedar (Thuja occidentalis) as a model species for declining to endangered long-lived tree species with mixed-mating system. Results We determined the SGS in two core and two peripheral populations of eastern white cedar from its Maritime Canadian eastern range using six nuclear microsatellite DNA markers. Significant SGS ranging from 15 m to 75 m distance classes was observed in the four studied populations. An analysis of combined four populations revealed significant positive SGS up to the 45 m distance class. The mean positive significant SGS observed in the peripheral populations was up to six times (up to 90 m) of that observed in the core populations (15 m). Spatial autocorrelation coefficients and correlograms of single and sub-sets of populations were statistically significant. The extent of within-population SGS was significantly negatively correlated with all genetic diversity parameters. Significant heterogeneity of within-population SGS was observed for 0-15 m and 61-90 m between core and peripheral populations. Average Sp, and gene flow distances were higher in peripheral (Sp = 0.023, σg = 135 m) than in core (Sp = 0.014, σg = 109 m) populations. However, the mean neighborhood size was higher in the core (Nb = 82) than in the peripheral (Nb = 48) populations. Conclusion Eastern white cedar populations have significant fine-scale genetic structure at short distances. Peripheral
Directory of Open Access Journals (Sweden)
Pandey Madhav
2012-04-01
Full Text Available Abstract Background Fine-scale or spatial genetic structure (SGS is one of the key genetic characteristics of plant populations. Several evolutionary and ecological processes and population characteristics influence the level of SGS within plant populations. Higher fine-scale genetic structure may be expected in peripheral than core populations of long-lived forest trees, owing to the differences in the magnitude of operating evolutionary and ecological forces such as gene flow, genetic drift, effective population size and founder effects. We addressed this question using eastern white cedar (Thuja occidentalis as a model species for declining to endangered long-lived tree species with mixed-mating system. Results We determined the SGS in two core and two peripheral populations of eastern white cedar from its Maritime Canadian eastern range using six nuclear microsatellite DNA markers. Significant SGS ranging from 15 m to 75 m distance classes was observed in the four studied populations. An analysis of combined four populations revealed significant positive SGS up to the 45 m distance class. The mean positive significant SGS observed in the peripheral populations was up to six times (up to 90 m of that observed in the core populations (15 m. Spatial autocorrelation coefficients and correlograms of single and sub-sets of populations were statistically significant. The extent of within-population SGS was significantly negatively correlated with all genetic diversity parameters. Significant heterogeneity of within-population SGS was observed for 0-15 m and 61-90 m between core and peripheral populations. Average Sp, and gene flow distances were higher in peripheral (Sp = 0.023, σg = 135 m than in core (Sp = 0.014, σg = 109 m populations. However, the mean neighborhood size was higher in the core (Nb = 82 than in the peripheral (Nb = 48 populations. Conclusion Eastern white cedar populations have significant fine-scale genetic structure at short
Directory of Open Access Journals (Sweden)
Alice Jiruskova
2016-08-01
Full Text Available We identified a high diversity in the net-winged beetles of the genus Cautires in Peninsular Malaysia. Fourteen new species are described: Cautires alexae sp. nov., C. andujari sp. nov., C. arribasae sp. nov., C. berembanensis sp. nov., C. campestris sp. nov., C. communis sp. nov., C. jasarensis sp. nov., C. katarinae sp. nov., C. kirstenae sp. nov., C. kotatinggensis sp. nov., C. linardi sp. nov., C. maseki sp. nov., C. pahangensis sp. nov. and C. renatae sp. nov. Seven previously described species are discussed, illustrated and differential diagnoses provided; all species are keyed. The Cautires species differ in a limited number of diagnostic characters, namely in the shape of male antennae, the relative size of eyes and in the shape of the male genitalia. The females are difficult to assign to a conspecific male due to high intraspecific variability. The characteristically low dispersal propensity of net-winged beetles lead to the evolution of the unique fauna in the Malay mountains and despite an extensive study of the type material we recorded only a single species of Cautires occurring simultaneously in Sumatra. We suggest that the Malay mountain fauna is highly endemic and evolved in situ.
Toziou, Peristera-Maria; Barmpalexis, Panagiotis; Boukouvala, Paraskevi; Verghese, Susan; Nikolakakis, Ioannis
2018-05-30
Since culture-based methods are costly and time consuming, alternative methods are investigated for the quantification of probiotics in commercial products. In this work ATR- FTIR vibration spectroscopy was applied for the differentiation and quantification of live Lactobacillus (La 5) in mixed populations of live and killed La 5, in the absence and in the presence of enteric polymer Eudragit ® L 100-55. Suspensions of live (La 5_L) and killed in acidic environment bacillus (La 5_K) were prepared and binary mixtures of different percentages were used to grow cell cultures for colony counting and spectral analysis. The increase in the number of colonies with added%La 5_L to the mixture was log-linear (r 2 = 0.926). Differentiation of La 5_L from La 5_K was possible directly from the peak area at 1635 cm -1 (amides of proteins and peptides) and a linear relationship between%La 5_L and peak area in the range 0-95% was obtained. Application of partial least squares regression (PLSR) gave reasonable prediction of%La 5_L (RMSEp = 6.48) in binary mixtures of live and killed La 5 but poor prediction (RMSEp = 11.75) when polymer was added to the La 5 mixture. Application of artificial neural networks (ANNs) improved greatly the predictive ability for%La 5_L both in the absence and in the presence of polymer (RMSEp = 8.11 × 10 -8 for La 5 only mixtures and RMSEp = 8.77 × 10 -8 with added polymer) due to their ability to express in the calibration models more hidden spectral information than PLSR. Copyright © 2018 Elsevier B.V. All rights reserved.
Inclusion in a Multicultural Nation: Realities through Case Studies
Balakrishnan, Vishalache
2015-01-01
According to Inclusion Press International, inclusion is not just a "disability issue" but about living full lives, about learning to live together and treasuring diversity and building community. When Malaysia obtained her independence from Britain in 1957, one of the main ruling was all three ethnicities (Malay, Chinese, and Indian)…
Herman, R P; Provencio, K R; Torrez, R J; Seager, G M
1993-01-01
In this study we measured changes in population levels of free-living N2-fixing bacteria in the root zones of potted Bouteloua eriopoda and Sporobolus flexuosus plants as well as the photosynthetic indices of the plants in response to added nitrogen, added water, and added water plus nitrogen treatments. In addition, N2 fixer population changes in response to added carbon source and nitrogen were measured in plant-free soil columns. There were significant increases in the numbers of N2 fixers associated with both plant species in the water and the water plus nitrogen treatments. Both treatments increased the photosynthetic index, suggesting that plant exudates were driving N2 fixer population changes. Population increases were greatest in the water plus nitrogen treatments, indicating that added nitrogen was synergistic with added water and suggesting that nitrogen addition spared bacteria the metabolic cost of N2 fixation, allowing greater reproduction. Plant-free column studies demonstrated a synergistic carbon-nitrogen effect when carbon levels were limiting (low malate addition) but not when carbon was abundant (high malate), further supporting this hypothesis. The results of this study indicate the presence of N2 fixer populations which interact with plants and which may play a role in the nitrogen balance of desert grasslands. PMID:8215373
Directory of Open Access Journals (Sweden)
Jung-Yun Lee
Full Text Available OBJECTIVE: In East Asia the recently increased number of marriages in response to pregnancy is an important social issue. This study evaluated the association of marriage preceded by pregnancy (bridal pregnancy with obstetric outcomes among live births in Korea. METHODS: In this population-based study, 1,152,593 first singleton births were evaluated from data registered in the national birth registration database from 2004 to 2008 in Korea. In the study population, the pregnancy outcomes among live births from the bridal pregnancy group (N = 62,590 were compared with the outcomes of the post-marital pregnancy group (N = 564,749, composed of women who gave birth after 10 months but before 24 months of marriage. The variables preterm birth (PTB; <37 weeks gestation and low birth weight (LBW; <2.5 kg were used to determine the primary outcome. The adjusted odds ratios (aORs and 95% confidence intervals (CIs were calculated after controlling for socio-demographic factors. RESULTS: The socio-demographic factors among the bridal pregnancy group were associated with a social disadvantage and particular risk factors. In the subgroup analyses of maternal age, differences in adverse pregnancy outcomes from bridal pregnancy were identified between women in the following age group: (i ≤19, (ii 20-39, and (iii ≥40 years. After the multivariate analysis, the aORs for each age group were 1.47 (95% CI: 1.15-1.89, 1.76 (1.70-1.83, and 1.13 (0.77-1.66, respectively, for PTB and 0.92 (0.70-1.21, 1.60 (1.53-1.66, and 1.11 (0.71-1.74, respectively, for LBW. In the adjusted logistic regression models, bridal pregnancy was associated with PTB (1.76, 1.69-1.82 and LBW (1.53, 1.48-1.59. CONCLUSION: Pregnancy outcomes among live births from bridal pregnancies are associated with higher risks for PTB and LBW in Korea.
Chang, Yuet Meng; Swaran, Yuvaneswari; Phoon, Yoong Keat; Sothirasan, Kavin; Sim, Hang Thiew; Lim, Kong Boon; Kuehn, Daniel
2009-06-01
17 Y-STRs (DYS456, DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385a/b, DYS393, DYS391, DYS439, DYS635 or Y-GATA C4, DYS392, Y-GATA H4, DYS437, DYS438 and DYS448) have been analyzed in 320 male individuals from Sarawak, an eastern state of Malaysia on the Borneo island using the AmpFlSTR Y-filer (Applied Biosystems, Foster City, CA). These individuals were from three indigenous ethnic groups in Sarawak comprising of 103 Ibans, 113 Bidayuhs and 104 Melanaus. The observed 17-loci haplotypes and the individual allele frequencies for each locus were estimated, whilst the locus diversity, haplotype diversity and discrimination capacity were calculated in the three groups. Analysis of molecular variance (AMOVA) indicated that 87.6% of the haplotypic variation was found within population and 12.4% between populations (fixation index F(ST)=0.124, p=0.000). This study has revealed that the indigenous populations in Sarawak are distinctly different to each other, and to the three major ethnic groups in Malaysia (Malays, Chinese and Indians), with the Melanaus having a strikingly high degree of shared haplotypes within. There are rare unusual variants and microvariants that were not present in Malaysian Malay, Chinese or Indian groups. In addition, occurrences of DYS385 duplications which were only noticeably present in Chinese group previously was also observed in the Iban group whilst null alleles were detected at several Y-loci (namely DYS19, DYS392, DYS389II and DYS448) in the Iban and Melanau groups.
Directory of Open Access Journals (Sweden)
Shariff-Ghazali eSazlina
2015-07-01
Full Text Available Introduction: Regular physical activity is an important aspect of self management among older people with type 2 diabetes but many remain inactive. Interventions to improve physical activity levels have been studied but few studies have evaluated the effects of personalised feedback or peer support; and there was no study on older people of Asian heritage. Hence, this trial evaluated whether personalised feedback (PF only or combined with peer support (PS improves physical activity among older Malays with type 2 diabetes (T2DM compared to usual care only. Materials and methods: A three arm randomised controlled trial was conducted in a primary healthcare clinic in Malaysia. 69 sedentary Malays aged 60 years and older with T2DM who received usual diabetes care were randomised to PF or PS interventions or as controls for 12 weeks with follow-ups at weeks 24 and 36. Intervention groups performed unsupervised walking activity and received written feedback on physical activity. The PS group also received group and telephone contacts from trained peer mentors. The primary outcome was pedometer steps. Secondary outcomes were self-reported physical activity, cardiovascular risk factors, cardiorespiratory fitness, balance, quality of life and psychosocial wellbeing. Results: 52 (75.4% completed the 36-week study. The PS group showed greater daily pedometer readings than the PF and controls (p=0.001. The PS group also had greater improvement in weekly duration (p<0.001 and frequency (p<0.001 of moderate intensity physical activity, scores on the Physical Activity Scale for Elderly (p=0.003, six minute walk test (p<0.001 and social support from friends (p=0.032 than PF and control groups. Conclusions: The findings suggest personalised feedback combined with peer support in older Malays with T2DM improved their physical activity levels, cardiorespiratory fitness and support from friends. Trial registration: Current Controlled Trials ISRCTN71447000.
Secondary polycythaemia in a Malay girl with homozygous Hb Tak.
Amran, H S; Aziz, M A; George, E; Mahmud, N; Lee, T Y; Md Noor, S
2017-12-01
Hb Tak is one of more than 200 high affinity haemoglobin variants reported worldwide. It results from the insertion of two nucleotides (AC) at the termination codon, between codon 146 and codon 147 of the beta-globin gene [Beta 147 (+AC)]. Polycythaemia is the main clinical feature although affected carriers are usually asymptomatic and do not require intervention. Several case studies in this region have reported the co-inheritance of Hb Tak with Hb E, delta beta and beta thalassaemia with one case of homozygous Hb Tak in a Thai boy. In this case report, a cluster of haemoglobin Tak was found in a family of Malay ethnic origin. Cascade family screening was conducted while investigating a 4-year old girl who presented with symptomatic polycythaemia. She had 2 previous Hb analysis done, at 7-month and 2-year-old with the diagnosis of possible Hb Q Thailand and Homozygous Hb D, respectively. Both diagnosis did not fit her clinical presentations. She was plethoric, had reduced exercise tolerance as well as cardiomyopathy. Her parents were consanguineously married and later diagnosed as asymptomatic carriers of Hb Tak. Consequently, re-analysis of the girl's blood sample revealed a homozygous state of Hb Tak. In conclusion, high oxygen affinity haemoglobin like Hb Tak should be considered in the investigation of polycythaemic patients with abnormal Hb analyses. In this case, DNA analysis was crucial in determining the correct diagnosis.
Zafar A. Handoo; Lynn K. Carta; Andrea M. Skantar; Sergei A. Subbotin; Stephen Fraedrich
2016-01-01
A population of Xiphinema chambersi from the root zone around live oak (Quercus virginiana Mill.) trees on Jekyll Island, GA, is described using both morphological and molecular tools and compared with descriptions of type specimens. Initially, because of a few morphological differences, this nematode was thought to represent an undescribed species. However, on further...
