WorldWideScience

Sample records for main active principles

  1. Preclinical evaluation of Luffa operculata Cogn. and its main active principle in the treatment of bacterial rhinosinusitis.

    Science.gov (United States)

    Silva, Leonardo; Costa, Henrique Olival; Souza, Flávia Coelho de; Lopes, Elaine Monteiro Cardoso; Ueda, Suely Mitoi Ykko

    2016-12-26

    The prevalence of rhinosinusitis is quite high. Despite the widespread use of antibiotics for rhinosinusitis, there are other forms of treatment, including phytotherapy. One of the most widely used herbal medicines for treatment of rhinosinusitis is Luffa operculata. This study aimed to evaluate the efficacy of topical nasal solution of the aqueous extract of L. operculata, determining the toxicity to its use and identifying the active principles presented in the aqueous extract. The secondary objective was to evaluate the action of active principles on bacteria commonly involved in acute rhino sinusitis. The study was conducted in experimental model of sinusitis. Three different concentrations of L. operculata were used as local treatment of rhino sinusitis. The results were compared with those observed in control groups that received nasal saline solution. Histological examination of the liver, kidney, spleen, myocardium, brain and lungs of all animals evaluated the toxicity of L. operculata. The aqueous extract used was subjected to chromatographic analysis and an active principle was isolated and tested for in vitro inhibition of bacterial colonies usually found in rhino sinusitis. Intranasal treatment of sinusitis with L. operculata showed better clinical evolution than control group. Statistically significant difference (p>0.10) between the treated group and the control group was observed in the histologic evaluation for inflammatory pattern. The aqueous extract of L. operculata used presented a predominance of 2,3-dicafeoilglicaric acid, a substance not yet described in the literature. There was a significant difference in bacterial growth of Streptococcus pyogenes on blood-agar plates when under the influence of both the aqueous extract and the active substance. Topical nasal solution of the aqueous extract of L. operculata is effective compared to the application of saline solution for the treatment of bacterial rhinosinusitis in an experimental model. L

  2. THE MAIN PRINCIPLES OF TOTAL QUALITY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    Andrei DIAMANDESCU

    2016-06-01

    Full Text Available Nowadays the industry is one of the main economic sectors, with a major contribution to achieving and maintaining a high rate of economic growth. The processing industry operation to high economic performance requires changes in structural terms, the re-engineering of processes and management. In this regard, one of the main actions taken at the level of companies in the manufacturing industry is the implementation of quality systems. Practicing quality management system not only allows businesses to react to changes taking place in business, but also to inflict them by the controlling of the future. This paper aims to analyze the principles of Total Quality Management – TQM and will highlight the advantages that organizations could obtain by applying each principle separately in the process of management.

  3. The Main General Didactical Principles of Glotoeducological Theory and Practice

    Directory of Open Access Journals (Sweden)

    Regina Juškienė

    2011-04-01

    Full Text Available As a pedagogical discipline glotoeducology is related to didactics, i. e. teaching theory. Three concepts of didactics are being distinguished: teaching, teaching principles and types of teaching activity. The authors limited themselves in their paper on one of them, namely: teaching principles that determine the usage of teaching regularities in the course of implementation of the objectives of teaching and education. The article also provides analysis of interaction of linguodidactical principles with general didactical principles, the impact thereof to teaching of foreign languages.

  4. Guide of principles in main dog and cat skin’s afections topical aplications

    Directory of Open Access Journals (Sweden)

    Faltinski, F.,

    2009-06-01

    Full Text Available The report is an attempt to remember of the updated general principles in the main dermatologic affects topical applications’ in in dog and cat. Initially are presented: general principles about drug topic formulation’s application, with the describing of skin’s anatomical bases and functions, active substance’s physic-chemicalproprieties, factors that affects transdermal passage, methods of transdermal amplification. Also are presented: characteristics of dog and cat’s skin, skin’s specific vascularisation, ecology and histochemy. In the last chapter are presented the main known dermatologic entities in dog and cat.

  5. METHODOLOGICAL ESSENTIAL PRINCIPLES OF REGIONAL INVESTMENT ACTIVITY FINANCEMENT MECHANIZM IMPROVEMENT

    OpenAIRE

    V.V. Morozov

    2005-01-01

    The strategy principles and main directions of regional investment activity financement mechanism improvement are formulated and worked out in the article. The contemporary conditions are analyzed, the factors are researched, the priority directions are defined, the suggestions on the better use of investment sources are worked out, and on this base the suggestions on the investment process activization in the territorial systems are worked out.

  6. Study of an effective structural system with rational parameters based on main energy principles

    Directory of Open Access Journals (Sweden)

    Toporkova Katerina

    2017-01-01

    Full Text Available The effective architectural and construction system with rational parameters based on main energy principles applied to construction of buildings and constructions with a small-step and large-step frames, representing the metal frame of full factory production collected in spatial system on high-strength bolts and previously strained combined prestressed concrete slabs which formed without timbering is proposed in this paper. The main constructive and technological features of the proposed frame, which allows reducing construction period, increasing working efficiency, and reducing labor intensity by using factory-made materials, quick erection of all process elements through the use of highstrength bolts is considered. The advantages of this constructive system in comparison with alternative systems are shown. The basic concepts of "rational decisions" to the design, namely, the objective of the optimal management of the structure parameters, which can not only improve its basic performance indicators, but also, and most importantly, improve operational reliability, is presented.

  7. Principles of Language Learning Activity Design Based on Constructivism

    Institute of Scientific and Technical Information of China (English)

    于玉星

    2010-01-01

    <正>This essay introduces constructivism and its four key theories in learning and explores its applications in language learning activity design.Following the theoretical background analysis,it proposes three principles concerning English language teaching activity design,namely interactive thinking principle,I + 1 principle and authentic communication principle.This paper also provides some practical teaching activities such as supporting examples of how these three principles can work in language teaching.

  8. Effect of Generalized Uncertainty Principle on Main-Sequence Stars and White Dwarfs

    CERN Document Server

    Moussa, Mohamed

    2015-01-01

    This paper addresses the effect of generalized uncertainty principle, emerged by a different approaches of quantum gravity within Planck scale, on thermodynamic properties of photon, non-relativistic ideal gases and degenerate fermions. A modification in pressure, particle number and energy density are calculated. Astrophysical objects such as main sequence stars and white dwarfs are examined and discussed as an application. A modification in Lane-Emden equation due to a change in a polytropic relation caused by the presence of quantum gravity, is investigated. The applicable range of quantum gravity parameters is estimated. The bounds in the perturbed parameters are relatively large but it may be considered reasonable values in the astrophysical regime.

  9. The principle and main structure design on national database of poverty, environment, and development in China

    Science.gov (United States)

    Wang, Yingjie; Feng, Xiangfeng; Yu, Zhuoyuan; Cui, Jing

    2009-07-01

    Poverty is listed as the one of eight "Millennium Development Goals" by UN Summit. From 1978 to 2004, rural poverty population in China is cut to 26.1 million from 250 million. In order to support the decision maker to make nice planning in elimination of poverty and promotion of regional sustainable development in China, the GIS based systemic and comprehensive database for poverty, environment and development is proposed and designed in the paper. Additionally, the design principle and main content of the database is discussed by utilization modern technology, such as spatialtemporal and tree-ring data models for data structuring and coding, in order to represent current poverty status, spatial distribution and temporal variations, and to explore the relationship among poverty, environment and development ultimately.

  10. Effect of Generalized Uncertainty Principle on Main-Sequence Stars and White Dwarfs

    Directory of Open Access Journals (Sweden)

    Mohamed Moussa

    2015-01-01

    Full Text Available This paper addresses the effect of generalized uncertainty principle, emerged from different approaches of quantum gravity within Planck scale, on thermodynamic properties of photon, nonrelativistic ideal gases, and degenerate fermions. A modification in pressure, particle number, and energy density are calculated. Astrophysical objects such as main-sequence stars and white dwarfs are examined and discussed as an application. A modification in Lane-Emden equation due to a change in a polytropic relation caused by the presence of quantum gravity is investigated. The applicable range of quantum gravity parameters is estimated. The bounds in the perturbed parameters are relatively large but they may be considered reasonable values in the astrophysical regime.

  11. THE MAIN FACTORS, CRITERIA AND PRINCIPLES OF RESOURCE MANAGEMENT IN TODAY'S

    Directory of Open Access Journals (Sweden)

    S. A. Loskutov

    2015-01-01

    Full Text Available According to domestic and foreign scientists, currently economic systems around the world are experiencing serious problems in resourcing, resource use in all sectors of the economy and production activities. Analysis of production and technical, organizational and management and socio-economic indicators showed that baking is an important part of the complex-those reflected domestic food industry. Based on this established fact, was a retrospective analysis of the industry and the evaluation of the results of scientific and industrial research and promising future of this, all this, from the perspective of statics and dynamics, allowed to form a syncretic conglomerate intra problems. Among the priority issues of development of domestic enterprises of the baking industry and the entire economy of Russia, have been isolated problems of rationality, resource and energy resource efficiency industrial technological units regardless of the forms and methods of production and economic activity. Sufficiently development of scientific and methodological approaches and practical solutions in the field of analysis, evaluation, control, monitoring and management of natural resource based production and economic activities of industrial enterprises actualize the need for a comprehensive study of the nature of the scarcity of resources and industry forming scientific and practical solutions to improve the mechanism domestic resource bakeries. This paper studied a group of factors shaping policy in the enterprise resource, identified criteria irrational organization of the process of resource in today's economy, formed a system of organizing the process of resource elements in the enterprise resource principles grounded on a national scale. As part of the generated system of principles, criteria and factors of rational and efficient use of resources in today's economy, paramount, the most important approximations are focused on identifying and disclosing the

  12. Failure Tolerant Operation and Trimming Principle in the CLIC Main Linac

    CERN Document Server

    Siemaszko, D

    2012-01-01

    A powering strategy for a high number of magnets disposed in a radiated and confined area is presented for a particle accelerator application. One power converter supplies the main current in series connected magnets. Then, for adjusting each current individually, small active trimmers are implemented together which each magnet. The trimmers are only dissipative, implemented as MOSFETs operated in their linear region and controlled by analog PI controllers. The reliability of the whole powering system is ensured with failure tolerance that complies with beam physics. The steady state operation and dynamic response in case of failures are experimentally studied in a reduced scale prototype.

  13. Simple Activity Demonstrates Wind Energy Principles

    Science.gov (United States)

    Roman, Harry T.

    2012-01-01

    Wind energy is an exciting and clean energy option often described as the fastest-growing energy system on the planet. With some simple materials, teachers can easily demonstrate its key principles in their classroom. (Contains 1 figure and 2 tables.)

  14. Efficient and Effective Change Principles in Active Videogames.

    Science.gov (United States)

    Straker, Leon M; Fenner, Ashley A; Howie, Erin K; Feltz, Deborah L; Gray, Cindy M; Lu, Amy Shirong; Mueller, Florian Floyd; Simons, Monique; Barnett, Lisa M

    2015-02-01

    Active videogames have the potential to enhance population levels of physical activity but have not been successful in achieving this aim to date. This article considers a range of principles that may be important to the design of effective and efficient active videogames from diverse discipline areas, including behavioral sciences (health behavior change, motor learning, and serious games), business production (marketing and sales), and technology engineering and design (human-computer interaction/ergonomics and flow). Both direct and indirect pathways to impact on population levels of habitual physical activity are proposed, along with the concept of a game use lifecycle. Examples of current active and sedentary electronic games are used to understand how such principles may be applied. Furthermore, limitations of the current usage of theoretical principles are discussed. A suggested list of principles for best practice in active videogame design is proposed along with suggested research ideas to inform practice to enhance physical activity.

  15. Active Asteroids: Main-Belt Comets and Disrupted Asteroids

    CERN Document Server

    Hsieh, Henry H

    2015-01-01

    The study of active asteroids has attracted a great deal of interest in recent years since the recognition of main-belt comets (which orbit in the main asteroid belt, but exhibit comet-like activity due to the sublimation of volatile ices) as a new class of comets in 2006, and the discovery of the first disrupted asteroids (which, unlike MBCs, exhibit comet-like activity due to a physical disruption such as an impact or rotational destabilization, not sublimation) in 2010. In this paper, I will briefly discuss key areas of interest in the study of active asteroids.

  16. Active nondestructive assay of nuclear materials: principles and applications

    Energy Technology Data Exchange (ETDEWEB)

    Gozani, Tsahi

    1981-01-01

    The purpose of this book is to present, coherently and comprehensively, the wealth of available but scattered information on the principles and applications of active nondestructive analysis (ANDA). Chapters are devoted to the following: background and overview; interactions of neutrons with matter; interactions of ..gamma..-rays with matter; neutron production and sources; ..gamma..-ray production and sources; effects of neutron and ..gamma..-ray transport in bulk media; signatures of neutron- and photon-induced fissions; neutron and photon detection systems and electronics; representative ANDA systems; and instrument analysis, calibration, and measurement control for ANDA. Each chapter has an introductory section describing the relationship of the topic of that chapter to ANDA. Each chapter ends with a section that summarizes the main results and conclusions of the chapter, and a reference list.

  17. Main principles and practices of auditing independence in China: A multifaceted discussion

    NARCIS (Netherlands)

    Lan, W.H.; Georgakopoulos, G.; Sotiropoulos, I.; Galanou, K.

    2010-01-01

    This paper attempts through a review of the associated literature to describe and critically evaluate the audit market in China by exploring the main factors that affect auditor independence. The study identifies that non-audit service and low-balling/price-cutting are not parameters affecting audit

  18. Main principles and practices of auditing independece in China: a multifaceted discussion

    NARCIS (Netherlands)

    Wan Hua, L.; Georgakopoulos, G.; Sotiropoulos, I.; Galanou, E.

    2010-01-01

    This paper attempts through a review of the associated literature to describe and critically evaluate the audit market in China by exploring the main factors that affect auditor independence. The study identifies that non-audit service and low-balling/price-cutting are not parameters affecting audit

  19. The optimization of diffraction structures based on the principle selection of the main criterion

    Science.gov (United States)

    Kravets, O.; Beletskaja, S.; Lvovich, Ya; Lvovich, I.; Choporov, O.; Preobrazhenskiy, A.

    2017-02-01

    The possibilities of optimizing the characteristics of diffractive structures are analysed. A functional block diagram of a subsystem of diffractive structure optimization is shown. Next, a description of the method for the multicriterion optimization of diffractive structures is given. We then consider an algorithm for selecting the main criterion in the process of optimization. The algorithm efficiency is confirmed by an example of optimization of the diffractive structure.

  20. Re-Examining first principles of regulation: NRG power marketing, LLC v. Maine public utilities Commission

    Energy Technology Data Exchange (ETDEWEB)

    Haskell, Mark R.

    2010-03-15

    Maine PUC and Morgan Stanley have resolved some of the key issues facing the energy industry. The Supreme Court has plainly and directly in both cases reaffirmed the central role that private contracts play in the energy industry and set terms to balance the need to secure long-term investment with the public interest that lies at the heart of the Federal Power Act. (author)

  1. Efficient and Effective Change Principles in Active Videogames

    NARCIS (Netherlands)

    Straker, Leon M; Fenner, Ashley A; Howie, Erin K; Feltz, Deborah L; Gray, Cindy M; Lu, Amy Shirong; Mueller, Florian Floyd; Simons, Monique; Barnett, Lisa M

    2015-01-01

    Active videogames have the potential to enhance population levels of physical activity but have not been successful in achieving this aim to date. This article considers a range of principles that may be important to the design of effective and efficient active videogames from diverse discipline are

  2. Guideline Principles for Designing Astronomy Activities

    Science.gov (United States)

    Strubbe, Linda

    2015-03-01

    We astronomy outreachers are passionate about sharing astronomy widely-but many astronomy outreach activities are designed more by how we hope things will work than in a careful intentional way. We also rarely evaluate how well our activities are achieving our goals. As a result, many educational activities must be significantly less effective than they could be. Fortunately, there is a large body of education research on how people learn. If we are serious about sharing astronomy widely and effectively, we must treat our teaching like research: (1) Have clear goals for our outreach, evaluate how well we are achieving our goals, and revise our strategies in light of what we learn; and (2) Use appropriate teaching techniques supported by education research wherever possible.

  3. Vibrational optical activity principles and applications

    CERN Document Server

    Nafie, Laurence A

    2011-01-01

    This unique book stands as the only comprehensive introduction to vibrational optical activity (VOA) and is the first single book that serves as a complete reference for this relatively new, but increasingly important area of molecular spectroscopy. Key features:A single-source reference on this topic that introduces, describes the background and foundation of this area of spectroscopy.Serves as a guide on how to use it to carry out applications with relevant problem solving.Depth and breadth of the subject is presented in a logical, complete and progressive fashion. A

  4. High pressure liquid chromatographic analysis of the main pungent principles of solar dried West Indian ginger (Zingiber officinale Roscoe)

    Energy Technology Data Exchange (ETDEWEB)

    Balladin, D.A.; Headley, O. [University of the West Indies, Cave Hill Campus, St. Michael, Barbados (West Indies). Centre for Resource Management and Environmental Studies; Chang-Yen, I. [University of the West Indies, St. Augustine Campus, Trinidad (West Indies). Faculty of Agriculture and Natural Sciences; McGaw, D.R. [University of the West Indies, St. Augustine Campus, Trinidad (West Indies). Dept. of Chemical Engineering

    1998-12-31

    The main pungent principles of West Indian ginger (Zingiber officinale Roscoe) were quantified and qualified using High Pressure Liquid Chromatography. This procedure was used to evaluate the pungency profile of fresh, solar dried and solar dried/steam distilled ginger rhizomes. In this investigation, the total oleoresin extracted was in the ratio [20: 1: 2] for [fresh ginger: solar dried: solar dried/steam distilled ginger rhizomes] with respect to the [6]-gingerol content. This simple isocratic HPLC method can be used to investigate the pungency profile of the extracted oleoresin from the ginger rhizomes. (author)

  5. Mathematic principle of active jamming against wideband LFM radar

    Institute of Scientific and Technical Information of China (English)

    Shixian Gong; Xizhang Wei; Xiang Li; Yongshun Ling

    2015-01-01

    The inherent mathematic principle of active jamming against the wideband linear frequency modulated (LFM) radar is investigated. According to different generation strategies, the active jamming methods are reclassified into three groups, i.e., non-coherent jamming (NCJ), convolution jamming (CJ) and mul-tiplying jamming (MJ). Based on the classification, the mathematic principles of different active jamming groups are put forward, which describe the relationships between the modulated signals and the jamming results. The advantages and disadvantages of different groups are further analyzed, which provides a new perspective for the study of jamming/anti-jamming methods and a potential for engineers to integrate similar jamming methods into one jam-mer platform. The analyses and simulation results of some typical active jamming methods prove the validity of the proposed mathe-matics principle.

  6. Schemes for applying active lubrication to main engine bearings

    DEFF Research Database (Denmark)

    Estupinan, Edgar Alberto; Santos, Ilmar

    2009-01-01

    and consequently reducing viscous friction losses and vibrations. One refers to active lubrication when conventional hydrodynamic lubrication is combined with dynamically modified hydrostatic lubrication. In this case, the hydrostatic lubrication is modified by injecting oil at controllable pressures, through......The work presented here is a theoretical study that describes two different schemes for the oil injection system in actively lubricated main engine bearings. The use of active lubrication in journal bearings helps to enhance the hydrodynamic fluid film by increasing the fluid film thickness...... orifices circumferentially located around the bearing surface. The pressure distribution of the hydrodynamic fluid film in journal bearings is governed by the Reynolds equation, which is modified to accommodate the dynamics of active lubrication, and which can be numerically solved using finite...

  7. The main principles of formation of structure of cultural-historical landscapes of Central Russia.

    Science.gov (United States)

    Nizovtsev, Vyacheslav; Natalia, Erman

    2014-05-01

    The forming and development of cultural-historical landscapes (CH) are obligate result of evolution of society and nature, as well as, man and landscapes during their coherent growth. CH landscapes are holistic historic-cultural and nature creations. They reflect the history of land use and spiritual development of ethnic community of concrete territory with determine homogeneous landscape characteristics. The majority of them appertain to the category of relict landscapes, which completed their evolution growth. That means that these are anthropogenic (AL) and cultural (CL) landscapes. They lost anthropogenic management and continue their growth obeying natural logic. These landscapes include elements of morphological structure and natural components, which have been transformed by men, and also artefacts, sociofacts and mental facts. These facts can be considered as peculiar "biographical chronicle" of activity of population in determinate landscape conditions in determinate historical period. These facts are evidences of material and spiritual cultural of society. The first AL begin to arise simultaneously with conversation of appropriating economy into generating economy. There was such conversation in Central Russia (Neolithic revolution) only in Bronze Age. Anthropogenic transformed landscape complexes and even man-made landscape complexes have been formed in Bronze Age. Some of these complexes exist now. Actual anthropogenic and cultural landscapes began to form only in Iron Age while permanent, long existed settlement and agriculture structure has organized. First, These are small settlement anthropogenic landscape complexes (selischa and gorodischa) with applied permanent miniature arable areas. These complexes located on the capes and on the areas between river banks and banks of streams. Second, these are pasture anthropogenic landscape complexes (on the level of podurochische and urochische), located in flood plain and valley-cavin position (pasture

  8. Activity-Based Management principles and implementation opportunities of the ABM system

    OpenAIRE

    Căpuşneanu, Sorinel/I

    2009-01-01

    This article describes the principles of Activity-Based Management and treats the implementation stages of it in enterprises from steel industry of Romania. The ABC method becomes the main tool of providing information for the ABM method. Thus, the ABM method becomes an important tool of obtaining performances in business.

  9. The Didactic Principles and Their Applications in the Didactic Activity

    Science.gov (United States)

    Marius-Costel, Esi

    2010-01-01

    The evaluation and reevaluation of the fundamental didactic principles suppose the acceptance at the level of an instructive-educative activity of a new educational paradigm. Thus, its understanding implies an assumption at a conceptual-theoretical level of some approaches where the didactic aspects find their usefulness by relating to value…

  10. Liquid chromatographic analysis of the main pungent principles of solar dried West Indian ginger (Zingiber officinale Roscoe)

    Energy Technology Data Exchange (ETDEWEB)

    Balladin, D.A.; Headley, Oliver [University of the West Indies, Center for Resource Management and Environmental Studies, St. Michael (Barbados)

    1999-10-01

    The main pungent principles and essential oils of West Indian ginger (Zingiber officinale Roscoe) were identified and quantified by liquid chromatography. The stationary phase used was (5.0 g silica gel 70-230 mesh) and the mobile phase [petroleum ether (60-80degC) : diethyl ether (3:7 v/v)]. The first 15 ml contained the very volatile and least polar compounds present in the extracted oleoresin from the solar dried ginger rhizome. These compounds are the essential oils (R{sub f} = 0.90) and 25.63% (w/w) of the total oleoresin charge to the column. The next 5 ml aliquot was without any compounds. The following 25 ml contained the shogaol fraction (R{sub f} = 0.42) and 47.74% (w/w) of the total oleoresin charge to the column. The next 5 ml aliquot was without any compounds. The following 35 ml contained the gingerol fraction (R{sub f} = 0.20) and 27.13% (w/w) of the total oleoresin charge to the column. This simple liquid chromatography method can be used to investigate the essential oils and pungent principles of the extracted oleoresin from the solar dried ginger rhizomes. (Author)

  11. Adaptive forecasting of aftershock activity after the main shock

    Science.gov (United States)

    Omi, Takahiro; Ogata, Yosihiko; Hirata, Yoshito; Aihara, Kazuyuki

    2014-05-01

    Forecasting aftershock activity is useful to reduce seismic risks in the affected area after the main shock. The difficulties to forecast aftershocks are (i) a forecasting model should be tailored to each aftershock sequence because the statistical property varies greatly according to an individual aftershock sequence and (ii) the forecasting model has to be estimated from highly deficient data where a significant fraction of early small aftershocks are missing from seismic records. To overcome this difficulty, we have been developing a statistical model to deal with incompletely detected aftershocks, in which the detection rate of aftershocks is sequentially estimated in a state-space modeling approach. Our method enables us to robustly estimate the forecasting model of underlying aftershocks including not only observed aftershocks but also missing ones from the incomplete catalog. We show that the Omori-Utsu formula can be well estimated only from a few hours of the data, and then it can be revised by the epidemic type aftershock sequence (ETAS) model to adaptively forecast an aftershock sequence with the individual cascading feature as the data size increases in real-time. We demonstrate that how these estimated models can effectively forecast the aftershock activity. We also discuss how these models can be implemented in an operational system for earthquake forecasting. References: T. Omi, Y. Ogata, Y. Hirata, and K. Aihiara, "Forecasting large aftershocks within one day after the main shock", Scientific Reports, 3, 2218 (2013). T. Omi, Y. Ogata, Y. Hirata, and K. Aihiara, "Estimating the ETAS model from an early aftershock sequence", (In submission).

  12. Triggering Sublimation-driven Activity of Main Belt Comets

    Science.gov (United States)

    Haghighipour, N.; Maindl, T. I.; Schäfer, C.; Speith, R.; Dvorak, R.

    2016-10-01

    It has been suggested that the comet-like activity of main belt comets (MBCs) is due to the sublimation of sub-surface water–ice that has been exposed as a result of their surfaces being impacted by meter-sized bodies. We have examined the viability of this scenario by simulating impacts between meter-sized and kilometer-sized objects using a smooth particle hydrodynamics approach. Simulations have been carried out for different values of the impact velocity and impact angle, as well as different target material and water-mass fractions. Results indicate that for the range of impact velocities corresponding to those in the asteroid belt, the depth of an impact crater is slightly larger than 10 m, suggesting that if the activation of MBCs is due to the sublimation of sub-surface water–ice, this ice has to exist no deeper than a few meters from the surface. Results also show that ice exposure occurs in the bottom and on the interior surface of impact craters, as well as on the surface of the target where some of the ejected icy inclusions are re-accreted. While our results demonstrate that the impact scenario is indeed a viable mechanism to expose ice and trigger the activity of MBCs, they also indicate that the activity of the current MBCs is likely due to ice sublimation from multiple impact sites and/or the water contents of these objects (and other asteroids in the outer asteroid belt) is larger than the 5% that is traditionally considered in models of terrestrial planet formation, providing more ice for sublimation. We present the details of our simulations and discuss their results and implications.

  13. Brand as the main marketing direction of enterprises activity

    Directory of Open Access Journals (Sweden)

    M.V. Moklyak

    2016-06-01

    Full Text Available The aim of the article is the research of brand as main stream of marketing activity of the enterprise. The results of the article. Relevance of the chosen subject is in the fact that creating of competitive brand is one of the main marketing direction of activity of modern enterprises. Global companies owe much to the creation of successful brand. In the current market environment conditions towards wide choice and product differentiation of product is almost impossible to compete for companies which don’t have strong brand, which could ensure uniqueness, originality and differentiation of the supply. Scientific novelty of the article is in the interpretation of the essence of branding, which is seen as a way of realization of individual ideas and expectations of the target audience was improved. The types and models of brand were viewed. Brand is imperceptible amount of product properties: its name, packaging and price, its history, reputation and the way of advertising. Brand is marketing concept and is well-known trademark. Usually if at least 20% of target audience is positive about this product, then it can be called brand. Turning the trade mark into the brand happens at a time when the objective perception of the value of product and brand is replaced by stable personal attitude towards them. Consumer gives his subjective mark of the quality of the product, its reliability, safety, ergonomics, design and product name. He adds emotions. To transfer trade mark into a brand it is necessary for it to become a symbol of reliability, guarantee the quality of goods or services, it is advantageous to characterize their specific properties. Branding is a powerful mean of ensuring the competitiveness of the enterprise. Branding becomes the main instrument of price competition for manufacturers, which is able to provide a steady demand for the entire product range of products offered to consumers under brand name. The company that owns strong

  14. Triggering Comet-Like Activity of Main Belt Comets

    Science.gov (United States)

    Haghighipour, Nader; Maindl, Thomas I.; Schaefer, Christoph; Speith, Roland; Dvorak, Rudolf

    2016-10-01

    Main-belt comets (MBCs) have attracted a great deal of interest since their identification as activated asteroids by Hsieh and Jewitt in 2006. It has been suggested that the comet-like activity of these objects are due to the sublimation of sub-surface water-ice that has been exposed as a result of their surfaces being impacted by small (e.g, m-sized) bodies. We have examined the viability of this scenario by simulating impacts between m-sized impactors and km-sized targets using a smooth particle hydrodynamics (SPH) approach. We have carried out simulations for a range of impact velocities and angles, material type and strength, and water content of the target allowing m-sized impactors to erode enough of an MBC's surface to trigger its activation. Results indicate that for the range of impact velocities corresponding to those in the asteroid belt, the depth of an impact crater is slightly larger than 10 m suggesting that if the activation of MBCs is due to the sublimation of sub-surface water-ice, this ice has to exist no deeper than a few meters from the surface. Our simulations point to a clearly notable spread in the aggregated crater depths due to different impact energy, impact angles, and MBC's water contents showing deeper craters due to less overall material strength. Results also show that ice-exposure occurs in the bottom and on the interior surface of impact craters as well as the surface of the target where some of the ejected icy inclusions are re-accreted. Our results, in addition to demonstrating that the impact scenario is indeed a viable mechanism to expose ice and trigger the activity of MBCs, indicate that the activity of the current MBCs is likely due to ice sublimation from multiple impact sites and/or the water contents of these objects (and other asteroids in the outer asteroid belt) is larger than the 5% that is traditionally considered in models of terrestrial planet formation. We present details of our simulations and discuss their

  15. Triggering Sublimation-Driven Activity of Main Belt Comets

    CERN Document Server

    Haghighipour, Nader; Schaefer, Christoph; Speith, Roland; Dvorak, Rudolf

    2016-01-01

    It has been suggested that the comet-like activity of Main Belt Comets are due to the sublimation of sub-surface water-ice that has been exposed as a result of their surfaces being impacted by m-sized bodies. We have examined the viability of this scenario by simulating impacts between m-sized and km-sized objects using a smooth particle hydrodynamics approach. Simulations have been carried out for different values of the impact velocity and impact angle as well as different target material and water-mass fraction. Results indicate that for the range of impact velocities corresponding to those in the asteroid belt, the depth of an impact crater is slightly larger than 10 m suggesting that if the activation of MBCs is due to the sublimation of sub-surface water-ice, this ice has to exist no deeper than a few meters from the surface. Results also show that ice-exposure occurs in the bottom and on the interior surface of impact craters as well as the surface of the target where some of the ejected icy inclusions...

  16. ACTIVE AGEING AND REFORMING PENSION SYSTEM. MAIN CHALLENGES

    Directory of Open Access Journals (Sweden)

    Valentina VASILE

    2012-11-01

    Full Text Available Active ageing and economic crisis create a great pressure on pension systems, from the financial sustainability and performance of the old architectures of the 3 tired system point of view. Reforms of public pension systems during the last years highlight that demographic ageing is a major influence factor on financial sustainability of the national insurance and social assistance systems, with long-term effects. Associated with “classic” demographic ageing (low birth-rate, increase of the average life expectancy for some new member states, such Romania, labour mobility on medium- and long-term and the change of its largest part into emigration, heightens labour force ageing and diminishes participation to insurance systems (due to the low portability of pensions. To these are added also the specific effects generated by the crisis that have put pressure on decreasing social expenditures, in reverse trend against the demand generated by demographic ageing. Romania, and also several EU member countries are involved in large-scale actions of reforming pension systems both as answer to the increase in the numbers of elderly population, and implicitly of associated social expenditures, but also for stimulating the extension of active life. The increase in the standard retirement age and its correlation to life expectancy constitute priorities of changing the methodology in pension computation. The reformed policies in the field of pensions pursue as well restricting accessibility and diminishing early-age retirement schemes in parallel with stimulating the employability of individuals aged 50 and over. In this paper we present the main policy action in order to stimulate and develop a new model of old age insurance and a new pattern of incomes after retirement, and also to investigate the support measures among EU member state for active ageing and increase incomes for elder persons.\\r\

  17. ACTIVE AGEING AND REFORMING PENSION SYSTEM. MAIN CHALLENGES

    Directory of Open Access Journals (Sweden)

    VALENTINA VASILE

    2012-05-01

    Full Text Available Active ageing and economic crisis create a great pressure on pension systems, from the financial sustainability and performance of the old architectures of the 3 tired system point of view. Reforms of public pension systems during the last years highlight that demographic ageing is a major influence factor on financial sustainability of the national insurance and social assistance systems, with long-term effects. Associated with “classic” demographic ageing (low birth-rate, increase of the average life expectancy for some new member states, such Romania, labour mobility on medium- and long-term and the change of its largest part into emigration, heightens labour force ageing and diminishes participation to insurance systems (due to the low portability of pensions. To these are added also the specific effects generated by the crisis that have put pressure on decreasing social expenditures, in reverse trend against the demand generated by demographic ageing. Romania, and also several EU member countries are involved in large-scale actions of reforming pension systems both as answer to the increase in the numbers of elderly population, and implicitly of associated social expenditures, but also for stimulating the extension of active life. The increase in the standard retirement age and its correlation to life expectancy constitute priorities of changing the methodology in pension computation. The reformed policies in the field of pensions pursue as well restricting accessibility and diminishing early-age retirement schemes in parallel with stimulating the employability of individuals aged 50 and over. In this paper we present the main policy action in order to stimulate and develop a new model of old age insurance and a new pattern of incomes after retirement, and also to investigate the support measures among EU member state for active ageing and increase incomes for elder persons.

  18. Application of Pilates principles increases paraspinal muscle activation.

    Science.gov (United States)

    Andrade, Letícia Souza; Mochizuki, Luís; Pires, Flávio Oliveira; da Silva, Renato André Sousa; Mota, Yomara Lima

    2015-01-01

    To analyze the effect of Pilates principles on the EMG activity of abdominal and paraspinal muscles on stable and unstable surfaces. Surface EMG data about the rectus abdominis (RA), iliocostalis (IL) and lumbar multifidus (MU) of 19 participants were collected while performing three repetitions of a crunch exercise in the following conditions: 1) with no Pilates technique and stable surface (nP + S); 2) with no Pilates technique and unstable surface (nP + U); 3) with Pilates technique and stable surface (P + S); 4) with Pilates and unstable surface (P + U). The EMG Fanalysis was conducted using a custom-made Matlab(®) 10. There was no condition effect in the RA iEMG with stable and unstable surfaces (F(1,290) = 0 p = 0.98) and with and without principles (F(1,290) = 1.2 p = 0.27). IL iEMG was higher for the stable surface condition (F(1,290) = 32.3 p Pilates principles (F(1,290) = 21.9 p Pilates principles (F(1,290) = 84.9 p < 0.001). Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. The Main Activities and Features of NGO in 2003

    Institute of Scientific and Technical Information of China (English)

    ZhuLingling; YanMoufeng

    2004-01-01

    In 2003, activities of non-governmental organizations(NGO) were increasing. The international community paid more and more attention to the rolep layed by NGO. The cooperation among NGO was strengthening. Governments of all countries supported the activities of NGO conditionally and at the same time, took advantage of the activities held by NGO to serve their foreign policies.

  20. Principles and Rules of Conduct in the Internal Audit Activity

    Directory of Open Access Journals (Sweden)

    Mihaela Iuliana Dumitru

    2016-02-01

    Full Text Available The objectives of the paper are to present the basic principles governing the internal audit mission as well as the code of conduct that must be observed in exercising such a mission, because the completion of a professional audit mission implies precisely the compliance with the two category of elements. Consequently, this paper is meant to be added to the practice specific to this field as support in exercising the internal audit according to the market requirements. For this purpose, we analysed the above-mentioned elements, presenting brief examples in support of the importance of the approached topics. Thus, from the practical point of view, we can notice the mechanisms used to apply these principles and how the compliance with the audit specific audit conduct lead to a more efficient activity. For these reasons, we can say that the paper is an element of interest both for the academic field (as a starting point for the support of practical approaches and also for the future researches in order to improve the specific audit activity.

  1. The Main Sequence of Explosive Solar Active Regions: Comparison of Emerging and Mature Active Regions

    Science.gov (United States)

    Falconer, David; Moore, Ron

    2011-01-01

    For mature active regions, an active region s magnetic flux content determines the maximum free energy the active region can have. Most Large flares and CMEs occur in active regions that are near their free-energy limit. Active-region flare power radiated in the GOES 1-8 band increases steeply as the free-energy limit is approached. We infer that the free-energy limit is set by the rate of release of an active region s free magnetic energy by flares, CMEs and coronal heating balancing the maximum rate the Sun can put free energy into the active region s magnetic field. This balance of maximum power results in explosive active regions residing in a "mainsequence" in active-region (flux content, free energy content) phase space, which sequence is analogous to the main sequence of hydrogen-burning stars in (mass, luminosity) phase space.

  2. Evaluation of Antileishmanial Activity of Selected Brazilian Plants and Identification of the Active Principles

    Directory of Open Access Journals (Sweden)

    Valdir Cechinel Filho

    2013-01-01

    Full Text Available This study evaluated extracts, fractions, and isolated compounds from some selected Brazilian medicinal plants against strains of promastigotes of Leishmania amazonensis and L. brasiliensis in vitro. The cell viability was determined, comparing the results with reference standards. The dichloromethane fractions of the roots, stems, and leaves of Allamanda schottii showed IC50 values between 14.0 and 2.0 μg/mL. Plumericin was the main active compound, with IC50 of 0.3 and 0.04 μg/mL against the two species of Leishmania analyzed. The hexane extract of Eugenia umbelliflora fruits showed IC50 of 14.3 and 5.7 μg/mL against L. amazonensis and L. brasiliensis, respectively. The methanolic extracts of the seeds of Garcinia achachairu and guttiferone A presented IC50 values of 35.9 and 10.4 μg/mL, against L. amazonensis, respectively. The ethanolic extracts of the stem barks of Rapanea ferruginea and the isolated compound, myrsinoic acid B, presented activity against L. brasiliensis with IC50 of 24.1 and 6.1 μg/mL. Chloroform fraction of Solanum sisymbriifolium exhibited IC50 of 33.8 and 20.5 μg/mL, and cilistol A was the main active principle, with IC50 of 6.6 and 3.1 μg/mL against L. amazonensis and L. brasiliensis, respectively. It is concluded that the analyzed plants are promising as new and effective antiparasitic agents.

  3. 78 FR 64064 - Agency Information Collection (Principles of Excellence Complaint System Intake) Activity Under...

    Science.gov (United States)

    2013-10-25

    ... AFFAIRS Agency Information Collection (Principles of Excellence Complaint System Intake) Activity Under... Excellence Complaint System Intake).'' SUPPLEMENTARY INFORMATION: Title: Principles of Excellence Complaint... System Intake) in any correspondence. FOR FURTHER INFORMATION CONTACT: Crystal Rennie, Enterprise...

  4. First principle active neutron coincidence counting measurements of uranium oxide

    Science.gov (United States)

    Goddard, Braden; Charlton, William; Peerani, Paolo

    2014-03-01

    Uranium is present in most nuclear fuel cycle facilities ranging from uranium mines, enrichment plants, fuel fabrication facilities, nuclear reactors, and reprocessing plants. The isotopic, chemical, and geometric composition of uranium can vary significantly between these facilities, depending on the application and type of facility. Examples of this variation are: enrichments varying from depleted (~0.2 wt% 235U) to high enriched (>20 wt% 235U); compositions consisting of U3O8, UO2, UF6, metallic, and ceramic forms; geometries ranging from plates, cans, and rods; and masses which can range from a 500 kg fuel assembly down to a few grams fuel pellet. Since 235U is a fissile material, it is routinely safeguarded in these facilities. Current techniques for quantifying the 235U mass in a sample include neutron coincidence counting. One of the main disadvantages of this technique is that it requires a known standard of representative geometry and composition for calibration, which opens up a pathway for potential erroneous declarations by the State and reduces the effectiveness of safeguards. In order to address this weakness, the authors have developed a neutron coincidence counting technique which uses the first principle point-model developed by Boehnel instead of the "known standard" method. This technique was primarily tested through simulations of 1000 g U3O8 samples using the Monte Carlo N-Particle eXtended (MCNPX) code. The results of these simulations showed good agreement between the simulated and exact 235U sample masses.

  5. THE FORECAST OF FORMING THE GLOBAL SYSTEM INSTITUTIONS ON THE BASIS OF SIMULATION MODELING: THE MAIN PRINCIPLES

    Directory of Open Access Journals (Sweden)

    Dmitry CHISTILIN

    2009-06-01

    Full Text Available The phenomenon of states changes of the world economy during the last 200 years shows that there is a certain 70-year regularity in its development, which is expressed in increased structural complexity of the global economic system every 70 years. The development happens after certain periods of bifurcation (up to 50 years accompanied by the lower rates of economic development, and periods of adaptation (up to 20 years with the higher rates. The theoretical justification of this process shows that the increased structural complexity of the global economic system is the external manifestations of the self-organization process in a large complex system we call the ôworld economyö. This process of development is based on two fundamental laws of nature: the principle of minimum dissipation of resources, and the law of conservation of economic potential; and is realized via two types of development mechanisms û bifurcation and adaptation.Formation of the world system model should rest on applying the natural laws of development, and lead towards the creation of a complex, two-level (regional and global structure with the institution of geopolitical pluralism, based on implementing the ôprinciple of minimum dissipationö. This will contribute to the development of the global systems on the conflict-free base.

  6. Data warehouses -- main principles, concepts and methods, tools, applications, design and building of data warehouse solution in real company

    OpenAIRE

    Mašek, Martin

    2007-01-01

    The main goal of this thesis is to summarize and introduce general theoretical concepts of Data Warehousing by using the systems approach. The thesis defines Data Warehousing and its main areas and delimitates Data Warehousing area in terms of higher-level area called Business Intelligence. It also describes the history of Data Warehousing & Business Intelligence, focuses on key principals of Data Warehouse building and explains the practical applications of this solution. The aim of the prac...

  7. Contextual Mobile Learning Strongly Related to Industrial Activities: Principles and Case Study

    CERN Document Server

    David, Bertrand; Chalon, René

    2010-01-01

    M-learning (mobile learning) can take various forms. We are interested in contextualized M-learning, i.e. the training related to the situation physically or logically localized. Contextualization and pervasivity are important aspects of our approach. We propose in particular MOCOCO principles (Mobility - COntextualisation - COoperation) using IMERA platform (Mobile Interaction in the Augmented Real Environment). We are studying various mobile learning contexts related to professional activities, in order to master appliances (Installation, Use, Breakdown diagnostic and Repairing). Contextualization, traceability and checking of execution of prescribed operations are based mainly on the use of RFID labels. Investigation of the appropriate training methods for this kind of learning situation, applying mainly a constructivist approach known as "Just-in-time learning", "learning by doing", "learning and doing", constitutes an important topic of this project. From an organizational point of view we are in perfect...

  8. Principles of sustainable development of the territory and priorities of architectural and urban construction activity

    Science.gov (United States)

    Dontsov, Dmitry; Yushkova, Natalia

    2017-01-01

    The paper is aimed at detecting conceptual conflicts within the architectural and urban construction activity (AUCA), defining their reasons and substantiating ways to decrease adverse effects they caused. Methods of causes and effects analyses are used, as well as evolutional and comparative analyses. They allow defining the laws to form activity model in modern environment, whose elements are ranked. Relevance of the paper is based on defining scientific and theoretical grounds of necessity to improve methodology of AUCA via its adaption to the imperatives of state management. System analyses enabled to prove practicability of considering factors of institution environment for reorganization of the model of AUCA, which provide the fullest implementation of sustainable development principles. It was proved that territorial planning is not only the leading type of AUCA, but also integrator for functioning structures of state management within planning of social and economic development. As main result of the paper consist in detection of the perspective ways for evolution of modern methodology due to increasing interdisciplinary aspect leading to the qualitative renewal of territorial management principles.

  9. Salvia officinalis for hot flushes: towards determination of mechanism of activity and active principles.

    Science.gov (United States)

    Rahte, Sinikka; Evans, Richard; Eugster, Philippe J; Marcourt, Laurence; Wolfender, Jean-Luc; Kortenkamp, Andreas; Tasdemir, Deniz

    2013-06-01

    Herbal medicinal products are commonly used in alternative treatment of menopausal hot flushes. In a recent clinical study, Salvia officinalis tincture was found to reduce hot flush frequency and intensity. The aim of the current study was the investigation of the mechanism(s) responsible for the anti-hot flush activity of S. officinalis and determination of its active principle(s). The 66% ethanolic tincture, as well as the n-hexane, CHCl₃, and aqueous ethanolic subextracts obtained from the tincture were studied in vitro for two of the most relevant activities, estrogenicity and selective serotonin reuptake inhibition. Because of an increased risk of menopausal women to suffer from Alzheimer's disease, an in vitro acetylcholinesterase inhibition assay was also employed. No activity was observed in the selective serotonin reuptake inhibition or the acetylcholinesterase inhibition assays at the highest test concentrations. The tincture showed no estrogenic effects whereas the aqueous ethanolic subextract exhibited estrogenicity in the ERLUX assay with an EC₅₀ value of 64 µg/mL. Estrogenic activity-guided fractionation of the aqueous ethanolic subextract by a combination of reverse-phase vacuum liquid chromatography and gel chromatography identified luteolin-7-O-glucuronide (EC₅₀ 129 µg/mL) as the active component of the vacuum liquid chromatography fraction 4 (EC₅₀ 69 µg/mL). Luteolin-7-O-glucoside was identified as the putative estrogenic principle of the most potent minor fraction (7.6.7.6, EC₅₀ 0.7 µg/mL) obtained from the initial vacuum liquid chromatography fraction 7 (EC₅₀ 3 µg/mL). This study suggests the involvement of common and ubiquitous estrogenic flavonoids in the anti-hot flush effect of Salvia officinalis, a safe and commonly used herbal medicinal product during the menopause.

  10. Prediction of solid oxide fuel cell cathode activity with first-principles descriptors

    DEFF Research Database (Denmark)

    Lee, Yueh-Lin; Kleis, Jesper; Rossmeisl, Jan

    2011-01-01

    In this work we demonstrate that the experimentally measured area specific resistance and oxygen surface exchange of solid oxide fuel cell cathode perovskites are strongly correlated with the first-principles calculated oxygen p-band center and vacancy formation energy. These quantities...... are therefore descriptors of catalytic activity that can be used in the first-principles design of new SOFC cathodes....

  11. Freelancers in Ukraine: characteristics and principles of their activity

    OpenAIRE

    Skybinskyi, O.; Solyarchuk, N.

    2014-01-01

    In the article the main results of a survey conducted by the authors in Ukraine were considered. Some results of the survey have been compared with data of similar surveys that have been conducted abroad. The basic characteristics of average statistical Ukrainian freelancer, including the e-lancers distribution by gender, level of education, and the distance between their residence and the nearest big city have been considered. Also, according to the survey, the distribution of Ukrainian f...

  12. Modeling & imaging of bioelectrical activity principles and applications

    CERN Document Server

    He, Bin

    2010-01-01

    Over the past several decades, much progress has been made in understanding the mechanisms of electrical activity in biological tissues and systems, and for developing non-invasive functional imaging technologies to aid clinical diagnosis of dysfunction in the human body. The book will provide full basic coverage of the fundamentals of modeling of electrical activity in various human organs, such as heart and brain. It will include details of bioelectromagnetic measurements and source imaging technologies, as well as biomedical applications. The book will review the latest trends in

  13. The source of spontaneous activity in the main olfactory bulb of the rat.

    Directory of Open Access Journals (Sweden)

    Josif Stakic

    Full Text Available INTRODUCTION: In vivo, most neurons in the main olfactory bulb exhibit robust spontaneous activity. This paper tests the hypothesis that spontaneous activity in olfactory receptor neurons drives much of the spontaneous activity in mitral and tufted cells via excitatory synapses. METHODS: Single units were recorded in vivo from the main olfactory bulb of a rat before, during, and after application of lidocaine to the olfactory nerve. The effect of lidocaine on the conduction of action potentials from the olfactory epithelium to the olfactory bulb was assessed by electrically stimulating the olfactory nerve rostral to the application site and monitoring the field potential evoked in the bulb. RESULTS: Lidocaine caused a significant decrease in the amplitude of the olfactory nerve evoked field potential that was recorded in the olfactory bulb. By contrast, the lidocaine block did not significantly alter the spontaneous activity of single units in the bulb, nor did it alter the field potential evoked by electrical stimulation of the lateral olfactory tract. Lidocaine block also did not change the temporal patters of action potential or their synchronization with respiration. CONCLUSIONS: Spontaneous activity in neurons of the main olfactory bulb is not driven mainly by activity in olfactory receptor neurons despite the extensive convergence onto mitral and tufted cells. These results suggest that spontaneous activity of mitral and tufted is either an inherent property of these cells or is driven by centrifugal inputs to the bulb.

  14. Effect of Magnetic Field on Enzyme Activities in Main Soils of Northeast China

    Institute of Scientific and Technical Information of China (English)

    LIUXIAOYI; YIYANLI; 等

    1996-01-01

    Soil enzyme activities as affected by applied magnetic field were studied with three main soils (brown soil,black soil and albic soil) collected from Northeast China,Appropriate intensities of magnetic field could obviously enhance the activities of hydrogen peroxidases,invertases,amylases and phosphatases in the three soils,although the effect varied with types and water regimes of the soils.Increasing times of magnetic treatment could multiple its good effect on the activities of hydrogen peroxidases in soils.

  15. Active-involvement principle in dental health education

    DEFF Research Database (Denmark)

    Schou, L

    1985-01-01

    A basic problem in dental health education (DHE) is that the effect usually disappears shortly after the termination of a program. The purpose of the present study was to obtain long-term effect of a DHE-program by emphasizing the active involvement of the participants. The sample comprised...

  16. Major Pesticides Are More Toxic to Human Cells Than Their Declared Active Principles

    Directory of Open Access Journals (Sweden)

    Robin Mesnage

    2014-01-01

    Full Text Available Pesticides are used throughout the world as mixtures called formulations. They contain adjuvants, which are often kept confidential and are called inerts by the manufacturing companies, plus a declared active principle, which is usually tested alone. We tested the toxicity of 9 pesticides, comparing active principles and their formulations, on three human cell lines (HepG2, HEK293, and JEG3. Glyphosate, isoproturon, fluroxypyr, pirimicarb, imidacloprid, acetamiprid, tebuconazole, epoxiconazole, and prochloraz constitute, respectively, the active principles of 3 major herbicides, 3 insecticides, and 3 fungicides. We measured mitochondrial activities, membrane degradations, and caspases 3/7 activities. Fungicides were the most toxic from concentrations 300–600 times lower than agricultural dilutions, followed by herbicides and then insecticides, with very similar profiles in all cell types. Despite its relatively benign reputation, Roundup was among the most toxic herbicides and insecticides tested. Most importantly, 8 formulations out of 9 were up to one thousand times more toxic than their active principles. Our results challenge the relevance of the acceptable daily intake for pesticides because this norm is calculated from the toxicity of the active principle alone. Chronic tests on pesticides may not reflect relevant environmental exposures if only one ingredient of these mixtures is tested alone.

  17. Major pesticides are more toxic to human cells than their declared active principles.

    Science.gov (United States)

    Mesnage, Robin; Defarge, Nicolas; Spiroux de Vendômois, Joël; Séralini, Gilles-Eric

    2014-01-01

    Pesticides are used throughout the world as mixtures called formulations. They contain adjuvants, which are often kept confidential and are called inerts by the manufacturing companies, plus a declared active principle, which is usually tested alone. We tested the toxicity of 9 pesticides, comparing active principles and their formulations, on three human cell lines (HepG2, HEK293, and JEG3). Glyphosate, isoproturon, fluroxypyr, pirimicarb, imidacloprid, acetamiprid, tebuconazole, epoxiconazole, and prochloraz constitute, respectively, the active principles of 3 major herbicides, 3 insecticides, and 3 fungicides. We measured mitochondrial activities, membrane degradations, and caspases 3/7 activities. Fungicides were the most toxic from concentrations 300-600 times lower than agricultural dilutions, followed by herbicides and then insecticides, with very similar profiles in all cell types. Despite its relatively benign reputation, Roundup was among the most toxic herbicides and insecticides tested. Most importantly, 8 formulations out of 9 were up to one thousand times more toxic than their active principles. Our results challenge the relevance of the acceptable daily intake for pesticides because this norm is calculated from the toxicity of the active principle alone. Chronic tests on pesticides may not reflect relevant environmental exposures if only one ingredient of these mixtures is tested alone.

  18. Fundamental principles of the cultural-activity approach in the psychology of giftedness

    Directory of Open Access Journals (Sweden)

    Babaeva, Yuliya D.

    2013-12-01

    Full Text Available This article examines the cultural-activity approach to the study of giftedness, which is based on the ideas of L. S. Vygotsky, A. N. Leontiev, and O. K. Tikhomirov. Three basic principles of this approach are described: the principle of polymorphism, the dynamic principle, and the principle of the holistic analysis of the giftedness phenomenon. The article introduces the results of empirical research (including a 10-year longitudinal study, which verifies the efficacy of the cultural-activity approach and its prospects for solving actual problems in the psychology of giftedness in light of the creation of new diagnostic procedures and methods of education and the development of gifted children.

  19. In-vivo neutron activation analysis: principles and clinical applications

    Energy Technology Data Exchange (ETDEWEB)

    Cohn, S.H.

    1982-01-01

    In vivo neutron activation has opened a new era of both clinical diagnosis and therapy evaluation, and investigation into and modelling of body composition. The techniques are new, but it is already clear that considerable strides can be made in increasing accuracy and precision, increasing the number of elements susceptible to measurement, enhancing uniformity, and reducing the dose required for the measurement. The work presently underway will yield significant data on a variety of environmental contaminants such as Cd. Compositional studies are determining the level of vital constituents such as nitrogen and potassium in both normal subjects and in patients with a variety of metabolic disorders. Therapeutic programs can be assessed while in progress. It seems likely that by the end of this century there will have been significant progress with this research tool, and exciting insights obtained into the nature and dynamics of human body composition.

  20. Modelling Dynamics of Main Indicators of Economic Activity of Households of Ukraine

    Directory of Open Access Journals (Sweden)

    Zhuk Mykola O.

    2014-01-01

    Full Text Available The goal of the article is the study of the structure of the system of economic activity of households in Ukraine and dynamics of interconnections between the main indicators of its functioning. In order to study dynamics of main indicators of the system of economic activity of households, the article uses tools of econometric vector-autoregression modelling (VAR models. Based on the existing statistical data and a developed VAR model, the article studies individual and aggregate influence of lag values of indicators upon their current values, system reaction on main indicators impulses, analyses dynamics of change of explanation of dispersion of some indicators with others, and conducts two types of forecasts that reflect a general tendency of development of economic activity of households in Ukraine. High accuracy of forecasts obtained with the help of the proposed econometric model testifies to a possibility of its practical application for assessment of the state of main indicators of economic activity of households of Ukraine. The article applies for the first time the tools of VAR modelling for the study of economic activity of households in Ukraine, which expands possibilities of use of mathematical and statistical methods and models in this field of economy.

  1. Supporting Teachers in Designing CSCL Activities: A Case Study of Principle-based Pedagogical Patterns in Networked Second Language Classrooms

    National Research Council Canada - National Science Library

    Yun Wen; Chee-Kit Looi; Wenli Chen

    2012-01-01

      This paper proposes the identification and use of principle-based pedagogical patterns to help teachers to translate design principles into actionable teaching activities, and to scaffold student...

  2. PRINCIPLES OF ORGANIZATION OF INNOVATION ACTIVITY IN SCIENTIFIC AGRO-INDUSTRIAL COMPLEX

    Directory of Open Access Journals (Sweden)

    Mironchuk V. A.

    2014-12-01

    Full Text Available The article provides and justifies the most preferred principle of innovative activity in agro-industrial complex - the development of multilevel model based on marketing concept of spheres and its approaches to managing innovation. The concept aims to create a competitive scientific and technical production, demand in the market through active marketing of the scientific-technical and innovation industry

  3. Antitumor properties and modulation of antioxidant enzymes' activity by Aloe vera leaf active principles isolated via supercritical carbon dioxide extraction.

    Science.gov (United States)

    El-Shemy, H A; Aboul-Soud, M A M; Nassr-Allah, A A; Aboul-Enein, K M; Kabash, A; Yagi, A

    2010-01-01

    The aim of this study was to evaluate the potential anticancer properties and modulatory effect of selected Aloe vera (A. vera) active principles on antioxidant enzyme activities. Thus, three anthraquinones (Namely: aloesin, aloe-emodin and barbaloin) were extracted from A. vera leaves by supercritical fluid extraction and subsequently purified by high performance liquid chromatography. Additionally, the N-terminal octapeptide derived from verectin, a biologically active 14 kDa glycoprotein present in A. vera, was also tested. In vivo, active principles exhibited significant prolongation of the life span of tumor-transplanted animals in the following order: barbaloin> octapeptide> aloesin > aloe-emodin. A. vera active principles exhibited significant inhibition on Ehrlich ascite carcinoma cell (EACC) number, when compared to positive control group, in the following order: barbaloin> aloe-emodin > octapeptide > aloesin. Moreover, in trypan blue cell viability assay, active principles showed a significant concentration-dependent cytotoxicity against acute myeloid leukemia (AML) and acute lymphocytes leukemia (ALL) cancerous cells. Furthermore, in MTT cell viability test, aloe-emodin was found to be active against two human colon cancer cell lines (i.e. DLD-1 and HT2), with IC(50) values of 8.94 and 10.78 microM, respectively. Treatments of human AML leukemic cells with active principles (100 microg ml(-1)) resulted in varying intensities of internucleosomal DNA fragmentation, hallmark of cells undergoing apoptosis, in the following order: aloe-emodin> aloesin> barbaloin> octapeptide. Intererstingly, treatment of EACC tumors with active principles resulted in a significant elevation activity of key antioxidant enzymes (SOD, GST, tGPx, and LDH). Our data suggest that the tested A. vera compounds may exert their chemo-preventive effect through modulating antioxidant and detoxification enzyme activity levels, as they are one of the indicators of tumorigenesis. These

  4. New Horizons in C-F Activation by Main Group Electrophiles

    Energy Technology Data Exchange (ETDEWEB)

    Ozerov, Oleg V. [Texas A & M Univ., College Station, TX (United States). Dept. of Chemistry

    2016-02-13

    This technical report describes progress on the DOE sponsored project "New Horizons in C-F Activation by Main Group Electrophiles" during the period of 09/15/2010 – 08/31/2015. The main goal of this project was to develop improved catalysts for conversion of carbon-fluorine bonds in potentially harmful compounds. The approach involved combining of a highly reactive positively charged main-group compound with a highly unreactive negatively charged species (anions) as a way to access potent catalysts for carbon-fluorine bond activation. This report details progress made in improving synthetic pathways to a variety of new anions with improved properties and analysis of their potential in catalysis.

  5. Is cost-effectiveness analysis preferred to severity of disease as the main guiding principle in priority setting in resource poor settings? The case of Uganda

    Directory of Open Access Journals (Sweden)

    Norheim Ole

    2004-01-01

    Full Text Available Abstract Introduction Several studies carried out to establish the relative preference of cost-effectiveness of interventions and severity of disease as criteria for priority setting in health have shown a strong preference for severity of disease. These preferences may differ in contexts of resource scarcity, as in developing countries, yet information is limited on such preferences in this context. Objective This study was carried out to identify the key players in priority setting in health and explore their relative preference regarding cost-effectiveness of interventions and severity of disease as criteria for setting priorities in Uganda. Design 610 self-administered questionnaires were sent to respondents at national, district, health sub-district and facility levels. Respondents included mainly health workers. We used three different simulations, assuming same patient characteristics and same treatment outcome but with varying either severity of disease or cost-effectiveness of treatment, to explore respondents' preferences regarding cost-effectiveness and severity. Results Actual main actors were identified to be health workers, development partners or donors and politicians. This was different from what respondents perceived as ideal. Above 90% of the respondents recognised the importance of both severity of disease and cost-effectiveness of intervention. In the three scenarios where they were made to choose between the two, a majority of the survey respondents assigned highest weight to treating the most severely ill patient with a less cost-effective intervention compared to the one with a more cost-effective intervention for a less severely ill patient. However, international development partners in in-depth interviews preferred the consideration of cost-effectiveness of intervention. Conclusions In a survey among health workers and other actors in priority setting in Uganda, we found that donors are considered to have more say than

  6. Main-belt comets: sublimation-driven activity in the asteroid belt

    CERN Document Server

    Hsieh, Henry H

    2015-01-01

    Our knowledge of main-belt comets (MBCs), which exhibit comet-like activity likely due to the sublimation of volatile ices, yet orbit in the main asteroid belt, has increased greatly since the discovery of the first known MBC, 133P/Elst-Pizarro, in 1996, and their recognition as a new class of solar system objects after the discovery of two more MBCs in 2005. I review work that has been done over the last 10 years to improve our understanding of these enigmatic objects, including the development of systematic discovery methods and diagnostics for distinguishing MBCs from disrupted asteroids (which exhibit comet-like activity due to physical disruptions such as impacts or rotational destabilization). I also discuss efforts to understand the dynamical and thermal properties of these objects.

  7. Erectile Dysfunction Among HIV Patients Undergoing Highly Active Antiretroviral Therapy: Dyslipidemia as a Main Risk Factor

    Directory of Open Access Journals (Sweden)

    Gustavo Romero‐Velez, MD

    2014-04-01

    Conclusions: ED is highly prevalent in HIV patients. Dyslipidemia should be considered as a risk factor for ED in HIV patients. Romero‐Velez G, Lisker‐Cervantes A, Villeda‐Sandoval CI, Sotomayor de Zavaleta M, Olvera‐Posada D, Sierra‐Madero JG, Arreguin‐Camacho LO, and Castillejos‐Molina RA. Erectile dysfunction among HIV patients undergoing highly active antiretroviral therapy: Dyslipidemia as a main risk factor. Sex Med 2014;2:24–30.

  8. [Main progress on studies of pharmacological activities and clinical applications of Guizhi Fuling capsule].

    Science.gov (United States)

    Su, Zhen-zhen; Li, Na; Cao, Liang; Wang, Tuan-jie; Zhang, Chen-feng; Ding, Gang; Wang, Zhen-zhong; Xiao, Wei

    2015-03-01

    Guizhi Fuling capsule is a traditional Chinese medicine composed of five kinds of medicinal plants, Cinnamomi Ramulus, Poria, Moutan Cortex, Persicae Semen, and Paeoniae Radix Alba. Pharmacology studies have shown that Guizhi Fuling capsule has many activities: anti-inflammatory, analgesic, anti-tumor, regulating smooth muscle, endocrine regulation and enhancing immunity. It achieved obvious effects in the treatment of uterine fibroids, pelvic inflammatory disease, dysmenorrheal, endometriosis, ovarian cysts, breast hyperplasia and other gynecological diseases. This paper reviewed the main progress on studies of pharmacological activities and clinical applications of Guizhi Fuling capsule in recent years.

  9. Three Types of Active Lubrication Systems for the Main Bearings of Reciprocating Machines

    DEFF Research Database (Denmark)

    Santos, Ilmar; Pulido, E. E.

    2010-01-01

    thickness and consequently reducing viscous friction losses and vibrations. One refers to active lubrication when conventional hydrodynamic lubrication is combined with dynamically modified hydrostatic lubrication. In this case, the hydrostatic lubrication is modified by injecting oil at controllable......In the paper the authors investigate three different schemes for the realization of the controllable oil injection system to be couple to the main engine bearings. The use of active lubrication in fluid film bearings helps to enhance the hydrodynamic fluid film by increasing the fluid film...

  10. Intestinal bacteria activate estrogenic effect of main constituents puerarin and daidzin of Pueraria thunbergiana.

    Science.gov (United States)

    Park, Eun-Kyung; Shin, Jieun; Bae, Eun-Ah; Lee, Young-Chul; Kim, Dong-Hyun

    2006-12-01

    To understand the relationship between the metabolites and estrogenic activity of the main isoflavones puerarin and daidzin of the rhizome of Pueraria thunbergiana (PT, family Leguminosae), PT and its isoflavones were transformed by human intestinal bacteria and their estrogenic effects were investigated. All human fecal specimens hydrolyzed puerarin and daidzin to daidzein, but their hydrolyzing activities varied depending on the individuals. All intestinal bacteria isolated from human also hydrolyzed daidzin to daidzein, but a few bacteria transformed puerarin to daidzein. When the estrogenic effect of PT, puerarin and daidzin was compared with those of their metabolites, the metabolites more potently increased proliferation of MCF-7 cells than PT, puerarin and daidzin. The metabolite daidzein also potently increased estrogen-response c-fos mRNA and PR protein expressions. These findings suggest that intestinal bacteria, which can hydrolyze puerarin and/or daidzin, may activate a potent estrogenic activity of PT.

