Blood Profile of Rabbits Infected with Eimeria magna

Directory of Open Access Journals (Sweden)

A Hana

2011-09-01

Full Text Available Abstract. The research aimed at determining the blood profile of local rabbits infected with different dose of Eimeria magna oocysts. This research used 45 male rabbits with the age of 4 month old, range from 1.5 to 1.8 kg, clinically healthy and free from coccidiosis. The rabbits were randomly divided into 3 groups, group I as control (K-0 was given 1.0 ml distilled water/rabbit orally, group II (K-10 was infected with single dose of 10x106 oocysts of E. magna/rabbit orally, and group III (K-20 was infected with single dose of 20x106 oocysts of E. magna/rabbit orally. After infection, rabbits were examined for clinical signs, body weight and temperature daily for five days. Blood samples were drawn from the vena marginalis to examine the number of erythrocytes, hemoglobine, packed cell volume (PCV, leukocytes and its deferent, total protein plasma (TPP and fibrinogen, activities of alkaline phosphatase (ALP, alanine amino transferase (ALT, and aspartat aminotransferase (AST. The data were statistically analyzed by two-way anova using factorial design. The results of this research showed that the infection of E. magna in rabbits caused fever and weight loss, accompanied by normochromic microcytic anemia (at doses of 10x106 oocysts, macrocytic normochromic (at doses of 20x106 oocysts, leukocytosis, lymphocytosis, hiperfibrinogenemia, and increased of ALP activity. There were correlations between clinical symptoms and blood profile of rabbits infected with E. magna for five days. The higher the dose and the longer the infection of E. magna in rabbits caused weight loss, increased body temperature, MCV (microcytic to macrocytic, leukocyte, fibrinogen and ALP activity. These findings were useful to have a better understanding of pathophysiology of E. magna infection in  rabbits. Key Words: Eimeria magna, oocyst, rabbit, blood profile A Hana et al/Animal Production 13(3:185-190 (2011

Molecular responses during cadmium-induced stress in Daphnia magna: Integration of differential gene expression with higher-level effects

Energy Technology Data Exchange (ETDEWEB)

Soetaert, Anneleen [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)]. E-mail: anneleen.soetaert@ua.ac.be; Vandenbrouck, Tine [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Ven, Karlijn van der [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Maras, Marleen [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Remortel, Piet van [Department of Mathematics and Informatics, Intelligent Systems Laboratory, University of Antwerp, Middelheimlaan 1, B-2020 Antwerp (Belgium); Blust, Ronny [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Coen, Wim M. de [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)

2007-07-20

DNA microarrays offer great potential in revealing insight into mechanistic toxicity of contaminants. The aim of the present study was (i) to gain insight in concentration- and time-dependent cadmium-induced molecular responses by using a customized Daphnia magna microarray, and (ii) to compare the gene expression profiles with effects at higher levels of biological organization (e.g. total energy budget and growth). Daphnids were exposed to three cadmium concentrations (nominal value of 10, 50, 100 {mu}g/l) for two time intervals (48 and 96 h). In general, dynamic expression patterns were obtained with a clear increase of gene expression changes at higher concentrations and longer exposure duration. Microarray analysis revealed cadmium affected molecular pathways associated with processes such as digestion, oxygen transport, cuticula metabolism and embryo development. These effects were compared with higher-level effects (energy budgets and growth). For instance, next to reduced energy budgets due to a decline in lipid, carbohydrate and protein content, we found an up-regulated expression of genes related to digestive processes (e.g. {alpha}-esterase, cellulase, {alpha}-amylase). Furthermore, cadmium affected the expression of genes coding for proteins involved in molecular pathways associated with immune response, stress response, cell adhesion, visual perception and signal transduction in the present study.

Population structure and dispersal routes of an invasive parasite, Fascioloides magna, in North America and Europe

Czech Academy of Sciences Publication Activity Database

Juhasova, L.; Kraľová-Hromadová, I.; Bazsalovicsová, E.; Minárik, G.; Štefka, Jan; Mikulíček, P.; Pálková, L.; Pybus, M.

2016-01-01

Roč. 9, OCT 13 (2016), č. článku 547. ISSN 1756-3305 Institutional support: RVO:60077344 Keywords : microsatellites * parasite * giant liver fluke * Fascioloides magna * genetic interrelationships * migratory routes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.080, year: 2016

Sex-related differences in the anteroposterior diameter of the foetal cisterna magna

Energy Technology Data Exchange (ETDEWEB)

Tao, G. [Department of Ultrasound, Qilu hospital of Shandong University, Jinan (China); Yew, D.T. [Department of Anatomy, Chinese University of Hong Kong (Hong Kong); Gu, T.; Liu, S.; Ma, Z.; Zhan, X.; Cheng, L. [Department of Ultrasound, Qilu hospital of Shandong University, Jinan (China); Li, C. [Department of Ultrasound, Qilu hospital of Shandong University, Jinan (China)], E-mail: chuanfuli2006@hotmail.com

2008-09-15

Aim: To measure the anteroposterior diameter of the foetal cisterna magna and observe whether there are differences according to sex. Materials and methods: Three hundred and thirty-seven Chinese women with low-risk pregnancies and a singleton foetus between 22 and 38 weeks' gestational age were included in this retrospective study. Informed consent of the volunteer subjects and hospital authority approval were first obtained. Double-blinded for gender, the anteroposterior diameter of the cisterna magna of the foetuses was measured by transabdominal sonography. Magnetic resonance imaging (MRI) was used for those foetuses with mega cisterna magna. All of the foetuses were healthy by prenatal and postnatal examination, including physical and imaging examination. Results: The mean anteroposterior diameter of the cisterna magna of all foetuses was 8.01 {+-} 1.79 mm. The anteroposterior diameter of the cisterna magna had no obvious correlation with the gestational age. The mean anteroposterior diameter of the cisterna magna of 179 male foetuses was 8.63 {+-} 2.16 mm, and the mean anteroposterior diameter of the cisterna magna of 158 female foetuses was 7.87 {+-} 1.74 mm. The size difference was statistically significant (p < 0.001). In the 33 foetuses with mega cisterna magna, the number of male foetuses was greater than female foetuses, and the proportion of the foetuses with mega cisterna magna in the male group was significantly higher than the foetuses in the female group (p < 0.05). Conclusion: Male foetuses had slightly larger anteroposterior diameters of the cisterna magna than female foetuses. The study would be useful for creating normal range values for the cisterna magna of male and female foetuses.

Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions

Directory of Open Access Journals (Sweden)

Silvia L. Bustamante

2003-07-01

Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

Molecular fingerprint of high fat diet induced urinary bladder metabolic dysfunction in a rat model.

Directory of Open Access Journals (Sweden)

Andreas Oberbach

Full Text Available AIMS/HYPOTHESIS: Diabetic voiding dysfunction has been reported in epidemiological dimension of individuals with diabetes mellitus. Animal models might provide new insights into the molecular mechanisms of this dysfunction to facilitate early diagnosis and to identify new drug targets for therapeutic interventions. METHODS: Thirty male Sprague-Dawley rats received either chow or high-fat diet for eleven weeks. Proteomic alterations were comparatively monitored in both groups to discover a molecular fingerprinting of the urinary bladder remodelling/dysfunction. Results were validated by ELISA, Western blotting and immunohistology. RESULTS: In the proteome analysis 383 proteins were identified and canonical pathway analysis revealed a significant up-regulation of acute phase reaction, hypoxia, glycolysis, β-oxidation, and proteins related to mitochondrial dysfunction in high-fat diet rats. In contrast, calcium signalling, cytoskeletal proteins, calpain, 14-3-3η and eNOS signalling were down-regulated in this group. Interestingly, we found increased ubiquitin proteasome activity in the high-fat diet group that might explain the significant down-regulation of eNOS, 14-3-3η and calpain. CONCLUSIONS/INTERPRETATION: Thus, high-fat diet is sufficient to induce significant remodelling of the urinary bladder and alterations of the molecular fingerprint. Our findings give new insights into obesity related bladder dysfunction and identified proteins that may indicate novel pathophysiological mechanisms and therefore constitute new drug targets.

Bioaccumulation and uptake routes of perfluoroalkyl acids in Daphnia magna.

Science.gov (United States)

Dai, Zhineng; Xia, Xinghui; Guo, Jia; Jiang, Xiaoman

2013-02-01

Perfluoroalkyl acids (PFAs), one kind of emerging contaminants, have attracted great attentions in recent years. However, the study about their bioaccumulation mechanism remains scarce. In this research, the bioaccumulation of six kinds of PFAs in water flea Daphnia magna was studied. The uptake rates of PFAs in D. magna ranged from 178 to 1338 L kg(-1) d(-1), and they increased with increasing perfluoroalkyl chain length; the elimination rates ranged from 0.98 to 2.82 d(-1). The bioaccumulation factors (BAFs) of PFAs ranged from 91 to 380 L kg(-1) in wet weight after 25 d exposure; they increased with increasing perfluoroalkyl chain length and had a significant positive correlation with the n-octanol/water partition coefficients (logK(ow)) of PFAs (pPFAs plays an important role in their bioaccumulation. The BAFs almost kept constant when the PFA concentrations in aqueous phase increased from 1 to 10 μg L(-1). Scenedesmus subspicatus, as the food of D. magna, did not significantly affect the bioaccumulation of PFAs by D. magna. Furthermore, the body burden of PFAs in the dead D. magna was 1.08-2.52 times higher than that in the living ones, inferring that the body surface sorption is a main uptake route of PFAs in D. magna. This study suggested that the bioaccumulation of PFAs in D. magna is mainly controlled by their partition between organisms and water; further research should be conducted to study the intrinsic mechanisms, especially the roles of protein and lipid in organisms. Copyright © 2012 Elsevier Ltd. All rights reserved.

Protein profiling as early detection biomarkers for TiO2 nanoparticle toxicity in Daphnia magna.

Science.gov (United States)

Sá-Pereira, Paula; Diniz, Mário S; Moita, Liliana; Pinheiro, Teresa; Mendonça, Elsa; Paixão, Susana M; Picado, Ana

2018-05-01

The mode of action for nanoparticle (NP) toxicity in aquatic organisms is not yet fully understood. In this work, a strategy other than toxicity testing was applied to Daphnia magna exposed to TiO 2 -NPs: the use of nuclear microscopy and the assessment of protein profile. D. magna is a keystone species broadly used as a model system in ecotoxicology. Titanium (Ti) was found in the D. magna digestive tract, mainly in the gut. The penetration of Ti into the epithelial region was greater at higher exposure levels and also observed in eggs in the brood pouch. The protein profile of individuals exposed to different concentrations showed that 2.8 and 5.6 mg/L TiO 2 -NP concentrations induced an over-expression of the majority of proteins, in particular proteins with molecular weight of ∼120, 85 and 15 kDa, while 11.2 mg/L TiO 2 -NP had an inhibitory effect on protein expression. The Matrix-assisted laser desorption ionization with tandem time of flight mass spectrometry (MALDI-TOF/TOF MS) analysis of these proteins consistently identified them as vitellogenin (Vtg)-like proteins, associated with enzymes involved in redox balance. These results indicate that Vtg-like proteins are up-regulated in D. magna exposed to TiO 2 -NPs. Vitellogenesis is associated with the reproduction system, suggesting that TiO 2 -NP exposure can impair reproduction by affecting this process. The precise mode of action of TiO 2 -NPs is still unclear and the results from this study are a first attempt to identify specific proteins as potential markers of TiO 2 -NP toxicity in D. magna, providing useful information for future research.

magna (Straus, 1820.

Directory of Open Access Journals (Sweden)

Hatice Parlak

2015-12-01

Full Text Available Nif Çayi Kirletilmiş Tatli Su ve Sedimentinin Daphnia magna (Strauss, 1820 Üzerine Akut Ve Kronik Toksisitesi. Nif Çayı Endüstriyel, evsel ve tarımsal deşarjlar ile doğrudan kirlenmektedir. Çayın suyunun evsel ve endüstriyel alanlarda sulama ve yıkama suyu olarak kullanılması rahatsızlık verici boyuttadır, bu nedenle doğal populasyonlar için potansiyel toksisitesinin bilinmesi büyük öneme sahiptir. Bu çalışmanın amacı Nif Çayı su ve sediment örneklerinin su piresi Daphnia magna kullanılarak toksisitesinin belirlenmesidir. Su ve sediment örneklerinin letal toksisitesi 48-saat akut test, subletal toksisite ise 7-gün kronik test ile gerçekleştirilmiştir. D.magna kullanılarak yapılan 48 saat Akut test sonuçlarına göre LC 50 değerleri su örnekleri için 6.8 ile 12.67 µl/L arasında sediment örnekleri içn 6.826 ile 38.038 µg/L arasında bulunmuştur. Subletal konsantrasyonlara maruz bırakılarak yapılan kronik testler sonucunda tüm istasyonlardan alınan su ve sediment örneklerin canlının üremesi üzerine negatif etkisi olduğu gözlenmiştir. Elde edilen veriler ışığında bu deneme sisteminin rutin kirlilik belirleme çalışmaları için uygunluğu tespit edilmiştir

Case of pacemaker pocket infection caused by Finegoldia magna.

Science.gov (United States)

Hosseini Dehkordi, Seyed Hamed; Osorio, Georgina

2017-10-01

Finegoldia magna (formerly called Peptostreptococcus magnus) is a Gram-positive anaerobic coccus which is increasingly recognized as an opportunistic pathogen. We present a case of F. magna associated non-valvular cardiovascular device-related infection in an 83 year-old male who received a permanent pacemaker for sick sinus syndrome seven weeks prior to his presentation. Five weeks after the implantation, the pacemaker and leads were explanted because of clinical evidence of pacemaker pocket infection. He was initially treated with sulfamethoxazole-trimethoprim based on the Gram stain results from the removed pacemaker. However, two weeks later, he was readmitted with sepsis and was successfully treated with ampicillin-sulbactam. Culture results from the pacemaker and pocket as well as blood cultures grew F. magna. Clinicians should be aware of the possibility of F. magna infection when initial gram stain results show "gram positive cocci". Copyright © 2017 Elsevier Ltd. All rights reserved.

Fuzzy tricentric pharmacophore fingerprints. 1. Topological fuzzy pharmacophore triplets and adapted molecular similarity scoring schemes.