Cheung, Ning; Teo, Kelvin; Zhao, Wanting; Wang, Jie Jin; Neelam, Kumari; Tan, Nicholas Y Q; Mitchell, Paul; Cheng, Ching-Yu; Wong, Tien Yin
2017-10-01
To our knowledge, population-based data on retinal emboli are limited in Asia. Besides its associations with traditional cardiovascular risk factors and stroke, associations between retinal emboli and renal disease and function remain unclear. To examine the prevalence of and risk factors for retinal emboli in a large, contemporary, multiethnic Asian population. This population-based cross-sectional study was conducted from 2004 to 2011 and included a total of 10 033 Chinese, Malay, and Indian persons aged 40 to 80 years residing in the general communities of Singapore. Analyses were performed from November 2016 to February 2017. Retinal emboli were ascertained from retinal photographs obtained from both eyes of all participants according to a standardized protocol. Age-standardized prevalence of retinal emboli was calculated using the 2010 Singapore adult population. Risk factors were assessed from comprehensive systemic and ophthalmic examinations, interviews, and laboratory investigations. Retinal emboli. Of the 10 033 participants, 9978 (99.5%) had gradable retinal photographs. Of these, 5057 (50.7%) were female, and 3375 (33.8%) were Indian. We identified 88 individuals (0.9%) with retinal emboli; the overall person-specific, age-standardized prevalence of retinal emboli was 0.75% (95% CI, 0.60-0.95), with the highest prevalence seen in the Indian cohort (0.98%), followed by the Chinese (0.73%) and Malay (0.44%) cohorts (P = .03). In multivariable-adjusted analysis, factors associated with prevalent retinal emboli included older age (per 5-year increase; odds ratio [OR], 1.22; 95% CI, 1.05-1.41), Indian ethnicity (compared with Malay ethnicity; OR, 3.58; 95% CI, 1.95-6.60), hypertension (OR, 1.95; 95% CI, 1.03-3.70), chronic kidney disease (OR, 2.05; 95% CI, 1.15-3.64), creatinine level (per SD increase; OR, 1.13; 95% CI, 1.05-1.21), glomerular filtration rate (per SD increase; OR, 0.67; 95% CI, 0.51-0.86), and history of stroke (OR, 3.45; 95% CI, 1
Norhayati, Mohd Noor; Aniza, Abd Aziz; Nik Hazlina, Nik Hussain; Azman, Mohd Yacob
2015-12-01
Social support is an essential component for the physical and emotional well-being of postpartum mothers. The objective of this study is to determine the psychometric properties of the revised Malay version Medical Outcome Study (MOS) Social Support Survey using a confirmatory validity approach. A cross-sectional study was conducted involving 144 postpartum mothers attending Obstetric and Gynecology Clinic, Universiti Sains Malaysia Hospital. Construct validity and internal consistency assessment was performed after the translation, content validity and face validity process. The data were analyzed using SPSS 20.0 (SPSS Inc., Chicago, IL, USA) and AMOS 20.0 (SPSS Inc., Chicago, IL, USA). The original questionnaire consists of four domains (emotional/informational support, tangible support, affectionate support and positive social interaction) and 19 items. Affectionate support domain with three items only was treated as a separate construct and was not included in the factor analysis. The final confirmatory model with three constructs and 13 items demonstrated acceptable factor loadings, domain to domain correlation and best fit; (χ2[df]=1.665 [61]; P-value=0.001; Tucker-Lewis Index=0.944; comparative fit index=0.956; root mean square error of approximation=0.068). Composite reliability, average variance extracted and Cronbach's α of the domains ranged from 0.649 to 0.903; 0.390 to 0.699; 0.616 to 0.902, respectively. The study suggested that the four-factor model with 16 items (including one separate factor of affectionate) of the revised Malay version MOS Social Support Survey was acceptable to be used to measure social support after childbirth because it is valid, reliable and simple. © 2015 Wiley Publishing Asia Pty Ltd.
Factors influencing smoking behaviour changes during Ramadan among Malay male students
Directory of Open Access Journals (Sweden)
Suriani Ismail
2015-10-01
Full Text Available Introduction: Fasting during Ramadan provides an opportunistic setting for smoking cessation intervention. Smokers find it easy to cease smoking during Ramadan due to the religion, cultural and environmental influences. This study aims to determine the changes in smoking behaviour during Ramadan among Malay Muslim male students who were current smokers. Methods: This is cross sectional study using self-administered questionnaire to evaluate the socio demographic characteristics and two main relevant religious perceptions on smoking (i.e. ‘Is smoking ‘haram’ and ‘Does smoking invalidate your fasting’. Fagerstrom Test for Nicotine Dependence (FTND questionnaire was used to evaluate smoking behaviour before and during Ramadan. The total FTND scores and the percentages according to FTDN items, before Ramadan and during Ramadan were compared to determine good or poor smoking behaviour changes. Results: The overall FTND scores and the percentage according to its items were significantly reduced. There were significant association between smoking behaviour changes during Ramadan and household income, nicotine dependence and perception that smoking is ‘haram’. The percentage of good smoking behaviour changes was higher among those with higher income, high nicotine dependence and those who are not aware that smoking is ‘haram’. Conclusion: There is a great potential in taking advantage of the Ramadan environment to encourage smoking cessation among Muslim smokers.
Energy Technology Data Exchange (ETDEWEB)
M. Fatima Reis; J. Pereira Miguel; Sampaio, C. [Inst. of Preventive Medicine, Lisbon (Portugal); J. Mauricio Melim [Public Health Regional Dept., Funchal (Portugal); Aguiar, P. [National School of Public Health, Lisbon (Portugal)
2004-09-15
The present study is one of a series of papers describing selected results of the ongoing projects, designed to ultimately evaluate the potential impact on public health of the updated solid waste incinerator. Addressing dioxins and dioxin-like compounds, specific aims of this study were: (i) to determine whether living in the vicinity of the Meia Serra incinerator increases the dioxin body burden of the general population; (ii) to investigate other potential determinants of dioxin exposure in this population for prevention priorities; (iii) to provide data on the extent and pattern of exposure of the general population to dioxins and dioxin-like compounds by determining respective toxicity levels and congeners profile in blood samples.
Directory of Open Access Journals (Sweden)
Laith N. Al-Eitan
2017-02-01
Full Text Available Objectives: To compare clinical, anthropometric, and laboratory characteristics in diabetes type 2 patients of 2 genetically-distinct ethnicities living in Jordan, Arabs and Circassians/Chechens. Methods: This cross sectional ethnic comparison study was conducted in King Abdullah University Hospital, Irbid and The National Center for Diabetes, Endocrinology, and Genetics, Amman, Jordan between June 2013 and February 2014. A sample of 347 (237 Arab and 110 Circassian/Chechen people living with diabetes were included in the study. Data were collected through direct interviews with the participants. Clinical data were collected using a questionnaire and anthropometric measurements. Laboratory data were extracted from the patients’ medical records. Results: More Arabs with diabetes had hypertension as a comorbidity than Circassians/Chechens with diabetes. Arabs living with diabetes were generally more obese, whereas Circassians/Chechens living with diabetes had worse lipid control. Arabs with diabetes had higher means of glycated haemoglobin (HbA1c and fasting blood sugar, and more Arabs with diabetes had unsatisfactory glycemic control (60.6% than Circassians/Chechens with diabetes (38.2% (HbA1c ≥7.0%. Most participants (88.8% had at least one lipid abnormality (dyslipidemia. Conclusion: Multiple discrepancies among the 2 ethnic diabetic populations were found. New diabetes management recommendations and policies should be used when treating people living with diabetes of those ethnicities, particularly in areas of glycemic control, lipid control, and obesity.
Tan, Yee Hock; Sidik, Shiran Mohd; Syed Husain, Sharifah Noor Akmal; Lye, Munn Sann; Chong, Pei Pei
2016-01-01
Tobacco smoking is considered a risk factor for cervical cancer development due to the presence of tobacco based carcinogenic metabolites in cervical cells of female smokers. In this study, we investigated the role of the T3801C (MspI) polymorphism of CYP1A1, a gene encoding an enzyme necessary for the initiation of tobacco based carcinogen metabolism, on cervical cancer risk. The T to C substitution may alter CYP1A1 activities, potentially elevating cervical cancer risk. Since results of gene-disease association studies vary according to the study population, the multi-ethnic population of Malaysia provides an excellent representative cohort for identifying and comparing the cervical cancer risk among the 3 major ethnics in Southeast Asia in relation to CYP1A1 MspI polymorphism. A total of 195 Thin Prep Pap smear samples from HPV negative and cancer free females were randomly selected as controls while 106 formalin fixed paraffin embedded samples from females with invasive cervical cancer were randomly selected for the cases group. The polymorphisms were identified using restriction fragment length polymorphism (RFLP) PCR. We found no significant associations between CYP1A1 MspI polymorphism and cervical cancer in the general Malaysian female population. However, upon ethnic stratification, the variant C/C genotype was significantly associated with a 4.66-fold increase in cervical cancer risk in Malay females (95% CI= 1.21-17.9; p=0.03). No significant association was observed in the Chinese and Indian females. Additionally, there were no significant associations in the dominant model and allele frequency model analysis in both the general and ethnically stratified female population of Malaysia. Our findings suggest that the C/C genotype of CYP1A1 MspI polymorphism is associated with the development of cervical carcinoma in the Malay females of Malaysia.
Guiguet, M; Dionou, S; Volant, J; Samba, M C; Benammar, N; Chauvin, P; Simon, A
2017-08-01
Delayed presentation to care among HIV-infected individuals continued to be frequent in France. Migrants are at high risk for late presentation. This cross-sectional study investigated barriers to HIV testing in the specific population of men from sub-Saharan Africa living in four migrant worker hostels in Paris, France. Factors associated with never having been tested for HIV were examined using logistic regression. In all, 550 men participated, coming mainly from Mali and Senegal, with 31 % having lived in France for less than 5 years, and 25 % without any health insurance. Only 37 % have ever been tested for HIV. Not having health insurance was the main risk factor for never-testing [adjusted odds ratio (aOR) 2.4; 95 % confidence interval (CI) 1.4-4.0]. Despite free and anonymous HIV testing available at dedicated public screening centers, 63 % of men living in migrant worker hostels had never been tested for HIV.
Indoor Air Quality and Respiratory Health among Malay Preschool Children in Selangor
Directory of Open Access Journals (Sweden)
Nur Azwani Mohd Nor Rawi
2015-01-01
Full Text Available Indoor air quality (IAQ has been the object of several studies due to its adverse health effects on children. Methods. A cross-sectional comparative study was carried out among Malay children in Balakong (2 studied preschools and Bangi (2 comparative preschools, Selangor, with the aims of determining IAQ and its association with respiratory health. 61 and 50 children aged 5-6 years were selected as studied and comparative groups. A questionnaire was used to obtain an exposure history and respiratory symptoms. Lung function test was carried out. IAQ parameters obtained include indoor concentration of particulate matter (PM, volatile organic compounds (VOCs, carbon monoxide (CO, carbon dioxide (CO2, temperature, air velocity (AV, and relative humidity. Results. There was a significant difference between IAQ in studied and comparative preschools for all parameters measured (P<0.001 except for CO2 and AV. Studied preschools had higher PM and CO concentration. FVC, FEV1, FVC% and FEV1% predicted values were significantly lower among studied group. Exposures to PM, VOCs, and CO were associated with wheezing. Conclusion. The finding concluded that exposures to poor IAQ might increase the risk of getting lung function abnormality and respiratory problems among study respondents.
A Study on the Absence of Palmaris Longus in a Multi- racial Population
Directory of Open Access Journals (Sweden)
SA Roohi
2007-05-01
Full Text Available Palmaris longus is a dispensable muscle with a long tendon which is very useful in reconstructive surgery. It is absent 2.8 to 24% of the population depending on the race/ethnicity studied. Four hundred and fifty healthy subjects (equally distributed among Malaysia’s 3 major ethnic groups were clinically examined for the presence or absence of palmaris longus. This tendon was found to be absent unilaterally in 6.4% of study subjects, and bilaterally in 2.9% of study participants. Malays have a high prevalence of palmaris longus absence at 11.3% followed closely by Indians at 10.7% whilst Chinese had a low absence rate of 6.0%.
Directory of Open Access Journals (Sweden)
Diego Sánchez González
2016-09-01
Full Text Available Book Review Who lives where. Habitability conditions of the population living in the great Andalusian cities Reseña Del Libro Quién vive dónde. Las condiciones de habitabilidad de la población que vive en las grandes ciudades andaluzas
The Contribution of Zapin as One of Malay Traditional Arts in Curriculum 2013
Directory of Open Access Journals (Sweden)
Ellya Roza
2017-07-01
Full Text Available Zapin consists of three elements which are complementary to create movement harmony and rhythm that beautiful to look, heard and seen. They are music, song and dance. Zapin is one culture comes from Arab that developed in archipelago line with Islamization process. Zapin in Nusantara grew and developed in accordance with the customs and conditions of the local community. It becomes palace art for events such as welcoming guests and celebrations in the kingdom and also entertainment for society. The study aims to determine the contribution of Zapin in the Curricullum 2013. A Mixed research was used where the data taken from documentation, observation, and interview. The finding of the study showed that although modern art has been rife enter and expand in the archipelago but Zapin as cultural heritage still exist in society because of its content in accordance with teaching point and attitude of society that moral and spiritual precedence. It means that Zapin with all devices containing a core competence value contained in curriculum 2013. It is concluded that the contribution of Zapin as one of Malay traditional arts might contribute to the strengthening of curriculum 2013.
Influence of industrial heavy metal pollution on soil free-living nematode population
International Nuclear Information System (INIS)
Pen-Mouratov, Stanislav; Shukurov, Nosir; Steinberger, Yosef
2008-01-01
The effect of distance from a heavy metal pollution source on the soil nematode community (trophic structure, sex structure, and taxa composition) was investigated along a 15-km transect originating at the Almalyk Industrial Complex, Uzbekistan (pollution source). The soil nematode community was exposed to heavy metal influence both directly and through soil properties changes. Pollution effect on the density and biomass of soil free-living nematodes was found to be highest at pollution source, with fungivores and plant parasites dominating at the upper and deeper soil layers next to the pollution source. These groups decreased along the transect, yielding domination to bacteria- and fungi-feeders. The sex ratio of nematode communities was found to be dependent on heavy metal pollution levels, with the juveniles being the most sensitive nematode group. The Maturity and modified Maturity Indices, reflecting the degree of disturbance of the soil ecosystem, were found to be the most sensitive indices. - Trophic structure and sex ratio of soil nematode population are sensitive tools for monitoring industrial pollution
Influence of industrial heavy metal pollution on soil free-living nematode population
Energy Technology Data Exchange (ETDEWEB)
Pen-Mouratov, Stanislav [The Mina and Everard Goodman Faculty of Life Sciences, Bar-Ilan University, Ramat-Gan 52900 (Israel); Shukurov, Nosir [Institute of Geology and Geophysics, Academy of Sciences, Tashkent 700041 (Uzbekistan); Steinberger, Yosef [The Mina and Everard Goodman Faculty of Life Sciences, Bar-Ilan University, Ramat-Gan 52900 (Israel)], E-mail: steinby@mail.biu.ac.il
2008-03-15
The effect of distance from a heavy metal pollution source on the soil nematode community (trophic structure, sex structure, and taxa composition) was investigated along a 15-km transect originating at the Almalyk Industrial Complex, Uzbekistan (pollution source). The soil nematode community was exposed to heavy metal influence both directly and through soil properties changes. Pollution effect on the density and biomass of soil free-living nematodes was found to be highest at pollution source, with fungivores and plant parasites dominating at the upper and deeper soil layers next to the pollution source. These groups decreased along the transect, yielding domination to bacteria- and fungi-feeders. The sex ratio of nematode communities was found to be dependent on heavy metal pollution levels, with the juveniles being the most sensitive nematode group. The Maturity and modified Maturity Indices, reflecting the degree of disturbance of the soil ecosystem, were found to be the most sensitive indices. - Trophic structure and sex ratio of soil nematode population are sensitive tools for monitoring industrial pollution.