  11. Inhibitory effects of active fraction and its main components of Shaofu Zhuyu decoction on uterus contraction.

    Science.gov (United States)

    Su, Shulan; Hua, Yongqing; Duan, Jin-Ao; Zhou, Wei; Shang, Erxin; Tang, Yuping

    2010-01-01

    Shaofu Zhuyu decoction is a famous formula for treating primary dysmenorrhea in China since the Qing dynasty. In this paper, the inhibitory effects of active-guided fraction and its main bioactive components of Shaofu Zhuyu decoction on a model of non-pregnant mice uterine contraction induced by oxytocin in vitro were investigated. Qualitative and quantitative chemical analyses were used to correlate the chemical composition of active fraction with the spasmolytic effects. Seven ingredients in the active fraction were identified and quantified by HPLC-DAD. Three ingredients, ferulic acid, vanillic acid, and typhaneoside, were evaluated for their effects on mice isolated uterine contraction induced by oxytocin in vitro. The ED(50) of them were 63.0 microg/ml, 57.6 microg/ml, 109.7 microg/ml, respectively. Furthermore, the inhibitory activity of the combination of these three compounds was prior to the fraction and seven compounds group. The ED(50) was 65.5 microg/ml. The data stated that ferulic acid, vanillic acid, and typhaneoside were possibly the main active components in the bioactive fraction of Shaofu Zhuyu decoction. The study also implied that Shaofu Zhuyu decoction may have direct inhibitory effects on the contractility of the mice uterus and justified the traditional use of the prescription for treating the uterine cramping associated dysmenorrhea.

  12. Principles and Implementation of Reading Activities in Primary School English Class

    Science.gov (United States)

    Jinxiu, Jing; Zhengping, Zeng

    2016-01-01

    Reading is an important skill in learning English. However, reading class is not emphasized in some primary schools in China, and there are various problems with the reading activities, which inadequately just focus on teaching of words, sentences separately from texts. This paper aims to bring out a whole system of principles in designing…

  13. A trend analysis of global fire activity. Is it land use or climate the main driver?

    Science.gov (United States)

    Bistinas, Ioannis; Oom, Duarte; Silva, Joao M. N.; Lopez-Saldaña, Gerardo; Pereira, Jose M. C.

    2016-04-01

    We perform a global trend analysis of active fire counts at 0.5o spatial resolution, using 156 months (January 2001 - December 2013) of MODIS Climate Modelling Grid data (TERRA). We use the Contextual Mann-Kendall (CMK) test to assess the statistical significance at cell level and found that 13% of the global land area displays statistically significant active fire count trends, with a slight predominance of negative trends (50.63% of the total significant cells). We perform the same trend analysis with the unexplained variability (residuals) between active fires and the Fire Weather Index (FWI) that is used as a proxy for climate. There is agreement between the main patterns from the trend analysis coming from the residuals and the active fire trends, implying that the main contemporary fire trends are not climate driven. Spatially coherent patches with significant trends were found in all continents (with the obvious exception of Antarctica). The majority of significant trends occur in areas of high fire incidence, and both increasing and decreasing trends appear to be associated with land use change processes. The analysis reveals large negative trends at the Sahel and between Russia and Kazakhstan, whereas a massive and coherent positive trend appears in southeastern Asia. Smaller patches of positive trends appear in southeastern United States and in Mexico, as well as in Brazil and between Argentina and Paraguay, and in Asia in India. There are also negative trends in Brazil, Argentina and in Australia. The study highlights the land use activities as the main driver of these trends, but also the need for data driven analyses and longer time series for future studies in order to gain better knowledge on fire occurrence.

  14. [Ethical and legal principles for the activities of bioprospection in relation to human beings and the human genome].

    Science.gov (United States)

    Romeo Casabona, Carlos María

    2012-01-01

    During recent decades, bioprospecting has become an important field of research, which looks for development alternatives, entry into global (environmental) markets, and the subsequent obtention of benefits under sustainable development principles. However, there is still so much to discuss regarding the social and environmental impacts produced by this activity, as well as its main limitations. To this end, the Forum/round-table discussion, entitled "Bioprospección, Etica y Sociedad" was organised to take place on 28 March 2012 at the National University of Colombia. Its main objective was to enrich our knowledge on bioprospecting considering the ethical considerations that involve society. The presentation given by Professor ROMEO CASABONA, regarding the connection between bioprospecting and the human genome deserves special attention and is presented below.

  15. Characterization of Active Main Belt Object P/2012 F5 (Gibbs): A Possible Impacted Asteroid

    CERN Document Server

    Stevenson, R; Bauer, J M; Masiero, J R; Mainzer, A K

    2012-01-01

    In this work we characterize the recently discovered active main belt object P/2012 F5 (Gibbs), which was discovered with a dust trail > 7' in length in the outer main belt, 7 months prior to aphelion. We use optical imaging obtained on UT 2012 March 27 to analyze the central condensation and the long trail. We find nuclear B-band and R-band apparent magnitudes of 20.96 and 19.93 mag, respectively, which give an upper limit on the radius of the nucleus of 2.1 km. The geometric cross-section of material in the trail was ~ 4 x 10^8 m^2, corresponding to a dust mass of ~ 5 x 10^7 kg. Analysis of infrared images taken by the Wide-Field Infrared Survey Explorer in September 2010 reveals that the object was below the detection limit, suggesting that it was less active than it was during 2012, or possibly inactive, just 6 months after it passed through perihelion. We set a 1-sigma upper limit on its radius during this time of 2.9 km. P/2012 F5 (Gibbs) is dynamically stable in the outer main belt on timescales of ~ 1...

  16. Ordinary and Activated Bone Grafts: Applied Classification and the Main Features

    Directory of Open Access Journals (Sweden)

    R. V. Deev

    2015-01-01

    Full Text Available Bone grafts are medical devices that are in high demand in clinical practice for substitution of bone defects and recovery of atrophic bone regions. Based on the analysis of the modern groups of bone grafts, the particularities of their composition, the mechanisms of their biological effects, and their therapeutic indications, applicable classification was proposed that separates the bone substitutes into “ordinary” and “activated.” The main differential criterion is the presence of biologically active components in the material that are standardized by qualitative and quantitative parameters: growth factors, cells, or gene constructions encoding growth factors. The pronounced osteoinductive and (or osteogenic properties of activated osteoplastic materials allow drawing upon their efficacy in the substitution of large bone defects.

  17. SUBLIMATION-DRIVEN ACTIVITY IN MAIN-BELT COMET 313P/GIBBS

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, Henry H. [Institute of Astronomy and Astrophysics, Academia Sinica, P.O. Box 23-141, Taipei 10617, Taiwan (China); Hainaut, Olivier [European Southern Observatory, Karl-Schwarzschild-Straße 2, D-85748 Garching bei München (Germany); Novaković, Bojan [Department of Astronomy, Faculty of Mathematics, University of Belgrade, Studentski trg 16, 11000 Belgrade (Serbia); Bolin, Bryce [Observatoire de la Côte d’Azur, Boulevard de l’Observatoire, B.P. 4229, F-06304 Nice Cedex 4 (France); Denneau, Larry; Haghighipour, Nader; Kleyna, Jan; Meech, Karen J.; Schunova, Eva; Wainscoat, Richard J. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Fitzsimmons, Alan [Astrophysics Research Centre, Queens University Belfast, Belfast BT7 1NN (United Kingdom); Kokotanekova, Rosita; Snodgrass, Colin [Planetary and Space Sciences, Department of Physical Sciences, The Open University, Milton Keynes MK7 6AA (United Kingdom); Lacerda, Pedro [Max Planck Institute for Solar System Research, Justus-von-Liebig-Weg 3, D-37077 Göttingen (Germany); Micheli, Marco [ESA SSA NEO Coordination Centre, Frascati, RM (Italy); Moskovitz, Nick; Wasserman, Lawrence [Lowell Observatory, 1400 W. Mars Hill Road, Flagstaff, AZ 86001 (United States); Waszczak, Adam, E-mail: hhsieh@asiaa.sinica.edu.tw [Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA 91125 (United States)

    2015-02-10

    We present an observational and dynamical study of newly discovered main-belt comet 313P/Gibbs. We find that the object is clearly active both in observations obtained in 2014 and in precovery observations obtained in 2003 by the Sloan Digital Sky Survey, strongly suggesting that its activity is sublimation-driven. This conclusion is supported by a photometric analysis showing an increase in the total brightness of the comet over the 2014 observing period, and dust modeling results showing that the dust emission persists over at least three months during both active periods, where we find start dates for emission no later than 2003 July 24 ± 10 for the 2003 active period and 2014 July 28 ± 10 for the 2014 active period. From serendipitous observations by the Subaru Telescope in 2004 when the object was apparently inactive, we estimate that the nucleus has an absolute R-band magnitude of H{sub R} = 17.1 ± 0.3, corresponding to an effective nucleus radius of r{sub e} ∼ 1.00 ± 0.15 km. The object’s faintness at that time means we cannot rule out the presence of activity, and so this computed radius should be considered an upper limit. We find that 313P’s orbit is intrinsically chaotic, having a Lyapunov time of T{sub l} = 12,000 yr and being located near two three-body mean-motion resonances with Jupiter and Saturn, 11J-1S-5A and 10J+12S-7A, yet appears stable over >50 Myr in an apparent example of stable chaos. We furthermore find that 313P is the second main-belt comet, after P/2012 T1 (PANSTARRS), to belong to the ∼155 Myr old Lixiaohua asteroid family.

  18. The Main Sequences of Starforming Galaxies and Active Galactic Nuclei at High Redshift

    CERN Document Server

    Mancuso, Claudia; Shi, J; Gonzàlez-Nuevo, J; Bèthermin, M; Danese, L

    2016-01-01

    We provide a novel, unifying physical interpretation on the origin, the average shape, the scatter, and the cosmic evolution for the main sequences of starforming galaxies and active galactic nuclei at high redshift z $\\gtrsim$ 1. We achieve this goal in a model-independent way by exploiting: (i) the redshift-dependent SFR functions based on the latest UV/far-IR data from HST/Herschel, and re- lated statistics of strong gravitationally lensed sources; (ii) deterministic evolutionary tracks for the history of star formation and black hole accretion, gauged on a wealth of multiwavelength observations including the observed Eddington ratio distribution. We further validate these ingredients by showing their consistency with the observed galaxy stellar mass functions and AGN bolometric luminosity functions at different redshifts via the continuity equation approach. Our analysis of the main sequence for high-redshift galaxies and AGNs highlights that the present data are consistently interpreted in terms of an in...

  19. Magnetic Activity of Pre-main Sequence Stars near the Stellar-Substellar Boundary

    CERN Document Server

    Principe, David A; Rodriguez, David

    2015-01-01

    X-ray observations of pre-main sequence (pre-MS) stars of M-type probe coronal emission and offer a means to investigate magnetic activity at the stellar-substellar boundary. Recent observations of main sequence (MS) stars at this boundary display a decrease in fractional X-ray luminosity ($L_{X}$/$L_{bol}$) by almost two orders of magnitude for spectral types M7 and later. We investigate magnetic activity and search for a decrease in X-ray emission in the pre-MS progenitors of these MS stars. We present XMM-Newton X-ray observations and preliminary results for ~10 nearby (30-70 pc), very low mass pre-MS stars in the relatively unexplored age range of 10-30 Myr. We compare the fractional X-ray luminosities of these 10-30 Myr old stars to younger (1-3 Myr) pre-MS brown dwarfs and find no dependence on spectral type or age suggesting that X-ray activity declines at an age later than ~30 Myr in these very low-mass stars.

  20. Magnetic Activity of Pre-main Sequence Stars near the Stellar-Substellar Boundary

    Science.gov (United States)

    Principe, David; Kastner, Joel. H.; Rodriguez, David

    2016-01-01

    X-ray observations of pre-main sequence (pre-MS) stars of M-type probe coronal emission and offer a means to investigate magnetic activity at the stellar-substellar boundary. Recent observations of main sequence (MS) stars at this boundary display a decrease in fractional X-ray luminosity (L X /L bol ) by almost two orders of magnitude for spectral types M7 and later. We investigate magnetic activity and search for a decrease in X-ray emission in the pre-MS progenitors of these MS stars. We present XMM-Newton X-ray observations and preliminary results for ~10 nearby (30-70 pc), very low mass pre-MS stars in the relatively unexplored age range of 10-30 Myr. We compare the fractional X-ray luminosities of these 10-30 Myr old stars to younger (1-3 Myr) pre-MS brown dwarfs and find no dependence on spectral type or age suggesting that X-ray activity declines at an age later than ~30 Myr in these very low-mass stars.

  1. Variation in contents of main active components and antioxidant activity in leaves of different pigeon pea cultivars during growth.

    Science.gov (United States)

    Wei, Zuo-Fu; Jin, Shuang; Luo, Meng; Pan, You-Zhi; Li, Ting-Ting; Qi, Xiao-Lin; Efferth, Thomas; Fu, Yu-Jie; Zu, Yuan-Gang

    2013-10-23

    Pigeon pea is an important and multiuse grain legume crop, and its leaves are a very valuable natural resource. To obtain a high-quality biological resource, it is necessary to choose the excellent cultivar and determine the appropriate harvest time. In this study, the variation in contents of main active components and antioxidant activity in leaves of six pigeon pea cultivars during growth were investigated. The level of each individual active component significantly varied during growth, but with a different pattern, and this variation was different among cultivars. Flavonoid glycosides orientin, vitexin, and apigenin-6,8-di-C-α-L-arabinopyranoside showed two peak values at mid-late and final stages of growth in most cases. Pinostrobin chalcone, longistyline C, and cajaninstilbene acid showed remarkablely higher values at the mid-late stage of growth than at other stages. Pinostrobin had an extremely different variation pattern compared to other active components. Its content was the highest at the earlier stage of growth. Principal component analysis (PCA) revealed that vitexin and apigenin-6,8-di-C-α-L-arabinopyranoside were mainly responsible for distinguishing cultivars analyzed. In a comprehensive consideration, the leaves should preferentially be harvested at the 135th day after sowing when the level of active components and antioxidant activity reached higher values. Cultivars ICP 13092, ICPL 87091, and ICPL 96053 were considered to be excellent cultivars with high antioxidant activity. Our findings can provide valuable information for producing a high-quality pigeon pea resource.

  2. Rotenoids from Tephrosia toxicaria with larvicidal activity against Aedes aegypti, the main vector of dengue fever

    Directory of Open Access Journals (Sweden)

    Jackson Nunes e Vasconcelos

    2012-01-01

    Full Text Available In the search for new larvicides from plants, we have investigated the potential activity of the rotenoids deguelin (1, 12a-hydroxy-α-toxicarol (2 and tephrosin (3, isolated from the bioactive ethanol extract of roots of Tephrosia toxicaria Pers., against Aedes aegypti, the main vector of dengue. The absolute configuration of these compounds was determined by circular dichroism (CD spectra. The LC50 values of the compounds evaluated justify the potential of T. toxicaria as a new natural larvicide.

  3. Sublimation-Driven Activity in Main-Belt Comet 313P/Gibbs

    CERN Document Server

    Hsieh, Henry H; Novakovic, Bojan; Bolin, Bryce; Denneau, Larry; Fitzsimmons, Alan; Haghighipour, Nader; Kleyna, Jan; Kokotanekova, Rosita; Lacerda, Pedro; Meech, Karen J; Micheli, Marco; Moskovitz, Nick; Schunova, Eva; Snodgrass, Colin; Wainscoat, Richard J; Wasserman, Lawrence; Waszczak, Adam

    2015-01-01

    We present an observational and dynamical study of newly discovered main-belt comet 313P/Gibbs. We find that the object is clearly active both in observations obtained in 2014 and in precovery observations obtained in 2003 by the Sloan Digital Sky Survey, strongly suggesting that its activity is sublimation-driven. This conclusion is supported by a photometric analysis showing an increase in the total brightness of the comet over the 2014 observing period, and dust modeling results showing that the dust emission persists over at least three months during both active periods, where we find start dates for emission no later than 2003 July 24+/-10 for the 2003 active period and 2014 July 28+/-10 for the 2014 active period. From serendipitous observations by the Subaru Telescope in 2004 when the object was apparently inactive, we estimate that the nucleus has an absolute R-band magnitude of H_R=17.1+/-0.3, corresponding to an effective nucleus radius of r_e~1.00+/-0.15 km. The object's faintness at that time mean...

  4. Atrazine and its main metabolites alter the locomotor activity of larval zebrafish (Danio rerio).

    Science.gov (United States)

    Liu, Zhenzhen; Wang, Yueyi; Zhu, Zhihong; Yang, Enlu; Feng, Xiayan; Fu, Zhengwei; Jin, Yuanxiang

    2016-04-01

    Atrazine (ATZ) and its main chlorometabolites, i.e., diaminochlorotriazine (DACT), deisopropylatrazine (DIP), and deethylatrazine (DE), have been widely detected in aquatic systems near agricultural fields. However, their possible effects on aquatic animals are still not fully understood. In this study, it was observed that several developmental endpoints such as the heart beat, hatchability, and morphological abnormalities were influenced by ATZ and its metabolites in different developmental stages. In addition, after 5 days of exposure to 30, 100, 300 μg L(-1) ATZ and its main chlorometabolites, the swimming behaviors of larval zebrafish were significantly disturbed, and the acetylcholinesterase (AChE) activities were consistently inhibited. Our results also demonstrate that ATZ and its main chlorometabolites are neuroendocrine disruptors that impact the expression of neurotoxicity-related genes such as Ache, Gap43, Gfap, Syn2a, Shha, Mbp, Elavl3, Nestin and Ngn1 in early developmental stages of zebrafish. According to our results, it is possible that not only ATZ but also its metabolites (DACT, DIP and DE) have the same or even more toxic effects on different endpoints of the early developmental stages of zebrafish.

  5. Application of the VALUE communication principles in ACTIVE hospice team meetings.

    Science.gov (United States)

    Washington, Karla T; Wittenberg-Lyles, Elaine; Parker Oliver, Debra; Demiris, George; Shaunfield, Sara; Crumb, Edith

    2013-01-01

    The ACTIVE (Assessing Caregivers for Team Intervention through Video Encounters) intervention uses technology to enable family caregivers to participate in hospice interdisciplinary team (IDT) meetings from geographically remote locations. Previous research has suggested that effective communication is critical to the success of these meetings. The purpose of this study was to explore communication in ACTIVE IDT meetings involving family caregivers and to assess the degree to which hospice teams use specific communication principles (summarized in the mnemonic VALUE: value, acknowledge, listen, understand, and elicit), which have been supported in previous research in intensive care settings. Researchers analyzed team-family communication during 84 video- and/or audio-recorded care plan discussions that took place during ACTIVE team meetings, using a template approach to text analysis to determine the extent and quality of VALUE principles. The total content analyzed was 9 hours, 28 minutes in length. Hospice clinicians routinely employed the VALUE communication principles in communication during ACTIVE IDT meetings with family caregivers, but the quality of this communication was frequently rated moderate or poor. The majority of such communication was task-focused. Less often, communication centered on emotional concerns and efforts to gain a more holistic understanding of patients and families. This analysis suggests an opportunity for improving support for family members during ACTIVE IDT meetings. Members of hospice IDTs should remain aware of the opportunity for additional attention to the emotional realities of the hospice experience for family caregivers and could improve support for family caregivers during IDT meetings by ensuring that messages used to exemplify VALUE principles during team-family communication are of a high quality.

  6. Movement-Related Sensorimotor High-Gamma Activity Mainly Represents Somatosensory Feedback

    Directory of Open Access Journals (Sweden)

    Seokyun Ryun

    2017-07-01

    Full Text Available Somatosensation plays pivotal roles in the everyday motor control of humans. During active movement, there exists a prominent high-gamma (HG >50 Hz power increase in the primary somatosensory cortex (S1, and this provides an important feature in relation to the decoding of movement in a brain-machine interface (BMI. However, one concern of BMI researchers is the inflation of the decoding performance due to the activation of somatosensory feedback, which is not elicited in patients who have lost their sensorimotor function. In fact, it is unclear as to how much the HG component activated in S1 contributes to the overall sensorimotor HG power during voluntary movement. With regard to other functional roles of HG in S1, recent findings have reported that these HG power levels increase before the onset of actual movement, which implies neural activation for top-down movement preparation or sensorimotor interaction, i.e., an efference copy. These results are promising for BMI applications but remain inconclusive. Here, we found using electrocorticography (ECoG from eight patients that HG activation in S1 is stronger and more informative than it is in the primary motor cortex (M1 regardless of the type of movement. We also demonstrate by means of electromyography (EMG that the onset timing of the HG power in S1 is later (49 ms than that of the actual movement. Interestingly, we show that the HG power fluctuations in S1 are closely related to subtle muscle contractions, even during the pre-movement period. These results suggest the following: (1 movement-related HG activity in S1 strongly affects the overall sensorimotor HG power, and (2 HG activity in S1 during voluntary movement mainly represents cortical neural processing for somatosensory feedback.

  7. Effects of Chlorophenoxy Herbicides and Their Main Transformation Products on DNA Damage and Acetylcholinesterase Activity

    Science.gov (United States)

    Benfeito, Sofia; Silva, Tiago; Garrido, Jorge; Andrade, Paula B.; Sottomayor, M. J.; Borges, Fernanda; Garrido, E. Manuela

    2014-01-01

    Persistent pesticide transformation products (TPs) are increasingly being detected among different environmental compartments, including groundwater and surface water. However, there is no sufficient experimental data on their toxicological potential to assess the risk associated with TPs, even if their occurrence is known. In this study, the interaction of chlorophenoxy herbicides (MCPA, mecoprop, 2,4-D and dichlorprop) and their main transformation products with calf thymus DNA by UV-visible absorption spectroscopy has been assessed. Additionally, the toxicity of the chlorophenoxy herbicides and TPs was also assessed evaluating the inhibition of acetylcholinesterase activity. On the basis of the results found, it seems that AChE is not the main target of chlorophenoxy herbicides and their TPs. However, the results found showed that the transformation products displayed a higher inhibitory activity when compared with the parent herbicides. The results obtained in the DNA interaction studies showed, in general, a slight effect on the stability of the double helix. However, the data found for 4-chloro-2-methyl-6-nitrophenol suggest that this transformation product can interact with DNA through a noncovalent mode. PMID:24795892

  8. Effects of Chlorophenoxy Herbicides and Their Main Transformation Products on DNA Damage and Acetylcholinesterase Activity

    Directory of Open Access Journals (Sweden)

    Sofia Benfeito

    2014-01-01

    Full Text Available Persistent pesticide transformation products (TPs are increasingly being detected among different environmental compartments, including groundwater and surface water. However, there is no sufficient experimental data on their toxicological potential to assess the risk associated with TPs, even if their occurrence is known. In this study, the interaction of chlorophenoxy herbicides (MCPA, mecoprop, 2,4-D and dichlorprop and their main transformation products with calf thymus DNA by UV-visible absorption spectroscopy has been assessed. Additionally, the toxicity of the chlorophenoxy herbicides and TPs was also assessed evaluating the inhibition of acetylcholinesterase activity. On the basis of the results found, it seems that AChE is not the main target of chlorophenoxy herbicides and their TPs. However, the results found showed that the transformation products displayed a higher inhibitory activity when compared with the parent herbicides. The results obtained in the DNA interaction studies showed, in general, a slight effect on the stability of the double helix. However, the data found for 4-chloro-2-methyl-6-nitrophenol suggest that this transformation product can interact with DNA through a noncovalent mode.

  9. Effects of chlorophenoxy herbicides and their main transformation products on DNA damage and acetylcholinesterase activity.

    Science.gov (United States)

    Benfeito, Sofia; Silva, Tiago; Garrido, Jorge; Andrade, Paula B; Sottomayor, M J; Borges, Fernanda; Garrido, E Manuela

    2014-01-01

    Persistent pesticide transformation products (TPs) are increasingly being detected among different environmental compartments, including groundwater and surface water. However, there is no sufficient experimental data on their toxicological potential to assess the risk associated with TPs, even if their occurrence is known. In this study, the interaction of chlorophenoxy herbicides (MCPA, mecoprop, 2,4-D and dichlorprop) and their main transformation products with calf thymus DNA by UV-visible absorption spectroscopy has been assessed. Additionally, the toxicity of the chlorophenoxy herbicides and TPs was also assessed evaluating the inhibition of acetylcholinesterase activity. On the basis of the results found, it seems that AChE is not the main target of chlorophenoxy herbicides and their TPs. However, the results found showed that the transformation products displayed a higher inhibitory activity when compared with the parent herbicides. The results obtained in the DNA interaction studies showed, in general, a slight effect on the stability of the double helix. However, the data found for 4-chloro-2-methyl-6-nitrophenol suggest that this transformation product can interact with DNA through a noncovalent mode.

  10. The Daily Pattern of Main Activities in the Gelada Baboon (Theropithecus gelada

    Directory of Open Access Journals (Sweden)

    Radek Filipčík

    2014-01-01

    Full Text Available The aim of this work was to observe and analyse the main daily activities in the group of geladas kept in the Zlín Zoo. The experimental group was formed by three males (one of them was a dominant alfa male and four females who were in the reproductive cycle at the observation period. The behavioural study included five recurrent observations which took place in March 2014. The observations revealed that geladas spent most of the time feeding (44.1% and performing comfort behaviour (24.6%. About 7.7–10.4% of the total time the geladas spent moving, resting and observing the neighbourhoods. The settled and stable social hierarchy within the group prevented greater incidence (0.7% of aggressive behaviour. Occurrence of other types of activities was low – play (1.7%, climbing the trees (0.5% and sexual behaviour (2.3%. The work also studied how the incidence of a particular type of behaviour changed over time within the day. A certain pattern in behavioural activities was apparent because their incidence tended to be similar on all observation days. Foraging activities were the greatest (44.80 ± 3.64 observations between 15.00 and 16.00, resting (8.00–9.80 observations between 12.00 and 14.00 and comfort behaviour (23.20 ± 2.82 observations in the morning.

  11. On the neglect of causality principles in solar activity - climate relations.

    Science.gov (United States)

    Stauning, Peter

    2010-05-01

    Many research papers have claimed to demonstrate close relations between solar activity and the terrestrial climate. In most cases the relations have been based on comparisons between time series of solar activity parameters, for instance sunspot numbers, and climate parameters, for instance terrestrial temperatures. However, many of the reported close relations are based on skilfully manipulated data and neglect of basic causality principles. For cause-effect relations to be reliably established, the cause must obviously happen prior to the effects. Thus it is problematic to use, for instance, running averages of parameters if the result depends too much on posterior elements of the causative time series or precursory elements of the effects. Even more neglected are the causality principles for cause-effect relations with a strongly varying source function. Damping of source variations by smoothing data handling introduces additional implied delays, which should be considered in the judgement of apparent correlations between processed time series of cause and effect parameters. The presentation will discuss examples of frequently quoted solar activity-climate relations (e.g., by Reid, Friis-Christensen, and Svensmark), which violate basic causality principles.

  12. Presence of pharmaceutically active compounds in Doñana Park (Spain) main watersheds.

    Science.gov (United States)

    Camacho-Muñoz, M D; Santos, J L; Aparicio, I; Alonso, E

    2010-05-15

    Among the emerging environmental contaminants, pharmaceutically active compounds have become a growing public concern because of their potential to cause undesirable ecological and human health effects. Doñana Park (South of Spain) includes a mosaic of unique ecosystems known around the world which is particularly affected by the quality of the incoming flowing water. This study reports the presence of a number of priority pharmaceuticals in wastewater and surface water samples from Doñana watersheds. In general, ibuprofen, naproxen, salicylic acid, propranolol, caffeine and gemfibrozil were the compounds most frequently found in all locations, in the range of ng/L to microg/L. Carbamazepine, with high potential risk to the environment, was also detected, although only in a few water samples. The main results are: (i) pharmaceuticals, as water pollutants, are continually discharged into Doñana water bodies and, owing to their biological activity, could lead to adverse effects in this outstanding aquatic ecosystem; (ii) wastewater treatments implemented in the area are insufficient to remove pharmaceuticals; and (iii) therefore, there is a requirement for better wastewater treatments in this natural area to reduce or avoid the presence of organic pollutants in general and pharmaceutical active compounds in particular. To the best of our knowledge, these data constitute the first measurements of pharmaceutical compounds in water not only from the protected area of Doñana Park but also from other Natural or National Parks in the world. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  13. WISE/NEOWISE OBSERVATIONS OF ACTIVE BODIES IN THE MAIN BELT

    Energy Technology Data Exchange (ETDEWEB)

    Bauer, James M.; Mainzer, A. K.; Masiero, Joseph R.; Blauvelt, Erin K.; Cherry, De' Andre [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, MS 183-401, Pasadena, CA 91109 (United States); Grav, Tommy [Planetary Science Institute, 1700 East Fort Lowell, Suite 106, Tucson, AZ 85719-2395 (United States); Walker, Russell G. [Monterey Institute for Research in Astronomy, 200 Eighth Street, Marina, CA 93933 (United States); McMillan, Robert S.; Scotti, James V. [Lunar and Planetary Laboratory, University of Arizona, 1629 East University Boulevard, Kuiper Space Science Building 92, Tucson, AZ 85721-0092 (United States); Fernandez, Yan R.; Kramer, Emily [Department of Physics, University of Central Florida, 4000 Central Florida Boulevard, P.S. Building, Orlando, FL 32816-2385 (United States); Meech, Karen J.; Tholen, David J.; Riesen, Timm; Urban, Laurie; Khayat, Alain [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Manoa, HI 96822 (United States); Lisse, Carey M. [Applied Physics Laboratory, Johns Hopkins University, 11100 Johns Hopkins Road, Laurel, MD 20723-6099 (United States); Cutri, Roc M.; Dailey, John W.; Pearman, George, E-mail: bauer@scn.jpl.nasa.gov [Infrared Processing and Analysis Center, California Institute of Technology, Pasadena, CA 91125 (United States); Collaboration: WISE Team; and others

    2012-03-01

    We report results based on mid-infrared photometry of five active main belt objects (AMBOs) detected by the Wide-field Infrared Survey Explorer (WISE) spacecraft. Four of these bodies, P/2010 R2 (La Sagra), 133P/Elst-Pizarro, (596) Scheila, and 176P/LINEAR, showed no signs of activity at the time of the observations, allowing the WISE detections to place firm constraints on their diameters and albedos. Geometric albedos were in the range of a few percent, and on the order of other measured comet nuclei. P/2010 A2 was observed on 2010 April 2-3, three months after its peak activity. Photometry of the coma at 12 and 22 {mu}m combined with ground-based visible-wavelength measurements provides constraints on the dust particle mass distribution (PMD), dlog n/dlog m, yielding power-law slope values of {alpha} = -0.5 {+-} 0.1. This PMD is considerably more shallow than that found for other comets, in particular inbound particle fluence during the Stardust encounter of comet 81P/Wild 2. It is similar to the PMD seen for 9P/Tempel 1 in the immediate aftermath of the Deep Impact experiment. Upper limits for CO{sub 2} and CO production are also provided for each AMBO and compared with revised production numbers for WISE observations of 103P/Hartley 2.

  14. Identification of the main active ingredients of agrochemicals used around the Lake of Tota, Colombia

    Directory of Open Access Journals (Sweden)

    Wilson Javier Pérez-Holguín

    2016-01-01

    Full Text Available This paper presents a descriptive study aimed at identifying the main active ingredients, frequency of use, and the processes employed in the application of the agrochemicals most used around the Lake of Tota, which is considered the most important freshwater ecosystem in Colombia. A key source for this study is a survey to farmers, which sampling frame was established from a Geographical Institute Agustin Codazzi (IGAC digital map, considering only the plots with some agricultural activity and runoff into the lake. This information was supplemented with geographic data obtained from Google Maps®. As control mechanism, two additional sources were used: i a manual count of packaging of agrochemicals in a certified collection center, and ii a census of stores that supply such products in the study area. The results allow knowing the set of agrochemicals most used around the lake, their active ingredients, and the most common farming practices, some of which could entail some risk to farmers, consumers and the environment.

  15. WISE/NEOWISE observations of Active Bodies in the Main Belt

    CERN Document Server

    Bauer, James M; Grav, Tommy; Walker, Russell G; Masiero, Joseph R; Blauvelt, Erin K; McMillan, Robert S; Fernández, Yan R; Meech, Karen J; Lisse, Carey M; Cutri, Roc M; Dailey, John W; Tholen, David J; Riesen, Timm; Urban, Laurie; Khayat, Alain; Pearman, George; Scotti, James V; Kramer, Emily; Cherry, De'Andre; Gautier, Thomas; Gomillion, Stephanie; Watkins, Jessica; Wright, Edward L

    2011-01-01

    We report results based on mid-infrared photometry of 5 active main belt objects (AMBOs) detected by the Wide-field Infrared Survey Explorer (WISE) spacecraft. Four of these bodies, P/2010 R2 (La Sagra), 133P/Elst-Pizarro, (596) Scheila, and 176P/LINEAR, showed no signs of activity at the time of the observations, allowing the WISE detections to place firm constraints on their diameters and albedos. Geometric albedos were in the range of a few percent, and on the order of other measured comet nuclei. P/2010 A2 was observed on April 2-3, 2010, three months after its peak activity. Photometry of the coma at 12 and 22 {\\mu}m combined with ground-based visible-wavelength measurements provides constraints on the dust particle mass distribution (PMD), dlogn/dlogm, yielding power-law slope values of {\\alpha} = -0.5 +/- 0.1. This PMD is considerably more shallow than that found for other comets, in particular inbound particle fluence during the Stardust encounter of comet 81P/Wild 2. It is similar to the PMD seen for...

  16. ACTIVITY-BASED PRINCIPLE IMPLEMENTATION IN THE METHODOLOGICAL CONCEPT OF N. E. JERGANOVA

    Directory of Open Access Journals (Sweden)

    N. K. Chapaev

    2016-01-01

    Full Text Available The aim of the publication is a philosophical-pedagogical conceptualization and the discovery of the mechanism of application of the principle while solving problems of program-methodological support of vocational education on the basis of summarizing the scientific heritage of N. E. Jerganova.Methods. The research is based on the hermeneutic methodology. The leading methods of analysis are the following: interpretation, conceptualization, understanding, as well as analysis, comparing, contrasting, synthesis, generalization.Results. Based on the analysis of the texts of the works of N. E. Jerganova, interpretational model of actualization principle of activity in developing methods of professional education is developed. According to this model, personal and professional development of man is attained primarily due to the actualization of his/her intellectual and creative potential, turning it into relatively self-sufficient entity of educational activity.Scientific novelty. Philosophical-methodological foundations and technological tools of the application of the principle activities in the process of problem solving of software and methodological support of professional education are disclosed; the expediency of development of activity-based strategy of professional education in modern conditions is proved.Practical significance. The thesis and conclusions of the article can be used in the development of the modern concept of methodological activities, in the process of program-methodological support of educational activity in professional education organizations.

  17. The Discovery of Solar-like Activity Cycles Beyond the End of the Main Sequence?

    CERN Document Server

    Route, Matthew

    2016-01-01

    The long-term magnetic behavior of objects near the cooler end of the stellar main sequence is poorly understood. Most theoretical work on the generation of magnetism in these ultracool dwarfs (spectral type >=M7 stars and brown dwarfs) suggests that their magnetic fields should not change in strength and direction. Using polarized radio emission measurements of their magnetic field orientations, I demonstrate that these cool, low-mass, fully-convective objects appear to undergo magnetic polarity reversals analogous to those that occur on the Sun. This powerful new technique potentially indicates that the patterns of magnetic activity displayed by the Sun continue to exist, despite the fully convective interiors of these objects, in contravention of several leading theories of the generation of magnetic fields by internal dynamos.

  18. Screening for antibacterial principle and activity of Aerva javanica (Burm .f) Juss. ex Schult.

    Institute of Scientific and Technical Information of China (English)

    P Srinivas; S Ram Reddy

    2012-01-01

    Objective: To investigate the antibacterial principle and activity of Aerva javanica, a medicinal plant. Methods: Crude extracts of different parts of Aerva javanica were made with hexane, chloroform and methanol. Phytochemical analysis of the crude extracts was done by following the standard methodology, and antibacterial activity was evaluated by inhibition zone and MIC values. Crude extracts were resolved through HPTLC and the antibacterial activity of the separated compounds was evaluated by bioautography. Results: The yields of crude extracts made from different plant parts varied both with plant part and solvent. Methanolic extracts of leaf and flower have shown a wide range of phytochemicals and more antibacterial activity. HPTLC separation of extracts coupled with bioautography studies revealed that apigenin followed by rutin and kaempferol has shown antibacterial activity against more number of bacteria. Conclusions:The present study supports the use of Aerva javanica in the traditional medicine, and it can be used against bacterial infections.

  19. Identification and quantification of the main active anticancer alkaloids from the root of Glaucium flavum.

    Science.gov (United States)

    Bournine, Lamine; Bensalem, Sihem; Wauters, Jean-Noël; Iguer-Ouada, Mokrane; Maiza-Benabdesselam, Fadila; Bedjou, Fatiha; Castronovo, Vincent; Bellahcène, Akeila; Tits, Monique; Frédérich, Michel

    2013-12-02

    Glaucium flavum is used in Algerian folk medicine to remove warts (benign tumors). Its local appellations are Cheqiq el-asfar and Qarn el-djedyane. We have recently reported the anti-tumoral activity of Glaucium flavum root alkaloid extract against human cancer cells, in vitro and in vivo. The principal identified alkaloid in the extract was protopine. This study aims to determine which component(s) of Glaucium flavum root extract might possess potent antitumor activity on human cancer cells. Quantitative estimation of Glaucium flavum alkaloids was realized by HPLC-DAD. Glaucium flavum effect on human normal and cancer cell viability was determined using WST-1 assay. Quantification of alkaloids in Glaucium flavum revealed that the dried root part contained 0.84% of protopine and 0.07% of bocconoline (w/w), while the dried aerial part contained only 0.08% of protopine, glaucine as the main alkaloid, and no bocconoline. In vitro evaluation of the growth inhibitory activity on breast cancer and normal cells demonstrated that purified protopine did not reproduce the full cytotoxic activity of the alkaloid root extract on cancer cell lines. On the other hand, bocconoline inhibited strongly the viability of cancer cells with an IC50 of 7.8 µM and only a low cytotoxic effect was observed against normal human cells. Our results showed for the first time that protopine is the major root alkaloid of Glaucium flavum. Finally, we are the first to demonstrate a specific anticancer effect of Glaucium flavum root extract against breast cancer cells, which can be attributed, at least in part, to bocconoline.

  20. Identification and Quantification of the Main Active Anticancer Alkaloids from the Root of Glaucium flavum

    Directory of Open Access Journals (Sweden)

    Lamine Bournine

    2013-12-01

    Full Text Available Glaucium flavum is used in Algerian folk medicine to remove warts (benign tumors. Its local appellations are Cheqiq el-asfar and Qarn el-djedyane. We have recently reported the anti-tumoral activity of Glaucium flavum root alkaloid extract against human cancer cells, in vitro and in vivo. The principal identified alkaloid in the extract was protopine. This study aims to determine which component(s of Glaucium flavum root extract might possess potent antitumor activity on human cancer cells. Quantitative estimation of Glaucium flavum alkaloids was realized by HPLC-DAD. Glaucium flavum effect on human normal and cancer cell viability was determined using WST-1 assay. Quantification of alkaloids in Glaucium flavum revealed that the dried root part contained 0.84% of protopine and 0.07% of bocconoline (w/w, while the dried aerial part contained only 0.08% of protopine, glaucine as the main alkaloid, and no bocconoline. In vitro evaluation of the growth inhibitory activity on breast cancer and normal cells demonstrated that purified protopine did not reproduce the full cytotoxic activity of the alkaloid root extract on cancer cell lines. On the other hand, bocconoline inhibited strongly the viability of cancer cells with an IC50 of 7.8 µM and only a low cytotoxic effect was observed against normal human cells. Our results showed for the first time that protopine is the major root alkaloid of Glaucium flavum. Finally, we are the first to demonstrate a specific anticancer effect of Glaucium flavum root extract against breast cancer cells, which can be attributed, at least in part, to bocconoline.

  1. Principles for microscale separations based on redox-active surfactants and electrochemical methods.

    Science.gov (United States)

    Rosslee, C A; Abbott, N L

    2001-10-15

    We report principles for microscale separations based on selective solubilization and deposition of sparingly water-soluble compounds by an aqueous solution of a redox-active surfactant. The surfactant, (11-ferrocenylundecyl)trimethylammonium bromide, undergoes a reversible change in micellization upon oxidation or reduction. This change in aggregation is exploited in a general scheme in which micelles of reduced surfactant are formed and then put in contact with a mixture of hydrophobic compounds leading to selective solubilization of the compounds. The micelles are then electrochemically disrupted, leading to the selective deposition of their contents. We measured the selectivity of the solubilization and deposition processes using mixtures of two model drug-like compounds, o-tolueneazo-beta-naphthol (I) and 1-phenylazo-2-naphthylamine (II). By repeatedly solubilizing and depositing a mixture that initially contained equal mole fractions of each compound, we demonstrate formation of a product that contains 98.4% of I after six cycles. Because the aggregation states of redox-active surfactants are easily controlled within simple microfabricated structures, including structures that define small stationary volumes (e.g., wells of a microtiter plate) or flowing volumes of liquids (e.g., microfabricated channels), we believe these principles may be useful for the purification or analysis of compounds in microscale chemical process systems. When used for purification, these principles provide separation of surfactant and product.

  2. Antibacterial activity and anticancer activity of Rosmarinus officinalis L. essential oil compared to that of its main components.

    Science.gov (United States)

    Wang, Wei; Li, Nan; Luo, Meng; Zu, Yuangang; Efferth, Thomas

    2012-03-05

    In this study, Rosmarinus officinalis L. essential oil and three of its main components 1,8-cineole (27.23%), α-pinene (19.43%) and β-pinene (6.71%) were evaluated for their in vitro antibacterial activities and toxicology properties. R. officinalis L. essential oil possessed similar antibacterial activities to α-pinene, and a little bit better than β-pinene, while 1,8-cineole possessed the lowest antibacterial activities. R. officinalis L. essential oil exhibited the strongest cytotoxicity towards three human cancer cells. Its inhibition concentration 50% (IC₅₀) values on SK-OV-3, HO-8910 and Bel-7402 were 0.025‰, 0.076‰ and 0.13‰ (v/v), respectively. The cytotoxicity of all the test samples on SK-OV-3 was significantly stronger than on HO-8910 and Bel-7402. In general, R. officinalis L. essential oil showed greater activity than its components in both antibacterial and anticancer test systems, and the activities were mostly related to their concentrations.

  3. Supporting Teachers in Designing CSCL Activities: A Case Study of Principle-Based Pedagogical Patterns in Networked Second Language Classrooms

    Science.gov (United States)

    Wen, Yun; Looi, Chee-Kit; Chen, Wenli

    2012-01-01

    This paper proposes the identification and use of principle-based pedagogical patterns to help teachers to translate design principles into actionable teaching activities, and to scaffold student learning with sufficient flexibility and creativity. A set of pedagogical patterns for networked Second language (L2) learning, categorized and…

  4. The Operating Principle of a Fully Solid State Active Magnetic Regenerator

    Energy Technology Data Exchange (ETDEWEB)

    Abdelaziz, Omar [ORNL

    2016-01-01

    As an alternative refrigeration technology, magnetocaloric refrigeration has the potential to be safer, quieter, more efficient, and more environmentally friendly than the conventional vapor compression refrigeration technology. Most of the reported active magnetic regenerator (AMR) systems that operate based on the magnetocaloric effect use heat transfer fluid to exchange heat, which results in complicated mechanical subsystems and components such as rotating valves and hydraulic pumps. This paper presents an operating principle of a fully solid state AMR, in which an alternative mechanism for heat transfer between the AMR and the heat source/sink is proposed. The operating principle of the fully solid state AMR is based on moving rods/sheets (e.g. copper, brass, iron or aluminum), which are employed to replace the heat transfer fluid. Such fully solid state AMR would provide a significantly higher heat transfer rate than a conventional AMR because the conductivity of moving solid rods/plates is high and it enables the increase in the machine operating frequency hence the cooling capacity. The details of operating principle are presented and discussed here. One of the key enabling features for this technology is the contact between the moving rods/sheets and magnetocaloric material, and heat exchange mechanism at the heat source/sink. This paper provides an overview of the design for a fully solid state magnetocaloric refrigeration system along with guidelines for their optimal design.

  5. CLIC main beam quadrupole active pre-alignment based on cam movers

    CERN Document Server

    Kemppinen, J; Leuxe, R; Mainaud Durand, H; Sandomierski, J; Sosin, M

    2012-01-01

    Compact Linear Collider (CLIC) is a study for a future 48 km long linear electron-positron collider in the multi TeV range. Its target luminosity can only be reached if the main beam quadrupoles (MB quads) are actively pre-aligned within 17 µm in sliding windows of 200 m with respect to a straight reference line. In addition to the positioning requirement, the pre-alignment system has to provide a rigid support for the nano-stabilization system to ensure that the first eigenfrequency is above 100 Hz. Re-adjustment based on cam movers was chosen for detailed studies to meet the stringent pre-alignment requirements. There are four different types of MB quads in CLIC. Their lengths and masses vary so that at least two types of cam movers have to be developed. The validation of the cams with less stringent space restrictions has proceeded to a test setup in 5 degrees of freedom (DOF). Prototypes of the more demanding, smaller cams have been manufactured and they are under tests in 1 DOF. This paper describes the...

  6. Nerolidol, the main constituent of Piper aduncum essential oil, has anti-Leishmania braziliensis activity.

    Science.gov (United States)

    Ceole, Ligia Fernanda; Cardoso, Maria DAS Graças; Soares, Maurilio José

    2017-08-01

    Leishmania (Viannia) braziliensis is a protozoan that causes mucocutaneous leishmaniasis, which is an infectious disease that affects more than 12 million people worldwide. The available treatment is limited, has side-effects or is inefficient. In a search for alternative compounds of natural origin, we tested the microbicidal activity of Piper aduncum essential oil (PaEO) on this parasite. Our data showed that PaEO had an inhibitory effect on the growth of L. braziliensis promastigotes with an IC50/24 h=77·9 µg mL-1. The main constituent (nerolidol: 25·22%) presented a similar inhibitory effect (IC50/24 h = 74·3 µg mL-1). Ultrastructural observation of nerolidol-treated parasites by scanning and transmission electron microscopies revealed cell shrinkage and morphological alterations in the mitochondrion, nuclear chromatin and flagellar pocket. Flow cytometry analysis showed a reduction in the cell size, loss of mitochondrial membrane potential, phosphatidylserine exposure and DNA degradation, which when associated with the morphological changes indicated that nerolidol induced incidental cell death in the L. braziliensis promastigotes. The results presented here indicate that nerolidol derivatives are promising compounds for further evaluation against Leishmania parasites.

  7. Magnetic Activity Analysis for a Sample of G-type Main Sequence Kepler Targets

    Science.gov (United States)

    Mehrabi, Ahmad; He, Han; Khosroshahi, Habib

    2017-01-01

    The variation of a stellar light curve owing to rotational modulation by magnetic features (starspots and faculae) on the star’s surface can be used to investigate the magnetic properties of the host star. In this paper, we use the periodicity and magnitude of the light-curve variation as two proxies to study the stellar magnetic properties for a large sample of G-type main sequence Kepler targets, for which the rotation periods were recently determined. By analyzing the correlation between the two magnetic proxies, it is found that: (1) the two proxies are positively correlated for most of the stars in our sample, and the percentages of negative, zero, and positive correlations are 4.27%, 6.81%, and 88.91%, respectively; (2) negative correlation stars cannot have a large magnitude of light-curve variation; and (3) with the increase of rotation period, the relative number of positive correlation stars decreases and the negative correlation one increases. These results indicate that stars with shorter rotation period tend to have positive correlation between the two proxies, and a good portion of the positive correlation stars have a larger magnitude of light-curve variation (and hence more intense magnetic activities) than negative correlation stars.

  8. Active materials for adaptive architectural envelopes based on plant adaptation principles

    Directory of Open Access Journals (Sweden)

    Marlen Lopez

    2015-06-01

    Full Text Available In this paper, the authors present research into adaptive architectural envelopes that adapt to environmental changes using active materials, as a result of application of biomimetic principles from plants to architecture. Buildings use large amounts of energy in order to maintain their internal comfort, because conventional buildings are designed to provide a static design solution. Most of the current solutions for facades are not designed for optimum adaptation to contextual issues and needs, while biological solutions to adaptation are often complex, multi-functional and highly responsive. We focus on plant adaptations to the environment, as, due to their immobility, they have developed special means of protection against weather changing conditions. Furthermore, recent developments in new technologies are allowing the possibility to transfer these plant adaptation strategies to technical implementation. These technologies include: multi-material 3D printing, advances in materials science and new capabilities in simulation software. Unlike traditional mechanical activation used for dynamic systems in kinetic facades, adaptive architectural envelopes require no complex electronics, sensors, or actuators. The paper proposes a research of the relationship that can be developed between active materials and environmental issues in order to propose innovative and low-tech design strategies to achieve living envelopes according to plant adaptation principles.  

  9. The Design Principles of Micro-Video Production and In-Class Activi-ties on the Base of Flipped Classroom

    Institute of Scientific and Technical Information of China (English)

    谢盟梦

    2016-01-01

    Flipped classroom is a brand-new teaching mode both at home and abroad. Its core is to reverse teaching sequence and teaching content by letting students watch self-made videos to learn relatively junior teaching content before class, thus leaving students adequate space to exert full activities in the classroom to complete knowledge absorption and consolidation. This article focus mainly on the design principles and relevant experiences of video production. In the meanwhile, the article also puts for-ward instructive suggestions for teachers to make appealing and stylistic videos as well as mobilize the enthusiasm of students. Video as the stepping stone only serves as a media to convey knowledge before class, the class is the core to convert students’ traditional role to be the real master by a series of effective activities, which should be carefully designed by teachers. So the sec-ond focus of the articles falls on the design principles of in-class activities.

  10. The Spanish Society of Soil Science: Main projects and activities developed during the last years

    Science.gov (United States)

    Porta, Jaume; Mataix-Solera, Jorge; Ortiz-Bernad, Irene; Arbelo, Carmen D.; Díaz-Raviña, Montserrat; Badía, David; Alcañiz, Josep M.; Santos, Fernando; Hermosin, M. Carmen; Barral, M. Teresa

    2017-04-01

    del Suelo (SLCS, Quito, 2016) and other activities, such as incentives for young students, are also some of the strategies to promote the soil, together with an annual award to the best PhD thesis supervised by SECS members. These and other examples will be shown during the session with the main aim of exchanging ideas among soil societies to promote the soil. Access in www.secs.com.es. Acknowledgements: to the members of the Spanish Society of Soil Science.

  11. Antimicrobial effect of Calotropis procera active principles against aquatic microbial pathogens isolated from shrimp and fishes

    Institute of Scientific and Technical Information of China (English)

    Subramanian Velmurugan; Vijayaragavan Thanga Viji; Mariavincent Michael Babu; Mary Josephine Punitha; Thavasimuthu Citarasu

    2012-01-01

    Objective: To study the influence of Calotropis procera (C. procera) active principles against aquatic microbial pathogens isolated from shrimp and fishes. Methods: C. procera leaf powder was serially extracted with hexane, ethyl acetate and methanol and screened by antibacterial, antifungal and antiviral activity against aquatic pathogens which isolated from shrimp/fish. After initial screening, the active extract was purified through column chromatography and again screened. Finally the active fractions were characterized by phytochemical analysis and GC-MS analysis. Results: In vitro antibacterial, antifungal and antiviral screening revealed that, the ethyl acetate extracts were effectively suppressed the bacterial pathogens Pseudomonas aeruginosa (P. aeruginosa), Vibrio harveyi (V. harveyi) and Aeromons hydrophila (A. hydrophila) of more than 20 mm zone of inhibition; the fungi Fusarium sp and the killer virus WSSV. The ethyl acetate extracts of C. procera incubated WSSV was failed to multiply its progeny in the in vivo system of shrimp P. monodon. The shrimp had 80% survival after WSSV challenge from the control group significantly (P<0.001) and also PCR detection confirmed that no WSSV transcription found in shrimp haemolymph. After purified the ethyl acetate extracts again antimicrobial screening performed and it concluded that the fraction namely F-II was effectively suppressed the bacterial growth and WSSV due to its enriched active principles such as cardiac glycosides, Phenols, alkaloids, Tannin and quinines. Surprisingly this fraction, F-II was effectively controlled the WSSV at 90% level at a highest significant level (P<0.001). Finally the structural characterization by GC-MS analysis revealed that, the F-II fraction contained Phenols including several other compounds such as 2,4-bis(1,1-dimethylethyl)-, Methyl tetradecanoate, Bicyclo[3.1.1] heptane, 2,6,6-trimethyl-, (1α,2β,5α)-and Hexadecanoic acid etc. Conclusions: The present study revealed

  12. A Brief Discussion on the Principles and Main Points of Restaurant Space Division%浅析餐厅空间规划原则及要点

    Institute of Scientific and Technical Information of China (English)

    周燕琼; 付元伟

    2015-01-01

    Concerning how to reasonably set each functional area in the restaurant space, this article sums up the principles and key points of spatial planning in the restaurant space. According to customers' behavior psychology, this paper analyzes some is-sues that should be avoided in the seat area. For designers, a rea-sonable and orderly combination of the limited interior space and a knowledge of the basic rule of restaurant space division can help them design a better restaurant space that meets the needs of customers.%对于餐厅空间的规划,如何合理设置每个功能区域?本文概括了常见的餐厅空间规划原则,以及空间布置的一些要点,从顾客的行为心理出发,分析了座位区域应该避免的一些问题。对于设计师来说,合理有序地组合好有限的室内空间,了解餐厅空间规划的基本规律,可以更好地设计出符合顾客需要的餐厅空间。

  13. Pharmaceutical gel analysis by NIR spectroscopy. Determination of the active principle and low concentration of preservatives.

    Science.gov (United States)

    Blanco, M; Alcalá, M; Bautista, M

    2008-04-23

    Near infrared spectroscopy has proved highly suitable for the analysis of pharmaceutical formulations. However, its limited sensitivity can severely restrict its scope of application. In this work, we determine the active principle and two preservatives in a pharmaceutical preparation available as a hydrogel. The matrix of the pharmaceutical preparation exhibits strong absorption in the NIR spectral region; also, the two preservatives (parabens) are very similar in chemical and spectral terms, and present at low concentrations in the pharmaceutical. These complications make it rather difficult to accurately quantify the active principle and the preservatives, which can only be accomplished by using an effective design in order to prepare the samples to be included in the calibration set and select the optimum spectral range for measuring each analyte. The evaporation of solvents during the measurement process produces increasing errors related with sample's air exposition; the introductions of new samples with a wider range of the volatile components correct this effect. An ANOVA of the predictions obtained with the new models shows that correct the error due to evaporation. The proposed method was validated for the analytical control of the studied preparation.

  14. Activating Mg acceptors in AlN by oxygen: first principles calculations

    CERN Document Server

    Wu, R Q

    2007-01-01

    First principles calculations based on density functional theory (DFT) are performed to study the electronic properties of Mg acceptors in AlN at the presence of oxygen. It is found that Mg and O tend to form complexes like Mg-O, Mg$_2$-O, Mg$_3$-O and Mg$_4$-O which have activation energies about 0.23 eV lower than that of Mg (except of the passive Mg-O). The lower activation energies originate from the extra states over valence band top of AlN induced by the passive Mg-O. By comparing to the well-established case of GaN, it is possible to fabricate Mg and O codoped AlN without MgO precipitate. These results suggest the possibility of achieving higher hole concentration in AlN by Mg and O codoping.

  15. Principle Component Analysis of Birkeland Currents Determined by the Active Magnetosphere and Planetary Electrodynamics Response Experiment

    Science.gov (United States)

    Milan, S. E.; Carter, J. A.; Korth, H.; Anderson, B. J.

    2015-12-01

    Principle Component Analysis is performed on northern and southern hemisphere Birkeland or field-aligned current (FAC) measurements from the Active Magnetosphere and Planetary Electrodynamics Response Experiment (AMPERE). PCA identifies the patterns in the FACs that respond coherently to different aspects of geomagnetic activity. The region 1 and 2 current system is shown to be the most reproducible feature of the currents, followed by cusp currents associated with magnetic tension forces on newly-reconnected field lines. The cusp currents are strongly modulated by season, indicating that their strength is regulated by the ionospheric conductance at the foot of the field lines. PCA does not identify a pattern that is clearly characteristic of a substorm current wedge. Rather, a superposed epoch analysis of the currents associated with substorms demonstrates that there is not a single mode of response, but a complicated and subtle mixture of different patterns. Other interhemispheric differences are discussed.

  16. First-Principles Study of Photochemical Activation of CO2 by Ti-based Oxides

    Science.gov (United States)

    He, Haiying; Zapol, Peter; Curtiss, Larry

    2013-03-01

    The photochemical conversion of CO2 and H2O into energy-bearing hydrocarbon fuels provides an attractive way of mitigating the green-house gas CO2 and utilizing solar energy as a sustainable energy source. However, due to the high reduction potential and chemical inertness of CO2 molecules, the conversion rate of CO2 is impractically low. The activation of CO2 is critical in facilitating further reactions. By carrying out first-principles calculations of reaction pathways from CO2 to CO2-anions on Ti-based oxides including zeolites in the presence of photoexcited electrons, we have studied the initial step of CO2 activation via 1e transfer. It is shown that the CO2 reactivity of these surfaces strongly depends on the crystal structure, surface orientation, and presence of defects. This opens a new dimension in surface structure modification to enhance the CO2 adsorption and reduction on semiconductor surfaces.

  17. QSAR prediction of estrogen activity for a large set of diverse chemicals under the guidance of OECD principles.

    Science.gov (United States)

    Liu, Huanxiang; Papa, Ester; Gramatica, Paola

    2006-11-01

    A large number of environmental chemicals, known as endocrine-disrupting chemicals, are suspected of disrupting endocrine functions by mimicking or antagonizing natural hormones, and such chemicals may pose a serious threat to the health of humans and wildlife. They are thought to act through a variety of mechanisms, mainly estrogen-receptor-mediated mechanisms of toxicity. However, it is practically impossible to perform thorough toxicological tests on all potential xenoestrogens, and thus, the quantitative structure--activity relationship (QSAR) provides a promising method for the estimation of a compound's estrogenic activity. Here, QSAR models of the estrogen receptor binding affinity of a large data set of heterogeneous chemicals have been built using theoretical molecular descriptors, giving full consideration to the new OECD principles in regulation for QSAR acceptability, during model construction and assessment. An unambiguous multiple linear regression (MLR) algorithm was used to build the models, and model predictive ability was validated by both internal and external validation. The applicability domain was checked by the leverage approach to verify prediction reliability. The results obtained using several validation paths indicate that the proposed QSAR model is robust and satisfactory, and can provide a feasible and practical tool for the rapid screening of the estrogen activity of organic compounds.

  18. Nisin as a Food Preservative: Part 1: Physicochemical Properties, Antimicrobial Activity, and Main Uses.

    Science.gov (United States)

    Gharsallaoui, Adem; Oulahal, Nadia; Joly, Catherine; Degraeve, Pascal

    2016-06-10

    Nisin is a natural preservative for many food products. This bacteriocin is mainly used in dairy and meat products. Nisin inhibits pathogenic food borne bacteria such as Listeria monocytogenes and many other Gram-positive food spoilage microorganisms. Nisin can be used alone or in combination with other preservatives or also with several physical treatments. This paper reviews physicochemical and biological properties of nisin, the main factors affecting its antimicrobial effectiveness, and its food applications as an additive directly incorporated into food matrices.

  19. Final Report: Main Group Element Chemistry in Service of Hydrogen Storage and Activation

    Energy Technology Data Exchange (ETDEWEB)

    David A. Dixon; Anthony J. Arduengo, III

    2010-09-30

    goal was met in terms of reducing the number of costly experiments and helping to focus the experimental effort on the potentially optimal targets. We have used computational chemistry approaches to predict the thermodynamic properties of a wide range of compounds containing boron, nitrogen, hydrogen, and other elements as appropriate including carbon. These calculations were done in most cases with high level molecular orbital theory methods that have small error bars on the order of ± 1 to 2 kcal/mol. The results were used to benchmark more approximate methods such as density functional theory for larger systems and for database development. We predicted reliable thermodynamics for thousands of compounds for release and regeneration schemes to aid/guide materials design and process design and simulation. These are the first reliable computed values for these compounds and for many represent the only available values. Overall, the computational results have provided us with new insights into the chemistry of main group and organic-base chemical hydrogen systems from the release of hydrogen to the regeneration of spent fuel. A number of experimental accomplishments were also made in this project. The experimental work on hydrogen storage materials centered on activated polarized σ- or π-bonded frameworks that hold the potential for ready dihydrogen activation, uptake, and eventually release. To this end, a large number of non-traditional valence systems including carbenes, cyanocarbons, and C-B and and B-N systems were synthesized and examined. During the course of these studies an important lead arose from the novel valency of a class of stable organic singlet bi-radical systems. A synthetic strategy to an “endless” hydrogen storage polymer has been developed based on our cyanocarbon chemistry. A key issue with the synthetic efforts was being able to link the kinetics of release with the size of the substituents as it was difficult to develop a low molecular

  20. Determination of antioxidant activity of spices and their active principles by differential pulse voltammetry.

    Science.gov (United States)

    Palma, Alberto; Ruiz Montoya, Mercedes; Arteaga, Jesús F; Rodríguez Mellado, Jose M

    2014-01-22

    The anodic oxidation of mercury in the presence of hydrogen peroxide in differential pulse voltammetry (DPV) was used to determine the antioxidant (AO) character of radical scavengers. Hydroperoxide radical is formed at the potentials of the oxidation peak on mercury electrodes, such radical reacting with the antioxidants in different extension. The parameter C10 (antioxidant concentration at which the peak area decreases by 10%) is used to measure the scavenging activity of the individual antioxidants. To establish the scavenging activity of antioxidant mixtures as a whole, the parameter, μ10 as the reverse of V10, V10 being the volume necessary to decrease the peak area in DPV by 10%, was selected. Higher μ10 values correspond to higher scavenging activity. The studies have been extended to aqueous extracts of some species. The results may be useful in explaining the effect of spices in vitro and in vivo studies.

  1. Antifeedant activity of ethanolic extract from Flourensia oolepis and isolation of pinocembrin as its active principle compound.

    Science.gov (United States)

    Diaz Napal, Georgina N; Carpinella, María C; Palacios, Sara M

    2009-07-01

    The ethanolic extract from Flourensia oolepis aerial parts showed strong antifeedant activity against the pest larvae, Epilachna paenulata, with an antifeedant index (AI%) of 99.1% at 100 microg/cm(2). Based on chromatographic fractionation of the extract, guided by bioassays on E. paenulata, the flavanone pinocembrin (1) was isolated as the most active principle. In a choice assay, compound 1 showed strong antifeedant activity against E. paenulata, Xanthogaleruca luteola and Spodoptera frugiperda with an AI% of 90, 94 and 91% (p<0.01) respectively, at 50 microg/cm(2). The dosages necessary for 50% feeding inhibition of the insects (ED(50)) were 7.98, 6.13 and 8.86 microg/cm(2), respectively. The feeding inhibitory activity of 1 against E. paenulata was compared with the activity of other structurally related flavonoids like naringenin, which was inactive up to 100 microg/cm(2), catechin which was nearly 6 times less active than 1, and quercetin which was equally active as 1. The effect of these on the feeding behavior of E. paenulata was also studied.