Science.gov (United States)

Bonachéra, Fanny; Parent, Benjamin; Barbosa, Frédérique; Froloff, Nicolas; Horvath, Dragos

2006-01-01

This paper introduces a novel molecular description--topological (2D) fuzzy pharmacophore triplets, 2D-FPT--using the number of interposed bonds as the measure of separation between the atoms representing pharmacophore types (hydrophobic, aromatic, hydrogen-bond donor and acceptor, cation, and anion). 2D-FPT features three key improvements with respect to the state-of-the-art pharmacophore fingerprints: (1) The first key novelty is fuzzy mapping of molecular triplets onto the basis set of pharmacophore triplets: unlike in the binary scheme where an atom triplet is set to highlight the bit of a single, best-matching basis triplet, the herein-defined fuzzy approach allows for gradual mapping of each atom triplet onto several related basis triplets, thus minimizing binary classification artifacts. (2) The second innovation is proteolytic equilibrium dependence, by explicitly considering all of the conjugated acids and bases (microspecies). 2D-FPTs are concentration-weighted (as predicted at pH=7.4) averages of microspecies fingerprints. Therefore, small structural modifications, not affecting the overall pharmacophore pattern (in the sense of classical rule-based assignment), but nevertheless triggering a pKa shift, will have a major impact on 2D-FPT. Pairs of almost identical compounds with significantly differing activities ("activity cliffs" in classical descriptor spaces) were in many cases predictable by 2D-FPT. (3) The third innovation is a new similarity scoring formula, acknowledging that the simultaneous absence of a triplet in two molecules is a less-constraining indicator of similarity than its simultaneous presence. It displays excellent neighborhood behavior, outperforming 2D or 3D two-point pharmacophore descriptors or chemical fingerprints. The 2D-FPT calculator was developed using the chemoinformatics toolkit of ChemAxon (www.chemaxon.com).

Predicting the performance of fingerprint similarity searching.

Science.gov (United States)

Vogt, Martin; Bajorath, Jürgen

2011-01-01

Fingerprints are bit string representations of molecular structure that typically encode structural fragments, topological features, or pharmacophore patterns. Various fingerprint designs are utilized in virtual screening and their search performance essentially depends on three parameters: the nature of the fingerprint, the active compounds serving as reference molecules, and the composition of the screening database. It is of considerable interest and practical relevance to predict the performance of fingerprint similarity searching. A quantitative assessment of the potential that a fingerprint search might successfully retrieve active compounds, if available in the screening database, would substantially help to select the type of fingerprint most suitable for a given search problem. The method presented herein utilizes concepts from information theory to relate the fingerprint feature distributions of reference compounds to screening libraries. If these feature distributions do not sufficiently differ, active database compounds that are similar to reference molecules cannot be retrieved because they disappear in the "background." By quantifying the difference in feature distribution using the Kullback-Leibler divergence and relating the divergence to compound recovery rates obtained for different benchmark classes, fingerprint search performance can be quantitatively predicted.

Fingerprint recognition with identical twin fingerprints.

Science.gov (United States)

Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

2012-01-01

Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

Fingerprint recognition with identical twin fingerprints.

Directory of Open Access Journals (Sweden)

Xunqiang Tao

Full Text Available Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6 images. Compared to the previous work, our contributions are summarized as follows: (1 Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2 Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3 A larger sample (83 pairs was collected. (4 A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5 A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering

Directory of Open Access Journals (Sweden)

Johnston J

2015-12-01

Full Text Available Jencilin Johnston,1 Erik N Taylor,1,2 Richard J Gilbert,2 Thomas J Webster1,3 1Department of Chemical Engineering, 2Department of Chemistry and Chemical Biology, Northeastern University, Boston, MA, USA; 3Center of Excellence for Advanced Materials Research, King Abdulaziz University, Jeddah, Saudi Arabia Abstract: Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched was assessed for the characterization of a Raman signal (ie, molecular fingerprint that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792 and carbocyanine (DTTC [3,3'-diethylthiatricarbocyanine iodide] and DTDC [3,3'-diethylthiadicarbocyanine iodide], were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye

Ramon Llull's Ars Magna

DEFF Research Database (Denmark)

Jensen, Thessa

2018-01-01

The Ars Magna of Ramon Llull must be seen as one of the first attempts to formalise language, thought processes, and creating a basis for rational discussions. It consists of so-called principles, concepts, which are defined and combined through the use of four main figures. Llull's contribution...

Improved Prediction of Blood-Brain Barrier Permeability Through Machine Learning with Combined Use of Molecular Property-Based Descriptors and Fingerprints.

Science.gov (United States)

Yuan, Yaxia; Zheng, Fang; Zhan, Chang-Guo

2018-03-21

Blood-brain barrier (BBB) permeability of a compound determines whether the compound can effectively enter the brain. It is an essential property which must be accounted for in drug discovery with a target in the brain. Several computational methods have been used to predict the BBB permeability. In particular, support vector machine (SVM), which is a kernel-based machine learning method, has been used popularly in this field. For SVM training and prediction, the compounds are characterized by molecular descriptors. Some SVM models were based on the use of molecular property-based descriptors (including 1D, 2D, and 3D descriptors) or fragment-based descriptors (known as the fingerprints of a molecule). The selection of descriptors is critical for the performance of a SVM model. In this study, we aimed to develop a generally applicable new SVM model by combining all of the features of the molecular property-based descriptors and fingerprints to improve the accuracy for the BBB permeability prediction. The results indicate that our SVM model has improved accuracy compared to the currently available models of the BBB permeability prediction.

Long-term effects to ionizing radiation in crustacean Daphnia magna

International Nuclear Information System (INIS)

Sarapul'tseva, E.I.

2016-01-01

The results of this study have provided strong evidence for the trans generational effects of parental exposure to ionizing radiation in crustacean Daphnia magna. To establish whether parental irradiation can affect the survival, life span and fertility of directly exposed organisms and their non-exposed offspring, D. magna were given 10, 100, 1000 and 10,000 mGy of acute γ-rays. MTT-assay was first applied for the investigation in vivo of the mechanisms of trans generational low doses effects of radiation and development of stress in Daphnia. Our dates strongly support MTT assay results as a good bio marker of survival and fertility effects at D. magna. (authors)

Toxicity of three strobilurins (kresoxim-methyl, pyraclostrobin, and trifloxystrobin) on Daphnia magna.

Science.gov (United States)

Cui, Feng; Chai, Tingting; Liu, Xiaoxu; Wang, Chengju

2017-01-01

Strobilurins constitute a new class of fungicides that is the most widely used in the world. The present study was conducted to investigate the aquatic toxicity of 3 common strobilurin fungicides (kresoxim-methyl, pyraclostrobin, and trifloxystrobin) to Daphnia magna. The neonate acute immobilization test showed that the 48-h 50% effective concentration (EC50) values of kresoxim-methyl, pyraclostrobin, and trifloxystrobin were 443.3 µg/L, 20.9 µg/L, and 23.0 µg/L, respectively. In addition, the 3 strobilurins significantly induced activity of the important detoxification enzyme glutathione S-transferase (GST) in D. magna, and there was a significant positive relationship between GST activity and immobility of D. magna after acute exposure. The 3 strobilurins showed higher toxicity to D. magna embryos, and the 48-h EC50 were 157.3 µg/L, 3.9 µg/L, and 1.7 µg/L for kresoxim-methyl, pyraclostrobin, and trifloxystrobin, respectively. The 21-d chronic test revealed that the strobilurins could also significantly affect the reproduction, development, and growth of D. magna at sublethal concentrations. The lowest-observed-effect concentrations of kresoxim-methyl, pyraclostrobin, and trifloxystrobin for reproduction were 20 µg/L, 0.15 µg/L, and 0.2 µg/L, respectively, which were close to environmental concentrations. The findings indicate that strobilurin fungicides are very toxic to D. magna and they are sufficient to cause harm to D. magna at environmentally relevant concentrations. Environ Toxicol Chem 2017;36:182-189. © 2016 SETAC. © 2016 SETAC.

Magna-field irradiation: physical considerations

Energy Technology Data Exchange (ETDEWEB)

Van Dyk, J.

1983-12-01

Magna-field radiotherapy in the form of total body, half body and total nodal irradiation is becoming increasingly prominent and involves dosimetric problems that are much more pronounced than they are for conventional field sizes. In this review of the physical considerations of magna-field irradiation, a number of possible alternate methods of producing large radiation fields are outlined, the basic beam dosimetry is reviewed and the factors producing dose variation in the patient are considered. Since the lung contains large regions of low density tissues and has a lower tolerance to radiaiton than most other tissues, special consideration is given to methods of dose determination and dose reduction to this organ. The question of accuracy in dose delivery is briefly discussed and the concept of delivering a radiation dose 'as precisely as readily achievable (APARA), technological and biological factors being taken into account' is introduced.

Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions Caracterización molecular del germoplasma de ñame colombiano utilizando "DNA Amplificaron Fingerprinting (DAF" en condiciones radiactivas

Directory of Open Access Journals (Sweden)

Bustamante Silvia L.

2003-12-01

Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

Fossa navicularis magna detection on cone-beam computed tomography

Energy Technology Data Exchange (ETDEWEB)

Syed, Ali Z. [Dept. of Oral and Maxillofacial Medicine and Diagnostic Sciences, School of Dental Medicine, Case Western Reserve University, Cleveland(United States); Mupparapu, Mel [Div. of Radiology, University of Pennsylvania School of Dental Medicine, Philadelphia (United States)

2016-03-15

Herein, we report and discuss the detection of fossa navicularis magna, a close radiographic anatomic variant of canalis basilaris medianus of the basiocciput, as an incidental finding in cone-beam computed tomography (CBCT) imaging. The CBCT data of the patients in question were referred for the evaluation of implant sites and to rule out pathology in the maxilla and mandible. CBCT analysis showed osseous, notch-like defects on the inferior aspect of the clivus in all four cases. The appearance of fossa navicularis magna varied among the cases. In some, it was completely within the basiocciput and mimicked a small rounded, corticated, lytic defect, whereas it appeared as a notch in others. Fossa navicularis magna is an anatomical variant that occurs on the inferior aspect of the clivus. The pertinent literature on the anatomical variations occurring in this region was reviewed.

Do microplastic particles affect Daphnia magna at the morphological, life history and molecular level?

Directory of Open Access Journals (Sweden)

Hannes K Imhof

Full Text Available Microplastic particles are ubiquitous not only in marine but also in freshwater ecosystems. However, the impacts of microplastics, consisting of a large variety of synthetic polymers, on freshwater organisms remains poorly understood. We examined the effects of two polymer mixtures on the morphology, life history and on the molecular level of the waterflea Daphnia magna (three different clones. Microplastic particles of ~40 μm were supplied at a low concentration (1% of the food particles leading to an average of ~30 particles in the digestive tract which reflects a high microplastic contamination but still resembles a natural situation. Neither increased mortality nor changes on the morphological (body length, width and tail spine length or reproductive parameters were observed for adult Daphnia. The analyses of juvenile Daphnia revealed a variety of small and rather subtle responses of morphological traits (body length, width and tail spine length. For adult Daphnia, alterations in expression of genes related to stress responses (i.e. HSP60, HSP70 & GST as well as of other genes involved in body function and body composition (i.e. SERCA were observed already 48h after exposure. We anticipate that the adverse effects of microplastic might be influenced by many additional factors like size, shape, type and even age of the particles and that the rather weak effects, as detected in a laboratory, may lead to reduced fitness in a natural multi-stressor environment.

Interspecific differences between D. pulex and D. magna in tolerance to cyanobacteria with protease inhibitors.

Directory of Open Access Journals (Sweden)

Christian J Kuster

Full Text Available It is known that cyanobacteria negatively affect herbivores due to their production of toxins such as protease inhibitors. In the present study we investigated potential interspecific differences between two major herbivores, Daphnia magna and Daphnia pulex, in terms of their tolerance to cyanobacteria with protease inhibitors. Seven clones each of D. magna and of D. pulex were isolated from different habitats in Europe and North America. To test for interspecific differences in the daphnids' tolerance to cyanobacteria, their somatic and population growth rates were determined for each D. magna and D. pulex clone after exposure to varying concentrations of two Microcystis aeruginosa strains. The M. aeruginosa strains NIVA and PCC(- contained either chymotrypsin or trypsin inhibitors, but no microcystins. Mean somatic and population growth rates on a diet with 20% NIVA were significantly more reduced in D. pulex than in D. magna. On a diet with 10% PCC(-, the population growth of D. pulex was significantly more reduced than that of D. magna. This indicates that D. magna is more tolerant to cyanobacteria with protease inhibitors than D. pulex. The reduction of growth rates was possibly caused by an interference of cyanobacterial inhibitors with proteases in the gut of Daphnia, as many other conceivable factors, which might have been able to explain the reduced growth, could be excluded as causal factors. Protease assays revealed that the sensitivities of chymotrypsins and trypsins to cyanobacterial protease inhibitors did not differ between D. magna and D. pulex. However, D. magna exhibited a 2.3-fold higher specific chymotrypsin activity than D. pulex, which explains the observed higher tolerance to cyanobacterial protease inhibitors of D. magna. The present study suggests that D. magna may control the development of cyanobacterial blooms more efficiently than D. pulex due to differences in their tolerance to cyanobacteria with protease

Absceso mamario no puerperal por Finegoldia magna Nonpuerperal breast abscess caused by Finegoldia magna

Directory of Open Access Journals (Sweden)

L. Castello

2007-06-01

Full Text Available Finegoldia magna son cocos gram-positivos anaerobios estrictos, cuyas células se disponen en pares, tétradas y acúmulos. Forman parte de la flora normal de la piel, tractos gastrointestinal y genitourinario femeninos, y cavidad oral. La especie se caracteriza por ser asacarolítica y su principal fuente de energía la constituyen aminoácidos y peptonas. Por lo general se la aísla en cultivos polimicrobianos a partir de abscesos y otras infecciones de piel y partes blandas, huesos y articulaciones. En el caso descrito, F. magna fue recuperada en cultivo monomicrobiano, a partir de un absceso mamario no puerperal, que se agrega a los dos casos comunicados en la literatura. La identificación se realizó mediante la determinación de la sensibilidad a los discos de potencia especial, pruebas convencionales, y producción de enzimas sacarolíticas y proteol��ticas. Se efectuó la prueba de sensibilidad a los antimicrobianos por el método epsilométrico. Los agentes ensayados y los valores de CIM (µg/ml obtenidos fueron: penicilina, 0,064; cefalotina, 1; metronidazol, 0,25; minociclina, Finegoldia magna is a species of strictly anaerobic gram-positive cocci, arranged in pairs, tetrads, and clusters. These organisms are components of the normal flora of the skin, gastrointestinal and genitourinary female tracts, and oral cavity. They are asaccharolytic and their major energy sources are aminoacids and peptones. The species is usually isolated in polymicrobial cultures from abscesses, soft tissue infections, bone and joints. In the case herein presented, F. magna was recovered in pure culture from a nonpuerperal breast abscess, which adds to the two reported cases in related literature. Species identification was performed by special potency disks, standard bacteriological anaerobic tests, and production of saccharolytic and proteolytic enzymes. Antimicrobial susceptibility testing was performed by using the epsilometric test. The agents

Development and characterization of multiplex panels of polymorphic microsatellite loci in giant liver fluke Fascioloides magna (Trematoda: Fasciolidae), using next-generation sequencing approach

Czech Academy of Sciences Publication Activity Database

Minárik, G.; Bazsalovicsová, E.; Zvijáková, Ĺ.; Štefka, Jan; Pálková, L.; Kraľová-Hromadová, I.