Shin, S H; Sok, S R
2012-06-01
As the global population of older people continuously increases, many countries are beginning to experience health problems associated with older age. These countries may be interested in knowing and understanding the health problems experienced by the older Korean population, which is projected to age the most rapidly. This study aimed to compare and examine the factors that influence the life satisfaction between older people living with their family and those living alone. A cross-sectional survey was conducted. The participants comprised a total 300 older Koreans (150 living with their family, 150 living alone) aged 65 years or over who met the eligibility criteria. All measures were self-administered. Data were analysed using the SAS statistical software program version 6.12 (SAS Institute Inc., Cary, NC). The older people living with their family were better than the older people living alone in perceived health status, self-esteem, depression and life satisfaction. Perceived health status, self-esteem, depression, age and monthly allowance were found to be the factors related to the life satisfaction of older people living with their family and those living alone. The factors that were found to have the greatest influence on the life satisfaction of older people living with their family and those living alone were depression and perceived health, respectively. This study may help healthcare providers to understand the factors that can influence the life satisfaction among older people living with their family and living alone in Korea. © 2011 The Authors. International Nursing Review © 2011 International Council of Nurses.
Zafar A Handoo; Lynn K. Carta; Andrea M. Skantar; Sergei A. Subbotin; Stephen W. Fraedrich
2016-01-01
A population of Xiphinema chambersi from the root zone around live oak (Quercus virginiana Mill.) trees on Jekyll Island, GA, is described using both morphological and molecular tools and compared with descriptions of type specimens. Initially, because of a few morphological differences, this nematode was thought to represent...
Dogan, Serkan; Kovačević, Lejla; Marjanović, Damir
2013-01-01
Allele frequencies of 15 STRs included in the PowerPlex 16 System (D3S1358, TH01, D21S11, D18S51, Penta E, D5S818, D13S317, D7S820, D16S539, CSF1PO, Penta D, VWA, D8S1179, TPOX and FGA) were calculated from the referent sample of 100 unrelated individuals of both sexes from Turkish student population living in Sarajevo, Bosnia and Herzegovina. Buccal swab, as a source of DNA, was collected from the volunteers from whom the informed consent form was obtained. DNA extraction was performed using...
Bialic-Murphy, Lalasia; Gaoue, Orou G
2018-01-01
Climate projections forecast more extreme interannual climate variability over time, with an increase in the severity and duration of extreme drought and rainfall events. Based on bioclimatic envelope models, it is projected that changing precipitation patterns will drastically alter the spatial distributions and density of plants and be a primary driver of biodiversity loss. However, many other underlying mechanisms can impact plant vital rates (i.e., survival, growth, and reproduction) and population dynamics. In this study, we developed a size-dependent integral projection model (IPM) to evaluate how interannual precipitation and mollusk herbivory influence the dynamics of a Hawaii endemic short-lived shrub, Schiedea obovata (Caryophyllaceae). Assessing how wet season precipitation effects population dynamics it critical, as it is the timeframe when most of the foliar growth occurs, plants flower and fruit, and seedlings establish. Temporal variation in wet season precipitation had a greater effect than mollusk herbivory on S . obovata population growth rate λ, and the impact of interannual precipitation on vital rates shifted across plant ontogeny. Furthermore, wet season precipitation influenced multiple vital rates in contrasting ways and the effect of precipitation on the survival of larger vegetative and reproductively mature individuals contributed the most to variation in the population growth rate. Among all combination of wet season precipitation and herbivory intensities, the only scenario that led to a growing population was when high wet precipitation was associated with low herbivory. Our study highlights the importance of evaluating how abiotic factors and plant-consumer interactions influence an organism across its life cycle to fully understand the underpinning mechanisms that structure its spatial and temporal distribution and abundance. Our results also illustrate that for short-lived species, like S. obovata , seedling herbivory can have
Directory of Open Access Journals (Sweden)
P. S. R. De Mattos
Full Text Available Electrophoretic analysis of presumptive twenty gene loci products was conducted in hemolisates and plasma samples of twenty-eight maned wolves (Chrysocyon brachyurus from an area in northeastern São Paulo State, Brazil. The area sampled was divided into three sub-areas, with the Mogi-Guaçu and Pardo rivers regarded as barriers to the gene flow. The polymorphism degree and heterozygosity level (intralocus and average estimated in this study were similar to those detected by other authors for maned wolves and other species of wild free-living canids. The samples of each sub-area and the total sample exhibited genotype frequencies consistent with the genetic equilibrium model. The values of the F-statistics evidenced absence of inbreeding and population subdivision and, consequently, low genetic distances were found among the samples of each area.
Directory of Open Access Journals (Sweden)
E. Lucía-Pavón
2001-12-01
Full Text Available In order to maintain rotifer populations during periods of low algal production, it is necessary to offer alternate diets, some of which include forms of preserved algae. The present work is based on the effect of live and dead Chlorella vulgaris on the population growth of Brachionus calyciflorus and Brachionus patulus. The experimental design consisted of 3 algal levels (0.5x10(6, 1.5x10(6 and 4.5x10(6 cells ml-1 offered in 3 forms (living, frozen and heat-killed. The maximal population density values for B. calyciflorus ranged from 55±1 ind. ml-1 (at 0.5x10(6 cells ml-1 to 471±72 ind. ml-1 (at 4.5x10(6 cells ml-1 with live Chlorella, but was much lower (6±1 to 26±6 ind. ml-1 with frozen or heat-killed alga under comparable food levels. However, the maximum population density of B. patulus under live or or heat-killed Chlorella was similar at comparable algal levels but when offered frozen algae it was four times less. The highest mean peak population density was 1227±83 ind. ml-1 under 4.5x10(6 cells ml-1. The rate of population increase for B. calyciflorus varied from 0.50 to 0.79 using live Chlorella, but under comparable conditions, this range was lower (0.21 to 0.31 for B. patulus. Results have been discussed in light of possible application for aquaculturePara mantener poblaciones de rotíferos durante periodos con escasez de microalgas, es necesario ofrecer dietas alternativas, incluyendo algunas formas de microalgas preservadas. El presente trabajo analiza el efecto de Chlorella vulgaris viva y muerta sobre el crecimiento poblacional de Brachionus calyciflorus y Brachonus patulus. El diseño experimental consistió en tres niveles de algas (0.5x10(6, 1.5x10(6 y 4.5x10(6 células ml-1 ofrecidas en tres formas (viva, congelada y muerta con agua caliente. Las abundancias máximas de población de B. calyciflorus variaron desde 55±1 ind. ml-1 (en 0.5x10(6 células ml-1 a 471±72 ind. ml-1 (en 4.5x10(6 células ml-1 con Chlorella viva
Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir
2014-01-01
Abstract Phylogenetic relationships among Malaysia’s long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo’s population was distinguished from Peninsula’s population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia’s M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations
Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir
2014-01-01
Phylogenetic relationships among Malaysia's long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo's population was distinguished from Peninsula's population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia's M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.
Liu, Rui; Tang, Audrey May Yi; Tan, Yen Ling; Limenta, Lie Michael George; Lee, Edmund Jon Deoon
2009-01-01
The aims of this study were to characterize the population frequency of PEPT2 (SLC15A2) polymorphic variants in three Asian ethnic populations, namely Chinese, Malay and Asian Indian, and to investigate the associations of ethnicity (Chinese vs. Asian Indian), PEPT2 haplotype and cephalexin pharmacokinetics in healthy Asian subjects. PEPT2 polymorphisms were screened from a cohort of 96 Chinese, 96 Malay and 96 Asian Indian subjects. Cephalexin (1000 mg, orally) pharmacokinetics was characterized in an additional 15 Chinese and 15 Asian Indian healthy subjects. These 30 subjects were subsequently genotyped for their PEPT2 polymorphisms. In total, ten common single nucleotide polymorphisms (SNPs) were detected in the three populations, forming two PEPT2 haplotypes. There were significant ethnic differences in PEPT2 haplotype distribution: the frequencies of the *1 and *2 alleles were 0.307 and 0.693 in the Chinese population, 0.495 and 0.505 in the Malay population and 0.729 and 0.271 in Asian Indian population, respectively. The C (max) of cephalexin was significantly lower in the Chinese (29.80 +/- 4.09 microg ml(-1)) population than in the Asian Indian one (33.29 +/- 4.97 microg ml(-1); P = 0.045). This difference could be explained by the higher average body weight of the Chinese population. There was no other significant difference in cephalexin pharmacokinetics between either ethnic or PEPT2 genotype groups. PEPT2 polymorphism distributions differ significantly between Chinese, Malay and Asian Indian populations. However, cephalexin pharmacokinetics is not meaningfully different between Chinese and Asian Indians. The association between the PEPT2 haplotype and cephalexin pharmacokinetics could not be confirmed, and future studies under better controlled conditions are needed.
International Nuclear Information System (INIS)
Heriard-Dubreuil, G.; Schneider, T.
1998-01-01
Experience from the Chernobyl accident revealed strong disturbance in social life and stress phenomenon in the population living in the contaminated territories. The ETHOS project (founded by the radiation protection research programme of the European Commission-DG XII) has initiated an alternative approach of the rehabilitation of living conditions in the contaminated territories of the CIS in the post-accident context of Chernobyl. This project started at the beginning of 1996 and is implemented in the Republic of Belarus. Its main goal is to create the conditions for the inhabitants of contaminated territories to reconstruct their global quality of life. The main features of the methodological approach of the ETHOS project in the village of Olmany in the district of Stolyn (Brest region) since March 1996 are presented, and its implementation and first results are discussed. (R.P.)
Hancock, Nicola; Smith-Merry, Jennifer; Gillespie, James A; Yen, Ivy
2017-10-01
Objective The Partners in Recovery (PIR) program is an Australian government initiative designed to make the mental health and social care sectors work in more coordinated ways to meet the needs of those with severe and complex mental illness. Herein we reflect on demographic data collected during evaluation of PIR implementation in two Western Sydney sites. The aims of the present study were to: (1) explore whether two Sydney-based PIR programs had recruited their intended population, namely people living with severe and persistent mental illness; and (2) learn more about this relatively unknown population and their self-identified need priorities. Methods Routinely collected initial client assessment data were analysed descriptively. Results The data suggest that the two programs are engaging the intended population. The highest unmet needs identified included psychological distress, lack of daytime activities and company, poor physical health and inadequate accommodation. Some groups remain hard to connect, including people from Aboriginal and other culturally diverse communities. Conclusions The data confirm that the PIR program, at least in the two regions evaluated, is mostly reaching its intended audience. Some data were being collected inconsistently, limiting the usefulness of the data and the ability to build on PIR findings to develop ongoing support for this population. What is known about the topic? PIR is a unique national program funded to engage with and address the needs of Australians living with severe and persistent mental illness by facilitating service access. What does this paper add? This paper reports on recruitment of people living with severe and persistent mental illness, their need priorities and data collection. These are three central elements to successful roll-out of the much anticipated mental health component of the National Disability Insurance Scheme, as well as ongoing PIR operation. What are the implications for practitioners
The relationship between poverty and fertility in Peninsular Malaysia: a district analysis.
Teo Cheok Chin, P
1989-01-01
An analysis of the poverty-fertility association in Peninsular Malaysia indicates that the decision to replace the 1970 New Economic Policy, aimed at redistributing income, with a policy based on economic growth through foreign investment may create serious demographic problems for the country. Although the country's crude birth rate fell from 40/1000 in 1950 to 30.3/1000 in 1975, the Malays (55%) of the population experienced only a 3% decline in this period and rural-urban differentials in fertility remained. Data from the 1980 Malaysian census on variables related to absolute and relative poverty confirm the serious nature of Malay rural poverty. Stepwise regression models for the urban-rural and Malay-Chinese factors used the following variables: % Malay, household possession dissimilarity index, ratio of Malay to non-Malay workers who are self-employed and unpaid family workers, ratio of Malay to non-Malay who own their housing, education dissimilarity index, employment rate dissimilarity, households with sanitation, households with electricity, households with piped water, per capita expenditures for basic needs, per capita expenditure for redistributing wealth, average education, median age at marriage, female labor force participation, % of child workers, % married, % rural, and % in agriculture. The partial correlation of the Malay-Chinese component with fertility was 0.42 while the urban-rural correlation was 0.33, suggesting that the ethnic factor is operable even in conditions of rural poverty. Urban poverty can be ameliorated by the provision of infrastructural facilities and Chinese poverty is reduced by the level of modernization, while Malay poverty is responsive to income redistribution. Unless the government reconsiders its policy, the high fertility rates in the impoverished, largely Malay, rural northwest, northeast, central, and east parts will persist.
Attitudes to Mental Illness and Its Demographic Correlates among General Population in Singapore.
Directory of Open Access Journals (Sweden)
Qi Yuan
Full Text Available Public attitudes to mental illness could influence how the public interact with, provide opportunities for, and help people with mental illness.This study aims to explore the underlying factors of the Attitudes to Mental Illness questionnaire among the general population in Singapore and the socio-demographic correlates of each factor.From March 2014 to April 2015, a nation-wide cross-sectional survey on mental health literacy with 3,006 participants was conducted in Singapore.Factor analysis revealed a 4-factor structure for the Attitudes to Mental Illness questionnaire among the Singapore general population, namely social distancing, tolerance/support for community care, social restrictiveness, and prejudice and misconception. Older age, male gender, lower education and socio-economic status were associated with more negative attitudes towards the mentally ill. Chinese showed more negative attitudes than Indians and Malays (except for prejudice and misconception.There is a need for culture-specific interventions, and the associated factors identified in this study should be considered for future attitude campaigns.
Attitudes to Mental Illness and Its Demographic Correlates among General Population in Singapore.
Yuan, Qi; Abdin, Edimansyah; Picco, Louisa; Vaingankar, Janhavi Ajit; Shahwan, Shazana; Jeyagurunathan, Anitha; Sagayadevan, Vathsala; Shafie, Saleha; Tay, Jenny; Chong, Siow Ann; Subramaniam, Mythily
2016-01-01
Public attitudes to mental illness could influence how the public interact with, provide opportunities for, and help people with mental illness. This study aims to explore the underlying factors of the Attitudes to Mental Illness questionnaire among the general population in Singapore and the socio-demographic correlates of each factor. From March 2014 to April 2015, a nation-wide cross-sectional survey on mental health literacy with 3,006 participants was conducted in Singapore. Factor analysis revealed a 4-factor structure for the Attitudes to Mental Illness questionnaire among the Singapore general population, namely social distancing, tolerance/support for community care, social restrictiveness, and prejudice and misconception. Older age, male gender, lower education and socio-economic status were associated with more negative attitudes towards the mentally ill. Chinese showed more negative attitudes than Indians and Malays (except for prejudice and misconception). There is a need for culture-specific interventions, and the associated factors identified in this study should be considered for future attitude campaigns.
International Nuclear Information System (INIS)
Prister, B.S.; Vinogradskaya, V.D.