  2. Anti-hyperglycaemic and antioxidant effects of Bidens tripartita and quantitative analysis on its active principles

    Science.gov (United States)

    Orhan, Nilüfer; İçöz, Ülkü Gökçen; Altun, Levent; Aslan, Mustafa

    2016-01-01

    Objective(s): Bidens species are used for their antidiabetic properties traditionally in many countries. Aim of this study is to evaluate hypoglycaemic and antidiabetic activity of Bidens tripartita extract and to identify its active compounds through bioactivity guided isolation technique. Materials and Methods: Hypoglycaemic effects of B. tripartita extract and its sub-extracts were investigated in normal and glucose-hyperglycaemic rats. Streptozotocin induced diabetic rats were used to examine antidiabetic activity of the extract and its sub-extracts after acute and sub-acute administration. Additionally, in vitro enzyme inhibitory and antioxidant activities were evaluated. HPLC analyses were carried out to determine the active constituents of the extract and its sub-extracts. Results: Through in vivo bioactivity-guided fractionation process, ethyl acetate and n-buthanol sub-extracts were found to have potent antidiabetic activity. In vitro enzyme inhibitory activities of the same sub-extracts were found to be potent. The highest total phenol, flavonoid contents and radical scavenging activity was determined in ethyl acetate sub-extract. According to LC-MS analyses, chlorogenic acid, luteolin and 7-O-glucoside of luteolin (cynaroside) were determined as the main components of the active sub-extracts. Conclusion: According to our results, B. tripartita has potent antidiabetic activity and its active constituents might be beneficial for diabetes and its complications. PMID:27872708

  3. Final Report: Main Group Element Chemistry in Service of Hydrogen Storage and Activation

    Energy Technology Data Exchange (ETDEWEB)

    David A. Dixon; Anthony J. Arduengo, III

    2010-09-30

    goal was met in terms of reducing the number of costly experiments and helping to focus the experimental effort on the potentially optimal targets. We have used computational chemistry approaches to predict the thermodynamic properties of a wide range of compounds containing boron, nitrogen, hydrogen, and other elements as appropriate including carbon. These calculations were done in most cases with high level molecular orbital theory methods that have small error bars on the order of ± 1 to 2 kcal/mol. The results were used to benchmark more approximate methods such as density functional theory for larger systems and for database development. We predicted reliable thermodynamics for thousands of compounds for release and regeneration schemes to aid/guide materials design and process design and simulation. These are the first reliable computed values for these compounds and for many represent the only available values. Overall, the computational results have provided us with new insights into the chemistry of main group and organic-base chemical hydrogen systems from the release of hydrogen to the regeneration of spent fuel. A number of experimental accomplishments were also made in this project. The experimental work on hydrogen storage materials centered on activated polarized σ- or π-bonded frameworks that hold the potential for ready dihydrogen activation, uptake, and eventually release. To this end, a large number of non-traditional valence systems including carbenes, cyanocarbons, and C-B and and B-N systems were synthesized and examined. During the course of these studies an important lead arose from the novel valency of a class of stable organic singlet bi-radical systems. A synthetic strategy to an “endless” hydrogen storage polymer has been developed based on our cyanocarbon chemistry. A key issue with the synthetic efforts was being able to link the kinetics of release with the size of the substituents as it was difficult to develop a low molecular

  4. Is spinal excitability of the triceps surae mainly affected by muscle activity or body position?

    Science.gov (United States)

    Cattagni, T; Martin, A; Scaglioni, G

    2014-06-15

    The aim of this study was to determine how muscle activity and body orientation contribute to the triceps surae spinal transmission modulation, when moving from a sitting to a standing position. Maximal Hoffmann-reflex (Hmax) and motor potential (Mmax) were evoked in the soleus (SOL), medial and lateral gastrocnemius in 10 male subjects and in three conditions, passive sitting, active sitting and upright standing, with the same SOL activity in active sitting and upright standing. Moreover volitional wave (V) was evoked in the two active conditions (i.e., active sitting and upright standing). The results showed that SOL Hmax/Mmax was lower in active sitting than in passive sitting, while for the gastrocnemii it was not significantly altered. For the three plantar flexors, Hmax/Mmax was lower in upright standing than in active sitting, whereas V/Mmax was not modulated. SOL H-reflex is therefore affected by the increase in muscle activity and change in body orientation, while, in the gastrocnemii, it was only affected by a change in posture. In conclusion, passing from a sitting to a standing position affects the Hmax/Mmax of the whole triceps surae, but the mechanisms responsible for this change differ among the synergist muscles. The V/Mmax does not change when upright stance is assumed. This means that the increased inhibitory activity in orthostatic position is compensated by an increased excitatory inflow to the α-motoneurons of central and/or peripheral origin.

  5. Oncogenic and tumor-promoting Spermatophytes and Pteridophytes and their active principles.

    Science.gov (United States)

    Farnsworth, N R; Bingel, A S; Fong, H H; Saleh, A A; Christenson, G M; Saufferer, S M

    1976-08-01

    A survey and discussion are presented of plants classified as Spermatophyta and Pteridophyta, extracts of which have been shown to be oncogenic or tumor-promoting in animals. The active oncogenic and tumor-promoting principles, where known, have been identified. They represent tannins; pyrrolizidine, indole, tropolone, quinoline, purine, and benzophenanthridine alkaloids; nitroso compounds; triterpene glycosides; lignans; isoflavans; allyl benzenoids; simple (nu-pyrenes; and carbocyclic hydroxy acids. A total of 28 compounds of known structure have been identified as oncogens and several phorbol esters as tumor-promoters. Plants known to contain any of the 28 oncogens (excluding shikimic acid and caffeine) have been tabulated; they represent at least 454 species, 110 genera, and 34 families of Spermatophyta and Pteridophyta.

  6. Water-ice-driven Activity on Main-Belt Comet P/2010 A2 (LINEAR)?

    DEFF Research Database (Denmark)

    Moreno, Fernando; Licandro, Javier; Tozzi, Gian-Paolo

    2010-01-01

    The dust ejecta of Main-Belt Comet P/2010 A2 (LINEAR) have been observed with several telescopes at the Observatorio del Roque de los Muchachos on La Palma, Spain. Application of an inverse dust tail Monte Carlo method to the images of the dust ejecta from the object indicates that a sustained, l...

  7. Effects of Chlorophenoxy Herbicides and Their Main Transformation Products on DNA Damage and Acetylcholinesterase Activity

    OpenAIRE

    2014-01-01

    Persistent pesticide transformation products (TPs) are increasingly being detected among different environmental compartments, including groundwater and surface water. However, there is no sufficient experimental data on their toxicological potential to assess the risk associated with TPs, even if their occurrence is known. In this study, the interaction of chlorophenoxy herbicides (MCPA, mecoprop, 2,4-D and dichlorprop) and their main transformation products with calf thymus DNA by UV-visibl...

  8. Essential oil from Chenopodium ambrosioides and main components: activity against Leishmania, their mitochondria and other microorganisms.

    Science.gov (United States)

    Monzote, Lianet; García, Marley; Pastor, Jacinta; Gil, Lizette; Scull, Ramón; Maes, Louis; Cos, Paul; Gille, Lars

    2014-01-01

    Chenopodium ambrosioides is an aromatic herb used by native people to treat parasitic diseases. The aim of this work is to compare the in vitro anti-leishmanial activity of the essential oil (EO) from C. ambrosioides and its major components (ascaridole, carvacrol and caryophyllene oxide) and study their mechanism of action and activity against a panel of microorganism. Antileishmanial activity and cytotoxicity of the EO and major components was study. In addition, experiments to elucidate the mechanism of action were perform and activities against other microorganisms (bacteria, fungi and protozoa) were evaluate. All products were active against promastigote and amastigote forms of Leishmania. Ascaridole exhibited the better antileishmanial activity and the EO the highest selectivity index. The exploration of the mechanism suggests that the products cause a breakdown of mitochondrial membrane potential and a modification of redox indexes. Only EO showed antiprotozoal effect against Plasmodium falciparum and Trypanosoma brucei; while no activity against bacteria and fungi was observed. Our results demonstrate the potentialities of EO in cellular and molecular system, which could be consider in future studies to develop new antileishmanial drugs with a wide anti-parasitic spectrum. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Antibacterial and Anti-Inflammatory Activities of Physalis Alkekengi var. franchetii and Its Main Constituents

    Directory of Open Access Journals (Sweden)

    Zunpeng Shu

    2016-01-01

    Full Text Available This study was designed to determine whether the 50% EtOH fraction from AB-8 macroporous resin fractionation of a 70% EtOH extract of P. Alkekengi (50-EFP has antibacterial and/or anti-inflammatory activity both in vivo and in vitro and to investigate the mechanism of 50-EFP anti-inflammatory activity. Additionally, this study sought to define the chemical composition of 50-EFP. Results indicated that 50-EFP showed significant antibacterial activity in vitro and efficacy in vivo. Moreover, 50-EFP significantly reduced nitric oxide (NO, prostaglandin E2 (PGE2, tumor necrosis factor alpha (TNF-α, interleukin 1 (IL-1, and interleukin 6 (IL-6 production in lipopolysaccharide- (LPS- stimulated THP-1 cells. Nitric oxide synthase (iNOS and cyclooxygenase-2 (COX-2 (examined at the protein level in THP-1 cells were suppressed by 50-EFP, which inhibited nuclear translocation of p65. Consistent with this anti-inflammatory activity in vitro, 50-EFP reduced inflammation in both animal models. Finally, seventeen compounds (8 physalins and 9 flavones were isolated as major components of 50-EFP. Our data demonstrate that 50-EFP has antibacterial and anti-inflammatory activities both in vitro and in vivo. The anti-inflammatory effect appears to occur, at least in part, through the inhibition of nuclear translocation of p65. Moreover, physalins and flavones are probably the active components in 50-EFP that exert antibacterial and anti-inflammatory activities.

  10. Identification and Quantification of the Main Active Anticancer Alkaloids from the Root of Glaucium flavum

    OpenAIRE

    Lamine Bournine; Sihem Bensalem; Jean-Noël Wauters; Mokrane Iguer-Ouada; Fadila Maiza-Benabdesselam; Fatiha Bedjou; Vincent Castronovo; Akeila Bellahcène; Monique Tits; Michel Frédérich

    2013-01-01

    Glaucium flavum is used in Algerian folk medicine to remove warts (benign tumors). Its local appellations are Cheqiq el-asfar and Qarn el-djedyane. We have recently reported the anti-tumoral activity of Glaucium flavum root alkaloid extract against human cancer cells, in vitro and in vivo. The principal identified alkaloid in the extract was protopine. This study aims to determine which component(s) of Glaucium flavum root extract might possess potent antitumor activity on human cancer cells....

  11. Contralateral delay activity tracks the influence of Gestalt grouping principles on active visual working memory representations.

    Science.gov (United States)

    Peterson, Dwight J; Gözenman, Filiz; Arciniega, Hector; Berryhill, Marian E

    2015-10-01

    Recent studies have demonstrated that factors influencing perception, such as Gestalt grouping cues, can influence the storage of information in visual working memory (VWM). In some cases, stationary cues, such as stimulus similarity, lead to superior VWM performance. However, the neural correlates underlying these benefits to VWM performance remain unclear. One neural index, the contralateral delay activity (CDA), is an event-related potential that shows increased amplitude according to the number of items held in VWM and asymptotes at an individual's VWM capacity limit. Here, we applied the CDA to determine whether previously reported behavioral benefits supplied by similarity, proximity, and uniform connectedness were reflected as a neural savings such that the CDA amplitude was reduced when these cues were present. We implemented VWM change-detection tasks with arrays including similarity and proximity (Experiment 1); uniform connectedness (Experiments 2a and 2b); and similarity/proximity and uniform connectedness (Experiment 3). The results indicated that when there was a behavioral benefit to VWM, this was echoed by a reduction in CDA amplitude, which suggests more efficient processing. However, not all perceptual grouping cues provided a VWM benefit in the same measure (e.g., accuracy) or of the same magnitude. We also found unexpected interactions between cues. We observed a mixed bag of effects, suggesting that these powerful perceptual grouping benefits are not as predictable in VWM. The current findings indicate that when grouping cues produce behavioral benefits, there is a parallel reduction in the neural resources required to maintain grouped items within VWM.

  12. Active phenomena in the pre-main sequence Herbig Ae star HD 163296

    Science.gov (United States)

    Catala, C.; Praderie, F.; Simon, T.; Talavera, A.; The, P. S.

    1989-01-01

    Observations by IUE of the short-term variability of the Mg II and Ca II resonance lines in the Herbig Ae star HD 163296 are presented. Evidence that these lines show a phenomenon of rotational modulation, similar to the one observed in AB Aur, another Herbig Ae star is found. The variations in the spectrum of HD 163296 are even more conspicuous than in the spectrum of AB Aur. Magnetically structured winds may thus be a widespread phenomenon among the pre-main sequence Herbig Ae/Be stars.

  13. Pro-active environmental strategies – main source of competitive advantage within economic organizations

    Directory of Open Access Journals (Sweden)

    Oana-Catalina TÃPURICA

    2009-06-01

    Full Text Available Nowadays, contemporary organizations within Romanian economic environment are striving to reach the environmental and quality performance standards set up by the European Union, concerning the environmental protection and preservation. Under these circumstances, the organizations are highly recommended, especially those operating in high environmental impact economic sectors, to develop and implement proactive environmental strategies, as a main source to achieve a sustainable competitive advantage on the market. Developing such strategic instruments is more and more important as long as the reactive environmental strategies tend to become counter-performing within a challenging, dynamic and equilibrated competitive environment, which better describes the knowledge-based society.

  14. Antibacterial activity of Thymoquinone, an active principle of Nigella sativa and its potency to prevent bacterial biofilm formation

    Directory of Open Access Journals (Sweden)

    Bakhrouf Amina

    2011-04-01

    Full Text Available Abstract Background Thymoquinone is an active principle of Nigella sativa seed known as "Habbah Al-Sauda" in Arabic countries and "Sinouj" in Tunisia. Bacterial biofilms tend to exhibit significant tolerance to antimicrobials drugs during infections. Methods The antibacterial activity of Thymoquinone (TQ and its biofilm inhibition potencies were investigated on 11 human pathogenic bacteria. The growth and development of the biofilm were assessed using the crystal violet (CV and the 2, 3-bis [2-methyloxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide (XTT reduction assay. Results TQ exhibited a significant bactericidal activity against the majority of the tested bacteria (MICs values ranged from 8 to 32 μg/ml especially Gram positive cocci (Staphylococcus aureus ATCC 25923 and Staphylococcus epidermidis CIP 106510. Crystal violet assay demonstrated that the minimum biofilm inhibition concentration (BIC50 was reached with 22 and 60 μg/ml for Staphylococcus aureus ATCC 25923 and Staphylococcus epidermidis CIP 106510 respectively. In addition our data revealed that cells oxidative activity was influenced by TQ supplementation. In the same way, TQ prevented cell adhesion to glass slides surface. Conclusion The ability of TQ to prevent biofilm formation warrants further investigation to explore its use as bioactive substances with antibiofilm potential.

  15. The Magnetic Activity of Solar-like Stars at Different Main-Sequence Ages

    Science.gov (United States)

    Lakatos, S. L.; Nandy, D.; Martens, P.

    2005-12-01

    We report on a study of modeling stellar magnetic activity inferred through CaII H+K and ROSAT X-ray emission. The purpose of this project is to create a subset of stars with similar properties to the Sun, but with a wide range of ages (0.6 - 10 Gyrs); to study the CaII H+K emission data and decipher how the stars' emission changes with age; and to compare the X-ray activity to the CaII H+K activity. The ultimate goal of this project is to determine and use the relationships between the stellar parameters to understand the evolution of the magnetic dynamo from an younger Sun to an older Sun. This research is supported by a NSF Research Experience for Undergraduates grant ATM-0243923 and a NASA Living With a Star grant NNG05GE47G to Montana State University.

  16. New Neighbors from 2MASS: Activity and Kinematics at the Bottom of the Main Sequence

    Science.gov (United States)

    Gizis, John E.; Monet, David G.; Reid, I. Neill; Kirkpatrick, J. Davy; Liebert, James; Williams, Rik J.

    2000-08-01

    We have combined 2MASS and POSS II data in a search for nearby ultracool (later than M6.5) dwarfs with Ksmass function that is smooth across the stellar/substellar limit. We show the observed frequency of Hα emission peaks at ~100% for M7 dwarfs and then decreases for cooler dwarfs. In absolute terms, however, as measured by the ratio of Hα to bolometric luminosity, none of the ultracool M dwarfs can be considered very active compared to earlier M dwarfs, and we show that the decrease that begins at spectral type M6 continues to the latest L dwarfs. We find that flaring is common among the coolest M dwarfs and estimate the frequency of flares at 7% or higher. We show that the kinematics of relatively active (EW>6 Å) ultracool M dwarfs are consistent with an ordinary old disk stellar population, while the kinematics of inactive ultracool M dwarfs are more typical of a 0.5 Gyr old population. The early L dwarfs in the sample have kinematics consistent with old ages, suggesting that the hydrogen-burning limit is near spectral types L2-L4. We use the available data on M and L dwarfs to show that chromospheric activity drops with decreasing mass and temperature and that at a given (M8 or later) spectral type, the younger field (brown) dwarfs are less active than many of the older, more massive field stellar dwarfs. Thus, contrary to the well-known stellar age-activity relationship, low activity in field ultracool dwarfs can be an indication of comparative youth and substellar mass.

  17. Influence of Main Components in Exhaust Gas on Mercury Adsorption Capacity of Brominated Activated Carbon

    Directory of Open Access Journals (Sweden)

    Tran Hong Con

    2016-01-01

    Full Text Available Brominated activated carbon (AC-Br, which was produced from coconut shell activated carbon (AC and brominated by wet way with elemental bromine, was determined as a material with super high adsorption capacity of mercury vapor. But in real exhaust gases, there are many components such as SO2, NOx, CO, CO2, HCl, H2O can influence on adsorption ability of the AC-Br. In this paper, these influences were studied and compared them between initial AC and AC-Br. Each component has different effect on AC and AC-Br and followed by its particular mechanism.

  18. MONITORING AND MODELING OF THE MAIN TRENDS IN THE DEVELOPMENT OF SCIENTIFIC ACTIVITY IN RUSSIA

    Directory of Open Access Journals (Sweden)

    Marina U. Archipova

    2014-01-01

    Full Text Available This article is devoted to monitoring of the scientific sphere in Russia in comparison to thedeveloped countries. Attention is paid especially to analysis of interrelation between scientifi c researches costs and the results of scientifi c activity,as well as to the modeling of innovative activityin Russia on the based on the systems of therecursive simultaneous equations. The conductedresearch allows to follow the diffusion of scientific knowledge and their influence on innovative activity in the country.

  19. Antiatherosclerotic Potential of Active Principle Isolated from Eugenia jambolana in Streptozotocin-Induced Diabetic Rats

    Directory of Open Access Journals (Sweden)

    Reenu Singh Tanwar

    2011-01-01

    Full Text Available The aim of the present study was to investigate the antiatherosclerotic effect of active principle (FIIc isolated from aqueous fruit pulp extract of Eugenia jambolana. Crude aqueous extract of E. jambolana was subjected to purification using chromatographic techniques which yielded purified active compound (FIIc. Purity of FIIc was tested by HPLC. Phytochemical investigation of FIIc by NMR, IR, and UV spectra showed that the purified compound is α-hydroxy succinamic acid. The streptozotocin- (STZ- induced diabetic rats were fed atherosclerotic (Ath diet containing 1.5 mL olive oil containing 8 mg (3, 20,000 IU vitamin D2 and 40 mg cholesterol for 5 consecutive days. The STZ-induced diabetic rats receiving Ath diet were orally administered FIIc at doses of 10, 15, and 20 mg/kg, and results were compared with reference drug, that is, glibenclamide (600 μg/mg and healthy control. 30-day treatment with FIIc resulted in significant (P<.001 improvement in blood glucose, serum lipid profile, apolipoproteins (Apo A1 and apoB100, and endothelial dysfunction parameters. Histomorphological studies also confirmed biochemical findings. Our results showed that FIIc has protective effect on hyperglycemia-induced atherosclerosis.

  20. Main determinants of physical activity levels in individuals with Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Raquel de Carvalho Lana

    2016-02-01

    Full Text Available ABSTRACT This study analyzed the relationship between patient characteristics, factors associated with Parkinson’s disease (PD, and physical activity level of individuals affected by the disease. Forty-six volunteers with mild-to-moderate idiopathic PD were assessed using sections II/III of the Unified Parkinson’s Disease Rating Scale and their motor functions were classified according to the modified Hoehn and Yahr (HY scale. Data such as age, disease duration, the Human Activity Profile (HAP, the Fatigue Severity Scale were collected. Lower limb bradykinesia and clinical subtypes of PD were defined. Two models that explained 76% of the variance of the HAP were used. The first comprised age, ability to perform activities of daily living (ADL, and the HY scale; the second comprised age, ability to perform ADL, and lower limb bradykinesia. Possible modifiable factors such as the ability to perform ADL and lower limb bradykinesia were identified as predictors of physical activity level of individuals with PD.

  1. New Neighbors from 2MASS Activity and Kinematics at the Bottom of the Main Sequence

    CERN Document Server

    Gizis, J E; Reid, I N; Kirkpatrick, J D; Liebert, J; Williams, R J; Gizis, John E.; Monet, David G.; Liebert, James; Williams, Rik J.

    2000-01-01

    We have combined 2MASS and POSS II data in a search for nearby ultracool (later than M6.5) dwarfs with K_s6 Angstroms) ultracool M dwarfs are consistent with an ordinary old disk stellar population, while the kinematics of inactive ultracool M dwarfs are more typical of a 0.5 Gyr old population. The early L dwarfs in the sample have kinematics consistent with old ages, suggesting that the hydrogen burning limit is near spectral types L2-L4. We use the available data on M and L dwarfs to show that chromospheric activity drops with decreasing mass and temperature, and that at a given (M8 or later) spectral type, the younger field (brown) dwarfs are less active than many of the older, more massive field stellar dwarfs. Thus, contrary to the well-known stellar age-activity relationship, low activity in field ultracool dwarfs can be an indication of comparative youth and substellar mass.

  2. Synthesis, characterization and biocidal activities of Schiff base polychelates containing polyurethane links in the main chain

    Science.gov (United States)

    Hasnain, Sumaiya; Nishat, Nahid

    The concept of combining metallo-polymers with urethanes offers a versatile approach for the synthesis of new polymeric materials. Polyurethane containing transition metals was synthesized by the reaction of Schiff base metal complex with toluene 2,4 diisocyanate. The proposed structures were confirmed by elemental analysis, 1H NMR, 13C NMR and FT-IR. The geometry is determined by UV-Visible spectra and magnetic moment measurements, which reveals that the Mn(II), Co(II) and Ni(II) complexes have octahedral geometry while square planer geometry is reported for Cu(II) and tetrahedral for Zn(II) complex. The antimicrobial activities are determined using the agar well diffusion method with Staphylococcus aureus, Escherichia coli, Bacillus subtilis (bacteria), Aspergillus niger, Candida albicans and Aspergillus flavus (yeast). All the polymeric metal complexes show comparatively good biocidal activity, which is further enhanced after polymerization.

  3. Magnetic activity analysis for a sample of G-type main sequence \\emph{Kepler} targets

    CERN Document Server

    Mehrabi, A; Khosroshahi, H

    2016-01-01

    The variation of a stellar light curve owing to the rotational modulation by the magnetic features (starspots and faculae) on the star's surface can be used to investigate the magnetic properties of the host star. In this paper, we use the periodicity and magnitude of the light-curve variation, as two proxies, suggested by (He et al. 2015), to study the stellar magnetic properties for a large sample of G-type main sequence \\emph{Kepler} targets, for which the rotation periods recently determined by (McQuillan et al. 2014). By analyzing the correlation between the two magnetic proxies, it is found that: (1) The two proxies are positively correlated for most of the stars in our sample, and the percentages of negative, zero, and positive correlation are $4.27\\%$, $6.81\\%$, and $88.91\\%$, respectively; (2) Negative correlation stars cannot have large magnitude of light-curve variation; (3) with the increase of rotation period, the relative number of positive correlation stars decreases and the negative correlatio...

  4. Quaternary volcano-tectonic activity in the Soddo region, western margin of the Southern Main Ethiopian Rift

    NARCIS (Netherlands)

    Corti, G.; Sani, F.; Philippon, M.; Sokoutis, D.; Willingshofer, E.; Molin, P.

    2013-01-01

    We present an analysis of the distribution, timing, and characteristics of the volcano-tectonic activity on the western margin of the Southern Main Ethiopian Rift in the Soddo area (latitudes between ~7°10'N and ~6°30'N). The margin is characterized by the presence of numerous normal faults, with li

  5. Bioassay-Guided Fractionation of a Leaf Extract from Combretum mucronatum with Anthelmintic Activity: Oligomeric Procyanidins as the Active Principle.

    Science.gov (United States)

    Spiegler, Verena; Sendker, Jandirk; Petereit, Frank; Liebau, Eva; Hensel, Andreas

    2015-08-14

    Combretum mucronatum Schumach. & Thonn. is a medicinal plant widely used in West African traditional medicine for wound healing and the treatment of helminth infections. The present study aimed at a phytochemical characterization of a hydroalcoholic leaf extract of this plant and the identification of the anthelmintic compounds by bioassay-guided fractionation. An EtOH-H2O (1:1) extract from defatted leaves was partitioned between EtOAc and H2O. Further fractionation was performed by fast centrifugal partition chromatography, RP18-MPLC and HPLC. Epicatechin (1), oligomeric proanthocyanidins (OPC) 2 to 10 (mainly procyanidins) and flavonoids 11 to 13 were identified as main components of the extract. The hydroalcoholic extract, fractions and purified compounds were tested in vitro for their anthelmintic activity using the model nematode Caenorhabditis elegans. The bioassay-guided fractionation led to the identification of OPCs as the active compounds with a dose-dependent anthelmintic activity ranging from 1 to 1000 μM. Using OPC-clusters with a defined degree of polymerization (DP) revealed that a DP ≥ 3 is necessary for an anthelmintic activity, whereas a DP > 4 does not lead to a further increased inhibitory effect against the helminths. In summary, the findings rationalize the traditional use of C. mucronatum and provide further insight into the anthelmintic activity of condensed tannins.

  6. Bioassay-Guided Fractionation of a Leaf Extract from Combretum mucronatum with Anthelmintic Activity: Oligomeric Procyanidins as the Active Principle

    Directory of Open Access Journals (Sweden)

    Verena Spiegler

    2015-08-01

    Full Text Available Combretum mucronatum Schumach. & Thonn. is a medicinal plant widely used in West African traditional medicine for wound healing and the treatment of helminth infections. The present study aimed at a phytochemical characterization of a hydroalcoholic leaf extract of this plant and the identification of the anthelmintic compounds by bioassay-guided fractionation. An EtOH-H2O (1:1 extract from defatted leaves was partitioned between EtOAc and H2O. Further fractionation was performed by fast centrifugal partition chromatography, RP18-MPLC and HPLC. Epicatechin (1, oligomeric proanthocyanidins (OPC 2 to 10 (mainly procyanidins and flavonoids 11 to 13 were identified as main components of the extract. The hydroalcoholic extract, fractions and purified compounds were tested in vitro for their anthelmintic activity using the model nematode Caenorhabditis elegans. The bioassay-guided fractionation led to the identification of OPCs as the active compounds with a dose-dependent anthelmintic activity ranging from 1 to 1000 μM. Using OPC-clusters with a defined degree of polymerization (DP revealed that a DP ≥ 3 is necessary for an anthelmintic activity, whereas a DP > 4 does not lead to a further increased inhibitory effect against the helminths. In summary, the findings rationalize the traditional use of C. mucronatum and provide further insight into the anthelmintic activity of condensed tannins.

  7. Antiprotozoal Activity of Buxus sempervirens and Activity-Guided Isolation of O-tigloylcyclovirobuxeine-B as the Main Constituent Active against Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Julia B. Althaus

    2014-05-01

    Full Text Available Buxus sempervirens L. (European Box, Buxaceae has been used in ethnomedicine to treat malaria. In the course of our screening of plant extracts for antiprotozoal activity, a CH2Cl2 extract from leaves of B. sempervirens showed selective in vitro activity against Plasmodium falciparum (IC50 = 2.79 vs. 20.2 µg/mL for cytotoxicity against L6 rat cells. Separation of the extract by acid/base extraction into a basic and a neutral non-polar fraction led to a much more active and even more selective fraction with alkaloids while the fraction of non-polar neutral constituents was markedly less active than the crude extract. Thus, the activity of the crude extract could clearly be attributed to alkaloid constituents. Identification of the main triterpene-alkaloids and characterization of the complex pattern of this alkaloid fraction was performed by UHPLC/+ESI-QTOF-MS analyses. ESI-MS/MS target-guided larger scale preparative separation of the alkaloid fraction was performed by ‘spiral coil-countercurrent chromatography’. From the most active subfraction, the cycloartane alkaloid O-tigloylcyclovirobuxeine-B was isolated and evaluated for antiplasmodial activity which yielded an IC50 of 0.455 µg/mL (cytotoxicity against L6 rat cells: IC50 = 9.38 µg/mL. O-tigloylcyclovirobuxeine-B is thus most significantly responsible for the high potency of the crude extract.

  8. Influence of garlic or its main active component diallyl disulfide on iron bioavailability and toxicity.

    Science.gov (United States)

    Nahdi, Afef; Hammami, Imen; Brasse-Lagnel, Carole; Pilard, Nathalie; Hamdaoui, Mohamed Hedi; Beaumont, Carole; El May, Michèle

    2010-02-01

    Garlic is regularly consumed and is known to have diverse biologic activities, particularly due to its antioxidant properties. In this study, we hypothesized that crude garlic can prevent iron-mediated oxidative stress in a rat model of nutritional iron overload, and we used an in vitro model to confirm the results. For the in vivo studies, rats received a basal diet supplemented with or without carbonyl iron (3%) and were fed distilled water or garlic solution (1g/kg body weight) by gavage for 3 weeks. The presence of both garlic and iron led to a 2-fold increase in plasma iron and a 50% increase in liver iron as compared with iron alone. However, garlic did not offer any protection against iron-induced oxidative stress. Duodenal divalent metal transporter-1 mRNA expression was fully repressed by iron and by the combined treatments but was also reduced by garlic alone. To confirm these data, we tested the effect of diallyl disulfide, one of the active components in garlic, in vitro on polarized Caco-2 cells. A 24-hour treatment decreased iron uptake at the apical side of Caco-2 cells but increased the percentage of iron transfer at the basolateral side. This probably resulted from a modest induction of ferroportin mRNA and protein expression. These results suggest that garlic, when given in the presence of iron, enhances iron absorption by increasing ferroportin expression. The presence of garlic in the diet at the dose studied does not seem to protect against iron-mediated oxidative stress. Copyright 2010 Elsevier Inc. All rights reserved.

  9. Principles and potential of the anaerobic digestion of waste-activated sludge

    Energy Technology Data Exchange (ETDEWEB)

    Appels, Lise; Degreve, Jan [Department of Chemical Engineering, Katholieke Universiteit Leuven, W. De Croylaan 46, B-3001 Heverlee (Belgium); Baeyens, Jan [Department of Chemical Engineering, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Dewil, Raf [Department of Chemical Engineering, Katholieke Universiteit Leuven, W. De Croylaan 46, B-3001 Heverlee (Belgium); Department of Chemical Engineering, Associated Faculty of Technology and Biosciences, Campus De Nayer, Katholieke Universiteit Leuven, Jan De Nayerlaan 5, B-2860 Sint-Katelijne-Waver (Belgium)

    2008-12-15

    When treating municipal wastewater, the disposal of sludge is a problem of growing importance, representing up to 50% of the current operating costs of a wastewater treatment plant. Although different disposal routes are possible, anaerobic digestion plays an important role for its abilities to further transform organic matter into biogas (60-70 vol% of methane, CH{sub 4}), as thereby it also reduces the amount of final sludge solids for disposal whilst destroying most of the pathogens present in the sludge and limiting odour problems associated with residual putrescible matter. Anaerobic digestion thus optimises WWTP costs, its environmental footprint and is considered a major and essential part of a modern WWTP. The potential of using the biogas as energy source has long been widely recognised and current techniques are being developed to upgrade quality and to enhance energy use. The present paper extensively reviews the principles of anaerobic digestion, the process parameters and their interaction, the design methods, the biogas utilisation, the possible problems and potential pro-active cures, and the recent developments to reduce the impact of the problems. After having reviewed the basic principles and techniques of the anaerobic digestion process, modelling concepts will be assessed to delineate the dominant parameters. Hydrolysis is recognised as rate-limiting step in the complex digestion process. The microbiology of anaerobic digestion is complex and delicate, involving several bacterial groups, each of them having their own optimum working conditions. As will be shown, these groups are sensitive to and possibly inhibited by several process parameters such as pH, alkalinity, concentration of free ammonia, hydrogen, sodium, potassium, heavy metals, volatile fatty acids and others. To accelerate the digestion and enhance the production of biogas, various pre-treatments can be used to improve the rate-limiting hydrolysis. These treatments include

  10. Evaluation of Essential Oil and its Three Main Active Ingredients of Chinese Chenopodium ambrosioides (Family: Chenopodiaceae) against Blattella germanica.

    Science.gov (United States)

    Zhu, Wei Xiang; Zhao, Kun; Chu, Sha Sha; Liu, Zhi Long

    2012-12-01

    The efficacy of essential oil of Chenopodium ambrosioides flowering aerial parts and its three main active ingredients was evaluated against Blattella germanica male adults. Composition of essential oil was determined by GC-MS. Topical application bioassay was used to evaluate contact toxicity of essential oil and three main components. Fumigant toxicity of essential oil and its main components was measured using a sealed space method. Twenty-two components were identified in the essential oil and the main components were (Z)-ascaridole (29.7%), isoascaridole (13.0%), ρ-cymene (12.7%) and piperitone (5.0%). The essential oil and (Z)-ascaridole, isoascaridole and ρ-cymene possessed fumigant toxicity against male German cockroaches with LC(50) values of 4.13, 0.55, 2.07 and 6.92 mg/L air, respectively. Topical application bioassay showed that all the three compounds were toxic to male German cockroaches and (Z)-ascaridole was the strongest with a LD(50) value of 22.02 μg/adult while the crude oil with a LD(50) value of 67.46 μg/adult. The essential oil from Chinese C. ambrosioides and its three main active ingredients may be explored as natural potential insecticides in the control of cockroaches.

  11. Present status of research activities relating global warming problems in Japan (mainly MITI and relating organizations)

    Energy Technology Data Exchange (ETDEWEB)

    Yokoyama, O.

    1993-12-31

    Japanese government has issued action program so called {open_quotes}Action Program to Arrest Global Warming{close_quotes} for preventing global warming at Oct., 1990. According to the program, CO{sub 2} emission should be stabilized on a per capita basis in the year 2000 and beyond at about same level as in 2000 by introducing several methods such as energy conservation, improvement of energy using efficiency, expanding use of renewable energy and so on. The basic concept, target and methods are summarized. At the same time, MITI published so called {open_quotes}New Earth 21{close_quotes} project which aims remedying the earth environment modified by human activities since industrial innovation began at about 200 years ago in coming 100 years. This plan proposed yearly step of research development of technology for mitigating CO{sub 2} emission. According to the MITI`s plan, 15 institutions belonging to AIST have carrying research for developing technology of reducing emission of CO{sub 2} and other greenhouse gases, with cooperation of other research organizations such as RITE (research Institute of Innovative Technology for Earth) and NEDO (New Energy and Industrial Technology Developing Organization). Time schedule of the research development by The New Earth 21 project is summarized in Table 2. Now, in Japan, many national institutions and universities, research works relating reduction and mitigation of GHG are carried out according to this guideline.

  12. Mentha suaveolens Ehrh. (Lamiaceae Essential Oil and Its Main Constituent Piperitenone Oxide: Biological Activities and Chemistry

    Directory of Open Access Journals (Sweden)

    Mijat Božović

    2015-05-01

    Full Text Available Since herbal medicines play an important role in the treatment of a wide range of diseases, there is a growing need for their quality control and standardization. Mentha suaveolens Ehrh. (MS is an aromatic herb with fruit and a spearmint flavor, used in the Mediterranean areas as a traditional medicine. It has an extensive range of biological activities, including cytotoxic, antimicrobial, antioxidant, anti-inflammatory, hypotensive and insecticidal properties, among others. This study aims to review the scientific findings and research reported to date on MS that prove many of the remarkable various biological actions, effects and some uses of this species as a source of bioactive natural compounds. On the other hand, piperitenone oxide (PO, the major chemical constituent of the carvone pathway MS essential oil, has been reported to exhibit numerous bioactivities in cells and animals. Thus, this integrated overview also surveys and interprets the present knowledge of chemistry and analysis of this oxygenated monoterpene, as well as its beneficial bioactivities. Areas for future research are suggested.

  13. [Ajoene the main active compound of garlic (Allium sativum): a new antifungal agent].

    Science.gov (United States)

    Ledezma, Eliades; Apitz-Castro, Rafael

    2006-06-01

    The curative properties of garlic in medicine have been known for a long time. But, it was only in the last three decades when garlic properties were seriously investigated confirming its potential as therapeutic agent. Allicin, ajoene, thiosulfinates and a wide range of other organosulphurate compounds, are known to be the constituents linked to the garlic properties. Regarding the biochemical properties of these compounds, ajoene [(E,Z)-4,5,9 Trithiadodeca 1,6,11 Triene 9-oxide] is stable in water, and it can be obtained by chemical synthesis. There is evidence that some of the garlic constituents exert a wide variety of effects on different biological systems. However, ajoene is the garlic compound related to more biological activities, as showed in in vitro and in vivo systems. Those studies found that ajoene has antithrombotic, anti-tumoral,antifungal, and antiparasitic effects. This study deals with a recently described antifungal property of ajoene, and its potential use in clinical trails to treat several fungal infections.

  14. Mentha suaveolens Ehrh. (Lamiaceae) Essential Oil and Its Main Constituent Piperitenone Oxide: Biological Activities and Chemistry.

    Science.gov (United States)

    Božović, Mijat; Pirolli, Adele; Ragno, Rino

    2015-05-13

    Since herbal medicines play an important role in the treatment of a wide range of diseases, there is a growing need for their quality control and standardization. Mentha suaveolens Ehrh. (MS) is an aromatic herb with fruit and a spearmint flavor, used in the Mediterranean areas as a traditional medicine. It has an extensive range of biological activities, including cytotoxic, antimicrobial, antioxidant, anti-inflammatory, hypotensive and insecticidal properties, among others. This study aims to review the scientific findings and research reported to date on MS that prove many of the remarkable various biological actions, effects and some uses of this species as a source of bioactive natural compounds. On the other hand, piperitenone oxide (PO), the major chemical constituent of the carvone pathway MS essential oil, has been reported to exhibit numerous bioactivities in cells and animals. Thus, this integrated overview also surveys and interprets the present knowledge of chemistry and analysis of this oxygenated monoterpene, as well as its beneficial bioactivities. Areas for future research are suggested.

  15. The analysis of pricing principles at domestic industrial enterprises

    Directory of Open Access Journals (Sweden)

    I.M. Rjabchenko

    2013-03-01

    Full Text Available The analysis of pricing principles at domestic industrial enterprisesTheoretical and methodological aspects of marketing pricing formation are investigated in the article. The aim of this research is systematization of marketing pricing principles and formation of corresponding offers concerning perfection of a domestic industrial enterprises pricing policy.The results of the analysis. The authors note that pricing principles are important element of pricing methodology which form basic positions, characteristics for all pricing system. The essence of such pricing principles as scientific substantiation of prices, target direction of prices, unity principle of pricing process, principle of continuous pricing process, interrelation between pricing policy and general enterprise strategy, principle of legality, planned character, proportionality, adequacy, principle of interdependence between types and forms of selling, flexibility principle is considered.The table of the resulted principles allows us to group them after the followings descriptions:general principles: planned character principle, principle of legality, principle of proportionality, principle of adequacy, principle of flexibility;main principles: principle of scientific prices substantiation, principle of prices target direction, unity principle of pricing process, principle of continuous pricing process;specific principles: principle of connection between pricing policy and general strategy of enterprise, principle of interrelation between types and forms of selling, principle connected with the features of products which will be distribute, principle connected with buyers quality maintenance;individual principles: principle connected with market structure, principle that applies to the choice of reaction type and market conditions change and so on.Conclusions and directions of further researches. Research of theoretical and methodological aspects of marketing pricing forming

  16. In vitro toxicological evaluation of essential oils and their main compounds used in active food packaging: A review.

    Science.gov (United States)

    Llana-Ruiz-Cabello, Maria; Pichardo, Silvia; Maisanaba, Sara; Puerto, Maria; Prieto, Ana I; Gutiérrez-Praena, Daniel; Jos, Angeles; Cameán, Ana M

    2015-07-01

    Essential oils (EOs) and their main constituent compounds have been extensively investigated due to their application in the food industry for improving the shelf life of perishable products. Although they are still not available for use in food packaging in the market in Europe, considerable research in this field has been carried out recently. The safety of these EOs should be guaranteed before being commercialized. The aim of this work was to review the scientific publications, with a primary focus on the last 10 years, with respect to different in vitro toxicological aspects, mainly focussed on mutagenicity/genotoxicity. In general, fewer genotoxic studies have been reported on EOs in comparison to their main components, and most of them did not show mutagenic activity. However, more studies are needed in this field since the guidelines of the European Food Safety Authority have not always been followed accurately. The mutagenic/genotoxic activities of these substances have been related to metabolic activation. Therefore, in vivo tests are required to confirm the absence of genotoxic effects. Considering the great variability of the EOs and their main compounds, a case-by-case evaluation is needed to assure their safe use in food packaging. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Permian to late Cenozoic evolution of northern Patagonia: Main tectonic events, magmatic activity, and depositional trends

    Science.gov (United States)

    Uliana, M. A.; Biddle, K. T.

    The late Paleozoic to late Cenozoic evolution of northern Patagonia was influenced significantly by events that occurred while the area was part of the South American sector of Gondwanaland. Late Paleozoic to Middle Triassic subduction along the edge of the supercontinent formed a broad convergent-margin system that is the underpinning of northern Patagonia. Deformation (Gondwanidian orogeny) associated with the subduction is recognized in both the forearc and the convergent backarc areas. Regional extension, accompanied by bimodal volcanism, began in the Late Triassic and led to the formation of a number of north-northwest trending rift basins in Patagonia, which generally followed the Gondwanidian basement grain. Continued extension in the Jurassic and Early Cretaceous led to the opening of the Rocas Verdes marginal basin in southern Chile and, ultimately, to the opening of the South Atlantic Ocean. Once oceanic crust began to form, faulting and volcanism declined in Patagonia. During the late Early Cretaceous to the Late Cretaceous, sags over the rift basins coalesced to form a broad backarc basin behind the volcanic arc to the west. These sags are suggestive of thermally driven subsidence. Subsidence of the evolving Atlantic margin allowed extensive marine transgressions to take place from the east. The stratigraphic record of northern Patagonia reflects these events. The upper Paleozoic to upper Mesozoic sedimentary sequences were deposited in basins directly associated with convergent activity along the margin of Gondwanaland or in rift basins created during its breakup. Even though the Tertiary evolution of Patagonia was dominated by events along the western margin of South America, the patterns of sediment transport, thickness, and general shoreline position were still influenced by the locations of the Mesozoic rifts formed during the breakup of Gondwanaland.

  18. Basic Principles of the Activity and Synergetic Approach as a Means of Interdisciplinary Research

    Directory of Open Access Journals (Sweden)

    Bolsunovskaya L.M.

    2016-01-01

    Full Text Available The paper considers the problem of interdisciplinarity as the main tendency of today’s science to unite the methodology and terminology and adapt them to any academic field in order to achieve more objective results in the study of complex phenomena. This article is a descriptive one and it deals with problems of terms’ interpretations and their adaptation to the anthropocentric research viewed by scientists of different academic schools. The main idea of the article is to find the most relevant and systemic definition of the given terms, which could be used as a tool in further linguistic analysis applied to the coming research of the authors. Special attention is paid to the description of the Activity Theory from different aspects of its interpretation: psychological, sociological, linguistic; to the explanation of the correlation between the epistemic structure of knowledge and an open non-linear synergetic bilateral (conceptual and lexical-semantic system influenced and motivated by processual factors to evolution in the modern discourse as the communicative activity of the interpreter and the constructor of discourse.

  19. Principles and Application of Magnetic Rubber Testing for Crack Detection in High-Strength Steel Components: I. Active-Field Inspection

    Science.gov (United States)

    2014-12-01

    UNCLASSIFIED UNCLASSIFIED Principles and Application of Magnetic Rubber Testing for Crack Detection in High-Strength Steel Components: I...scientific principles governing both active-field and residual-field variants of MRT were examined. The results of theoretical and experimental...investigations into active-field MRT are documented in the current report, which describes the principles of active-field MRT, and then examines both the basis

  20. Antihypertensive and vasorelaxant activities of Laelia autumnalis are mainly through calcium channel blockade.

    Science.gov (United States)

    Vergara-Galicia, Jorge; Ortiz-Andrade, Rolffy; Castillo-España, Patricia; Ibarra-Barajas, Maximiliano; Gallardo-Ortiz, Itzell; Villalobos-Molina, Rafael; Estrada-Soto, Samuel

    2008-07-01

    The aim of the present study was to evaluate the possible mechanism of the vasorelaxant action of methanol extract from Laelia autumnalis (MELa) in isolated rat aortic rings, and to establish its antihypertensive activity in vivo. MELa (0.15-->50 microg/mL) induced relaxation in aortic rings pre-contracted with KCl (80 mM), showing an IC50 value of 34.61+/-1.41 microg/mL and E max value of 85.0+/-4.38% (in endothelium-intact rings) and an IC50 value of 45.11+/-4.17 microg/mL and E max value of 80.0+/-12.1% (in endothelium-denuded rings). Serotonin (5-HT, 1 x 10(-4) M) provoked sustained contraction, which was markedly inhibited by MELa (0.15-->50 microg/mL) in a concentration-dependent and endothelium-independent manner. Pretreatment with MELa (15, 46, 150, 300 and 1500 microg/mL) also inhibited contractile responses to norepinephrine (NE 1 x 10(-11) M to 1 x 10(-5.5) M). In endothelium-denuded rings, the vasorelaxant effect of MELa was reduced partially by ODQ (1 microM), but not by tetraethylammonium (5 microM), glibenclamide (10 microM), and 2-aminopyridine (100 microM). The extract also reduced NE-induced transient contraction in Ca2+-free solution, and inhibited contraction induced by increasing external calcium in Ca2+-free medium plus high KCl (80 mM). The antihypertensive effect of MELa was determined in spontaneously hypertensive rats (SHR). A single oral administration of the extract (100 mg/kg) exhibited a significant decrease in systolic and diastolic blood pressure and heart rate (p<0.05) in SHR rats. Our results suggest that MELa induces relaxation in rat aortic rings through an endothelium-independent pathway, involving blockade of Ca2+ channels and a possible cGMP enhanced concentrations and also causes an antihypertensive effect.

  1. 医用雾化器的工作原理及主要技术要求%The Working Principle and Main Technical Requirements of the Medical Atomizer

    Institute of Scientific and Technical Information of China (English)

    陈聪; 郝素丽

    2016-01-01

    医用雾化器在临床上得到了越来越广泛的应用。目前,很多生产企业对于医用雾化器的技术要求还不太清楚,本文介绍了医用雾化器的工作原理、适用标准及主要技术要求。%Medical atomizer has been more and more widely used in clinic. At present, many manufacturing enterprises for technical requirements of the medical atomizer is not clear, this paper introduces the working principle, applicable standards and the main technical requirements of the medical atomizer.

  2. Anti-snake venom activities of ethanolic extract of fruits of Piper longum L. (Piperaceae) against Russell's viper venom: characterization of piperine as active principle.

    Science.gov (United States)

    Shenoy, P A; Nipate, S S; Sonpetkar, J M; Salvi, N C; Waghmare, A B; Chaudhari, P D

    2013-05-20

    Piper longum L. fruits have been traditionally used against snakebites in north-eastern and southern region of India. To examine the ability of ethanolic extract of fruits of Piper longum L., Piperaceae (PLE) and piperine, one of the main active principles of Piper longum, to inhibit the Russell's viper (Doboia russelii, Viperidae) snake venom activities. Anti-snake venom activities of ethanolic extract of fruits of Piper longum L. (Piperaceae) and piperine against Russell's viper venom was studied in embryonated fertile chicken eggs, mice and rats by using various models as follows: inhibition of venom lethal action, inhibition of venom haemorrhagic action (in vitro), inhibition of venom haemorrhagic action (in vivo), inhibition of venom necrotizing action, inhibition of venom defibrinogenating action, inhibition of venom induced paw edema, inhibition of venom induced mast cell degranulation, creatine kinase assay and assay for catalase activity. PLE was found to inhibit the venom induced haemorrhage in embryonated fertile chicken eggs. Administration of PLE and piperine significantly (p<0.01) inhibited venom induced lethality, haemorrhage, necrosis, defibrinogenation and inflammatory paw edema in mice in a dose dependent manner. PLE and piperine also significantly (p<0.01) reduced venom induced mast cell degranulation in rats. Venom induced decrease in catalase enzyme levels in mice kidney tissue and increase in creatine kinase enzyme levels in mice serum were significantly (p<0.01) reversed by administration of both PLE and piperine. PLE possesses good anti-snake venom properties and piperine is one of the compounds responsible for the effective venom neutralizing ability of the plant. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  3. Principles of the bark of Amphipterygium adstringens (Julianaceae) with anti-inflammatory activity.

    Science.gov (United States)

    Oviedo-Chávez, I; Ramírez-Apan, T; Soto-Hernández, M; Martínez-Vázquez, M

    2004-07-01

    Despite the fact that Amphipterygium adstringens (usually known as "cuachalalate") is used intensively in traditional medicine throughout México, there are, to our knowledge, no previous studies concerning the actual therapeutic, anti-inflammatory properties of this species. This lack of data prompted us to evaluate the aqueous (AE) and hexane (HE) extracts from A. adstringens in two models of acute inflammation: 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced ear edema and carrageenan-induced paw edema. The results showed that HE possesses dose-dependent activity, while AE showed no anti-inflammatory effect on TPA-induced edema. Reverse effects were found in the carrageenan test, wherein AE showed a 73.5% of inhibition of edema, while HE showed only a 14.4% activity at 100 mg/kg body weight. These results could indicate that AE and HE possess different anti-inflammatory mechanisms of action. On the other hand, it is known that masticadienonic (1) and 3alpha-hydroxymasticadienonic (2) acids are the main constituents of the organic extract of A. adstringens bark. Because of this knowledge, we tested 1 and 2 in the same experimental models. The results showed that 2 possesses a dose-dependent effect, while 1 does not show a dose-dependent response in TPA-induced edema. In carrageenan-induced edema tests, both 1 and 2 showed almost the same activity (approximately 44% inhibition at 100 mg/kg body weight). In order to determine whether the anti-inflammatory activities of AE, HE, 1 and 2 are involved in the alteration of inducible nitric oxide synthase (iNOS) activity, we evaluated these substances by examining nitric oxide generation in lipopolysaccharide (LPS)-activated peritoneal macrophages. The results showed that 1 presented the highest activity (93.3%), followed by 2 (86.5%), while AE (57%) and HE (33.6%) showed the lowest. In the cytotoxic MTT assay, however only 1 and 2 showed any activity whatsoever.

  4. A sulfated fucan from the brown alga Laminaria cichorioides has mainly heparin cofactor II-dependent anticoagulant activity.

    Science.gov (United States)

    Yoon, Seon-Joo; Pyun, Yu-Ryang; Hwang, Jae-Kwan; Mourão, Paulo A S

    2007-11-05

    The major acidic polysaccharide from the brown alga Laminaria cichorioides is a complex and heterogeneous sulfated fucan. Its preponderant structure is a 2,3-disulfated, 4-linked alpha-fucose unit. The purified polysaccharide has a potent anticoagulant activity, as estimated by APTT assay ( approximately 40 IU/mg), which is mainly mediated by thrombin inhibition by heparin cofactor II. It also accelerates thrombin and factor Xa inhibition by antithrombin but at a lower potency. Sulfated fucan from L. cichorioides is a promising anticoagulant polysaccharide and a possible alternative for an antithrombotic compound due to its preferential heparin cofactor II-dependent activity.

  5. In vitro anti-plasmodial activity of Dicoma anomala subsp. gerrardii (Asteraceae: identification of its main active constituent, structure-activity relationship studies and gene expression profiling

    Directory of Open Access Journals (Sweden)

    van Heerden Fanie R

    2011-10-01

    Full Text Available Abstract Background Anti-malarial drug resistance threatens to undermine efforts to eliminate this deadly disease. The resulting omnipresent requirement for drugs with novel modes of action prompted a national consortium initiative to discover new anti-plasmodial agents from South African medicinal plants. One of the plants selected for investigation was Dicoma anomala subsp. gerrardii, based on its ethnomedicinal profile. Methods Standard phytochemical analysis techniques, including solvent-solvent extraction, thin-layer- and column chromatography, were used to isolate the main active constituent of Dicoma anomala subsp. gerrardii. The crystallized pure compound was identified using nuclear magnetic resonance spectroscopy, mass spectrometry and X-ray crystallography. The compound was tested in vitro on Plasmodium falciparum cultures using the parasite lactate dehydrogenase (pLDH assay and was found to have anti-malarial activity. To determine the functional groups responsible for the activity, a small collection of synthetic analogues was generated - the aim being to vary features proposed as likely to be related to the anti-malarial activity and to quantify the effect of the modifications in vitro using the pLDH assay. The effects of the pure compound on the P. falciparum transcriptome were subsequently investigated by treating ring-stage parasites (alongside untreated controls, followed by oligonucleotide microarray- and data analysis. Results The main active constituent was identified as dehydrobrachylaenolide, a eudesmanolide-type sesquiterpene lactone. The compound demonstrated an in vitro IC50 of 1.865 μM against a chloroquine-sensitive strain (D10 of P. falciparum. Synthetic analogues of the compound confirmed an absolute requirement that the α-methylene lactone be present in the eudesmanolide before significant anti-malarial activity was observed. This feature is absent in the artemisinins and suggests a different mode of action

  6. Discovery and characteristics of the rapidly rotating active asteroid (62412) 2000 SY178 in the main belt

    Energy Technology Data Exchange (ETDEWEB)

    Sheppard, Scott S. [Department of Terrestrial Magnetism, Carnegie Institution for Science, 5241 Broad Branch Road. NW, Washington, DC 20015 (United States); Trujillo, Chadwick, E-mail: ssheppard@carnegiescience.edu [Gemini Observatory, 670 North A‘ohoku Place, Hilo, HI 96720 (United States)

    2015-02-01

    We report a new active asteroid in the main belt of asteroids between Mars and Jupiter. Object (62412) 2000 SY178 exhibited a tail in images collected during our survey for objects beyond the Kuiper Belt using the Dark Energy Camera on the CTIO 4 m telescope. We obtained broadband colors of 62412 at the Magellan Telescope, which, along with 62412's low albedo, suggests it is a C-type asteroid. 62412's orbital dynamics and color strongly correlate with the Hygiea family in the outer main belt, making it the first active asteroid known in this heavily populated family. We also find 62412 to have a very short rotation period of 3.33 ± 0.01 hours from a double-peaked light curve with a maximum peak-to-peak amplitude of 0.45 ± 0.01 mag. We identify 62412 as the fastest known rotator of the Hygiea family and the nearby Themis family of similar composition, which contains several known main belt comets. The activity on 62412 was seen over one year after perihelion passage in its 5.6 year orbit. 62412 has the highest perihelion and one of the most circular orbits known for any active asteroid. The observed activity is probably linked to 62412's rapid rotation, which is near the critical period for break-up. The fast spin rate may also change the shape and shift material around 62412's surface, possibly exposing buried ice. Assuming 62412 is a strengthless rubble pile, we find the density of 62412 to be around 1500 kg m{sup −3}.

  7. Antibacterial activity of propolis and its active principles alone and in combination with macrolides, beta-lactams and fluoroquinolones against microorganisms responsible for respiratory infections.

    Science.gov (United States)

    Speciale, A; Costanzo, R; Puglisi, S; Musumeci, R; Catania, M R; Caccamo, F; Iauk, L

    2006-04-01

    Propolis is produced by bees and is reported to have several pharmaceutical properties. Its antibacterial activity against strains causing upper respiratory tract infections is particularly important: propolis might be used as a therapeutic agent to prevent the bacterial infections that sometimes overlap viral infections. In this study the in vitro activity of both an alcoholic solution and a hydroglyceric extract of propolis, as well as its active principles, was tested against bacteria responsible for respiratory infections (Streptococcus pneumoniae, Haemophilus influenzae, Haemophilus parainfluenzae, Moraxella catarrhalis and Streptococcus pyogenes). We also evaluated the in vitro activity of a combination of propolis and its active principles and some beta-lactams, macrolides and fluoroquinolones. Our results, though not demonstrating a clearly synergistic activity between antibiotics and propolis and its constituents, show the possibility of using natural preparations, due to their antimicrobial and anti-inflammatory properties, to enhance antibacterial therapy.

  8. Methodological principles outline discipline "Organization studies-tourism activity" using information technologies.

    Directory of Open Access Journals (Sweden)

    Kozina Zh.L.

    2011-08-01

    Full Text Available The basic methodological principles of the disciplines of tourism and local history with information technology. 15 analyzed the literature and experience of leading experts in the field of sports and health tourism, and orienteering. Identified principles of academic disciplines of tourism and local history: the shift in emphasis from sports tourism to the cognitive, health tourism, the development of spiritual qualities, acquisition of life skills in nature, discovery and development of pedagogical and psychological abilities, character traits through the study of native land, the development of cognitive-research abilities, physical abilities, motor skills, application of modern information technology.

  9. [Civil responsibility of medical care activities in regard to the precautionary principle].

    Science.gov (United States)

    Le Foyer de Costil, H

    2000-01-01

    In the absence of a legal body regulating the precaution, do we have to confine the principle to public health? A negative answer is required at a time the medical liability is increasing more and more and the obligation to take all means is slipping toward to a strict obligation as to the result. The respect of the principle of precaution can be found in the obligation for the doctor to prove that he has fully informed the patient, but the medicine specificity requires delimitation of this obligation outlines.

  10. Evaluation of Essential Oil and its Three Main Active Ingredients of Chinese Chenopodium Ambrosioides (Family: Chenopodiaceae Against Blattella Germanica

    Directory of Open Access Journals (Sweden)

    Wei Xiang Zhu

    2012-12-01

    Full Text Available Background: The efficacy of essential oil of Chenopodium ambrosioides flowering aerial parts and its three mainactive ingredients was evaluated against Blattella germanica male adults.Methods: Composition of essential oil was determined by GC-MS. Topical application bioassay was used to evaluatecontact toxicity of essential oil and three main components. Fumigant toxicity of essential oil and its main components was measured using a sealed space method.Results: Twenty-two components were identified in the essential oil and the main components were (Z-ascaridole(29.7%, isoascaridole (13.0%, ρ-cymene (12.7% and piperitone (5.0%. The essential oil and (Z-ascaridole,isoascaridole and -cymene possessed fumigant toxicity against male German cockroaches with LC50 values of 4.13,0.55, 2.07 and 6.92 mg/L air, respectively. Topical application bioassay showed that all the three compounds weretoxic to male German cockroaches and (Z-ascaridole was the strongest with a LD50 value of 22.02 g/adult while the crude oil with a LD50 value of 67.46 g/adult.Conclusion: The essential oil from Chinese C. ambrosioides and its three main active ingredients may be explored as natural potential insecticides in the control of cockroaches.

  11. Mg II h + k emission lines as stellar activity indicators of main sequence F-K stars

    CERN Document Server

    Buccino, Andrea P

    2008-01-01

    The main purpose of this study is to use the IUE spectra in the analysis of magnetic activity of main sequence F-K stars. Combining IUE observations of MgII and optical spectroscopy of Ca II, the registry of ctivity of stars can be extended in time. We retrieved all the high-resolution spectra of F, G, and K main sequence stars observed by IUE (i.e. 1623 spectra of 259 F to K dwarf stars). We obtained the continuum surface flux near the Mg II h+k lines near 2800 \\AA and the MgII line-core surface flux from the IUE spectra. We obtained a relation between the mean continuum flux near the MgII lines with the colour $B-V$ of the star. For a set of 117 nearly simultaneous observations of Mg II and Ca II fluxes of 21 F5 to K3 main sequence stars, we obtained a colour dependent relation between the Mount Wilson CaII S-index and the MgII emission line-core flux. As an application of this calibration, we computed the Mount Wilson index for all the dF to dK stars which have high resolution IUE spectra. For some of the ...

  12. From CoRoT 102899501 to the Sun. A time evolution model of chromospheric activity on the main sequence

    CERN Document Server

    Gondoin, P; Fridlund, M; Frasca, A; Guenther, E W; Hatzes, A; Deeg, H J; Parviainen, H; Eigmueller, P; Deleuil, M

    2012-01-01

    Using a model based on the rotational modulation of the visibility of active regions, we analyse the high-accuracy CoRoT lightcurve of the active young star CoRoT102899501. Spectroscopic follow-up observations are used to derive its fundamental parameters. We compare its chromospheric activity level with a model of chrosmospheric activity evolution established by combining relationships between the R'HK index and the Rossby number with a recent model of stellar rotation evolution on the main sequence. We measure the spot coverage of the stellar surface as a function of time, and find evidence for a tentative increase from 5-14% at the beginning of the observing run to 13-29% 35 days later. A high level of magnetic activity on CoRoT102899501 is corroborated by a strong emission in the Balmer and Ca II HK lines (logR'HK ~ -4). The starspots used as tracers of the star rotation constrain the rotation period to 1.625+/-0.002 days and do not show evidence for differential rotation. The effective temperature (Teff=...

  13. Variability of stellar granulation and convective blueshift with spectral type and magnetic activity. I. K and G main sequence stars

    Science.gov (United States)

    Meunier, N.; Lagrange, A.-M.; Mbemba Kabuiku, L.; Alex, M.; Mignon, L.; Borgniet, S.

    2017-01-01

    Context. In solar-type stars, the attenuation of convective blueshift by stellar magnetic activity dominates the RV (radial velocity) variations over the low amplitude signal induced by low mass planets. Models of stars that differ from the Sun will require a good knowledge of the attenuation of the convective blueshift to estimate its impact on the variations. Aims: It is therefore crucial to precisely determine not only the amplitude of the convective blueshift for different types of stars, but also the dependence of this convective blueshift on magnetic activity, as these are key factors in our model producing the RV. Methods: We studied a sample of main sequence stars with spectral types from G0 to K2 and focused on their temporally averaged properties: the activity level and a criterion allowing to characterise the amplitude of the convective blueshift. This criterion is derived from the dependence of the convective blueshift with the intensity at the bottom of a large set of selected spectral lines. Results: We find the differential velocity shifts of spectral lines due to convection to depend on the spectral type, the wavelength (this dependence is correlated with the Teff and activity level), and on the activity level. This allows us to quantify the dependence of granulation properties on magnetic activity for stars other than the Sun. We are indeed able to derive a significant dependence of the convective blueshift on activity level for all types of stars. The attenuation factor of the convective blueshift appears to be constant over the considered range of spectral types. We derive a convective blueshift which decreases towards lower temperatures, with a trend in close agreement with models for Teff lower than 5800 K, but with a significantly larger global amplitude. Differences also remain to be examined in detail for larger Teff. We finally compare the observed RV variation amplitudes with those that could be derived from our convective blueshift using

  14. MAIN ABSTRACTS

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    The Historical Implications of the Dissemination of Materialist View of History in China Liang Zhu The formulation of materialist view of history constitutes a revolutionary leap. The wide dissemination of such view in China is contextualized by its social and revolutionary development. When the materialist view of history replaced the idealist one, and class analysis replaced evolutionism, Marxism became the guiding principle for social sciences in China. In the meantime, the basic principle of this view have been applied to the exploration of the practical issues in Chinese history and society, thus integrating Marxist theories into the Chinese revolutionary practices and making the materialist view of history a powerful weapon in the struggles of Chinese revolution. Therefore, revisiting the dissemination of the materialist view of history in China is of great significance to the cause of socialism with Chinese characteristics.

  15. Development of an Eccentric CAM Based Active Pre-Alignment System for the CLIC Main Beam Quadrupole Magnet

    CERN Document Server

    Lackner, F; Collette, C; Mainaud Durand, H; Hauviller, C; Kemppinen, J; Leuxe, R

    2010-01-01

    CLIC (Compact Linear Collider) is a study for a future electron-positron collider that would allow physicists to explore a new energy region beyond the capabilities of today's particle accelerators. The demanding transverse and vertical beam sizes and emittance specifications are resulting in stringent alignment and a nanometre stability requirement. In the current feasibility study, the main beam quadrupole magnets have to be actively pre-aligned with a precision of 1 µm in 5 degrees of freedom (d.o.f.) before being mechanically stabilized to the nm scale above 1 Hz. This contribution describes the approach of performing this active pre-alignment based on an eccentric cam system. In order to limit the amplification of the vibration sources at resonant frequencies a sufficiently high Eigenfrequency is required. Therefore the contact region between cam and support was optimized for adequate stiffness based on the Hertzian theory. Furthermore, practical tests performed on a single degree of freedom mock-up wil...

  16. Influence of pre-harvest red light irradiation on main phytochemicals and antioxidant activity of Chinese kale sprouts.

    Science.gov (United States)

    Deng, Mingdan; Qian, Hongmei; Chen, Lili; Sun, Bo; Chang, Jiaqi; Miao, Huiying; Cai, Congxi; Wang, Qiaomei

    2017-05-01

    The effects of pre-harvest red light irradiation on main healthy phytochemicals as well as antioxidant activity of Chinese kale sprouts during postharvest storage were investigated. 6-day-old sprouts were treated by red light for 24h before harvest and sampled for further analysis of nutritional quality on the first, second and third day after harvest. The results indicated that red light exposure notably postponed the degradation of aliphatic, indole, and total glucosinolates during postharvest storage. The vitamin C level was remarkably higher in red light treated sprouts on the first and second day after harvest when compared with the control. In addition, red light treatment also enhanced the accumulation of total phenolics and maintained higher level of antioxidant activity than the control. All above results suggested that pre-harvest red light treatment might provide a new strategy to maintain the nutritive value of Chinese kale sprouts during postharvest storage.