2014-01-01

Roč. 195, č. 1 (2014), s. 30-33 ISSN 0166-6851 Institutional support: RVO:60077344 Keywords : Short tandem repeats * Population genetics * Invasive parasite * Microsatellites * Fascioloides magna Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.787, year: 2014

Accumulation of dieldrin in an alga (Scenedesmus obliquus), Daphnia magna, and the guppy (Poecilia reticulata)

Science.gov (United States)

Reinert, Robert E.

1972-01-01

Scenedesmus obliquus, Daphnia magna, and Poecilia reticulata accumulated dieldrin directly from water; average concentration factors (concentration in organism, dry weight, divided by concentration in water) were 1282 for the alga, 13,954 for D. magna, and 49,307 (estimated) for the guppy. The amount accumulated by each species at equilibrium (after about 1.5, 3-4, and 18 days, respectively) was directly proportional to the concentration of dieldrin in the water. Daphnia magna and guppies accumulated more dieldrin from water than from food that had been exposed to similar concentrations in water. When guppies were fed equal daily rations of D. magna containing different concentrations of insecticide, the amounts of dieldrin accumulated by the fish were directly proportional to the concentration in D. magna; when two lots of guppies were fed different quantities of D. magna (10 and 20 organisms per day) containing identical concentrations of dieldrin, however, the amounts accumulated did not differ substantially.

Molecular Fingerprints of the Human Fecal Microbiota From 9 to 18 Months Old and the Effect of Fish Oil Supplementation

DEFF Research Database (Denmark)

Andersen, Anders Daniel; Mølbak, Lars; Michaelsen, Kim Fleischer

2011-01-01

supplementation with 5mL of fish oil (FO) or sunflower oil (SO) from 9 to 18 months of age, stool samples were collected from 132 healthy Danish infants. Molecular fingerprints of the bacterial DNA were obtained by terminal restriction fragment length polymorphism (T-RFLP). Results: The T-RFLP profiles indicated...

In-vitro antioxidant activity of crataeva magna lour. dc bark extract

Directory of Open Access Journals (Sweden)

Sridhar N

2012-10-01

Full Text Available The plant Crataeva magna belonging to family Capparaceae is used in anti spasmodic, hypotensive, anti-inflammatory, hypoglycemic, anti protozoal, analgesic purposes. The present study was carried out to evaluate appropriate animal model. The antioxidative potential of different solvent extracts of Crataeva magna were evaluated using 1,1-Diphenyl-2-Picrylhydrazyl (DPPH, 2,2 ’-Azino-Bis(3-ethylbenzthiazoline-6-Sulphonic acid (ABTS, superoxide radical, hydroxyl radical, nitric oxide radical scavenging activities and lipid peroxidation inhibition assay. Among those solvent extracts, ethanolic extract of C. magna exhibited highest level of antioxidant activities. The ethanolic extract also inhibited H 2O2 mediated haemolysis and lipid peroxidation in human RBC.

Spatio-temporal variability of the molecular fingerprint of soil dissolved organic matter in a headwater agricultural catchment

Science.gov (United States)

Jeanneau, Laurent; Pierson-Wickmann, Anne-Catherine; Jaffrezic, Anne; Lambert, Thibault; Gruau, Gérard

2013-04-01

Dissolved organic matter (DOM) is implied in (i) ecosystem services such as the support of biodiversity, (ii) the alteration of the drinkable water quality by formation of trihalomethane and (iii) the transfer of micropollutants from soils to rivers. Moreover, since DOM connects soils and oceans that are interacting with the atmosphere, understanding its biogeochemistry will help in investigating the carbon cycle and in creating strategies to mitigate climate change. DOM in headwater stream ecosystems is mainly inherited from allochtonous inputs with different reservoirs being mobilized during storm and interstorm events at the scale of an hydrological year. Those changes in DOM reservoirs, if accompanied by composition and reactivity changes, may impact DOM ecosystem services and drinking water production processes. Elucidating the compositional changes due to changes in the source of DOM in rivers has thus become a important axis of DOM research. The aim of this study is to test the ability of the molecular tools of the organic geochemistry and more specifically the combination of thermochemiolysis and gas chromatography - mass spectrometry (THM-GC-MS) to (i) link the variability of the river DOM composition to different DOM reservoirs in catchment soils and (ii) provide hypothesis on the nature and the mechanisms of formation (microbial growth, litter decomposition) of those reservoirs. This analytical method seems particularly adapted since it allows the differentiation between vegetal and microbial inputs and the determination of the extent of the biodegradation process of biomolecules such as lignin. To test this method, the molecular fingerprint of soil DOM has been investigated in the wetland area of a small (500 ha) agricultural catchment (the so-called Kervidy-Naizin catchment) located in Brittany, western France. The soil DOM was sampled fortnightly at three depths using zero-tension lysimeters during the hydrological year 2010-2011. The samples were

Medical-biological aspects of radiation effects in Daphnia magna

International Nuclear Information System (INIS)

Sarapultseva, E; Ustenko, K; Uskalova, D; Savina, N

2017-01-01

We have shown that γ-irradiation at doses of 100 and 1000 mGy significantly compromised fecundity and reproductive success of the directly exposed D. magna . These effects were also observed among the non-exposed first-generation progeny of irradiated parents, thus implying the manifestation of transgenerational effects in Daphnia . We have also shown that compromised viability of irradiated D. magna can be attributed cytotoxic effects of irradiation. It would therefore appear that the compromised viability may be attributed to the cytotoxic effects resulted from epigenetic changes affecting some metabolic pathways involved in detoxification of free-radicals. Additionally we have analyzed more distant progeny of irradiated at doses of 10, 100 and 1000 mGy Daphnia . Our data demonstrated that multicellular crustacean D. magna represent a very useful experimental model for analyse of long-term effects of ionising radiation at the organismal level. (paper)

A tree based method for the rapid screening of chemical fingerprints

DEFF Research Database (Denmark)

Kristensen, Thomas Greve; Nielsen, Jesper; Pedersen, Christian Nørgaard Storm

2009-01-01

The fingerprint of a molecule is a bitstring based on its structure, constructed such that structurally similar molecules will have similar fingerprints. Molecular fingerprints can be used in an initial phase for identifying novel drug candidates by screening large databases for molecules......: the kD grid and the Multibit tree. The kD grid is based on splitting the fingerprints into k shorter bitstrings and utilising these to compute bounds on the similarity of the complete bitstrings. The Multibit tree uses hierarchical clustering and similarity within each cluster to compute similar bounds...

Multigenerational cadmium acclimation and biokinetics in Daphnia magna

International Nuclear Information System (INIS)

Guan Rui; Wang Wenxiong

2006-01-01

A Cd exposure (3 μg L -1 ) experiment was conducted for six successive generations to investigate the responses to chronic Cd stress in Daphnia magna. We observed a biphasic accumulation of Cd in the six generations and suggested a similar pattern with respect to daphnids' tolerance. Cd assimilation efficiencies, daphnid growth, and reproduction corresponded to the changes of tolerance, which was partially accounted for by metallothionein induction. When maternally exposed neonates grew in Cd-free water for one or two generations, their growth, MT concentration and biokinetic parameters partially or totally recovered. The rapid recovery suggests the high potential for ecological restoration from Cd pollution. Our results indicate that the tolerance of sensitive D. magna clones to Cd was dependent on long-term or multigenerational exposure. The tolerance developed within the first several generations might not be maintained, and the animals may become even more sensitive to Cd stress in subsequent generations. - Tolerance of sensitive Daphnia magna clones to cadmium was dependent on long-term or multigenerational exposure

Mid-infrared supercontinuum generation in the fingerprint region

DEFF Research Database (Denmark)

Møller, Uffe Visbech; Petersen, Christian Rosenberg; Kubat, Irnis

The mid-infrared spectral region is of great technical and scientific interest because most molecules display fundamental vibrational absorptions in this region, leaving distinctive spectral fingerprints. Here, we demonstrate experimentally that launching intense ultra-short pulses with a central...... the potential of fibres to emit across the mid-infrared molecular fingerprint region, which is of key importance for applications such as early cancer diagnostics, gas sensing and food quality control....

Effect of an Aspartame-Ethanol Mixture on Daphnia magna Cardiac Activity

Directory of Open Access Journals (Sweden)

Rebecca Kohn

2009-01-01

Full Text Available Aspartame in conjunction with alcohol has been shown to increase the blood alcohol level in humans faster than alcohol and sucrose (Wu et al., 2006. To determine the potential effects of various mixtures of ethanol and aspartame on the nervous system, the heart rate of Daphnia magna (D.magna, water flea was measured in deionized water (control, ethanol, aspartame, and five different mixtures of ethanol and aspartame. The heart rate was chosen as a representative measure since it is controlled by the nervous system and the heart rate of D.magna can easily be measured. The results were statistically evaluated by student’s t-test. A significant increase in heart rate was observed for all mixed assays compared to both control and ethanol, but not to aspartame. The data suggests that the aspartame and alcohol mixture have a greater effect on D. magna heart rate than water or ethanol, but not aspartame alone. We propose that alcohol in combination with aspartame has potentially detrimental consequences for the nervous system.

Multigenerational contaminant exposures produce non-monotonic, transgenerational responses in Daphnia magna

International Nuclear Information System (INIS)

Kimberly, David A.; Salice, Christopher J.

2015-01-01

Generally, ecotoxicologists rely on short-term tests that assume populations to be static. Conversely, natural populations may be exposed to the same stressors for many generations, which can alter tolerance to the same (or other) stressors. The objective of this study was to improve our understanding of how multigenerational stressors alter life history traits and stressor tolerance. After continuously exposing Daphnia magna to cadmium for 120 days, we assessed life history traits and conducted a challenge at higher temperature and cadmium concentrations. Predictably, individuals exposed to cadmium showed an overall decrease in reproductive output compared to controls. Interestingly, control D. magna were the most cadmium tolerant to novel cadmium, followed by those exposed to high cadmium. Our data suggest that long-term exposure to cadmium alter tolerance traits in a non-monotonic way. Because we observed effects after one-generation removal from cadmium, transgenerational effects may be possible as a result of multigenerational exposure. - Highlights: • Daphnia magna exposed to cadmium for 120 days. • D. magna exposed to cadmium had decreased reproductive output. • Control D. magna were most cadmium tolerant to novel cadmium stress. • Long-term exposure to cadmium alter tolerance traits in a non-monotonic way. • Transgenerational effects observed as a result of multigenerational exposure. - Adverse effects of long-term cadmium exposure persist into cadmium free conditions, as seen by non-monotonic responses when exposed to novel stress one generation removed.

Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

Science.gov (United States)

Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

2017-01-01

Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

Exploring the vibrational fingerprint of the electronic excitation energy via molecular dynamics

International Nuclear Information System (INIS)

Deyne, Andy Van Yperen-De; Pauwels, Ewald; Ghysels, An; Waroquier, Michel; Van Speybroeck, Veronique; Hemelsoet, Karen; De Meyer, Thierry; De Clerck, Karen

2014-01-01

A Fourier-based method is presented to relate changes of the molecular structure during a molecular dynamics simulation with fluctuations in the electronic excitation energy. The method implies sampling of the ground state potential energy surface. Subsequently, the power spectrum of the velocities is compared with the power spectrum of the excitation energy computed using time-dependent density functional theory. Peaks in both spectra are compared, and motions exhibiting a linear or quadratic behavior can be distinguished. The quadratically active motions are mainly responsible for the changes in the excitation energy and hence cause shifts between the dynamic and static values of the spectral property. Moreover, information about the potential energy surface of various excited states can be obtained. The procedure is illustrated with three case studies. The first electronic excitation is explored in detail and dominant vibrational motions responsible for changes in the excitation energy are identified for ethylene, biphenyl, and hexamethylbenzene. The proposed method is also extended to other low-energy excitations. Finally, the vibrational fingerprint of the excitation energy of a more complex molecule, in particular the azo dye ethyl orange in a water environment, is analyzed

An SDN-Based Fingerprint Hopping Method to Prevent Fingerprinting Attacks

Directory of Open Access Journals (Sweden)

Zheng Zhao

2017-01-01

Full Text Available Fingerprinting attacks are one of the most severe threats to the security of networks. Fingerprinting attack aims to obtain the operating system information of target hosts to make preparations for future attacks. In this paper, a fingerprint hopping method (FPH is proposed based on software-defined networks to defend against fingerprinting attacks. FPH introduces the idea of moving target defense to show a hopping fingerprint toward the fingerprinting attackers. The interaction of the fingerprinting attack and its defense is modeled as a signal game, and the equilibriums of the game are analyzed to develop an optimal defense strategy. Experiments show that FPH can resist fingerprinting attacks effectively.

Stereoselective virtual screening of the ZINC database using atom pair 3D-fingerprints.

Science.gov (United States)

Awale, Mahendra; Jin, Xian; Reymond, Jean-Louis

2015-01-01

Tools to explore large compound databases in search for analogs of query molecules provide a strategically important support in drug discovery to help identify available analogs of any given reference or hit compound by ligand based virtual screening (LBVS). We recently showed that large databases can be formatted for very fast searching with various 2D-fingerprints using the city-block distance as similarity measure, in particular a 2D-atom pair fingerprint (APfp) and the related category extended atom pair fingerprint (Xfp) which efficiently encode molecular shape and pharmacophores, but do not perceive stereochemistry. Here we investigated related 3D-atom pair fingerprints to enable rapid stereoselective searches in the ZINC database (23.2 million 3D structures). Molecular fingerprints counting atom pairs at increasing through-space distance intervals were designed using either all atoms (16-bit 3DAPfp) or different atom categories (80-bit 3DXfp). These 3D-fingerprints retrieved molecular shape and pharmacophore analogs (defined by OpenEye ROCS scoring functions) of 110,000 compounds from the Cambridge Structural Database with equal or better accuracy than the 2D-fingerprints APfp and Xfp, and showed comparable performance in recovering actives from decoys in the DUD database. LBVS by 3DXfp or 3DAPfp similarity was stereoselective and gave very different analogs when starting from different diastereomers of the same chiral drug. Results were also different from LBVS with the parent 2D-fingerprints Xfp or APfp. 3D- and 2D-fingerprints also gave very different results in LBVS of folded molecules where through-space distances between atom pairs are much shorter than topological distances. 3DAPfp and 3DXfp are suitable for stereoselective searches for shape and pharmacophore analogs of query molecules in large databases. Web-browsers for searching ZINC by 3DAPfp and 3DXfp similarity are accessible at www.gdb.unibe.ch and should provide useful assistance to drug

Transmission risk assessment of invasive fluke Fascioloides magna using GIS-modelling and multicriteria analysis methods

Directory of Open Access Journals (Sweden)

Juhásová L.