2009-01-01
On the basis of modern pictures of cesium and strontium ion absorption mechanisms a soil taking complex was build the kinetic model of radionuclide migration from soil to plants. Model parameter association with the agricultural chemistry properties of soil, represented by complex estimation of soil properties S e f. The example of model application for prognostication of population internal irradiation dose due to consumption of milk at the soil way of long-living radionuclides including in food chains
Directory of Open Access Journals (Sweden)
Maik Rehnus
Full Text Available Measurement of glucocorticoid metabolites (GCM in faeces has become a widely used and effective tool for evaluating the amount of stress experienced by animals. However, the potential sampling bias resulting from an oversampling of individuals when collecting "anonymous" (unknown sex or individual faeces has rarely been investigated. We used non-invasive genetic sampling (NIGS to investigate potential interpretation errors of GCM measurements in a free-living population of mountain hares during the mating and post-reproductive periods. Genetic data improved the interpretation of results of faecal GCM measurements. In general GCM concentrations were influenced by season. However, genetic information revealed that it was sex-dependent. Within the mating period, females had higher GCM levels than males, but individual differences were more expressed in males. In the post-reproductive period, GCM concentrations were neither influenced by sex nor individual. We also identified potential pitfalls in the interpretation of anonymous faecal samples by individual differences in GCM concentrations and resampling rates. Our study showed that sex- and individual-dependent GCM levels led to a misinterpretation of GCM values when collecting "anonymous" faeces. To accurately evaluate the amount of stress experienced by free-living animals using faecal GCM measurements, we recommend documenting individuals and their sex of the sampled population. In stress-sensitive and elusive species, such documentation can be achieved by using NIGS and for diurnal animals with sexual and individual variation in appearance or marked individuals, it can be provided by a detailed field protocol.
Evaluating Living Standard Indicators
Directory of Open Access Journals (Sweden)
Birčiaková Naďa
2015-09-01
Full Text Available This paper deals with the evaluation of selected available indicators of living standards, divided into three groups, namely economic, environmental, and social. We have selected six countries of the European Union for analysis: Bulgaria, the Czech Republic, Hungary, Luxembourg, France, and Great Britain. The aim of this paper is to evaluate indicators measuring living standards and suggest the most important factors which should be included in the final measurement. We have tried to determine what factors influence each indicator and what factors affect living standards. We have chosen regression analysis as our main method. From the study of factors, we can deduce their impact on living standards, and thus the value of indicators of living standards. Indicators with a high degree of reliability include the following factors: size and density of population, health care and spending on education. Emissions of carbon dioxide in the atmosphere also have a certain lower degree of reliability.
Eyawo, Oghenowede; Franco-Villalobos, Conrado; Hull, Mark W; Nohpal, Adriana; Samji, Hasina; Sereda, Paul; Lima, Viviane D; Shoveller, Jeannie; Moore, David; Montaner, Julio S G; Hogg, Robert S
2017-02-27
Non-HIV/AIDS-related diseases are gaining prominence as important causes of morbidity and mortality among people living with HIV. The purpose of this study was to characterize and compare changes over time in mortality rates and causes of death among a population-based cohort of persons living with and without HIV in British Columbia (BC), Canada. We analysed data from the Comparative Outcomes And Service Utilization Trends (COAST) study; a retrospective population-based study created via linkage between the BC Centre for Excellence in HIV/AIDS and Population Data BC, and containing data for HIV-infected individuals and the general population of BC, respectively. Our analysis included all known HIV-infected adults (≥ 20 years) in BC and a random 10% sample of uninfected BC adults followed from 1996 to 2012. Deaths were identified through Population Data BC - which contains information on all registered deaths in BC (BC Vital Statistics Agency dataset) and classified into cause of death categories using International Classification of Diseases (ICD) 9/10 codes. Age-standardized mortality rates (ASMR) and mortality rate ratios were calculated. Trend test were performed. 3401 (25%), and 47,647 (9%) individuals died during the 5,620,150 person-years of follow-up among 13,729 HIV-infected and 510,313 uninfected individuals, respectively. All-cause and cause-specific mortality rates were consistently higher among HIV-infected compared to HIV-negative individuals, except for neurological disorders. All-cause ASMR decreased from 126.75 (95% CI: 84.92-168.57) per 1000 population in 1996 to 21.29 (95% CI: 17.79-24.79) in 2011-2012 (83% decline; p ASMR reductions were also observed for hepatic/liver disease and drug abuse/overdose deaths. ASMRs for neurological disorders increased significantly over time. Non-AIDS-defining cancers are currently the leading non-HIV/AIDS-related cause of death in both HIV-infected and uninfected individuals. Despite the significant
Schteingart, M
1989-01-01
"In this article, an attempt is made to account for certain trends in the growth and distribution of the population, and in the structuring of living space in the metropolitan zone of Mexico City.... Among the important conclusions of this essay are those having to do with the huge growth of some political-administrative units and the relation of this phenomenon to the practices followed by private realtors, often articulated with the policies and programs set by the State's housing agencies, as well as those that associate urban growth and expansion with the development of habitational spaces within the so-called 'formal' and 'informal' housing sectors." Data are from Mexican censuses and other official sources. (SUMMARY IN ENG) excerpt
Directory of Open Access Journals (Sweden)
Kamaruzzaman Bustamam-Ahmad
2011-06-01
Full Text Available Islam in Indonesian and Malay world is very much heterogenuous. Taking Islam Liberal, Islam Hadhari, and Islam Progresif as the subject of analysis, this article deals with the concepts Islam Liberal, Islam Hadhari, and Islam Progresif as products of the trends in Islamic thinking, the impact of these three interpretations of Islam in Malaysia and Indonesia, the similarities and dissimilarities between the three, and their future prospects in the region. It argues that the prominence of the debates surrounding the three currents of Islamic thought is the result of struggles for power and authority in Islamic discourse in the region. It further argues that the Indonesian-based Islam Liberal differs from the Malaysian-based Islam Hadhari in that it does not originate from government sources. Islam Progresif is more of an umbrella term referring to various strands of thought developed by Muslims opposed to the status quo. Although Islam Hadhari is a newly-coined term, it contains many elements in common with other schools of Islamic thought including Islam Liberal and neo-modernist Islam.
Directory of Open Access Journals (Sweden)
Negin Chehrehnegar
2016-07-01
Full Text Available Objectives: Increasing life expectancy and decreasing birthrates have significantly contributed to an increased aging population throughout the world. This sudden change is a global phenomenon often resulting in biological changes that may have various consequences, such as reduced life power and coping skills in the elderly population. Cognitive deficits are one of the most severe impairments in the elderly people. Deficits in cognitive abilities, especially visual constructive skills, can have a considerable impact on the independency of the daily living skills of the elderly people. Self-care by individuals to maintain their life and wellbeing is a key element for their independency. The activity of daily living (ADL can support personal life independency, and is considered as a morbidity index. In the present cross-sectional study, we assessed the visual abilities and ADL in older subjects to determine whether cognitive impairment is associated with changes in self-care behavior. Methods & Materials: This study employed random sampling technique to select and recruit forty seven individuals aged between 60 to 80 years from Jahandidegan club in Shiraz, Iran. They were evaluated through "visual constructive ability" sub-scale from Loewenstein Occupational Therapy Cognitive Assessment (LOTCA battery and "Katz Index", which were used to assess their associated skill and ADL, respectively. Data was collected through observation and interviews. Data analysis was performed through Pearson's correlation test using SPSS. Results: The mean age of the participants (9 women and 38 men was 69.94±4.66 years. Lower scores in cognitive domains predicted functional decline in some scales. There was a significant correlation between visual constructive ability and eating; however, no significant correlation was found between this sub-scale with bathing, moving, toileting, and bowel control. Conclusion: In summary, a significant correlation was noted
Wong, L P; Syuhada, A R Nur
2011-09-01
Globally, HIV/AIDS-related stigma and discriminatory attitudes deter the effectiveness of HIV prevention and care programs. This study investigated the general public's perceptions about HIV/AIDS-related stigma and discrimination towards people living with or affected by HIV/AIDS in order to understand the root of HIV/AIDS-related stigma and discriminatory attitudes. Study was carried out using qualitative focus group discussions (FGD). An interview guide with semi-structured questions was used. Participants were members of the public in Malaysia. Purposive sampling was adopted for recruitment of participants. A total 14 focus group discussions (n = 74) was carried out between March and July 2008. HIV/AIDS-related stigma and discrimination towards people living with HIV/AIDS (PLWHA) was profound. Key factors affecting discriminatory attitudes included high-risk taking behavior, individuals related to stigmatized identities, sources of HIV infection, stage of the disease, and relationship with an infected person. Other factors that influence attitudes toward PLWHA include ethnicity and urban-rural locality. Malay participants were less likely than other ethnic groups to perceive no stigmatization if their spouses were HIV positive. HIV/AIDS-related stigma and discrimination were stronger among participants in rural settings. The differences indicate attitudes toward PLWHA are influenced by cultural differences.
Cross-cultural adaptation of the Spence children's anxiety scale in Malaysia.
Ahmadi, Atefeh; Mustaffa, Mohamed Sharif; Haghdoost, AliAkbar; Khan, Aqeel; Latif, Adibah Abdul
2015-01-01
Anxiety among children has increased in recent years. Culturally adapted questionnaires developed to measure the level of anxiety are the best screening instruments for the general population. This study describes the scientific translation and adaptation of the Spence Children's Anxiety Scale (SCAS) into the Malay language. The process of scientific translation of this selfreport instrument followed the guidelines of the Task Force for Translation and Cultural Adaptation of the International Society for Pharmacoeconomics and Outcomes Research (ISPOR). The Malay version and its adaptation for a new cultural context are described. The Malay version achieved the aims of the original version and its conceptual and operational equivalence. It may be used as the first Malay instrument to measure anxiety among children in research and in clinical and community settings.
Cross-cultural adaptation of the Spence Children's Anxiety Scale in Malaysia
Directory of Open Access Journals (Sweden)
Atefeh Ahmadi
2015-03-01
Full Text Available Introduction: Anxiety among children has increased in recent years. Culturally adapted questionnaires developed to measure the level of anxiety are the best screening instruments for the general population. This study describes the scientific translation and adaptation of the Spence Children's Anxiety Scale (SCAS into the Malay language.Method: The process of scientific translation of this selfreport instrument followed the guidelines of the Task Force for Translation and Cultural Adaptation of the International Society for Pharmacoeconomics and Outcomes Research (ISPOR.Results: The Malay version and its adaptation for a new cultural context are described.Conclusion: The Malay version achieved the aims of the original version and its conceptual and operational equivalence. It may be used as the first Malay instrument to measure anxiety among children in research and in clinical and community settings.
Annequin, Margot; Lert, France; Spire, Bruno; Dray-Spira, Rosemary
2016-01-01
Despite improved health, unemployment has increased among people living with HIV (PlwHIV) over the last decade. However, since the economic recession of 2008, unemployment also increased in the French general population. This paper aimed to determine if the increase in the unemployment rate in the HIV population was higher than that in the French general population. We used data from the ANRS-Vespa study, a repeated cross-sectional survey among two national representative samples of PlwHIV followed at hospitals in France in 2003 and 2011. We compared employment and unemployment rates between HIV-infected people (overall and according to period of HIV diagnosis) and the French general population in 2003 and 2011, using multivariate Poisson regressions adjusted for individual sociodemographic characteristics. The employment rate among PlwHIV was consistently lower than that in the general population in 2003 and 2011. In contrast, there was a trend of an increasing unemployment rate difference between PlwHIV and the general population: PlwHIV's unemployment rate was 1.48 (95% confidence interval [CI]: 1.16-1.90) times higher than that of the general population in 2003, versus 1.62 (95% CI: 1.34-1.96) times higher in 2011. This unemployment rate difference was the highest for PlwHIV diagnosed in or after 2008 (adjusted prevalence rate ratio: 2.06; 95% CI: 1.59-2.67). These results suggest that in time of economic recession, an increasing proportion of PlwHIV may be excluded from the labor market although they are willing to re-enter it. This constitutes a major issue relative to social consequences of chronic disease.
DEFF Research Database (Denmark)
Fristrup, Tine
2014-01-01
Europe and the rest of the world, which may help offset the effects of ageing in some counties or regions, but which brings its own challenges. Alongside this change in the structure of the population, we are seeing a reshaping of the lifecourse, from a fairly simple one with three stages – childhood...... and assistive technologies are enabling people to live longer and healthier lives, but sometimes at a substantial cost. Communication technologies are transforming how people interact, how business is done and how public services are delivered. These changes have positive and negative dimensions and can present......Demographic change is changing the shape of Europe. Rising life expectancy, combined with low fertility rates and complex patterns of migration, mean that while the size of the population remains stable, its distribution and average age is rising steadily. At the same time general health...
The genetic history of Peninsular Malaysia.
Norhalifah, Hanim Kamis; Syaza, Fatnin Hisham; Chambers, Geoffrey Keith; Edinur, Hisham Atan
2016-07-15
This article explores the genetic history of the various sub-populations currently living in Peninsular Malaysia. This region has received multiple waves of migrants like the Orang Asli in prehistoric times and the Chinese, Indians, Europeans and Arabs during historic times. There are three highly distinct lineages that make up the Orang Asli; Semang, Senoi and Proto-Malays. The Semang, who have 'Negrito' characteristics, represent the first human settlers in Peninsular Malaysia arriving from about 50,000ya. The Senoi later migrated from Indochina and are a mix between an Asian Neolithic population and the Semang. These Asian genomes probably came in before Austroasiatic languages arrived between 5000 and 4000years ago. Semang and Senoi both now speak Austro-Asiatic languages indicative of cultural diffusion from Senoi to Semang. In contrast, the Proto-Malays who came last to the southern part of this region speak Austronesian language and are Austronesians with some Negrito admixture. It is from this group that the contemporary Malays emerged. Here we provide an overview of the best available genetic evidences (single nucleotide polymorphisms, mitochondrial DNA, Y-chromosome, blood groups, human platelet antigen, human leukocyte antigen, human neutrophil antigen and killer-cell immunoglobulin-like receptor) supporting the complex genetic history of Peninsular Malaysia. Large scale sampling and high throughput genetic screening programmes such as those using genome-wide single nucleotide polymorphism analyses have provided insights into various ancestral and admixture genetic fractions in this region. Given the now extensive admixture present in the contemporary descendants of ancient sub-populations in Peninsular Malaysia, improved reconstruction of human migration history in this region will require new evidence from ancient DNA in well-preserved skeletons. All other aspects of the highly diverse and complex genetic makeup in Peninsular Malaysia should be
The other-race effect in children from a multiracial population: A cross-cultural comparison.