  17. The juridical nature of the European Court of Justice and the principles of its activity

    Directory of Open Access Journals (Sweden)

    Vilma Hasneziri

    2015-07-01

    In this work, especially in the second part, there shall be presented several decisions of the European Court of Justice as well, that have to do with its interpretation on the dispositions of the establishing Treaties as well as the analysis of the above mentioned principles. At the end of this work, there will be given its conclusions as well as the bibliography where it is based on.

  18. Antifungal Activity of the Essential Oil of Illicium verum Fruit and Its Main Component trans-Anethole

    Directory of Open Access Journals (Sweden)

    Qi Wang

    2010-10-01

    Full Text Available In order to identify natural products for plant disease control, the essential oil of star anise (Illicium verum Hook. f. fruit was investigated for its antifungal activity on plant pathogenic fungi. The fruit essential oil obtained by hydro-distillation was analyzed for its chemical composition by gas chromatography (GC and gas chromatography-mass spectrometry (GC-MS. trans-Anethole (89.5%, 2-(1-cyclopentenyl-furan (0.9% and cis-anethole (0.7% were found to be the main components among 22 identified compounds, which accounted for 94.6% of the total oil. The antifungal activity of the oil and its main component trans-anethole against plant pathogenic fungi were determined. Both the essential oil and trans-anethole exhibited strong inhibitory effect against all test fungi indicating that most of the observed antifungal properties was due to the presence of trans-anethole in the oil, which could be developed as natural fungicides for plant disease control in fruit and vegetable preservation.

  19. Principles of neural information processing

    CERN Document Server

    Seelen, Werner v

    2016-01-01

    In this fundamental book the authors devise a framework that describes the working of the brain as a whole. It presents a comprehensive introduction to the principles of Neural Information Processing as well as recent and authoritative research. The books´ guiding principles are the main purpose of neural activity, namely, to organize behavior to ensure survival, as well as the understanding of the evolutionary genesis of the brain. Among the developed principles and strategies belong self-organization of neural systems, flexibility, the active interpretation of the world by means of construction and prediction as well as their embedding into the world, all of which form the framework of the presented description. Since, in brains, their partial self-organization, the lifelong adaptation and their use of various methods of processing incoming information are all interconnected, the authors have chosen not only neurobiology and evolution theory as a basis for the elaboration of such a framework, but also syst...

  20. Transduction for pheromones in the main olfactory epithelium is mediated by the Ca2+ -activated channel TRPM5.

    Science.gov (United States)

    López, Fabián; Delgado, Ricardo; López, Roberto; Bacigalupo, Juan; Restrepo, Diego

    2014-02-26

    Growing evidence suggests that the main olfactory epithelium contains a subset of olfactory sensory neurons (OSNs) responding to pheromones. One candidate subpopulation expresses the calcium activated cation channel TRPM5 (transient receptor potential channel M5). Using GFP driven by the TRPM5 promoter in mice, we show that this subpopulation responds to putative pheromones, urine, and major histocompatibility complex peptides, but not to regular odors or a pheromone detected by other species. In addition, this subpopulation of TRPM5-GFP+ OSNs uses novel transduction. In regular OSNs, odorants elicit activation of the cyclic nucleotide-gated (CNG) channel, leading to Ca2+ gating of Cl- channels; in TRPM5-GFP+ OSNs, the Ca2+ -activated Cl- ANO2 (anoctamin 2) channel is not expressed, and pheromones elicit activation of the CNG channel leading to Ca2+ gating of TRPM5. In conclusion, we show that OSNs expressing TRPM5 respond to pheromones, but not to regular odors through the opening of CNG channels leading to Ca2+ gating of TRPM5.

  1. Variability of stellar granulation and convective blueshift with spectral type and magnetic activity. I. K and G main sequence stars

    CERN Document Server

    Meunier, N; Kabuiku, L Mbemba; Alex, M; Mignon, L; Borgniet, S

    2016-01-01

    In solar-type stars, the attenuation of convective blueshift by stellar magnetic activity dominates the RV variations over the low amplitude signal induced by low mass planets. Models of stars that differ from the Sun will require a good knowledge of the attenuation of the convective blueshift to estimate its impact on the variations. It is therefore crucial to precisely determine not only the amplitude of the convective blueshift for different types of stars, but also the dependence of this convective blueshift on magnetic activity, as these are key factors in our model producing the RV. We studied a sample of main sequence stars with spectral types from G0 to K2 and focused on their temporally averaged properties: the activity level and a criterion allowing to characterise the amplitude of the convective blueshift. We find the differential velocity shifts of spectral lines due to convection to depend on the spectral type, the wavelength (this dependence is correlated with the Teff and activity level), and o...

  2. The Factors and Transversal Reorganizations Principles of Romanian Textile Industry Enterprises using Activity-Based Costing Method

    Directory of Open Access Journals (Sweden)

    Sorinel Capusneanu

    2007-04-01

    Full Text Available This article describes the factors and the principles of transversal reorganization of the enterprises from the Romanian textile industry by adapting the Activity-Based Costing method (ABC to its specific. There are presented and analyzed the real possibilities of reorganization of the enterprises in Romania by elaboration of methodological phases that will be covered until the implementation of their transversal organization. Are we ready to adapt the Activity-Based Costing method to the specific of the Romanian textile industry and not only? Here is the question whose response we will find in this article.

  3. The “Main-Belt Comets” are not comets, nor active asteroids; they are temporary shaken asteroids

    Science.gov (United States)

    Tancredi, Gonzalo

    2015-08-01

    Several objects in asteroidal orbits have presented comaes and tails similar to the ones presented by comets for short period of times. There are at present 16 objects in this group. Several hypotheses have been proposed to explain the activity of this object [Jewitt 2012]. Among them, the most accepted scenario for many objects is the ice sublimation and the ejection of dust, in a similar way as the cometary activity. Therefore several authors have coined these objects “Main Belt Comets” [Hsieh & Jewitt 2006]. Nevertheless, in some cases, some authors have concluded that the ejection of dust must be due to an impact.We propose an alternative model for the formation of the dusty comaes and tails.The impact of a small body against a larger one initially produces a crater and the ejection of dust at high velocity (>100 m/s). The dust is rapidly dispersed and it should be only observable just after the impact. In addition the impact generates a shock wave, which propagates to the body interior. The asteroid is globally shaken. Material is ejected at low velocities from the entire surface, similar to the low escape velocities at the surface. The particles move away from the asteroid due to the solar radiation pressure, forming the thin tails aligned with the orbital plane. These tails could persist for various months, as they have been seen in these objects.In addition, chunks of rock could be ejected in suborbital flights lasting for days; which, at return they would induce a new low-velocity ejection of particles. This process can explain some of the long-lasting events.The recurrence of the activity for some objects could be explained due to the collision with a dense meteor shower present in the main-belt.The so-called “Main Belt Comets” could be explained with a hypothesis that does not require the presence of ice on the surface of these objects. We also do not favor the term “Activated asteroids”, because it implies some kind of endogenous process

  4. Design principles for oxygen-reduction activity on perovskite oxide catalysts for fuel cells and metal-air batteries.

    Science.gov (United States)

    Suntivich, Jin; Gasteiger, Hubert A; Yabuuchi, Naoaki; Nakanishi, Haruyuki; Goodenough, John B; Shao-Horn, Yang

    2011-06-12

    The prohibitive cost and scarcity of the noble-metal catalysts needed for catalysing the oxygen reduction reaction (ORR) in fuel cells and metal-air batteries limit the commercialization of these clean-energy technologies. Identifying a catalyst design principle that links material properties to the catalytic activity can accelerate the search for highly active and abundant transition-metal-oxide catalysts to replace platinum. Here, we demonstrate that the ORR activity for oxide catalysts primarily correlates to σ-orbital (e(g)) occupation and the extent of B-site transition-metal-oxygen covalency, which serves as a secondary activity descriptor. Our findings reflect the critical influences of the σ orbital and metal-oxygen covalency on the competition between O(2)(2-)/OH(-) displacement and OH(-) regeneration on surface transition-metal ions as the rate-limiting steps of the ORR, and thus highlight the importance of electronic structure in controlling oxide catalytic activity.

  5. Mitogen activated protein kinase signaling pathways participate in the active principle region of Buyang Huanwu decoction-induced differentiation of bone marrow mesenchymal stem cells

    Institute of Scientific and Technical Information of China (English)

    Jinghui Zheng; Jian Liang; Xin Deng; Xiaofeng Chen; Fasheng Wu; Xiaofang Zhao; Yuan Luo; Lei Fu; Zuling Jiang

    2012-01-01

    Our preliminary studies confirmed that an active principle region of Buyang Huanwu decoction, comprising alkaloid, polysaccharide, aglycon, glucoside and volatile oil, can induce bone marrow mesenchymal stem cell differentiation into neurons. Mitogen-activated protein kinase signaling was identified as one of the key pathways underlying this differentiation process. The present study shows phosphorylated extracellular signal-regulated protein kinase and phosphorylated p38 protein expression was increased after differentiation. Cellular signaling pathway blocking agents, PD98059 and SB203580, inhibited extracellular signal-regulated protein kinase and p38 in mitogen-activated protein kinase signaling pathways respectively. mRNA and protein expression of the neuronal marker, neuron specific enolase, and neural stem cell marker, nestin, were decreased in bone marrow mesenchymal stem cells after treatment with the active principle region of Buyang Huanwu decoction. Experimental findings indicate that, extracellular signal-regulated protein kinase and p38 in mitogen-activated protein kinase signaling pathways participate in bone marrow mesenchymal stem cell differentiation into neuron-like cells, induced by the active principle region of Buyang Huanwu decoction.

  6. Understanding the main route of drug entry in adult Fasciola hepatica: Further insights into closantel pharmacological activity.

    Science.gov (United States)

    Ceballos, L; Canton, C; Cadenazzi, G; Larsen, K; Virkel, G; Moreno, L; Fairweather, I; Lanusse, C; Alvarez, L

    2017-10-01

    Closantel (CLS) is highly effective against adult liver flukes after its oral or subcutaneous (sc) administration in ruminants. Trans-tegumental diffusion and oral ingestion are the two potential routes available for the entry of drugs into Fasciola hepatica. The work reported here contributes to improve the understanding of CLS pharmacology. The main goals of were: I) to determine the pattern of in vivo CLS accumulation into adult F. hepatica and relevant tissues in CLS-treated sheep; II) to investigate the influence of the physicochemical composition of the incubation medium on the CLS diffusion process into adult F. hepatica; III) to assess the ovicidal activity of CLS against F. hepatica eggs; and IV) to investigate the in vivo effect of CLS treatment on glutathione S-transferases activity in adult liver flukes exposed to CLS. Fourteen healthy sheep were each orally infected with 75 F. hepatica metacercariae. Sixteen (16) weeks after infection, animals were treated with CLS by oral (n = 6, 10 mg/kg) or sub-cutaneous (sc) (n = 6, 5 mg/kg) route. At 12, 24 and 36 h post-treatment, animals were sacrificed (n = 2) and samples of blood, bile and adult F. hepatica were collected. In addition, flukes recovered from non-treated sheep (n = 2) were ex vivo incubated (60 min) in the presence of CLS in either RPMI or bile as incubation medium. CLS concentration was measured by HPLC. The ovicidal activity of CLS was investigated using eggs obtained from the bile of untreated sheep. Finally, glutathione S-transferase activity in F. hepatica recovered from untreated and CLS-treated sheep was assessed. In the in vivo studies, the highest CLS concentrations were measured in plasma and adult liver flukes. A positive correlation was observed between CLS concentration in plasma and in F. hepatica. Results obtained in the current work indicate that the in vivo accumulation of CLS into adult liver flukes occurs mainly by the oral route. After ex

  7. Observation and modeling of main sequence star chromospheres. 3: Differential analysis of hydrogen lines versus activity level in M dwarfs

    Science.gov (United States)

    Houdebine, E. R.; Doyle, J. G.; Koscielecki, M.

    1995-02-01

    We use the constraints at the extremes in magnetic activity level to simulate the effect of varying magnetic non-thermal heating in dM and dMe chromospheres by varying the transition region pressure and temperature minimum. We built four grids of model atmospheres with temperature minimum either at 2,660 K or 3,000 K, and a range of transition region pressure. We found that when decreasing the transition region pressure (i.e. the chromospheric temperature gradient), the Balmer lines change rapidly from emission to strong absorption, then the profiles weaken and become narrower until they disappear totally (zero Halpha stars). The Paschen and Brackett series exhibit a qualitatively similar behavior, but the `emission domain' is at a higher column mass. The Brackett lines never really develop a strong absorption. In opposition with other series, the Lyman lines show a monotonous decrease and even change to absorption for very low density models. These differences are useful spectral diagnostics for M dwarf atmospheres. All hydrogen series, except the Lyman series for intermediate and high pressures, are sensitive to the temperature minimum when large changes are considered. We also investigated the effect of the temperature break zone and found it is important only for high pressure atmospheres. Our grids of models successfully reproduce all type of observed Halpha profiles: (1) high activity with strong emission and weak self-reversal, (2) filled in intermediate activity with inner wings in emission and the core in absorption, (3) intermediate activity with strong and broad absorption, (4) low activity with weak and narrow absorption, (5) `zero activity' with an undetectable profile. We discuss the line characteristics over this wide range of physical conditions. We analyze the ionization fraction and electron density for our series of chromospheres. Changes in the ionization fraction are important throughout the pressure range. Heavy elements are the main electron

  8. Anxiolytic activity and active principles of Piper amalago (Piperaceae), a medicinal plant used by the Q'eqchi' Maya to treat susto, a culture-bound illness.

    Science.gov (United States)

    Mullally, M; Cayer, C; Muhammad, A; Walshe-Roussel, B; Ahmed, F; Sanchez-Vindas, P E; Otarola Rojas, M; Merali, Z; Cal, V; Durst, T; Trudeau, V L; Arnason, J T

    2016-06-05

    The medicinal plant, Piper amalago L. (Piperaceae), is used traditionally by Q'eqchi' Maya healers for the treatment of "susto" a culture-bound syndrome. Previous research suggests that susto symptoms may be a manifestation of anxiety. The objectives were to characterize the effect of ethanolic extract of P. amalago in behavioral assays of anxiety at doses representative of traditional use and to isolate active principles. Rats treated orally with low dose ethanolic extracts of P. amalago leaves (8-75mg/kg) were tested in several behavioral paradigms including the elevated plus maze (EPM), social interaction (SI), and conditioned emotional response (CER) tests, and compared to diazepam, a positive control. The active anxiolytic principle was isolated by bioassay guided isolation using an in vitro GABAA competitive binding assay. Extracts had significant anxiolytic activity in all behavioral tests, with the strongest activity in the SI and the CER paradigms. In an in vitro GABAA competitive binding assay, a 66.5µg/mL concentration of P. amalago ethanol extract displaced 50% of the GABAA-BZD receptor ligand [(3)H]-Flunitrazepam. Bioassay-guided fractionation identified a furofuran lignan, a molecule with structural similarity to yangambin, with high affinity for the GABAA-BZD receptor as the principle bioactive. The results suggest that the ethnobotanical use of this plant may have a pharmacological basis in its anxiolytic activity, as demonstrated in animal behaviour tests. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Reproductive phenology of the American Bullfrog in subtropical Brazil: photoperiod as a main determinant of seasonal activity

    Directory of Open Access Journals (Sweden)

    CAMILA I. MEDEIROS

    2016-01-01

    Full Text Available ABSTRACT The North American bullfrog Lithobates catesbeianus continues to invade ecosystems worldwide, potentially causing population declines and even extinctions. Within its native distribution, bullfrogs show prolonged reproductive seasons and high fertility. However, data on breeding biology of bullfrogs ex-situ in invaded localities mainly comes from anecdotal reports. Understanding how invasive species are adjusting their life histories to new colonized environments is important for conservation purposes. Here we describe temporal and spatial abundance, calling activity, spawning and tadpole distribution of bullfrogs in southern Brazil. Eighteen samplings occurred during one year. The abundance of individuals was positively related to longer photoperiods and higher temperatures. Reproductive activity was also positively associated with longer photoperiods. Calling sites, spawning and tadpoles were associated with microhabitats presenting hydrophytes, which may provide shelter and thermal stability to bullfrogs. The reproductive seasonal activity of bullfrogs can be highly variable across its growing geographical range, but in subtropical Brazil it is associated with photoperiod, a highly predictable abiotic determinant. In our study area, bullfrogs presented a breeding season twice as long as that observed in some native localities. We suggest that management strategies directed to bullfrog populations must consider the habitat structures and seasonal regimes determined by each invaded environment.

  10. Solar sensor activated and computer controlled shading system -- Field study at the San Francisco New Main Library

    Energy Technology Data Exchange (ETDEWEB)

    Jain, P.

    1999-07-01

    This paper presents the result of the post-occupancy evaluation of MechoShade Systems{trademark} AAC-PC Window Management Program at the San Francisco New Main Public Library. The AAC-PC Window Management Program is a solar sensor activated (Li-Cor Radiometers) and PC computer controlled shading system. The purpose of this research was to inform the building design community about the occupant response to the new technology of automatic shading. There was a double need for this research because of the (1) Rising trend of automatic shading system applications specially in large office or public buildings, and (2) Significant lack of published reports on post-occupancy evaluation of any type of automatic shading systems. The automatic shading system in the new main San Francisco Public Library has had continuous problems since the building opened in 1996. The library staff has been experiencing low to high level of many environmental discomforts. Occupant comfort and satisfaction should be an important design criteria for the long term success of any new technology in buildings whether it is for solar control, energy efficiency, or any other purpose.

  11. [The main ways in performing analysis of the activities of medical supply organizations of the Armed Forces].

    Science.gov (United States)

    Stavila, A G; Krasavin, K D; Levchenko, V N; Lemeshko, A L

    2015-06-01

    Without a complex comprehensive analysis of the activities of medical supply organizations is impossible to effectively manage the processes of provision of medical equipment and property, and provide a quality control of finished products and magistral formulas, technical and metrological provision of medical services and to render better decisions. In this regard, the article provides a list of pharmaceutical services (works) provided by medical supply organizations of the Armed Forces of the Russian Federation and proposes indicators in assessing their effectiveness. Examples of analysis and assessment of the main indicators of provided services (works) in absolute values are given. At the same time, the authors give the ways of solutions aimed at increasing the motivation of various specialists to improve the quality of performance indicators in the medical equipment and property support centres of the Ministry of Defense of the Russian Federation.

  12. The Rethinking of the Economic Activity Based on Principles of Eco-Efficiency

    Directory of Open Access Journals (Sweden)

    Daniela VÎRJAN

    2011-07-01

    Full Text Available Drought, floods, damaging storms, heat waves, acid rain, climate changes are but a few of the consequences of human action upon the environment. Can we possibly live against the environment? The answer is NO, and as such we must run an economy which respects the principles of eco-efficiency because only so can economic progress go on. Green economy is a great opportunity for all of the world’s countries, and is a real economy which keeps the resource-needs and environment relation in balance, aims towards quality and not quantity, lays emphasis on regeneration, recycling, reuse and creativity. Eco-efficiency implies both innovation towards a high degree of product dematerialization, services and systems, alongside with greatly changing current production and consumption practices. If we produce based on the principle of eco-efficiency we can reduce the effects of the profound economic, ecological, socio-political and cultural-spiritual crisis which marks our planet and countries.

  13. The Ccr4-Not deadenylase complex constitutes the main poly(A) removal activity in C. elegans.

    Science.gov (United States)

    Nousch, Marco; Techritz, Nora; Hampel, Daniel; Millonigg, Sophia; Eckmann, Christian R

    2013-09-15

    Post-transcriptional regulatory mechanisms are widely used to control gene expression programs of tissue development and physiology. Controlled 3' poly(A) tail-length changes of mRNAs provide a mechanistic basis of such regulation, affecting mRNA stability and translational competence. Deadenylases are a conserved class of enzymes that facilitate poly(A) tail removal, and their biochemical activities have been mainly studied in the context of single-cell systems. Little is known about the different deadenylases and their biological role in multicellular organisms. In this study, we identify and characterize all known deadenylases of Caenorhabditis elegans, and identify the germ line as tissue that depends strongly on deadenylase activity. Most deadenylases are required for hermaphrodite fertility, albeit to different degrees. Whereas ccr-4 and ccf-1 deadenylases promote germline function under physiological conditions, panl-2 and parn-1 deadenylases are only required under heat-stress conditions. We also show that the Ccr4-Not core complex in nematodes is composed of the two catalytic subunits CCR-4 and CCF-1 and the structural subunit NTL-1, which we find to regulate the stability of CCF-1. Using bulk poly(A) tail measurements with nucleotide resolution, we detect strong deadenylation defects of mRNAs at the global level only in the absence of ccr-4, ccf-1 and ntl-1, but not of panl-2, parn-1 and parn-2. Taken together, this study suggests that the Ccr4-Not complex is the main deadenylase complex in C. elegans germ cells. On the basis of this and as a result of evidence in flies, we propose that the conserved Ccr4-Not complex is an essential component in post-transcriptional regulatory networks promoting animal reproduction.

  14. Generation of recombinant single-chain antibodies neutralizing the cytolytic activity of vaginolysin, the main virulence factor of Gardnerella vaginalis

    Directory of Open Access Journals (Sweden)

    Pleckaityte Milda

    2011-11-01

    Full Text Available Abstract Background Gardnerella vaginalis is identified as the predominant colonist of the vaginal tract in women with bacterial vaginosis. Vaginolysin (VLY is a protein toxin released by G. vaginalis. VLY possesses cytolytic activity and is considered as a main virulence factor of G. vaginalis. Inhibition of VLY-mediated cell lysis by antibodies may have important physiological relevance. Results Single-chain variable fragments of immunoglobulins (scFvs were cloned from two hybridoma cell lines producing neutralizing antibodies against VLY and expressed as active proteins in E. coli. For each hybridoma, two variants of anti-VLY scFv consisting of either VL-VH or VH-VL linked with a 20 aa-long linker sequence (G4S4 were constructed. Recovery of scFvs from inclusion bodies with subsequent purification by metal-chelate chromatography resulted in VLY-binding proteins that were predominantly monomeric. The antigen-binding activity of purified scFvs was verified by an indirect ELISA. The neutralizing activity was investigated by in vitro hemolytic assay and cytolytic assay using HeLa cell line. Calculated apparent Kd values and neutralizing potency of scFvs were in agreement with those of parental full-length antibodies. VH-VL and VL-VH variants of scFvs showed similar affinity and neutralizing potency. The anti-VLY scFvs derived from hybridoma clone 9B4 exhibited high VLY-neutralizing activity both on human erythrocytes and cervical epithelial HeLa cells. Conclusions Hybridoma-derived scFvs with VLY-binding activity were expressed in E. coli. Recombinant anti-VLY scFvs inhibited VLY-mediated cell lysis. The monovalent scFvs showed reduced affinity and neutralizing potency as compared to the respective full-length antibodies. The loss of avidity could be restored by generating scFv constructs with multivalent binding properties. Generated scFvs is the first example of recombinant single-chain antibodies with VLY-neutralizing activity produced in

  15. Turbine main engines

    CERN Document Server

    Main, John B; Herbert, C W; Bennett, A J S

    1965-01-01

    Turbine Main Engines deals with the principle of operation of turbine main engines. Topics covered include practical considerations that affect turbine design and efficiency; steam turbine rotors, blades, nozzles, and diaphragms; lubricating oil systems; and gas turbines for use with nuclear reactors. Gas turbines for naval boost propulsion, merchant ship propulsion, and naval main propulsion are also considered. This book is divided into three parts and begins with an overview of the basic mode of operation of the steam turbine engine and how it converts the pressure energy of the ingoing ste

  16. Arachnids of medical importance in Brazil: main active compounds present in scorpion and spider venoms and tick saliva.

    Science.gov (United States)

    Cordeiro, Francielle A; Amorim, Fernanda G; Anjolette, Fernando A P; Arantes, Eliane C

    2015-01-01

    Arachnida is the largest class among the arthropods, constituting over 60,000 described species (spiders, mites, ticks, scorpions, palpigrades, pseudoscorpions, solpugids and harvestmen). Many accidents are caused by arachnids, especially spiders and scorpions, while some diseases can be transmitted by mites and ticks. These animals are widely dispersed in urban centers due to the large availability of shelter and food, increasing the incidence of accidents. Several protein and non-protein compounds present in the venom and saliva of these animals are responsible for symptoms observed in envenoming, exhibiting neurotoxic, dermonecrotic and hemorrhagic activities. The phylogenomic analysis from the complementary DNA of single-copy nuclear protein-coding genes shows that these animals share some common protein families known as neurotoxins, defensins, hyaluronidase, antimicrobial peptides, phospholipases and proteinases. This indicates that the venoms from these animals may present components with functional and structural similarities. Therefore, we described in this review the main components present in spider and scorpion venom as well as in tick saliva, since they have similar components. These three arachnids are responsible for many accidents of medical relevance in Brazil. Additionally, this study shows potential biotechnological applications of some components with important biological activities, which may motivate the conducting of further research studies on their action mechanisms.

  17. Antiviral activity of the Lippia graveolens (Mexican oregano essential oil and its main compound carvacrol against human and animal viruses

    Directory of Open Access Journals (Sweden)

    Marciele Ribas Pilau

    2011-12-01

    Full Text Available Mexican oregano (Lippia graveolens is a plant found in Mexico and Central America that is traditionally used as a medicinal herb. In the present study, we investigated the antiviral activity of the essential oil of Mexican oregano and its major component, carvacrol, against different human and animal viruses. The MTT test (3-4,5-dimethythiazol-2yl-2,5-diphenyl tetrazolium bromide was conducted to determine the selectivity index (SI of the essential oil, which was equal to 13.1, 7.4, 10.8, 9.7, and 7.2 for acyclovir-resistant herpes simplex virus type 1 (ACVR-HHV-1, acyclovir-sensitive HHV-1, human respiratory syncytial virus (HRSV, bovine herpesvirus type 2 (BoHV-2, and bovine viral diarrhoea virus (BVDV, respectively. The human rotavirus (RV and BoHV-1 and 5 were not inhibited by the essential oil. Carvacrol alone exhibited high antiviral activity against RV with a SI of 33, but it was less efficient than the oil for the other viruses. Thus, Mexican oregano oil and its main component, carvacrol, are able to inhibit different human and animal viruses in vitro. Specifically, the antiviral effects of Mexican oregano oil on ACVR-HHV-1 and HRSV and of carvacrol on RV justify more detailed studies.

  18. Analysis and Assessment of Main Economic Indicators of Activity of Agro-industrial Enterprises of the Autonomous Republic of Crimea

    Directory of Open Access Journals (Sweden)

    Reznikova Olha S.

    2014-03-01

    Full Text Available The goal of the article lies in analysis of the modern state of the level of resource availability and efficiency of functioning of agro-industrial enterprises of the Crimean region. The article studies works of scientists, considers problems of concentration of agro-industrial production and land resources, economic efficiency of agro-industrial production and factors of its increase, however, issues of analysis and assessment of activity of agro-industrial enterprises of the AR Crimea stay unstudied. The article analyses and assesses main economic indicators of activity of agro-industrial enterprises of the Crimean regions, studies the state of efficiency of production of agricultural products in agro-formations of the region and also assesses the modern state of efficiency of functioning of agro-industrial enterprises of the AR of Crimea. The article offers prospective directions of increase of efficiency of functioning of agro-industrial enterprises that include technical re-equipment of production, increase of a number of people engaged in production of agricultural products and significant increase of well-being of a rural worker.

  19. Fusion research principles

    CERN Document Server

    Dolan, Thomas James

    2013-01-01

    Fusion Research, Volume I: Principles provides a general description of the methods and problems of fusion research. The book contains three main parts: Principles, Experiments, and Technology. The Principles part describes the conditions necessary for a fusion reaction, as well as the fundamentals of plasma confinement, heating, and diagnostics. The Experiments part details about forty plasma confinement schemes and experiments. The last part explores various engineering problems associated with reactor design, vacuum and magnet systems, materials, plasma purity, fueling, blankets, neutronics

  20. Growth inhibition and differentiation of promyelocytic cells (HL-60) induced by BC-4, an active principle from Boswellia carterii Birdw.

    Science.gov (United States)

    Jing, Y; Xia, L; Han, R

    1992-03-01

    The induction of cell differentiation and growth inhibition of HL-60 cells by Bc-4, an active principle from Boswellia carterii, was studied in vitro and in vivo. The proliferation of HL-60 cells was found to be inhibited by Bc-4 at a concentration of 5-10 micrograms/ml. Under the action of Bc-4, the acid phosphatase and NBT reduction activities in HL-60 cells were increased, and phagocytosis of cells was also induced. All these activities were concentration dependent. The HL-60 cells were induced by Bc-4 to differentiate into more mature cells morphologically. The in vivo growth of HL-60 cells in mouse subrenal capsules (SRC) and in diffusion chambers inoculated into mice was inhibited by Bc-4 at a dose of 50 mg/kg. The morphology of HL-60 cells treated by Bc-4 in diffusion chambers exhibited characteristics of mature granulocytic cells.

  1. Can We Forecast 1-Month Span Aftershock Activity from the First Day Data after the Main Shock?

    Science.gov (United States)

    Omi, T.; Ogata, Y.; Hirata, Y.; Aihara, K.

    2014-12-01

    A large earthquake triggers persistent aftershock activity in and near the focal region. Thus, intermediate term forecasting of aftershocks at its earlier stage is important for mitigating seismic risks. A main difficulty for the early forecasting is the substantial incompleteness of early aftershock data. To deal with such incomplete data, we have developed a statistical model of the incomplete data, enabling us to obtain the immediate estimate of the forecasting models from incomplete data [1, 2]. Another difficulty for the intermediate term forecasting is that we have to determine the parameter values of the forecasting models with high accuracy, because even a small bias in the parameter values can lead to a significant bias of the forecasting in intermediate term. However such accurate estimation is quite difficult at the early stage, especially using the early and incomplete data. Here we present a Bayesian forecasting method by using the epidemic-type aftershock sequence (ETAS) model. The Bayesian forecasting considers not only the best parameter values such as the maximum likelihood estimates or maximum a posteriori estimates but also the estimation uncertainty of the parameter values. By analyzing aftershock sequences in Japan, we show the forecasting performances of the intermediate-term aftershocks can be significantly improved by considering the estimation uncertainty of the ETAS model [3]. Furthermore, we discuss the impact of the modeling of the magnitude frequency distribution of detected aftershocks within a day span on the forecasting of large aftershocks. [1] T. Omi, Y. Ogata, Y. Hirata and K. Aihara, "Forecasting large aftershocks within one day after the main shock", Scientific Reports 3, 2218 (2013). [2] T. Omi, Y. Ogata, Y. Hirata and K. Aihara, "Estimating the ETAS model from an early aftershock sequence", Geophysical Research Letters 41, 850 (2014). [3] T. Omi, Y. Ogata, Y. Hirata and K. Aihara, "Intermediate-term forecasting of aftershocks

  2. Mechanisms Underlying the Antinociceptive, Antiedematogenic, and Anti-Inflammatory Activity of the Main Flavonoid from Kalanchoe pinnata

    Directory of Open Access Journals (Sweden)

    Raquel Teixeira Ferreira

    2014-01-01

    Full Text Available Kalanchoe pinnata (KP is popularly used for treating inflammatory diseases. This study investigated the antinociceptive, antiedematogenic, and anti-inflammatory potential of the subcutaneous administration of KP flower aqueous extract (KPFE, its ethyl acetate (EtOAcF and butanol (BuOHF fractions, and the main KP flavonoid [quercetin 3-O-α-L-arabinopyranosyl (1→2 α-L-rhamnopyranoside] (KPFV in mice, as well as its possible mechanisms of action. KPFE (30–300 mg/kg and KPFV (1–10 mg/kg inhibited the acetic acid-induced writhing (ID50 = 164.8 and 9.4 mg/kg, resp.. KPFE (300 mg/kg, EtOAcF (12 mg/kg, BuOHF (15 mg/kg, or KPFV (0.3–3.0 mg/kg reduced leukocyte migration on carrageenan-induced pleurisy (ID50 = 2.0 mg/kg for KPFV. KPFE (3–30 mg/kg and KPFV (0.3–3.0 mg/kg reduced the croton oil-induced ear edema (ID50 = 4.3 and 0.76 mg/kg, resp.. KPFE and KPFV reduced the TNF-α concentration in the pleural exudates on carrageenan-induced pleurisy test. Moreover, KPFV inhibited COX-1 (IC50 = 22.1 μg/mL and COX-2 (IC50 > 50 μg/mL. The selectivity index (COX-1IC50/COX-2IC50 was <0.44. These results indicate that KPFE and KPFV produced antinociceptive, antiedematogenic, and anti-inflammatory activities through COX inhibition and TNF-α reduction, revealing that the main flavonoid in KP flowers and leaves plays an important role in the ethnomedicinal use of the plant.

  3. Ability to perform activities of daily living is the main factor affecting quality of life in patients with dementia

    Directory of Open Access Journals (Sweden)

    Andersen Kjeld

    2004-09-01

    Full Text Available Abstract Background Dementia is a chronic illness associated with a progressive loss of cognitive and intellectual abilities, such as memory, judgment and abstract thinking. The objective of this study was to assess the health utilities of patients with dementia in Europe and identify the key factors influencing their Health-Related Quality of Life (HRQol. Methods This study used cross-sectional data from the Odense study; a Danish cohort of patients aged 65–84 living in Odense, Denmark. A total of 244 patients with mild to severe dementia were interviewed together with a caregiver about their health status and activities of daily living (ADL. Alzheimer's disease was diagnosed according to the NINCDS-ADRDA criteria for probable dementia. Vascular dementia and other types of dementia were diagnosed according to the DSM-IIIR criteria. Severity of dementia was defined by score intervals on the Mini Mental State Examination score: mild (MMSE 20–30, moderate (MMSE 10–19, and severe (MMSE 0–9. Based on the ADL information, the patients' dependency level was defined as either dependent or independent. Questions from the Odense Study were mapped into each of the five dimensions of the EQ-5D in order to assess patients' HRQol. Danish EQ-5D social tariffs were used to value patients' HRQol. A regression analysis of EQ-5D values was conducted with backward selection on gender, age, severity, ADL level and setting in order to determine the main factor influencing HRQoL. Results The EQ-5D weight in patients independent upon others in ADL was 0.641 (95% CI: [0.612–0.669], and in those dependent upon others was 0.343 (95% CI: [0.251–0.436]. Conclusion Dependency upon others to perform ADL was the main factor affecting HRQoL.

  4. Main Memory

    NARCIS (Netherlands)

    P.A. Boncz (Peter); L. Liu (Lei); M. Tamer Özsu

    2008-01-01

    htmlabstractPrimary storage, presently known as main memory, is the largest memory directly accessible to the CPU in the prevalent Von Neumann model and stores both data and instructions (program code). The CPU continuously reads instructions stored there and executes them. It is also called Random

  5. Gamescape Principles

    DEFF Research Database (Denmark)

    Nobaew, Banphot; Ryberg, Thomas

    2011-01-01

    This paper proposes a new theoretical framework or visual grammar for analysing visual aspects of digital 3D games, and for understanding more deeply the notion of Visual Digital Game Literacy. The framework focuses on the development of a visual grammar by drawing on the digital literacy framewo...... as to understand how learners posses or can develop broader critical media literacies and visual digital literacies in education.......This paper proposes a new theoretical framework or visual grammar for analysing visual aspects of digital 3D games, and for understanding more deeply the notion of Visual Digital Game Literacy. The framework focuses on the development of a visual grammar by drawing on the digital literacy framework...... and interviews) collected during a game workshop where students, studying to become game designers, developed a number of games. The visual digital literacy framework we propose consists of five main major components: Gamescape Principles, Interpretation, Style, Experiences and Practices. For the purpose...

  6. Main Memory

    OpenAIRE

    Boncz, Peter; Liu, Lei; Özsu, Tamer, M.

    2008-01-01

    Primary storage, presently known as main memory, is the largest memory directly accessible to the CPU in the prevalent Von Neumann model and stores both data and instructions (program code). The CPU continuously reads instructions stored there and executes them. It is also called Random Access Memory (RAM), to indicate that load/store instructions can access data at any location at the same cost, is usually implemented using DRAM chips, which are connected to the CPU and other peripherals (di...

  7. "JCE" Classroom Activity #108. Using Archimedes' Principle to Explain Floating and Sinking Cans

    Science.gov (United States)

    Sanger, Michael J.

    2011-01-01

    In this activity, students (working alone or in groups) measure the mass of several soda cans (diet and regular soda) along with the mass of water that each can displaces. The students are then asked to compare these two mass values for the sinking cans and for the floating cans. The purpose of this activity is for students to determine that the…

  8. "JCE" Classroom Activity #108. Using Archimedes' Principle to Explain Floating and Sinking Cans

    Science.gov (United States)

    Sanger, Michael J.

    2011-01-01

    In this activity, students (working alone or in groups) measure the mass of several soda cans (diet and regular soda) along with the mass of water that each can displaces. The students are then asked to compare these two mass values for the sinking cans and for the floating cans. The purpose of this activity is for students to determine that the…

  9. Distributed smart home activity recommender system using hidden Markov model principles

    DEFF Research Database (Denmark)

    Lynggaard, Per

    2013-01-01

    A smart home is able to propose learned activities to its user and learn new activities by observing the user’s behavioral patterns, that is, the user’s actions. Most of today’s discussed systems use some more or less complex classifier algorithms to predict user activities from contextual...... information provided by sensors. However, an alternative concept using a distributed framework is presented in this paper. It offers the possibility of combining simple low level activity classifiers with a more sophisticated one. The high level classifier has been modeled in Java and tested on a publicly...... available data set that offers approximately seven months of annotated activity including 6468 sensor events produced by a women living in the test home. Using this data set, it has been shown that this system can achieve good performance with a recognition probability of 75%....

  10. Identification and compatibility of the major active principles in some new natural origin antiseptics

    Science.gov (United States)

    Nikolić, G. S.; Zlatković, S.; Nikolić, N.

    2009-09-01

    The newly established instrumentation of HPLC/DAD, FTIR, and NMR techniques have been applied for simultaneous identification and physicochemical compatibility determination of the potential major antiseptic constituents ( Hypericum perforatum L. and Usnea barbata extracts) which can be present in some new origin pharmaceutical preparation. Based on the obtained results the conclusion is that a simultaneous use of the analyzed constituents in production of some new preparations with antiseptic properties is possible. The chromatographic separation of antiseptic mixture was performed on a RP-HPLC C18 column. For the NMR detection, the analytes eluted from LC column were trapped and hereafter transported into the NMR flow-cell. The NMR and FTIR techniques allowed the characterization of the major constituent of Hypericum perforatum L., mainly hypericin, as well as of Usnea barbata, mainly usnic acid.

  11. Anti-plasmodial activity of Dicoma tomentosa (Asteraceae and identification of urospermal A-15-O-acetate as the main active compound

    Directory of Open Access Journals (Sweden)

    Jansen Olivia

    2012-08-01

    highlighted the very promising anti-plasmodial activity of D. tomentosa and enabled to identify its main active compound, urospermal A-15-O-acetate. The high anti-plasmodial activity of this compound merits further study about its anti-plasmodial mechanism of action. The active extracts of D. tomentosa, as well as urospermal A 15-O-acetate, displayed only a moderate selectivity, and further studies are needed to assess the safety of the use of the plant by the local population.

  12. A Cu-amyloid β complex activating Fenton chemistry in Alzheimer's disease: Learning with multiple first-principles simulations

    Science.gov (United States)

    La Penna, Giovanni; Hureau, Christelle; Faller, Peter

    2014-10-01

    Amyloid β peptides form complexes with copper, both in vitro and in vivo, relatively soluble in water as oligomers and active as catalysts for oxidation of organic substrates by hydrogen peroxide, a species always present in cells and in their aerobic environment. All these species are present in the synapse, thus making a connection between the amyloid cascade hypothesis and the oxidative damages by reactive oxygen species in neurons, when pathological dishomeostasis of amyloid peptides and metal ions occur. In order to understand the structural features of these toxic complexes, we built several models of Cu-Aβ peptides in monomeric and dimeric forms and we found, performing multiple first-principles molecular dynamics simulations, that Cu-induced dimers are more active than monomers in converting hydrogen peroxide into aggressive hydroxyl radicals.

  13. Main factors controlling microbial community structure, growth and activity after reclamation of a tailing pond with aided phytostabilization

    Science.gov (United States)

    Zornoza, Raúl; Acosta, José A.; Martínez-Martínez, Silvia; Faz, Ángel; Bååth, Erland

    2015-04-01

    Reclamation on bare tailing ponds has the potential to represent soil genesis in Technosols favoring the understanding of the changes of microbial communities and function. In this study we used phytostabilization aided with calcium carbonate and pig slurry/manure to reclaim an acidic bare tailing pond with the aim of investigating the effect of amending and different species on microbial community structure and function. We sampled after two years of amending and planting: unamended tailing soil (UTS), non-rhizospheric amended tailing soil (ATS), rhizospheric soil from four species, and non-rhizospheric native forest soil (NS), which acted as reference. The application of amendments increased pH up to neutrality, organic carbon (Corg), C/N and aggregate stability, while decreased salinity and heavy metals availability. No effect of rhizosphere was observed on physicochemical properties, metals immobilization and microbial community structure and function. To account for confounding effects due to soil organic matter, microbial properties were expressed per Corg. The high increments in pH and Corg have been the main factors driving changes in microbial community structure and function. Bacterial biomass was higher in UTS, without significant differences among the rest of soils. Fungal biomass followed the trend UTS growth increased and fungal growth decreased with increasing pH, despite the high availability of metals at low pH. Enzyme activities were lower in UTS, being β-glucosidase and β-glucosaminidase activities highly correlated with bacterial growth. Microbial activities were not correlated with the exchangeable fraction of heavy metals, indicating that microbial function is not strongly affected by these metals, likely due to the efficiency of the reclamation procedure to reduce metals toxicity. Changes in microbial community composition were largely explained by changes in pH, heavy metals availability and Corg, with increments in fungal and

  14. Principles of private law

    OpenAIRE

    Andraško, Richard

    2011-01-01

    Principles of private law The reason of choosing "Principles of private law" for my thesis is that private law is built on untouchable values. For example, basic values like freedom and equality, which are represented by these principles. Many of them are indispensable in the relation of functionality of the whole system of law. Most of them have Roman law origin. The purpose of my thesis is to describe and summarize the main principles of private law that mostly appear in Czech law, especial...

  15. Strategic consistency of enterprise logistics activities on the bases of ecological principles

    Directory of Open Access Journals (Sweden)

    N.M. Mashchak

    2011-12-01

    Full Text Available The consistency of logistics enterprises with environmental strategies investigated. Examples of foreign experience and results of such consistency in practice are given. The necessity and strategic advantages of logistic activities on environmental grounds proved.

  16. Studying of the standardization principles of pharmacological activity of recombinant erythropoietin preparations

    Directory of Open Access Journals (Sweden)

    A. K. Yakovlev

    2016-01-01

    Full Text Available Analysis of the publications devoted to the structure, functions, mechanism of action of erythropoietin is given in the article. Erythropoietin preparations derived from recombinant DNA technology are a mixture of isoforms with different biological activity, which determine the biological properties pharmacological activity, pharmacokinetics, efficacy and safety of medicinal product. Erythropoietin preparations derived by using recombinant DNA technology are a mixture of isoforms with different biological activity, that determine the biological properties, pharmacological activity, pharmacokinetics, safety and therapeutic efficacy of the drug. However, at production of erythropoietin, its pharmacological activity is controlled only by the ability to stimulate erythropoiesis, despite the multiplicity of different directions of action of drugs erythropoietin. The drug is dispensed and applied on this indicator. The international reference standard, a European reference biologic drug or calibrated by him enterprise standard samples are used by manufacturers to assess the quality of erythropoietin in the Russian Federation. The urgency of developing domestic standard samples for the evaluation of biological activity and physico-chemical characteristics of erythropoietin preparations produced by recombinant DNA technology.

  17. Collection of main international documents on the ethical principles of research and the main regulations on bioethics of the United States and of European Community; Raccolta sui principali documenti internazionali sui principi etici della ricerca e dei principali documenti legislativi degli Stati Uniti e della Comunita` Europea sulla bioetica

    Energy Technology Data Exchange (ETDEWEB)

    Scuderi, G. [Istituto Superiore di Sanita`, Rome (Italy). Lab. di Immunologia

    1998-12-31

    The collection includes an Italian translation of the main international documents on ethical principles of scientific research (the Nuremberg Code, the Helsinki Declaration, the Belmont Report) as well as the regulatory text of the United States (the Code of Federal Regulation Title 45, Part 46, that is the 45 Cfr 46) and the regulations of the European Community (the Good Clinical Practice and the Convention for the protection of human rights and dignity of the human being regards to the application of biology and medicine: convention on human rights and biomedicine). The informed consent and the human rights of human subjects involved in a clinical trial are discussed. Moreover, in the regulatory texts, legal rights of particular subjects, i.e. pregnant women, minors, fetuses, embrions, prisoners, are discussed; as well as the bioethics of organ transplantations. [Italiano] Contiene una traduzione in lingua italiana dei principali documenti internazionali sui principi etici della ricerca scientifica: il Codice di Norimberga, la dichiarazione di Helsinki e il rapporto Belmont; il testo legislativo degli Stati Uniti Code of Federal Regulation, capitolo 45 parte 46 (detto il 45 CFR 46) e la normativa della Comunita` Europea relativa alle norme di Good Clinical Practice e alla Convenzione per la protezione dei diritti dell`uomo e la dignita` dei soggetti umani relativamente alle applicazioni della biologia e medicina: Convenzione sui diritti dell`uomo e la biomedicina. Vengono trattati il consenso informato e i diritti umani delle persone che sono coinvolte in una sperimentazione clinica. Inoltre, nei testi normativi ci si riferisce anche ai diritti legali di soggetti particolari, ad esempio: donne in stato di gravidanza, minori, feti, embrioni, prigionieri; viene trattata, infine, l`etica dei trapianti d`organo.

  18. Participation needs of older adults having disabilities and receiving home care: met needs mainly concern daily activities, while unmet needs mostly involve social activities.

    Science.gov (United States)

    Turcotte, Pier-Luc; Larivière, Nadine; Desrosiers, Johanne; Voyer, Philippe; Champoux, Nathalie; Carbonneau, Hélène; Carrier, Annie; Levasseur, Mélanie

    2015-08-01

    Participation is a key determinant of successful aging and enables older adults to stay in their homes and be integrated into the community. Assessing participation needs involves identifying restrictions in the accomplishment of daily and social activities. Although meeting participation needs involves older adults, their caregivers and healthcare providers, little is known about their respective viewpoints. This study thus explored the participation needs of older adults having disabilities as perceived by the older adults themselves, their caregivers and healthcare providers. A qualitative multiple case study consisted of conducting 33 semi-structured interviews in eleven triads, each composed of an older adult, his/her caregiver and a healthcare provider recruited in a Health and Social Services Centre (HSSC) in Québec, Canada. Interview transcripts and reviews of clinical records were analyzed using content analysis and descriptive statistics based on thematic saliency analysis methods. Aged 66 to 88 years, five older adults had physical disabilities, five had mild cognitive impairment and one had psychological problems, leading to moderate to severe functional decline. Caregivers and healthcare providers were mainly women, respectively retired spouses and various professionals with four to 32 years of clinical experience. Participation needs reported by each triad included all domains of participation. Needs related to daily activities, such as personal care, nutrition, and housing, were generally met. Regarding social activities, few needs were met by various resources in the community and were generally limited to personal responsibilities, including making decisions and managing budgets, and some community life activities, such as going shopping. Unmet needs were mainly related to social activities, involving leisure, other community life activities and interpersonal relationships, and some daily activities, including fitness and mobility. This study

  19. Cellular Telephones Measure Activity and Lifespace in Community-Dwelling Adults: Proof of Principle

    Science.gov (United States)

    Schenk, Ana Katrin; Witbrodt, Bradley C.; Hoarty, Carrie A.; Carlson, Richard H.; Goulding, Evan H.; Potter, Jane F.; Bonasera, Stephen J.

    2011-01-01

    OBJECTIVES To describe a system that uses off-the-shelf sensor and telecommunication technologies to continuously measure individual lifespace and activity levels in a novel way. DESIGN Proof of concept involving three field trials of 30, 30, and 21 days. SETTING Omaha, Nebraska, metropolitan and surrounding rural region. PARTICIPANTS Three participants (48-year-old man, 33-year-old woman, and 27-year-old male), none with any functional limitations. MEASUREMENTS Cellular telephones were used to detect in-home position and in-community location and to measure physical activity. Within the home, cellular telephones and Bluetooth transmitters (beacons) were used to locate participants at room-level resolution. Outside the home, the same cellular telephones and global positioning system (GPS) technology were used to locate participants at a community-level resolution. Physical activity was simultaneously measured using the cellular telephone accelerometer. RESULTS This approach had face validity to measure activity and lifespace. More importantly, this system could measure the spatial and temporal organization of these metrics. For example, an individual’s lifespace was automatically calculated across multiple time intervals. Behavioral time budgets showing how people allocate time to specific regions within the home were also automatically generated. CONCLUSION Mobile monitoring shows much promise as an easily deployed system to quantify activity and lifespace, important indicators of function, in community-dwelling adults. PMID:21288235

  20. Pomegranate juice and prostate cancer: importance of the characterisation of the active principle.

    Science.gov (United States)

    Chrubasik-Hausmann, Sigrun; Vlachojannis, Christian; Zimmermann, Benno

    2014-11-01

    Two exploratory clinical studies investigating proprietary pomegranate products showed a trend of effectiveness in increasing prostate-specific antigen doubling time in patients with prostate cancer. A recent clinical study did not support these results. We therefore analysed a lot of the marketed pomegranate blend for co-active pomegranate compounds. The high-performance liquid chromatography method was used to detect punicalagin, ellagic acid and anthocyanins. Total polyphenoles were determined by the Folin-Ciocalteu method using gallic acid as reference. The results show that the co-active compounds in the daily dose of the pomegranate blend were far below those previously tested and that the photometric assessment is not reliable for the standardisation of study medications. Not pomegranate but the low amount of co-active compounds in the proprietary pomegranate blend was responsible for its clinical ineffectiveness.

  1. Protection of ornamental gold fish Carassius auratus against Aeromonas hydrophila by treating Ixora coccinea active principles.

    Science.gov (United States)

    Anusha, Paulraj; Thangaviji, Vijayaragavan; Velmurugan, Subramanian; Michaelbabu, Mariavincent; Citarasu, Thavasimuthu

    2014-02-01

    Herbals such as Ixora coccinea, Daemia extensa and Tridax procumbens were selected to screen in vitro antibacterial and immunostimulant activity against the freshwater fish pathogen Aeromonas hydrophila using different organic polar and non-polar solvents. Initial screening results revealed that, ethyl acetate extracts and its purified fraction of I. coccinea was able to suppress the A. hydrophila strains at more than 15 mm of zone of inhibition and positive immunostimulant activity. The purified active fraction, which eluted from H40: EA60 mobile phase was structurally characterized by GC-MS analysis. Two compounds such as Diethyl Phthalate (1,2-Benzene dicarboxylic acid, monobutyl ester) and Dibutyl Phthalate were characterized using NIST database search. In order to study the in vivo immunostimulant influence of the compounds, the crude extracts (ICE) and purified fractions (ICF) were incorporated to the artificial diets at the concentration of 400 mg kg⁻¹ and fed to the ornamental gold fish Carassius auratus for 30 days. After termination of feeding experiment, they were challenged with highly virulent A. hydrophila AHV-1 which was isolated from infected gold fish and studied the survival, specific bacterial load reduction, serum biochemistry, haematology, immunology and histological parameters. The control diet fed fishes succumbed to death within five days at 100% mortality whereas ICE and ICF fed groups survived 60 and 80% respectively after 10 days. The diets also helped to decrease the Aeromonas load after challenge and significantly (P ≤ 0.01) improved the serum albumin, globulin and protein. The diets also helped to increase the RBC and haemoglobin level significantly (P ≤ 0.05) from the control group. Surprisingly the immunological parameters like phagocytic activity, serum bactericidal activity and lysozyme activity were significantly increased (P ≤ 0.001) in the experimental diets. Macrophages and erythrocytes were abundantly expressed in the

  2. Current parallel chemistry principles and practice: application to the discovery of biologically active molecules.

    Science.gov (United States)

    Edwards, Paul J

    2009-11-01

    This article describes the use of parallel chemistry techniques for drug discovery, based on publications from January 2006 to December 2008. Chemical libraries that yielded active compounds across a range of biological targets are presented, together with synthetic details when appropriate. Background information for the biological targets involved and any SAR that could be discerned within members of a library series also is discussed. New technological developments, as applied to library design and synthesis and, more generally, in the discovery of biologically active entities, are highlighted. In addition, the likely future directions for parallel chemistry in its ability to impact upon drug discovery are also presented.

  3. Evaluation of hepatoprotective effect of Gentiana olivieri herbs on subacute administration and isolation of active principle.

    Science.gov (United States)

    Orhan, Didem Deliorman; Aslan, Mustafa; Aktay, Göknur; Ergun, Ender; Yesilada, Erdem; Ergun, Fatma

    2003-04-04

    Hepatoprotective effect of Gentiana olivieri Griseb. (Gentianaceae) flowering herbs on subacute administration were studied using in vivo models in rats. For the activity assessment on carbon tetrachloride-induced hepatic damage following biochemical parameters were evaluated; plasma and hepatic tissue malondialdehyde formation, and liver tissue glutathione level, as well as plasma transaminase enzyme levels (aspartate transferase and alanine transferase). Results of biochemical tests were also confirmed by histopathological examination. Through bioassay-guided fractionation procedures isoorientin, a known C-glycosylflavone, was isolated from the ethyl acetate fraction as the active antihepatotoxic constituent by silica gel column chromatography. Isoorientin exhibited significant hepatoprotective effect at 15 mg/kg b.w. dose.

  4. Pore-fluid chemistry along the main axis of an active lobe at the Congo deep-sea fan

    Science.gov (United States)

    Croguennec, C.; Ruffine, L.; Guyader, V.; Le Bruchec, J.; Ruesch, B.; Caprais, J.; Cathalot, C.; de Prunelé, A.; Germain, Y.; Bollinger, C.; Dennielou, B.; Olu, K.; Rabouille, C.

    2013-12-01

    The distal lobes of the Congo deep-sea fan constitute a unique in situ laboratory to study early diagenesis of marine sediments. They are located at water depth of about 5000 m and result from the deposition of sediment transported by turbidity currents along the channel-levee systems and submarine canyon connected to the Congo River. Thus, a huge amount of organic matter, transported from the river to the lobes, undergoes decomposition processes involving different oxidants present within the sedimentary column. This drastically changes the chemistry of the pore fluids, allowing the occurence of a succession of biogeochemical processes. The present study is part of an ongoing project which aims at better understanding the role and the fate of organic matter transported to the lobe systems, as well as its implication in the distribution of the living communities encountered there. Thus, pore fluids have been sampled from 8 Calypso cores in order to determine the concentration of dissolved elements. Five sites have been investigated: four of them are located along the main axis of a currently active lobe, the last one being located on a lobe disconnected from the chenals. The analyses of methane, major (Cl, SO4, Mg, Ca, K, Na) and minor (Sr, Ba, B, Li, Mn) elements have been carried out along with total alkalinity determination. The resulting profiles show a highly heterogeneous pore-fluid chemistry. Sulphate concentration near the seawater/sediment interface varies from 3 to 29 mM, indicating intense sulphate reduction. Surprisingly the lowest values are found at the site which is disconnected from the active lobe. The manganese cycle is well defined for all cores. The core recovered at the more distal lobe exhibits very peculiar pore-fluid profiles which are likely related to a geological event, most likely sediment slide and remobilization. References: Babonneau, N., Savoye, B., Cremer, M. & Klein, B., 2002. Morphology and architecture of the present canyon and

  5. MAIN CONTENTS

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    The Key to Agricultural Science and Technology Innovation should be placed on the FiveMajor Changes Based on analysis and forecasting on grain consumption influencing factors, production influencing factors and import influencing factors, the supply and demand of main sorts of grain in China is forecas- ted respectively, including paddy, wheat, corn and soybean. In 2020, grain consumption quantity, grain production quantity and grain import quantity of China is 693 million tons, 644 million tons and 49 million tons respectively. For grain security in future, new stratagem on food security should be im- plemented, grain import circumstance and global grain security. Father mechanism should be im- proved, and early warning and regulation on grain production capacity should be paid attention to sys- temically.

  6. Evaluation of the biological activities of crude extracts from patagonian prosopis seeds and some of their active principles.

    Science.gov (United States)

    Mazzuca, M; Kraus, W; Balzaretti, V

    2003-01-01

    Extracts of different polarities from three species and three varieties of the genera Prosopis: P. alpataco, P. denudans var. denudans, P. denudans var. patagonica, and P. denudans var. stenocarpa, were screened in order to evaluate their antibacterial, antifungal, antifeedant, antihelminthic, molluscicidal and toxic activities. The extractions of the plant materials were carried out successively with petroleum ether, dichloromethane, ethyl acetate, methanol and water. All petroleum ether extracts showed antibacterial activity. The dichloromethane extract of P. alpataco showed antibacterial and antifungal activities. Methanol and aqueous extracts of P. denudans var. denudans and P. denudans var. patagonica showed antifungal activities and a slight response to the toxicity test. Fatty acids and a group of pentacyclic triterpenes were identified as responsible for antibacterial activities in some of the active extracts.

  7. Using an FPLC to Promote Active Learning of the Principles of Protein Structure and Purification

    Science.gov (United States)

    Robinson, Rebekah L.; Neely, Amy E.; Mojadedi, Wais; Threatt, Katie N.; Davis, Nicole Y.; Weiland, Mitch H.

    2017-01-01

    The concepts of protein purification are often taught in undergraduate biology and biochemistry lectures and reinforced during laboratory exercises; however, very few reported activities allow students to directly gain experience using modern protein purification instruments, such as Fast Protein Liquid Chromatography (FPLC). This laboratory…

  8. Transforming Principles into Practice: Using Cognitive Active Learning Strategies in the High School Classroom

    Science.gov (United States)

    Swiderski, Suzanne M.

    2011-01-01

    High school teachers who engage students through active learning in their classrooms can more fully understand this instructional practice by examining the theories and strategies underlying the cognitive perspective of educational psychology, which addresses the development of knowledge in the individual mind. Two theoretical explanations,…

  9. Using an FPLC to Promote Active Learning of the Principles of Protein Structure and Purification

    Science.gov (United States)

    Robinson, Rebekah L.; Neely, Amy E.; Mojadedi, Wais; Threatt, Katie N.; Davis, Nicole Y.; Weiland, Mitch H.

    2017-01-01

    The concepts of protein purification are often taught in undergraduate biology and biochemistry lectures and reinforced during laboratory exercises; however, very few reported activities allow students to directly gain experience using modern protein purification instruments, such as Fast Protein Liquid Chromatography (FPLC). This laboratory…

  10. Causality Principle

    OpenAIRE

    Chi, Do Minh

    2001-01-01

    We advance a famous principle - causality principle - but under a new view. This principle is a principium automatically leading to most fundamental laws of the nature. It is the inner origin of variation, rules evolutionary processes of things, and the answer of the quest for ultimate theories of the Universe.

  11. Magnetic resonance imaging of the active second stage of labour: Proof of principle

    Energy Technology Data Exchange (ETDEWEB)

    Guettler, F.V.; Heinrich, A.; Rump, J.; Bucourt, M. de; Hamm, B.; Teichgraeber, U.K. [Charite University Hospital, Department of Radiology, Berlin (Germany); Schnackenburg, B. [Philips GmbH Unternehmensbereich Healthcare, Hamburg (Germany); Bamberg, C. [Charite University Hospital, Department of Obstetrics, Berlin (Germany)

    2012-09-15

    To prove that magnetic resonance imaging of foetal anatomy during the active second stage of vaginal delivery is feasible. Initially, five pregnant volunteers around the 30th week of gestation were examined in an open MRI. Based on the findings, one vaginal delivery was acquired under real-time imaging. To monitor the birth status during image acquisition, an MR-compatible wireless cardiotocography (CTG) system was built. Single-shot sequence parameters were optimised to compensate motion artefacts during labour. Safety requirements to monitor the birth process under real-time MR imaging were met. High-resolution MR images were acquired immediately before and after delivery. In one patient, TSE single-shot cinematic sequences of the active second stage of labour were obtained. All sequences were adapted to tolerate movement of the mother and infant, as well as residual noise from the CTG. Furthermore, the MR imaging during labour showed only minor image artefacts. CTG-monitored acquisition of MRI series during the active second stage of delivery is feasible. Image quality should allow various further studies to improve models for birth simulation as well as potential investigation of obstructed labour and obstetric complications. (orig.)

  12. 电磁轴承的原理与应用%Principle and Application of Active Magnetic Bearings

    Institute of Scientific and Technical Information of China (English)

    严文彩; 李宏冰; 周殿莹

    2013-01-01

    The active magnetic bearing is a new supporting technology in the world,and it began to be study in the mid- 1960s.In the paper, the structure,principle,characteristics of active magetic bearings were introduced,and the developing level and tendency of the active magnetic bearing were analyzed. At last, taking methane expansion compressor in the ethylene plant as an example, matters needing attention during design,type selection and application of the active magetic bearing were discussed.%  电磁轴承技术是国际上20世纪60年代中期开始研究的一项新的支承技术。第一部分简要介绍电磁轴承的结构、原理、特点,并分析了国内外电磁轴承的发展现状及前景。第二部分,以乙烯装置的甲烷膨胀/压缩机为例,阐述了电磁轴承设计选型时的注意事项及其应用。

  13. Exploring the catalytic activity of pristine T6[100] surface for oxygen reduction reaction: A first-principles study

    Science.gov (United States)

    Banerjee, Paramita; Chakrabarty, Soubhik; Thapa, Ranjit; Das, G. P.

    2017-10-01

    The electrocatalytic activity of T6[100] surface containing both sp3 (C1) and sp2 (C2) hybridized carbon atoms is explored using first-principles density functional theory based approach. The top layered C1 atom of the surface is found to be more active towards the oxygen reduction reaction (ORR), as compared to that of C2 atom. This is attributed to the presence of dangling σ bond in the corresponding C1 atom, leading to the high electron density near the Ferrmi level. Whereas, the π electron in the top layered C2 atom forms a weak out of plane network. As estimated from free energy profile, the overpotential is much lower when C1 is considered as the active site and the final step i.e desorption of final OH- ion is found to be the potential determining step. We have also reported the effect of Si dopant on the catalytic activity of T6[100] surface and explained the origin of high overpotential value in this case. Thus in this report, we propose a new metal-free catalyst i.e T6[100] surface, having both sp2 (maintains the high metallicity needed to reduce ohmic loss) and sp3 (helps in capturing the upcoming molecules) hybridized carbon atoms, as a potential candidate for ORR.

  14. Can active learning principles be applied to the bioscience assessments of nursing students? A review of the literature.

    Science.gov (United States)

    Bakon, Shannon; Craft, Judy; Christensen, Martin; Wirihana, Lisa

    2016-02-01

    To explore if active learning principles be applied to nursing bioscience assessments and will this influence student perception of confidence in applying theory to practice? A review of the literature utilising searches of various databases including CINAHL, PUBMED, Google Scholar and Mosby's Journal Index. The literature search identified research from twenty-six original articles, two electronic books, one published book and one conference proceedings paper. Bioscience has been identified as an area that nurses struggle to learn in tertiary institutions and then apply to clinical practice. A number of problems have been identified and explored that may contribute to this poor understanding and retention. University academics need to be knowledgeable of innovative teaching and assessing modalities that focus on enhancing student learning and address the integration issues associated with the theory practice gap. Increased bioscience education is associated with improved patient outcomes therefore by addressing this "bioscience problem" and improving the integration of bioscience in clinical practice there will subsequently be an improvement in health care outcomes. From the literature several themes were identified. First there are many problems with teaching nursing students bioscience education. These include class sizes, motivation, concentration, delivery mode, lecturer perspectives, student's previous knowledge, anxiety, and a lack of confidence. Among these influences the type of assessment employed by the educator has not been explored or identified as a contributor to student learning specifically in nursing bioscience instruction. Second that educating could be achieved more effectively if active learning principles were applied and the needs and expectations of the student were met. Lastly, assessment influences student retention and the student experience and as such assessment should be congruent with the subject content, align with the learning

  15. Tuning the chemical activity through PtAu nanoalloying: a first principles study

    KAUST Repository

    Mokkath, Junais Habeeb

    2013-06-21

    The electronic structure and adsorption properties of 1.5 nm sized Pt, Au, and PtAu nanoclusters are studied by density functional theory. We explain the recent experimental finding that 20% Au content in PtAu nanoparticles is optimal to induce a dramatically different catalytic behavior. Our results show that the d-band center together with the density of states at the Fermi energy can be used as an indicator of the chemical activity of PtAu nanoclusters. The most favorable adsorption sites on the cluster surfaces as a function of the Pt/Au ratio are identified using atomic H as a probe.