2017-06-01

Full Text Available The combination of multicriteria analysis (MCA, particularly analytic hierarchy process (AHP and geographic information system (GIS were applied for transmission risk assessment of Fascioloides magna (Trematoda; Fasciolidae in south-western Slovakia. Based on the details on F. magna life cycle, the following risk factors (RF of parasite transmission were determined: intermediate (RFIH and final hosts (RFFH (biological factors, annual precipitation (RFAP, land use (RFLU, flooded area (RFFA, and annual mean air temperature (RFAT (environmental factors. Two types of risk analyses were modelled: (1 potential risk analysis was focused on the determination of the potential risk of parasite transmission into novel territories (data on F. magna occurrence were excluded; (2 actual risk analysis considered also the summary data on F. magna occurrence in the model region (risk factor parasite occurrence RFPO included in the analysis. The results of the potential risk analysis provided novel distribution pattern and revealed new geographical area as the potential risk zone of F. magna occurrence. Although the actual risk analysis revealed all four risk zones of F. magna transmission (acceptable, moderate, undesirable and unacceptable, its outputs were significantly affected by the data on parasite occurrence what reduced the informative value of the actual transmission risk assessment.

CRISPR/Cas-mediated targeted mutagenesis in Daphnia magna.

Directory of Open Access Journals (Sweden)

Takashi Nakanishi

Full Text Available The water flea Daphnia magna has been used as an animal model in ecology, evolution, and environmental sciences. Thanks to the recent progress in Daphnia genomics, genetic information such as the draft genome sequence and expressed sequence tags (ESTs is now available. To investigate the relationship between phenotypes and the available genetic information about Daphnia, some gene manipulation methods have been developed. However, a technique to induce targeted mutagenesis into Daphnia genome remains elusive. To overcome this problem, we focused on an emerging genome editing technique mediated by the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas system to introduce genomic mutations. In this study, we targeted a functionally conserved regulator of eye development, the eyeless gene in D. magna. When we injected Cas9 mRNAs and eyeless-targeting guide RNAs into eggs, 18-47% of the survived juveniles exhibited abnormal eye morphology. After maturation, up to 8.2% of the adults produced progenies with deformed eyes, which carried mutations in the eyeless loci. These results showed that CRISPR/Cas system could introduce heritable mutations into the endogenous eyeless gene in D. magna. This is the first report of a targeted gene knockout technique in Daphnia and will be useful in uncovering Daphnia gene functions.

Molecular fingerprinting reflects different histotypes and brain region in low grade gliomas

International Nuclear Information System (INIS)

Mascelli, Samantha; Fasulo, Daniel; Noy, Karin; Wittemberg, Gayle; Pignatelli, Sara; Piatelli, Gianluca; Cama, Armando; Garré, Maria Luisa; Capra, Valeria; Verri, Alessandro; Barla, Annalisa; Raso, Alessandro; Mosci, Sofia; Nozza, Paolo; Biassoni, Roberto; Morana, Giovanni; Huber, Martin; Mircean, Cristian

2013-01-01

Paediatric low-grade gliomas (LGGs) encompass a heterogeneous set of tumours of different histologies, site of lesion, age and gender distribution, growth potential, morphological features, tendency to progression and clinical course. Among LGGs, Pilocytic astrocytomas (PAs) are the most common central nervous system (CNS) tumours in children. They are typically well-circumscribed, classified as grade I by the World Health Organization (WHO), but recurrence or progressive disease occurs in about 10-20% of cases. Despite radiological and neuropathological features deemed as classic are acknowledged, PA may present a bewildering variety of microscopic features. Indeed, tumours containing both neoplastic ganglion and astrocytic cells occur at a lower frequency. Gene expression profiling on 40 primary LGGs including PAs and mixed glial-neuronal tumours comprising gangliogliomas (GG) and desmoplastic infantile gangliogliomas (DIG) using Affymetrix array platform was performed. A biologically validated machine learning workflow for the identification of microarray-based gene signatures was devised. The method is based on a sparsity inducing regularization algorithm l 1 l 2 that selects relevant variables and takes into account their correlation. The most significant genetic signatures emerging from gene-chip analysis were confirmed and validated by qPCR. We identified an expression signature composed by a biologically validated list of 15 genes, able to distinguish infratentorial from supratentorial LGGs. In addition, a specific molecular fingerprinting distinguishes the supratentorial PAs from those originating in the posterior fossa. Lastly, within supratentorial tumours, we also identified a gene expression pattern composed by neurogenesis, cell motility and cell growth genes which dichotomize mixed glial-neuronal tumours versus PAs. Our results reinforce previous observations about aberrant activation of the mitogen-activated protein kinase (MAPK) pathway in LGGs

Advanced Fingerprint Analysis Project Fingerprint Constituents

Energy Technology Data Exchange (ETDEWEB)

GM Mong; CE Petersen; TRW Clauss

1999-10-29

The work described in this report was focused on generating fundamental data on fingerprint components which will be used to develop advanced forensic techniques to enhance fluorescent detection, and visualization of latent fingerprints. Chemical components of sweat gland secretions are well documented in the medical literature and many chemical techniques are available to develop latent prints, but there have been no systematic forensic studies of fingerprint sweat components or of the chemical and physical changes these substances undergo over time.

Computed tomography of the cisterna magna and mega cisterna magna in normal children

International Nuclear Information System (INIS)

Enomoto, Takao; Nakada, Yoshitaka; Maki, Yutaka

1984-01-01

We studied the cisterna magna (CM) on the computed tomography of children under 15 years of age. The scanners were GE-8800RTX and Hitachi CTH, and scanning was carried out parallel to the orbitomeatal line. Those with artifacts were excluded. 5 slices were needed to cover all the posterior fossa in children, but 4 slices were enough in infants, especially those under 6 months of age. 698 cases were included in the former group, and 69, in the latter. The authors estimated the size of the CM on the basis of the position of its tip. 7.1% of the children and 4% of the infants, especially under 6 months of age, had a CM of the full extent (from the foramen magnum to the 5th slice in children and to the 4th one in infants). If we may define a mega cisterna magna (MCM) as a CM more than 2 SD bigger than the mean, then the MCM are included in the groups described above. The MCM had no relationship with age or underlying disorders. The size of the 4th ventricle was, however, rather bigger in the MCM group than the normal CM group, suggesting that the pathogenesis of MCM might be a physiological hypoplasia of the cerebellar vermis. Therefore, no therapy was indicated for this abnormality. (author)

Parasitism drives host genome evolution: Insights from the Pasteuria ramosa-Daphnia magna system.

Science.gov (United States)

Bourgeois, Yann; Roulin, Anne C; Müller, Kristina; Ebert, Dieter

2017-04-01

Because parasitism is thought to play a major role in shaping host genomes, it has been predicted that genomic regions associated with resistance to parasites should stand out in genome scans, revealing signals of selection above the genomic background. To test whether parasitism is indeed such a major factor in host evolution and to better understand host-parasite interaction at the molecular level, we studied genome-wide polymorphisms in 97 genotypes of the planktonic crustacean Daphnia magna originating from three localities across Europe. Daphnia magna is known to coevolve with the bacterial pathogen Pasteuria ramosa for which host genotypes (clonal lines) are either resistant or susceptible. Using association mapping, we identified two genomic regions involved in resistance to P. ramosa, one of which was already known from a previous QTL analysis. We then performed a naïve genome scan to test for signatures of positive selection and found that the two regions identified with the association mapping further stood out as outliers. Several other regions with evidence for selection were also found, but no link between these regions and phenotypic variation could be established. Our results are consistent with the hypothesis that parasitism is driving host genome evolution. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

Dietary carbohydrate source influences molecular fingerprints of the rat faecal microbiota

DEFF Research Database (Denmark)

Licht, Tine Rask; Hansen, Max; Poulsen, Morten

2006-01-01

Background: A study was designed to elucidate effects of selected carbohydrates on composition and activity of the intestinal microbiota. Five groups of eight rats were fed a western type diet containing cornstarch (reference group), sucrose, potato starch, inulin (a long-chained fructan) or olig......Background: A study was designed to elucidate effects of selected carbohydrates on composition and activity of the intestinal microbiota. Five groups of eight rats were fed a western type diet containing cornstarch (reference group), sucrose, potato starch, inulin (a long-chained fructan...... of coliform bacteria in faeces. In the inulin and oligofructose groups, higher levels of butyrate and propionate, respectively, were measured. Principal Component Analysis of profiles of the faecal microbiota obtained by Denaturing Gradient Gel Electrophoresis (DGGE) of PCR amplified bacterial 16S rRNA genes...... and are not expected to reach the large intestine, the DGGE band patterns obtained indicated that these carbohydrates indeed affected the composition of bacteria in the large gut. Also the two fructans resulted in completely different molecular fingerprints of the faecal microbiota, indicating that even though...

Molecular Fingerprinting Approach in Plant Species Evaluation for a Nuclear Power Programme

International Nuclear Information System (INIS)

Azhar Mohamed

2011-01-01

Deoxyribonucleic acid (DNA) as a tool for marker technology is found to be remarkable, advanced and exciting in recent years. DNA markers are valuable tools and important in various plant breeding analyses for identification, gene mapping, marker systems and mutagenesis response. As gene expression is related to concurrent cellular activities and is mobilised in the adaptation of plants to adverse environmental conditions, changes at the DNA levels can be detected simultaneously. The changes also reflect response onto plant traits in which selection for better quality plant materials can be made and/or used as bio-indicator response in tracking any environmental change. The objective of the present study is to show Inter Simple Sequence Repeat (ISSR) markers as an important technique in differentiating plant DNA genomic in various species for the evaluation of their diversity and radiation effects in population. The technique has been found to be rapid, simple, reliable and robust in generating molecular fingerprinting database in bio surveillance for a nuclear power programme. (author)

A fluorescence-based hydrolytic enzyme activity assay for quantifying toxic effects of Roundup® to Daphnia magna

DEFF Research Database (Denmark)

Ørsted, Michael; Roslev, Peter

2015-01-01

Daphnia magna is a widely used model organism for aquatic toxicity testing. In the present study, we investigated the hydrolytic enzyme activity of D. magna after exposure to toxicant stress. In vivo enzyme activity was quantified using 15 fluorogenic enzyme probes based on 4-methylumbelliferyl...... or 7-amino-4-methylcoumarin. Probing D. magna enzyme activity was evaluated using short-term exposure (24-48 h) to the reference chemical K2Cr2O7, or the herbicide formulation Roundup®. Toxicant induced changes in hydrolytic enzyme activity were compared to changes in mobility (ISO 6341). The results...... showed that hydrolytic enzyme activity was quantifiable as a combination of whole body fluorescence of D. magna, and fluorescence of the surrounding water. Exposure of D. magna to lethal and sublethal concentrations of Roundup® resulted in loss of whole body enzyme activity, and release of cell...

Life history response of Daphnia magna to a mixotrophic golden alga, Poterioochromonas sp., at different food levels

DEFF Research Database (Denmark)

Zhang, Xue; Hu, Hong-Ying; Perlt, Trine Warming

2011-01-01

The toxicity of Poterioochromonas to Daphnia magna was investigated at different food (Scenedesmus acutus) levels. Poterioochromonas alone of 0.4–20 mg C L-1 was not acutely toxic to D. magna, but did not support D. magna growth, either. When fed mixed diets (2 mg C L-1 in total), D. magna...

Towards secondary fingerprint classification

CSIR Research Space (South Africa)

Msiza, IS

2011-07-01

Full Text Available an accuracy figure of 76.8%. This small difference between the two figures is indicative of the validity of the proposed secondary classification module. Keywords?fingerprint core; fingerprint delta; primary classifi- cation; secondary classification I..., namely, the fingerprint core and the fingerprint delta. Forensically, a fingerprint core is defined as the innermost turning point where the fingerprint ridges form a loop, while the fingerprint delta is defined as the point where these ridges form a...

Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

Science.gov (United States)

O'Neill, Kelly C; Lee, Young Jin

2018-05-01

The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

Breast abscess due to Finegoldia magna in a non-puerperal women.

Science.gov (United States)

Cobo, Fernando; Rodríguez-Granger, Javier; Sampedro, Antonio; Navarro-Marí, José María

2017-10-01

Finegoldia magna is a Gram-positive anaerobic coccus involved in a wide variety of infections. We report a unusual case of breast abscess in a non-puerperal patient. A 46-year-old woman presented with pain and a nodular lesion in the left breast. Culture of abscess drainage resulted in isolation of F. magna. Initial treatment with clindamycin was changed to a definitive treatment with amoxicillin-clavulanate for 10 days due to resistance to clindamycin, and improvement of this infection was documented. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effect of the lipid regulator Gemfibrozil in the Cladocera Daphnia magna at different temperatures.

Science.gov (United States)

Salesa, Beatriz; Ferrando, María D; Villarroel, María J; Sancho, Encarna

2017-02-23

In the present study, an ecotoxicological approach to the evaluation of Gemfibrozil (GEM) as an emerging organic pollutant was done. In order to assess its toxicity, tests were conducted using the cladocera Daphnia magna. Experiments were carried out at 22°C and 28°C. EC 50 , feeding behavior, and chronic toxicity tests (21 days) were evaluated in D. magna exposed to GEM as well as cholesterol levels at 21-day chronic exposure. D. magna GEM EC 50 values (24 h) in our experimental conditions were 148.75 and 116.24 mg L -1 at 22°C and 28°C, respectively. Test concentrations of 0.1, 0.5, 1.0, 5.0 and 7.5 mg L -1 were selected for subacute and chronic experiments. Subacute short-term test (feeding study) was assessed after exposure to the toxicant. Filtration and ingestion rates of D. magna exposed animals did not show any significant difference (P > 0.05) with respect to control daphniids neither at 22°C nor at 28°C. Therefore, GEM test concentrations used in the present study did not reduce feeding behavior in D. magna. Temperature increased from 22°C to 28°C, which resulted in a decrease of the daphniids reproductive parameters such as brood size and number of young per female. Other parameters as longevity were not affected. The GEM concentrations used in the chronic test with D. magna did not affect daphniids longevity but some reproductive parameters as number of young per female or brood size were affected. Finally, a significant decreased in cholesterol levels was found in those animals exposed to the highest toxicant concentrations. More studies must be done to determine the possible implications of GEM in aquatic fauna and to derive its possible effects on the environment.

Bioaccumulation, stress, and swimming impairment in Daphnia magna exposed to multiwalled carbon nanotubes, graphene, and graphene oxide.

Science.gov (United States)

Cano, Amanda M; Maul, Jonathan D; Saed, Mohammad; Shah, Smit A; Green, Micah J; Cañas-Carrell, Jaclyn E

2017-08-01

The use of carbon-based nanomaterials (CNMs) such as multiwalled carbon nanotubes (MWCNTs), graphene, and graphene oxide (GO) is increasing across many applications because of their unique and versatile properties. These CNMs may enter the aquatic environment through many pathways, creating the potential for organism exposure. The present study addresses the bioaccumulation and toxicity seen in Daphnia magna exposed to CNMs dispersed in sodium dodecyl benzene sulfonate (SDBS). In study I, D. magna were exposed to varying outer diameters of MWCNTs for 24 h in moderately hard or hard freshwater. Bioaccumulation of MWCNT was found in all treatments, with the highest concentrations (0.53 ± 0.27 μg/g) in D. magna exposed in hard freshwater (p < 0.005). The median lethal concentration (LC50) was determined for D. magna exposed to CNMs in moderately hard and hard freshwater. In study II, D. magna were exposed to CNMs for 72 h in moderately hard freshwater to assess swimming velocity and generation of reactive oxygen species (ROS) detected by dichlorofluorescein fluorescence. An overall decrease was seen in D. magna swimming velocity after exposure to CNMs. The generation of ROS was significantly higher (1.54 ± 0.38 dichlorofluorescein mM/mg dry wt) in D. magna exposed to MWCNTs of smaller outer diameters than in controls after 72 h (p < 0.05). These results suggest that further investigation of CNM toxicity and behavior in the aquatic environment is needed. Environ Toxicol Chem 2017;36:2199-2204. © 2017 SETAC. © 2017 SETAC.