Tham, Diana Su Yun; Bremner, J Gavin; Hay, Dennis
2017-03-01
The role of experience with other-race faces in the development of the other-race effect was investigated through a cross-cultural comparison between 5- and 6-year-olds and 13- and 14-year-olds raised in a monoracial (British White, n=83) population and a multiracial (Malaysian Chinese, n=68) population. British White children showed an other-race effect to three other-race faces (Chinese, Malay, and African Black) that was stable across age. Malaysian Chinese children showed a recognition deficit for less experienced faces (African Black) but showed a recognition advantage for faces of which they have direct or indirect experience. Interestingly, younger (Malaysian Chinese) children showed no other-race effect for female faces such that they can recognize all female faces regardless of race. These findings point to the importance of early race and gender experiences in reorganizing the face representation to accommodate changes in experience across development. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jane M Hughes
Full Text Available The Australian lungfish is a unique living representative of an ancient dipnoan lineage, listed as 'vulnerable' to extinction under Australia's Environment Protection and Biodiversity Conservation Act 1999. Historical accounts indicate this species occurred naturally in two adjacent river systems in Australia, the Burnett and Mary. Current day populations in other rivers are thought to have arisen by translocation from these source populations. Early genetic work detected very little variation and so had limited power to answer questions relevant for management including how genetic variation is partitioned within and among sub-populations. In this study, we use newly developed microsatellite markers to examine samples from the Burnett and Mary Rivers, as well as from two populations thought to be of translocated origin, Brisbane and North Pine. We test whether there is significant genetic structure among and within river drainages; assign putatively translocated populations to potential source populations; and estimate effective population sizes. Eleven polymorphic microsatellite loci genotyped in 218 individuals gave an average within-population heterozygosity of 0.39 which is low relative to other threatened taxa and for freshwater fishes in general. Based on FST values (average over loci = 0.11 and STRUCTURE analyses, we identify three distinct populations in the natural range, one in the Burnett and two distinct populations in the Mary. These analyses also support the hypothesis that the Mary River is the likely source of translocated populations in the Brisbane and North Pine rivers, which agrees with historical published records of a translocation event giving rise to these populations. We were unable to obtain bounded estimates of effective population size, as we have too few genotype combinations, although point estimates were low, ranging from 29 - 129. We recommend that, in order to preserve any local adaptation in the three distinct
Palawi, Ari
2017-01-01
This thesis investigates the music-cultural identity and conservational dilemma of the hitherto un-researched music-culture of the Islanders (Urang Pulo) of the Banyak Archipelago in Aceh-Singkil Regency off the west coast of Aceh, Indonesia. The Islanders’ dominant concept of identity is coloured by their dominant sikambang music, dance and legend, history of cultural contact with west-coastal Sumatran Malay and offshore island area, Niasan and Simeulue immigration to th...
An Exploratory Note on Interstate Living-Cost Differentials
Cebula, Richard
1985-01-01
This exploratory study seeks to identify factors that systematically influence interstate living-cost differentials. Living costs refer to the average cost of living for a four-person family in each of the 50 states. For the year 1977, the living cost level is found to be an increasing function of population density, average income, and the degree of urbanization, while being a decreasing function of the presence of right-to-work laws.
Deng, Chunyan; Xie, Han; Ye, Xuejie; Zhang, Haoran; Liu, Maodian; Tong, Yindong; Ou, Langbo; Yuan, Wen; Zhang, Wei; Wang, Xuejun
2016-12-01
Risk assessments for human health have been conducted for municipal solid waste incinerators (MSWIs) in many western countries, whereas only a few risk assessments have been performed for MSWIs in developing countries such as China where the use of waste incineration is increasing rapidly. To assess the mercury exposure risks of a population living near the largest MSWI in South China, we combined internal exposure and external exposure assessment with an individual-specific questionnaire. The mercury concentrations in air, soil, and locally collected food around the MSWI were assessed. The total mercury (T-Hg) and methylmercury (MeHg) of 447 blood samples from a control group, residential exposure group, and MSWI workers were measured. The internal and external exposures of the subject population were analyzed. Significant difference in MeHg concentrations was observed between the control group and the exposed group, between the control group and the MSWI workers, and between the exposed group and the MSWI workers (median levels: 0.70 μg/L, 0.81 μg/L, and 1.02 μg/L for the control group, exposed group, and MSWI workers, respectively). The MeHg/T-Hg ratio was 0.51 ± 0.19, 0.59 ± 0.17 and 0.58 ± 0.25, respectively. Multiple linear regression analysis indicated that MeHg concentrations were positively correlated with the gaseous mercury in the air. Combining internal and external exposure assessment showed that the direct contribution of MSWI emissions was minor compared with the dietary contribution. The external and internal exposures were well matched with each other. This study also suggested that an integrated method combining internal and external exposure assessment with an individual-specific questionnaire is feasible to assess the risks for a population living near a MSWI. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Iyengar, G.V.; Kawamura, H.; Dang, H.S.; Parr, R.M.; Wang, J.W.; Akhter, Perveen; Cho, S.Y.; Natera, E.; Miah, F.K.; Nguyen, M.S.
2004-01-01
Daily dietary intakes of two naturally occurring long-lived radionuclides, 232 Th and 238 U, were estimated for the adult population living in a number of Asian countries, using highly sensitive analytical methods such as instrumental and radiochemical neutron activation analysis (INAA and RNAA), and inductively coupled plasma mass spectrometry (ICP-MS). The Asian countries that participated in the study were Bangladesh (BGD), China (CPR), India (IND), Japan (JPN), Pakistan (PAK), Philippines (PHI), Republic of Korea (ROK) and Vietnam (VIE). Altogether, these countries represent more than 50% of the world population. The median daily intakes of 232 Th ranged between 0.6 and 14.4 mBq, the lowest being for Philippines and the highest for Bangladesh, and daily intakes of 238 U ranged between 6.7 and 62.5 mBq, lowest and the highest being for India and China, respectively. The Asian median intakes were obtained as 4.2 mBq for 232 Th and 12.7 mBq for 238 U. Although the Asian intakes were lower than intakes of 12.3 mBq (3.0 μg) 232 Th and 23.6 mBq (1.9 μg) 238 U proposed by the International Commission on Radiological Protection (ICRP) for the ICRP Reference Man, they were comparable to the global intake values of 4.6 mBq 232 Th and 15.6 mBq 238 U proposed by the United Nation Scientific Commission on Effects of Radiation (UNSCEAR). The annual committed effective doses to Asian population from the dietary intake of 232 Th and 238 U were calculated to be 0.34 and 0.20 μSv, respectively, which are three orders of magnitude lower than the global average annual radiation dose of 2400 μSv to man from the natural radiation sources as proposed by UNSCEAR
Elfering, Achim; Cronenberg, Sonja; Grebner, Simone; Tamcan, Oezguer; Müller, Urs
2017-12-01
A newly developed questionnaire assessing limitations in activity of daily living (LADL-Q) that should improve assessment of LADL is tested in a large population-based validation study. This survey was paper-based. Overall, 16,634 individuals who were representative of the working population in the German-speaking part of Switzerland participated in the study. Item analysis was used the final version of the LADL-Q to four items per subscale that correspond to potential problems in three body regions (back and neck, upper extremities, lower extremities). Analysis included tests for reliability, internal consistency, dimensionality and convergent validity. Test-retest reliability coefficients after 2 weeks ranged from 0.82 to 0.99 (Mdn = 0.87), with no item having a coefficient below 0.60. The median item-total coefficients ranged between moderate and good. Correlation coefficients between LADL-Q subscales and three validated clinical instruments (Western Ontario and McMaster Universities osteoarthritis index, shoulder pain disability index, Oswestry) ranged from 0.63 to 0.81. In structural equation modeling the three subscales were significantly related with two important outcomes in occupational rehabilitation: self-reported general health and daily task performance. The new LADL-Q is a brief, reliable and valid tool for assessment of LADL in studies on musculoskeletal health.
The Usage of Animals in the Lives of the Lanoh and Temiar Tribes of Lenggong, Perak
Directory of Open Access Journals (Sweden)
Yahaya Fatan Hamamah
2015-01-01
Full Text Available In Malaysia, the Orang Asli communities are natives that comprise the Negrito, Senoi and Proto-Malay peoples. Traditionally, the Orang Asli live in isolated forests or in forest peripheries. Although Globalisation occurs in Malaysia, its occurrence does not affect the traditional values of the said Orang Asli, who still depend on the natural environment to live. Nature provides the Orang Asli with a community resource for acquiring animals that are not just consumed as food, but also used in medicine, hunting and myth creation. This study intends to identify the animal species and the methods the Senoi and Negrito use these animals, within the aspects of their diet, medicine, hunting methods and their myth creation. Empirical data collection is focused only on the Lanoh and Temiar tribes who live in Lenggong. The method of data collection involves in-depth interviews with key informants that comprise Tok Batins (tribal chiefs and focus groups from the chosen Orang Asli village communities in Kampung Air Bah and Kampung Lubuk Chupak, Lenggong. The findings of this study reveal a wide variety of animals are still being hunted by the Orang Asli community for food and medicine. Apart from that, there are specific beliefs regarding the animals hunted narrated through myths and legends. Therefore, this study is significant in order to determine that the animal usage in the lives of the Orang Asli community continue for the sake of the demands of their heritage and families in order to preserve its pristine continuity. This is because while findings show that wildlife is still used by the Orang Asli, their usage among the younger generation is increasingly eroded due to such factors as wildlife extinction, dwindling availability, new religious taboos and modern progress which continues to find its place within the Orang Asli community.
Directory of Open Access Journals (Sweden)
L. Parzianello
2008-06-01
Full Text Available Apolipoprotein CIII (apo-CIII participates in the regulation of triglyceride-rich lipoprotein metabolism. Several polymorphic sites have been detected within and around the apo-CIII gene. Here, we examined the relationship between apo-CIII SstI polymorphism (CC, CG, GG genotypes and plasma triglyceride (TG levels in a group of 159 Japanese individuals living in Southern Brazil. The sample was divided into a group of Japanese descendants (N = 51 with high TG (HTG; >200 mg/dL and a group of Japanese descendants (N = 108 with normal TG (NTG; <200 mg/dL. TG and total cholesterol levels were analyzed by an enzymatic method using the Labtest-Diagnostic kit and high- and low-density lipoproteins by a direct method using the Labtest-Diagnostic kit and DiaSys Diagnostic System International kit, respectively. A 428-bp sequence of apo-CIII gene was amplified using oligonucleotide primers 5' GGT GAC CGA TGG CTT CAG TTC CCT GA 3' and 5' CAG AAG GTG GAT AGA GCG CTG GCC T 3'. The PCR products were digested with a restriction endonuclease SstI. Rare G allele was highly prevalent in our study population (0.416 compared to Caucasians (0.00-0.11. G allele was almost two times more prevalent in the HTG group compared to the NTG group (P < 0.001. The genotype distribution was consistent with the Hardy-Weinberg equilibrium. There was a significant association between rare G allele and HTG in Japanese individuals living in Southern Brazil as indicated by one-way ANOVA, P < 0.05.
Liang, Yajun; Welmer, Anna-Karin; Möller, Jette; Qiu, Chengxuan
2017-08-28
Data on trends for disability in instrumental activity of daily living (IADL) are sparse in older Chinese adults. To assess trends in prevalence and incidence of IADL disability among older Chinese adults and to explore contributing factors. Population based study. 15 provinces and municipalities in China. Participants (age ≥60) were from four waves of the China Health and Nutrition Survey, conducted in 1997 (n=1533), 2000 (n=1581), 2004 (n=2028) and 2006 (n=2256), and from two cohorts constructed within the national survey: cohort 1997-2004 (n=712) and cohort 2000-2006 (n=823). IADL disability was defined as inability to perform one or more of the following: shopping, cooking, using transportation, financing and telephoning. Data were analysed with logistic regression and generalised estimating equation models. The prevalence of IADL disability significantly decreased from 1997 to 2006 in the total sample and in all of the subgroups by age, sex, living region and IADL items (all p trend 0.10). The recovery rate from IADL disability significantly increased over time in those aged 60-69 years (p=0.03). Living in a rural area or access to local clinics for healthcare was less disabling over time (p trend <0.02). The prevalence of IADL disability decreased among older Chinese adults during 1997-2006, whereas the incidence remained stable. The declining prevalence of IADL disability might be partly due to the decreased duration of IADL disability, and to improvements in living conditions and healthcare facilities over time. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Patrício, P.; Almeida, P. L.; Portela, R.; Sobral, R. G.; Grilo, I. R.; Cidade, T.; Leal, C. R.
2014-08-01
The activity of growing living bacteria was investigated using real-time and in situ rheology—in stationary and oscillatory shear. Two different strains of the human pathogen Staphylococcus aureus—strain COL and its isogenic cell wall autolysis mutant, RUSAL9—were considered in this work. For low bacteria density, strain COL forms small clusters, while the mutant, presenting deficient cell separation, forms irregular larger aggregates. In the early stages of growth, when subjected to a stationary shear, the viscosity of the cultures of both strains increases with the population of cells. As the bacteria reach the exponential phase of growth, the viscosity of the cultures of the two strains follows different and rich behaviors, with no counterpart in the optical density or in the population's colony-forming units measurements. While the viscosity of strain COL culture keeps increasing during the exponential phase and returns close to its initial value for the late phase of growth, where the population stabilizes, the viscosity of the mutant strain culture decreases steeply, still in the exponential phase, remains constant for some time, and increases again, reaching a constant plateau at a maximum value for the late phase of growth. These complex viscoelastic behaviors, which were observed to be shear-stress-dependent, are a consequence of two coupled effects: the cell density continuous increase and its changing interacting properties. The viscous and elastic moduli of strain COL culture, obtained with oscillatory shear, exhibit power-law behaviors whose exponents are dependent on the bacteria growth stage. The viscous and elastic moduli of the mutant culture have complex behaviors, emerging from the different relaxation times that are associated with the large molecules of the medium and the self-organized structures of bacteria. Nevertheless, these behaviors reflect the bacteria growth stage.
Directory of Open Access Journals (Sweden)
Martin W Hahn
Full Text Available The bacterial taxon Polynucleobacter necessarius subspecies asymbioticus represents a group of planktonic freshwater bacteria with cosmopolitan and ubiquitous distribution in standing freshwater habitats. These bacteria comprise <1% to 70% (on average about 20% of total bacterioplankton cells in various freshwater habitats. The ubiquity of this taxon was recently explained by intra-taxon ecological diversification, i.e. specialization of lineages to specific environmental conditions; however, details on specific adaptations are not known. Here we investigated by means of genomic and experimental analyses the ecological adaptation of a persistent population dwelling in a small acidic pond.The investigated population (F10 lineage contributed on average 11% to total bacterioplankton in the pond during the vegetation periods (ice-free period, usually May to November. Only a low degree of genetic diversification of the population could be revealed. These bacteria are characterized by a small genome size (2.1 Mb, a relatively small number of genes involved in transduction of environmental signals, and the lack of motility and quorum sensing. Experiments indicated that these bacteria live as chemoorganotrophs by mainly utilizing low-molecular-weight substrates derived from photooxidation of humic substances.Evolutionary genome streamlining resulted in a highly passive lifestyle so far only known among free-living bacteria from pelagic marine taxa dwelling in environmentally stable nutrient-poor off-shore systems. Surprisingly, such a lifestyle is also successful in a highly dynamic and nutrient-richer environment such as the water column of the investigated pond, which was undergoing complete mixis and pronounced stratification in diurnal cycles. Obviously, metabolic and ecological versatility is not a prerequisite for long-lasting establishment of abundant bacterial populations under highly dynamic environmental conditions. Caution should be exercised
Boyden, Jo
2013-01-01
This article examines the association between formal education, social mobility and independent child migration in Ethiopia, India (Andhra Pradesh), Peru and Vietnam and draws on data from Young Lives, a longitudinal study of childhood poverty and schooling. It argues that among resource-poor populations, child migration sustains kin relations…
Variations in tooth size and arch dimensions in Malay schoolchildren.