  16. Investigation into the antioxidant and antidiabetic potential of Moringa stenopetala: identification of the active principles.

    Science.gov (United States)

    Habtemariam, Solomon

    2015-03-01

    The fresh leaves of Moringa stenopetala (family, Moringaceae) are commonly eaten as cabbage while dried leaves are used as nutritional supplement and for treating a variety of disease conditions including diabetes. The present investigation into the therapeutic potential of the leaves and seeds of the plant revealed no inhibitory effect against α-glucosidase enzyme up to the concentration of 200 μg/mL but the leaves extract displayed potent DPPH (1,1-diphenyl-2- picrylhydrazyl) radical scavenging effect (IC50, 59.5 ± 4.1 μg/mL). An activity directed fractionation and isolation procedure resulted in the identification of the major antioxidant compound as rutin and minor active component, neochlorogenic acid. Both the crude extract (0.8-200 μg/mL) and rutin (0.8-200 μM) but not neochlorogenic acid displayed a concentration-dependent protection of human pancreatic β-cells (1.4E7 cells) from oxidant-induced cell death. The identification of these compounds along with their potential role in the nutritional and medicinal significance of the plant is discussed.

  17. A Principle for Describing and Verifying Brain Mechanisms Using Ongoing Activity

    Science.gov (United States)

    Eriksson, David

    2017-01-01

    Not even the most informed scientist can setup a theory that takes all brain signals into account. A neuron not only receives neuronal short range and long range input from all over the brain but a neuron also receives input from the extracellular space, astrocytes and vasculature. Given this complexity, how does one describe and verify a typical brain mechanism in vivo? Common to most described mechanisms is that one focuses on how one specific input signal gives rise to the activity in a population of neurons. This can be an input from a brain area, a population of neurons or a specific cell type. All remaining inputs originating from all over the brain are lumped together into one background input. The division into two inputs is attractive since it can be used to quantify the relative importance of either input. Here we have chosen to extract the specific and the background input by means of recording and inhibiting the specific input. We summarize what it takes to estimate the two inputs on a single trial level. The inhibition should not only be strong but also fast and the specific input measurement has to be tailor-made to the inhibition. In essence, we suggest ways to control electrophysiological experiments in vivo. By applying those controls it may become possible to describe and verify many brain mechanisms, and it may also allow the study of the integration of spontaneous and ongoing activity, which in turn governs cognition and behavior. PMID:28174523

  18. An active coronagraph using a liquid crystal array for exoplanet imaging: principle and testing

    Institute of Scientific and Technical Information of China (English)

    Xi Zhang; De-Qing Ren; Yong-Tian Zhu; Jiang-Pei Dou

    2012-01-01

    High-contrast imaging coronagraphs,used for the detection of exoplanets,have always adopted passive coronagraph optical components.It is therefore impossible to actively optimize the coronagraphs to achieve their best performance.To solve this problem,we propose a novel high-contrast imaging coronagraph which combines a liquid crystal array (LCA) for active pupil apodization and a deformable mirror (DM) for phase correction.The LCA we use is an amplitude-only spatial light modulator.The LCA is well calibrated and compensates for its amplitude non-uniformity and nonlinear intensity responsivity.We measured the imaging contrasts of the coronagraph system with the LCA only and without the DM deployed.Imaging contrasts of 10-4 and 10-5 can be reached at an inner working angular distance of 2.5 and 5λ/D,respectively.A simulation shows that the phase errors on the coronagraph pupil limit the contrast performance.The contrast could be further improved if a DM is deployed to correct the phase errors induced by the LCA and coronagraph optics.

  19. IMPROVEMENT OF THE PRINCIPLES OF THE ORGANIZATION OF INSPECTION AND SUPERVISING ACTIVITY OF BANK OF RUSSIA

    Directory of Open Access Journals (Sweden)

    Виктор Макарович Заернюк

    2013-04-01

    Full Text Available In article established practices of the organization of control and supervision of Bank of Russia of activity of the Russian commercial banks are considered.  The analysis is carried out and the assessment of a level of development of a substantial component of bank regulation and supervision is given.Purpose: Research of tendencies and problems in the organization of control and supervising activity of Bank of Russia at the present stage.Methodology: General scientific methods were used: analysis and synthesis, comparisons, generalizations, system approach. In the course of use of the actual material methods of the economical and statistical analysis were used.Results: The conclusion that the excessive and bureaucratized control from the Central bank interferes with dynamic development of the banking sector is drawn. It is required to generation of the new thinking which is expressing in transfer of accent from need of strict, in many respects of formal, application of bank instructions and regulations on formation of professional opinion of the controler, increase of its responsibility for results of checks.DOI: http://dx.doi.org/10.12731/2218-7405-2013-3-1

  20. 农作物总DNA提取的基本原理和主要方法概述%Basic Principle and Main Method of Crop Total DNA Extraction

    Institute of Scientific and Technical Information of China (English)

    徐亮

    2011-01-01

    概述了农作物DNA提取的基本原理,总结了DNA提取各步骤的操作经验,并介绍了几种常用的DNA提取方法.%The paper summarizes the basic principle of crop DNA extraction and the operation experience of each DNA extraction step,and introduces several commonly used DNA extraction method.

  1. Active principles of Grindelia robusta exert antiinflammatory properties in a macrophage model.

    Science.gov (United States)

    La, Vu Dang; Lazzarin, Francesco; Ricci, Donata; Fraternale, Daniele; Genovese, Salvatore; Epifano, Francesco; Grenier, Daniel

    2010-11-01

    Plant extracts and/or secondary metabolites are receiving considerable attention as therapeutic agents for treating inflammatory diseases such as periodontitis, which affects the tooth supporting tissues. The aim of this study was to investigate the effect of a Grindelia robusta extract enriched in saponins and polyphenols on Aggregatibacter actinomycetemcomitans lipopolysaccharide (LPS)-induced inflammatory mediator (IL-6, TNF-a, RANTES, MCP-1, PGE(2) ) and matrix metalloproteinase (MMP-1, -3, -7, -8, -9, -13) secretion by macrophages. LPS induced a marked increase in the secretion of all inflammatory mediators and MMPs tested by macrophages, as determined by enzyme-linked immunosorbent assays. At non-cytotoxic concentrations, the G. robusta extract inhibited dose-dependently the secretion of IL-6, RANTES, MCP-1 and, to a lesser extent, PGE(2) and TNF-a. Such inhibition was also observed for MMP-1, -3, -7, -8, -9 and -13 secretion. This ability of G. robusta extract to reduce the LPS-induced secretion of inflammatory mediators and MMPs was associated with a reduction of nuclear factor-kappa B (NF-kB) p65 activation. The results suggest that G. robusta extract possesses an antiinflammatory therapeutic potential through its capacity to reduce the accumulation of inflammatory mediators and MMPs.

  2. Forum: Communication Activism Pedagogy. Long-Term Impacts of Communication Activism Pedagogy: Guiding Principles for Future Research

    Science.gov (United States)

    Russell, Vincent; Congdon, Mark, Jr.

    2017-01-01

    Communication activism pedagogy (CAP) illuminates an array of ways to intervene into oppressive systems to promote just conditions, and CAP's transformative effects on students and communities have been substantively demonstrated (Frey & Palmer 2014). Yet, Frey and Palmer recognize that "social justice issues are long-term, large-scale…

  3. Ameliorative Effect of Active Principle Isolated from Seeds of Eugenia jambolana on Carbohydrate Metabolism in Experimental Diabetes

    Directory of Open Access Journals (Sweden)

    Suman Bala Sharma

    2011-01-01

    Full Text Available The aim of this study was to evaluate the antidiabetic activity of LH II purified from ethanolic seed extract of Eugenia jambolana in alloxan-induced mild diabetic (MD and severely diabetic (SD rabbits. Ethanolic extract upon chromatographic purification yielded partially purified hypoglycemic principle (SIII which on further purification by sephadex LH 20 yielded pharmacological active compound LH II. Homogeneity of LH II was tested by HPLC. Phytochemical investigation of LH II by various structural spectra showed the presence of saturated fatty acid, Δ5 lipid and presence of sterol. LH II was administered orally at a dose of 10 mg kg−1 body weight to MD and SD. LH II resulted, significant fall in FBG at 90 min (21.2% MD: 28.6% SD, 7th day (35.6% MD and 15th day (59.6% SD. Glycosylated hemoglobin was significantly decreased (50.5% in SD after 15 days treatment (Tt. Plasma insulin levels were significantly increased (P <  .001. In vitro studies with pancreatic islets showed 3-fold increase in insulin levels as compared to untreated animals. LH II also showed extrapancreatic effect by significantly increasing (P <  .001 the activity of key enzymes of glycolysis and significantly decreasing (P <  .001 the activity of key enzymes of gluconeogenesis. Liver and muscle glycogen content were increased by 36.6 and 30% for MD, and 52 and 47% for SD, respectively. Thus, the present study demonstrates that LH II possesses potent antidiabetic activity and it is effective in both MD and SD rabbits.

  4. Xanthoangelol and 4-Hydroxyderricin Are the Major Active Principles of the Inhibitory Activities against Monoamine Oxidases on Angelica keiskei K.

    Science.gov (United States)

    Kim, Ji Ho; Son, Yeon Kyung; Kim, Gun Hee; Hwang, Keum Hee

    2013-05-30

    Monoamine oxidase inhibitors (MAOI) have been widely used as antidepressants. Recently, there has been renewed interest in MAO inhibitors. The activity-guided fractionation of extracts from Angelica keiskei Koidzumi (A. keiskei K.) led to the isolation of two prenylated chalcones, xanthoangelol and 4-hydroxyderricin and a flavonoid, cynaroside. These three isolated compounds are the major active ingredients of A. keiskei K. to inhibit the MAOs and DBH activities. Xanthoangelol is a nonselective MAO inhibitor, and a potent dopamine β-hydroxylase (DBH) inhibitor. IC50 values of xanthoangelol to MAO-A and MAO-B were calculated to be 43.4 μM, and 43.9 μM. These values were very similar to iproniazid, which is a nonselective MAO inhibitor used as a drug against depression. The IC50 values of iproniazid were 37 μM, and 42.5 μM in our parallel examination. Moreover, IC50 value of xanthoangelol to DBH was calculated 0.52 μM. 4-Hydroxyderricin is a potent selective MAO-B inhibitor and also mildly inhibits DBH activity. The IC50 value of 4-hydroxyderricin to MAO-B was calculated to be 3.43 μM and this value was higher than that of deprenyl (0.046 μM) used as a positive control for selective MAO-B inhibitor in our test. Cynaroside is a most potent DBH inhibitor. The IC50 value of cynaroside to DBH was calculated at 0.0410 μM. Results of this study suggest that the two prenylated chalcones, xanthoangelol and 4-hydroxyderricin isolated from A. keiskei K., are expected for potent candidates for development of combined antidepressant drug. A. keiskei K. will be an excellent new bio-functional food material that has the combined antidepressant effect.

  5. In Vivo Anti-Trypanosoma cruzi Activity of Hydro-Ethanolic Extract and Isolated Active Principles from Aristeguietia glutinosa and Mechanism of Action Studies

    Directory of Open Access Journals (Sweden)

    Javier Varela

    2014-06-01

    Full Text Available The currently available treatments for Chagas disease show limited therapeutic potential and are associated with serious side effects. Attempting to find alternative drugs isolated from Nature as agents against Trypanosoma cruzi has been our goal. Recently, we have demonstrated the in vitro anti-T. cruzi activities of two secondary metabolites isolated from the hydro-ethanolic extract of the aerial parts of Aristeguietia glutinosa (Lam., (family Asteraceae. These active principles displayed poor hemolytic activity, low toxicity against murine macrophages, and absence of mutagenicity. Herein, proof of concept in vivo studies of the whole hydro-ethanolic extract of the aerial parts of Aristeguietia glutinosa and of the most active component isolated from the hydro-ethanolic extract, i.e., (+-15-hydroxy-7-labden-17-al, was done in a murine acute model of Chagas disease. Both treatments caused a decrease in the animals’ parasitemia. Metabolomic mechanism of action studies were done by 1H-NMR, both on the extract and on the active compounds, examining the effects of the metabolites both on membrane sterol biosynthesis and mitochondrial dehydrogenases, whereby we found that one of the metabolites inhibited the activity of the parasite mitochondrial dehydrogenases and the other inhibited the biosynthesis of parasite membrane sterols. The results are interesting in the context of popular use of plants for the treatment of Chagas disease.

  6. In Vitro Inhibitory Effect of Clove Essential Oil and Its Two Active Principles on Tooth Decalcification by Apple Juice

    Directory of Open Access Journals (Sweden)

    Charu M. Marya

    2012-01-01

    Full Text Available The dental erosion or decalcification of enamel is a significant clinical problem. Apple acidic beverages are thought to increase the potential for dental erosion. The purpose of this in vitro study was to investigate the effect of clove essential oil (CEO and its active principles on tooth decalcification of apple juices. On GC-MS analysis, CEO showed a high content of eugenol (58.29% and eugenyl acetate (19.10%. Teeth specimens were randomly divided into 5 treatment groups: control, CEO, eugenol, eugenyl-acetate, and fluoride. The specimens were exposed for 24 h and were analyzed for calcium contents using Inductively Coupled Plasma with Optical Emission Spectroscopy (ICP-OES. Data were analyzed using student t-test (<0.05. CEO, eugenol, and eugenyl-acetate significantly decreased the decalcification of tooth by the apple juice to only 17, 24, and 21 mgL−1, respectively. Hemolytic activity on human erythrocytes was studied to exclude the possibility of further associated cytotoxicity. It was observed that the CEO and its two lead molecules inhibit the decalcification and/or promote the remineralization caused by the apple juices. The effect of the test compounds appears to be distinct like that of fluoride treatment. CEO may, therefore, serve to be a promising adjunct to fluoride in the treatment of root caries during minimally invasive therapy.

  7. In Vitro Inhibitory Effect of Clove Essential Oil and Its Two Active Principles on Tooth Decalcification by Apple Juice

    Science.gov (United States)

    Marya, Charu M.; Satija, Gunjan; J., Avinash; Nagpal, Ruchi; Kapoor, Rohtash; Ahmad, Aijaz

    2012-01-01

    The dental erosion or decalcification of enamel is a significant clinical problem. Apple acidic beverages are thought to increase the potential for dental erosion. The purpose of this in vitro study was to investigate the effect of clove essential oil (CEO) and its active principles on tooth decalcification of apple juices. On GC-MS analysis, CEO showed a high content of eugenol (58.29%) and eugenyl acetate (19.10%). Teeth specimens were randomly divided into 5 treatment groups: control, CEO, eugenol, eugenyl-acetate, and fluoride. The specimens were exposed for 24 h and were analyzed for calcium contents using Inductively Coupled Plasma with Optical Emission Spectroscopy (ICP-OES). Data were analyzed using student t-test (P < 0.05). CEO, eugenol, and eugenyl-acetate significantly decreased the decalcification of tooth by the apple juice to only 17, 24, and 21 mgL−1, respectively. Hemolytic activity on human erythrocytes was studied to exclude the possibility of further associated cytotoxicity. It was observed that the CEO and its two lead molecules inhibit the decalcification and/or promote the remineralization caused by the apple juices. The effect of the test compounds appears to be distinct like that of fluoride treatment. CEO may, therefore, serve to be a promising adjunct to fluoride in the treatment of root caries during minimally invasive therapy. PMID:22997520

  8. Endoscopic Scores for Evaluation of Crohn's Disease Activity at Small Bowel Capsule Endoscopy: General Principles and Current Applications.

    Science.gov (United States)

    Rosa, Bruno; Pinho, Rolando; de Ferro, Susana Mão; Almeida, Nuno; Cotter, José; Saraiva, Miguel Mascarenhas

    2016-01-01

    The small bowel is affected in the vast majority of patients with Crohn's Disease (CD). Small bowel capsule endoscopy (SBCE) has a very high sensitivity for the detection of CD-related pathology, including early mucosal lesions and/or those located in the proximal segments of the small bowel, which is a major advantage when compared with other small bowel imaging modalities. The recent guidelines of European Society of Gastrointestinal Endoscopy (ESGE) and European Crohn's and Colitis Organisation (ECCO) advocate the use of validated endoscopic scoring indices for the classification of inflammatory activity in patients with CD undergoing SBCE, such as the Lewis Score or the Capsule Endoscopy Crohn's Disease Activity Index (CECDAI). These scores aim to standardize the description of lesions and capsule endoscopy reports, contributing to increase inter-observer agreement and enabling a stratification of the severity of the disease. On behalf of the Grupo de Estudos Português do Intestino Delgado (GEPID) - Portuguese Small Bowel Study Group, we aimed to summarize the general principles and clinical applications of current endoscopic scoring systems for SBCE in the setting of CD, covering the topic of suspected CD as well as the evaluation of disease extent (with potential prognostic and therapeutic impact), evaluation of mucosal healing in response to treatment and evaluation of post-surgical recurrence in patients with previously established diagnosis of CD.

  9. EVOLUTION OF WORLD CREDIT GRANTED BY IBRD AND IDA TO SUPPORT THE FINANCING NEEDS OF THE MAIN ACTIVITY SECTORS

    Directory of Open Access Journals (Sweden)

    IRINA-ELENA CHIRTOC

    2016-12-01

    Full Text Available Principles of "Keynes Plan" which led to the establishment of the World Bank are more current than ever, if we look at the forms of financial support given poor regions around the world. Practical projects financed by loans to poor countries are analyzed on the basis of conditions to ensure a balance of payments balances. The guarantee granted by IBRD and IDA credit is provided by the state budgets that will record deficits and controlled within limits by maintaining full employment of labor. By self-financing obtained from financial market World Bank Group has full autonomy to provide funding for projects that contribute to the general welfare of mankind. Funding analyzed in this article highlights that essentially, in particular, the World Bank Group has granted financial assistance, technical assistance and advice to emerging countries in Africa, South Asia, East Asia and Pacific, without putting emphasis on the poor. Through the study done we wanted to reiterate the volume of loans granted by World Bank in 2012-2016 to world countries which are in difficulty in reconstruction and development to improve their living standards. From the beginning, the World Bank has proposed funding over underdeveloped regions, for a world free of poverty.

  10. Principle and Control Design of Active Ground-Fault Arc Suppression Device for Full Compensation of Ground Current

    DEFF Research Database (Denmark)

    Wang, Wen; Zeng, Xiangjun; Yan, Lingjie;

    2017-01-01

    Traditional ground-fault arc suppression devices mainly deal with capacitive component of ground current and have weak effect on the active and harmonic ones, which limits the arc suppression performance. The capacitive current detection needed in them suffers from low accuracy and robustness....... The commonly-used large-capacity reactive component may bring about overvoltage because of possible resonance with the distributed phase-to-ground capacitance. To solve these problems, an active ground-fault arc suppression device is presented. It employs a topology based on single-phase inverter to inject...... current into the neutral without any large-capacity reactors, and thus avoids the aforementioned overvoltage. It compensates all the active, reactive and harmonic components of the ground current to reliably extinguish the ground-fault arcs. A dual-loop voltage control method is proposed to realize arc...

  11. Software citation principles

    Directory of Open Access Journals (Sweden)

    Arfon M. Smith

    2016-09-01

    Full Text Available Software is a critical part of modern research and yet there is little support across the scholarly ecosystem for its acknowledgement and citation. Inspired by the activities of the FORCE11 working group focused on data citation, this document summarizes the recommendations of the FORCE11 Software Citation Working Group and its activities between June 2015 and April 2016. Based on a review of existing community practices, the goal of the working group was to produce a consolidated set of citation principles that may encourage broad adoption of a consistent policy for software citation across disciplines and venues. Our work is presented here as a set of software citation principles, a discussion of the motivations for developing the principles, reviews of existing community practice, and a discussion of the requirements these principles would place upon different stakeholders. Working examples and possible technical solutions for how these principles can be implemented will be discussed in a separate paper.

  12. Development of a NIR-based blend uniformity method for a drug product containing multiple structurally similar actives by using the quality by design principles.

    Science.gov (United States)

    Lin, Yiqing; Li, Weiyong; Xu, Jin; Boulas, Pierre

    2015-07-05

    The aim of this study is to develop an at-line near infrared (NIR) method for the rapid and simultaneous determination of four structurally similar active pharmaceutical ingredients (APIs) in powder blends intended for the manufacturing of tablets. Two of the four APIs in the formula are present in relatively small amounts, one at 0.95% and the other at 0.57%. Such small amounts in addition to the similarity in structures add significant complexity to the blend uniformity analysis. The NIR method is developed using spectra from six laboratory-created calibration samples augmented by a small set of spectra from a large-scale blending sample. Applying the quality by design (QbD) principles, the calibration design included concentration variations of the four APIs and a main excipient, microcrystalline cellulose. A bench-top FT-NIR instrument was used to acquire the spectra. The obtained NIR spectra were analyzed by applying principal component analysis (PCA) before calibration model development. Score patterns from the PCA were analyzed to reveal relationship between latent variables and concentration variations of the APIs. In calibration model development, both PLS-1 and PLS-2 models were created and evaluated for their effectiveness in predicting API concentrations in the blending samples. The final NIR method shows satisfactory specificity and accuracy.

  13. Investigation of the main trends of the primary real estate market in Ukraine and peculiarities of the seller marketing activity

    Directory of Open Access Journals (Sweden)

    N.Ye. Seliuchenko

    2016-12-01

    Full Text Available The aim of this article. The main objective of this paper is to study the primary real estate market of Ukraine and identify the impact of the results on the formation of individual components of the marketing activity of construction companies and sellers. In this paper it was investigated the dynamics of supply in the primary real estate market of Ukraine during the period between 2000 and 2015, and assessed the dynamics of average prices for residential real estate in the city of Kyiv since the beginning of January 2003 until the end of July 2016. The dynamics in the city of Kyiv reflects prices trends for housing in Ukraine in general. The results of the analysis. On the basis of results obtained by national scientists and our own statistical calculations it was distinguished separate stages in the formation of the primary real estate market and compared trends of the volume of commissioning of housing area and the number of built apartments during the periods of 2003-2007 and 2009-2015. It was also determined factors that influenced the volume of housing supply during mentioned periods and caused some differences in the dynamics of supply of housing area and the number of built apartments. Before the collapse of the market in 2009 the trends of both indices were quite similar. Since 2010 the volume of housing, put into operation, somewhat fluctuated. At the same time there was a gradual increase in the number of built apartments. Dynamics of commissioning during 2003-2007 corresponds to the trend which is described by exponential function, and the trend of this indicator for 2009-2015 is characterized by the logarithmic function, which confirms the faster change of the indices at the beginning of this period and their slowing down in 2011-2013. Dynamics of flats built in both periods is characterized by exponential dependence. Equation parameters that describe the trends of the change in the number of flats built for both periods are quite

  14. Novel synthesis of nanosilver particles using plant active principle aloin and evaluation of their cytotoxic effect against Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Thota Venkata Chaitanya Kumar

    2014-02-01

    Full Text Available Objective: To develop a reliable, eco-friendly and easy process for the synthesis of silver nanoparticles using aloin, the active principle of medicinal plant ‘Aloe vera ’ and to evaluate antimicrobial activity against Staphylococcus aureus (S. aureus, a causative organism of most of the diseases in livestock and to standardize the level of safety of synthesized silver nanoparticles. Methods: Characterization using UV-vis spectrophotometry, DLS technique, FT-IR and SEM. Tube dilution method was carried out to evaluate the MIC of the compound against S. aureus. MTT assay was performed to evaluate the level of safety of nanoparticles. Results: UV-vis absorption spectrum showed a maximum absorption around 200 nm for aloin mediated silver nanoparticles (ANS. The size of the particles as measured by DLS technique was 67.8 nm. The results of FT-IR analysis indicated the involvement of hydroxyl, carboxyl, amine and nitrile groups in the synthesis and stabilization of aloin mediated silver nanoparticles. SEM images showed that ANS with cubical, rectangular, triangular and spherical morphology and measured sizes of the agglomerated nanoparticles are in a range of 287.5 to 293.2 nm, however the average size of an individual particle is estimated to be approximately 70 nm. The compound (ANS showed a MIC of 21.8 ng/mL against S. aureus and showed an in vitro spleenocyte viability of more than 80% at the highest concentration of 87.5 mg/L per well. Conclusions: Aloin consists of functional groups which reduced Ag+ ions to Ago ions and helped in synthesis of silver nanoparticles. The synthesis process has further enhanced the antimicrobial activity of nanosilver. The compound is also proved to be safe at the level many times higher than the MIC.

  15. Active and Principled

    Institute of Scientific and Technical Information of China (English)

    wang yi

    2016-01-01

    Reuters: The fourth foreign ministers' meet- ing of the ISSG held yesterday [February 11] had achieved some breakthroughs. However, in the situation that Russia is still carrying out military strikes against Syria, do you think the outcomes of this foreign ministers' meeting will bring about changes in the situation on the ground in Syria?

  16. Involvement of GABAergic pathway in the sedative activity of apigenin, the main flavonoid from Passiflora quadrangularis pericarp

    Directory of Open Access Journals (Sweden)

    Andressa C. Gazola

    2015-04-01

    Full Text Available Abstract In the current study we showed that oral administration of an aqueous extract of Passiflora quadrangularis L., Passifloraceae, pericarp results in a significant prolongation of the sleep duration in mice evaluated in the ethyl ether-induced hypnosis test which indicates sedative effects. Apigenin, the main flavonoid of the extract, induced a similar sedative response when applied alone, at a dose equivalent to that found in the extract, suggesting that apigenin is mediating the sedative effects of P. quadrangularis extract. In addition, the sedative effect of apigenin was blocked by pretreatment with the benzodiazepine antagonist flumazenil (1 mg/kg, suggesting an interaction of apigenin with gamma-aminobutyric acid type A (GABAA receptors. However, apigenin at concentrations 0.1–50 µM failed to enhance GABA-induced currents through GABAA receptors (α1β2γ2S expressed in Xenopus oocytes. Nevertheless, based on our results, we suggest that the in vivo sedative effect of the P. quadrangularis extract and its main flavonoid apigenin maybe be due to an enhancement of the GABAergic system.

  17. RELATIONSHIP BETWEEN THE EXTENT OF IMPLEMENTATION OF THE PROCESS MANAGEMENT PRINCIPLES AND THE LEGAL FORM OF THE BUSINESS AND BUSINESS ACTIVITY

    Directory of Open Access Journals (Sweden)

    Monika Maříková

    2015-04-01

    Full Text Available Nowadays, enterprises are challenged with continuously changing environment and they have to react quickly to these changes. Process management can be a tool that greatly helps businesses in this difficult time to survive (Hora, 2010. Process Management brings a relatively new perspective on corporate governance. According to McCoy et al. (2007 enterprises which implemented rules of process management have a competitive advantage over others. The paper presents the application of the principles of process management in relation to the legal form of business enterprise and business activity. For determining the level of principles of process management the indicator MPP was used (Rolśnek, 2012; Truneček, 2005. Based on statistical analysis, it can be argued that there is a relationship between the application of the principles of process management, business legal forms and also business activities.

  18. The Active Ingredients of Jiang-Zhi-Ning: Study of the Nelumbo nucifera Alkaloids and Their Main Bioactive Metabolites

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2012-08-01

    Full Text Available The object of this study was to identify the major active ingredients of the Chinese Traditional Medicine Jiang-Zhi-Ning (JZN based on the high performance liquid chromatography (HPLC profiles of plasma samples obtained from beagle dogs at different times after intragastric administration of JZN, crude JZN extracts, different extracted fractions, different subfractions of the active fraction and different isolated ingredients. 2-Hydroxy-1-methoxyaporphin (2H1M, an alkaloid from Nelumbo nucifera, one of the herbs that make up JZN, was identified as the constituent showing the major pharmacodynamic effect. The major metabolites of 2H1M were analyzed and identified as N-demethyl-2-hydroxy-1-methoxyaporphine-2-O-glycuronic acid, 2-hydroxy-1-methoxy-aporphine-2-O-glycuronic acid and 2-hydroxy-1-methoxy-aporphine-2-O-sulphate. This study provided a comprehensive insight into the active components of JZN.

  19. The Plant Virus Tomato Spotted Wilt Tospovirus Activates the Immune System of Its Main Insect Vector, Frankliniella occidentalis

    Science.gov (United States)

    Medeiros, Ricardo B.; Resende, Renato de O.; de Ávila, Antonio Carlos

    2004-01-01

    Tospoviruses have the ability to infect plants and their insect vectors. Tomato spotted wilt virus (TSWV), the type species in the Tospovirus genus, infects its most important insect vector, Frankliniella occidentalis, the western flower thrips (WFT). However, no detrimental effects on the life cycle or cytopathological changes have been reported in the WFT after TSWV infection, and relatively few viral particles can be observed even several days after infection. We hypothesized that TSWV infection triggers an immune response in the WFT. Using subtractive cDNA libraries to probe WFT DNA macroarrays, we found that the WFT's immune system is activated by TSWV infection. The activated genes included (i) those encoding antimicrobial peptides, such as defensin and cecropin; (ii) genes involved in pathogen recognition, such as those encoding lectins; (iii) those encoding receptors that activate the innate immune response, such as Toll-3; and (iv) those encoding members of signal transduction pathways activated by Toll-like receptors, such as JNK kinase. Transcriptional upregulation of these genes after TSWV infection was confirmed by Northern analysis, and the kinetics of the immune response was measured over time. Several of the detected genes were activated at the same time that viral replication was first detected by reverse transcription-PCR. To our knowledge, this is the first report of the activation of an insect vector immune response by a plant virus. The results may lead to a better understanding of insects' immune responses against viruses and may help in the future development of novel control strategies against plant viruses, as well as human and animal viruses transmitted by insect vectors. PMID:15113877

  20. Final Technical Report for grant entitled "New Horizons in C-F Activation by Main Group Electrophiles"

    Energy Technology Data Exchange (ETDEWEB)

    Ozerov, Oleg V [Texas A& M University; Ozerov, Oleg V.

    2014-01-16

    We became interested in developing new methods for hydrodefluorination (HDF) and other types of C-F bond conversion in polyfluoroalkanes under mild conditions. We were attracted to an approach to C-F activation, where the key C-F cleavage proceeds by a Lewis acid abstraction of fluoride rather than a redox event. The efforts during the previous period were aimed at a) advancing the HDF reactivity with improvement in scope and catalyst longevity; b) extending C-F activation beyond HDF; c) generating insight about the elementary steps of the reaction and potential intermediates.

  1. Study on Effect of IH764-3, an Active Principle of Salviae miltiorrhizae, in Inducing Hepatic Stellate Cell Apoptosis

    Institute of Scientific and Technical Information of China (English)

    赵东强; 姜慧卿; 修贺明; 张晓岚

    2002-01-01

    Objective: To explore the anti-fibrotic mechanism of Salviae miltiorrhizae from the view of proliferation and apoptosis of hepatic stellate cells (HSC).Methods: IH764-3, an active principle of Salviae miltiorrhizae, was used to intervene in the cultured HSC in vitro. Cell proliferation was detected by methyl thiazolyl tetrazolium (MTT) method, and the cell apoptosis was examined by electron microscopy, flow cytometer and terminal deoxynucleotidyl transferase mediated dUTP nick-end-labeling method (TUNEL).Results: MTT showed that IH764-3 has obvious inhibition on the proliferation of HSC. Specific cell apoptosis figures of HSC, such as chromatin agglutination, were seen under electron microscopy in the IH764-3 treated group. By flow cytometer, it was shown that the HSC apoptosis rate in the IH764-3 treated group was higher than that in the control group, and the apoptosis inducing effect of IH764-3 was dose- and time-dependent. TUNEL analysis showed that the HSC apoptotsis rate was 28.3±1.5% after being incubated for 48 hrs with IH764-3, which was significantly higher than that in the control group (6.7±0.6%, P<0.05).Conclusion: IH764-3 could inhibit the proliferation of HSC and induce its apoptosis. These effects may be one of the anti-fibrotic mechanisms of Salviae miltiorrhizae.

  2. Screening of promising chemotherapeutic candidates against human adult T-cell leukemia/lymphoma from plants: active principles from Physalis pruinosa and structure-activity relationships with withanolides.

    Science.gov (United States)

    Nakano, Daisuke; Ishitsuka, Kenji; Hatsuse, Takahiro; Tsuchihashi, Ryota; Okawa, Masafumi; Okabe, Hikaru; Tamura, Kazuo; Kinjo, Junei

    2011-07-01

    Adult T-cell leukemia/lymphoma (ATL) is a peripheral T-cell malignancy caused by human T-cell lymphotropic virus type I (HTLV-1). Clinical manifestations of ATL range from smoldering to chronic, lymphoma and acute subtypes. Patients with acute and lymphoma-type ATL require therapeutic intervention. Conventional chemotherapeutic regimens used against other malignant lymphoma have been administered to ATL patients, but the therapeutic outcomes of acute and lymphoma-type ATL remain very poor. In this study, 214 extracts from 162 plants belonging to 65 families were screened for the purpose of elucidating the anti-proliferative effect against HTLV-1-infected T-cell lines. Extracts from aerial parts of Physalis pruinosa showed potent inhibitory effect. We isolated five withanolides from the extracts by activity-guided fractionation and examined the structure-activity relationships. The presence of a 5β,6β-epoxy function is suggested to be essential for the activity, and the most active principle showed selective toxicity to HTLV-1-infected T-cell lines.

  3. 25 years of N-heterocyclic carbenes: activation of both main-group element-element bonds and NHCs themselves.

    Science.gov (United States)

    Würtemberger-Pietsch, Sabrina; Radius, Udo; Marder, Todd B

    2016-04-14

    N-Heterocyclic carbenes (NHCs) are widely used ligands and reagents in modern inorganic synthesis as well as in homogeneous catalysis and organocatalysis. However, NHCs are not always innocent bystanders. In the last few years, more and more examples were reported of reactions of NHCs with main-group elements which resulted in modification of the NHC. Many of these reactions lead to ring expansion and the formation of six-membered heterocyclic rings involving insertion of the heteroatom into the C-N bond and migration of hydrides, phenyl groups or boron-containing fragments. Furthermore, a few related NHC rearrangements were observed some decades ago. In this Perspective, we summarise the history of NHC ring expansion reactions from the 1960s till the present.

  4. Acute mechanical stretch promotes eNOS activation in venous endothelial cells mainly via PKA and Akt pathways.

    Directory of Open Access Journals (Sweden)

    Zhenqian Hu

    Full Text Available In the vasculature, physiological levels of nitric oxide (NO protect against various stressors, including mechanical stretch. While endothelial NO production in response to various stimuli has been studied extensively, the precise mechanism underlying stretch-induced NO production in venous endothelial cells remains incompletely understood. Using a model of continuous cellular stretch, we found that stretch promoted phosphorylation of endothelial NO synthase (eNOS at Ser¹¹⁷⁷, Ser⁶³³ and Ser⁶¹⁵ and NO production in human umbilical vein endothelial cells. Although stretch activated the kinases AMPKα, PKA, Akt, and ERK1/2, stretch-induced eNOS activation was only inhibited by kinase-specific inhibitors of PKA and PI3K/Akt, but not of AMPKα and Erk1/2. Similar results were obtained with knockdown by shRNAs targeting the PKA and Akt genes. Furthermore, inhibition of PKA preferentially attenuated eNOS activation in the early phase, while inhibition of the PI3K/Akt pathway reduced eNOS activation in the late phase, suggesting that the PKA and PI3K/Akt pathways play distinct roles in a time-dependent manner. Finally, we investigated the role of these pathways in stretch-induced endothelial exocytosis and leukocyte adhesion. Interestingly, we found that inhibition of the PI3K/Akt pathway increased stretch-induced Weibel-Palade body exocytosis and leukocyte adhesion, while inhibition of the PKA pathway had the opposite effects, suggesting that the exocytosis-promoting effect of PKA overwhelms the inhibitory effect of PKA-mediated NO production. Taken together, the results suggest that PKA and Akt are important regulators of eNOS activation in venous endothelial cells under mechanical stretch, while playing different roles in the regulation of stretch-induced endothelial exocytosis and leukocyte adhesion.

  5. THE PRINCIPLES OF METHODICAL SYSTEM OF TEACHING GEOMETRY

    Directory of Open Access Journals (Sweden)

    Svetlana Feodosevna Miteneva

    2016-01-01

    Full Text Available The article deals with the main components of methodical system of teaching geometry, including the developing spatial thinking, the process of creating images, the conditions for the organization of students cognitive activity. The author describes the scheme of formation of spatial understanding of geometric objects, marks the conditions of students activities organization aimed at creating a spatial image of the studied object, lists research skills to address geometric problems and ways to implement these skills into practice, gives a summary of methods of teaching geometry, including the principle of holistic approach priority, the principle of an open multi-valuedness, the principle of subjective experience accounting.

  6. Variability of stellar granulation and convective blueshift with spectral type and magnetic activity. I. K and G main sequence stars

    OpenAIRE

    Meunier, N.; Lagrange, A. -M.; Kabuiku, L. Mbemba; Alex, M; Mignon, L.; Borgniet, S.

    2016-01-01

    In solar-type stars, the attenuation of convective blueshift by stellar magnetic activity dominates the RV variations over the low amplitude signal induced by low mass planets. Models of stars that differ from the Sun will require a good knowledge of the attenuation of the convective blueshift to estimate its impact on the variations. It is therefore crucial to precisely determine not only the amplitude of the convective blueshift for different types of stars, but also the dependence of this ...

  7. Insecticidal Activity of Essential Oil of Carum Carvi Fruits from China and Its Main Components against Two Grain Storage Insects

    Directory of Open Access Journals (Sweden)

    Shu Shan Du

    2010-12-01

    Full Text Available During our screening program for agrochemicals from Chinese medicinal herbs and wild plants, the essential oil of Carum carvi fruits was found to possess strong contact toxicity against Sitophilus zeamais and Tribolium castaneum adults, with LD50 values of 3.07 and 3.29 mg/adult, respectively, and also showed strong fumigant toxicity against the two grain storage insects with LC50 values of 3.37 and 2.53 mg/L, respectively. The essential oil obtained by hydrodistillation was investigated by GC and GC-MS. The main components of the essential oil were identified to be (R-carvone (37.98% and D-limonene (26.55% followed by α-pinene (5.21, cis-carveol (5.01% and b-myrcene (4.67%. (R-Carvone and D-limonene were separated and purified by silica gel column chromatography and preparative thin layer chromatography, and further identified by means of physicochemical and spectrometric analysis. (R-Carvone and D-limonene showed strong contact toxicity against S. zeamais (LD50 = 2.79 and 29.86 mg/adult and T. castaneum (LD50 = 2.64 and 20.14 mg/adult. (R-Carvone and D-limonene also possessed strong fumigant toxicity against S. zeamais (LC50 = 2.76 and 48.18 mg/L and T. castaneum adults (LC50 = 1.96 and 19.10 mg/L.

  8. Functional ultrasound imaging reveals different odor-evoked patterns of vascular activity in the main olfactory bulb and the anterior piriform cortex.

    Science.gov (United States)

    Osmanski, B F; Martin, C; Montaldo, G; Lanièce, P; Pain, F; Tanter, M; Gurden, H

    2014-07-15

    Topographic representation of the outside world is a key feature of sensory systems, but so far it has been difficult to define how the activity pattern of the olfactory information is distributed at successive stages in the olfactory system. We studied odor-evoked activation patterns in the main olfactory bulb and the anterior piriform cortex of rats using functional ultrasound (fUS) imaging. fUS imaging is based on the use of ultrafast ultrasound scanners and detects variations in the local blood volume during brain activation. It makes deep brain imaging of ventral structures, such as the piriform cortex, possible. Stimulation with two different odors (hexanal and pentylacetate) induced the activation of odor-specific zones that were spatially segregated in the main olfactory bulb. Interestingly, the same odorants triggered the activation of the entire anterior piriform cortex, in all layers, with no distinguishable odor-specific areas detected in the power Doppler images. These fUS imaging results confirm the spatial distribution of odor-evoked activity in the main olfactory bulb, and furthermore, they reveal the absence of such a distribution in the anterior piriform cortex at the macroscopic scale in vivo.

  9. 中国木工机械的主要种类及组系与产品结构的调整原则%The Main Types and the Structure Adjustment Principles of Chinese Woodworking Machinery

    Institute of Scientific and Technical Information of China (English)

    马岩

    2012-01-01

    According to the relevant national standards, there are generally 327 kinds of woodworking machineries in China, among which 17 kinds are long-term high-volume products, 37 kinds are medium-volume products, and the other 234 kinds will probably be CNC machineries. And all of the machineries are reasonably classified. By analyzing characteristics of different woodworking machineries, the author of this paper indicated the problems of Chinese woodworking machinery structure and consequently brought forward some adjustment principles. The basic principle is to streamline the product category. A conclusion can be made that: in order to have a good future, each enterprise should produce the product suitable for themselves and engage development according to own product structure, the small and medium-sized enterprises must manufacture products according to their own features, but not blindly follow the large-sized enterprises.%我国木工机械按国内编号标准粗略统计有327种(其中长线大批量产品有17种,中等批量的产品有37种,有234种产品具有开发成为数控木工机械的前景),并将它们合理的分类,笔者分析了各类木工机械产品开发的特点,指出我国木工机械产品结构存在的问题,提出我国木工机械产品结构的调整原则,其中重点是精简企业生产的产品种类,精简是调整的基本原则.中小企业只能回避大企业的产品结构才能有大的发展,什么类型的企业生产什么类型的产品,各类企业一定坚定地围绕自己的产品结构搞开发.

  10. Acaricidal activity of Thymus vulgaris oil and its main components against Tyrophagus putrescentiae, a stored food mite.

    Science.gov (United States)

    Jeong, E Y; Lim, J H; Kim, H G; Lee, H S

    2008-02-01

    The acaricidal activities of compounds derived from Thymus vulgaris (thyme) oil against Tyrophagus putrescentiae were assessed using an impregnated fabric disk bioassay, and were compared with those of the synthetic acaricides, benzyl benzoate and N,N-diethyl-m-toluamide. The observed responses differed according to dosage and chemical components. The 50% lethal dose (LD50) value of the T. vulgaris oil against T. putrescentiae was 10.2 microg/cm2. Biologically active constituents derived from T. vulgaris oil were purified by using silica gel chromatography and high-performance liquid chromatography. The structures of acaricidal components were analyzed by gas chromatography-mass spectrometry, 1H nuclear magnetic resonance (NMR), 13C NMR, 1H-13C COSY-NMR, and DEPT-NMR spectra, and were subsequently identified as carvacrol and thymol. Carvacrol was the most toxic compound with LD50 values (4.5 microg/cm2) significantly different from thymol (11.1 microg/cm2), benzyl benzoate (11.3 microg/cm2), and N,N-diethyl-m-toluamide (13.9 microg/cm2). Linalool was as toxic as was N,N-diethyl-m-toluamide. The lower LD50 of carvacrol indicates that it may be the major contributor of the toxicity of T. vulagaris oil against the stored food mite, although it only constitutes 14.2% of the oil. From this point of view, carvacrol and thymol can be very useful as potential control agents against stored food mite.

  11. Antibacterial activity of essential oils, their blends and mixtures of their main constituents against some strains supporting livestock mastitis.

    Science.gov (United States)

    Fratini, Filippo; Casella, Sergio; Leonardi, Michele; Pisseri, Francesca; Ebani, Valentina Virginia; Pistelli, Laura; Pistelli, Luisa

    2014-07-01

    Ten of the most known and used commercial essential oils (Cinnamomum zeylanicum L., Citrus bergamia Risso, Eucalyptus globulus Labill., Foeniculum vulgare Mill., Origanum majorana L., Origanum vulgare L., Rosmarinus officinalis L., Satureja montana L., Thymus vulgaris L. ct. carvacrol, Thymus vulgaris L. ct. thymol) were tested against six bacteria strains Staphylococcus aureus, Staphylococcus chromogenes, Staphylococcus sciuri, Staphylococcus warneri, Staphylococcus xylosus and Escherichia coli, responsible for mastitis in animals. The best results were achieved by S. montana, T. vulgaris ct. thymol and O. vulgare. Two binary mixtures of essential oils (EOs) were prepared of S. montana and T. vulgaris ct. thymol (ST) and of S. montana and O. vulgare (SO). The ST mixture exhibited the best inhibitory activity against all the tested bacterial strains. Two artificial mixtures of carvacrol/thymol (AB) and carvacrol/thymol/p-cymene (CD) were prepared and tested against all of the bacterial strains used. The results exhibited a general reduction of the inhibitory activity of mixture AB, although not reaching the inhibition of the ST and SO mixtures. However the mixture CD presented an apparent strong inhibition against S. aureus and S. sciuri. The EO mixtures and the mixture CD represent promising phytotherapic approaches against bacteria strains responsible for environmental mastitis.

  12. Laforin, a dual specificity phosphatase involved in Lafora disease, is present mainly as monomeric form with full phosphatase activity.

    Directory of Open Access Journals (Sweden)

    Vikas V Dukhande

    Full Text Available Lafora Disease (LD is a fatal neurodegenerative epileptic disorder that presents as a neurological deterioration with the accumulation of insoluble, intracellular, hyperphosphorylated carbohydrates called Lafora bodies (LBs. LD is caused by mutations in either the gene encoding laforin or malin. Laforin contains a dual specificity phosphatase domain and a carbohydrate-binding module, and is a member of the recently described family of glucan phosphatases. In the current study, we investigated the functional and physiological relevance of laforin dimerization. We purified recombinant human laforin and subjected the monomer and dimer fractions to denaturing gel electrophoresis, mass spectrometry, phosphatase assays, protein-protein interaction assays, and glucan binding assays. Our results demonstrate that laforin prevalently exists as a monomer with a small dimer fraction both in vitro and in vivo. Of mechanistic importance, laforin monomer and dimer possess equal phosphatase activity, and they both associate with malin and bind glucans to a similar extent. However, we found differences between the two states' ability to interact simultaneously with malin and carbohydrates. Furthermore, we tested other members of the glucan phosphatase family. Cumulatively, our data suggest that laforin monomer is the dominant form of the protein and that it contains phosphatase activity.

  13. Stellar Activity on the Young Suns of Orion: COUP Observations of K5-7 Pre-Main Sequence Stars

    CERN Document Server

    Wolk, S J; Micela, G; Favata, F; Glassgold, A E; Shang, H; Feigelson, E D

    2005-01-01

    In January 2003, the Chandra Orion Ultradeep Project (COUP) detected about 1400 young stars during a 13.2 day observation of the Orion Nebula Cluster (ONC). This paper studies a well-defined sample of 28 solar-mass COUP sources to characterize the magnetic activity of analogs of the young Sun and thereby to improve understanding of the effects of solar X-rays on the solar nebula during the era of planet formation. We find that active young Suns spend 70% of their time in a characteristic state with relatively constant flux and magnetically confined plasma with temperatures kT_2 = 2.1 * kT_1. During characteristic periods, the 0.5-8 keV X-ray luminosity is about 0.03% of the bolometric luminosity. One or two powerful flares per week with peak luminosities logL_x ~ 30-32 erg/s are typically superposed on this characteristic emission accompanied by heating of the hot plasma component from ~2.4 keV to ~7 keV at the flare peak. The energy distribution of flares superposed on the characteristic emission level follo...

  14. The Application of Euphemism in International Business Negotiations from the Perspective of Politeness Principle

    Institute of Scientific and Technical Information of China (English)

    刘晓双

    2016-01-01

    Business negotiation is an active course of different economic entities. This paper mainly focuses on the application of the six maxims of Politeness Principle and its pragmatic politeness strategies in international business negotiations.

  15. Studies on the antimicrobial activity and brine shrimp toxicity of Zeyheria tuberculosa (Vell. Bur. (Bignoniaceae extracts and their main constituents

    Directory of Open Access Journals (Sweden)

    Rocha Eliana MM

    2009-05-01

    Full Text Available Abstract Background Due to the indiscriminate use of antimicrobial drugs, the emergence of human pathogenic microorganisms resistant to major classes of antibiotics has been increased and has caused many clinical problems in the treatment of infectious diseases. Thus, the aim of this study was to evaluate for the first time the in vitro antimicrobial activity and brine shrimp lethality of extracts and isolated compounds from Zeyheria tuberculosa (Vell. Bur., a species used in Brazilian folk medicine for treatment of cancer and skin diseases. Methods Using the disc diffusion method, bioautography assay and brine shrimp toxicity test (Artemia salina Leach, we studied the antimicrobial activity and lethality of extracts and isolated compounds against three microorganisms strains, including Gram-positive (Staphylococcus aureus and Gram-negative (Pseudomonas aeruginosa bacteria and yeasts (Candida albicans. Results In this study, the extracts inhibited S. aureus (8.0 ± 0.0 to 14.0 ± 0.0 mm and C. albicans (15.3 ± 0.68 to 25.6 ± 0.4 mm growth. In the brine shrimp test, only two of them showed toxic effects (LC50 29.55 to 398.05 μg/mL and some extracts were non-toxic or showed weak lethality (LC50 705.02 to > 1000 μg/mL. From these extracts, four flavones [5,6,7,8-tetramethoxyflavone (1, 5,6,7-trimethoxyflavone (2, 4'-hydroxy-5,6,7,8-tetramethoxyflavone (3, and 4'-hydroxy-5,6,7-trimethoxyflavone (4] were isolated through bioassay-guided fractionation and identified based on the 1D and 2D NMR spectral data. By bioautography assays, compounds 1 [S. aureus (16.0 ± 0.0 mm and C. albicans (20.0 ± 0.0 mm] and 3 [S. aureus (10.3 ± 0.6 mm and C. albicans (19.7 ± 0.6 mm] inhibited both microorganisms while 2 inhibited only S. aureus (11.7 ± 0.6 mm. Compound 4 did not restrain the growth of any tested microorganism. Conclusion Our results showed that extracts and isolated flavones from Z. tuberculosa may be particularly useful against two pathogenic

  16. Management principles of the interaction between market attractiveness producer and its recipients

    Directory of Open Access Journals (Sweden)

    O.V. Sviridova

    2013-09-01

    Full Text Available The aim of the article. The article is devoted to the definition of the content of interaction between attractiveness producer and its recipients through the prism of general and derived management principles. Actuality of this article is caused by the formation of long-term relationships between business subjects. The main aim of these relationships is attracting and using of resources to further joint production and benefits distribution from these activities. Formation of such long-term relationships in condition of high competitiveness is one of the urgent problems of modern enterprises. In this regard, the traditional management principles are supplemented by the principles of the interaction and attractiveness managing. The purpose of the article is further improving of management principles through the establishment of specific management principles of the interaction between market attractiveness producer and its recipients.The results of the analysis. Management principles are the statements of fundamental truth based on logic which provides guidelines for managerial decision making and actions. The research of classic, general and structural management principles is conducted in the article. The possibility and necessity of ascertainment of the derivative management principles of interaction between subjects of market environment is noted. Derivative management principles reflect the content of the specialized management activity on forming of enterprise attractiveness. The analysis of existing management principles of different objects is conducted. It is established that as a basis for systematization of management principles scientists use different management features, such as socio-political principles, principles of management culture and state-administrative activity, socio-political, structural, scientific, legal, personnel and organizational basis.Results of research of management principles and management interaction proved

  17. Epidihydropinidine, the main piperidine alkaloid compound of Norway spruce (Picea abies) shows promising antibacterial and anti-Candida activity.

    Science.gov (United States)

    Fyhrquist, Pia; Virjamo, Virpi; Hiltunen, Eveliina; Julkunen-Tiitto, Riitta

    2017-03-01

    This study reports for the first time promising antibacterial and antifungal effects of epidihydropinidine, the major piperidine alkaloid in the needles and bark of Norway spruce, Picea abies (L.) Karsten. Epidihydropinidine was growth inhibitory against all bacterial and fungal strains used in our investigation, showing the lowest MIC value of 5.37μg/mL against Pseudomonas aeruginosa, Enterococcus faecalis, Candida glabrata and C. albicans. Epidihydropinidine was nearly three times more active than tetracycline against P. aeruginosa and E. faecalis. Promising antibacterial effects were also recorded against Staphylococcus aureus and Bacillus cereus (MIC 10.75μg/mL) as well as against Salmonella enterica (MIC and MBC 43μg/mL). Our preliminary results suggest that epidihydropinidine as well related alkaloids of Norway spruce could be powerful candidates for new antibiotics and for preventing food spoilage.

  18. Vasodilator Activity of the Essential Oil from Aerial Parts of Pectis brevipedunculata and Its Main Constituent Citral in Rat Aorta

    Directory of Open Access Journals (Sweden)

    Gisele Zapata-Sudo

    2013-03-01

    Full Text Available The essential oil of Pectis brevipedunculata (EOPB, a Brazilian ornamental aromatic grass, is characterized by its high content of citral (81.9%: neral 32.7% and geranial 49.2%, limonene (4.7% and α-pinene (3.4%. Vasodilation induced by EOPB and isolated citral was investigated in pre-contracted vascular smooth muscle, using thoracic aorta from Wistar Kyoto (WKY rats which was prepared for isometric tension recording. EOPB promoted intense relaxation of endothelium-intact and denuded aortic rings with the concentration to induce 50% of the maximal relaxation (IC50 of 0.044% ± 0.006% and 0.093% ± 0.015% (p 0.05. In endothelium-intact aorta, EOPB-induced vasorelaxation was significantly reduced by L-NAME, a nitric oxide synthase inhibitor. The vasodilator activity of citral was increased in the KCl-contracted aorta and citral attenuated the contracture elicited by Ca2+ in depolarized aorta. EOPB and citral elicited vasorelaxation on thoracic aorta by affecting the NO/cyclic GMP pathway and the calcium influx through voltage-dependent L-type Ca2+ channels, respectively.

  19. Accretion and outflow activity on the late phases of pre-main-sequence evolution. The case of RZ Piscium

    Science.gov (United States)

    Potravnov, I. S.; Mkrtichian, D. E.; Grinin, V. P.; Ilyin, I. V.; Shakhovskoy, D. N.

    2017-03-01

    RZ Psc is an isolated high-latitude post-T Tauri star that demonstrates a UX Ori-type photometric activity. The star shows very weak spectroscopic signatures of accretion, but at the same time possesses the unusual footprints of the wind in Na i D lines. In the present work we investigate new spectroscopic observations of RZ Psc obtained in 2014 during two observation runs. We found variable blueshifted absorption components (BACs) in lines of the other alcali metals, K i 7699 Å and Ca ii IR triplet. We also confirmed the presence of a weak emission component in the Hα line, which allowed us to estimate the mass accretion rate on the star as Ṁ ≤ 7 × 10-12M⊙ yr-1. We could not reveal any clear periodicity in the appearance of BACs in sodium lines. Nevertheless, the exact coincidence of the structure and velocities of the Na i D absorptions observed with the interval of about one year suggests that such a periodicity should exist.

  20. Qualitative and quantitative determination of 15 main active constituents in Fructus Sophorae pill by liquid chromatography tandem mass spectrometry

    Directory of Open Access Journals (Sweden)

    Xu-ran Zhi

    2015-01-01

    Full Text Available Background: Fructus Sophorae pill, one of the traditional Chinese medicine, was widely used for hemorrhoids, hypertension and odontalgia. This paper describes a sensitive and specific assay for the determination of the 15 active constituents (sophoricoside, genistin, genistein, rutin, quercetin, kaempferol, baicalein, baicalin, naringin, naringenin, hesperidin, neohesperidin, wogonin and cimifugin, prim-O-glucosylcimifugin in Fructus Sophorae pill. Materials and Methods: Chromatographic separation was performed on a C 18 column with acidified aqueous methanol gradients at a flow rate of 0.8 mL/min. The identification and quantification of the analytes were achieved by use of a hybrid quadrupole linear ion trap mass spectrometer. Multiple-reaction monitoring scanning was applied to quantification with switching electrospray ion source polarity between positive and negative modes. Results: The proposed method was used to analyze 40 batches of samples with good linearity (r, 0.9990-0.9999, intraday precisions (RSD, 0.14-2.55%, interday precisions (RSD, 0.51-2.81%, stability (RSD, 0.31-2.65%, and recovery (RSD, 1.29-2.95% of the 15 compounds. In addition, the hierarchical cluster analysis, including a method called furthest neighbor and nearest neighbor, was employed to classify samples according to characteristics of the 15 constituents. Conclusion: The results indicated that the analytical method was rapid, reliable, simple and suitable for the quality evaluation of Fructus Sophorae pill.

  1. Synthesis of Analogues of Gingerol and Shogaol, the Active Pungent Principles from the Rhizomes of Zingiber officinale and Evaluation of Their Anti-Platelet Aggregation Effects

    Directory of Open Access Journals (Sweden)

    Hung-Cheng Shih

    2014-03-01

    Full Text Available The present study was aimed at discovering novel biologically active compounds based on the skeletons of gingerol and shogaol, the pungent principles from the rhizomes of Zingiber officinale. Therefore, eight groups of analogues were synthesized and examined for their inhibitory activities of platelet aggregation induced by arachidonic acid, collagen, platelet activating factor, and thrombin. Among the tested compounds, [6]-paradol (5b exhibited the most significant anti-platelet aggregation activity. It was the most potent candidate, which could be used in further investigation to explore new drug leads.

  2. Main Directions of Increasing Efficiency of Foreign Trade Activities of the Fishing Industry of the European North

    Directory of Open Access Journals (Sweden)

    Anatolii Mikhailovich Vasil’ev

    2015-09-01

    Full Text Available Analysis of the List of Orders of the Russian Federation President Vladimir Putin has shown that many priority challenges of the fishing industry development, including promotion of fish production with a high degree of processing and its exports have not been solved. Analysis of exports of cod, haddock and saithe from Russia (Murmansk Oblast and Norway proves that there is a wider range of products from Norway with high added value. The unit cost of the same products from Norway is also significantly higher. The consequence of these factors is the low unit cost of Russian exports, compared to Norwegian. For 2009–2013 the average unit cost of cod is lower by 2.66 US dollars (47.9%, of haddock – by 0.23 US dollars (10.6%. The article estimates foreign currency revenues, which were not fully received due to the reasons mentioned above. The author points out key directions of increase of economic efficiency of Russian exports of cod, haddock and saithe: 1. Change in the access of economic agents to marketable resources by stimulating the obtainment of larger quotas of biological resources at the expense of profit ratio. 2. Establishment of an organization for the export of fish products. The purpose of the organization is to study international markets, to regulate foreign trade activities and perform other functions as set forth above, in accordance with the Russian legislation. 3. Exclusion of intermediaries in the sales of fish products by organizing electronic auctions. 4. Prohibition of using fishery products for the payment of loans obtained from foreign banks. 5. Use of trawlers that are not able to produce products with added value, to provide fish processing enterprises of Russia with fish resources

  3. Dynamo action and magnetic activity during the pre-main sequence: Influence of rotation and structural changes

    Science.gov (United States)

    Emeriau-Viard, Constance; Brun, Allan Sacha

    2017-10-01

    During the PMS, structure and rotation rate of stars evolve significantly. We wish to assess the consequences of these drastic changes on stellar dynamo, internal magnetic field topology and activity level by mean of HPC simulations with the ASH code. To answer this question, we develop 3D MHD simulations that represent specific stages of stellar evolution along the PMS. We choose five different models characterized by the radius of their radiative zone following an evolutionary track, from 1 Myr to 50 Myr, computed by a 1D stellar evolution code. We introduce a seed magnetic field in the youngest model and then we spread it through all simulations. First of all, we study the consequences that the increase of rotation rate and the change of geometry of the convective zone have on the dynamo field that exists in the convective envelop. The magnetic energy increases, the topology of the magnetic field becomes more complex and the axisymmetric magnetic field becomes less predominant as the star ages. The computation of the fully convective MHD model shows that a strong dynamo develops with a ratio of magnetic to kinetic energy reaching equipartition and even super-equipartition states in the faster rotating cases. Magnetic fields resulting from our MHD simulations possess a mixed poloidal-toroidal topology with no obvious dominant component. We also study the relaxation of the vestige dynamo magnetic field within the radiative core and found that it satisfies stability criteria. Hence it does not experience a global reconfiguration and instead slowly relaxes by retaining its mixed poloidal-toroidal topology.

  4. Phenotyping studies to assess the effects of phytopharmaceuticals on in vivo activity of main human cytochrome p450 enzymes.

    Science.gov (United States)

    Zadoyan, Gregor; Fuhr, Uwe

    2012-09-01

    The extensive use of herbal drugs and their multiple components and modes of action suggests that they may also cause drug interactions by changing the activity of human cytochrome P450 enzymes. The purpose of the present review is to present the available data for the top 14 herbal drug sales in the U. S. Studies describing the effects of herbal drugs on phenotyping substrates for individual CYPs were identified by a comprehensive MEDLINE search. Drugs included Allium sativum (Liliaceae), Echinacea purpurea (Asteraceae), Serenoa repens (Arecaceae), Ginkgo biloba (Ginkgoaceae), Vaccinium macrocarpon (Ericaceae), Glycine max (Fabaceae), Panax ginseng (Araliaceae), Actea racemosa (Ranunculaceae), Hypericum perforatum (Hypericaceae), Silybum marianum (Asteraceae), Camellia sinensis (Theaceae), Valeriana officinalis (Valerianaceae), Piper methysticum (Piperaceae), and Hydrastis canadensis (Ranunculaceae) preparations. We identified 70 clinical studies in 69 publications. The majority of the herbal drugs appeared to have no clear effects on most of the CYPs examined. If there was an effect, there was mild inhibition in almost all cases, as seen with garlic or kava effects on CYP2E1 and with soybean components on CYP1A2. The most pronounced effects were induction of CYP3A and other CYPs by St. John's wort and the inhibitory effect of goldenseal on CYP3A and CYP2D6, both being borderline between mild and moderate in magnitude. With the exceptions of St.John's wort and goldenseal, the information currently available suggests that concomitant intake of the herbal drugs addressed here is not a major risk for drugs that are metabolized by CYPs.

  5. Variational principles

    CERN Document Server

    Moiseiwitsch, B L

    2004-01-01

    This graduate-level text's primary objective is to demonstrate the expression of the equations of the various branches of mathematical physics in the succinct and elegant form of variational principles (and thereby illuminate their interrelationship). Its related intentions are to show how variational principles may be employed to determine the discrete eigenvalues for stationary state problems and to illustrate how to find the values of quantities (such as the phase shifts) that arise in the theory of scattering. Chapter-by-chapter treatment consists of analytical dynamics; optics, wave mecha

  6. [Financial and economic principles of assessing enterprises' insurance premium for mandatory social worker's compensation].

    Science.gov (United States)

    Petrosiants, E V; Bal'nova, L G

    2000-01-01

    The authors analyzed present enterprises' insurance premiums, pointed out the associated drawbacks, defined main financial and economic principles underlying determination of enterprise's insurance premium (principle of sufficiency, principle of justice, principle of collective responsibility and principle of stimulation).

  7. Geoethics and its principles

    Directory of Open Access Journals (Sweden)

    Szabó Štefan

    1997-12-01

    Full Text Available Mining and mineral processing belong to the activities with a mostly negative impact on the environment. GAIA hypothesis should help us to understand the basic mechanisms of planetary homeostasis, influenced by human activities. Principles of the geoethics should help to respect the limits of disturbances and loading capacity of ecosystems, which have the essential importance for our survival.

  8. [Studies on effects of Achyranthes bidentata on tongsaimai pellets main active ingredients chlorogenic acid, isoliquiritin, harpagoside and glycyrrhizin in vivo pharmacokinetics].