Identification of sources of tar balls deposited along the Goa coast, India, using fingerprinting techniques

Digital Repository Service at National Institute of Oceanography (India)

Suneel, V.; Vethamony, P.; Zakaria, M.P.; Naik, B.G.; Prasad, K.V.

. Christensen et al (2007) reviewed the practical aspects of chemometrics for oil spill fingerprinting and provided a basis for the use of chemometric 3    methods in tiered oil spill fingerprinting. Biomarker compounds such as isoprenoid alkanes, hopanes... deposited along the Malaysian beaches. Low molecular weight/high molecular weight ratios (L/H) of both alkanes and PAHs together are useful in categorizing the weathering effects of tar balls (Chandru et al., 2008). However, in cases...

Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

NARCIS (Netherlands)

P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

1995-01-01

textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

Multigenerational effects evaluation of the flame retardant tris(2-butoxyethyl) phosphate (TBOEP) using Daphnia magna.

Science.gov (United States)

Giraudo, Maeva; Dubé, Maxime; Lépine, Mélanie; Gagnon, Pierre; Douville, Mélanie; Houde, Magali

2017-09-01

Tris(2-butoxyethyl) phosphate (TBOEP) is an organophosphate ester used as substitute following the phase-out of brominated flamed retardants. Because of its high production volume and its use in a broad range of applications, this chemical is now frequently detected in the environment and biota. However, limited information is available on the long-term effects of TBOEP in aquatic organisms. In this study, Daphnia magna were exposed over three 21d generations to an environmentally relevant concentration of TBOEP (10μg/L) and effects were evaluated at the gene transcription, protein, and life-history (i.e., survival, reproduction and growth) levels. Chronic exposure to TBEOP did not impact survival or reproduction of D. magna but affected the growth output. The mean number of molts was also found to be lower in daphnids exposed to the chemical compared to control for a given generation, however there were no significant differences over the three generations. Molecular responses indicated significant differences in the transcription of genes related to growth, molting, ecdysteroid and juvenile hormone signaling, proteolysis, oxidative stress, and oxygen transport within generations. Levels of mRNA were also found to be significantly different for genes known to be involved in endocrine-mediated mechanisms such as reproduction and growth between generations F0, F1, and F2, indicating effects of parental exposure on offspring. Transcription results were supported by protein analyses with the significant decreased in catalase (CAT) activity in F1 generation, following the decreased transcription of cat in the parental generation. Taken together, these multi-biological level results suggest long-term potential endocrine disruption effects of TBOEP in D. magna exposed to an environmentally relevant concentration. This study highlights the importance of using chronic and multigenerational biological evaluation to assess risks of emerging chemicals. Crown Copyright �

Bioconcentration of the antidepressant fluoxetine and its effects on the physiological and biochemical status in Daphnia magna.

Science.gov (United States)

Ding, Jiannan; Zou, Hua; Liu, Qingqing; Zhang, Shanshan; Mamitiana Razanajatovo, Roger

2017-08-01

The aim of this study was to evaluate the bioconcentration potential of fluoxetine and its biological effects in Daphnia magna. After 48h of waterborne exposure, the bioconcentration of fluoxetine in D. magna was determined to be 460.61 and 174.41Lkg -1 for nominal exposure concentrations of 0.5 and 5µgL -1 , respectively. Moreover, various biological endpoints, including physiological responses (filtration and ingestion rates), enzymatic biomarkers related to neurotoxicity [acetylcholinesterase (AChE)] and antioxidant defense [superoxide dismutase (SOD)], and an oxidative stress damage marker [malondialdehyde (MDA)], were assessed. Fluoxetine exposure increased the filtration rate of daphnia, while the ingestion rate was not obviously modified. AChE activity was significantly inhibited, highlighting the neurotoxicity of fluoxetine on D. magna. However, with some alterations in the SOD activity and MDA content, no obvious oxidative damage was observed in D. magna exposed to fluoxetine at the tested concentrations. These results indicate that fluoxetine can be accumulated and consequently induce physiological and biochemical perturbations in D. magna. Copyright © 2017. Published by Elsevier Inc.

A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

Science.gov (United States)

Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

2015-01-01

A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

Directory of Open Access Journals (Sweden)

Chi-Jim Chen

2015-03-01

Full Text Available A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS, successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM, based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates.

A Case with Mega Cisterna Magna Renal and Ear Anomalies: Is This a New Syndrome?

Directory of Open Access Journals (Sweden)

Çapan Konca

2013-01-01

Full Text Available Background. Extrarenal pathologies may be associated with renal position and fusion anomalies. According to the literature, our patient is the first horseshoe kidney case that had mega cisterna magna, arachnodactyly, and mild mental retardation. Case Report. A 9-year-old boy admitted because of the myoclonic jerks. He had a dysmorphic face, low-set and cup-shaped ears, arachnodactyly, and mild mental retardation. The patient’s laboratory findings were normal except for a mild leucocytosis and hypochromic microcytic anemia. His cerebrospinal fluid was cytologically and biochemically normal. Cranial MRI revealed 1.5 cm diametered mega cisterna magna in the retrocerebellar region. Although there were no significant epileptical discharges in the electroencephalography, there were slow wave discharges arising from the anterior regions of both hemispheres. Because he had stomachache, abdominal ultrasonography was performed, and horseshoe kidney was determined. Abdominal CT did not reveal any abnormalities except the horseshoe kidney. There were not any cardiac pathologies in echocardiography. He had normal 46XY karyotype and there were no repeated chromosomal derangements, but we could not evaluate for molecular and submicroscopic somatic changes. He was treated with valproic acid and myoclonic jerks did not repeat. Conclusion. We suggest that the presence of these novel findings may represent a newly recognized, separate syndrome.

Fingerprint pores extractor

CSIR Research Space (South Africa)

Mngenge, NA

2012-11-01

Full Text Available , this is not always the case because of diseases and hash working conditions that affect fingerprints. In order to maintain high level of security independent of varying fingerprint image quality research suggests the use of other fingerprint features to compliment...

Touchless fingerprint biometrics

CERN Document Server

Labati, Ruggero Donida; Scotti, Fabio

2015-01-01

Offering the first comprehensive analysis of touchless fingerprint-recognition technologies, Touchless Fingerprint Biometrics gives an overview of the state of the art and describes relevant industrial applications. It also presents new techniques to efficiently and effectively implement advanced solutions based on touchless fingerprinting.The most accurate current biometric technologies in touch-based fingerprint-recognition systems require a relatively high level of user cooperation to acquire samples of the concerned biometric trait. With the potential for reduced constraints, reduced hardw

Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

Science.gov (United States)

Burgess, Jacob A. J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

2015-09-01

Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface.

Secreted protein eco-corona mediates uptake and impacts of polystyrene nanoparticles on Daphnia magna.

Science.gov (United States)

Nasser, Fatima; Lynch, Iseult

2016-03-30

Nanoparticles (NPs) are defined as having at least one external dimension between 1 and 100 nm. Due to their small size, NPs have a large surface area to volume ratio giving them unique characteristics that differ from bulk material of the same chemical composition. As a result these novel materials have found numerous applications in medical and industrial fields with the result that environmental exposure to NPs is increasingly likely. Similarly, increased reliance on plastic, which degrades extremely slowly in the environment, is resulting in increased accumulation of micro-/nano-plastics in fresh and marine waters, whose ecotoxicological impacts are as yet poorly understood. Although NPs are well known to adsorb macromolecules from their environment, forming a biomolecule corona which changes the NP identity and how it interacts with organisms, significantly less research has been performed on the ecological corona (eco-corona). Secretion of biomolecules is a well established predator-prey response in aquatic food chains, raising the question of whether NPs interact with secreted proteins, and the impact of such interaction on NP uptake and ecotoxicity. We report here initial studies, including optimisation of protocols using carboxylic-acid and amino modified spherical polystyrene NPs, to assess interaction of NPs with biomolecules secreted by Daphnia magna and the impact of these interactions on NP uptake, retention and toxicity towards Daphnia magna. Daphnia magna are an important environmental indicator species who may be especially sensitive to nanoparticles (NPs) as a result of being filter-feeders. This paper demonstrates for the first time that proteins released by Daphnia magna create an eco-corona around polystyrene NPs which causes heightened uptake of the NPs and consequently increases toxicity. The secreted protein eco-corona also causes the NPs to be less efficiently removed from the gut of D. magna and NPs remaining in the gut of D. magna

Paraspidodera uncinata (Nematoda, Lauroiinae as parasite of Cavia magna and Cavia aperea (Rodentia, Caviidae in southern Brazil

Directory of Open Access Journals (Sweden)

Ana Gabriela da Silva Rocha

2015-05-01

Full Text Available Out of the 5 species of Guinea pig registered for Brazil, 4 (Cavia fulgida, C. porcellus, C. aperea, and C. magna have already been reported as hosts of Paraspidodera uncinata. The rodent species C. magna and C. aperea are small-sized mammals, with terrestrial habits, which occur from southern Brazil to eastern Uruguay. Guinea pig specimens donated for research were necropsied for the analysis of endoparasites, and the nematodes found were identified as P. uncinata. The microhabitats of this species were the small and large intestines in C. magna and the large intestine in C. aperea. The prevalence of P. uncinata in the hosts was 60% in C. magna (n = 5 and 14% in C. aperea (n = 7. The record of P. uncinata in different Guinea pig species allows inferring that the foraging mode is similar in the different locations where they occur in southern Brazil, because, perhaps, the infection of hosts has occurred through the ingestion of vegetables contaminated with P. uncinata eggs. This study contributes to knowledge on the helminth fauna of C. magna and C. aperea in southern Brazil.

Ecotoxicological testing of gas oils (daphnia magna test)

Energy Technology Data Exchange (ETDEWEB)

Altmann, B.R.; Mueller, J.; Wenzel, A.; Hensel, R.

2002-02-01

The Water Accomodated Fractions WAF of 4 diesel fuels no. 2 and 4 domestic heating fuels no. 2 of differing origin were analysed on their effect on the mobility of the freshwater crustacean Daphnia Magna. Five loadings per test substance were tested. After an exposition period of 24 h a relationship between loading rates of the WAF and immobility was found for 3 samples, while after 48 h this was observed for all samples. WAF-generation and gas oil data were documented. (orig.) [German] Von 4 Dieselkraftstoff-Gasoelen und 4 Heizoel-Gasoelen EL wurden die Water Accomodated Fractions WAF auf ihre immobilisierende Wirkung auf den Wasserfloh Daphnia Magna untersucht. Von jeder Probe wurden fuenf unterschiedliche Dosierraten geprueft. Nach einer Expositionszeit von 24 Stunden zeigte sich bei 3 Proben und nach 48 Stunden bei allen Proben eine Beziehung zwischen der Dosierrate der Probe und der Immobilitaet. Die Herstellung der WAF und die Daten der Gasoele wurden dokumentiert. (orig.)

Distorted Fingerprint Verification System

Directory of Open Access Journals (Sweden)

Divya KARTHIKAESHWARAN

2011-01-01

Full Text Available Fingerprint verification is one of the most reliable personal identification methods. Fingerprint matching is affected by non-linear distortion introduced in fingerprint impression during the image acquisition process. This non-linear deformation changes both the position and orientation of minutiae. The proposed system operates in three stages: alignment based fingerprint matching, fuzzy clustering and classifier framework. First, an enhanced input fingerprint image has been aligned with the template fingerprint image and matching score is computed. To improve the performance of the system, a fuzzy clustering based on distance and density has been used to cluster the feature set obtained from the fingerprint matcher. Finally a classifier framework has been developed and found that cost sensitive classifier produces better results. The system has been evaluated on fingerprint database and the experimental result shows that system produces a verification rate of 96%. This system plays an important role in forensic and civilian applications.

Longitudinal study of fingerprint recognition.

Science.gov (United States)

Yoon, Soweon; Jain, Anil K

2015-07-14

Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject's age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis.

A Study on the D. magna and V. fischeri Toxicity Relationship of Industrial Wastewater from Korea

Science.gov (United States)

Pyo, S.; Lee, S.; Chun Sang, H.; Park, T. J.; Kim, M. S.

2015-12-01

It is well known that high concentration of TDS (total dissolved solid) in industrial effluent gives rise to the toxicity to the Daphnia magna toxicity test. D. magna is vulnerable to relatively low TDS concentration showing the 24-hr EC50 of Salinity 0.6% (as the sea salt concentration). Recently, standard mandatory toxicity testing using Daphnia magna has been used to monitor industrial effluent toxicity according to Korea standard method (Acute Toxicity Test Method of the Daphnia magna Straus (Cladocera, Crustacea), ES 04704. 1a) under regulation. Since only one acute toxicity testing is applied in the present, we are trying to introduce microbial battery for more complete toxicity assessment. In this study, the acute toxicities between daphnids and microbes were compared. The results of D. magna and Vibrio fischeri toxicity test from 165 industrial wastewater effluents showed high positive correlation. In addition, the possibility of predicting daphnia toxicity from the bacterial toxicity data amounts to 92.6% if we consider salinity effect (>5ppt) together. From this study, we found that the V. fischeri toxicity test is a powerful battery tool to assess the industrial wastewater toxicity. Here, we suggest that luminescent bacteria toxicity test be useful not only for complete toxicity assessment which can't be obtained by daphnia toxicity testing only but also for the reduction cost, time, and labor in the Korean society. Keywords : D. magna, V. fischeri, Industrial waste water, battery test Acknowledgement This research was supported by a grant (15IFIP-B089908-02) from Plant Research Program funded by Ministry of Land, Infrastructure and Transport of Korean government

Genomic integration and germline transmission of plasmid injected into crustacean Daphnia magna eggs.

Directory of Open Access Journals (Sweden)

Yasuhiko Kato

Full Text Available The water flea, Daphnia, has been the subject of study in ecology, evolution, and environmental sciences for decades. Over the last few years, expressed sequence tags and a genome sequence have been determined. In addition, functional approaches of overexpression and gene silencing based on microinjection of RNAs into eggs have been established. However, the transient nature of these approaches prevents us from analyzing gene functions in later stages of development. To overcome this limitation, transgenesis would become a key tool. Here we report establishment of a transgenic line using microinjection of plasmid into Daphnia magna eggs. The green fluorescent protein (GFP gene fused with the D. magna histone H2B gene under the control of a promoter/enhancer region of the elongation factor 1α-1 (EF1α-1 gene, EF1α-1::H2B-GFP, was used as a reporter providing high resolution visualization of active chromatin. Transgenic lines were obtained from 0.67% of the total fertile adults that survived the injections. One of the transgenic animals, which exhibited fluorescence in the nuclei of cells during embryogenesis and oogenesis, had two copies of EF1α-1::H2B-GFP in a head-to-tail array. This is the first report of a transgenesis technique in Daphnia and, together with emerging genome sequences, will be useful for advancing knowledge of the molecular biology of Daphnia.