Hussein, Khalid W; Rajion, Zainul A; Hassan, Rozita; Noor, Siti Noor Fazliah Mohd
2009-11-01
To compare the mesio-distal tooth sizes and dental arch dimensions in Malay boys and girls with Class I, Class II and Class III malocclusions. The dental casts of 150 subjects (78 boys, 72 girls), between 12 and 16 years of age, with Class I, Class II and Class III malocclusions were used. Each group consisted of 50 subjects. An electronic digital caliper was used to measure the mesio-distal tooth sizes of the upper and lower permanent teeth (first molar to first molar), the intercanine and intermolar widths. The arch lengths and arch perimeters were measured with AutoCAD software (Autodesk Inc., San Rafael, CA, U.S.A.). The mesio-distal dimensions of the upper lateral incisors and canines in the Class I malocclusion group were significantly smaller than the corresponding teeth in the Class III and Class II groups, respectively. The lower canines and first molars were significantly smaller in the Class I group than the corresponding teeth in the Class II group. The lower intercanine width was significantly smaller in the Class II group as compared with the Class I group, and the upper intermolar width was significantly larger in Class III group as compared with the Class II group. There were no significant differences in the arch perimeters or arch lengths. The boys had significantly wider teeth than the girls, except for the left lower second premolar. The boys also had larger upper and lower intermolar widths and lower intercanine width than the girls. Small, but statistically significant, differences in tooth sizes are not necessarily accompanied by significant arch width, arch length or arch perimeter differences. Generally, boys have wider teeth, larger lower intercanine width and upper and lower intermolar widths than girls.
Directory of Open Access Journals (Sweden)
Nur Wahida Md Hassan
2017-03-01
Full Text Available The process of teaching and learning that is active and can attract many students to learn. Especially those with learning difficulties who require special methods for helping their learning process to make it more interesting. Therefore, this study is more focused on teaching and learning courseware ‘Let’s Reading’ methods using reading method called syllables have features that can help students with learning disabilities to learn Malay Language. The respondents comprised of six students with learning disabilities moderate levels studying in a secondary school in Kuala Lumpur. A monitoring form adaptation course from Davis et al. (2007 and (Sidek et al., 2014 with some modifications has been used as an instrument to evaluate the study. The findings were analyzed using quatitative methods. In addition, the oral test is carried out before and after the use of the software is run. The study found software has been developed according to the development ASSURE model is able to attract pupils with learning disabilities to learn Malay Language. In addition, these children also showed improvements in reading. Proses pembelajaran dan pengajaran yang aktif dan pelbagai dapat menarik minat murid untuk belajar. Terutamanya murid bermasalah pembelajaran yang memerlukan kaedah khusus bagi membantu proses pembelajaran mereka agar lebih menarik. Oleh itu, kajian ini dijalankan yang lebih tertumpu kepada pengajaran dan pembelajaran menggunakan perisian kursus ‘Jom Bacalah’ yang menggunakan kaedah membaca menggunakan kaedah sebut suku kata yang mempunyai ciri-ciri yang dapat membantu murid bermasalah pembelajaran untuk belajar Bahasa Melayu. Responden kajian terdiri daripada enam murid bermasalah pembelajaran aras sederhana yang sedang belajar di sebuah sekolah menengah di Kuala Lumpur. Satu borang pemantauan kursus adaptasi daripada kajian Davis et al. (2007 dan Sidek et al. (2014 dengan sedikit pengubahsuaian telah digunakan sebagai instrumen bagi
Prevalence of and risk factors for age-related macular degeneration in a multiethnic Asian cohort.
Cheung, Chui Ming Gemmy; Tai, E Shyong; Kawasaki, Ryo; Tay, Wan Ting; Lee, Jeannette L; Hamzah, Haslina; Wong, Tien Y
2012-04-01
To describe the prevalence of and risk factors for age-related macular degeneration (AMD) in a multiethnic Asian cohort of Chinese, Malay, and Indian persons. In this population-based study, 3172 persons of Chinese, Malay, and Indian ethnicities 40 years and older were included. Participants underwent comprehensive systemic and ocular examination, retinal photography, and laboratory investigations. Early and late AMD signs were graded from retinal photographs. Age-standardized prevalence estimates were calculated using the 2010 Singapore adult population as the standard population. Association with a range of systemic risk factors was analyzed. Of 3172 participants, AMD was present in 211 subjects. Age-standardized prevalence of AMD was 7.0% in persons 40 years and older. The age-standardized prevalence was similar in all 3 Asian ethnic groups: Chinese, 7.3%; Malay, 7.7%; and Indian, 5.7% (P value = .44). The prevalence increased with age and was higher in men. Of the range of risk factors evaluated, only myopic refractive error (Chinese men. The prevalence of AMD was similar in the 3 major ethnic groups in Asia and comparable with white populations. Myopic refractive error was associated with reduced risk of AMD in Chinese men.
Predicted equations for ventilatory function among Kuching (Sarawak, Malaysia) population.
Djojodibroto, R D; Pratibha, G; Kamaluddin, B; Manjit, S S; Sumitabha, G; Kumar, A Deva; Hashami, B
2009-12-01
Spirometry data of 869 individuals (males and females) between the ages of 10 to 60 years were analyzed. The analysis yielded the following conclusions: 1. The pattern of Forced Vital Capacity (FVC) and Forced Expiratory Volume in One Second (FEV1) for the selected subgroups seems to be gender dependant: in males, the highest values were seen in the Chinese, followed by the Malay, and then the Dayak; in females, the highest values were seen in the Chinese, followed by the Dayak, and then the Malay. 2. Smoking that did not produce respiratory symptom was not associated with a decline in lung function, in fact we noted higher values in smokers as compared to nonsmokers. 3. Prediction formulae (54 in total) are worked out for FVC & FEV1 for the respective gender and each of the selected subgroups.
Cognitive assisted living ambient system: a survey
Directory of Open Access Journals (Sweden)
Ruijiao Li
2015-11-01
Full Text Available The demographic change towards an aging population is creating a significant impact and introducing drastic challenges to our society. We therefore need to find ways to assist older people to stay independently and prevent social isolation of these population. Information and Communication Technologies (ICT provide various solutions to help older adults to improve their quality of life, stay healthier, and live independently for a time. Ambient Assisted Living (AAL is a field to investigate innovative technologies to provide assistance as well as healthcare and rehabilitation to impaired seniors. The paper provides a review of research background and technologies of AAL.
Schembre, Susan M.; Yuen, Jessica
2011-01-01
There are no standardized methods for monitoring appetite in free-living populations. Fifteen participants tested a computer-automated text-messaging system designed to track hunger ratings over seven days. Participants were sent text-messages (SMS) hourly and instructed to reply during waking hours with their current hunger rating. Of 168 SMS, 0.6-7.1% were undelivered, varying by mobile service provider, On average 12 SMS responses were received daily with minor variations by observation day or day of the week. Compliance was over 74% and 93% of the ratings were received within 30-minutes. Automated text-messaging is a feasible method to monitor appetite ratings in this population. PMID:21251941
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
Energy Technology Data Exchange (ETDEWEB)
Sulaiman, Noorzamzarina; Hamzah, Umar; Samsudin, Abdul Rahim [Geology Programme, School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)
2014-09-03
Fluvial sandstones constitute one of the major clastic petroleum reservoir types in many sedimentary basins around the world. This study is based on the analysis of high-resolution, shallow (seabed to 500 m depth) 3D seismic data which generated three-dimensional (3D) time slices that provide exceptional imaging of the geometry, dimension and temporal and spatial distribution of fluvial channels. The study area is in the northeast of Malay Basin about 280 km to the east of Terengganu offshore. The Malay Basin comprises a thick (> 8 km), rift to post-rift Oligo-Miocene to Pliocene basin-fill. The youngest (Miocene to Pliocene), post-rift succession is dominated by a thick (1–5 km), cyclic succession of coastal plain and coastal deposits, which accumulated in a humid-tropical climatic setting. This study focuses on the Pleistocene to Recent (500 m thick) succession, which comprises a range of seismic facies analysis of the two-dimensional (2D) seismic sections, mainly reflecting changes in fluvial channel style and river architecture. The succession has been divided into four seismic units (Unit S1-S4), bounded by basin-wide strata surfaces. Two types of boundaries have been identified: 1) a boundary that is defined by a regionally-extensive erosion surface at the base of a prominent incised valley (S3 and S4); 2) a sequence boundary that is defined by more weakly-incised, straight and low-sinuosity channels which is interpreted as low-stand alluvial bypass channel systems (S1 and S2). Each unit displays a predictable vertical change of the channel pattern and scale, with wide low-sinuosity channels at the base passing gradationally upwards into narrow high-sinuosity channels at the top. The wide variation in channel style and size is interpreted to be controlled mainly by the sea-level fluctuations on the widely flat Sunda land Platform.
Sulaiman, Noorzamzarina; Hamzah, Umar; Samsudin, Abdul Rahim
2014-09-01
Fluvial sandstones constitute one of the major clastic petroleum reservoir types in many sedimentary basins around the world. This study is based on the analysis of high-resolution, shallow (seabed to 500 m depth) 3D seismic data which generated three-dimensional (3D) time slices that provide exceptional imaging of the geometry, dimension and temporal and spatial distribution of fluvial channels. The study area is in the northeast of Malay Basin about 280 km to the east of Terengganu offshore. The Malay Basin comprises a thick (> 8 km), rift to post-rift Oligo-Miocene to Pliocene basin-fill. The youngest (Miocene to Pliocene), post-rift succession is dominated by a thick (1-5 km), cyclic succession of coastal plain and coastal deposits, which accumulated in a humid-tropical climatic setting. This study focuses on the Pleistocene to Recent (500 m thick) succession, which comprises a range of seismic facies analysis of the two-dimensional (2D) seismic sections, mainly reflecting changes in fluvial channel style and river architecture. The succession has been divided into four seismic units (Unit S1-S4), bounded by basin-wide strata surfaces. Two types of boundaries have been identified: 1) a boundary that is defined by a regionally-extensive erosion surface at the base of a prominent incised valley (S3 and S4); 2) a sequence boundary that is defined by more weakly-incised, straight and low-sinuosity channels which is interpreted as low-stand alluvial bypass channel systems (S1 and S2). Each unit displays a predictable vertical change of the channel pattern and scale, with wide low-sinuosity channels at the base passing gradationally upwards into narrow high-sinuosity channels at the top. The wide variation in channel style and size is interpreted to be controlled mainly by the sea-level fluctuations on the widely flat Sunda land Platform.
International Nuclear Information System (INIS)
Sulaiman, Noorzamzarina; Hamzah, Umar; Samsudin, Abdul Rahim
2014-01-01
Fluvial sandstones constitute one of the major clastic petroleum reservoir types in many sedimentary basins around the world. This study is based on the analysis of high-resolution, shallow (seabed to 500 m depth) 3D seismic data which generated three-dimensional (3D) time slices that provide exceptional imaging of the geometry, dimension and temporal and spatial distribution of fluvial channels. The study area is in the northeast of Malay Basin about 280 km to the east of Terengganu offshore. The Malay Basin comprises a thick (> 8 km), rift to post-rift Oligo-Miocene to Pliocene basin-fill. The youngest (Miocene to Pliocene), post-rift succession is dominated by a thick (1–5 km), cyclic succession of coastal plain and coastal deposits, which accumulated in a humid-tropical climatic setting. This study focuses on the Pleistocene to Recent (500 m thick) succession, which comprises a range of seismic facies analysis of the two-dimensional (2D) seismic sections, mainly reflecting changes in fluvial channel style and river architecture. The succession has been divided into four seismic units (Unit S1-S4), bounded by basin-wide strata surfaces. Two types of boundaries have been identified: 1) a boundary that is defined by a regionally-extensive erosion surface at the base of a prominent incised valley (S3 and S4); 2) a sequence boundary that is defined by more weakly-incised, straight and low-sinuosity channels which is interpreted as low-stand alluvial bypass channel systems (S1 and S2). Each unit displays a predictable vertical change of the channel pattern and scale, with wide low-sinuosity channels at the base passing gradationally upwards into narrow high-sinuosity channels at the top. The wide variation in channel style and size is interpreted to be controlled mainly by the sea-level fluctuations on the widely flat Sunda land Platform
Sazlina, Shariff-Ghazali; Browning, Colette Joy; Yasin, Shajahan
2015-01-01
Regular physical activity is an important aspect of self-management among older people with type 2 diabetes but many remain inactive. Interventions to improve physical activity levels have been studied but few studies have evaluated the effects of personalized feedback (PF) or peer support (PS); and there was no study on older people of Asian heritage. Hence, this trial evaluated whether PF only or combined with PS improves physical activity among older Malays with type 2 diabetes (T2DM) compared to usual care only. A three-arm randomized controlled trial was conducted in a primary healthcare clinic in Malaysia. Sixty-nine sedentary Malays aged 60 years and older with T2DM who received usual diabetes care were randomized to PF or PS interventions or as controls for 12 weeks with follow-ups at weeks 24 and 36. Intervention groups performed unsupervised walking activity and received written feedback on physical activity. The PS group also received group and telephone contacts from trained peer mentors. The primary outcome was pedometer steps. Secondary outcomes were self-reported physical activity, cardiovascular risk factors, cardiorespiratory fitness, balance, quality of life, and psychosocial wellbeing. Fifty-two (75.4%) completed the 36-week study. The PS group showed greater daily pedometer readings than the PF and controls (p = 0.001). The PS group also had greater improvement in weekly duration (p fitness, and support from friends. Current Controlled Trials ISRCTN71447000.