    Science.gov (United States)

    Cheng, Jian; Di, Liu-Qing; Shan, Jin-Jun; Zhao, Xiao-Li; Kang, An; Bi, Xiao-Lin; Li, Jun-Song

    2014-04-01

    To study on the effects of Achyranthes bidentata on Tongsaimai pellets main active ingredients chlorogenic acid, isoliquiritin, harpagoside and glycyrrhizin in rats in vivo pharmacokinetic behaviors, a method for the simultaneous determination of chlorogenic acid, isoliquiritin, harpagoside and liquiritigenin in rat plasma was established by UPLC-MS/MS. The analysis was performed on a waters Acquity BEH C18 column (2.1 mm x 100 mm, 1.7 microm) with the mixture of acetonitrile and 0.1% formic acid/water as mobile phase, and the gradient elution at a flow rate of 0.3 mL x min(-1). The analytes were detected by tandem mass spectrometry with the electrospray ionization (ESI) source and in the multiple reaction monitoring (MRM) mode. It turned out that the analytes of Tongsaimai pellets groups C(max) and AUC(Q-infinity) values were higher than that with A. bidentata group, and the C(max) values of chlorogenic acid had significantly difference (P < 0.05), the AUC(0-infinity) values of chlorogenic acid and glycyrrhizin had significantly difference (P < 0.05); The T(max) and CL values of two groups had no significantly difference. Results showed that the established method was specific, rapid, accurate and sensitive for the studies of Tongsaimai pellets four main active ingredients in rat in vivo pharmacokinetic, and A. bidentata have varying degrees of effects on Tongsaimai pellets four main active ingredients in rat in vivo pharmacokinetic behaviors.

  9. Genetic principles.

    Science.gov (United States)

    Abuelo, D

    1987-01-01

    The author discusses the basic principles of genetics, including the classification of genetic disorders and a consideration of the rules and mechanisms of inheritance. The most common pitfalls in clinical genetic diagnosis are described, with emphasis on the problem of the negative or misleading family history.

  10. Cosmological principle

    Energy Technology Data Exchange (ETDEWEB)

    Wesson, P.S.

    1979-10-01

    The Cosmological Principle states: the universe looks the same to all observers regardless of where they are located. To most astronomers today the Cosmological Principle means the universe looks the same to all observers because density of the galaxies is the same in all places. A new Cosmological Principle is proposed. It is called the Dimensional Cosmological Principle. It uses the properties of matter in the universe: density (rho), pressure (p), and mass (m) within some region of space of length (l). The laws of physics require incorporation of constants for gravity (G) and the speed of light (C). After combining the six parameters into dimensionless numbers, the best choices are: 8..pi..Gl/sup 2/ rho/c/sup 2/, 8..pi..Gl/sup 2/ rho/c/sup 4/, and 2 Gm/c/sup 2/l (the Schwarzchild factor). The Dimensional Cosmological Principal came about because old ideas conflicted with the rapidly-growing body of observational evidence indicating that galaxies in the universe have a clumpy rather than uniform distribution. (SC)

  11. SELF-REGULATION FOR PROFESSIONAL ACTIVITIES OF STOCK MARKET PARTICIPANTS THEIR SENSE, AIMS AND PRINCIPLES OF INTEGRATION

    Directory of Open Access Journals (Sweden)

    N. V. Bachal

    2010-10-01

    Full Text Available The expediency of introduction of self-regulation as most important element of realization of the general strategy of optimization of the state intervention in economy is proved. The essence, the purposes and principles of introduction of the self-regulatory organizations of stock exchange market participants are shown. Advantages and demerits of self-regulation are presented.

  12. Electrical principles 3 checkbook

    CERN Document Server

    Bird, J O

    2013-01-01

    Electrical Principles 3 Checkbook aims to introduce students to the basic electrical principles needed by technicians in electrical engineering, electronics, and telecommunications.The book first tackles circuit theorems, single-phase series A.C. circuits, and single-phase parallel A.C. circuits. Discussions focus on worked problems on parallel A.C. circuits, worked problems on series A.C. circuits, main points concerned with D.C. circuit analysis, worked problems on circuit theorems, and further problems on circuit theorems. The manuscript then examines three-phase systems and D.C. transients

  13. LEAN SUPPLY CHAIN DESIGN PRINCIPLES

    OpenAIRE

    Kozlov, Aleksandr

    2015-01-01

    The article presents a set of principles, which can guide the design of lean supply chains. The author divides design principles into 3 main categories. The first two sets describe internal production processes while the 3-rd set relates to the entire supply chain.

  14. The Application of Cooperation Principle and Politeness Principle in Oral Teaching

    Institute of Scientific and Technical Information of China (English)

    石洁

    2014-01-01

    The pragmatic principle that people should comply with in communicative activities are the principles of cooperation and politeness principle. The principles of cooperation play a regulatory role in communication while politeness principle actually has a greater binding. In teaching, teachers should always teach basing on language and make students understand the Cooperative Principle and Politeness Principle in pragmatics in order to improve oral communication skills.

  15. Quantum mechanics principles and formalism

    CERN Document Server

    McWeeny, Roy

    2012-01-01

    Focusing on main principles of quantum mechanics and their immediate consequences, this graduate student-oriented volume develops the subject as a fundamental discipline, opening with review of origins of Schrödinger's equations and vector spaces.

  16. Antioxidant enzyme activities and lipid peroxidation as biomarker for potato tuber stored by two essential oils from Caraway and Clove and its main component carvone and eugenol

    Institute of Scientific and Technical Information of China (English)

    Abd El-Moneim MR Afify; Hossam S El-Beltagi; Amina A Aly; Abeer E El-Ansary

    2012-01-01

    Objective: To evaluate two essential oils from Caraway and Clove and its main component carvone and eugenol as sprout inhibitors on germination of potato tubers. Methods: The enzymes activities: catalase, glutathione-S-transferase, peroxidase, polyphenol oxidase and superoxide dismutase, in addition to lipid peroxidation level were tested in potato tubers stored for 3, 6 and 9 weeks. Essential oils; Caraway, Clove, carvone and eugenol with three concentration (100, 200 and 300 ppm) were used to control germination process of potato tubers. Results: The results of enzyme activities varied depending on the function of enzymes involved. As general trend the activities of the enzymes recorded are significantly found on the range of enzyme control or less, which prevent of potato tuber from germination. Glutathione-S-transferase activity was significantly increased after treatment with essential oils and the activity of enzyme reached (23.3±5.15) (100 ppm) for Caraway, (18.8±0.00) (100 ppm) for carvone, (10.4±0.00) (100 ppm) for colve, and (14.1±0.0) (100 ppm) for eugenol respectively compared to control (7.86±3.26). Conclusions:Polyphenol oxidase and peroxidase activity increased in its activity and recovered to the level of control after treatment with essential oils which maintain potato tuber for 9 weeks. The pure essential oils especially carvone have more potent as suppressor of potato tuber germination.

  17. Alpha-Pinene as the Main Component of Ducrosia anethifolia (Boiss Essential Oil is Responsible for its Effect on Locomotor Activity in Rats

    Directory of Open Access Journals (Sweden)

    Zamyad

    2016-05-01

    Full Text Available Background Ducrosia anethifolia (DA is a medicinal plant traditionally used to treat a wide spectrum of illnesses. DA contains a series of antioxidant compounds, including alpha-pinene, which give it a sedative and relaxing effect. In spite of these effects of DA, the effects of DA essential oil on anxiety and locomotor activity in open field tests have not yet been studied. In the present study, the effects of DA essential oil and its main component of alpha-pinene on locomotor activity and anxiety were studied using open field tests. Objectives The purpose of this study was to investigate the effects of DA essential oil and its main component, alpha-pinene, on locomotor activity and anxiety behaviors using open field and antioxidant capacity tests in Wistar rats. Methods Sixty-three adult male Wistar rats (weighing 200 - 250 g were divided into 9 groups: control, positive control (diazepam, essential oil treated groups (25, 50, 100, 200, and 500 mg/kg administered intraperitoneally, (i.p. and alpha-pinene groups (0.2 and 0.4 mg/kg, i.p.. For precisely 30 minutes after each injection in all groups, open field tests were used to assess behaviors such as rearing, line crossing, walling, grooming, and stretched attend posturing. In addition, oxidant and antioxidant parameters (malondialdehyde [MDA] and catalase [CAT] were assessed in the rats’ temporal lobes. Results DA (200 and 500 mg/kg doses and alpha-pinene (0.2 and 0.4 mg/kg doses significantly reduced locomotor activity, whereas doses of 25, 50, and 100 mg/kg of DA failed to show such an effect. Treatment with DA and alpha-pinene resulted in a significant decrease in MDA levels and a significant increase in CAT activity in comparison to controls. Conclusions The results of this study suggest that the main component of DA (alpha-pinene is responsible for DA’s ability to reduce locomotor activity and anxiety, which is indicative of CNS depressant activity. Moreover, it is possible that

  18. Basic Principles of Chromatography

    Science.gov (United States)

    Ismail, Baraem; Nielsen, S. Suzanne

    Chromatography has a great impact on all areas of analysis and, therefore, on the progress of science in general. Chromatography differs from other methods of separation in that a wide variety of materials, equipment, and techniques can be used. [Readers are referred to references (1-19) for general and specific information on chromatography.]. This chapter will focus on the principles of chromatography, mainly liquid chromatography (LC). Detailed principles and applications of gas chromatography (GC) will be discussed in Chap. 29. In view of its widespread use and applications, high-performance liquid chromatography (HPLC) will be discussed in a separate chapter (Chap. 28). The general principles of extraction are first described as a basis for understanding chromatography.

  19. Activation Products from Copper and Steel Samples Exposed to Showers Produced by 8 GeV Protons Lost in the Fermilab Main Injector Collimation System

    CERN Document Server

    Brown, Bruce C; Pronskikh, Vitaly S

    2015-01-01

    In conjunction with efforts to predict residual radiation levels in the Fermilab Main Injector, measurements of residual radiation were correlated with the time history of losses. Detailed examination suggested that the list of radioactive isotopes used for fitting was incomplete. We will report on activation studies of magnet steel and copper samples which we irradiated adjacent to the Fermilab Main Injector collimation system. Our results identified several additional radioactive isotopes of interest. The MARS15 studies using a simplified model are compared with measurements. The long half-life isotopes will grow in importance as operation stretches to a second decade and as loss rates rise. These studies allow us to predict limits on these concerns.

  20. The Effects of Xiangqing Anodyne Spray on Treating Acute Soft-Tissue Injury Mainly Depend on Suppressing Activations of AKT and p38 Pathways

    Directory of Open Access Journals (Sweden)

    Shudong Wang

    2016-01-01

    Full Text Available Objectives. In the present study we try to elucidate the mechanism of Xiangqing anodyne spray (XQAS effects on acute soft-tissue injury (STI. Methods. Acute STI model was established by hammer blow in the rat hind leg muscle. Within 8 hours, instantly after modeling and per 2-hour interval repeated topical applications with or without XQAS, CP or IH ethanol extracts spray (CPS and IHS were performed, respectively; muscle swelling rate and inflammation-related biochemical parameters, muscle histological observation, and mRNA and protein expression were then examined. Results. XQAS dose-dependently suppressed STI-caused muscle swelling, proinflammatory mediator productions, and oxidative stress as well as severe pathological changes in the injured muscle tissue. Moreover, CPS mainly by blocking p38 activation while IHS majorly by blocking AKT activation led to cytoplastic IκBα degradation with NF-κB p65 translocated into the nucleus. There are synergistic effects between CP and IH components in the XQAS on preventing from acute STI with suppressing IκBα degradation, NF-κB p65 translocation, and subsequent inflammation and oxidative stress-related abnormality. Conclusion. Marked effects of XQAS on treating acute STI are ascribed to strong anti-inflammatory and antioxidative actions with a reasonable combination of CP active components, blocking p38-NF-κB pathway activated, and IH active components, blocking AKT-NF-κB pathway activated.

  1. The Effects of Xiangqing Anodyne Spray on Treating Acute Soft-Tissue Injury Mainly Depend on Suppressing Activations of AKT and p38 Pathways

    Science.gov (United States)

    Wang, Shudong; Li, Tao; Qu, Wei; Li, Xin; Ma, Shaoxin; Wang, Zheng; Liu, Wenya; Hou, Shanshan; Fu, Jihua

    2016-01-01

    Objectives. In the present study we try to elucidate the mechanism of Xiangqing anodyne spray (XQAS) effects on acute soft-tissue injury (STI). Methods. Acute STI model was established by hammer blow in the rat hind leg muscle. Within 8 hours, instantly after modeling and per 2-hour interval repeated topical applications with or without XQAS, CP or IH ethanol extracts spray (CPS and IHS) were performed, respectively; muscle swelling rate and inflammation-related biochemical parameters, muscle histological observation, and mRNA and protein expression were then examined. Results. XQAS dose-dependently suppressed STI-caused muscle swelling, proinflammatory mediator productions, and oxidative stress as well as severe pathological changes in the injured muscle tissue. Moreover, CPS mainly by blocking p38 activation while IHS majorly by blocking AKT activation led to cytoplastic IκBα degradation with NF-κB p65 translocated into the nucleus. There are synergistic effects between CP and IH components in the XQAS on preventing from acute STI with suppressing IκBα degradation, NF-κB p65 translocation, and subsequent inflammation and oxidative stress-related abnormality. Conclusion. Marked effects of XQAS on treating acute STI are ascribed to strong anti-inflammatory and antioxidative actions with a reasonable combination of CP active components, blocking p38-NF-κB pathway activated, and IH active components, blocking AKT-NF-κB pathway activated. PMID:27190541

  2. Peroxisome Proliferator-Activated Receptor α Activation Is Not the Main Contributor to Teratogenesis Elicited by Polar Compounds from Oxidized Frying Oil

    Science.gov (United States)

    Lin, Yu-Shun; Lin, Ting-Yi; Wu, Jia-Jiuan; Yao, Hsien-Tsung; Chang, Sunny Li-Yun; Chao, Pei-Min

    2017-01-01

    We previously reported that polar compounds (PO) in cooking oil are teratogenic and perturbed retinoic acid (RA) metabolism. Considering PO as a potent peroxisome proliferator-activated receptor α (PPARα) activator, this study aimed to investigate the role of PPARα in PO-induced teratogenesis and disturbance of RA metabolism. Female PPARα knockout or wild type mice were mated with males of the same genotype. Pregnant mice were fed a diet containing 10% fat from either fresh oil (FO) or PO from gestational day1 to day18, and killed at day18. The PO diet significantly increased the incidence of teratogenesis and fetal RA concentrations, regardless of genotype. Though PPARα deficiency disturbed maternal RA homeostasis, itself did not contribute to teratogenesis as long as FO diet was given. The mRNA profile of genes involved in RA metabolism was differentially affected by diet or genotype in mothers and fetuses. Based on hepatic mRNA levels of genes involved in xenobiotic metabolism, we inferred that PO not only activated PPARα, but also altered transactivity of other xenobiotic receptors. We concluded that PO-induced fetal anomalies and RA accumulation were independent of PPARα activation. PMID:28264465

  3. Peroxisome Proliferator-Activated Receptor α Activation Is Not the Main Contributor to Teratogenesis Elicited by Polar Compounds from Oxidized Frying Oil

    Directory of Open Access Journals (Sweden)

    Yu-Shun Lin

    2017-02-01

    Full Text Available We previously reported that polar compounds (PO in cooking oil are teratogenic and perturbed retinoic acid (RA metabolism. Considering PO as a potent peroxisome proliferator-activated receptor α (PPARα activator, this study aimed to investigate the role of PPARα in PO-induced teratogenesis and disturbance of RA metabolism. Female PPARα knockout or wild type mice were mated with males of the same genotype. Pregnant mice were fed a diet containing 10% fat from either fresh oil (FO or PO from gestational day1 to day18, and killed at day18. The PO diet significantly increased the incidence of teratogenesis and fetal RA concentrations, regardless of genotype. Though PPARα deficiency disturbed maternal RA homeostasis, itself did not contribute to teratogenesis as long as FO diet was given. The mRNA profile of genes involved in RA metabolism was differentially affected by diet or genotype in mothers and fetuses. Based on hepatic mRNA levels of genes involved in xenobiotic metabolism, we inferred that PO not only activated PPARα, but also altered transactivity of other xenobiotic receptors. We concluded that PO-induced fetal anomalies and RA accumulation were independent of PPARα activation.

  4. Comparison of social interaction and neural activation in the main olfactory bulb and the accessory olfactory bulb between Microtus mandarinus and Microtus fortis

    Directory of Open Access Journals (Sweden)

    Fadao TAI, Wanying WANG, Hugh BRODERS, Ruyong SUN, Limin LIU , Hongyuan WANG

    2009-08-01

    Full Text Available To gain insight into the function of AOB and MOB during different social interaction and in different vole species, the behaviors and neural activation of the olfactory bulbs in social interactions of mandarin voles Microtus mandarinus and reed voles Microtus fortis were compared in the present research. Mandarin voles spent significantly more time attacking and sniffing its opponent and sniffing sawdust than reed voles. During same sex encounters, mandarin voles attacked its opponent for a significantly longer time and sniffed its opponent for shorter time compared with male-female interactions. However, no significant behavioral differences were found during encounters of two individual reed voles, regardless of gender composition of the pair. Using c-Fos as an indicator of neural activation, we observed that neural activation was significantly higher in almost all sub-regions of the main olfactory bulb (MOB and the accessory olfactory bulb (AOB of mandarin voles compared with reed voles. Numbers of c-Fos-ir neurons in almost all sub-regions of the AOB and the MOB during male-female interactions were also higher than those in interactions of the same sex. Anterior-posterior ratios of Fos-ir neurons in the AOBM (AOBMR and the AOBG (AOBGR in male-female interaction were significantly higher than those in interaction of the same sex. The AOBMR of male mandarin voles and reed voles were larger than those of females in male-female interactions. Behavioral patterns are consistent with cellular activity patterns. Consistent level of neural activation in MOB and AOB suggests important roles of both the main olfactory bulb and the accessory olfactory bulb in social interaction in two species [Current Zoology 55(4: 279 –287, 2009].

  5. Specific activity of [{sup 11}C]CH{sub 3}I synthesized by the 'wet' method: Main sources of non-radioactive carbon

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Vallejo, Vanessa [Institut Alta Tecnologia PRBB-Fundacio Privada, Parc de Recerca Biomedica de Barcelona, C/Dr. Aiguader, 88 08003 Barcelona (Spain); Llop, Jordi [Institut Alta Tecnologia PRBB-Fundacio Privada, Parc de Recerca Biomedica de Barcelona, C/Dr. Aiguader, 88 08003 Barcelona (Spain)], E-mail: jllop@cicbiomagune.es

    2009-01-15

    Positron emission tomography (PET) is a powerful molecular imaging technique based on the administration and detection of radioactive (positron emitting) species. In some applications, the concept of specific activity becomes especially important in order to prevent undesired pharmacological and/or toxic effects after injection of the radiotracer. Problems to obtain high specific activities are found when {sup 11}C-labeled compounds are prepared by methylation following the so called 'wet' method, which consists of a simple route but usually yields radiotracers highly diluted with the stable specie. In the present work, the main sources of contamination by stable carbon in the [{sup 11}C]CH{sub 3}I synthesis following the 'wet' method have been analyzed and their individual contribution has been quantified. The results show that the most relevant contamination of CO{sub 2} is generated during the bombardment process.

  6. Effects of Increasing Doses of UV-B on Main Phenolic Acids Content, Antioxidant Activity and Estimated Biomass in Lavandin (Lavandula x intermedia).

    Science.gov (United States)

    Usano-Alemany, Jaime; Panjai, Lachinee

    2015-07-01

    Lavandin is a well-known aromatic plant cultivated mainly for its valuable essential oil. Nonetheless, little attention has been paid so far to the quantification of other natural products such as polyphenols. Accordingly, we examined the effect of increasing doses of UV-B radiation on the main phenolic content, antioxidant activity and estimated biomass of one year old lavandin pots compared with pots grown outdoors. Significantly higher total phenolic content and concentration of main polyphenols have been found in outdoor plants. Rosmarinic acid has been described as the major phenolic compound in methanolic extracts (max. 25.9 ± 9.7 mg/g(-1) DW). Furthermore, we found that increasing doses of UV-B promote the plant growth of this species as well as the accumulation of phenolic compounds although with less antioxidant capacity in scavenging DPPH radicals. On the other hand, our results showed a remarkable variability among individual plants regarding the content of major phenolic acids. The application of UV-B doses during plant growth could be a method to promote biomass in this species along with the promotion of higher content of valuable secondary metabolites.

  7. Genkwanin inhibits proinflammatory mediators mainly through the regulation of miR-101/MKP-1/MAPK pathway in LPS-activated macrophages.

    Directory of Open Access Journals (Sweden)

    Yuan Gao

    Full Text Available Genkwanin is one of the major non-glycosylated flavonoids in many herbs with anti-inflammatory activities. Although its anti-inflammatory activity in vivo has been reported, the potential molecular mechanisms remain obscure. In this study, by pharmacological and genetic approaches, we explore the anti-inflammatory effects of genkwanin in LPS-activated RAW264.7 macrophages. Genkwanin potently decreases the proinflammatory mediators, such as iNOS, TNF-α, IL-1β and IL-6, at the transcriptional and translational levels without cytotoxicity, indicating the excellent anti-inflammatory potency of genkwanin in vitro. Mechanism study shows that genkwanin significantly suppresses the p38- and JNK-mediated AP-1 signaling pathway and increases the mitogen-activated protein kinase (MAPK phosphatase 1 (MKP-1 expression at the posttranscriptional level. We also confirmed that microRNA-101 (miR-101 is a negative regulator of MKP-1 expression. Moreover, regardless of miR-101-deficient cells or miR-101-abundant cells, the suppression effects of genkwanin on supernatant proinflammatory mediators' levels are far less than that in respective negative control cells, suggesting that genkwanin exerts anti-inflammatory effect mainly through reducing miR-101 production. However, genkwanin can't affect the level of phospho-Akt (p-Akt, indicating that the phosphorylation of Akt may be not responsible for the effect of genkwanin on miR-101 production. We conclude that genkwanin exerts its anti-inflammatory effect mainly through the regulation of the miR-101/MKP-1/MAPK pathway.

  8. Achieving a predictable 24-hour return to normal activities after breast augmentation: part I. Refining practices by using motion and time study principles.

    Science.gov (United States)

    Tebbetts, John B

    2002-01-01

    The purpose of this study was to develop techniques to predictably return patients receiving inframammary and axillary, subpectoral breast augmentation to full normal activities within 24 hours of their primary breast augmentation. This 5-year study applies motion and time study principles to refine practices in augmentation mammaplasty to reduce perioperative morbidity and shorten patient recovery. Retrospective data for operative times, medications administered, recovery times, times to discharge, and time to return to normal activities were collected from patient chart reviews and patient contacts from 1982 to 1984 (group 1, n = 16, axillary partial retropectoral augmentations) and 1990 (group 2, n = 16, inframammary partial retropectoral augmentations). Videotapes from operative procedures of groups 1 and 2 were analyzed with macromotion and micromotion study principles, and tables of events were formulated for all operating room personnel, detailing every step of each function they performed. The events tables were then refined into detailed scripts by using motion and time study principles. Scripts were used for surgeon and personnel training and for reference during operative procedures. Extensive changes in all aspects of patient care, including patient education, preparation, operative planning, implant selection, anesthesia techniques, surgical techniques, instrumentation, and postoperative care derived from data and videotape studies of patients in groups 1 and 2 were then applied to a third group of patients (group 3), collecting prospective data over a 3-year period (1998 to 2000). Group 3 (n = 627) data included timed events, medications, and time to return to normal activities. Patients in group 3 had substantially shorter anesthesia, operation, and postanesthesia care unit times and time to discharge and time to return to normal activities compared with groups 1 and 2. Of the patients in group 3, 96 percent were able to return to normal activities

  9. 浅谈听力活动设计原则及影响因素%Design principle and influencing factor of listening activities

    Institute of Scientific and Technical Information of China (English)

    陈适; 朱晨

    2013-01-01

    Many language teachers have been committed to the design of the listening activities, in order to make the students actively participate in teaching activities in classroom listening, and obtain satisfactory learning effect. According to the author's own teaching experience and professional literature, summarizes and expounds the factors influencing the design principle and listening activities.%很多语言教学工作者一直致力于听力活动的设计,以求能让学生积极主动地参与课堂听力教学活动,并获得较为满意的学习效果。本文结合作者的自身教学经验以及一些专业文献资料,简单归纳和阐述了听力活动设计的原则以及影响因素。

  10. Widely available active sites on Ni2P for electrochemical hydrogen evolution - insights from first principles calculations

    DEFF Research Database (Denmark)

    Hansen, Martin Hangaard; Stern, Lucas-Alexandre; Feng, Ligang;

    2015-01-01

    We present insights into the mechanism and the active site for hydrogen evolution on nickel phosphide (Ni2P). Ni2P was recently discovered to be a very active non-precious hydrogen evolution catalyst. Current literature attributes the activity of Ni2P to a particular site on the (0001) facet. In ...

  11. THE MAIN PROBLEM OF COUNTERACTION AGAINST CORRUPTION

    Directory of Open Access Journals (Sweden)

    Alexander Sergeevich Dilkov

    2015-01-01

    Full Text Available The article considers the problem of corruption. The experience of anti-corruption activities in various countries shows convincingly that to completely get rid of corruption is impossible, as any other social evil, with solid foundations in economic, social and political system of society. You can put a question only about how to reduce the scale of corruption to the socially acceptable level. Corruption infringes upon interests and constitutional rights of citizens, undermines the rule of law and democratic principles, suggests discrediting the activities of the state apparatus, distorts the principle of legality, hinders economic reforms and therefore requires detailed investigation with the scientific side to find the most effective ways of countering this phenomenon. Corruption can be done in different ways and methods. The conclusion that corruption is not only a form of criminal enrichment bureaucratic state apparatus, it has always been the main source of criminalization of social life, its degradation.Corruption is both a prerequisite and a consequence of the functioning of the shadow economy, strengthening property differentiation of the society, the fall of morals and degradation of the socio-political life.

  12. Amoebicidal activity of α-bisabolol, the main sesquiterpene in chamomile (Matricaria recutita L.) essential oil against the trophozoite stage of Acanthamoeba castellani Neff.

    Science.gov (United States)

    Hajaji, Soumaya; Sifaoui, Ines; López-Arencibia, Atteneri; Reyes-Batlle, María; Valladares, Basilio; Pinero, José E; Lorenzo-Morales, Jacob; Akkari, Hafidh

    2017-06-01

    Acanthamoeba genus includes opportunistic pathogens which are distributed worldwide and are causative agents of a fatal encephalitis and severe keratitis in humans and other animals. Until present there are not fully effective therapeutic agents against this pathogen and thus the need to search for novel anti-amoebic compounds is urgent. Recently, essential oils of aromatic and medicinal plants have shown activity against Acanthamoeba strains. Therefore, this study was aimed to evaluate the activity of main component of chamomile essential oil (a sesquiterpene) namely α-bisabolol against the Acanthamoeba castellani Neff strain. After evaluation of the activity and toxicity of this molecule, IC50 values of 20.839 ± 2.015 for treated amoebae as well as low citotoxicty levels in a murine macrophage cell line was observed. Moreover, in order to elucidate mechanism of action of this molecule, changes in chromatin condensation levels, permeability of the plasmatic membrane, the mitochondrial membrane potential and the ATP levels in the treated amoebic strains were checked. The obtained results revealed that α-bisabolol was able to induce apoptosis, increase the permeability of the plasmatic membrane and decrease both mitochondrial and ATP levels in the treated amoebae. Therefore, and given the obtained results, α-bisabolol could be used a future therapeutic agent against Acanthamoeba infections.

  13. Perspectives of digestive pest control with proteinase inhibitors that mainly affect the trypsin-like activity of Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    M.E. Pereira

    2005-11-01

    Full Text Available The present study describes the main characteristics of the proteolytic activities of the velvetbean caterpillar, Anticarsia gemmatalis Hübner, and their sensitivity to proteinase inhibitors and activators. Midguts of last instar larvae reared on an artificial diet were homogenized in 0.15 M NaCl and centrifuged at 14,000 g for 10 min at 4ºC and the supernatants were used in enzymatic assays at 30ºC, pH 10.0. Basal total proteolytic activity (azocasein hydrolysis was 1.14 ± 0.15 absorbance variation min-1 mg protein-1, at 420 nm; basal trypsin-like activity (N-benzoyl-L-arginine-p-nitroanilide, BApNA, hydrolysis was 0.217 ± 0.02 mmol p-nitroaniline min-1 mg protein-1. The maximum proteolytic activities were observed at pH 10.5 using azocasein and at pH 10.0 using BApNA, this pH being identical to the midgut pH of 10.0. The maximum trypsin-like activity occurred at 50ºC, a temperature that reduces enzyme stability to 80 and 60% of the original, when pre-incubated for 5 and 30 min, respectively. Phenylmethylsulfonyl fluoride inhibited the proteolytic activities with an IC50 of 0.39 mM for azocasein hydrolysis and of 1.35 mM for BApNA hydrolysis. Benzamidine inhibited the hydrolysis with an IC50 of 0.69 and 0.076 mM for azocasein and BApNA, respectively. The absence of cysteine-proteinases is indicated by the fact that 2-mercaptoethanol and L-cysteine did not increase the rate of azocasein hydrolysis. These results demonstrate the presence of serine-proteinases and the predominance of trypsin-like activity in the midgut of Lepidoptera insects, now also detected in A. gemmatalis, and suggest this enzyme as a major target for pest control based on disruption of protein metabolism using proteinase inhibitors.

  14. The Main Chemical Composition and in vitro Antifungal Activity of the Essential Oils of Ocimum basilicum Linn. var. pilosum (Willd. Benth

    Directory of Open Access Journals (Sweden)

    Ji-Wen Zhang

    2009-01-01

    Full Text Available The essential oils of the aerial parts of Ocimum basilicum Linn.var. pilosum (Willd. Benth., an endemic medicinal plant growing in China, was obtained by hydrodistillation and analysed by GC-MS. Fifteen compounds, representing 74.19% of the total oil were identified. The main components were as follows: linalool (29.68%, (Z-cinnamic acid methyl ester (21.49%, cyclohexene (4.41%, α- cadinol (3.99%, 2,4-diisopropenyl-1-methyl-1-vinylcyclohexane (2.27%, 3,5-pyridine-dicarboxylic acid, 2,6-dimethyl-diethyl ester (2.01%, β-cubebene (1.97%, guaia-1(10,11-diene (1.58%, cadinene (1.41% (E-cinnamic acid methyl ester (1.36% and β-guaiene (1.30%. The essential oils showed significant antifungal activity against some plant pathogenic fungi.

  15. European and Czech principles of contract law

    OpenAIRE

    Balážová, Júlia

    2008-01-01

    8 Summary European and Czech Principles of Contract Law This thesis is focused on principles of contract law. In the first instance, it explains the theoretical conception of principles of law and adverts to their status in the Czech legal system. The second Chapter of the thesis dissertates about basic principles of the Czech private law starting with the principle of freedom of contract, ends with the principles of good faith and fair dealing. The main part of the thesis deals with the Euro...

  16. Framework for the design and delivery of organized physical activity sessions for children and adolescents: rationale and description of the 'SAAFE' teaching principles.

    Science.gov (United States)

    Lubans, David R; Lonsdale, Chris; Cohen, Kristen; Eather, Narelle; Beauchamp, Mark R; Morgan, Philip J; Sylvester, Benjamin D; Smith, Jordan J

    2017-02-23

    The economic burden of inactivity is substantial, with conservative estimates suggesting the global cost to health care systems is more than US$50 billion. School-based programs, including physical education and school sport, have been recommended as important components of a multi-sector, multi-system approach to address physical inactivity. Additionally, community sporting clubs and after-school programs (ASPs) offer further opportunities for young people to be physically active outside of school. Despite demonstrating promise, current evidence suggests school-based physical activity programs, community sporting clubs and ASPs are not achieving their full potential. For example, physical activity levels in physical education (PE) and ASP sessions are typically much lower than recommended. For these sessions to have the strongest effects on young people's physical activity levels and their on-going physical literacy, they need to improve in quality and should be highly active and engaging. This paper presents the Supportive, Active, Autonomous, Fair, Enjoyable (SAAFE) principles, which represent an evidence-based framework designed to guide the planning, delivery and evaluation of organized physical activity sessions in school, community sport and ASPs. In this paper we provide a narrative and integrative review of the conceptual and empirical bases that underpin this framework and highlight implications for knowledge translation and application.

  17. Effects of the Combination of the Main Active Components of Astragalus and Panax notoginseng on Inflammation and Apoptosis of Nerve Cell after Cerebral Ischemia-Reperfusion.

    Science.gov (United States)

    Huang, Xiao-Ping; Ding, Huang; Lu, Jin-Dong; Tang, Ying-Hong; Deng, Bing-Xiang; Deng, Chang-Qing

    2015-01-01

    Astragalus and Panax notoginseng are commonly used to treat cardio-cerebrovascular diseases in China and are often combined together to promote curative effect. We speculate that the enhancement of the combination on anticerebral ischemia injury may come from the main active components. The purpose of this work was to probe the effects and mechanisms of Astragaloside IV (the active component of Astragalus) combined with Ginsenoside Rg1, Ginsenoside Rb1, and Notoginsenoside R1 (the active components of P. notoginseng) to antagonize ischemia/reperfusion (I/R) injury via inflammation and apoptosis. C57BL/6 mice were randomly divided into sham, model, Astragaloside IV, Ginsenoside Rg1, Ginsenoside Rb1, Notoginsenoside R1, four active components combination, and Edaravone groups. After administration for 3 days, bilateral common carotid arteries (CCA) were occluded with artery clip for 20[Formula: see text]min followed by reperfusion for 24[Formula: see text]h. Our results showed that the survival rate of nerve cell in hippocampal CA1 decreased while the apoptotic rate increased, and the level of caspase-3 protein in brain tissues was elevated, the expressions of TNF-a, IL-1, and ICAM-1 mRNA as well as phosphorylated nuclear factor kappa B (NF-κB) inhibitor protein α (p-IκBa) in brain tissues were up-regulated, and the nuclear translocation rate of NF-κB was raised. Additionally, the protein expressions of phosphorylated tyrosine kinase 1 (p-JAK1), phosphorylated signal transducer and activator of transcription-1 (p-STAT1), glucose regulated protein 78 (GRP78), caspase-12, and phosphorylated c-Jun N-terminal kinases 1/2 (p-JNK1/2) in brain tissues were also significantly strengthened after I/R for 24 h. All drugs could increase neurocyte survival rate in hippocampal CA1, decrease the apoptotic rate, and inhibit caspase-3 protein expression, in contrast, the effects of four active components combination were better than those of active components alone. In addition

  18. Effect of rTMS on brain activation in schizophrenia with negative symptoms: A proof-of-principle study.

    Science.gov (United States)

    Dlabac-de Lange, Jozarni J; Liemburg, Edith J; Bais, Leonie; Renken, Remco J; Knegtering, Henderikus; Aleman, André

    2015-10-01

    Prefrontal cortical dysfunction is frequently reported in schizophrenia and is thought to underlie negative symptoms of schizophrenia. Repetitive Transcranial Magnetic Stimulation (rTMS) can modulate neuronal activity and has been shown to improve negative symptoms in patients with schizophrenia, but the underlying neural mechanism is unknown. To examine whether 3weeks of 10Hz rTMS treatment of the bilateral dorsolateral prefrontal cortex (DLPFC) would improve frontal brain activation in patients with negative symptoms of schizophrenia, as measured by functional magnetic resonance imaging (fMRI) during the Tower of London (ToL) task. 24 patients with the diagnosis of schizophrenia with moderate to severe negative symptoms (Positive and Negative Syndrome Scale (PANSS) negative subscale≥15) participated. Patients were randomized to a 3-week (15day) course of active or sham rTMS. All patients performed the ToL task during fMRI scanning both pre-treatment and post-treatment. Differences in brain activation between the two groups were compared non-parametrically. After rTMS treatment, brain activity in the active group increased in the right DLPFC and the right medial frontal gyrus as compared to the sham group. In addition, the groups significantly differed with regard to activation change in the left posterior cingulate, with decreased activation in the active and increased activation in the sham group. Treatment with rTMS over the DLPFC may have the potential for increasing task-related activation in frontal areas in patients with schizophrenia. Effects of different rTMS parameters and fMRI tasks targeting relevant brain circuitry deserve further investigation. Nederlands Trial Register, registration number: NTR1261. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Composition and biological activities of hogweed [Heracleum sphondylium L. subsp. ternatum (Velen.) Brummitt] essential oil and its main components octyl acetate and octyl butyrate.

    Science.gov (United States)

    Maggi, Filippo; Quassinti, Luana; Bramucci, Massimo; Lupidi, Giulio; Petrelli, Dezemona; Vitali, Luca A; Papa, Fabrizio; Vittori, Sauro

    2014-01-01

    The essential oil obtained from the fruits of hogweed (Heracleum sphondylium subsp. ternatum) growing in central Apennines (Italy) was analysed for chemical composition by gas chromatographic-flame ionisation detector (GC-FID) and gas chromatography-mass spectrometry (GC-MS). The oil was composed mainly of aliphatic esters (86.9-89.5%), among them octyl acetate (54.9-60.2%) and octyl butyrate (10.1-13.4%) were the most abundant. The oil and its two major esters, octyl acetate and octyl butyrate, were tested for in vitro biological activity, namely antibacterial, antioxidant and cytotoxic, by microdilution, DPPH (2,2-diphenyl-1-picrylhydrazyl), ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)) and MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide) assays. Worthy of mention was only the cytotoxic activity of the oil against two tumour cell lines, i.e. A375 (human malignant melanoma) and HCT116 (human colon carcinoma) cells, with IC50 values of 48.69 and 95.83 μg/mL, respectively; the major compound responsible for this effect was octyl butyrate which displayed IC50 values of 20.19 μg/mL (100.8 μM) and 55.35 μg/mL (276.3 μM) on the same cells, respectively.

  20. ACTIVE GALACTIC NUCLEI AS MAIN CONTRIBUTORS TO THE ULTRAVIOLET IONIZING EMISSIVITY AT HIGH REDSHIFTS: PREDICTIONS FROM A {Lambda}-CDM MODEL WITH LINKED AGN/GALAXY EVOLUTION

    Energy Technology Data Exchange (ETDEWEB)

    Giallongo, E.; Menci, N.; Fiore, F.; Castellano, M.; Fontana, A.; Grazian, A.; Pentericci, L. [INAF-Osservatorio Astronomico di Roma, via di Frascati 33, I-00040 Monteporzio (Italy)

    2012-08-20

    We have evaluated the contribution of the active galactic nuclei (AGN) population to the ionization history of the universe based on a semi-analytic model of galaxy formation and evolution in the cold dark matter cosmological scenario. The model connects the growth of black holes and of the ensuing AGN activity to galaxy interactions. In the model we have included a self-consistent physical description of the escape of ionizing UV photons; this is based on the blast-wave model for the AGN feedback we developed in a previous paper to explain the distribution of hydrogen column densities in AGNs of various redshifts and luminosities, due to absorption by the host galaxy gas. The model predicts UV luminosity functions for AGNs that are in good agreement with those derived from the observations especially at low and intermediate redshifts (z {approx} 3). At higher redshifts (z > 5), the model tends to overestimate the data at faint luminosities. Critical biases in both the data and in the model are discussed to explain such apparent discrepancies. The predicted hydrogen photoionization rate as a function of redshift is found to be consistent with that derived from the observations. All of the above suggests that we should reconsider the role of the AGNs as the main driver of the ionization history of the universe.

  1. Common Principles and Multiculturalism

    Science.gov (United States)

    Zahedi, Farzaneh; Larijani, Bagher

    2009-01-01

    Judgment on rightness and wrongness of beliefs and behaviors is a main issue in bioethics. Over centuries, big philosophers and ethicists have been discussing the suitable tools to determine which act is morally sound and which one is not. Emerging the contemporary bioethics in the West has resulted in a misconception that absolute westernized principles would be appropriate tools for ethical decision making in different cultures. We will discuss this issue by introducing a clinical case. Considering various cultural beliefs around the world, though it is not logical to consider all of them ethically acceptable, we can gather on some general fundamental principles instead of going to the extremes of relativism and absolutism. Islamic teachings, according to the presented evidence in this paper, fall in with this idea. PMID:23908720

  2. Common principles and multiculturalism.

    Science.gov (United States)

    Zahedi, Farzaneh; Larijani, Bagher

    2009-01-01

    Judgment on rightness and wrongness of beliefs and behaviors is a main issue in bioethics. Over centuries, big philosophers and ethicists have been discussing the suitable tools to determine which act is morally sound and which one is not. Emerging the contemporary bioethics in the West has resulted in a misconception that absolute westernized principles would be appropriate tools for ethical decision making in different cultures. We will discuss this issue by introducing a clinical case. Considering various cultural beliefs around the world, though it is not logical to consider all of them ethically acceptable, we can gather on some general fundamental principles instead of going to the extremes of relativism and absolutism. Islamic teachings, according to the presented evidence in this paper, fall in with this idea.

  3. Pharmacokinetic based study on "lagged stimulation" of Curcumae Longae Rhizoma - Piper nigrum couplet in their main active components' metabolism using UPLC-MS-MS.

    Science.gov (United States)

    Chen, Zhao; Sun, Dongmei; Bi, Xiaoli; Zeng, Xiaohui; Luo, Wenhui; Cai, Dake; Zeng, Qiaohuang; Xu, Aili

    2017-04-15

    Curcumae Longae Rhizoma is one of the commonly used traditional Chinese medicines, which has multiple biological activities such as relieving stagnation and stasis, pain alleviation, curing amenorrhea and wounds. However, its main active component-curcumin has poor absorption and very fast metabolism in body. To solve this problem, Piper nigrum was introduced for its ability to strengthen bioavailability of other compounds. In most cases of TCM couplets, all ingredients were prepared and taken simultaneously, which in our opinion did not take full advantage of their interactions. Therefore, order of administration should be adjusted according to pharmacokinetic parameters of the ingredients, which the ones act as supplement can first be taken, and main therapeutic components followed when the former reached its peak. the extract of Piper nigrum (containing at least 95% piperine) was taken by rats 6h before taking Curcumae Longae Rhizoma extract (containing at least 95% curcumin). Then, a UPLC-MS-MS method was developed to determine their content in plasma simultaneously. Determination was carried out by on a C18 column within 5min by isocratic elution using 0.2% formic acid and acetonitrile (50:50, v/v). Tandem mass detection was conducted by selective reaction monitoring (SRM) via electrospray ionization (ESI) source in positive mode. Samples were pre-treated by liquid-liquid extraction (LLE), and verapamil was used as internal standard (IS). For both curcumin and piperine, the proposed method had good linearity (r(2)=0.999) within the concentration range of 1-1000ng/ml, with good recovery, precision and stability. The lower limit of quantification (LLOQ) was 1ng/ml. As pharmacokinetic data indicated, Maximum concentration (Cmax) of curcumin increased significantly to 394.06; the time reach maximum concentration (Tmax) and elimination half-life (T1/2) were 0.5 and 0.67h, respectively; CONCLUSION: The results provide a good strategy for the investigation of TCM

  4. Pharmacological activation of CB2 receptors counteracts the deleterious effect of ethanol on cell proliferation in the main neurogenic zones of the adult rat brain

    Science.gov (United States)

    Rivera, Patricia; Blanco, Eduardo; Bindila, Laura; Alen, Francisco; Vargas, Antonio; Rubio, Leticia; Pavón, Francisco J.; Serrano, Antonia; Lutz, Beat; Rodríguez de Fonseca, Fernando; Suárez, Juan

    2015-01-01

    Chronic alcohol exposure reduces endocannabinoid activity and disrupts adult neurogenesis in rodents, which results in structural and functional alterations. Cannabinoid receptor agonists promote adult neural progenitor cell (NPC) proliferation. We evaluated the protective effects of the selective CB1 receptor agonist ACEA, the selective CB2 receptor agonist JWH133 and the fatty-acid amide-hydrolase (FAAH) inhibitor URB597, which enhances endocannabinoid receptor activity, on NPC proliferation in rats with forced consumption of ethanol (10%) or sucrose liquid diets for 2 weeks. We performed immunohistochemical and stereological analyses of cells expressing the mitotic phosphorylation of histone-3 (phospho-H3+) and the replicating cell DNA marker 5-bromo-2'-deoxyuridine (BrdU+) in the main neurogenic zones of adult brain: subgranular zone of dentate gyrus (SGZ), subventricular zone of lateral ventricles (SVZ) and hypothalamus. Animals were allowed ad libitum ethanol intake (7.3 ± 1.1 g/kg/day) after a controlled isocaloric pair-feeding period of sucrose and alcoholic diets. Alcohol intake reduced the number of BrdU+ cells in SGZ, SVZ, and hypothalamus. The treatments (URB597, ACEA, JWH133) exerted a differential increase in alcohol consumption over time, but JWH133 specifically counteracted the deleterious effect of ethanol on NPC proliferation in the SVZ and SGZ, and ACEA reversed this effect in the SGZ only. JWH133 also induced an increased number of BrdU+ cells expressing neuron-specific β3-tubulin in the SVZ and SGZ. These results indicated that the specific activation of CB2 receptors rescued alcohol-induced impaired NPC proliferation, which is a potential clinical interest for the risk of neural damage in alcohol dependence. PMID:26483633

  5. Pharmacological activation of CB2 receptors counteracts the deleterious effect of ethanol on cell proliferation in the main neurogenic zones of the adult rat brain

    Directory of Open Access Journals (Sweden)

    Patricia eRivera

    2015-09-01

    Full Text Available Chronic alcohol exposure reduces endocannabinoid activity and disrupts adult neurogenesis in rodents, which results in structural and functional alterations. Cannabinoid receptor agonists promote adult neural progenitor cell (NPC proliferation. We evaluated the protective effects of the selective CB1 receptor agonist ACEA, the selective CB2 receptor agonist JWH133 and the fatty-acid amide-hydrolase (FAAH inhibitor URB597, which enhances endocannabinoid receptor activity, on NPC proliferation in rats with forced consumption of ethanol (10% or sucrose liquid diets for two weeks. We performed immunohistochemical and stereological analyses of cells expressing the mitotic phosphorylation of histone-3 (phospho-H3+ and the replicating cell DNA marker 5-bromo-2’-deoxyuridine (BrdU+ in the main neurogenic zones of adult brain: subgranular zone of dentate gyrus (SGZ, subventricular zone of lateral ventricles (SVZ and hypothalamus. Animals were allowed ad libitum ethanol intake (7.3±1.1 g/kg/day after a controlled isocaloric pair-feeding period of sucrose and alcoholic diets. Alcohol intake reduced the number of BrdU+ cells in SGZ, SVZ and hypothalamus. The treatments (URB597, ACEA, JWH133 exerted a differential increase in alcohol consumption over time, but JWH133 specifically counteracted the deleterious effect of ethanol on NPC proliferation in the SVZ and SGZ, and ACEA reversed this effect in the SGZ only. JWH133 also induced an increased number of BrdU+ cells expressing neuron-specific β3-tubulin in the SVZ and SGZ. These results indicated that the specific activation of CB2 receptors rescued alcohol-induced impaired NPC proliferation, which is a potential clinical interest for the risk of neural damage in alcohol dependence.

  6. The TOMO-ETNA experiment: an imaging active campaign at Mt. Etna volcano. Context, main objectives, working-plans and involved research projects

    Directory of Open Access Journals (Sweden)

    Jesús M. Ibáñez

    2016-09-01

    Full Text Available The TOMO-ETNA experiment was devised to image of the crust underlying the volcanic edifice and, possibly, its plumbing system by using passive and active refraction/reflection seismic methods. This experiment included activities both on-land and offshore with the main objective of obtaining a new high-resolution seismic tomography to improve the knowledge of the crustal structures existing beneath the Etna volcano and northeast Sicily up to Aeolian Islands. The TOMO ETNA experiment was divided in two phases. The first phase started on June 15, 2014 and finalized on July 24, 2014, with the withdrawal of two removable seismic networks (a Short Period Network and a Broadband network composed by 80 and 20 stations respectively deployed at Etna volcano and surrounding areas. During this first phase the oceanographic research vessel “Sarmiento de Gamboa” and the hydro-oceanographic vessel “Galatea” performed the offshore activities, which includes the deployment of ocean bottom seismometers (OBS, air-gun shooting for Wide Angle Seismic refraction (WAS, Multi-Channel Seismic (MCS reflection surveys, magnetic surveys and ROV (Remotely Operated Vehicle dives. This phase finished with the recovery of the short period seismic network. In the second phase the Broadband seismic network remained operative until October 28, 2014, and the R/V “Aegaeo” performed additional MCS surveys during November 19-27, 2014. Overall, the information deriving from TOMO-ETNA experiment could provide the answer to many uncertainties that have arisen while exploiting the large amount of data provided by the cutting-edge monitoring systems of Etna volcano and seismogenic area of eastern Sicily.

  7. Social Justice as the Main Task of a State

    Directory of Open Access Journals (Sweden)

    Slatenkova Mariia O.

    2013-11-01

    Full Text Available Social justice always was and will be as the most significant indicator of efficiency of social development of the society being one of the fundamental grounds of the civilisation and progress. The goal of the article is justification of a necessity of application of the principle of social justice in practice of the state regulation for creation of favourable conditions of development of the society. The article considers one of the main functions of a state – social, directed at the socio-political harmonisation of social relations; justifies objective necessity of interference of the state with the problem of restoration of justice in the society. The main instrument of this interference is active social policy of the state oriented at problems of the whole population. Main instruments that regulate social relations are main spheres of the society, such as political, economic and social. Finding a balance among these social spheres would facilitate the nation’s well-being.

  8. Novel Principles of Gamma-Retroviral Insertional Transcription Activation in Murine Leukemia Virus-induced End-stage Tumors

    DEFF Research Database (Denmark)

    Sokol, Martin; Wabl, Matthias; Rius Ruiz, Irene;

    2014-01-01

    Background Insertional mutagenesis screens of retrovirus-induced mouse tumors have proven valuable in human cancer research and for understanding adverse effects of retroviral-based gene therapies. In previous studies, the assignment of mouse genes to individual retroviral integration sites has...... been based on close proximity and expression patterns of annotated genes at target positions in the genome. We here employed next-generation RNA sequencing to map retroviral-mouse chimeric junctions genome-wide, and to identify local patterns of transcription activation in T-lymphomas induced...... than 2,000 mice was examined. Results We detected several novel mechanisms of retroviral insertional mutagenesis: bidirectional activation of mouse transcripts on opposite sides of a provirus including transcription of unannotated mouse sequence; sense/antisense-type activation of genes located...

  9. Main Principles of Formation of the Complex of Models of Management of Financial Risks of a Company Основные принципы формирования комплекса моделей управления финансовыми рисками предприятия

    National Research Council Canada - National Science Library

    Polyakova Olga Yu; Goltyaeva Lyudmila A

    2013-01-01

    The article is devoted to basics of management of financial risks of a company. It develops a system of management of financial risks of a company and identifies main principles of its construction...

  10. Effect of the Principle of Activating Blood Circulation to Break Stasis on GMP-140 and D2 Dimer in Patients with Acute Cerebral Infarction

    Institute of Scientific and Technical Information of China (English)

    WANG Ning

    2005-01-01

    Objective:To explore the clinical efficacy of the principle of activating blood circulation to break stasis (ABCBS) and its influence on platelet membranous protein particle (GMP-140) and D2 dimer (Ddimer) before and after treatment. Methods: Eighty-eight patients with blood stasis syndrome (BSS) of acute cerebral infarction (ACI) were randomly divided into two groups, both of which were treated with conventional treatment, i.e. with western medicine (WM), with Salvia injection added through intravenously dripping.One of the two groups was used as the control and the other group as the treated group who had ABCBS herbs orally taken in addition. The duration of treatment course for both groups was 3 weeks. Results: There were changes in both groups over clinical symptoms, nerve function deficit scoring and GMP-140, D-dimer, but the treated group showed significantly better than that of the control group, (P<0.05). Conclusion: ABCBS principle could serve as an important auxiliary treating method for BSS of ACI, as it can effectively alter the blood of ACI patients which was viscous, condense, coagulant and aggregating.

  11. First principles investigation of the activity of thin film Pt, Pd and Au surface alloys for oxygen reduction

    DEFF Research Database (Denmark)

    Tripkovic, Vladimir; Hansen, Heine Anton; Rossmeisl, Jan

    2015-01-01

    of Au with mixed Pt/Pd skins. The activity of the binary and ternary catalysts is explained through weakening of the OH binding energy caused by solute elements. However, given the low alloy formation energies it may be difficult to tune and retain the composition under operating conditions...

  12. Effect of rTMS on brain activation in schizophrenia with negative symptoms : A proof-of-principle study

    NARCIS (Netherlands)

    Dlabac-de Lange, Jozarni J.; Liemburg, Edith J.; Bais, Leonie; Renken, Remco J.; Knegtering, Henderikus; Aleman, Andre

    2015-01-01

    Background: Prefrontal cortical dysfunction is frequently reported in schizophrenia and is thought to underlie negative symptoms of schizophrenia. Repetitive Transcranial Magnetic Stimulation (rTMS) can modulate neuronal activity and has been shown to improve negative symptoms in patients with schiz

  13. Study on Moving Principle of Colonoscopic Robot

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The moving principle of a colonoscopic robot is presented in this paper. The robot mainly consists of soft mobile mechanism for earthworm locomotion and turning mechanism based on shape memory effect. The soft mobile mechanism contacts colon wall with air-in inflatable balloons, so the robot has better soft and non-invasive properties. The turning mechanism can be actively bent by shape memory alloy components. It ensures the robot to adapt to the tortuous shape of colon. Therefore, the colonoscopic robot has good safety, lower working strength of surgeon and higher efficiency of colonooscopy.

  14. Antileishmanial activity of essential oil from Chenopodium ambrosioides and its main components against experimental cutaneous leishmaniasis in BALB/c mice.

    Science.gov (United States)

    Monzote, L; Pastor, J; Scull, R; Gille, L

    2014-01-01

    Chenopodium ambrosioides have been used during centuries by native people to treat parasitic diseases. To compare the in vivo anti-leishmanial activity of the essential oil (EO) from C. ambrosioides and its major components (ascaridole, carvacrol and caryophyllene oxide). Anti-leishmanial effect was evaluated in BALB/c mice infected with Leishmania amazonensis and treated with the EO, main compounds and artificial mix of pure components by intralesional route at 30 mg/kg every 4 days during 14 days. Diseases progression and parasite burden in infected tissues were determined. EO prevented lesion development compared (p<0.05) with untreated animals and treated with vehicle. In addition, the efficacy of EO was also statistically superior (p<0.05) compared with the glucantime-treated animals. No potential effects were observed with pure components treatment. Mix of pure compounds cause death of animals after 3 days of treatment. Our results demonstrate the superiority of EO against experimental cutaneous leishmaniasis caused by L. amazonensis. Copyright © 2014 Elsevier GmbH. All rights reserved.

  15. Report for spreading culture of medical radiation safety in Korea: Mainly the activities of the Korean alliance for radiation safety and culture in medicine (KARSM)

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Yong Su; Kim, Jung Min; Kim, Ji Hyun; Choi, In Seok [Dept. of Radiologic Science, Korea University, Seoul (Korea, Republic of); Sung, Dong Wook [Dept. of Radiology, Kyunghee University Hospital, Seoul (Korea, Republic of); Do, Kyung Hyun [Dept. of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul (Korea, Republic of); Jung, Seung Eun [Dept. of Radiology, College of Medicine, The Catholic University of Korea, Seoul (Korea, Republic of); Kim, Hyung Soo [Dept. of Radiation Safety, National Institute of Food and Drug Safety Evaluation, Korea Food and Drug Administration, Seoul (Korea, Republic of)

    2013-09-15

    There are many concerns about radiation exposure in Korea after Fukushima Nuclear Plant Accident on 2011 in Japan. As some isotope materials are detected in Korea, people get worried about the radioactive material. In addition, the mass media create an air of anxiety that jump on the people’s fear instead of scientific approach. Therefore, for curbing this flow, health, medical institute from the world provide a variety of information about medical radiation safety and hold the campaign which can give people the image that medical radiation is safe. At this, the Korean Food and Drug Administration(KFDA) suggested that make the alliance of medical radiation safety and culture on August, 2011. Seven societies and institutions related medical radiation started to research and advertise the culture of medical radiation safety in Korea. In this report, mainly introduce the activities of the Korean Alliance for Radiation Safety and Culture in Medicine(KARSM) for spreading culture of medical radiation safety from 2011 to 2012.

  16. 漂浮式微型波力发电装置原理与结构%Principle & Structure of Floating Micro-type Device for Wave-activated Power Generation

    Institute of Scientific and Technical Information of China (English)

    苏毅; 张涛; 张镇; 林梅

    2013-01-01

      为了满足偏远岛屿小功率用电保障需求,根据波浪能特点,提出一种新型漂浮式微型波力发电装置。利用重锤惯性定心原理,建立浮动“机架”,解决漂浮体内部相对固定问题;采用机-电直接转换系统,提高波浪能的利用效率;研究系统的原理与结构,分析系统的功能特点和主要运动参数。研究结果表明,漂浮式微型波力发电装置具有结构原理新颖、传动效率高、传动质量好与轻巧便携等优点。该研究为漂浮式微型波力发电装置的研发与应用奠定了基础。%To meet the needs for small power electricity utilization on islands,and based on the characteristics of ocean wave energy, a new floating micro⁃type device for wave⁃activated power generation is proposed. In order to solve the problem of station being fixed in buoy device,a floating frame is used by the inertial stabilization principle of ballast. The utilization efficiency of ocean wave energy is raised by direct machinery⁃electricity conversion system. And then,the structural principles and functional characteristics of the power generation system,especially main movement parameters of the system,are described for further research and application. Results show advantages of the floating micro⁃type device for wave⁃activated power generation including novel structural principle,high drive efficiency, good drive effect,easy carrying,and so on. The study could provide sound basis for the research&development and application of the proposed floating micro⁃type device.

  17. 农业供应链金融风险的主要特征与风险防范的基本原则%The Main Characteristics of the Financial risk in Agricultural Supply Chain and the Basic Principles of Risk Prevention

    Institute of Scientific and Technical Information of China (English)

    彭路

    2015-01-01

    The main features of agricultural supply chain are collectivization,modernization, and ecologization.The security,liquidity and rating of the credit funds need to be managed and coordinated comprehensively.The transaction costs and the asymmetric information determine that agricultural supply chain is based on mainly indirect financing in China.The main characteris-tics of financial risk are as follows:outstanding moral hazard,the integral risk identified in diffi-culty,potential regional systemic risk and agricultural systemic risk.The banks should finance the agricultural supply chain according to local conditions,and control the financial risk of agri-cultural supply chain by using the principle of systems theory.%我国农业供应链突出表现为“集体化”、“现代化”和“生态化”,资金的安全性、流动性和信用程度都需要整体协同管控。交易成本和信息不对称决定了我国农业供应链以间接融资为主,其金融风险的特征主要表现为道德风险突出、整体风险难识别、可能引致区域系统性风险和行业系统性风险。因此,应当因地制宜确定农业供应链金融支持项目,并运用系统论原理控制农业供应链金融风险。

  18. Maine Agricultural Foods. Project SEED.

    Science.gov (United States)

    Beaulieu, Peter; Ossenfort, Pat

    This paper describes an activity-based program that teaches students in grades 4-12 about the importance of Maine agriculture in their lives. Specifically, the goal is to increase student awareness of how the foods they eat are planted, harvested, and processed. The emphasis is on crops grown in Maine such as potatoes, broccoli, peas, blueberries,…

  19. Activity origin and catalyst design principles for electrocatalytic hydrogen evolution on heteroatom-doped graphene

    Science.gov (United States)

    Jiao, Yan; Zheng, Yao; Davey, Kenneth; Qiao, Shi-Zhang

    2016-10-01

    The hydrogen evolution reaction (HER) is a fundamental process in electrocatalysis and plays an important role in energy conversion through water splitting to produce hydrogen. Effective candidates for HER are often based on noble metals or transition metal dichalcogenides, while carbon-based metal-free electrocatalysts generally demonstrate poorer activity. Here we report evaluation of a series of heteroatom-doped graphene materials as efficient HER electrocatalysts by combining spectroscopic characterization, electrochemical measurements, and density functional theory calculations. Results of theoretical computations are shown to be in good agreement with experimental observations regarding the intrinsic electrocatalytic activity and the HER reaction mechanism. As a result, we establish a HER activity trend for graphene-based materials, and explore their reactivity origin to guide the design of more efficient electrocatalysts. We predict that by rationally modifying particular experimentally achievable physicochemical characteristics, a practically realizable graphene-based material will have the potential to exceed the performance of the metal-based benchmark for HER.

  20. Comparison of the Simple Cyclic Voltammetry (CV and DPPH Assays for the Determination of Antioxidant Capacity of Active Principles

    Directory of Open Access Journals (Sweden)

    Jesús F. Arteaga

    2012-05-01

    Full Text Available Antioxidant activity of a number of small (low molecular weight natural compounds found in spices, condiments or drugs (gallic acid, sesamol, eugenol, thymol, carvacrol, vanillin, salicylaldehyde, limonene, geraniol, 4-hexylresorcinol, etc. has been evaluated using electrochemical and DPPH radical scavenging measurements. Structural analysis of the tested compound suggest a remarkable activity for phenol derivatives and the importance of the –R groups located on the phenolic ring in the molecule’s ability to act as free radical scavenging as well as their influence in the electrochemical behavior. The voltammetric method can be used for the determination of the antioxidant capability in the same manner as the DPPH radical scavenging because of the correlation found between oxidation potentials and anti-radical power (ARP = 1/EC50. Such electrochemical determination is fast and cheap and allows making measurements under a variety of experimental conditions. The accuracy of the electrochemical measurements is the same for all the compounds, irrespective of their scavenging activity, the opposite of what occurs in the DPPH test.

  1. First principles investigation of the activity of thin film Pt, Pd and Au surface alloys for oxygen reduction

    DEFF Research Database (Denmark)

    Tripkovic, Vladimir; Hansen, Heine Anton; Rossmeisl, Jan;

    2015-01-01

    active binary thin films are near-surface alloys of Pt with subsurface Pd and certain PdAu and PtAu thin films with surface and/or subsurface Au. The most active ternary thin films are with pure metal Pt or Pd skins with some degree of Au in the surface and/or subsurface layer and the near-surface alloys...... of Au with mixed Pt/Pd skins. The activity of the binary and ternary catalysts is explained through weakening of the OH binding energy caused by solute elements. However, given the low alloy formation energies it may be difficult to tune and retain the composition under operating conditions....... This is particularly challenging for alloys containing Au due to a high propensity of Au to segregate to the surface. We also show that once Au is on the surface it will diffuse to defect sites, explaining why small amounts of Au retard dissolution of Pt nanoparticles. For the PtPd thin films there is no pronounced...

  2. A Crystallin Fold in the Interleukin-4-inducing Principle of Schistosoma mansoni Eggs (IPSE/α-1) Mediates IgE Binding for Antigen-independent Basophil Activation.

    Science.gov (United States)

    Meyer, N Helge; Mayerhofer, Hubert; Tripsianes, Konstantinos; Blindow, Silke; Barths, Daniela; Mewes, Astrid; Weimar, Thomas; Köhli, Thies; Bade, Steffen; Madl, Tobias; Frey, Andreas; Haas, Helmut; Mueller-Dieckmann, Jochen; Sattler, Michael; Schramm, Gabriele

    2015-09-04

    The IL-4-inducing principle from Schistosoma mansoni eggs (IPSE/α-1), the major secretory product of eggs from the parasitic worm S. mansoni, efficiently triggers basophils to release the immunomodulatory key cytokine interleukin-4. Activation by IPSE/α-1 requires the presence of IgE on the basophils, but the detailed molecular mechanism underlying activation is unknown. NMR and crystallographic analysis of IPSEΔNLS, a monomeric IPSE/α-1 mutant, revealed that IPSE/α-1 is a new member of the βγ-crystallin superfamily. We demonstrate that this molecule is a general immunoglobulin-binding factor with highest affinity for IgE. NMR binding studies of IPSEΔNLS with the 180-kDa molecule IgE identified a large positively charged binding surface that includes a flexible loop, which is unique to the IPSE/α-1 crystallin fold. Mutational analysis of amino acids in the binding interface showed that residues contributing to IgE binding are important for IgE-dependent activation of basophils. As IPSE/α-1 is unable to cross-link IgE, we propose that this molecule, by taking advantage of its unique IgE-binding crystallin fold, activates basophils by a novel, cross-linking-independent mechanism.

  3. 五味子醋制前后主要有效成分的变化规律%Regularity of changes in main active components of Schisandra chinensis before and after being processed with vinegar

    Institute of Scientific and Technical Information of China (English)

    李丽; 肖永庆; 于定荣; 麻印莲; 朱明贵; 陈梁

    2012-01-01

    目的:探讨五味子醋制前后饮片主要有效成分的变化规律.方法:采用高效液相色谱法,测定五味子醋制前后饮片中木脂素及有机酸类成分的含量变化.结果:醋制后五味子饮片中木脂素类成分含量明显降低,有机酸类成分明显增加,二者比例由1∶16(生品)变为1∶21(醋品).结论:五味子醋制后主要药理作用的改变不仅与木脂素或有机酸成分含量的增减有关,更重要的是2类成分的量比关系发生了明显的变化,对于揭示五味子醋制原理和物质基础与药理改变的相关性具有重要意义.%Objective: To investigate the regularity of changes in the main active components of Schisandra chinensis preparations before and after being processed with vinegar. Method: High performance liquid chromatography was used to analyze the changes in the content of lignans and organic acids in S. chinensis preparations before and after being processed with vinegar. Result: After being processed with vinegar, the content of lignans in S. chinensis preparations significantly reduced, while that of organic acids significantly increased. The ratio between them reduced from 1: 16 (raw product) to 1: 21 (vinegar products). Conclusion: The changes in the main pharmacological effects of S. chinensis are related to not only the changes in the contents of lignan and organic acids, but also the significant changes in the ratio relations between the two components. This is of great significance to the correlation among the principle of S. chinensis processed with vinegar and material basis and the changes in pharmacological effects.