Microorganism Identification Based On MALDI-TOF-MS Fingerprints

Science.gov (United States)

Elssner, Thomas; Kostrzewa, Markus; Maier, Thomas; Kruppa, Gary

Advances in MALDI-TOF mass spectrometry have enabled the ­development of a rapid, accurate and specific method for the identification of bacteria directly from colonies picked from culture plates, which we have named the MALDI Biotyper. The picked colonies are placed on a target plate, a drop of matrix solution is added, and a pattern of protein molecular weights and intensities, "the protein fingerprint" of the bacteria, is produced by the MALDI-TOF mass spectrometer. The obtained protein mass fingerprint representing a molecular signature of the microorganism is then matched against a database containing a library of previously measured protein mass fingerprints, and scores for the match to every library entry are produced. An ID is obtained if a score is returned over a pre-set threshold. The sensitivity of the techniques is such that only approximately 104 bacterial cells are needed, meaning that an overnight culture is sufficient, and the results are obtained in minutes after culture. The improvement in time to result over biochemical methods, and the capability to perform a non-targeted identification of bacteria and spores, potentially makes this method suitable for use in the detect-to-treat timeframe in a bioterrorism event. In the case of white-powder samples, the infectious spore is present in sufficient quantity in the powder so that the MALDI Biotyper result can be obtained directly from the white powder, without the need for culture. While spores produce very different patterns from the vegetative colonies of the corresponding bacteria, this problem is overcome by simply including protein fingerprints of the spores in the library. Results on spores can be returned within minutes, making the method suitable for use in the "detect-to-protect" timeframe.

Toxicity and genotoxicity of the quaternary ammonium compound benzalkonium chloride (BAC) using Daphnia magna and Ceriodaphnia dubia as model systems

International Nuclear Information System (INIS)

Lavorgna, Margherita; Russo, Chiara; D'Abrosca, Brigida; Parrella, Alfredo; Isidori, Marina

2016-01-01

The toxicity and genotoxicity of the cationic surfactant benzalkonium chloride (BAC) were studied using Daphnia magna and Ceriodaphnia dubia as model systems. Acute and chronic toxicity testing were performed according to the international standard guidelines and the genotoxicity was detected through the comet assay on cells from whole organisms in vivo exposed. Acute effects occurred at concentrations in the order of tens of μg/L in D. magna and hundreds of μg/L in C. dubia. Chronic effects were found at one order of magnitude less than short-term effects maintaining the same difference in sensitivity between D. magna and C. dubia. BAC induced relevant DNA damage, in both cladocerans; the lowest adverse effect levels were 0.4 and 4 ng/L for D. magna and C. dubia, respectively. As these effective concentrations are far lower than BAC occurrence in surface waters (units of μg/L) a concerning environmental risk cannot be excluded. The findings of this study showed that D. magna and C. dubia, could be used as model organisms to detect acute and chronic toxicity as well as genotoxicity at the whole organism level. - Highlights: • Benzalkonium chloride chronic effect in C. dubia was found at dozens of μg/L. • The LOAEC detected by comet assay in D. magna is in the order of hundreds of pg/L. • D. magna and C. dubia are useful model organisms to detect toxicity and genotoxicity. - Benzalkonium chloride showed chronic toxicity and genotoxicity in Daphnia magna and Ceriodaphnia dubia at concentrations of environmental concern. Daphnids are useful model organisms.

In vivo biodegradation of colloidal quantum dots by a freshwater invertebrate, Daphnia magna

Energy Technology Data Exchange (ETDEWEB)

Kwon, Dongwook; Kim, Min Jung; Park, Chansik; Park, Jaehong [Department of Chemistry, Hanyang University, Seoul 133-791 (Korea, Republic of); Choi, Kyungho [Department of Environmental Health, Seoul National University, Seoul 151-742 (Korea, Republic of); Yoon, Tae Hyun, E-mail: thyoon@gmail.com [Department of Chemistry, Hanyang University, Seoul 133-791 (Korea, Republic of)

2012-06-15

Impacts of planktonic invertebrate, Daphnia magna, on the speciation of colloidal quantum dots (QD) were investigated using fluorescence spectromicroscopic technique. Well-dispersed {sup GA/TOPO}QD were prepared by forming a supramolecular assembly of hydrophobic {sup TOPO}QD with biomacromolecules (i.e., Gum Arabic, GA). Biological degradation of this nanomaterial was monitored by fluorescence spectromicroscopic methods. Our study confirmed the major uptake pathway of manufactured nanomaterials and in vivo biodegradation processes in a well-known toxicity test organism, D. magna. In addition, we also found that D. magna can induce significant deterioration of aquatic media by releasing fragments of partially degraded QD colloids. These biological processes may significantly change the predicted toxicities of nanomaterials in aquatic environments. Thus, we propose that the impacts of aquatic living organisms on the environmental fate of manufactured nanomaterials (MNs) should be carefully taken into account when assessing the risk of MNs to the environment and human health.

Multi-generational effects of propranolol on Daphnia magna at different environmental concentrations

International Nuclear Information System (INIS)

Jeong, Tae-Yong; Kim, Hyun Young; Kim, Sang Don

2015-01-01

To evaluate the effects of propranolol on Daphnia magna (D. magna), we employed a multi-generational exposure period for eight generations and an environmentally relevant low concentration with 1.5 ng/L, 0.2 μg/L and 26 μg/L to reflect a realistic exposure scenario. Physiological endpoints were checked, including growth, number of neonates, heart rate, frequency of abdominal appendage movement and malformation rate of neonates. In the results, growth and abdominal appendage movement were affected by environmental concentration during several generations, and the responses showed consistent tendencies of response increase with concentration increase. Heart rate was the only endpoint affected throughout all exposure generations. Inhibitory and acceleratory effects on heart rate, growth and abdominal appendage movement suggest that it is necessary to cover sub-lethal endpoints of non-targeted organisms in eco-toxicity study because the physiological responses were detected at much lower concentrations than the results of traditional toxicity tests, including environmental concentration. - Highlights: • Multi-generational exposure was conducted to evaluate the effect of propranolol on Daphnia magna. • Heart rate was the only endpoint affected throughout all exposure generations. • Growth and abdominal appendage movement were affected at environmental concentrations. • Time series fluctuations in responses appeared with no tendencies throughout all generations. • It is necessary to cover sub-organismal endpoints and long-term exposure in ecotoxicity test. - Heart rate, growth and abdominal appendage movement of D. magna were affected by the multigenerational exposure of propranolol at environmental levels.

Photogrammetric fingerprint unwrapping

Science.gov (United States)

Paar, Gerhard; del Pilar Caballo Perucha, Maria; Bauer, Arnold; Nauschnegg, Bernhard

2008-04-01

Fingerprints are important biometric cues. Compared to conventional fingerprint sensors the use of contact-free stereoscopic image acquisition of the front-most finger segment has a set of advantages: Finger deformation is avoided, the entire relevant area for biometric use is covered, some technical aspects like sensor maintenance and cleaning are facilitated, and access to a three-dimensional reconstruction of the covered area is possible. We describe a photogrammetric workflow for nail-to-nail fingerprint reconstruction: A calibrated sensor setup with typically 5 cameras and dedicated illumination acquires adjacent stereo pairs. Using the silhouettes of the segmented finger a raw cylindrical model is generated. After preprocessing (shading correction, dust removal, lens distortion correction), each individual camera texture is projected onto the model. Image-to-image matching on these pseudo ortho images and dense 3D reconstruction obtains a textured cylindrical digital surface model with radial distances around the major axis and a grid size in the range of 25-50 µm. The model allows for objective fingerprint unwrapping and novel fingerprint matching algorithms since 3D relations between fingerprint features are available as additional cues. Moreover, covering the entire region with relevant fingerprint texture is particularly important for establishing a comprehensive forensic database. The workflow has been implemented in portable C and is ready for industrial exploitation. Further improvement issues are code optimization, unwrapping method, illumination strategy to avoid highlights and to improve the initial segmentation, and the comparison of the unwrapping result to conventional fingerprint acquisition technology.

[Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae].

Science.gov (United States)

Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing

2010-04-01

Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.

Sequence analysis of ribosomal and mitochondrial genes of the giant liver fluke Fascioloides magna (Trematoda: Fasciolidae): intraspecific variation and differentiation from Fasciola hepatica

Czech Academy of Sciences Publication Activity Database

Kráľová-Hromadová, I.; Špakulová, M.; Horáčková, Eva; Turčeková, Ĺ.; Novobilský, A.; Beck, R.; Koudela, Břetislav; Marinculić, A.; Rajský, D.; Pybus, M.

2008-01-01

Roč. 94, č. 1 (2008), s. 58-67 ISSN 0022-3395 R&D Projects: GA ČR GD524/03/H133; GA AV ČR IAA6022404 Grant - others:Slovak Research and Development Agency(SK) APVV-51-062205 Institutional research plan: CEZ:AV0Z60220518 Keywords : Fascioloides magna * Fasciola hepatica * ribosomal genes * mitochondrial genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.165, year: 2008

Genetic variation in the cellular response of Daphnia magna (Crustacea: Cladocera) to its bacterial parasite.

Science.gov (United States)

Auld, Stuart K J R; Scholefield, Jennifer A; Little, Tom J

2010-11-07

Linking measures of immune function with infection, and ultimately, host and parasite fitness is a major goal in the field of ecological immunology. In this study, we tested for the presence and timing of a cellular immune response in the crustacean Daphnia magna following exposure to its sterilizing endoparasite Pasteuria ramosa. We found that D. magna possesses two cell types circulating in the haemolymph: a spherical one, which we call a granulocyte and an irregular-shaped amoeboid cell first described by Metchnikoff over 125 years ago. Daphnia magna mounts a strong cellular response (of the amoeboid cells) just a few hours after parasite exposure. We further tested for, and found, considerable genetic variation for the magnitude of this cellular response. These data fostered a heuristic model of resistance in this naturally coevolving host-parasite interaction. Specifically, the strongest cellular responses were found in the most susceptible hosts, indicating resistance is not always borne from a response that destroys invading parasites, but rather stems from mechanisms that prevent their initial entry. Thus, D. magna may have a two-stage defence--a genetically determined barrier to parasite establishment and a cellular response once establishment has begun.

Physics and fingerprints

Science.gov (United States)

Voss-de Haan, Patrick

2006-08-01

This article discusses a variety of aspects in the detection and development of fingerprints and the physics involved in it. It gives an introduction to some basic issues like composition and properties of fingerprint deposits and a rudimentary framework of dactyloscopy; it covers various techniques for the visualization of latent fingerprints; and it concludes with a view of current research topics. The techniques range from very common procedures, such as powdering and cyanoacrylate fuming, to more demanding methods, for example luminescence and vacuum metal deposition, to fairly unusual approaches like autoradiography. The emphasis is placed on the physical rather than the forensic aspects of these topics while trying to give the physicist—who is not dealing with fingerprinting and forensic science on a daily basis—a feeling for the problems and solutions in the visualization of latent fingerprints.

Gabor filter based fingerprint image enhancement

Science.gov (United States)

Wang, Jin-Xiang

2013-03-01

Fingerprint recognition technology has become the most reliable biometric technology due to its uniqueness and invariance, which has been most convenient and most reliable technique for personal authentication. The development of Automated Fingerprint Identification System is an urgent need for modern information security. Meanwhile, fingerprint preprocessing algorithm of fingerprint recognition technology has played an important part in Automatic Fingerprint Identification System. This article introduces the general steps in the fingerprint recognition technology, namely the image input, preprocessing, feature recognition, and fingerprint image enhancement. As the key to fingerprint identification technology, fingerprint image enhancement affects the accuracy of the system. It focuses on the characteristics of the fingerprint image, Gabor filters algorithm for fingerprint image enhancement, the theoretical basis of Gabor filters, and demonstration of the filter. The enhancement algorithm for fingerprint image is in the windows XP platform with matlab.65 as a development tool for the demonstration. The result shows that the Gabor filter is effective in fingerprint image enhancement technology.

Mechanistic study of the toxicity of ionizing radiation in Daphnia magna

Energy Technology Data Exchange (ETDEWEB)

Parisot, F.; Alonzo, F. [Institut de Radioprotection et de Surete Nucleaire, IRSN/PRP-ENV/SERIS/LECO, Laboratoire d' Ecotoxicologie des Radionucleides, Cadarache (France); Bourdineaud, J.P. [UMR CNRS 5805 EPOC - OASU Station Marine d' Arcachon Universite Bordeaux 1, Arcachon (France); Poggiale, J.C. [Mediterranean Institute of Oceanography - MIO - UMR 7294 Pytheas Institute - OSU, Aix-Marseille University, Marseille (France)

2014-07-01

In the last decade, the ecological impact of ionizing radiation has emerged as a growing scientific concern for ecosystems protection. However, the assessment of potential radiological effects on the environment is hampered by both a gap of available scientific data and a lack in proven methods. Understanding how ionizing radiation affects wildlife at biologically and ecologically relevant scales is a major issue in environmental protection. This issue is one of the objectives of the Strategic Research Agenda (SRA) developed in the framework of the European program STAR (Strategy for Allied Radioecology). In this context, the present PhD project aims to evaluate chronic effects of external Cs-137 gamma radiation at low doses on a representative species of aquatic ecosystems, the cladoceran crustacean Daphnia magna. More precisely, the objectives of this study are to evaluate multi-generational effects of irradiation on: (i) genotoxic effects and their potential consequences on survival, somatic growth and fecundity, (ii) the energy budget and (iii) the population dynamics of Daphnia. An experimental design was developed to expose daphnids to low doses of ionizing radiation ranging from 0,008 to 32 mGy.h{sup -1} across 3 successive generations (75 days). DNA damages were assessed using random amplified polymorphic DNA and real time PCR (RAPD - PCR). Effects on survival, somatic growth and fecundity were monitored for 21-25 days in each generation, from hatching to release of brood 5. Our aim is to: examine a potential correlation between molecular (DNA) damage and effects observed at the individual level (survival, somatic growth and fecundity) across generations and test the suitability of DNA damage as an early indice of future trans-generational effects. As a future perspective, individual and molecular effects data will be analysed using a DEBtox model (Dynamic Energy Budget Applied to Toxicology) in order to identify the metabolic modes of action of ionizing

Interclonal proteomic responses to predator exposure in Daphnia magna may depend on predator composition of habitats.