Rehabilitation needs for older adults with stroke living at home: perceptions of four populations
Directory of Open Access Journals (Sweden)
Viscogliosi Chantal
2007-08-01
Full Text Available Abstract Background Many people who have suffered a stroke require rehabilitation to help them resume their previous activities and roles in their own environment, but only some of them receive inpatient or even outpatient rehabilitation services. Partial and unmet rehabilitation needs may ultimately lead to a loss of functional autonomy, which increases utilization of health services, number of hospitalizations and early institutionalization, leading to a significant psychological and financial burden on the patients, their families and the health care system. The aim of this study was to explore partially met and unmet rehabilitation needs of older adults who had suffered a stroke and who live in the community. The emphasis was put on needs that act as obstacles to social participation in terms of personal factors, environmental factors and life habits, from the point of view of four target populations. Methods Using the focus group technique, we met four types of experts living in three geographic areas of the province of Québec (Canada: older people with stroke, caregivers, health professionals and health care managers, for a total of 12 groups and 72 participants. The audio recordings of the meetings were transcribed and NVivo software was used to manage the data. The process of reducing, categorizing and analyzing the data was conducted using themes from the Disability Creation Process model. Results Rehabilitation needs persist for nine capabilities (e.g. related to behaviour or motor activities, nine factors related to the environment (e.g. type of teaching, adaptation and rehabilitation and 11 life habits (e.g. nutrition, interpersonal relationships. The caregivers and health professionals identified more unmet needs and insisted on an individualized rehabilitation. Older people with stroke and the health care managers had a more global view of rehabilitation needs and emphasized the availability of resources. Conclusion Better
Directory of Open Access Journals (Sweden)
Hossein Bahri
2016-06-01
Full Text Available The present paper examines the use of Google Translate as a supplementary tool for helping international students at Universiti Sains Malaysia (USM to learn and develop their knowledge and skills in learning Bahasa Malaysia (Malay Language. The participants of the study were 16 international students at the School of Languages, Literacies, and Translation, USM who had registered for the LKM 100 Bahasa Malaysia (I course. Based on the literature review, analysis of the collected data, and an assessment of the course content and activities inside and outside the language classroom, the findings suggest that most international students at USM recognize Google Translate as an effective supplementary tool for learning vocabulary, writing, and reading in Bahasa Malaysia. In fact, some students reported that they could optimally benefit from their self-learning if they were assisted to use Google Translate effectively. Moreover, using Google Translate for doing classroom tasks and activities can encourage students to study independently, and to shape their own strategies for solving language learning problems. Keywords: Google Translate, supplementary tool, translation, language learning, Bahasa Malaysia
Directory of Open Access Journals (Sweden)
Sharifah Mohamad
2013-02-01
Full Text Available A total of 60 products of traditional herbal medicine (THM in various dosage forms of herbal preparation were analyzed to determine selected trace elements (i.e., Zn, Mn, Cu, Cd, and Se using ICP-MS. Thirty types of both Chinese and Malay THMs were chosen to represent each population. The closed vessel acid microwave digestion method, using CEM MARS 5, was employed for the extraction of the selected trace elements. The digestion method applied was validated by using certified reference material from the Trace Element in Spinach Leaves (SRM1570a. The recoveries of all elements were found to be in the range of 85.3%–98.9%. The results indicated that Zn, Mn, Cu, Cd and Se have their own trends of concentrations in all samples studied. The daily intake concentrations of the elements were in the following order: Mn > Zn > Cu > Se > Cd. Concentrations of all five elements were found to be dominant in Chinese THMs. The essentiality of the selected trace elements was also assessed, based on the recommended daily allowance (RDA, adequate intake (AI and the United States Pharmacopeia (USP for trace elements as reference. The concentrations of all elements studied were below the RDA, AI and USP values, which fall within the essential concentration range, except for cadmium.
Women live longer than men even during severe famines and epidemics
DEFF Research Database (Denmark)
Zarulli, Virginia; Barthold Jones, Julia A; Oksuzyan, Anna
2018-01-01
Women in almost all modern populations live longer than men. Research to date provides evidence for both biological and social factors influencing this gender gap. Conditions when both men and women experience extremely high levels of mortality risk are unexplored sources of information. We...... investigate the survival of both sexes in seven populations under extreme conditions from famines, epidemics, and slavery. Women survived better than men: In all populations, they had lower mortality across almost all ages, and, with the exception of one slave population, they lived longer on average than men...
Annequin, Margot; Lert, France; Spire, Bruno; Dray-Spira, Rosemary
2016-01-01
Background Despite improved health, unemployment has increased among people living with HIV (PlwHIV) over the last decade. However, since the economic recession of 2008, unemployment also increased in the French general population. This paper aimed to determine if the increase in the unemployment rate in the HIV population was higher than that in the French general population. Methods We used data from the ANRS-Vespa study, a repeated cross-sectional survey among two national representative samples of PlwHIV followed at hospitals in France in 2003 and 2011. We compared employment and unemployment rates between HIV-infected people (overall and according to period of HIV diagnosis) and the French general population in 2003 and 2011, using multivariate Poisson regressions adjusted for individual sociodemographic characteristics. Results The employment rate among PlwHIV was consistently lower than that in the general population in 2003 and 2011. In contrast, there was a trend of an increasing unemployment rate difference between PlwHIV and the general population: PlwHIV’s unemployment rate was 1.48 (95% confidence interval [CI]: 1.16–1.90) times higher than that of the general population in 2003, versus 1.62 (95% CI: 1.34–1.96) times higher in 2011. This unemployment rate difference was the highest for PlwHIV diagnosed in or after 2008 (adjusted prevalence rate ratio: 2.06; 95% CI: 1.59–2.67). Conclusions These results suggest that in time of economic recession, an increasing proportion of PlwHIV may be excluded from the labor market although they are willing to re-enter it. This constitutes a major issue relative to social consequences of chronic disease. PMID:27814374
International Nuclear Information System (INIS)
Lindholm, C.; Bersimbacv, R. I.; Dubrova, Y. E.; Hulten, M.; Bigbee, W. I.; Murphy, B. P.; Koivistoinen, A.; Tankimonova, M.; Mamyrbaeva, Z.; Djansugarova, L.; Mustonen, R.; Salomaa, S.
2004-01-01
The objectives of the study were to determine minisatellite mutation rates in families in three generations and to perform retrospective biodosimetry of individuals in these families living close to the Semipalatinsk nuclear test site in Kazakhstan. The oldes generation (Po) lived in the area at the time of the first Soviet nuclear test in 1949 whereas the younger generations (F1,F2) were exposed to smaller doses from the residual fallout and later tests. Matched control families in three generations living in non-contamianted areas were analysed in parallel. The retrospective biodosimetry comprehended two endpoints; chromosomal translocations determined by FISH chromosome painting and the glycophorin A (GPA) somatic mutation assay. The minisatellite mutation rate in the cohort of P0 parents was 1-8-fold higher than in the control non-exposed population. Moreover, the minisatellite mutatin rate in the cohort of f1 parents from the exposed area showed a significant negative correlation with with the year of birth, fully consistent with the decay of radioisotopes after the cessation of surface and atmospheric nuclear tests. The results from the FISH painting analysis showed similar translocation frequencies in the Semipalatinsk cohort and the control group. Based on the FISH results it can be concluded that the P0 generation has received a cumulative mean dose of less than 0.5 Gy. The GPA assay did not reveal significant diffrences in the variant cell frequencies for all subjects from the Semipalatinsk area compared with the matched controls. However, a significant increase (P<0.05) of the mean allele-loss φN variant frequency was observed among the exposed P0 generation in comparison to controls. Considering the sensitivity of the GPA assay, the results suggest that the mean dose to the P0 generation of the affected villages was relatively low and in accordance to the results obtained using FISH. (Author) 17 refs
Energy Technology Data Exchange (ETDEWEB)
Lindholm, C.; Bersimbacv, R. I.; Dubrova, Y. E.; Hulten, M.; Bigbee, W. I.; Murphy, B. P.; Koivistoinen, A.; Tankimonova, M.; Mamyrbaeva, Z.; Djansugarova, L.; Mustonen, R.; Salomaa, S.
2004-07-01
The objectives of the study were to determine minisatellite mutation rates in families in three generations and to perform retrospective biodosimetry of individuals in these families living close to the Semipalatinsk nuclear test site in Kazakhstan. The oldes generation (Po) lived in the area at the time of the first Soviet nuclear test in 1949 whereas the younger generations (F1,F2) were exposed to smaller doses from the residual fallout and later tests. Matched control families in three generations living in non-contamianted areas were analysed in parallel. The retrospective biodosimetry comprehended two endpoints; chromosomal translocations determined by FISH chromosome painting and the glycophorin A (GPA) somatic mutation assay. The minisatellite mutation rate in the cohort of P0 parents was 1-8-fold higher than in the control non-exposed population. Moreover, the minisatellite mutatin rate in the cohort of f1 parents from the exposed area showed a significant negative correlation with with the year of birth, fully consistent with the decay of radioisotopes after the cessation of surface and atmospheric nuclear tests. The results from the FISH painting analysis showed similar translocation frequencies in the Semipalatinsk cohort and the control group. Based on the FISH results it can be concluded that the P0 generation has received a cumulative mean dose of less than 0.5 Gy. The GPA assay did not reveal significant diffrences in the variant cell frequencies for all subjects from the Semipalatinsk area compared with the matched controls. However, a significant increase (P<0.05) of the mean allele-loss {phi}N variant frequency was observed among the exposed P0 generation in comparison to controls. Considering the sensitivity of the GPA assay, the results suggest that the mean dose to the P0 generation of the affected villages was relatively low and in accordance to the results obtained using FISH. (Author) 17 refs.
The effect of faith-based smoking cessation intervention during Ramadan among Malay smokers.
Ismail, Suriani; Abdul Rahman, Hejar; Abidin, Emelia Zainal; Isha, Ahmad Sharul Nizam; Abu Bakar, Sallehuddin; Zulkifley, Nur Aishah; Fuad, Ahmad Farhan Ahmad
2016-01-01
Objectives: To study the effects of a faith-based smoking cessation intervention during Ramadan among Malay male smokers working in public offices. Methods: This was a quasi-experimental study conducted during Ramadan 2015. The intervention was developed based on the constructs within the Theory of Planned Behaviour. The intervention intended to increase the intention and the perceived behaviour control to stop smoking among Muslim smokers during Ramadan. The outcomes measured were changes in the Fagerstrom Test for Nicotine Dependence score and saliva cotinine levels. Data were collected at baseline (5 days before Ramadan), during Ramadan (21st day of Ramadan) and post-Ramadan (21 days after Ramadan). Statistical tests to examine changes within and between groups were carried out and the significance level was set at p Ramadan, the saliva cotinine level decreased significantly in both groups ( p = 0.001 in the control group and p = Ramadan, it remained significant only in the intervention group ( p = 0.025). A significant change between the groups was only noticed during Ramadan ( p = 0.049). Conclusion: The reduction in the saliva cotinine level was found to be more sustainable post-Ramadan in the intervention group. This finding could indicate the positive effect of using this culturally-competent intervention to encourage smoking cessation during Ramadan.
Timsit, M-O; Kleinclauss, F; Mamzer Bruneel, M F; Thuret, R
2016-11-01
To review ethical, legal and technical aspects of living kidney donor surgery. An exhaustive systematic review of the scientific literature was performed in the Medline database (http://www.ncbi.nlm.nih.gov) and Embase (http://www.embase.com) using different associations of the following keywords: Donor nephrectomy; Kidney paired donation; Kidney transplantation; Laparoscopic nephrectomy; Living donor; Organs trafficking; Robotic assisted nephrectomy; Vaginal extraction. French legal documents have been reviewed using the government portal (http://www.legifrance.gouv.fr). Articles were selected according to methods, language of publication and relevance. A total of 6421 articles were identified; after careful selection, 161 publications were considered of interest and were eligible for our review. The ethical debate focuses on organ shortage, financial incentive, organ trafficking and the recent data suggesting a small but significant increase risk for late renal disease in donor population. Legal decisions aim to increase the number of kidneys available for donation, such as kidney-paired donation that faces several obstacles in France. Laparoscopic approach became widely used, while robotic-assisted donor nephrectomy failed to demonstrate improved outcome as compared with other minimal invasive techniques. Minimally invasive living donor nephrectomy aims to limit side effects in the donor without increasing the morbidity in this specific population of healthy persons; long term surveillance to prevent the onset of renal disease in mandatory. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Norlelawati, A T; Rusmawati, I; Naznin, M; Nur Nadia, O; Rizqan Aizzani, R; Noraziana, A W
2014-02-01
Inherited anti-thrombin deficiency is an autosomal dominant disorder which is associated with increased risk for venous thromboembolism (VTE). This condition is very rare in Malaysia and there has been no documented report. Thus, the aim of the present study is to investigate the type of an inherited anti-thrombin deficiency mutation in a 25-year-old Malay woman who presented with deep vein thrombosis in her first pregnancy. DNA was extracted from the patient's blood sample and buccal mucosal swabs from family members. Polymerase chain reaction(PCR) assays were designed to cover all seven exons of the serpin peptidase inhibitor, clade C (antithrombin), member 1 (SERPINC1) gene; and the products were subjected to DNA sequencing. Sequences were referred to NCBI Reference Sequence: NG_012462.1. A heterozygous substitution mutation at nucleotide position 13267 (CCT->ACT) was identified in the patient and two other family members, giving a possible change of codon 439 (Pro→Thr) also known as anti-thrombin Budapest 5. The genotype was absent in 90 healthy controls. The study revealed a heterozygous antithrombin Budapest 5 mutation in SERPINC 1 giving rise to a possible anti-thrombin deficiency in a Malay-Malaysian family.
Chen, Peng; Ong, Rick Twee-Hee; Tay, Wan-Ting; Sim, Xueling; Ali, Mohammad; Xu, Haiyan; Suo, Chen; Liu, Jianjun; Chia, Kee-Seng; Vithana, Eranga; Young, Terri L; Aung, Tin; Lim, Wei-Yen; Khor, Chiea-Chuen; Cheng, Ching-Yu; Wong, Tien-Yin; Teo, Yik-Ying; Tai, E-Shyong
2013-01-01
Glycated hemoglobin A1C (HbA1C) level is used as a diagnostic marker for diabetes mellitus and a predictor of diabetes associated complications. Genome-wide association studies have identified genetic variants associated with HbA1C level. Most of these studies have been conducted in populations of European ancestry. Here we report the findings from a meta-analysis of genome-wide association studies of HbA1C levels in 6,682 non-diabetic subjects of Chinese, Malay and South Asian ancestries. We also sought to examine the associations between HbA1C associated SNPs and microvascular complications associated with diabetes mellitus, namely chronic kidney disease and retinopathy. A cluster of 6 SNPs on chromosome 17 showed an association with HbA1C which achieved genome-wide significance in the Malays but not in Chinese and Asian Indians. No other variants achieved genome-wide significance in the individual studies or in the meta-analysis. When we investigated the reproducibility of the findings that emerged from the European studies, six loci out of fifteen were found to be associated with HbA1C with effect sizes similar to those reported in the populations of European ancestry and P-value ≤ 0.05. No convincing associations with chronic kidney disease and retinopathy were identified in this study.
Directory of Open Access Journals (Sweden)
Peng Chen
Full Text Available Glycated hemoglobin A1C (HbA1C level is used as a diagnostic marker for diabetes mellitus and a predictor of diabetes associated complications. Genome-wide association studies have identified genetic variants associated with HbA1C level. Most of these studies have been conducted in populations of European ancestry. Here we report the findings from a meta-analysis of genome-wide association studies of HbA1C levels in 6,682 non-diabetic subjects of Chinese, Malay and South Asian ancestries. We also sought to examine the associations between HbA1C associated SNPs and microvascular complications associated with diabetes mellitus, namely chronic kidney disease and retinopathy. A cluster of 6 SNPs on chromosome 17 showed an association with HbA1C which achieved genome-wide significance in the Malays but not in Chinese and Asian Indians. No other variants achieved genome-wide significance in the individual studies or in the meta-analysis. When we investigated the reproducibility of the findings that emerged from the European studies, six loci out of fifteen were found to be associated with HbA1C with effect sizes similar to those reported in the populations of European ancestry and P-value ≤ 0.05. No convincing associations with chronic kidney disease and retinopathy were identified in this study.