  4. Equivalence principles and electromagnetism

    Science.gov (United States)

    Ni, W.-T.

    1977-01-01

    The implications of the weak equivalence principles are investigated in detail for electromagnetic systems in a general framework. In particular, it is shown that the universality of free-fall trajectories (Galileo weak equivalence principle) does not imply the validity of the Einstein equivalence principle. However, the Galileo principle plus the universality of free-fall rotation states does imply the Einstein principle.

  5. Neuronavigation. Principles. Surgical technique.

    Science.gov (United States)

    Ivanov, Marcel; Ciurea, Alexandru Vlad

    2009-01-01

    Neuronavigation and stereotaxy are techniques designed to help neurosurgeons precisely localize different intracerebral pathological processes by using a set of preoperative images (CT, MRI, fMRI, PET, SPECT etc.). The development of computer assisted surgery was possible only after a significant technological progress, especially in the area of informatics and imagistics. The main indications of neuronavigation are represented by the targeting of small and deep intracerebral lesions and choosing the best way to treat them, in order to preserve the neurological function. Stereotaxis also allows lesioning or stimulation of basal ganglia for the treatment of movement disorders. These techniques can bring an important amount of confort both to the patient and to the neurosurgeon. Neuronavigation was introduced in Romania around 2003, in four neurosurgical centers. We present our five-years experience in neuronavigation and describe the main principles and surgical techniques.

  6. Activation of the AMP activated protein kinase by short-chain fatty acids is the main mechanism underlying the beneficial effect of a high fiber diet on the metabolic syndrome.

    Science.gov (United States)

    Hu, Guo-Xin; Chen, Guo-Rong; Xu, Hui; Ge, Ren-Shan; Lin, Jing

    2010-01-01

    The metabolic syndrome, a cluster of conditions including abdominal obesity, insulin resistance, dyslipidemia, and elevated blood pressure, is a natural consequence of over nutrition and a sedentary lifestyle. The prevalence of the metabolic syndrome has increased to epidemic proportions in the world. The exact pathogenesis of the metabolic syndrome remains unclear, but it is known to be a complex interaction between genetic, metabolic, and environmental factors. Promotion of physical activity and dietary management are still the main methods for the prevention and management of the metabolic syndrome. Numerous experimental and clinical studies have demonstrated the beneficial effects of high fiber diet on the metabolic syndrome. The principal beneficial effects of a fiber-rich diet in these patients are: prevention of obesity, improved glucose levels, and control of the profile of blood lipids. Dietary fiber may also favor the control of arterial blood pressure. How dietary fiber exerts its beneficial effects on the metabolic syndrome is not well understood. AMP activated protein kinase (AMPK) functions as a major cellular fuel gauge and a master regulator of metabolic homeostasis. Several lines of evidence suggest that AMPK can be activated by short-chain fatty acids (SCFA) either directly or indirectly. It is our hypothesis that the main mechanism underlying the beneficial effect of a high fiber diet on the metabolic syndrome is the increased SCFA production in the colon leading to a higher concentration of SCFA in the portal vein, which activates the AMPK in the liver.

  7. Abstracts of Main Essays

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    The Political, Philosophic and Ethic Problems in the Economic Relations of Capitalism Based on the manuscript of philosophic-political economy in MEGA 2, this article analyzed and discussed those three problems of the ontological prerequisite of property ownership, the principle of equal exchange, and the individual-universal relation that Marx has dealt with during the period of his political economic critic studies before Capital, from the points of politics, philosophy and ethics. It points out that the divergences between Marx and national economists do not come from understanding of the prerequisite and the principle themselves, but from the recognition of the distortion of the prerequisite and the principle in the actual capitalism, and in disclosing and proving this kind of distortion, Marx has formed the theoretical basement for his criticizing of capitalism.

  8. First principles investigation of the activity of thin film Pt, Pd and Au surface alloys for oxygen reduction

    DEFF Research Database (Denmark)

    Tripkovic, Vladimir; Hansen, Heine Anton; Rossmeisl, Jan

    2015-01-01

    Further advances in fuel cell technologies are hampered by kinetic limitations associated with the sluggish cathodic oxygen reduction reaction. We have investigated a range of different formulations of binary and ternary Pt, Pd and Au thin films as electrocatalysts for oxygen reduction. The most...... active binary thin films are near-surface alloys of Pt with subsurface Pd and certain PdAu and PtAu thin films with surface and/or subsurface Au. The most active ternary thin films are with pure metal Pt or Pd skins with some degree of Au in the surface and/or subsurface layer and the near-surface alloys....... This is particularly challenging for alloys containing Au due to a high propensity of Au to segregate to the surface. We also show that once Au is on the surface it will diffuse to defect sites, explaining why small amounts of Au retard dissolution of Pt nanoparticles. For the PtPd thin films there is no pronounced...

  9. Combined treatment with cotylenin A and phenethyl isothiocyanate induces strong antitumor activity mainly through the induction of ferroptotic cell death in human pancreatic cancer cells.

    Science.gov (United States)

    Kasukabe, Takashi; Honma, Yoshio; Okabe-Kado, Junko; Higuchi, Yusuke; Kato, Nobuo; Kumakura, Shunichi

    2016-08-01

    The treatment of pancreatic cancer, one of the most aggressive gastrointestinal tract malignancies, with current chemotherapeutic drugs has had limited success due to its chemoresistance and poor prognosis. Therefore, the development of new drugs or effective combination therapies is urgently needed. Cotylenin A (CN-A) (a plant growth regulator) is a potent inducer of differentiation in myeloid leukemia cells and exhibits potent antitumor activities in several cancer cell lines. In the present study, we demonstrated that CN-A and phenethyl isothiocyanate (PEITC), an inducer of reactive oxygen species (ROS) and a dietary anticarcinogenic compound, synergistically inhibited the proliferation of MIAPaCa-2, PANC-1 and gemcitabine-resistant PANC-1 cells. A combined treatment with CN-A and PEITC also effectively inhibited the anchorage-independent growth of these cancer cells. The combined treatment with CN-A and PEITC strongly induced cell death within 1 day at concentrations at which CN-A or PEITC alone did not affect cell viability. A combined treatment with synthetic CN-A derivatives (ISIR-005 and ISIR-042) or fusicoccin J (CN-A-related natural product) and PEITC did not have synergistic effects on cell death. The combined treatment with CN-A and PEITC synergistically induced the generation of ROS. Antioxidants (N-acetylcysteine and trolox), ferroptosis inhibitors (ferrostatin-1 and liproxstatin), and the lysosomal iron chelator deferoxamine canceled the synergistic cell death. Apoptosis inhibitors (Z-VAD-FMK and Q-VD-OPH) and the necrosis inhibitor necrostatin-1s did not inhibit synergistic cell death. Autophagy inhibitors (3-metyladenine and chloroquine) partially prevented cell death. These results show that synergistic cell death induced by the combined treatment with CN-A and PEITC is mainly due to the induction of ferroptosis. Therefore, the combination of CN-A and PEITC has potential as a novel therapeutic strategy against pancreatic cancer.

  10. Principles of Mechanical Excavation

    Energy Technology Data Exchange (ETDEWEB)

    Lislerud, A. [Tamrock Corp., Tampere (Finland)

    1997-12-01

    Mechanical excavation of rock today includes several methods such as tunnel boring, raiseboring, roadheading and various continuous mining systems. Of these raiseboring is one potential technique for excavating shafts in the repository for spent nuclear fuel and dry blind boring is promising technique for excavation of deposition holes, as demonstrated in the Research Tunnel at Olkiluoto. In addition, there is potential for use of other mechanical excavation techniques in different parts of the repository. One of the main objectives of this study was to analyze the factors which affect the feasibility of mechanical rock excavation in hard rock conditions and to enhance the understanding of factors which affect rock cutting so as to provide an improved basis for excavator performance prediction modeling. The study included the following four main topics: (a) phenomenological model based on similarity analysis for roller disk cutting, (b) rock mass properties which affect rock cuttability and tool life, (c) principles for linear and field cutting tests and performance prediction modeling and (d) cutter head lacing design procedures and principles. As a conclusion of this study, a test rig was constructed, field tests were planned and started up. The results of the study can be used to improve the performance prediction models used to assess the feasibility of different mechanical excavation techniques at various repository investigation sites. (orig.). 21 refs.

  11. Diabetes melito: plantas e princípios ativos naturais hipoglicemiantes Diabetes mellitus: hypoglicemic plants and natural active principles

    Directory of Open Access Journals (Sweden)

    Giuseppina Negri

    2005-06-01

    Full Text Available O diabetes melito é considerada como uma síndrome que é, quanto a etiologia e patogênese, caracterizada por alterar a homeostase do organismo, por distúrbios metabólicos complexos e primários dos carboidratos, que envolvem secundariamente, porém de forma importante, lipídeos e proteínas. Grande número de espécies de plantas tem sido usado experimentalmente para tratar os sintomas do diabetes melito e a distância filogenética entre este grupo de plantas é forte indicação da natureza variada de seus constituintes. Tem sido constatado que muitas substâncias extraídas de plantas reduzem o nível de glicose no sangue. A grande diversidade de classes químicas indica que uma variedade de mecanismos de ação deve estar envolvida na redução do nível de glicose no sangue. Algumas destas substâncias podem ter potencial terapêutico enquanto outras podem produzir hipoglicemia como um efeito colateral devido à sua toxicidade, especialmente hepatotoxidade. Este artigo apresenta uma revisão atualizada e acrescenta mais plantas e princípios ativos hipoglicemiantes à extensa lista existente nos artigos de revisão anteriores.Diabetes mellitus comprises a group of ethiologically and clinically heterogeneous disorders with a common set of symptoms: excessive thirst and hunger, muscular weakness, weight loss, excessive urination and elevation of the blood glucose level among others. There has been a striking emergence of non-insulin-dependent diabetes mellitus as a major health problem in populations undergoing modernization of life-style, both in developed and underdeveloped nations. Many species of plants have been used ethnopharmacologically or experimentally to treat symptons of diabetes mellitus. The high percentage of active plants probably reflects, at least in part, the great variety of possible active constituents and mechanisms of action. The wide diversity of chemical classes indicate a variety of mechanisms must be involved

  12. First-principles investigation of Cu-doped ZnS with enhanced photocatalytic hydrogen production activity

    Science.gov (United States)

    Dong, Ming; Zhou, Peng; Jiang, Chuanjia; Cheng, Bei; Yu, Jiaguo

    2017-01-01

    The band structure and electronic properties of Cu-doped wurtzite ZnS were investigated by density functional theory calculations. According to the formation energies, the substitutional Cu and S vacancy defects are stable among the examined doping species. Particularly, the hybridization of substitutional Cu 3d and S 3p orbitals narrows the band gap of substitutional Cu-doped ZnS (CuZn-ZnS), while the high effective mass ratio of photogenerated holes and electrons (mh∗/me∗) in the CuZn-ZnS is beneficial for the separation and migration of the photogenerated charge carriers. Lab-synthesized CuZn-ZnS sample exhibited enhanced visible-light absorption and photocatalytic hydrogen production activity compared to pure ZnS.

  13. First-principles study on codoping effect to enhance photocatalytic activity of anatase TiO2

    Science.gov (United States)

    Bai, Yujie; Zhang, Qinfang; Zheng, Fubao; Yang, Yun; Meng, Qiangqiang; Zhu, Lei; Wang, Baolin

    2017-03-01

    Codopant is an effective approach to modify the bandgap and band edge positions of transition metal oxide. Here, the electronic structures as well as the optical properties of pristine, mono-doped (N/P/Sb) and codoped (Sb, N/P) anatase TiO2 have been systematically investigated based on density functional theory calculations. It is found that mono-doped TiO2 exhibits either unoccupied or partially occupied intermediate state within the energy gap, which promotes the recombination of electron-hole pairs. However, the presence of (Sb, N/P) codopant not only effectively reduces the width of bandgap by introducing delocalized occupied intermediate states, but also adjusts the band edge alignment to enhance the hydrogen evolution activity of TiO2. Moreover, the optical absorption spectrum for (Sb, N/P) codoped TiO2, which is favored under oxygen-rich condition, demonstrates the improvement of its visible light absorption. These findings will promote the potential application of (Sb, N/P) codoped TiO2 photocatalysis for water splitting under visible light irradiation.

  14. STRING 2008 hold at CERN -- the largest and most important conference on String Theory with the mostly active researchers in the field. The main purpose of the conference is to review the latest developments for experts.

    CERN Multimedia

    Maximilien Brice

    2008-01-01

    STRING 2008 hold at CERN -- the largest and most important conference on String Theory with the mostly active researchers in the field. The main purpose of the conference is to review the latest developments for experts.

  15. The Principle of Structural Reciprocity

    DEFF Research Database (Denmark)

    Pugnale, Alberto; Parigi, Dario; Kirkegaard, Poul Henning

    2011-01-01

    This paper deals with the principle of structural reciprocity, considering its origins in both Occidental and Orient culture and aiming to highlight the definition, main peculiarities and interesting aspects of such concept referring to its application to the world of construction. Issues spanning...

  16. On the Dirichlet's Box Principle

    Science.gov (United States)

    Poon, Kin-Keung; Shiu, Wai-Chee

    2008-01-01

    In this note, we will focus on several applications on the Dirichlet's box principle in Discrete Mathematics lesson and number theory lesson. In addition, the main result is an innovative game on a triangular board developed by the authors. The game has been used in teaching and learning mathematics in Discrete Mathematics and some high schools in…

  17. Principles of the Antarctic Treaty

    Science.gov (United States)

    Candidi, M.

    The operation of any base or expedition to Antarctica is regulated by the mutual agreement among nations in the “Antarctic Treaty”. This treaty deals with the major aspects of life in Antarctica and its main principles and provisions are described in what follows.

  18. The active principle region of Buyang Huanwu decoction induced differentiation of bone marrow-derived mesenchymal stem cells into neural-like cells Superior effects over original formula of Buyang Huanwu decoction

    Institute of Scientific and Technical Information of China (English)

    Jinghui Zheng; Yi Wan; Jianhuai Chi; Dekai Shen; Tingting Wu; Weimin Li; Pengcheng Du

    2012-01-01

    The present study induced in vitro-cultured passage 4 bone marrow-derived mesenchymal stem cells to differentiate into neural-like cells with a mixture of alkaloid, polysaccharide, aglycone, glycoside, essential oils, and effective components of Buyang Huanwu decoction (active principle region of decoction for invigorating yang for recuperation). After 28 days, nestin and neuron-specific enolase were expressed in the cytoplasm. Reverse transcription-PCR and western blot analyses showed that nestin and neuron-specific enolase mRNA and protein expression was greater in the active principle region group compared with the original formula group. Results demonstrated that the active principle region of Buyang Huanwu decoction induced greater differentiation of rat bone marrow-derived mesenchymal stem cells into neural-like cells in vitro than the original Buyang Huanwu decoction formula.

  19. Principles Guiding Vocabulary Learning through Extensive Reading

    Science.gov (United States)

    Nation, Paul

    2015-01-01

    Extensive reading is one of a range of activities that can be used in a language learning course. Ideally, the choice of activities to go into a course should be guided by principles which are well supported by research. Similarly, the way each of those activities is used should be guided by well-justified principles. In this article, we look at…

  20. Discussion on the creating principle of primary school activity space%初探小学活动空间的营造原则

    Institute of Scientific and Technical Information of China (English)

    王栋

    2015-01-01

    Based on the current actual requirements,combining with two excellent design examples of Tsinghua University elementary school and Xiaoquan national primary school,from the convenience,diversity,size appropriate three aspects of space activities discussed the creating princi-ple of primary school activity space,made the design scheme to meet the space environment and atmosphere of learning and communication,pro-moted the healthy development of student’s body and mind.%立足于现阶段的现实需求,结合清华大学附小和孝泉民族小学两个优秀的设计实例,从活动空间的便捷性、多样性、尺度的适宜性三个方面探讨了小学活动空间的营造原则,使设计方案能满足学习和交往的空间环境和氛围,促进学生身心的健康发展。

  1. Selective monoamine oxidase B inhibition by an Aphanizomenon flos-aquae extract and by its constitutive active principles phycocyanin and mycosporine-like amino acids.

    Science.gov (United States)

    Scoglio, Stefano; Benedetti, Yanina; Benvenuti, Francesca; Battistelli, Serafina; Canestrari, Franco; Benedetti, Serena

    2014-06-15

    Aphanizomenon flos-aquae (AFA) is a fresh water unicellular blue-green alga that has been traditionally used for over 25 years for its health-enhancing properties. Recent studies have shown the ability of a proprietary AFA extract (Klamin(®)) to improve mood, counteract anxiety, and enhance attention and learning. Aim of this study was to test the monoamine oxidase (MAO) inhibition activity of the same AFA extract and of its constituents phycocyanin (AFA-PC) and mycosporine-like aminoacids (AFA-MAAs). All compounds showed a dose-dependent selective inhibition of MAO-B activity as compared to MAO-A. The IC50 values of the AFA extract (concentration 10 mg/ml), AFA-PC and AFA-MAAs were 6.4 μl/ml, 1.33 μM and 1.98 μM, respectively, evidencing a mixed-type of inhibition for the AFA extract (Ki 0.99 μl/ml), a non-competitive inhibition for AFA-PC (Ki 1.06 μM) and a competitive inhibition for AFA-MAAs (Ki 0.585 μM). These results are important to explain the neuromodulating properties of the AFA extract Klamin(®), which is rich in phenylethylamine, a general neuromodulator, that would nevertheless rapidly destroyed by MAO-B enzymes without the inhibitory activity of the synergic active principles AFA-PC and AFA-MAAs. The present investigation thus proposes the extract as potentially relevant in clinical areas such as mood disorders and neurodegenerative diseases. Copyright © 2014 Elsevier GmbH. All rights reserved.

  2. Defeating Mechanisms of Armours for Main Battle Tanks

    Institute of Scientific and Technical Information of China (English)

    Manfred Held

    2005-01-01

    The fundamental protection principles of the new armours for main battle tanks against kinetic energy projectiles (KE) and chemical energy weapons (CE)--shaped charges are shortly described and their efficiency against both threats discussed. The armour topics can be split into: "perpendicular or zero-degree armours", such as rolled homogeneous armour (RHA), also with extremely high strength, ceramics, glass, liquid filled columns and explosive filled cells,"inclined armours", as spaced RHA plates with their corner effects, bulging armour, additive and integrated explosive reactive armours (ERA) and "hard kill active defence possibilities" in different defeating distances.

  3. Principles of copula theory

    CERN Document Server

    Durante, Fabrizio

    2015-01-01

    Principles of Copula Theory explores the state of the art on copulas and provides you with the foundation to use copulas in a variety of applications. Throughout the book, historical remarks and further readings highlight active research in the field, including new results, streamlined presentations, and new proofs of old results.After covering the essentials of copula theory, the book addresses the issue of modeling dependence among components of a random vector using copulas. It then presents copulas from the point of view of measure theory, compares methods for the approximation of copulas,

  4. Developmental Principles: Fact or Fiction

    Directory of Open Access Journals (Sweden)

    A. J. Durston

    2012-01-01

    Full Text Available While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, “whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm”. We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level? adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them.

  5. Teaching Spreadsheets: Curriculum Design Principles

    CERN Document Server

    Tort, Francoise

    2010-01-01

    EuSpRIG concerns direct researchers to revisit spreadsheet education, taking into account error auditing tools, checklists, and good practices. This paper aims at elaborating principles to design a spreadsheet curriculum. It mainly focuses on two important issues. Firstly, it is necessary to establish the spreadsheet invariants to be taught, especially those concerning errors and good practices. Secondly, it is important to take into account the learners' ICT experience, and to encourage them to attitudes that foster self-learning. We suggest key principles for spreadsheet teaching, and we illustrate them with teaching guidelines.

  6. Implementation of corporate governance principles in Romania

    Directory of Open Access Journals (Sweden)

    Ramona Iulia Țarțavulea (Dieaconescu

    2014-12-01

    Full Text Available The paper aims to conduct a study regarding the manner in which corporate governance principles are applied in Romania, in both public and private sector. In the first part of the paper, the corporate governance principles are presented as they are defined in Romania, in comparison with the main international sources of interest in the domain (OECD corporate governance principles, UE legal framework. The corporate governance (CG principles refer to issues regarding board composition, transparency of scope, objectives and policies; they define the relations between directors and managers, shareholders and stakeholders. The research methodology is based on both fundamental research and empirical study on the implementation of corporate governance principles in companies from Romania. The main instrument of research is a corporate governance index, calculated based on a framework proposed by the author. The corporate governance principles are transposed in criteria that compose the framework for the CG index. The results of the study consist of scores for each CG principles and calculation of CG index for seven companies selected from the public and private sector in Romania. The results are analyzed and discussed in order to formulate general and particular recommendations. The main conclusion of this study is that that a legal framework in the area of corporate governance regulation is needed in Romania. I consider that the main CG principles should be enforced by developing a mandatory legal framework.

  7. Principles of Bioenergetics

    CERN Document Server

    Skulachev, Vladimir P; Kasparinsky, Felix O

    2013-01-01

    Principles of Bioenergetics summarizes one of the quickly growing branches of modern biochemistry. Bioenergetics concerns energy transductions occurring in living systems and this book pays special attention to molecular mechanisms of these processes. The main subject of the book is the "energy coupling membrane" which refers to inner membranes of intracellular organelles, for example, mitochondria and chloroplasts. Cellular cytoplasmic membranes where respiratory and photosynthetic energy transducers, as well as ion-transporting ATP-synthases (ATPases) are also part of this membrane. Significant attention is paid to the alternative function of mitochondria as generators of reactive oxygen species (ROS) that mediate programmed death of cells (apoptosis and necrosis) and organisms (phenoptosis). The latter process is considered as a key mechanism of aging which may be suppressed by mitochondria-targeted antioxidants.

  8. Maine's Employability Skills Program

    Science.gov (United States)

    McMahon, John M.; Wolffe, Karen E.; Wolfe, Judy; Brooker, Carrie

    2013-01-01

    This Practice Report describes the development and implementation of the "Maine Employability Skills Program," a model employment program developed by the Maine Division for the Blind and Visually Impaired (DBVI). The program was designed to support the efforts of the chronically unemployed or underemployed. These consumers were either…

  9. Effect of SPL (Spent Pot Liner) and its main components on root growth, mitotic activity and phosphorylation of Histone H3 in Lactuca sativa L.

    Science.gov (United States)

    Freitas, Aline Silva; Fontes Cunha, Isabela Martinez; Andrade-Vieira, Larissa Fonseca; Techio, Vânia Helena

    2016-02-01

    Spent Pot Liner (SPL) is a solid waste from the aluminum industry frequently disposed of in industrial landfills; it can be leached and contaminate the soil, sources of drinking water and plantations, and thus may pose a risk to human health and to ecosystems. Its composition is high variable, including cyanide, fluoride and aluminum salts, which are highly toxic and environmental pollutants. This study evaluated the effect of SPL and its main components on root growth and the mitosis of Lactuca sativa, by investigating the mechanisms of cellular and chromosomal alterations with the aid of immunolocalization. To this end, newly emerged roots of L. sativa were exposed to SPL and its main components (solutions of cyanide, fluoride and aluminum) and to calcium chloride (control) for 48h. After this, root length was measured and cell cycle was examined by means of conventional cytogenetics and immunolocalization. Root growth was inhibited in the treatments with SPL and aluminum; chromosomal and nuclear alterations were observed in all treatments. The immunolocalization evidenced normal dividing cells with regular temporal and spatial distribution of histone H3 phosphorylation at serine 10 (H3S10ph). However, SPL and its main components inhibited the phosphorylation of histone H3 at serine 10, inactivated pericentromeric regions and affected the cohesion of sister chromatids, thus affecting the arrangement of chromosomes in the metaphase plate and separation of chromatids in anaphase. In addition, these substances induced breaks in pericentromeric regions, characterized as fragile sites.

  10. Abstracts of Main Essays

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    Ferments of Thought in the Reflection of Modernity: In View of Young Hegel Yu Wujin Hegel is the first philosopher for whom modernity has become a problem. He started his reflections on modernity from his youth time. In those manuscripts and works written during his youth time, he has deeply reflected on the problems such as the positivity of religion, the mechanical nature of labor, the principle of utility within enlightenment and the absoluteness of human will. All of these have provided important resources for the present researches on modernity.

  11. Economic analysis of the principles of liability in tort in the backdrop of liability for compensation for damage occurring as a result of the activities of one entity to the goods of another entity

    Directory of Open Access Journals (Sweden)

    Joanna Kuźmicka-Sulikowska

    2012-12-01

    Full Text Available The article addresses basic issues associated with the economic analysis of liability in tort principles. The deliberations focus on an attempt to define the economic and social consequences of introducing various combinations of principles of tortious liability for damage suffered as a result of the activities of one entity borne in the goods of another. Lack of liability situations are treated in some detail as well as liability based on the principle of risk and the principle of fault. The analyses were conducted based on unilateral and bilateral models. Factors coming into play in determining the economically effective level of carefulness in actions are discussed. A series of other factors of significant relevance for the choice of an optimal principle of liability from the economic point of view are also highlighted. In this context the role of the level of activity of entities, availability of insurance policies and costs associated with pursuing compensation claims are discussed. The deliberations are concluded with a summary, which also entails a critical look at the method of economic analysis of law.

  12. Electrophysiology of living organs from first principles

    CERN Document Server

    Scharf, Günter

    2010-01-01

    Based on the derivation of the macroscopic Maxwell's equations by spatial averaging of the microscopic equations, we discuss the electrophysiology of living organs. Other methods of averaging (or homogenization) like the bidomain model are not compatible with Maxwell's theory. We also point out that modeling the active cells by source currents is not a suitable description of the situation from first principles. Instead, it turns out that the main source of the measured electrical potentials is the polarization charge density which exists at the membranes of the active cells and adds up to a macroscopic polarization. The latter is the source term in the Laplace equation, the solution of which gives the measured far-field potential. As a consequence it is the polarization or dipole density which is best suited for localization of cardiac arrhythmia.

  13. Cosmological implications of Heisenberg's principle

    CERN Document Server

    Gonzalo, Julio A

    2015-01-01

    The aim of this book is to analyze the all important implications of Heisenberg's Uncertainty Principle for a finite universe with very large mass-energy content such as ours. The earlier and main contributors to the formulation of Quantum Mechanics are briefly reviewed regarding the formulation of Heisenberg's Principle. After discussing “indeterminacy” versus ”uncertainty”, the universal constants of physics are reviewed and Planck's units are given. Next, a novel set of units, Heisenberg–Lemaitre units, are defined in terms of the large finite mass of the universe. With the help of Heisenberg's principle, the time evolution of the finite zero-point energy for the universe is investigated quantitatively. Next, taking advantage of the rigorous solutions of Einstein's cosmological equation for a flat, open and mixed universe of finite mass, the most recent and accurate data on the “age” (to) and the expansion rate (Ho) of the universe and their implications are reconsidered.

  14. On principles of internet language formation

    Institute of Scientific and Technical Information of China (English)

    赵倩

    2008-01-01

    This paper mainly researches on the principles which guide the formation of the numerous and complicated intemet lan- guage.By studying the methods of intemet language formation (abbre- viation,old expression with new meaning,Arabic number code,emot- icons and bilingual code) and analyzing the age and educational back- ground of the netizens,the author demonstrates the formation of the in- ternet language is guided by these two principles:saving keystroke principle and showing individuality principle.And as the author is a Chinese student majored in English,beth the Chinese and English in- ternet language sources will be studied.

  15. Maine Field Station

    Data.gov (United States)

    Federal Laboratory Consortium — In 2000 NOAA's National Marine Fisheries Service established the Maine Field Station in Orono, ME to have more direct involvement in the conservation of the living...

  16. 2004 Maine Lidar

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This metadata document describes the collection and processing of Light Detection and Ranging (LIDAR) data over an area along the coast of Maine. Data was collected...

  17. Monitoring of benzodiazepines (clobazam, diazepam and their main active metabolites) in human plasma by column-switching high-performance liquid chromatography.

    Science.gov (United States)

    Lacroix, C; Wojciechowski, F; Danger, P

    1993-08-11

    A column-switching high-performance liquid chromatographic method for the simultaneous determination of clobazam, diazepam and their main metabolites in human plasma is described. A 200-microliters plasma sample was directly injected into a precolumn filled with TSK-gel PW. After a washing step with potassium phosphate buffer, the retained substances were backflushed into a reversed-phase column with a mobile phase of acetonitrile-phosphate buffer-diethylamine. Various drugs frequently co-administered with clobazam or diazepam do not interfere with the determination.

  18. Study of structure of technical and tactical activity of high class hockey players of different line by the method of main component

    Directory of Open Access Journals (Sweden)

    Oleksiy Mikhnov

    2014-10-01

    Full Text Available Purpose: to study the factor structure of technical and tactical actions of hockey players of high qualification of different playing line of business. Material and methods: for the leadthrough of analysis of competition activity information of technical and tactical actions of hockey players was used NHL. Competition activity was in general complication analysed more than 800 hockey players of different line of business. Methods were used: pedagogical supervisions and analysis of competition activity, analysis of data of the special scientific-methodical literature, an analysis of data is the Internet, methods of mathematical statistics. Results: information is presented in relation to the specific of competition activity of hockey players of high class of different line of business in a match. The factor structure of technical and tactical activity of hockey players, executing in the command of function of extreme forward, central forward, defender and goalkeeper is set. for the players of line of attack most meaningfulness was had factors, related to the attack of gate of competitor, for defenders are power single combats, defense of gate and selection of puck, for a goalkeeper the most meaningful factor is characterized by efficiency of reflection of throws on a gate. Conclusions: the exposed features are in realization of technical and tactical actions the hockey players of high class of different playing line of business, it is necessary certainly to take into account in the process of estimation and control.

  19. Safety of spanish nuclear park. Analysis of the fundamental principles of security of nuclear facilities and activities; Seguridad del parque nuclear espanol. Analisis de los principios fundamentales de ls seguridad de las instalaciones y actividades nucleares

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2010-07-01

    The aim of this study is to analyze the fundamental principles underlying the safety of nuclear installations and activities, which defined the International Atomic Energy Agency (IAEA). These principles determine the roles of government and responsibilities of the holders of power, explain how to achieve security and nuclear energy to justify the society, present and future and the environment from the risks of ionizing radiation, both and explain natural and man must be managed as waste that occur or have occurred in the past. (Author)

  20. Physico-chemical studies on the evaluation of the antioxidant activity of herbal extracts and active principles of some Indian medicinal plants.

    Science.gov (United States)

    Adhikari, Soumyakanti; Indira Priyadarsini, Kavirayani; Mukherjee, Tulsi

    2007-05-01

    Understanding of the efficacy and mechanism for the reaction of the biologically important radicals with natural and/or synthetic antioxidants is the first step towards the development of future therapeutic agents. The kinetic parameters e.g., formation and decay rate constants predict the efficacy of an antioxidant and its fate after reaction. These parameters also dictate the ease with which competing reactions would occur in a bio-environment. The spectroscopic parameters provide the clue to the site of free radical attack to these antioxidants. Here, in this article an attempt has been made to show the use of physico-chemical methods in the evaluation of antioxidant activity of some important medicinal plants commonly used in India and the subcontinent. The systems chosen here for discussions are herbal extracts as such, curcumin from turmeric, methoxy phenols from Indian spices, dehydrogingerdione from ginger and bakuchiol from Psoralea corylifolia. All the examples shown in this article illustrate the potential of the pulse radiolysis coupled with kinetic spectroscopy and other physicochemical techniques for the study of antioxidants either in the form of mixture as in herbal extract or as an isolated compound.

  1. Principles of project management

    Science.gov (United States)

    1982-01-01

    The basic principles of project management as practiced by NASA management personnel are presented. These principles are given as ground rules and guidelines to be used in the performance of research, development, construction or operational assignments.

  2. Principles of safety pharmacology.

    Science.gov (United States)

    Pugsley, M K; Authier, S; Curtis, M J

    2008-08-01

    Safety Pharmacology is a rapidly developing discipline that uses the basic principles of pharmacology in a regulatory-driven process to generate data to inform risk/benefit assessment. The aim of Safety Pharmacology is to characterize the pharmacodynamic/pharmacokinetic (PK/PD) relationship of a drug's adverse effects using continuously evolving methodology. Unlike toxicology, Safety Pharmacology includes within its remit a regulatory requirement to predict the risk of rare lethal events. This gives Safety Pharmacology its unique character. The key issues for Safety Pharmacology are detection of an adverse effect liability, projection of the data into safety margin calculation and finally clinical safety monitoring. This article sets out to explain the drivers for Safety Pharmacology so that the wider pharmacology community is better placed to understand the discipline. It concludes with a summary of principles that may help inform future resolution of unmet needs (especially establishing model validation for accurate risk assessment). Subsequent articles in this issue of the journal address specific aspects of Safety Pharmacology to explore the issues of model choice, the burden of proof and to highlight areas of intensive activity (such as testing for drug-induced rare event liability, and the challenge of testing the safety of so-called biologics (antibodies, gene therapy and so on.).

  3. [Principles of callus distraction].

    Science.gov (United States)

    Hankemeier, S; Bastian, L; Gosling, T; Krettek, C

    2004-10-01

    Callus distraction is based on the principle of regenerating bone by continuous distraction of proliferating callus tissue. It has become the standard treatment of significant leg shortening and large bone defects. Due to many problems and complications, exact preoperative planning, operative technique and careful postoperative follow-up are essential. External fixators can be used for all indications of callus distraction. However, due to pin tract infections, pain and loss of mobility caused by soft tissue transfixation, fixators are applied in patients with open growth plates, simultaneous lengthening with continuous deformity corrections, and increased risk of infection. Distraction over an intramedullary nail allows removal of the external fixator at the end of distraction before callus consolidation (monorail method). The intramedullary nail protects newly formed callus tissue and reduces the risk of axial deviation and refractures. Recently developed, fully intramedullary lengthening devices eliminate fixator-associated complications and accelerate return to normal daily activities. This review describes principles of callus distraction, potential complications and their management.

  4. Clinical forensic medicine and its main fields of activity from the foundation of the German Society of Legal Medicine until today.

    Science.gov (United States)

    Pollak, S

    2004-09-10

    The fields mainly covered by clinical forensic medicine are subject to time-related changes which are described on the basis of the German literature of the 20th century. Some fields of forensic sexual medicine (diagnosis of virginity, proof of criminal abortion, potentia coeundi, potentia generandi, potentia concipiendi) have become less important in the daily work of medicolegal institutes, whereas victims of rape and sexual abuse continue to form a major part of the forensic examination material in the German-speaking countries. The evaluation of suspected physical child abuse has grown in importance since the 60s, and it is essentially the merit of Elisabeth Trube-Becker that this problem is now dealt with also in scientific medicine. More recently, medicolegal experts are increasingly confronted with further groups of persons: victims of domestic violence, abused/neglected seniors, refugees from countries where torture is used. A new special field, which established itself only in the 90s, is the estimation of age with regard to the criminal responsibility of suspects who have no identity papers or pretend to have none. A phenomenon frequently observed in the last two decades is the non-accidental self-infliction of injuries. Whereas in the first half of the 20th century the motive for self-mutilation was typically to evade military service, this category of injury was later mainly seen in the context of insurance fraud; more recently most forensically relevant self-inflicted injuries refer to simulated offenses (fictitious sexual offenses and robbery, attacks allegedly having a political background). One of the traditional fields of clinical forensic medicine continues to be the evaluation of victims and suspects following bodily harm and attempted homicides. In the field of civil law medicolegal experts are particularly often concerned with controversial consequences of traffic accidents (e.g. alleged whiplash injuries after rear-end collisions at low

  5. Principles of human rights protection in foreign and home legal policy of the Russian state

    Directory of Open Access Journals (Sweden)

    Anokhin Yu.V.

    2014-12-01

    Full Text Available The principles of state protection of human rights are stated to be important. The principles of human rights policy being a system are conditional on main state goals and objectives, that is ensuring legal safety and unhindered development of an individual and society. This system is argued to be two-component and to include the principles of government mechanism’s construction and activity and general human rights principles. The principles which are not fixed in the legislation are also of great importance. The legislative fixing of principles of civil servants’ activity concerning the human rights is positively estimated by the authors, notably the priority of rights and freedoms of man and citizen; professionalism and competence of civil servants; availability of information on civil service; cooperation with public associations and citizens; security of civil servants against illegal intrusion into their activity. The facts of departure from impartial justice and disrespectful attitude of law enforcement officers to citizens are stated to be wide-spread. The authors prove the necessity to intensify the control of public authorities’ and officials’ activity, to create conditions of its full transparency for the public. The principles of state protection of human rights are ruling principles of public authority’s organization and activity, stating its essence, social function and orientation on setting high level of legal security of man and citizen, fixed in the international agreements and national legislation. It is proposed to reconsider the principles of Russia’s functioning in the sphere of protecting the rights of citizens and proprietors residing abroad.

  6. Chemical Principles Exemplified

    Science.gov (United States)

    Plumb, Robert C.

    1970-01-01

    This is the first of a new series of brief ancedotes about materials and phenomena which exemplify chemical principles. Examples include (1) the sea-lab experiment illustrating principles of the kinetic theory of gases, (2) snow-making machines illustrating principles of thermodynamics in gas expansions and phase changes, and (3) sunglasses that…

  7. The neural circuits for arithmetic principles.

    Science.gov (United States)

    Liu, Jie; Zhang, Han; Chen, Chuansheng; Chen, Hui; Cui, Jiaxin; Zhou, Xinlin

    2017-02-15

    Arithmetic principles are the regularities underlying arithmetic computation. Little is known about how the brain supports the processing of arithmetic principles. The current fMRI study examined neural activation and functional connectivity during the processing of verbalized arithmetic principles, as compared to numerical computation and general language processing. As expected, arithmetic principles elicited stronger activation in bilateral horizontal intraparietal sulcus and right supramarginal gyrus than did language processing, and stronger activation in left middle temporal lobe and left orbital part of inferior frontal gyrus than did computation. In contrast, computation elicited greater activation in bilateral horizontal intraparietal sulcus (extending to posterior superior parietal lobule) than did either arithmetic principles or language processing. Functional connectivity analysis with the psychophysiological interaction approach (PPI) showed that left temporal-parietal (MTG-HIPS) connectivity was stronger during the processing of arithmetic principle and language than during computation, whereas parietal-occipital connectivities were stronger during computation than during the processing of arithmetic principles and language. Additionally, the left fronto-parietal (orbital IFG-HIPS) connectivity was stronger during the processing of arithmetic principles than during computation. The results suggest that verbalized arithmetic principles engage a neural network that overlaps but is distinct from the networks for computation and language processing.

  8. The main cubioid

    Science.gov (United States)

    Blokh, Alexander; Oversteegen, Lex; Ptacek, Ross; Timorin, Vladlen

    2014-08-01

    The connectedness locus in the parameter space of quadratic polynomials is called the Mandelbrot set. A good combinatorial model of this set is due to Thurston. By definition, the principal hyperbolic domain of the Mandelbrot set consists of parameter values, for which the corresponding quadratic polynomials have an attracting fixed point. The closure of the principal hyperbolic domain of the Mandelbrot set is called the main cardioid. Its topology is completely described by Thurston's model. Less is known about the connectedness locus in the parameter space of cubic polynomials. In this paper, we discuss cubic analogues of the main cardioid and establish relationships between them.

  9. Myeloperoxidase-Dependent LDL Modifications in Bloodstream Are Mainly Predicted by Angiotensin II, Adiponectin, and Myeloperoxidase Activity: A Cross-Sectional Study in Men

    Directory of Open Access Journals (Sweden)

    Karim Zouaoui Boudjeltia

    2013-01-01

    Full Text Available The present paradigm of atherogenesis proposes that low density lipoproteins (LDLs are trapped in subendothelial space of the vascular wall where they are oxidized. Previously, we showed that oxidation is not restricted to the subendothelial location. Myeloperoxidase (MPO, an enzyme secreted by neutrophils and macrophages, can modify LDL (Mox-LDL at the surface of endothelial cells. In addition we observed that the activation of the endothelial cells by angiotensin II amplifies this process. We suggested that induction of the NADPH oxidase complex was a major step in the oxidative process. Based on these data, we asked whether there was an independent association, in 121 patients, between NADPH oxidase modulators, such as angiotensin II, adiponectin, and levels of circulating Mox-LDL. Our observations suggest that the combination of blood angiotensin II, MPO activity, and adiponectin explains, at least partially, serum Mox-LDL levels.

  10. In vivo activity of terpinen-4-ol, the main bioactive component of Melaleuca alternifolia Cheel (tea tree oil against azole-susceptible and -resistant human pathogenic Candida species

    Directory of Open Access Journals (Sweden)

    Cassone Antonio

    2006-11-01

    Full Text Available Abstract Background Recent investigations on the antifungal properties of essential oil of Melaleuca alternifolia Cheel (Tea Tree Oil, TTO have been performed with reference to the treatment of vaginal candidiasis. However, there is a lack of in vivo data supporting in vitro results, especially regarding the antifungal properties of TTO constituents. Thus, the aim of our study was to investigate the in vitro and the in vivo anti-Candida activity of two critical bioactive constituents of TTO, terpinen-4-ol and 1,8-cineole. Methods Oophorectomized, pseudoestrus rats under estrogen treatment were used for experimental vaginal infection with azole (fluconazole, itraconazole -susceptible or -resistant strains of C. albicans. All these strains were preliminarily tested for in vitro susceptibility to TTO, terpinen-4-ol and 1,8-cineole for their antifungal properties, using a modification of the CLSI (formerly NCCLS reference M27-A2 broth micro-dilution method. Results In vitro minimal inhibitory concentrations (MIC90 values were 0.06% (volume/volume for terpinen-4-ol and 4% (volume/volume for 1,8-cineole, regardless of susceptibility or resistance of the strains to fluconazole and itraconazole. Fungicidal concentrations of terpinen-4-ol were equivalent to the candidastatic activity. In the rat vaginal infection model, terpinen-4-ol was as active as TTO in accelerating clearance from the vagina of all Candida strains examined. Conclusion Our data suggest that terpinen-4-ol is a likely mediator of the in vitro and in vivo activity of TTO. This is the first in vivo demonstration that terpinen-4-ol could control C. albicans vaginal infections. The purified compound holds promise for the treatment of vaginal candidiasis, and particularly the azole-resistant forms.

  11. Quality control of tuirejieduling granules using high-performance liquid chromatography fingerprint method and simultaneous determination of four main active ingredients

    Directory of Open Access Journals (Sweden)

    Aixia Yang

    2013-01-01

    Full Text Available Background: The Tuirejieduling granule is a compound preparation made from four kinds of Chinese medicines. It is effective for anti-inflammation, antivirus, defervescence and anti-bacterium; however, its quality control standards have remained unknown. Objective: To establish a simple and accurate fingerprint method for quality control of the Tuirejieduling granule. Materials and Methods: The methanol extract of the Tuirejieduling granule was used for the fingerprint analysis and the four selected active ingredients (epigoitrin, phillyrin, saikosaponin A and glycyrrhetinic acid in the extract were determined. The fingerprint method was performed on an Amethyst C18-P chromatography column by gradient elution with acetonitrile and aqueous phase (containing 0.5% H 3 PO 4 (v/v, pH 3.0. Results: Under the optimal chromatographic condition, twenty peaks were chosen as fingerprint peaks of the Tuirejieduling granules extractions. The similarities of 10 batches of Tuirejieduling granule was more than 0.99. This indicates that the different batches of Tuirejieduling granules were under the consistent quality control. Good linear behaviors over the investigated concentration ranges were obtained with the values of R2 higher than 0.99 for four studied active ingredients. The recoveries for spiked samples were in the range of 96.2-105.5%. The developed method was successfully applied to determine the contents of active constituents in different batches of Tuirejieduling granule. Conclusion: The HPLC fingerprint was proved to be a reliable method for the quality control of Tuirejieduling granule.

  12. Emulsion Science Basic Principles

    CERN Document Server

    Leal-Calderon, Fernando; Schmitt, Véronique

    2007-01-01

    Emulsions are generally made out of two immiscible fluids like oil and water, one being dispersed in the second in the presence of surface-active compounds.They are used as intermediate or end products in a huge range of areas including the food, chemical, cosmetic, pharmaceutical, paint, and coating industries. Besides the broad domain of technological interest, emulsions are raising a variety of fundamental questions at the frontier between physics and chemistry. This book aims to give an overview of the most recent advances in emulsion science. The basic principles, covering aspects of emulsions from their preparation to their destruction, are presented in close relation to both the fundamental physics and the applications of these materials. The book is intended to help scientists and engineers in formulating new materials by giving them the basics of emulsion science.

  13. Ladybugs of Maine

    Science.gov (United States)

    Color images are presented for the 57 species of Coccinellidae, commonly known as ladybugs, that are documented from Maine. Images are displayed in taxonomic order. Information on each species includes its genus-species name, length, and an actual-size silhouette beside a grid matched to the scale...

  14. Abstracts of Main Essays

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    On Engels'Dialectics of "Theoretical Thinking" Sun Zheng-yu The main significant contribution to Marxist dialectics of Engels is to formulate dialectics on the level of theoretical thinking. This contribution is expressed in three aspects: 1 ) generalizing thoroughly the historical evolution of the way of thinking embodied in science history, philosophy history and human history;

  15. A Matter of Principle: The Principles of Quantum Theory, Dirac's Equation, and Quantum Information

    CERN Document Server

    Plotnitsky, Arkady

    2015-01-01

    This article is concerned with the role of fundamental principles in theoretical physics, especially quantum theory. The fundamental principles of relativity will be be addressed as well in view of their role in quantum electrodynamics and quantum field theory, specifically Dirac's work, which, in particular Dirac's derivation of his relativistic equation for the electron from the principles of relativity and quantum theory, is the main focus of this article. I shall, however, also consider Heisenberg's derivation of quantum mechanics, which inspired Dirac. I argue that Heisenberg's and Dirac's work alike was guided by their adherence to and confidence in the fundamental principles of quantum theory. The final section of the article discusses the recent work by G. M. D' Ariano and his coworkers on the principles of quantum information theory, which extends quantum theory and its principles in a new direction. This extension enabled them to offer a new derivation of Dirac's equation from these principles alone...

  16. Fishing activity and impacts along the main nesting area of loggerhead sea turtle Caretta caretta in Italy: overwhelming discrepancy with the official data

    Directory of Open Access Journals (Sweden)

    Giulia Cambiè

    2010-06-01

    Full Text Available The southern coast of Ionian Calabria was recently recognized as the main nesting area of the loggerhead sea turtle Caretta caretta in Italy. The aim of this study was to characterize the fishing fleet in this area in terms of number of boats, economic situation, social aspects and impact on sea turtle specimens and target species. A multidisciplinary approach was essential to understand how the conservation problems of C. caretta are linked to various characteristics of the fishing fleet. Our data showed a vast discrepancy between the official census and the actual number of boats fishing in the area: 87% of the observed artisanal vessels lacked a required registration number, and thus were fishing illegally. This has caused serious social problems that worsened over the summer of 2007, when the presence of non-local registered vessels, using drift nets, generated a spatial conflict with the local artisanal fishermen. We identified 11 fishing gears used in the area and four of them were studied with on board observations: illegal drift nets, trammel nets, bottom longlines and longlines targeting swordfish. The total number of turtles caught during the summer in the area by longliners targeting swordfish was calculated to be 500 (±180 SE. In addition the presence of drift netters had a negative impact from an ecological and social point of view.

  17. THE MAIN PSYCHOLOGICAL ACTIVITIES OF PATIENTS DURING PATIENT -DOCTOR DISPUTES%医患纠纷中患方的主要心理活动分析

    Institute of Scientific and Technical Information of China (English)

    赵汝成

    2015-01-01

    This paper lists several kinds of typical and nagtive Psychological Activities of the patients which are aggressivity, anxiety, melancholy, suspiciousness and paranoia respectively .This paper describes the characteris-tics of the psychological activities show in the disputes and analyzes the reasons .Some Coping Strategies were also put forward after that .I hope this paper can bring some inspiration for the mediation personnel and can popularize the ap -plication of the psychological theory and psychological counseling techniques in the practice .%笔者列举了几种医患纠纷中患方较为典型的、且易于引发不良后果的心理活动,它们是攻击性、焦虑、忧郁、多疑、偏执,并描述了这些心理活动在纠纷中所表现出的特征,初步分析了它们产生的原因并结合原因提出了若干应对策略。希望能为广大医患纠纷调解人员的日常工作提供些许启发,并抛砖引玉,推广心理学理论与心理咨询技术在医患纠纷处理中的运用。

  18. Evaluation of antifungal activity in essential oil of the Syzygium aromaticum (L. by extraction, purification and analysis of its main component eugenol

    Directory of Open Access Journals (Sweden)

    Inder Singh Rana

    2011-12-01

    Full Text Available Antifungal properties of some essential oils have been well documented. Clove oil is reported to have strong antifungal activity against many fungal species. In this study we have evaluated antifungal potential of essential oil of Syzygium aromaticum (L. against some common fungal pathogens of plants and animals namely, Fusarium moniliforme NCIM 1100, Fusarium oxysporum MTCC 284, Aspergillus sp., Mucor sp., Trichophyton rubrum and Microsporum gypseum. All fungal species were found to be inhibited by the oil when tested through agar well diffusion method. Minimum inhibitory concentration (MIC was determined for all the species. Column chromatography was performed to separate the eugenol rich fraction from clove oil. Out of seven fractions maximum activity was obtained in column fraction II. TLC and HPLC data confirmed presence of considerable Eugenol in fraction II and clove oil. Microscopic study on effect of clove oil and column fraction II on spores of Mucor sp. and M. gypseum showed distortion and shrinkage while it was absent in other column fractions. So it can be concluded that the antifungal action of clove oil is due to its high eugenol content.

  19. Evaluation of antifungal activity in essential oil of the Syzygium aromaticum (L.) by extraction, purification and analysis of its main component eugenol.

    Science.gov (United States)

    Rana, Inder Singh; Rana, Aarti Singh; Rajak, Ram Charan

    2011-10-01

    Antifungal properties of some essential oils have been well documented. Clove oil is reported to have strong antifungal activity against many fungal species. In this study we have evaluated antifungal potential of essential oil of Syzygium aromaticum (L.) against some common fungal pathogens of plants and animals namely, Fusarium moniliforme NCIM 1100, Fusarium oxysporum MTCC 284, Aspergillus sp., Mucor sp., Trichophyton rubrum and Microsporum gypseum. All fungal species were found to be inhibited by the oil when tested through agar well diffusion method. Minimum inhibitory concentration (MIC) was determined for all the species. Column chromatography was performed to separate the eugenol rich fraction from clove oil. Out of seven fractions maximum activity was obtained in column fraction II. TLC and HPLC data confirmed presence of considerable Eugenol in fraction II and clove oil. Microscopic study on effect of clove oil and column fraction II on spores of Mucor sp. and M. gypseum showed distortion and shrinkage while it was absent in other column fractions. So it can be concluded that the antifungal action of clove oil is due to its high eugenol content.

  20. A computational study on the N-heterocyclic carbene-catalyzed Csp(2)-Csp(3) bond activation/[4+2] cycloaddition cascade reaction of cyclobutenones with imines: a new application of the conservation principle of molecular orbital symmetry.

    Science.gov (United States)

    Wang, Yang; Wu, Bohua; Zhang, Haoyang; Wei, Donghui; Tang, Mingsheng

    2016-07-20

    A comprehensive density functional theory (DFT) investigation has been performed to interrogate the mechanisms and stereoselectivities of the Csp(2)-Csp(3) single bond activation of cyclobutenones and their [4+2] cycloaddition reaction with imines via N-heterocyclic carbene (NHC) organocatalysis. According to our calculated results, the fundamental reaction pathway contains four steps: nucleophilic addition of NHC to cyclobutenone, C-C bond cleavage for the formation of an enolate intermediate, [4+2] cycloaddition of the enolate intermediate with isatin imine, and the elimination of the NHC catalyst. In addition, the calculated results also reveal that the second reaction step is the rate-determining step, whereas the third step is the regio- and stereo-selectivity determining step. For the regio- and stereo-selectivity determining step, all four possible attack modes were considered. The addition of the C[double bond, length as m-dash]N bond in isatin imine to the dienolate intermediate is more energy favorable than the addition of the C[double bond, length as m-dash]O bond to a dienolate intermediate. Moreover, the Re face addition of the C[double bond, length as m-dash]N bond in isatin imine to the Re face of the dienolate intermediate leading to the SS configuration N-containing product was demonstrated to be most energy favorable, which is mainly due to the stronger second-order perturbation energy value in the corresponding transition state. Furthermore, by tracking the frontier molecular orbital (FMO) changes in the rate-determining C-C bond cleavage step, we found that the reaction obeys the conservation principle of molecular orbital symmetry. We believe that the present work would provide valuable insights into this kind of reaction.

  1. The strong maximum principle revisited

    Science.gov (United States)

    Pucci, Patrizia; Serrin, James

    In this paper we first present the classical maximum principle due to E. Hopf, together with an extended commentary and discussion of Hopf's paper. We emphasize the comparison technique invented by Hopf to prove this principle, which has since become a main mathematical tool for the study of second order elliptic partial differential equations and has generated an enormous number of important applications. While Hopf's principle is generally understood to apply to linear equations, it is in fact also crucial in nonlinear theories, such as those under consideration here. In particular, we shall treat and discuss recent generalizations of the strong maximum principle, and also the compact support principle, for the case of singular quasilinear elliptic differential inequalities, under generally weak assumptions on the quasilinear operators and the nonlinearities involved. Our principal interest is in necessary and sufficient conditions for the validity of both principles; in exposing and simplifying earlier proofs of corresponding results; and in extending the conclusions to wider classes of singular operators than previously considered. The results have unexpected ramifications for other problems, as will develop from the exposition, e.g. two point boundary value problems for singular quasilinear ordinary differential equations (Sections 3 and 4); the exterior Dirichlet boundary value problem (Section 5); the existence of dead cores and compact support solutions, i.e. dead cores at infinity (Section 7); Euler-Lagrange inequalities on a Riemannian manifold (Section 9); comparison and uniqueness theorems for solutions of singular quasilinear differential inequalities (Section 10). The case of p-regular elliptic inequalities is briefly considered in Section 11.

  2. Cryostratigraphy and Main Physical Properties of Active Layer Soils and Upper Horizon of Permafrost at the Barrow Environmental Observatory Research Site.

    Science.gov (United States)

    Kholodov, A. L.; Liljedahl, A.; Romanovsky, V. E.; Cable, W.

    2014-12-01

    Complete understanding of the results of geophysical survey, microbiological and biogeochemical analyzes of soil cores in the Arctic environment impossible without detail description of the frozen soil and its physical properties determination. Cryostratigraphyc features i.e. total ice content and forms of ice patterns reflects the important processes such as water migration due to freezing in frozen active layer soils and history of sedimentation and freezing in underlying perennially frozen deposits. That plays significant role in biogeochemical processes that take place in the Arctic ecosystem. Current research was based on description and analyzing of 8 cores taken during 2012 and 2013 coring campaigne had been done at the Barrow Environmental Observatory research site. Cores were taken from different types of polygons and analyzed on lithological composition, soil density, ice content and thermal conductivity. Volumetric ice content within the active layer composed by organic soil consists of 70 to 80% and within silt one - less than 60%. Ice content of underlying syncryogenic perennial frozen deposits is about 70%. No clear evidences of soil moisture redistribution due to freezing of active layer were noticed in the cores composed by the organic soil. Organic soil does not have any clear cryogenic structures. Ice usually fills the pores and follows the plants fibers. Mineral soil has recticulated cryogenic structure (ice forms grid like patterns with vertically oriented cells) with some thin (up to 2 cm thick) layers of soil particles and aggregates suspended in ice. Thermal conductivity of frozen samples varies in the range from 1.5 to 2.8 W/(m*°K). It has a positive correlation with soil density and negative with gravimetric ice content (see figure below). Mineral soils have a higher bulk density and average thermal conductivity in the range 2.15 W/(m*°K), organic soils have a lower density and average thermal conductivity about 2 W/(m*°K). Samples

  3. Anti-inflammatory and antiedematogenic activity of the Ocimum basilicum essential oil and its main compound estragole: In vivo mouse models.

    Science.gov (United States)

    Rodrigues, Lindaiane Bezerra; Oliveira Brito Pereira Bezerra Martins, Anita; Cesário, Francisco Rafael Alves Santana; Ferreira E Castro, Fyama; de Albuquerque, Thaís Rodrigues; Martins Fernandes, Maria Neyze; Fernandes da Silva, Bruno Anderson; Quintans Júnior, Lucindo José; da Costa, José Galberto Martins; Melo Coutinho, Henrique Douglas; Barbosa, Roseli; Alencar de Menezes, Irwin Rose

    2016-09-25

    The genus Ocimum are used in cooking, however, their essential oils are utilized in traditional medicine as aromatherapy. The present study was carried out to investigate the chemical composition and systemic anti-inflammatory activity of the Ocimum basilicum essential oil (EOOB) and its major component estragole, as well as its possible mechanisms of action. The Ocimum basilicum essential oil was obtained by hydrodistillation and analyzed by GC-MS. The anti-inflammatory action was verified using acute and chronic in vivo tests as paw edema, peritonitis, and vascular permeability and granulomatous inflammation model. The anti-inflammatory mechanism of action was analyzed by the participation of histamine and arachidonic acid pathways. The chemical profile analysis identified fourteen components present in the essential oil, within them: estragole (60.96%). The in vivo test results show that treatment with EOOB (100 and 50 mg/kg) and estragole (60 and 30 mg/kg) significantly reduced paw edema induced by carrageenan and dextran. The smallest doses of EOOB (50 mg/kg) and estragole (30 mg/kg) showed efficacy in the reduction of paw edema induced by histamine and arachidonic acid, vascular permeability inhibition and leukocyte emigration in the peritoneal fluid. Theses doses were capable of reducing the chronic inflammatory process. The results observed between the EOOB and estragole demonstrate efficacy in anti-inflammatory activity, however, the essential oil is more efficacious in the acute and chronic anti-inflammatory action. This study confirms the therapeutic potential of this plant and reinforces the validity of its use in popular medicine.

  4. Antibacterial activity and mechanism of action of Monarda punctata essential oil and its main components against common bacterial pathogens in respiratory tract.

    Science.gov (United States)

    Li, Hong; Yang, Tian; Li, Fei-Yan; Yao, Yan; Sun, Zhong-Min

    2014-01-01

    The aim of the current research work was to study the chemical composition of the essential oil of Monarda punctata along with evaluating the essential oil and its major components for their antibacterial effects against some frequently encountered respiratory infection causing pathogens. Gas chromatographic mass spectrometric analysis revealed the presence of 13 chemical constituents with thymol (75.2%), p-cymene (6.7%), limonene (5.4), and carvacrol (3.5%) as the major constituents. The oil composition was dominated by the oxygenated monoterpenes. Antibacterial activity of the essential oil and its major constituents (thymol, p-cymene, limonene) was evaluated against Streptococcus pyogenes, methicillin-resistant Staphylococcus aureus (MRSA), Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli. The study revealed that the essential oil and its constituents exhibited a broad spectrum and variable degree of antibacterial activity against different strains. Among the tested strains, Streptococcus pyogenes, Escherichia coli and Streptococcus pneumoniae were the most susceptible bacterial strain showing lowest MIC and MBC values. Methicillin-resistant Staphylococcus aureus was the most resistant bacterial strain to the essential oil treatment showing relatively higher MIC and MBC values. Scanning electron microscopy revealed that the essential oil induced potent and dose-dependent membrane damage in S. pyogenes and MRSA bacterial strains. The reactive oxygen species generated by the Monarda punctata essential oil were identified using 2', 7'-dichlorofluorescein diacetate (DCFDA).This study indicated that the Monarda punctata essential oil to a great extent and thymol to a lower extent triggered a substantial increase in the ROS levels in S. pyogenes bacterial cultures which ultimately cause membrane damage as revealed by SEM results.

  5. Renovating the Main Building

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    CERN's "Main Building" is exactly that. The Organization's central hub, with hundreds of staff and visitors passing through its doors every day, will soon be getting a well-earned facelift. Refurbishment work will proceed in phases, starting with the Salle des Pas Perdus, the concourse between the Council Chamber and the Main Auditorium. By the end of August, informal seating areas will be installed, electronic display panels will provide practical information and improved sound insulation will enhance conditions in the auditoria and surrounding meeting rooms.   In light green the area that will undergo the facelift. Work will start in July. The ground floor is home to the entrance to Restaurant No. 1, the bank, the post office, the travel agent, the Users Office, the Staff Association, the notice boards etc. Step up to the first floor to access CERN's largest lecture theatre, the Council Chamber and its "Pas Perdus" lobby. Everyone who works at or visits CERN i...

  6. Maine coast winds

    Energy Technology Data Exchange (ETDEWEB)

    Avery, Richard

    2000-01-28

    The Maine Coast Winds Project was proposed for four possible turbine locations. Significant progress has been made at the prime location, with a lease-power purchase contract for ten years for the installation of turbine equipment having been obtained. Most of the site planning and permitting have been completed. It is expect that the turbine will be installed in early May. The other three locations are less suitable for the project, and new locations are being considered.

  7. Lodging Update: Portland, Maine

    Directory of Open Access Journals (Sweden)

    Rachel J. Roginsky

    2013-01-01

    Full Text Available Each quarter, Pinnacle Advisory Group prepares an analysis of the New England lodging industry, which provides a regional summary and then focuses in depth on a particular market. These reviews look at recent and proposed supply changes, factors affecting demand and growth rates, and the effects of interactions between such supply and demand trends. In this issue, the authors summarize regional performance for 2012, offer projections for 2013, and spotlight the lodging market in Portland, Maine.

  8. Children's Understanding of the Addition/Subtraction Complement Principle

    Science.gov (United States)

    Torbeyns, Joke; Peters, Greet; De Smedt, Bert; Ghesquière, Pol; Verschaffel, Lieven

    2016-01-01

    Background: In the last decades, children's understanding of mathematical principles has become an important research topic. Different from the commutativity and inversion principles, only few studies have focused on children's understanding of the addition/subtraction complement principle (if a - b = c, then c + b = a), mainly relying on verbal…

  9. Natural resistance to ascorbic acid induced oxidative stress is mainly mediated by catalase activity in human cancer cells and catalase-silencing sensitizes to oxidative stress

    Directory of Open Access Journals (Sweden)

    Klingelhoeffer Christoph

    2012-05-01

    Full Text Available Abstract Background Ascorbic acid demonstrates a cytotoxic effect by generating hydrogen peroxide, a reactive oxygen species (ROS involved in oxidative cell stress. A panel of eleven human cancer cell lines, glioblastoma and carcinoma, were exposed to serial dilutions of ascorbic acid (5-100 mmol/L. The purpose of this study was to analyse the impact of catalase, an important hydrogen peroxide-detoxifying enzyme, on the resistance of cancer cells to ascorbic acid mediated oxidative stress. Methods Effective concentration (EC50 values, which indicate the concentration of ascorbic acid that reduced the number of viable cells by 50%, were detected with the crystal violet assay. The level of intracellular catalase protein and enzyme activity was determined. Expression of catalase was silenced by catalase-specific short hairpin RNA (sh-RNA in BT-20 breast carcinoma cells. Oxidative cell stress induced apoptosis was measured by a caspase luminescent assay. Results The tested human cancer cell lines demonstrated obvious differences in their resistance to ascorbic acid mediated oxidative cell stress. Forty-five percent of the cell lines had an EC50 > 20 mmol/L and fifty-five percent had an EC50 50 of 2.6–5.5 mmol/L, glioblastoma cells were the most susceptible cancer cell lines analysed in this study. A correlation between catalase activity and the susceptibility to ascorbic acid was observed. To study the possible protective role of catalase on the resistance of cancer cells to oxidative cell stress, the expression of catalase in the breast carcinoma cell line BT-20, which cells were highly resistant to the exposure to ascorbic acid (EC50: 94,9 mmol/L, was silenced with specific sh-RNA. The effect was that catalase-silenced BT-20 cells (BT-20 KD-CAT became more susceptible to high concentrations of ascorbic acid (50 and 100 mmol/L. Conclusions Fifty-five percent of the human cancer cell lines tested were unable to protect themselves

  10. Simultaneous analysis of 11 main active components in Cirsium setosum based on HPLC-ESI-MS/MS and combined with statistical methods.