Science.gov (United States)

Otte, Kathrin A; Schrank, Isabella; Fröhlich, Thomas; Arnold, Georg J; Laforsch, Christian

2015-08-01

Phenotypic plasticity, the ability of one genotype to express different phenotypes in response to changing environmental conditions, is one of the most common phenomena characterizing the living world and is not only relevant for the ecology but also for the evolution of species. Daphnia, the water flea, is a textbook example for predator-induced phenotypic plastic defences; however, the analysis of molecular mechanisms underlying these inducible defences is still in its early stages. We exposed Daphnia magna to chemical cues of the predator Triops cancriformis to identify key processes underlying plastic defensive trait formation. To get a more comprehensive idea of this phenomenon, we studied four genotypes with five biological replicates each, originating from habitats characterized by different predator composition, ranging from predator-free habitats to habitats containing T. cancriformis. We analysed the morphologies as well as proteomes of predator-exposed and control animals. Three genotypes showed morphological changes when the predator was present. Using a high-throughput proteomics approach, we found 294 proteins which were significantly altered in their abundance after predator exposure in a general or genotype-dependent manner. Proteins connected to genotype-dependent responses were related to the cuticle, protein synthesis and calcium binding, whereas the yolk protein vitellogenin increased in abundance in all genotypes, indicating their involvement in a more general response. Furthermore, genotype-dependent responses at the proteome level were most distinct for the only genotype that shares its habitat with Triops. Altogether, our study provides new insights concerning genotype-dependent and general molecular processes involved in predator-induced phenotypic plasticity in D. magna. © 2015 John Wiley & Sons Ltd.

Fingerprints in cancer cells

International Nuclear Information System (INIS)

Servomaa, K.

1994-01-01

Gene research has shown that factors causing cancer, or carcinogens, may leave marks typical of each particular carcinogen (fingerprints) in the genotype of the cell. Radiation, for instance, may leave such fingerprints in a cancer cell. In particular, the discovery of a gene called p53 has yielded much new information on fingerprints. It has been discovered, for example, that toxic fungus and UV-radiation each leave fingerprints in the p53 gene. Based on the detection of fingerprints, it may be possible in the future to tell a cancer patient what factor had trigged the maglinancy

Magna Carta: Teaching Medieval Topics for Historical Significance

Science.gov (United States)

Metzger, Scott Alan

2010-01-01

The Middle Ages are an immensely important era in the Western experience. Unfortunately, medieval studies are often marginalized or trivialized in school curriculum. With the approach of the 800th anniversary of Magna Carta, the famous charter of rights from medieval England, one has a timely and useful example for considering what a focus on…

Mid-infrared supercontinuum covering the 1.4–13.3 μm molecular fingerprint region using ultra-high NA chalcogenide step-index fibre

DEFF Research Database (Denmark)

Petersen, Christian Rosenberg; Møller, Uffe Visbech; Kubat, Irnis

2014-01-01

-power laser diodes, quantum cascade lasers and synchrotron radiation have precluded mid-infrared applications where the spatial coherence, broad bandwidth, high brightness and portability of a supercontinuum laser are all required. Here, we demonstrate experimentally that launching intense ultra-short pulses...... the potential of fibres to emit across the mid-infrared molecular ‘fingerprint region’, which is of key importance for applications such as early cancer diagnostics3, gas sensing and food quality control....

Ecotoxicological effect of ketamine: Evidence of acute, chronic and photolysis toxicity to Daphnia magna.

Science.gov (United States)

Li, Shih-Wei; Wang, Yu-Hsiang; Lin, Angela Yu-Chen

2017-09-01

Ketamine has been increasingly used in medicine and has the potential for abuse or illicit use around the world. Ketamine cannot be removed by conventional wastewater treatment plants. Although ketamine and its metabolite norketamine have been detected to a significant degree in effluents and aquatic environments, their ecotoxicity effects in aquatic organisms remain undefined. In this study, we investigated the acute toxicity of ketamine and its metabolite, along with the chronic reproductive toxicity of ketamine (5-100μg/L) to Daphnia magna. Multiple environmental scenarios were also evaluated, including drug mixtures and sunlight irradiation toxicity. Ketamine and norketamine caused acute toxicity to D. magna, with half lethal concentration (LC 50 ) values of 30.93 and 25.35mg/L, respectively, after 48h of exposure. Irradiated solutions of ketamine (20mg/L) significantly increased the mortality of D. magna; pre-irradiation durations up to 2h rapidly increased the death rate to 100%. A new photolysis byproduct (M.W. 241) of norketamine that accumulates during irradiation was identified for the first time. The relevant environmental concentration of ketamine produced significant reproductive toxicity effects in D. magna, as revealed by the reduction of the number of total live offspring by 33.6-49.8% (p ketamine concentration cannot be ignored and warrant further examination. Copyright © 2017 Elsevier Inc. All rights reserved.

The response of European Daphnia magna Straus and Australian Daphnia carinata King to changes in geomagnetic field.

Science.gov (United States)

Krylov, Viacheslav V; Bolotovskaya, Irina V; Osipova, Elena A

2013-03-01

This study investigates the effects of lifelong exposure to reversed geomagnetic and zero geomagnetic fields (the latter means absence of geomagnetic field) on the life history of Daphnia carinata King from Australia and Daphnia magna Straus from Europe. Considerable deviation in the geomagnetic field from the usual strength, leads to a decrease in daphnia size and life span. Reduced brood sizes and increased body length of neonates are observed in D. magna exposed to unusual magnetic background. The most apparent effects are induced by zero geomagnetic field in both species of Daphnia. A delay in the first reproduction in zero geomagnetic field is observed only in D. magna. No adaptive maternal effects to reversed geomagnetic field are found in a line of D. magna maintained in these magnetic conditions for eight generations. Integrally, the responses of D. magna to unusual geomagnetic conditions are more extensive than that in D. carinata. We suggest that the mechanism of the effects of geomagnetic field reversal on Daphnia may be related to differences in the pattern of distribution of the particles that have a magnetic moment, or to moving charged organic molecules owing to a change in combined outcome and orientation of the geomagnetic field and Earth's gravitational field. The possibility of modulation of self-oscillating processes with changes in geomagnetic field is also discussed.

Uptake and depuration of gold nanoparticles in Daphnia magna

DEFF Research Database (Denmark)

Skjolding, Lars Michael; Kern, Kristina; Hjorth, Rune

2014-01-01

This study presents a series of short-term studies (total duration 48 h) of uptake and depuration of engineered nanoparticles (ENP) in neonate Daphnia magna. Gold nanoparticles (Au NP) were used to study the influence of size, stabilizing agent and feeding on uptake and depuration kinetics...

Free ionic nickel accumulation and localization in the freshwater zooplankter, Daphnia magna

International Nuclear Information System (INIS)

Hall, T.M.

1982-01-01

The processes which lead to the accumulation of free ionic nickel (radioactive) from solution by Daphnia magna were studied and incorporated into a model which describes accummulation at different concentrations. Adsorption proved to be a relatively small component of nickel accummulation. The accummulation rate eventually approached zero, which represented an equilibrium between uptake and loss of nickel. However, elimination experiments did reveal a pool of relatively static nickel. The appearance and distribution of nickel within five body parts (body fluid, carapace, gut, filtering appendages, and eggs) of D. magna supported the accummulation data and added to the understanding of the pathways of nickel through the organism

Bioassay of Phenol and its Intermediate Products Using Daphnia magna

Directory of Open Access Journals (Sweden)

Afshin Maleki

2008-06-01

Full Text Available Phenol is one of the most common compounds found in many industrial effluents such as petroleum refining and petrochemicals, pharmaceuticals, pesticides, paint and dye industries, organic chemicals manufacturing, etc. The contamination of bodies of water with phenol is a serious problem in terms of environmental considerations due to its high toxicity. In this study, toxicity of phenol and its degradation mixtures by sonochemical, photochemical, and photosonochemical processes were investigated. Toxicity assay tests were carried out using Daphnia magna as a bio-indicator. The sonochemical and photochemical experiments were carried out using a bath sonicator (500 W working at 35 and 130 kHz frequencies and with a 400 W medium pressure mercury lamp, respectively. Experiments were performed at initial concentrations of 100 mg L-1. Bioassay tests showed that phenol was toxic to D.magna and so resulted in quite low LC50 values. Comparison of toxicity units (TU between phenol and effluent toxicity showed that TU value for photosonochemical effluent was lower than that obtained for phenol, photochemical effluent, and sonochemical effluent. It was found that the toxicity unit of photochemical effluent was lower than that obtained for sonochemical effluent. According to the D.magna acute toxicity test, it is concluded that photosonolysis and photolysis are capable of decreasing the toxicity of by-products formed during the degradation of phenol aqueous solutions. Photosonic and photolytic processes can, therefore, be recommended as a potential approach to the treatment of phenolic wastewater.

The acute toxic effects of 1-alkyl-3-methylimidazolium nitrate ionic liquids on Chlorella vulgaris and Daphnia magna.

Science.gov (United States)

Zhang, Cheng; Zhang, Shuai; Zhu, Lusheng; Wang, Jinhua; Wang, Jun; Zhou, Tongtong

2017-10-01

Given their increasingly widespread application, the toxic effects of ionic liquids (ILs) have become the subject of significant attention in recent years. Therefore, the present study assessed the acute toxic effects of 1-alkyl-3-methylimidazolium nitrate ([C n mim]NO 3 (n = 2, 4, 6, 8, 10, 12)) on Chlorella vulgaris and Daphnia magna. The sensitivity of the tested organism Daphnia magna and the investigated IL concentrations in water using high-performance liquid chromatography (HPLC) were also evaluated to demonstrate the reliability of the present study. The results illustrated that Daphnia magna is indeed sensitive to the reference toxicant and the investigated ILs were stable in the aquatic environment. The 50% effect concentration (EC 50 ) was used to represent the acute toxic effects on Chlorella vulgaris and Daphnia magna. With the increasing alkyl-chain lengths, the toxicity of the investigated ILs increased in both the test organisms. Accordingly, the alkyl-chain lengths can cause significantly toxic effects on aquatic organisms, and Daphnia magna are much more sensitive than Chlorella vulgaris to the imidazolium-based ILs used in the present study. Furthermore, the present study provides more information on the acute toxic effects of 1-alkyl-3-methylimidazolium nitrate. Copyright © 2017 Elsevier Ltd. All rights reserved.

Magna Carta Libertatum – osmisté výročí

Czech Academy of Sciences Publication Activity Database

Blahož, Josef

2015-01-01

Roč. 154, č. 6 (2015), s. 449-464 ISSN 0231-6625 Institutional support: RVO:68378122 Keywords : Magna Carta Libertatum * development of constitutionalism * rule of law Subject RIV: AG - Legal Sciences

Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

Directory of Open Access Journals (Sweden)

Souche Erika L

2011-06-01

Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

Acute and chronic toxicity of veterinary antibiotics to Daphnia magna

DEFF Research Database (Denmark)

Wollenberger, Leah; Halling-Sørensen, B.; Kusk, Kresten Ole

2000-01-01

The acute and chronic toxicity of nine antibiotics used both therapeutically and as growth promoters in intensive farming was investigated on the freshwater crustacean Daphnia magna. The effect of the antibiotics metronidazole (M), olaquindox (OL), oxolinic acid (OA), oxytetracycline (OTC...

New target prediction and visualization tools incorporating open source molecular fingerprints for TB Mobile 2.0.

Science.gov (United States)

Clark, Alex M; Sarker, Malabika; Ekins, Sean

2014-01-01

We recently developed a freely available mobile app (TB Mobile) for both iOS and Android platforms that displays Mycobacterium tuberculosis (Mtb) active molecule structures and their targets with links to associated data. The app was developed to make target information available to as large an audience as possible. We now report a major update of the iOS version of the app. This includes enhancements that use an implementation of ECFP_6 fingerprints that we have made open source. Using these fingerprints, the user can propose compounds with possible anti-TB activity, and view the compounds within a cluster landscape. Proposed compounds can also be compared to existing target data, using a näive Bayesian scoring system to rank probable targets. We have curated an additional 60 new compounds and their targets for Mtb and added these to the original set of 745 compounds. We have also curated 20 further compounds (many without targets in TB Mobile) to evaluate this version of the app with 805 compounds and associated targets. TB Mobile can now manage a small collection of compounds that can be imported from external sources, or exported by various means such as email or app-to-app inter-process communication. This means that TB Mobile can be used as a node within a growing ecosystem of mobile apps for cheminformatics. It can also cluster compounds and use internal algorithms to help identify potential targets based on molecular similarity. TB Mobile represents a valuable dataset, data-visualization aid and target prediction tool.

Dealing with Insufficient Location Fingerprints in Wi-Fi Based Indoor Location Fingerprinting

Directory of Open Access Journals (Sweden)

Kai Dong

2017-01-01

Full Text Available The development of the Internet of Things has accelerated research in the indoor location fingerprinting technique, which provides value-added localization services for existing WLAN infrastructures without the need for any specialized hardware. The deployment of a fingerprinting based localization system requires an extremely large amount of measurements on received signal strength information to generate a location fingerprint database. Nonetheless, this requirement can rarely be satisfied in most indoor environments. In this paper, we target one but common situation when the collected measurements on received signal strength information are insufficient, and show limitations of existing location fingerprinting methods in dealing with inadequate location fingerprints. We also introduce a novel method to reduce noise in measuring the received signal strength based on the maximum likelihood estimation, and compute locations from inadequate location fingerprints by using the stochastic gradient descent algorithm. Our experiment results show that our proposed method can achieve better localization performance even when only a small quantity of RSS measurements is available. Especially when the number of observations at each location is small, our proposed method has evident superiority in localization accuracy.

Rapid changes in water hardness and alkalinity: Calcite formation is lethal to Daphnia magna.

Science.gov (United States)

Bogart, Sarah J; Woodman, Samuel; Steinkey, Dylan; Meays, Cindy; Pyle, Greg G

2016-07-15

There is growing concern that freshwater ecosystems may be negatively affected by ever-increasing anthropogenic inputs of extremely hard, highly alkaline effluent containing large quantities of Ca(2+), Mg(2+), CO3(2-), and HCO3(-) ions. In this study, the toxicity of rapid and extreme shifts in water hardness (38-600mg/L as CaCO3) and alkalinity (30-420mg/L as CaCO3) to Daphnia magna was tested, both independently and in combination. Within these ranges, where no precipitation event occurred, shifts in water hardness and/or alkalinity were not toxic to D. magna. In contrast, 98-100% of D. magna died within 96h after exposure to 600mg/L as CaCO3 water hardness and 420mg/L as CaCO3 alkalinity (LT50 of 60h with a 95% CI of 54.2-66.0h). In this treatment, a CaCO3 (calcite) precipitate formed in the water column which was ingested by and thoroughly coated the D. magna. Calcite collected from a mining impacted stream contained embedded organisms, suggesting field streams may also experience similar conditions and possibly increased mortality as observed in the lab tests. Although further investigation is required to determine the exact fate of aquatic organisms exposed to rapid calcite precipitation in the field, we caution that negative effects may occur more quickly or at lower concentrations of water hardness and alkalinity in which we observed effects in D. magna, because some species, such as aquatic insects, are more sensitive than cladocerans to changes in ionic strength. Our results provide evidence that both calcite precipitation and the major ion balance of waters should be managed in industrially affected ecosystems and we support the development of a hardness+alkalinity guideline for the protection of aquatic life. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Fingerprint Change: Not Visible, But Tangible.