Design of Eco-Smart Homes For Elderly Independent Living
Zhang, Yiran; Liu, Xiaohui
2015-01-01
The aging of the world population has increased dramatically during the past century. The rapid increase of elderly population is putting a heavy strain on healthcare and social welfare. Living conditions and service provision for elderly people have thus become an increasingly hot topic worldwide. In this paper, we address this problem by presenting a conceptual model of an integrated and personalized system for an eco-smart home for elderly independent living. This approach was inspired by ...
Neglected Population, Neglected Right: Children Living with HIV and the Right to Science.
Scanlon, Michael L; MacNaughton, Gillian; Sprague, Courtenay
2017-12-01
The laws, language, and tools of human rights have been instrumental in expanding access to lifesaving treatment for people living with HIV. Children, however, remain a neglected population, as evidenced by inadequate child-specific and child-friendly HIV treatment options. In this article, we explore the right to science, a potentially powerful but underdeveloped right in international law, and its application to research and development for pediatric HIV treatment. Drawing on reports of human rights bodies and scholars and applying the human rights typology of state obligations to respect, protect, and fulfill, we argue that states have five core obligations related to research and development for child-specific and child-friendly treatment: (1) adopting a public goods approach to science and science policy; (2) including and protecting children in research activities; (3) adopting legal and policy frameworks to support research and development through public funding and private sector incentives; (4) promoting international cooperation and assistance; and (5) ensuring the participation of marginalized communities in decision-making processes. In concluding, we make a number of recommendations for states, human rights bodies, international organizations, civil society, and private industry to further develop and implement the right to science.
Genetic Risk Factors of Systemic Lupus Erythematosus in the Malaysian Population: A Minireview
Directory of Open Access Journals (Sweden)
Hwa Chia Chai
2012-01-01
Full Text Available SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6.
Attitudes to Mental Illness and Its Demographic Correlates among General Population in Singapore
Yuan, Qi; Abdin, Edimansyah; Picco, Louisa; Vaingankar, Janhavi Ajit; Shahwan, Shazana; Jeyagurunathan, Anitha; Sagayadevan, Vathsala; Shafie, Saleha; Tay, Jenny; Chong, Siow Ann; Subramaniam, Mythily
2016-01-01
Background Public attitudes to mental illness could influence how the public interact with, provide opportunities for, and help people with mental illness. Aims This study aims to explore the underlying factors of the Attitudes to Mental Illness questionnaire among the general population in Singapore and the socio-demographic correlates of each factor. Methods From March 2014 to April 2015, a nation-wide cross-sectional survey on mental health literacy with 3,006 participants was conducted in Singapore. Results Factor analysis revealed a 4-factor structure for the Attitudes to Mental Illness questionnaire among the Singapore general population, namely social distancing, tolerance/support for community care, social restrictiveness, and prejudice and misconception. Older age, male gender, lower education and socio-economic status were associated with more negative attitudes towards the mentally ill. Chinese showed more negative attitudes than Indians and Malays (except for prejudice and misconception). Conclusions There is a need for culture-specific interventions, and the associated factors identified in this study should be considered for future attitude campaigns. PMID:27893796
Rampal, Sanjay; Rampal, Lekhraj; Rahmat, Ramlee; Zain, Azhar Md; Yap, Yee Guan; Mohamed, Mafauzy; Taha, Mohamad
2010-04-01
The purpose of this study was to determine the association between different ethnic groups and the prevalence, awareness, and control of diabetes in Malaysia. A population-based cross-sectional study using multistage sampling was conducted in Malaysia. Diabetes is defined as having a fasting blood glucose > or =7 mmol/L or a self-reported diabetic on treatment. Among the 7683 respondents aged > or =30 years, the prevalence of diabetes mellitus was 15.2% (95% CI = 14.1, 16.4). Multivariate analysis showed that compared with Malays, Chinese had lower odds (adjusted odds ratio [aOR] 0.71; 95% CI = 0.56, 0.91) and Indians had higher odds of having diabetes (aOR 1.54; 95% CI = 1.20, 1.98). The odds of diabetes increased with age, family history of diabetes, body mass index, and lower education levels. Among those with diabetes mellitus, 45.0% were aware and 42.7% were under treatment. Among treated diabetics, 25.1% had their fasting blood sugar under control. There is a significant association between prevalence of diabetes and different ethnic groups.
International Nuclear Information System (INIS)
Lochard, J.; Schneider, T.
1992-01-01
This part presents a first estimate of the cost and averted collective exposure of the potential relocation of the population from the affected territories of the BSSR, the RSFSR and the UKrSSR, to improve their living conditions following the Chernobyl accident. It is an input to the evaluation of the radiological consequences of the Chernobyl accident in the USSR. The general objective was to assess 'the concept which the USSR has evolved to enable the population to live safely in areas affected by radioactive contamination following the Chernobyl accident, and an evaluation of the effectiveness of the steps taken in these areas to safeguard the health of the population'. Specifically, this work aimed at evaluating protective measures from 1990 onwards
Herrera, C M; Pozo, M I; Bazaga, P
2011-11-01
Vast amounts of effort have been devoted to investigate patterns of genetic diversity and structuring in plants and animals, but similar information is scarce for organisms of other kingdoms. The study of the genetic structure of natural populations of wild yeasts can provide insights into the ecological and genetic correlates of clonality, and into the generality of recent hypotheses postulating that microbial populations lack the potential for genetic divergence and allopatric speciation. Ninety-one isolates of the flower-living yeast Metschnikowia gruessii from southeastern Spain were DNA fingerprinted using amplified fragment length polymorphism (AFLP) markers. Genetic diversity and structuring was investigated with band-based methods and model- and nonmodel-based clustering. Linkage disequilibrium tests were used to assess reproduction mode. Microsite-dependent, diversifying selection was tested by comparing genetic characteristics of isolates from bumble bee vectors and different floral microsites. AFLP polymorphism (91%) and genotypic diversity were very high. Genetic diversity was spatially structured, as shown by amova (Φ(st) = 0.155) and clustering. The null hypothesis of random mating was rejected, clonality seeming the prevailing reproductive mode in the populations studied. Genetic diversity of isolates declined from bumble bee mouthparts to floral microsites, and frequency of five AFLP markers varied significantly across floral microsites, thus supporting the hypothesis of diversifying selection on clonal lineages. Wild populations of clonal fungal microbes can exhibit levels of genetic diversity and spatial structuring that are not singularly different from those shown by sexually reproducing plants or animals. Microsite-dependent, divergent selection can maintain high local and regional genetic diversity in microbial populations despite extensive clonality. © 2011 Blackwell Publishing Ltd.
Alikbayeva, L A; Kim, A V; Iakubova, Sh; Ok, Im En; Darizhapov, B B
The aim of this study was to perform a comprehensive hygienic assessment of environmental conditions in the port cities of the Sakhalin region to identify priority risk factors affecting on population health and management decisions for the optimization of living conditions. As a result of the assessment of risk and damages for public health from the effects of air pollution on the dose-response, effects were found to excess of impact on the target organs by 10 times. The main ecotoxicant was determined to be manganese oxide, which is associated with a priority manganese content in soil samples ofport cities. The positive dynamics of the gain in the accumulation of soil heavy metals according to the total index indicates to the existence of problems for soil contamination. Analysis of demographic variables shows that the population of the Sakhalin region in general and the port cities in particular relates to a regressive type. The main causes of the population decline are mortality and migration outflow of able-bodied population in other regions of Russia. However, in the port cities there is an increase in the number of work places, contributing to an increase in the labor force. The primary and general morbidity of the population ofport cities is characterized by higher levels compared with the average for the Sakhalin Region and the Far Eastern Federal District. Among all the classes of diseases as priority ones there are marked “neoplasm”, “diseases of the nervous system”, “respiratory diseases”, “diseases of the skin and subcutaneous tissue”. Port cities occupy the top ranking places on the incidence of malignant tumors among the cities of the Sakhalin region.
Amin, N A; Quek, K F; Oxley, J A; Noah, R M; Nordin, R
2015-10-01
The Job Content Questionnaire (M-JCQ) is an established self-reported instrument used across the world to measure the work dimensions based on the Karasek's demand-control-support model. To evaluate the psychometrics properties of the Malay version of M-JCQ among nurses in Malaysia. This cross-sectional study was carried out on nurses working in 4 public hospitals in Klang Valley area, Malaysia. M-JCQ was used to assess the perceived psychosocial stressors and physical demands of nurses at their workplaces. Construct validity of the questionnaire was examined using exploratory factor analysis (EFA). Cronbach's α values were used to estimate the reliability (internal consistency) of the M-JCQ. EFA showed that 34 selected items were loaded in 4 factors. Except for psychological job demand (Cronbach's α 0.51), the remaining 3 α values for 3 subscales (job control, social support, and physical demand) were greater than 0.70, indicating acceptable internal consistency. However, an item was excluded due to poor item-total correlation (rMalaysia.
Martínez-Abraín, Alejandro
2010-01-01
A few years ago, Camus & Lima (2002) wrote an essay to stimulate ecologists to think about how we define and use a fundamental concept in ecology: the population. They concluded, concurring with Berryman (2002), that a population is "a group of individuals of the same species that live together in an area of sufficient size to permit normal dispersal and/or migration behaviour and in which population changes are largely the results of birth and death processes". They pointed out that ecologis...
Energy Technology Data Exchange (ETDEWEB)
Iyengar, G.V. E-mail: v.iyengar@iaea.org; Kawamura, H.; Dang, H.S.; Parr, R.M.; Wang, J.W.; Akhter, Perveen; Cho, S.Y.; Natera, E.; Miah, F.K.; Nguyen, M.S
2004-07-01
Daily dietary intakes of two naturally occurring long-lived radionuclides, {sup 232}Th and {sup 238}U, were estimated for the adult population living in a number of Asian countries, using highly sensitive analytical methods such as instrumental and radiochemical neutron activation analysis (INAA and RNAA), and inductively coupled plasma mass spectrometry (ICP-MS). The Asian countries that participated in the study were Bangladesh (BGD), China (CPR), India (IND), Japan (JPN), Pakistan (PAK), Philippines (PHI), Republic of Korea (ROK) and Vietnam (VIE). Altogether, these countries represent more than 50% of the world population. The median daily intakes of {sup 232}Th ranged between 0.6 and 14.4 mBq, the lowest being for Philippines and the highest for Bangladesh, and daily intakes of {sup 238}U ranged between 6.7 and 62.5 mBq, lowest and the highest being for India and China, respectively. The Asian median intakes were obtained as 4.2 mBq for {sup 232}Th and 12.7 mBq for {sup 238}U. Although the Asian intakes were lower than intakes of 12.3 mBq (3.0 {mu}g) {sup 232}Th and 23.6 mBq (1.9 {mu}g) {sup 238}U proposed by the International Commission on Radiological Protection (ICRP) for the ICRP Reference Man, they were comparable to the global intake values of 4.6 mBq {sup 232}Th and 15.6 mBq {sup 238}U proposed by the United Nation Scientific Commission on Effects of Radiation (UNSCEAR). The annual committed effective doses to Asian population from the dietary intake of {sup 232}Th and {sup 238}U were calculated to be 0.34 and 0.20 {mu}Sv, respectively, which are three orders of magnitude lower than the global average annual radiation dose of 2400 {mu}Sv to man from the natural radiation sources as proposed by UNSCEAR.
Chin, Koo Hui; Sathyasurya, Daniel Robert; Abu Saad, Hazizi; Jan Mohamed, Hamid Jan B
2013-01-01
The Malaysian Health and morbidity Survey (2006) reported the highest prevalence of type 2 diabetes mellitus (T2DM) among the Indian population compared to the Malay and Chinese populations. Many studies have supported the important role of adiponectin in insulin-sensitizing, which is associated with T2DM. These studies have raised a research question whether the variation in prevalence is related to the adiponectin concentrations or the lifestyle factors. The purpose of this study is to determine whether the adiponectin concentrations differ between the Malay, Chinese and the Indian populations with T2DM. It is to investigate the association of adiponectin concentrations with ethnicity, dietary intake and physical activity too. In this cross-sectional study, a total of 210 T2DM patients with mean (SD) age of 56.73 (10.23) years were recruited from Penang, Malaysia. Data on demographic background, medical history, anthropometry (weight, height, visceral fat, percentage of body fat and waist circumference), dietary intake (3 days 24 hours diet recall) and physical activity (International Physical Activity Questionnaire) were obtained accordingly. Plasma adiponectin and routine laboratory tests (fasting blood sugar, HbA1c, total cholesterol, LDL, HDL and triglyceride) were performed according to standard procedure. After adjustment for physical activity and dietary intakes, the Indian population had significantly lower adiponectin concentrations (P = 0.003) when compared with the Malay and the Chinese populations, The Indian population also had significantly higher value of HbA1c (P = 0.017) and significantly lower HDL (P = 0.013). Plasma adiponectin concentrations was significantly associated with ethnicity (P = 0.011), dietary carbohydrate (P = 0.003) and physical activity total MET score (P = 0.026), after medical history, age, sex, total cholesterol and visceral fat adjusted. However, dietary carbohydrate and physical activity did not show significantly
Ting, Chuo Yew; Ahmad Zaidi Adruce, Shahren; Hassali, Mohamed Azmi; Ting, Hiram; Lim, Chien Joo; Ting, Rachel Sing-Kiat; Abd Jabar, Abu Hassan Alshaari; Osman, Nor Anizah; Shuib, Izzul Syazwan; Loo, Shing Chyi; Sim, Sui Theng; Lim, Su Ee; Morisky, Donald E
2018-06-05
Amidst the high disease burden, non-adherence to medications among patients with type 2 diabetes mellitus (T2DM) has been reported to be common and devastating. Sarawak Pharmaceutical Services Division has formulated a pharmacist-led, multiple-theoretical-grounding, culturally sensitive and structured group-based program, namely "Know Your Medicine - Take if for Health" (MEDIHEALTH), to improve medication adherence among Malay patients with T2DM. However, to date, little is known about the effectiveness and sustainability of the Program. This is a prospective, parallel-design, two-treatment-group randomized controlled trial to evaluate the effectiveness and sustainability of MEDIHEALTH in improving medication adherence. Malay patients who have underlying T2DM, who obtain medication therapy at Petra Jaya Health Clinic and Kota Samarahan Health Clinic, and who have a moderate to low adherence level (8-item Morisky Medication Adherence Scale, Malaysian specific, score sustainability of the Program will be triangulated by findings from semi-structured interviews with five selected participants conducted 1 month after the intervention and in-depth interviews with two main facilitators and two managerial officers in charge of the Program 12 months after the intervention. Statistical analyses of quantitative data were conducted using SPSS version 22 and Stata version 14. Thematic analysis for qualitative data were conducted with the assistance of ATLAS.ti 8. This study provides evidence on the effectiveness and sustainability of a structured group-based educational program that employs multiple theoretical grounding and a culturally sensitive approach in promoting medication adherence among Malays with underlying T2DM. Both the quantitative and qualitative findings of this study could assist in the future development of the Program. National Medical Research Register, NMRR-17-925-35875 (IIR). Registered on 19 May 2017. ClinicalTrials.gov, NCT03228706 . Registered on 25