    Science.gov (United States)

    Sun, Qian; Chang, Lu; Ren, Yanping; Cao, Liang; Sun, Yingguang; Du, Yingfeng; Shi, Xiaowei; Wang, Qiao; Zhang, Lantong

    2012-11-01

    A novel method based on high-performance liquid chromatography coupled with electrospray ionization tandem mass spectrometry was developed for simultaneous determination of the 11 major active components including ten flavonoids and one phenolic acid in Cirsium setosum. Separation was performed on a reversed-phase C(18) column with gradient elution of methanol and 0.1‰ acetic acid (v/v). The identification and quantification of the analytes were achieved on a hybrid quadrupole linear ion trap mass spectrometer. Multiple-reaction monitoring scanning was employed for quantification with switching electrospray ion source polarity between positive and negative modes in a single run. Full validation of the assay was carried out including linearity, precision, accuracy, stability, limits of detection and quantification. The results demonstrated that the method developed was reliable, rapid, and specific. The 25 batches of C. setosum samples from different sources were first determined using the developed method and the total contents of 11 analytes ranged from 1717.460 to 23028.258 μg/g. Among them, the content of linarin was highest, and its mean value was 7340.967 μg/g. Principal component analysis and hierarchical clustering analysis were performed to differentiate and classify the samples, which is helpful for comprehensive evaluation of the quality of C. setosum.

  11. Main: PIIATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available PIIATGAPB S000382 23-Sep-2001 (last modified) kehi PII found in the Arabidopsis thalia...ydrogenase(GADPH) of A.T.; GAPB; glyceraldehyde-3-phosphate dehydrogenase; light-activated transcription; Arabidopsis thaliana TTGGTTTTGATCAAAACCAA ...

  12. Main: PIATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available PIATGAPB S000381 23-Aug-2001 (last modified) uchi PI found in the Arabidopsis thalia...drogenase(GADPH) of A.T.; GAPB; glyceraldehyde-3-phosphate dehydrogenase; light-activated transcription; Arabidopsis thaliana GTGATCAC ...

  13. New insight into the enhanced visible-light photocatalytic activities of B-, C- and B/C-doped anatase TiO2 by first-principles.

    Science.gov (United States)

    Yu, Jiaguo; Zhou, Peng; Li, Qin

    2013-08-07

    The geometry structures, formation energies and electronic properties of the B-, C- and B/C-doped anatase TiO2 were investigated by the density functional theory (DFT) calculations of first-principles. The results indicated that the visible-light absorption and photocatalytic activities of the B-, C- and B/C-doped anatase TiO2 were not only influenced by the energy gaps (Eg) and the distributions of impurity states, but also affected by the locations of Fermi levels (EF) and the energies of the edges of band gaps (Ev for the top of valence bands and Ec for the bottom of conduction bands). However, the above four factors changed with the doped models of TiO2. The impurity states in the band gaps reduced the maximum energy gaps in the band gaps, which is responsible for the absorption of visible light. The Fermi levels at the bottom of conduction bands indicated the existence of Ti(3+) ions, which enhanced the separation rates of photogenerated electrons and holes. Further, the energies of the edges of band gaps, determining the dominant types of oxidants (O2(-), hole, ˙OH) in the photocatalytic degradation, were discussed. Moreover, the stability of the doped TiO2 depended on its growth conditions (O-rich or Ti-rich environment). The O-rich growth condition is beneficial to the substitutional B and C atoms to Ti atoms, while the Ti-rich growth condition is favorable to the other doped TiO2 including the most stable co-doped TiO2 with the interstitial B atom and the substitutional C atom to O atom. In addition, our results also showed that the B/C-doped TiO2 inherited the partial electronic properties of single-doped TiO2, but also exhibited many new electronic properties, implying that the electronic properties of co-doped systems are not a mechanical mixture of those of both single-doped systems.

  14. THE EQUALITY PRINCIPLE REQUIREMENTS

    Directory of Open Access Journals (Sweden)

    CLAUDIA ANDRIŢOI

    2013-05-01

    Full Text Available The problem premises and the objectives followed: the idea of inserting the equality principle between the freedom and the justice principles is manifested in positive law in two stages, as a general idea of all judicial norms and as requirement of the owner of a subjective right of the applicants of an objective law. Equality in face of the law and of public authorities can not involve the idea of standardization, of uniformity, of enlisting of all citizens under the mark of the same judicial regime, regardless of their natural or socio-professional situation. Through the Beijing Platform and the position documents of the European Commission we have defined the integrative approach of equality as representing an active and visible integration of the gender perspective in all sectors and at all levels. The research methods used are: the conceptualist method, the logical method and the intuitive method necessary as means of reasoning in order to argue our demonstration. We have to underline the fact that the system analysis of the research methods of the judicial phenomenon doesn’t agree with “value ranking”, because one value cannot be generalized in rapport to another. At the same time, we must fight against a methodological extremism. The final purpose of this study is represented by the reaching of the perfecting/excellence stage by all individuals through the promotion of equality and freedom. This supposes the fact that the existence of a non-discrimination favourable frame (fairness represents a means and a condition of self-determination, and the state of perfection/excellency is a result of this self-determination, the condition necessary for the obtaining of this nondiscrimination frame for all of us and in conditions of freedom for all individuals, represents the same condition that promotes the state of perfection/excellency. In conclusion we may state the fact that the equality principle represents a true catalyst of the

  15. Principles of rock mechanics

    Energy Technology Data Exchange (ETDEWEB)

    Turchaninov, I.A.; Iofis, M.A.; Kasparyan, E.V.

    1979-01-01

    This book presents the principles of rock mechanics in a systematic way, reflecting both the historic development and the contemporary status of theoretical and experimental techniques used for the determination of the properties and stress state of rock masses, calculation of elements of systems for exploitation of useful mineral deposits and the design of mine openings. The subject of rock mechanics is discussed and methods and basic approaches are analyzed. The most widely used methods for determining the properties of rock in specimens and in situ are described. Problems of determining the stress strain state of the rock around mine openings by both experimental and analytic methods are discussed. The primary results of the study of the stress state of rock around main, development and production openings are presented. Problems of the movement of rock due to extraction of minerals are analyzed in detail, as are the conditions and causes of the development of rock bursts and sudden release of rock and gas in both surface and underground mines. Procedures for preventing or localizing rock bursts or sudden outbursts are described. (313 refs.)

  16. Biomechanics principles and practices

    CERN Document Server

    Peterson, Donald R

    2014-01-01

    Presents Current Principles and ApplicationsBiomedical engineering is considered to be the most expansive of all the engineering sciences. Its function involves the direct combination of core engineering sciences as well as knowledge of nonengineering disciplines such as biology and medicine. Drawing on material from the biomechanics section of The Biomedical Engineering Handbook, Fourth Edition and utilizing the expert knowledge of respected published scientists in the application and research of biomechanics, Biomechanics: Principles and Practices discusses the latest principles and applicat

  17. Heisenberg's uncertainty principle

    OpenAIRE

    Busch, Paul; Heinonen, Teiko; Lahti, Pekka

    2007-01-01

    Heisenberg's uncertainty principle is usually taken to express a limitation of operational possibilities imposed by quantum mechanics. Here we demonstrate that the full content of this principle also includes its positive role as a condition ensuring that mutually exclusive experimental options can be reconciled if an appropriate trade-off is accepted. The uncertainty principle is shown to appear in three manifestations, in the form of uncertainty relations: for the widths of the position and...

  18. Regulatory framework in assisted reproductive technologies, relevance and main issues.

    Directory of Open Access Journals (Sweden)

    Françoise Merlet

    2010-01-01

    Full Text Available Assisted reproductive technologies (ART have changed life for the past 25 years and many ethical and social issues have emerged following this new method of conception. In order to protect individuals against scientific and ethical abuses without inhibiting scientific progress, a specific legal framework is necessary. The first French law on Bioethics was voted after an extensive debate in 1994 then reviewed in 2004. This review previously scheduled every five years is currently being discussed. Legal provisions applying to ART are part of a large framework including the protection of the patients' rights and biomedical research. The key principles consist of respect for human life and ban on commercial practices of human body parts, eugenic practices and any kind of cloning. These key principles apply to ART. Donation is anonymous and free. Created in 2004, the Agence de la biomĂŠdecine is a government agency and one of the main tools of the French regulations. The missions focus on improving the quality and the safety of the management of ART. Evaluation of activities is available to all from the annual report. The agency represents the French competent authority for medical and scientific aspects of ART. Substantial differences in European legislations exist from the open-up "laissez faire" to the most restrictive one. As a consequence a large reproductive tourism has developed particularly for egg donation or surrogacy. The medical and ethical conditions of management of patients and donors represent the main critical points. In order to avoid ethical abuses, homogenization regarding the key principles is necessary in Europe. It is an opportunity to reassert that human body parts should not be a source of financial gain.

  19. Regulatory framework in assisted reproductive technologies, relevance and main issues.

    Science.gov (United States)

    Merlet, Françoise

    2009-01-01

    Assisted reproductive technologies (ART) have changed life for the past 25 years and many ethical and social issues have emerged following this new method of conception. In order to protect individuals against scientific and ethical abuses without inhibiting scientific progress, a specific legal framework is necessary. The first French law on Bioethics was voted after an extensive debate in 1994 then reviewed in 2004. This review previously scheduled every five years is currently being discussed. Legal provisions applying to ART are part of a large framework including the protection of the patients' rights and biomedical research. The key principles consist of respect for human life and ban on commercial practices of human body parts, eugenic practices and any kind of cloning. These key principles apply to ART. Donation is anonymous and free. Created in 2004, the Agence de la biomédecine is a government agency and one of the main tools of the French regulations. The missions focus on improving the quality and the safety of the management of ART. Evaluation of activities is available to all from the annual report. The agency represents the French competent authority for medical and scientific aspects of ART. Substantial differences in European legislations exist from the open-up "laissez faire" to the most restrictive one. As a consequence a large reproductive tourism has developed particularly for egg donation or surrogacy. The medical and ethical conditions of management of patients and donors represent the main critical points. In order to avoid ethical abuses, homogenization regarding the key principles is necessary in Europe. It is an opportunity to reassert that human body parts should not be a source of financial gain.

  20. Main: CPRFPCCHS [PLACE

    Lifescience Database Archive (English)

    Full Text Available CPRFPCCHS S000313 8-February-2006 (last modified) kehi BoxII; Binding site of CPRF-...1, -2, -3 and -4(Common Plant Regulatory Factor) in the parsley (P.c.) light responsive chalcone synthase (CHS) gene promoter; CPRF... proteins are bZIP class transcription factors; CPRF proteins participates in the lig...ht-mediated activation of the CHS gene in parsley; ACE; The proline-rich domains of CPRF...1 and 4 activate transcription; CPRF1-containing bZIP heterodimer interacts with ACE in vivo; BoxII; CPRF

  1. Milk fever control principles: a review

    DEFF Research Database (Denmark)

    Thilsing-Hansen, T; Jørgensen, R J; Østergaard, S

    2002-01-01

    Three main preventive principles against milk fever were evaluated in this literature review, and the efficacy of each principle was estimated from the results of controlled investigations. Oral calcium drenching around calving apparently has a mean efficacy of 50%-60% in terms of milk fever...... prevention as well as prevention of milk fever relapse after intravenous treatment with calcium solutions. However, some drenches have been shown to cause lesions in the forestomacs. When using the DCAD (dietary cation-anion difference) principle, feeding rations with a negative DCAD (measured as (Na + K......)-(Cl + S)) significantly reduce the milk fever incidence. Calculating the relative risk (RR) of developing milk fever from controlled experiments results in a mean RR between 0.19 and 0.35 when rations with a negative versus positive DCAD are compared. The main drawback from the DCAD principle...

  2. Database principles programming performance

    CERN Document Server

    O'Neil, Patrick

    2014-01-01

    Database: Principles Programming Performance provides an introduction to the fundamental principles of database systems. This book focuses on database programming and the relationships between principles, programming, and performance.Organized into 10 chapters, this book begins with an overview of database design principles and presents a comprehensive introduction to the concepts used by a DBA. This text then provides grounding in many abstract concepts of the relational model. Other chapters introduce SQL, describing its capabilities and covering the statements and functions of the programmi

  3. Main: CCTCGTGTCTCGMGH3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ent in Soybean (G.m.) GH3 gene promoter; Showed constitutive activity with TGTCTC element (See S000270); Con...CCTCGTGTCTCGMGH3 S000369 16-Feb-2001 (last modified) seki Sequence found in D1 elem...fers auxin inducibility; Binding site of nuclear protein; See also S000368; D1; D4; GH3; Auxin; Soybean (Glycine max) CCTCGTGTCTC ...

  4. Main: TBOXATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available TBOXATGAPB S000383 23-Aug-2001 (last modified) uchi Tbox found in the Arabidopsis thaliana (A.T.) GAPB...ions in the Tbox resulted in reductions of light-activated gene transcription; GAPB encodes the B subunit of... chloroplast glyceraldehyde-3-phosphate dehydrogenase(GADPH) of A.T.; GAPB; glyce

  5. Main: RBENTGA3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available RBENTGA3 S000358 16-Feb-2001 (last modified) seki rbe (RSG binding element) found in the tobacco (N.t.) GA3...scriptional activator; RSG regulates the morphology of plants by controlling the endogenous amounts of GAs; RSG; rbe; rbeGA3...; bZIP; GA3; gibberellin; leaf; shoot; tobacco (Nicotiana tabacum) TCCAACTTGGA ...

  6. Main: QELEMENTZMZM13 [PLACE

    Lifescience Database Archive (English)

    Full Text Available maize (Z.m.) ZM13 gene promoter; Found at -107 to -102; Involved in expression enhancing activity; ZM13 is a... maize homolog of tomato LAT52 gene; ZM13 is a pollen-specific maize gene; enhancing; ZM13; LAT52; pollen; maize (Zea mays) AGGTCA ...

  7. Main: CANBNNAPA [PLACE

    Lifescience Database Archive (English)

    Full Text Available CANBNNAPA S000148 10-May-1998 (last modified) kehi Core of (CA)n element in storage...in) gene, napA; seed specificity; activator and repressor; (CA)n element; napA; napin; seed; storage protein; Brassica napus; CNAACAC ...

  8. Main: AMMORESIIUDCRNIA1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available AMMORESIIUDCRNIA1 S000374 31-Jul-2001 (last modified) uchi Motifs (IIU and IID) fou...nd in the Chlamydomonas (C.R.) Nia1 gene promoter; Involved in ammonium-response; Located between -231 and -...219 and also between -76 and -65; Involved in Nia1 transcription activation; W=T/A; nitrate reductase; ammonium response; Chlamydomonas reinhardtii GGWAGGGT ...

  9. Main: AMMORESVDCRNIA1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available AMMORESVDCRNIA1 S000376 31-Jul-2001 (last modified) uchi Motif (VD) found in the Ch...lamydomonas (C.R.) Nia1 gene promoter; Located between -33 and -8; Involved in Nia1 transcription activation; nitrate reductase; amm

  10. Main: PROXBBNNAPA [PLACE

    Lifescience Database Archive (English)

    Full Text Available PROXBBNNAPA S000263 16-Feb-2001 (last modified) seki prox B (proximal portion of B-...ent and ABA-dependent activation through the dist B ABRE; ABRE; ABA; prox B; B-box; seed; napA; napin; Brassica napus CAAACACC ...

  11. Main Oxidizer Valve Design

    Science.gov (United States)

    Addona, Brad; Eddleman, David

    2015-01-01

    A developmental Main Oxidizer Valve (MOV) was designed by NASA-MSFC using additive manufacturing processes. The MOV is a pneumatically actuated poppet valve to control the flow of liquid oxygen to an engine's injector. A compression spring is used to return the valve to the closed state when pneumatic pressure is removed from the valve. The valve internal parts are cylindrical in shape, which lends itself to traditional lathe and milling operations. However, the valve body represents a complicated shape and contains the majority of the mass of the valve. Additive manufacturing techniques were used to produce a part that optimized mass and allowed for design features not practical with traditional machining processes.

  12. Abstracts of Main Essays

    Institute of Scientific and Technical Information of China (English)

    Feng Zi-yi

    2011-01-01

    On Deepening the Research on the Law of the Social Horizontal Development Feng Zi-yi The further development of globalization makes it urgent to deepen the research on the law of social hori- zontal development. Historical development of human society has experienced periods of isolation, multi-cen- ter, and globalization, while the truly horizontal development began from modernity. This kind of development is driven mainly by the logic of capital. The transforming process of capital, from dominating the whole process of economic development toward all aspects of social life, and from dominating nations toward the whole world, is also the logical process of capital pursuing itself and the process of social horizontal and wholly development as well. Horizontal and vertical developments of the society are interacting always. Researching on the law of social horizontal development is important for us to adapt to the historical trend consciously, to grasp the logic of capital rationally and to choose the right road of development.

  13. Applying the prudence principle in non-profit organizations and financial institutions

    Directory of Open Access Journals (Sweden)

    Milena Otavová

    2011-01-01

    Full Text Available The paper describes in detail the accounting principle of prudence in non-profit organizations and financial institutions. It defines its application in such organizations and based on comparison it evaluates the practical use of the prudence principle and its reflection in the accounting books. The main focus is on differences in applying the prudence principle that result from differences in the purpose activities and methods of asset management in these organizations. The practical application of the prudence principle in accounting consists mainly in the creation and use of provisions and impairments. These methods are defined by the Implementing Regulation to the Accounting Act No. 563/1991. The paper also provides tables where the creation and use of impairments and provisions in the above-mentioned organizations is compared with how business companies proceed in creating impairments and provisions. The key legislation standardizing accounting in the Czech Republic is the Accounting Act No. 563/1991, as amended, which stipulates the general accounting principles, the so-called accounting philosophy. The accounting is built around the general accounting principles, which are perceived as the pillars of accounting. Even though they are not stipulated in any particular law, they are legally enforceable and their ignorance can be sanctioned. The general accounting principles represent a set of rules to be observed in keeping the accounting books, preparing the accounting reports and submitting the accounting reports to users. The keystone accounting principle is the principle of true and fair refl ection of facts the essential goal of which is to report in the fi nancial statement actual assets and the fi nancial position of the accounting unit with an essential focus on reporting events that occurred during the accounting period with respect to their content.

  14. Nonlinear optics principles and applications

    CERN Document Server

    Li, Chunfei

    2017-01-01

    This book reflects the latest advances in nonlinear optics. Besides the simple, strict mathematical deduction, it also discusses the experimental verification and possible future applications, such as the all-optical switches. It consistently uses the practical unit system throughout. It employs simple physical images, such as "light waves" and "photons" to systematically explain the main principles of nonlinear optical effects. It uses the first-order nonlinear wave equation in frequency domain under the condition of “slowly varying amplitude approximation" and the classical model of the interaction between the light and electric dipole. At the same time, it also uses the rate equations based on the energy-level transition of particle systems excited by photons and the energy and momentum conservation principles to explain the nonlinear optical phenomenon. The book is intended for researchers, engineers and graduate students in the field of the optics, optoelectronics, fiber communication, information tech...

  15. [Genetics and the precautionary principle].

    Science.gov (United States)

    Rosa, J

    2000-01-01

    It is very important to follow the Precautionary Principles with regard to genetics because of its fast development and of its impact in the public imaginer. In that regard gene grafts, OGM or recombinant drugs are pre-eminently be suspected to transmit human or animal viruses and/or to induce severe allergies. Pharmaceutical Industry has conducted large reflexions on such problems and are using drastic rules to prevent them. By contrast, academic research laboratories are handicapped by the problem of fund seeking. At the genetic disease level and mainly because the fast development of Predictive Medicine, patient and family councelling requires a great lot of reflexion and carefulness. Memorization of the presence of abnormal genes in the history of families also constitutes an important problem. We believe that, to be in accordance with the Precautionary Principles, an important work of formation and information is required.

  16. Main: PALBOXAPC [PLACE

    Lifescience Database Archive (English)

    Full Text Available ee putative cis-acting elements (boxes P, A, and L) of phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) genes in pa...995); See also S000136 (Box P), S000138 (Box L); Box A; PAL; parsley (Petroselinum crispum) CCGTCC ... ...PALBOXAPC S000137 06-January-2006 (last modified) kehi Box A; Consensus; One of thr... to be necessary but not sufficient for elicitor- or light-mediated PAL gene activation. (Logemann et al., 1

  17. Main: AGCBOXNPGLB [PLACE

    Lifescience Database Archive (English)

    Full Text Available AGCBOXNPGLB S000232 02-August-2006 (last modified) kehi AGC box repeated twice in a... 61 bp enhancer element in tobacco (N.p.) class I beta-1,3-glucanase (GLB) gene; See S000036, S000089; GCC-b... EREBP1, which enhance DNA-binding activity of the factor to the GCC box; AGC box; GLB; ERE; ERFs; Ethylene;

  18. Main: CCAATBOX1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available 5'-non-coding regions of eukaryotic genes; CCAAT box found in the promoter of heat shock protein genes; Loca...CCAATBOX1 S000030 04-January-2007 (last modified) kehi Common sequence found in the...ted immediately upstream from the most distal HSE of the promoter; CCAAT box act cooperatively with HSEs to... increase the hs promoter activity; HSE (Heat shock element); CCAAT box; eukaryotes; Glycine max (Soybean) CCAAT ...

  19. Implementation of Supply Chain Management (SCM in pharmaceutical company, general principles and case study

    Directory of Open Access Journals (Sweden)

    Zoran Nakov

    2014-12-01

    Full Text Available Supply Chain Management (SCM in pharmaceutical industry is defined as a “responsible SCM” and its implementation is according to the principles of: business ethics, rights of labor and principles of healthy and safe working environment. Pharmaceutical companies with implemented “responsible SCM” have to use management systems to facilitate continuous improvement in accordance with their working principles. The main purpose of this management system is to ensure the consistency, reliability and continuous improvement of all workflows within an organization.The analyzed case describes the project of European generic pharmaceutical company, which intends to implement best practice SCM operations for five European manufacturing sites and European logistics organizations (active ingredients supply, distribution centers, affiliate customers and third party manufacturers. The main objectives of the project were the creation of the future improved To-Be situation through implementation of new SCM models to the existing To-Day situation.

  20. Principles of snow hydrology

    National Research Council Canada - National Science Library

    DeWalle, David R; Rango, Albert

    2008-01-01

    ... Hydrology describes the factors that control the accumulation, melting, and runoff of water from seasonal snowpacks over the surface of the earth. The book addresses not only the basic principles governing snow in the hydrologic cycle, but also the latest applications of remote sensing, and principles applicable to modelling streamflow from snowmelt across lar...

  1. Great Principles of Computing

    OpenAIRE

    Denning, Peter J.

    2008-01-01

    The Great Principles of Computing is a framework for understanding computing as a field of science. The website ...April 2008 (Rev. 8/31/08) The Great Principles of Computing is a framework for understanding computing as a field of science.

  2. Basic principle of superconductivity

    OpenAIRE

    De Cao, Tian

    2007-01-01

    The basic principle of superconductivity is suggested in this paper. There have been two vital wrong suggestions on the basic principle, one is the relation between superconductivity and the Bose-Einstein condensation (BEC), and another is the relation between superconductivity and pseudogap.

  3. [The precaution principle and blood transfusion].

    Science.gov (United States)

    Sicard, D

    2000-06-01

    Because of the HIV and HCV virus transmission by transfusion during the eighties, there has been a retrospective reflection about the non-application of the precautionary principle, which has appeared only recently in the medical world. Since it was difficult to identify the real cause of the above-cited transmission in France, mainly because of the bad selection of blood donors, we feel we are justified in applying this precautionary principle more and more, in a monopolistic way, for biological security reasons. As a result, the biological research is not limited to looking for a 'degree zero' risk. Whether it concerns the 'PCR', the research of a new potential virus, the excessive fear regarding the transfusion of the new ESB agent, the worry caused by the blood donors who lived in the British Isles, the need for security based upon the precautionary principle is increasing endlessly. It is, however, more reasonable to consider that the precautionary principle should be essence incite a multi-disciplinary reflection involving biological sciences as well as social sciences. The precautionary principle would not make sense if it were not questioned for bad estimations, its harmful influences or its opportunistic use. Transfusion security, which is so important as a goal and as a principle, cannot appeal to the precautionary principle all the time, since the excessive use of this principle would lead to the paradox of not being able to identify the issues anymore.

  4. Classroom Demonstrations of Social Psychological Principles

    Science.gov (United States)

    Singleton, Royce Jr.

    1978-01-01

    Describes eight classroom activities which instruct college level sociology students about major concepts and principles of social psychology. Concepts include gestalt psychology, nonverbal communication, adaptation level, relative deprivation, selective exposure, labeling, sexism, and perceptual distortion. (Author/DB)

  5. Principles of European Company Law

    DEFF Research Database (Denmark)

    Werlauff, Erik

    2010-01-01

    The article focuses on how much we have in common in Europe within company law and its development, and on the principles which are the determining factors for the activities of European companies. The article shows that what we have in common greatly outweighs what divides us, and this is presen......The article focuses on how much we have in common in Europe within company law and its development, and on the principles which are the determining factors for the activities of European companies. The article shows that what we have in common greatly outweighs what divides us......, and this is presented in the article as the provisional capstone of 400 years of joint European development of company law....

  6. Main: EREGCC [PLACE

    Lifescience Database Archive (English)

    Full Text Available EREGCC S000036 03-Jun-2003 (last modified) kehi GCC box in ERE (ethylene responsive... element); Ethylene-responsive region of tobacco (N.t.) chitinase gene contains two copies of the GCC-box; E...RF2 and ERF4 enhanced the GCC box-mediated transcription; ERF3 reduced the transcription of the reporter gen...ich belong to the ERF family activate the expression of GCC box-containing PR genes; ERF3 was found to inter...act with NtUBC2, a ubiquitin-conjugating enzyme; Ethylene; EREBP; GCC box; G-box; CHN; ERE; ERF; xylanase; T

  7. Main: PREATPRODH [PLACE

    Lifescience Database Archive (English)

    Full Text Available PREATPRODH S000450 04-August-2006 (last modified) kehi PRE (Pro- or hypoosmolarity-...responsive element) found in the promoter region of proline dehydrogenase (ProDH) gene in Arabidopsis; Core ...of 9-bp sequence ACTCATCCT which is necessary for the efficient expression of ProDH in response to L-Pro and... hypoosmolarity (Satoh et al., 2002); ATB2-binding site; Similar to GCN4 motif (A...TGA(C/G)TCAT); ATB2 subgroup of bZIP transcription factors function as transcriptional activator for hypoosmolarity-inducible Pro

  8. Dynamic sealing principles

    Science.gov (United States)

    Zuk, J.

    1976-01-01

    The fundamental principles governing dynamic sealing operation are discussed. Different seals are described in terms of these principles. Despite the large variety of detailed construction, there appear to be some basic principles, or combinations of basic principles, by which all seals function, these are presented and discussed. Theoretical and practical considerations in the application of these principles are discussed. Advantages, disadvantages, limitations, and application examples of various conventional and special seals are presented. Fundamental equations governing liquid and gas flows in thin film seals, which enable leakage calculations to be made, are also presented. Concept of flow functions, application of Reynolds lubrication equation, and nonlubrication equation flow, friction and wear; and seal lubrication regimes are explained.

  9. Variational principles in physics

    CERN Document Server

    Basdevant, Jean-Louis

    2007-01-01

    Optimization under constraints is an essential part of everyday life. Indeed, we routinely solve problems by striking a balance between contradictory interests, individual desires and material contingencies. This notion of equilibrium was dear to thinkers of the enlightenment, as illustrated by Montesquieu’s famous formulation: "In all magistracies, the greatness of the power must be compensated by the brevity of the duration." Astonishingly, natural laws are guided by a similar principle. Variational principles have proven to be surprisingly fertile. For example, Fermat used variational methods to demonstrate that light follows the fastest route from one point to another, an idea which came to be known as Fermat’s principle, a cornerstone of geometrical optics. Variational Principles in Physics explains variational principles and charts their use throughout modern physics. The heart of the book is devoted to the analytical mechanics of Lagrange and Hamilton, the basic tools of any physicist. Prof. Basdev...

  10. Equivalence principles exotica

    Institute of Scientific and Technical Information of China (English)

    C.S. UNNIKRISHNAN; George T. GILLIES

    2008-01-01

    This is a short review of the different prin-ciples of equivalence stated and used in the context of the gravitational interaction. We emphasize the need for precision in stating and differentiating these different equivalence principles, especially in the context of preva-lent confusion regarding the applicability of the weak equivalence principle in quantum mechanics. We discuss several empirical results pertaining to the validity of the equivalence principle in exotic physical sitautions not di-rectly amenable to experimental tests. We conclude with a section on the physical basis of the universal validity of the equivalence principle, as manifest in the universality of free fall, and discuss its link to cosmic gravity.

  11. 老年人在城市体育公园中的活动类型及设计原则%Design Principles and Types of Activities of Elderly in City Sports Park

    Institute of Scientific and Technical Information of China (English)

    孙小茜; 周萌

    2014-01-01

    Through the analysis on the activity types of the elderly in the city sports park, the author deeply discusses the design principle of the city sports park, aiming at creating a more comfortable, healthy, safe recreational activity space for the aged.%本文通过对城市体育公园中老年人活动类型的分析,深入探讨了城市体育公园的设计原则,旨在为老年人营造一个更加舒适、健康、安全的娱乐活动空间。

  12. Geolocation Techniques Principles and Applications

    CERN Document Server

    Gentile, Camillo; Raulefs, Ronald; Teolis, Carole

    2013-01-01

    Geolocation Techniques: Principles and Applications provides a comprehensive overview of geolocation technologies and techniques, from radio-frequency based to inertial based. The focus of this book is to provide an overview on the different types of infra-structure supported by most commercial localization systems as well as on the most popular computational techniques which these systems employ. This book can serve as a reference for scholarly activities such as teaching, self-learning, or research.

  13. Principles of dynamics

    CERN Document Server

    Hill, Rodney

    2013-01-01

    Principles of Dynamics presents classical dynamics primarily as an exemplar of scientific theory and method. This book is divided into three major parts concerned with gravitational theory of planetary systems; general principles of the foundations of mechanics; and general motion of a rigid body. Some of the specific topics covered are Keplerian Laws of Planetary Motion; gravitational potential and potential energy; and fields of axisymmetric bodies. The principles of work and energy, fictitious body-forces, and inertial mass are also looked into. Other specific topics examined are kinematics

  14. Biomedical engineering principles

    CERN Document Server

    Ritter, Arthur B; Valdevit, Antonio; Ascione, Alfred N

    2011-01-01

    Introduction: Modeling of Physiological ProcessesCell Physiology and TransportPrinciples and Biomedical Applications of HemodynamicsA Systems Approach to PhysiologyThe Cardiovascular SystemBiomedical Signal ProcessingSignal Acquisition and ProcessingTechniques for Physiological Signal ProcessingExamples of Physiological Signal ProcessingPrinciples of BiomechanicsPractical Applications of BiomechanicsBiomaterialsPrinciples of Biomedical Capstone DesignUnmet Clinical NeedsEntrepreneurship: Reasons why Most Good Designs Never Get to MarketAn Engineering Solution in Search of a Biomedical Problem

  15. Modern electronic maintenance principles

    CERN Document Server

    Garland, DJ

    2013-01-01

    Modern Electronic Maintenance Principles reviews the principles of maintaining modern, complex electronic equipment, with emphasis on preventive and corrective maintenance. Unfamiliar subjects such as the half-split method of fault location, functional diagrams, and fault finding guides are explained. This book consists of 12 chapters and begins by stressing the need for maintenance principles and discussing the problem of complexity as well as the requirements for a maintenance technician. The next chapter deals with the connection between reliability and maintenance and defines the terms fai

  16. Developing principles of growth

    DEFF Research Database (Denmark)

    Neergaard, Helle; Fleck, Emma

    of the principles of growth among women-owned firms. Using an in-depth case study methodology, data was collected from women-owned firms in Denmark and Ireland, as these countries are similar in contextual terms, e.g. population and business composition, dominated by micro, small and medium-sized enterprises....... Extending on principles put forward in effectuation theory, we propose that women grow their firms according to five principles which enable women’s enterprises to survive in the face of crises such as the current financial world crisis....

  17. Coexisting principles and logics of elder care

    DEFF Research Database (Denmark)

    Dahl, Hanne Marlene; Eskelinen, Leena; Boll Hansen, Eigil

    2015-01-01

    Healthy and active ageing has become an ideal in Western societies. In the Nordic countries, this ideal has been supported through a policy of help to self-help in elder care since the 1980s. However, reforms inspired by New Public Management (NPM) have introduced a new policy principle of consumer......-oriented service that stresses the wishes and priorities of older people. We have studied how these two principles are applied by care workers in Denmark. Is one principle or logic replacing the other, or do they coexist? Do they create tensions between professional knowledge and the autonomy of older people......? Using neo-institutional theory and feminist care theory, we analysed the articulation of the two policy principles in interviews and their logics in observations in four local authorities. We conclude that help to self-help is the dominant principle, that it is deeply entrenched in the identity...

  18. Principles of Practical Training Organization in a Networking (Development of the Module "Psychological Prevention of Behavioral Disorders and Abnormalities in Development" as Example

    Directory of Open Access Journals (Sweden)

    Bogdanovich N. V.

    2016-01-01

    Full Text Available The article presents principles of inserting study subjects and practices in educational modules running with network organizations (internship sites. We proposed a methodological basis of the modular organization of educational process in the framework of the master's program, combied the activity, competence and psychotechnical approaches. Networking of leading chair and specially selected organizations providing the base for practical training solves the problem of organizing activity-related content of educational module. We discussed the main options for networking with the databases of practice and offered methodological principles of designing the educational practice-oriented module, wherein the main principle is the reflexive and activity character of networking. We proposed activity-based content of educational module "Psychological prevention of behavioral disorders and abnormalities in development", based on the substantial psychological definition of psychoprophylaxis as a directions of professional activity of the psychologist.

  19. Bateman's principle and immunity

    National Research Council Canada - National Science Library

    Jens Rolff

    2002-01-01

    .... This alternative is based on Bateman's principle, that males gain fitness by increasing their mating success whilst females increase fitness through longevity because their reproductive effort is much higher...

  20. The Symmetry Principle

    Directory of Open Access Journals (Sweden)

    Joe Rosen

    2005-12-01

    Full Text Available Abstract: The symmetry principle is described in this paper. The full details are given in the book: J. Rosen, Symmetry in Science: An Introduction to the General Theory (Springer-Verlag, New York, 1995.

  1. Archimedes' Principle in Action

    Science.gov (United States)

    Kires, Marian

    2007-01-01

    The conceptual understanding of Archimedes' principle can be verified in experimental procedures which determine mass and density using a floating object. This is demonstrated by simple experiments using graduated beakers. (Contains 5 figures.)

  2. Principles of nanomagnetism

    CERN Document Server

    Guimarães, Alberto P

    2017-01-01

    This is the first monograph on nanomagnetism. It emphasizes general principles and mechanisms relevant to the understanding of the intriguing properties of nanomagnetic objects including thin films, nanoparticles, nanowires, nanodisks and nanorings.

  3. Archimedes' Principle in Action

    Science.gov (United States)

    Kires, Marian

    2007-01-01

    The conceptual understanding of Archimedes' principle can be verified in experimental procedures which determine mass and density using a floating object. This is demonstrated by simple experiments using graduated beakers. (Contains 5 figures.)

  4. Principles Scientifiques, Principes Philosophiques

    Directory of Open Access Journals (Sweden)

    Gilles-Gaston Granger

    1999-06-01

    Full Text Available A principle is a starting point of departure as well as a rule. In science principles are either alleged evident rules or generalizations of already accepted laws, or formal determinations for objects in a given domain. Thus two problems arise: first, does their nature have a conventional character? and sencond, what kind of truth is to be assigned to them. In philosophy principles are taken as a method of thinking as well as fundamental experiences. Even though they are points of departure, their true meaning is known only after a philosophical job is done. Thus, paradoxically enough, we can say that in both science and philosophy a principle is at the same time in the begining and in the end.

  5. Heisenberg's observability principle

    OpenAIRE

    Wolff, JE

    2014-01-01

    Werner Heisenberg's 1925 paper ‘Quantum-theoretical re-interpretation of kinematic and mechanical relations’ marks the beginning of quantum mechanics. Heisenberg famously claims that the paper is based on the idea that the new quantum mechanics should be ‘founded exclusively upon relationships between quantities which in principle are observable’. My paper is an attempt to understand this observability principle, and to see whether its employment is philosophically defensible. Against interpr...

  6. Electrical and electronic principles

    CERN Document Server

    Knight, S A

    1991-01-01

    Electrical and Electronic Principles, 2, Second Edition covers the syllabus requirements of BTEC Unit U86/329, including the principles of control systems and elements of data transmission. The book first tackles series and parallel circuits, electrical networks, and capacitors and capacitance. Discussions focus on flux density, electric force, permittivity, Kirchhoff's laws, superposition theorem, arrangement of resistors, internal resistance, and powers in a circuit. The text then takes a look at capacitors in circuit, magnetism and magnetization, electromagnetic induction, and alternating v

  7. Electrical and electronic principles

    CERN Document Server

    Knight, SA

    1988-01-01

    Electrical and Electronic Principles, 3 focuses on the principles involved in electrical and electronic circuits, including impedance, inductance, capacitance, and resistance.The book first deals with circuit elements and theorems, D.C. transients, and the series circuits of alternating current. Discussions focus on inductance and resistance in series, resistance and capacitance in series, power factor, impedance, circuit magnification, equation of charge, discharge of a capacitor, transfer of power, and decibels and attenuation. The manuscript then examines the parallel circuits of alternatin

  8. Ternary optical computer principle

    Institute of Scientific and Technical Information of China (English)

    金翊; 何华灿; 吕养天

    2003-01-01

    The fundamental principle and the characteristics of ternary optical computer, using horizontal polarized light, vertical polarized light and no-intensity to express information, are propounded in thispaper. The practicability to make key parts of the ternary optical computer from modern micro or integrated optical devices, opto-electronic and electro-photonic elements is discussed. The principle can be applied in three-state optical fiber communication via horizontal and vertical polarized light.

  9. PRINCIPLES OF ANIMAL BREEDING

    OpenAIRE

    2014-01-01

    University textbook Principles of Animal Breeding is intended for students of agriculture and veterinary medicine. The material is the adapted curricula of undergraduate and graduate level studies in the framework of which the modules Principles of animal breeding as well as Basics of genetics and selection of animals attended are listened. The textbook contains 14 chapters and a glossary of terms. Its concept enables combining fundamental and modern knowledge in the ...

  10. Microwave system engineering principles

    CERN Document Server

    Raff, Samuel J

    1977-01-01

    Microwave System Engineering Principles focuses on the calculus, differential equations, and transforms of microwave systems. This book discusses the basic nature and principles that can be derived from thermal noise; statistical concepts and binomial distribution; incoherent signal processing; basic properties of antennas; and beam widths and useful approximations. The fundamentals of propagation; LaPlace's Equation and Transmission Line (TEM) waves; interfaces between homogeneous media; modulation, bandwidth, and noise; and communications satellites are also deliberated in this text. This bo

  11. Microprocessors principles and applications

    CERN Document Server

    Debenham, Michael J

    1979-01-01

    Microprocessors: Principles and Applications deals with the principles and applications of microprocessors and covers topics ranging from computer architecture and programmed machines to microprocessor programming, support systems and software, and system design. A number of microprocessor applications are considered, including data processing, process control, and telephone switching. This book is comprised of 10 chapters and begins with a historical overview of computers and computing, followed by a discussion on computer architecture and programmed machines, paying particular attention to t

  12. COMPARATIVE STUDY ON MAIN SOLVENCY ASSESSMENT MODELS FOR INSURANCE FIELD

    Directory of Open Access Journals (Sweden)

    Daniela Nicoleta SAHLIAN

    2015-07-01

    Full Text Available During the recent financial crisis of insurance domain, there were imposed new aspects that have to be taken into account concerning the risks management and surveillance activity. The insurance societies could develop internal models in order to determine the minimum capital requirement imposed by the new regulations that are to be adopted on 1 January 2016. In this respect, the purpose of this research paper is to offer a real presentation and comparing with the main solvency regulation systems used worldwide, the accent being on their common characteristics and current tendencies. Thereby, we would like to offer a better understanding of the similarities and differences between the existent solvency regimes in order to develop the best regime of solvency for Romania within the Solvency II project. The study will show that there are clear differences between the existent Solvency I regime and the new approaches based on risk and will also point out the fact that even the key principles supporting the new solvency regimes are convergent, there are a lot of approaches for the application of these principles. In this context, the question we would try to find the answer is "how could the global solvency models be useful for the financial surveillance authority of Romania for the implementation of general model and for the development of internal solvency models according to the requirements of Solvency II" and "which would be the requirements for the implementation of this type of approach?". This thing makes the analysis of solvency models an interesting exercise.

  13. Generalized uncertainty principles

    CERN Document Server

    Machluf, Ronny

    2008-01-01

    The phenomenon in the essence of classical uncertainty principles is well known since the thirties of the last century. We introduce a new phenomenon which is in the essence of a new notion that we introduce: "Generalized Uncertainty Principles". We show the relation between classical uncertainty principles and generalized uncertainty principles. We generalized "Landau-Pollak-Slepian" uncertainty principle. Our generalization relates the following two quantities and two scaling parameters: 1) The weighted time spreading $\\int_{-\\infty}^\\infty |f(x)|^2w_1(x)dx$, ($w_1(x)$ is a non-negative function). 2) The weighted frequency spreading $\\int_{-\\infty}^\\infty |\\hat{f}(\\omega)|^2w_2(\\omega)d\\omega$. 3) The time weight scale $a$, ${w_1}_a(x)=w_1(xa^{-1})$ and 4) The frequency weight scale $b$, ${w_2}_b(\\omega)=w_2(\\omega b^{-1})$. "Generalized Uncertainty Principle" is an inequality that summarizes the constraints on the relations between the two spreading quantities and two scaling parameters. For any two reason...

  14. Principles for system level electrochemistry

    Science.gov (United States)

    Thaller, L. H.

    1986-01-01

    The higher power and higher voltage levels anticipated for future space missions have required a careful review of the techniques currently in use to preclude battery problems that are related to the dispersion characteristics of the individual cells. Not only are the out-of-balance problems accentuated in these larger systems, but the thermal management considerations also require a greater degree of accurate design. Newer concepts which employ active cooling techniques are being developed which permit higher rates of discharge and tighter packing densities for the electrochemical components. This paper will put forward six semi-independent principles relating to battery systems. These principles will progressively address cell, battery and finally system related aspects of large electrochemical storage systems.

  15. A Revisit to Probability - Possibility Consistency Principles

    Directory of Open Access Journals (Sweden)

    Mamoni Dhar

    2013-03-01

    Full Text Available In this article, our main intention is to highlight the fact that the probable links between probability and possibility which were established by different authors at different point of time on the basis of some well known consistency principles cannot provide the desired result. That is why the paper discussed some prominent works for transformations between probability and possibility and finally aimed to suggest a new principle because none of the existing principles because none of them found the unique transformation. The new consistency principle which is suggested hereby would in turn replace all others that exist in the literature references by providing a reliable estimate of consistency between the two.Furthermore some properties of entropy of fuzzy numbers are also presented in this article.

  16. The precautionary principle and chemicals regulation

    DEFF Research Database (Denmark)

    Løkke, Søren

    2006-01-01

    , is the present reformulation of the European Chemicals policy in danger of falling into loop-holes that equal problems related to the present regulation of existing chemicals? 'Precaution' has been reduced virtually to an abstract concept that is more or less devoid of practical meaning in the regulatory process...... has been shaped in relation to chemicals regulation and management since Carson's Silent Spring (years before the principle was confirmed as a policy-principle in German and European legislation. Furthermore, it is examined how the precautionary principle interacted with the development of the present...... and endocrine disrupting substances. Results: The analysis demonstrates the changing character of the integration of the precautionary principle. The main tendencies are from implicit to more explicit precaution and from a closed expert-orientation towards a more deliberative approach to scientific knowledge...

  17. PRINCIPLE "EARLY MATCHING" AERODYNAMIC DESIGN AIRCRAFT WITH LANDING GEAR HOVERCRAFT

    Directory of Open Access Journals (Sweden)

    V. P. Morozov

    2015-01-01

    Full Text Available The principle of "early matching" aircraft aerohydrodynamic layouts with air cushion landing gear is suggested. Application of this principle is considered as an example of adaptation to the ball screw base circuit of light transport aircraft. The principle, other than weight, aerodynamic, technological and operational requirements includes additional project activities related to the installation of ball screws.

  18. Hydrotectonics; principles and relevance

    Science.gov (United States)

    Kopf, R.W.

    1982-01-01

    Hydrotectonics combines the principles of hydraulics and rock mechanics. The hypothesis assumes that: (1) no faults are truly planar, (2) opposing noncongruent wavy wallrock surfaces form chambers and bottlenecks along the fault, and (3) most thrusting occurs beneath the water table. These physical constraints permit the following dynamics. Shear displacement accompanying faulting must constantly change the volume of each chamber. Addition of ground water liquefies dry fault breccia to a heavy incompressible viscous muddy breccia I call fault slurry. When the volume of a chamber along a thrust fault decreases faster than its fault slurry can escape laterally, overpressurized slurry is hydraulically injected into the base of near-vertical fractures in the otherwise impervious overriding plate. Breccia pipes commonly form where such fissures intersect. Alternating decrease and increase in volume of the chamber subjects this injection slurry to reversible surges that not only raft and abrade huge clasts sporadically spalled from the walls of the conduit but also act as a forceful hydraulic ram which periodically widens the conduit and extends its top. If the pipe perforates a petroleum reservoir, leaking hydrocarbons float to its top. Sudden faulting may generate a powerful water hammer that can be amplified at some distal narrow ends of the anastomosing plumbing system, where the shock may produce shatter cones. If vented on the Earth's surface, the muddy breccia, now called extrusion slurry, forms a mud volcano. This hypothesis suggests that many highly disturbed features presently attributed to such catastrophic processes as subsurface explosions or meteorite impacts are due to the rheology of tectonic slurry in an intermittently reactivated pressure-relief tube rooted in a powerful reciprocating hydrotectonic pump activated by a long-lived deep-seated thrust fault.

  19. Transfer pricing principles in VAT Law

    DEFF Research Database (Denmark)

    Jensen, Dennis Ramsdahl

    2011-01-01

    The main part of the article is devoted to a critical analysis of the optional transfer pricing provisions in the EC VAT Directive in the light of the principle of fiscal neutrality. As an integrated part of this analysis, the VAT transfer pricing regime is considered in the light of the well-kno......-known principles for transfer pricing in the area of income tax law, as set out in Art. 9 of the OECD Model Tax Convention. The last part of the article contains a brief discussion of to which extent it is desirable to harmonize the two tax systems´ transfer pricing rules.......The main part of the article is devoted to a critical analysis of the optional transfer pricing provisions in the EC VAT Directive in the light of the principle of fiscal neutrality. As an integrated part of this analysis, the VAT transfer pricing regime is considered in the light of the well...

  20. An h-principle with boundary condition

    DEFF Research Database (Denmark)

    Dotto, Emanuele

    2010-01-01

    We prove an h-principle with boundary condition for a certain class of topological spaces valued sheaves. The techniques used in the proof come from the study of the homotopy type of the cobordism categories, and they are of simplicial and categorical nature. Applying the main result of this paper...

  1. GENERAL PRINCIPLES OF LAW

    Directory of Open Access Journals (Sweden)

    Elena ANGHEL

    2016-05-01

    Full Text Available According to Professor Djuvara “law can be a science, and legal knowledge can also become science when, referring to a number as large as possible of acts of those covered by law, sorts and connects them by their essential characters upon legal concepts or principles which are universally valid, just like the laws of nature”. The general principles of law take a privileged place in the positive legal order and represent the foundation of any legal construction. The essence of the legal principles resides in their generality. In respect of the term “general”, Franck Moderne raised the question on the degree of generality used in order to define a principle as being general – at the level of an institution, of a branch of the law or at the level of the entire legal order. The purpose of this study is to find out the characteristics of law principles. In our opinion, four characteristics can be mentioned.

  2. A Principle of Intentionality

    Science.gov (United States)

    Turner, Charles K.

    2017-01-01

    The mainstream theories and models of the physical sciences, including neuroscience, are all consistent with the principle of causality. Wholly causal explanations make sense of how things go, but are inherently value-neutral, providing no objective basis for true beliefs being better than false beliefs, nor for it being better to intend wisely than foolishly. Dennett (1987) makes a related point in calling the brain a syntactic (procedure-based) engine. He says that you cannot get to a semantic (meaning-based) engine from there. He suggests that folk psychology revolves around an intentional stance that is independent of the causal theories of the brain, and accounts for constructs such as meanings, agency, true belief, and wise desire. Dennett proposes that the intentional stance is so powerful that it can be developed into a valid intentional theory. This article expands Dennett’s model into a principle of intentionality that revolves around the construct of objective wisdom. This principle provides a structure that can account for all mental processes, and for the scientific understanding of objective value. It is suggested that science can develop a far more complete worldview with a combination of the principles of causality and intentionality than would be possible with scientific theories that are consistent with the principle of causality alone. PMID:28223954

  3. Planning principles as integral tool of financial planning implementation at enterprise

    Directory of Open Access Journals (Sweden)

    A.V. Overchuk

    2016-09-01

    Full Text Available The main problems of using financial planning tools, namely its principles, in order to achieve an effective system of financial planning at the enterprise are considered. Planning is an integral part of management and provides achievement of sustainable enterprise development, that is why, effective financial planning is the necessary means of realization of the main objective of the company – profit maximization. It is determined that the principles of financial planning are the objective category of planning science, which serves as a starting fundamental concept that expresses the cumulative effect of a number of laws. In addition, on the base of the aggregation and analysis of planning principles the system of financial planning principles is specified, providing efficient financial planning and control functions use, achievement of the mission and objectives of the economic entity activity management and ensuring of its profitability. The scientific novelty of the research lies in the specification of financial planning principles defining at the enterprise and their semantic characteristics

  4. Inhibition of formyl peptide-stimulated superoxide anion generation by Fal-002-2 occurs mainly through the blockade of the p21-activated kinase and protein kinase C signaling pathways in ratneutrophils.

    Science.gov (United States)

    Tsai, Ya-Ru; Huang, Li-Jiau; Lin, Hui-Yi; Hung, Yun-Jie; Lee, Miau-Rong; Kuo, Sheng-Chu; Hsu, Mei-Feng; Wang, Jih-Pyang

    2013-02-15

    In formyl-Met-Leu-Phe (fMLP)-stimulated rat neutrophils, a synthetic compound, 6-chloro-2-(2-chlorophenyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (Fal-002-2), inhibited superoxide anion (O2(•-)) generation with an IC50 value of about 11μM, which was not mediated by scavenging the generated O2(•-) or by a cytotoxic effect on neutrophils. Fal-002-2 effectively attenuated the phosphorylation of Ser residues in p47(phox) and the association between p47(phox) and p22(phox) in fMLP-stimulated neutrophils. The interaction of p47(phox) with protein kinase C (PKC) isoforms (α, βI, βII, δ and ζ) was attenuated by Fal-002-2 with a similar IC50 value to that required for inhibition of O2(•-) generation, whereas Fal-002-2 had no prominent effect on PKC isoform membrane translocation and did not affect the kinase activity. Moreover, Fal-002-2 had no effect on the phosphorylation of Akt and downstream glycogen synthase kinase-3β, only slightly affected the intracellular free Ca(2+) concentration, phosphorylation of extracellular signal-regulated kinase and p38 mitogen-activated protein kinase (MAPK), but effectively attenuated the downstream MAPK-activated protein kinase-2 phosphorylation. The interaction of p21-activated kinase (PAK) 1with p47(phox), phosphorylation of PAK1 (Thr423/Ser144) and the membrane recruitment of PAK1 were effectively inhibited by Fal-002-2. Fal-002-2 also blocked the activation of Rac1 and Cdc42 in a concentration range that effectively inhibited PAK activation. Taken together, these results suggest that Fal-002-2 inhibits fMLP-stimulated O2(•-) generation in neutrophils mainly through the blockade of PKC and PAK signaling pathways and partly through p38 MAPK signaling.

  5. Lycorine, the Main Phenanthridine Amaryllidaceae Alkaloid, Exhibits Significant Anti-Tumor Activity in Cancer Cells that Display Resistance to Proapoptotic Stimuli: an Investigation of Structure-Activity Relationship and Mechanistic Insight

    Science.gov (United States)

    Lamoral-Theys, Delphine; Andolfi, Anna; Van Goietsenoven, Gwendoline; Cimmino, Alessio; Le Calvé, Benjamin; Wauthoz, Nathalie; Mégalizzi, Véronique; Gras, Thierry; Bruyère, Céline; Dubois, Jacques; Mathieu, Véronique; Kornienko, Alexander; Kiss, Robert; Evidente, Antonio

    2011-01-01

    Twenty-two lycorine-related compounds were investigated for in vitro anti-tumor activity using four cancer cell lines displaying different levels of resistance to pro-apoptotic stimuli and two cancer cell lines sensitive to pro-apoptotic stimuli. Lycorine and six of its congeners exhibited potency in the single-digit micromolar range, while no compound appeared more active than lycorine. Lycorine also displayed the highest potential (in vitro) therapeutic ratio, being at least 15 times more active against cancer than normal cells. Our studies also showed that lycorine exerts its in vitro anti-tumor activity through cytostatic rather than cytotoxic effects. Furthermore, lycorine provided significant therapeutic benefit in mice bearing brain grafts of the B16F10 melanoma model at non-toxic doses. Thus, the results of the current study make lycorine an excellent lead for the generation of compounds able to combat cancers, which are naturally resistant to pro-apoptotic stimuli, such as glioblastoma, melanoma, non-small-cell-lung cancers, metastatic cancers, among others. PMID:19788245

  6. Lycorine, the main phenanthridine Amaryllidaceae alkaloid, exhibits significant antitumor activity in cancer cells that display resistance to proapoptotic stimuli: an investigation of structure-activity relationship and mechanistic insight.

    Science.gov (United States)

    Lamoral-Theys, Delphine; Andolfi, Anna; Van Goietsenoven, Gwendoline; Cimmino, Alessio; Le Calvé, Benjamin; Wauthoz, Nathalie; Mégalizzi, Véronique; Gras, Thierry; Bruyère, Céline; Dubois, Jacques; Mathieu, Véronique; Kornienko, Alexander; Kiss, Robert; Evidente, Antonio

    2009-10-22

    Twenty-two lycorine-related compounds were investigated for in vitro antitumor activity using four cancer cell lines displaying different levels of resistance to proapoptotic stimuli and two cancer cell lines sensitive to proapoptotic stimuli. Lycorine and six of its congeners exhibited potency in the single-digit micromolar range, while no compound appeared more active than lycorine. Lycorine also displayed the highest potential (in vitro) therapeutic ratio, being at least 15 times more active against cancer than normal cells. Our studies also showed that lycorine exerts its in vitro antitumor activity through cytostatic rather than cytotoxic effects. Furthermore, lycorine provided significant therapeutic benefit in mice bearing brain grafts of the B16F10 melanoma model at nontoxic doses. Thus, the results of the current study make lycorine an excellent lead for the generation of compounds able to combat cancers, which are naturally resistant to proapoptotic stimuli, such as glioblastoma, melanoma, non-small-cell-lung cancers, and metastatic cancers, among others.

  7. Principles of musical acoustics

    CERN Document Server

    Hartmann, William M

    2013-01-01

    Principles of Musical Acoustics focuses on the basic principles in the science and technology of music. Musical examples and specific musical instruments demonstrate the principles. The book begins with a study of vibrations and waves, in that order. These topics constitute the basic physical properties of sound, one of two pillars supporting the science of musical acoustics. The second pillar is the human element, the physiological and psychological aspects of acoustical science. The perceptual topics include loudness, pitch, tone color, and localization of sound. With these two pillars in place, it is possible to go in a variety of directions. The book treats in turn, the topics of room acoustics, audio both analog and digital, broadcasting, and speech. It ends with chapters on the traditional musical instruments, organized by family. The mathematical level of this book assumes that the reader is familiar with elementary algebra. Trigonometric functions, logarithms and powers also appear in the book, but co...

  8. 块菌主要生理活性及活性物质生产的研究进展%Main physiological activities of Truffles and research progress of active substances production

    Institute of Scientific and Technical Information of China (English)

    过敏; 唐丽薇; 严金平; 伊日布斯

    2012-01-01

    块菌是一种与高等植物根部共生的地下真菌,生物分类学上属于子囊菌亚门、块菌目、块菌科、块菌属。块菌具有多种生理活性,包括抗氧化、抗病原微生物、保肝、抗诱变、抗肿瘤、调节女性月经周期和性功能等。该文较详细地介绍了块菌生理活性及获得活性物质的研究现状,并对目前块菌活性物质研究中存在的问题和发展前景进行了讨论和展望。%Truffles belong to a family of fungi that grow underground in a symbiotic relationship with the higher plants.In taxonomy, they belong to tuber, tuberaceae, tuberales of ascomycetina. Truffies have a wide range of physiological activities, including oxidation resistance, anti-pathogenic microorganism activity, liver protection, resistance to mutagenesis,antitumor and regulation of menstrual cycle and sexual function in females,et al.ln this review, the physiological activities of Truffles and research progress of obtaining active substances were introduced in detail.The problems existing in the current research of active substances in truffles were investigated and its development prospect was proposed.

  9. On Figures of speech, Cooperative Principle and Politeness Principle

    Institute of Scientific and Technical Information of China (English)

    于永丽; 朱丽萍

    2008-01-01

    To accomplish the communication efficiently and successfully, the people usually follow some certain principle in conversation. Grice named this principle as the cooperative principle. The politeness principle that Leech has developed can explain some phenomenon from a different perspective that the cooperative principle cannot. Nowadays, the use of the figures of speech is becoming more and more often. What we should pay attention to is the fact that the use of the figures of speech violates the cooperative principle, while following the politeness principle to a certain extent. And this paper aims to discuss the relationship among them, to provide some information for the readers.

  10. Mechanical engineering principles

    CERN Document Server

    Bird, John

    2014-01-01

    A student-friendly introduction to core engineering topicsThis book introduces mechanical principles and technology through examples and applications, enabling students to develop a sound understanding of both engineering principles and their use in practice. These theoretical concepts are supported by 400 fully worked problems, 700 further problems with answers, and 300 multiple-choice questions, all of which add up to give the reader a firm grounding on each topic.The new edition is up to date with the latest BTEC National specifications and can also be used on undergraduate courses in mecha

  11. Itch Management: General Principles.

    Science.gov (United States)

    Misery, Laurent

    2016-01-01

    Like pain, itch is a challenging condition that needs to be managed. Within this setting, the first principle of itch management is to get an appropriate diagnosis to perform an etiology-oriented therapy. In several cases it is not possible to treat the cause, the etiology is undetermined, there are several causes, or the etiological treatment is not effective enough to alleviate itch completely. This is also why there is need for symptomatic treatment. In all patients, psychological support and associated pragmatic measures might be helpful. General principles and guidelines are required, yet patient-centered individual care remains fundamental.

  12. Principles of quantum electronics

    CERN Document Server

    Marcuse, Dietrich

    1980-01-01

    Principles of Quantum Electronics focuses on the concept of quantum electronics as the application of quantum theory to engineering problems. It examines the principles that govern specific quantum electronics devices and presents their theoretical applications to typical problems. Comprised of 10 chapters, this book starts with an overview of the Dirac formulation of quantum mechanics. This text then considers the derivation of the formalism of field quantization and discusses the properties of photons and phonons. Other chapters examine the interaction between the electromagnetic field and c

  13. Principles of engineering geology

    Energy Technology Data Exchange (ETDEWEB)

    Attewell, P.B.; Farmer, I.W.

    1976-01-01

    This book discusses basic principles as well as the practical applications of geological survey and analysis. Topics covered include the mechanical and physical response of rocks, rock masses and soils to changes in environmental conditions, and the principles of groundwater flow. The core of the book deals with the collection of geological and technical data, its subsequent analysis, and application to design. The combination of rigorous and detailed discussion of theory and well-illustrated examples made the book an indispensable reference source and ideal course book for both geologists and civil engineers.

  14. Principles of statistics

    CERN Document Server

    Bulmer, M G

    1979-01-01

    There are many textbooks which describe current methods of statistical analysis, while neglecting related theory. There are equally many advanced textbooks which delve into the far reaches of statistical theory, while bypassing practical applications. But between these two approaches is an unfilled gap, in which theory and practice merge at an intermediate level. Professor M. G. Bulmer's Principles of Statistics, originally published in 1965, was created to fill that need. The new, corrected Dover edition of Principles of Statistics makes this invaluable mid-level text available once again fo

  15. Do adults with Down syndrome do the same amount of physical activity as adults without disability? A proof of principle study.

    Science.gov (United States)

    Shields, Nora; Plant, Samantha; Warren, Catherine; Wollersheim, Dennis; Peiris, Casey

    2017-09-27

    This study compared levels of physical activity completed by adults with and without Down syndrome. Fifteen adults with and 15 adults without Down syndrome matched for age and gender, took part. The intensity and duration of physical activity were measured using RT3 accelerometers worn for seven days. Only, 12 participants with Down syndrome had complete physical activity data, and these participants and their matched controls (total: six females, 18 males; aged 25.8 ± 9.7) were included in the analyses. There were significantly lower levels of moderate and vigorous physical activity per day for people with Down syndrome (median = 27 min) compared to those without (median = 101 min) (p Down syndrome. Adults with Down syndrome appear to participate in lower levels of physical activity than adults without Down syndrome. Further research should validate these estimates. © 2017 John Wiley & Sons Ltd.

  16. Principles of developing a well-rounded program of physical rehabilitation for female students in the special medical group with consideration of physical activity impairment

    OpenAIRE

    Golod N. R.

    2015-01-01

    Purpose : to highlight the main provisions of a comprehensive physical rehabilitation program for students of special medical group based on violations of the motor capacity. Material : testing 24 students of special medical group and the same number of their healthy peers on standardized tests of physical qualities. To reflect the movement disorders applied functional movement screen. Results : a program of rehabilitation of the students included: lifestyle modification; morning hygienic gym...

  17. Optimal decisions principles of programming

    CERN Document Server

    Lange, Oskar

    1971-01-01

    Optimal Decisions: Principles of Programming deals with all important problems related to programming.This book provides a general interpretation of the theory of programming based on the application of the Lagrange multipliers, followed by a presentation of the marginal and linear programming as special cases of this general theory. The praxeological interpretation of the method of Lagrange multipliers is also discussed.This text covers the Koopmans' model of transportation, geometric interpretation of the programming problem, and nature of activity analysis. The solution of t

  18. English Humor Derived from the Violation of Cooperative Principle

    Institute of Scientific and Technical Information of China (English)

    逯凌虹

    2009-01-01

    Humor is a wisdom, which reflects a person's character, mind and educational level. Humor can be revealed in many ways, yet mainly by means oflanguage. Starting from the analysis of the language of English humor, this paper studies the ways of English humor, especially the English humor on the violation of Cooperative Principle. By analyzing the relationship of English humor and the Cooperative Principle, this paper aims at bettering our understanding and comprehension of the Cooperative Principle and English humor.

  19. Oxygen reduction activity on perovskite oxide surfaces: a comparative first-principle study of LaMnO$_3$, LaFeO$_3$ and LaCrO$_3$

    CERN Document Server

    Wang, Yan

    2012-01-01

    The understanding of oxygen reduction reaction (ORR) activity on perovskite oxide surfaces is essential for promising future fuel cell applications. We report a comparative study of ORR mechanisms on La$B$O$_3$ ($B$=Mn, Fe, Cr) surfaces by first-principles calculations based on density functional theory (DFT). Results obtained from varied DFT methods such as generalized gradient approximation(GGA), GGA+$U$ and the hybrid Hartree-Fock density functional method are reported for comparative purposes. We find that the results calculated from hybrid-functional method suggest that the order of ORR activity is LaMnO$_3$ $>$ LaCrO$_3$ $>$ LaFeO$_3$, which is in better agreement with recent experimental results (Suntivich \\textit{et al.}, Nature Chemistry 3, 546 (2011)) than those using the GGA or GGA+$U$ method.

  20. Principles of Bridge Reliability

    DEFF Research Database (Denmark)

    Thoft-Christensen, Palle; Nowak, Andrzej S.

    The paper gives a brief introduction to the basic principles of structural reliability theory and its application to bridge engineering. Fundamental concepts like failure probability and reliability index are introduced. Ultimate as well as serviceability limit states for bridges are formulated...