Science.gov (United States)

Negri, Francesca V; De Giorgi, Annamaria; Bozzetti, Cecilia; Squadrilli, Anna; Petronini, Pier Giorgio; Leonardi, Francesco; Bisogno, Luigi; Garofano, Luciano

2017-09-01

Hand-foot syndrome, a chemotherapy-induced cutaneous toxicity, can cause an alteration in fingerprints causing a setback for cancer patients due to the occurrence of false rejections. A colon cancer patient was fingerprinted after not having been able to use fingerprint recognition devices after 6 months of adjuvant chemotherapy. The fingerprint images were digitally processed to improve fingerprint definition without altering the papillary design. No evidence of skin toxicity was present. Two months later, the situation returned to normal. The fingerprint evaluation conducted on 15 identification points highlighted the quantitative and qualitative fingerprint alteration details detected after the end of chemotherapy and 2 months later. Fingerprint alteration during chemotherapy has been reported, but to our knowledge, this particular case is the first ever reported without evident clinical signs. Alternative fingerprint identification methods as well as improved biometric identification systems are needed in case of unexpected situations. © 2017 American Academy of Forensic Sciences.

Rigorous patient-prosthesis matching of Perimount Magna aortic bioprosthesis.

Science.gov (United States)

Nakamura, Hiromasa; Yamaguchi, Hiroki; Takagaki, Masami; Kadowaki, Tasuku; Nakao, Tatsuya; Amano, Atsushi

2015-03-01

Severe patient-prosthesis mismatch, defined as effective orifice area index ≤0.65 cm(2) m(-2), has demonstrated poor long-term survival after aortic valve replacement. Reported rates of severe mismatch involving the Perimount Magna aortic bioprosthesis range from 4% to 20% in patients with a small annulus. Between June 2008 and August 2011, 251 patients (mean age 70.5 ± 10.2 years; mean body surface area 1.55 ± 0.19 m(2)) underwent aortic valve replacement with a Perimount Magna bioprosthesis, with or without concomitant procedures. We performed our procedure with rigorous patient-prosthesis matching to implant a valve appropriately sized to each patient, and carried out annular enlargement when a 19-mm valve did not fit. The bioprosthetic performance was evaluated by transthoracic echocardiography predischarge and at 1 and 2 years after surgery. Overall hospital mortality was 1.6%. Only 5 (2.0%) patients required annular enlargement. The mean follow-up period was 19.1 ± 10.7 months with a 98.4% completion rate. Predischarge data showed a mean effective orifice area index of 1.21 ± 0.20 cm(2) m(-2). Moderate mismatch, defined as effective orifice area index ≤0.85 cm(2) m(-2), developed in 4 (1.6%) patients. None developed severe mismatch. Data at 1 and 2 years showed only two cases of moderate mismatch; neither was severe. Rigorous patient-prosthesis matching maximized the performance of the Perimount Magna, and no severe mismatch resulted in this Japanese population of aortic valve replacement patients. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Comet Assay on Daphnia magna in eco-genotoxicity testing.

Science.gov (United States)

Pellegri, Valerio; Gorbi, Gessica; Buschini, Annamaria

2014-10-01

Detection of potentially hazardous compounds in water bodies is a priority in environmental risk assessment. For the evaluation and monitoring of water quality, a series of methodologies may be applied. Among them, the worldwide used toxicity tests with organisms of the genus Daphnia is one of the most powerful. In recent years, some attempts were made to utilize Daphnia magna in genotoxicity testing as many of the new environmental contaminants are described as DNA-damaging agents in aquatic organisms. The aim of this research was to develop a highly standardized protocol of the Comet Assay adapted for D. magna, especially regarding the isolation of cells derived from the same tissue (haemolymph) from newborn organisms exposed in vivo. Several methods for haemolymph extraction and different Comet Assay parameters were compared. Electrophoretic conditions were adapted in order to obtain minimum DNA migration in cells derived from untreated organisms and, at the same time, maximum sensitivity in specimens treated with known genotoxicants (CdCl2 and H2O2). Additional tests were performed to investigate if life-history traits of the cladoceran (such as the age of adult organisms that provide newborns, the clutch size of origin, the number of generations reared in standard conditions) and the water composition as well, might influence the response of the assay. This study confirms the potential application of the Comet Assay in D. magna for assessing genotoxic loads in aqueous solution. The newly developed protocol could integrate the acute toxicity bioassay, thus expanding the possibility of using this model species in freshwater monitoring (waters, sediment and soil elutriates) and is in line with the spirit of the EU Water Framework Directive in reducing the number of bioassays that involve medium-sized species. Copyright © 2014 Elsevier B.V. All rights reserved.

Toxicity of noradrenaline, a novel anti-biofouling component, to two non-target zooplankton species, Daphnia magna and Ceriodaphnia dubia.

Science.gov (United States)

Overturf, C L; Wormington, A M; Blythe, K N; Gohad, N V; Mount, A S; Roberts, A P

2015-05-01

Noradrenaline (NA) is the active component of novel antifouling agents and acts by preventing attachment of fouling organisms. The goal of this study was to examine the toxicity of NA to the non-target zooplankton D. magna and C. dubia. Neonates were exposed to one of five concentrations of NA and effects on survival, reproduction and molting were determined. Calculated LC50 values were determined to be 46 and 38 μM in C. dubia and D. magna, respectively. A 10-day C. dubia study found that reproduction metrics were significantly impacted at non-lethal concentrations. In D. magna, concentrations greater than 40 μM significantly impacted molting. A toxicity test was conducted with D. magna using oxidized NA, which yielded similar results. These data indicate that both NA and oxidized NA are toxic to non-target zooplankton. Results obtained from this study can be used to guide future ecological risk assessments of catecholamine-based antifouling agents. Copyright © 2015. Published by Elsevier Inc.

Online fingerprint verification.

Science.gov (United States)

Upendra, K; Singh, S; Kumar, V; Verma, H K

2007-01-01

As organizations search for more secure authentication methods for user access, e-commerce, and other security applications, biometrics is gaining increasing attention. With an increasing emphasis on the emerging automatic personal identification applications, fingerprint based identification is becoming more popular. The most widely used fingerprint representation is the minutiae based representation. The main drawback with this representation is that it does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Also, it is difficult quickly to match two fingerprint images containing different number of unregistered minutiae points. In this study filter bank based representation, which eliminates these weakness, is implemented and the overall performance of the developed system is tested. The results have shown that this system can be used effectively for secure online verification applications.

TdPIR minisatellite fingerprinting as a useful new tool for Torulaspora delbrueckii molecular typing.

Science.gov (United States)

Canonico, Laura; Comitini, Francesca; Ciani, Maurizio

2015-05-04

Torulaspora delbrueckii yeast strains are being increasingly applied at the industrial level, such as in the winemaking process, and so their identification and characterisation require effective, fast, accurate, reproducible and reliable approaches. Therefore, the development of typing techniques that allow discrimination at the strain level will provide an essential tool for those working with T. delbrueckii strains. Here, 28 T. delbrueckii strains from various substrates were characterised using different PCR-fingerprinting molecular methods: random amplified polymorphic DNA with polymerase chain reaction (RAPD-PCR), minisatellites SED1, AGA1, DAN4 and the newly designed T. delbrueckii (Td)PIR, and microsatellites (GAC)5 and (GTG)5. The aim was to determine and compare the efficacies, reproducibilities and discriminating powers of these molecular methods. RAPD-PCR using the M13 primers and the newly designed TdPIR3 minisatellite primer pair provided discrimination of the greatest number of T. delbrueckii strains. TdPIR3 clustered the 28 strains into 16 different groups with an efficiency of 100%, while M13 clustered the strains into 17 different groups, although with a lower efficiency of 89%. Moreover, the TdPIR3 primers showed reproducible profiles when the stringency of the PCR protocol was varied, which highlighted the great robustness of this technique. In contrast, variation of the stringency of the M13 PCR protocol resulted in modification of the amplified profiles, which suggested low reproducibility of this technique. Copyright © 2015 Elsevier B.V. All rights reserved.

Performance Evaluation of Manual and Automated (MagNA Pure Nucleic Acid Isolation in HPV Detection and Genotyping Using Roche Linear Array HPV Test

Directory of Open Access Journals (Sweden)

Aikaterini Chranioti

2011-01-01

Full Text Available Nucleic acids of human papillomavirus (HPV isolated by manual extraction method (AmpliLute and automated MagNA pure system were compared and evaluated with cytohistological findings in 253 women. The concordance level between AmpliLute and MagNA was very good 93.3% (=0.864, <.0001. Overall HPVpositivity detected by AmpliLute was 57.3% (30.4% as single and 27% as multiple infections in contrast to MagNA 54.5% (32% and 23%, resp.. Discrepant results observed in 25 cases: 11 MagNA(−/AmpliLute(+, 10 of which had positive histology; 5 MagNA(+/AmpliLute(− with negative histology; 8 MagNA(+/AmpliLute(+: in 7 of which AmpliLute detected extra HPV genotypes and 1 MagNA(invalid/AmpliLute(+ with positive histology. Both methods performed well when compared against cytological (area under curve (AUC of AmpliLute 0.712 versus 0.672 of MagNA and histological diagnoses (AUC of AmpliLute 0.935 versus 0.877 of MagNA, with AmpliLute showing a slightly predominance over MagNA. However, higher sensitivities, specificities, and positive/negative predictive values were obtained by AmpliLute.

Evaluation of Daphnia magna as an indicator of Toxicity and ...

African Journals Online (AJOL)

Performance evaluation of wastewater treatment plants (WWTPs) with special reference to toxicity reduction using Daphnia magna straus as test organism is very important to study the likely adverse effects of the treated wastewater on the aquatic ecosystem of receiving waters and to detect common environmentally ...

Trophic transfer of gold nanoparticles from Euglena gracilis or Chlamydomonas reinhardtii to Daphnia magna

International Nuclear Information System (INIS)

Lee, Woo-Mi; Yoon, Sung-Ji; Shin, Yu-Jin; An, Youn-Joo

2015-01-01

Understanding the trophic transfer of nanoparticles (NPs) is important because NPs are small enough to easily penetrate into organisms. In this study, we evaluated the trophic transfer of gold NPs (AuNPs) within the aquatic food chain. We observed AuNPs transfer from 2 species of primary producers (Chlamydomonas reinhardtii or Euglena gracilis) to the primary consumer (Daphnia magna). Also, bioaccumulation of AuNPs in E. gracilis was higher than that in C. reinhardtii. The reasons for the difference in Au accumulation may be the physical structure of these organisms, and the surface area that is available for interaction with NPs. C. reinhardtii has a cell wall that may act as a barrier to the penetration of NPs. The size of E. gracilis is larger than that of C. reinhardtii. This study demonstrates the trophic transfer of AuNPs from a general producer to a consumer in an aquatic environment. - Highlights: • This study evaluated the trophic transfer of AuNPs in an aquatic food chain. • Chlamydomonas reinhardtii and Euglena gracilis were selected as the primary producers. • Daphnia magna was used as the primary consumer. • The bioaccumulation of AuNPs in E. gracilis was higher than that in C. reinhardtii. • AuNPs were transferred from C. reinhardtii and E. gracilis to D. magna. - Gold nanoparticles can transfer from primary producers (Chlamydomonas reinhardtii or Euglena gracilis) to the primary consumer (Daphnia magna) in an aquatic environment

Effects of symbiotic bacteria on chemical sensitivity of Daphnia magna.

Science.gov (United States)

Manakul, Patcharaporn; Peerakietkhajorn, Saranya; Matsuura, Tomoaki; Kato, Yasuhiko; Watanabe, Hajime

2017-07-01

The crustacean zooplankton Daphnia magna has been widely used for chemical toxicity tests. Although abiotic factors have been well documented in ecotoxicological test protocols, biotic factors that may affect the sensitivity to chemical compounds remain limited. Recently, we identified symbiotic bacteria that are critical for the growth and reproduction of D. magna. The presence of symbiotic bacteria on Daphnia raised the question as to whether these bacteria have a positive or negative effect on toxicity tests. In order to evaluate the effects of symbiotic bacteria on toxicity tests, bacteria-free Daphnia were prepared, and their chemical sensitivities were compared with that of Daphnia with symbiotic bacteria based on an acute immobilization test. The Daphnia with symbiotic bacteria showed higher chemical resistance to nonylphenol, fenoxycarb, and pentachlorophenol than bacteria-free Daphnia. These results suggested potential roles of symbiotic bacteria in the chemical resistance of its host Daphnia. Copyright © 2017 Elsevier Ltd. All rights reserved.

DEGRADATION AND CONSERVATION OF MARBLE IN THE GREEK ROMAN HADRIANIC BATHS IN LEPTIS MAGNA, LIBYA

OpenAIRE

Nabil.A. ABD EL-TAWAB

2012-01-01

The Hadrianic Baths is one of the most important archaeological sites in Leptis Magna- Libya. It was built at the command of Emperor Hadrian in the early 2nd century CE; they represent some of the most lavish structures of Leptis Magna. It is unique in design and building technique. It was built of limestone, marble and brick. This paper mainly describes the deterioration of marble. The marble in the monuments can be classified into several types, based on its color, texture, chemical composi...

Fingerprint separation: an application of ICA

Science.gov (United States)

Singh, Meenakshi; Singh, Deepak Kumar; Kalra, Prem Kumar

2008-04-01

Among all existing biometric techniques, fingerprint-based identification is the oldest method, which has been successfully used in numerous applications. Fingerprint-based identification is the most recognized tool in biometrics because of its reliability and accuracy. Fingerprint identification is done by matching questioned and known friction skin ridge impressions from fingers, palms, and toes to determine if the impressions are from the same finger (or palm, toe, etc.). There are many fingerprint matching algorithms which automate and facilitate the job of fingerprint matching, but for any of these algorithms matching can be difficult if the fingerprints are overlapped or mixed. In this paper, we have proposed a new algorithm for separating overlapped or mixed fingerprints so that the performance of the matching algorithms will improve when they are fed with these inputs. Independent Component Analysis (ICA) has been used as a tool to separate the overlapped or mixed fingerprints.

DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

Science.gov (United States)

Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

2012-01-01

Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

DNA Fingerprinting of Chinese Melon Provides Evidentiary Support of Seed Quality Appraisal

Science.gov (United States)

Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

2012-01-01

Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications. PMID:23285039

DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

Directory of Open Access Journals (Sweden)

Peng Gao

Full Text Available Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines. Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR codes of 471 melon varieties (lines were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

Evaluation of three methods for DNA fingerprinting of Corynebacterium pseudotuberculosis strains isolated from goats in Poland.

Science.gov (United States)

Stefańska, Ilona; Rzewuska, Magdalena; Binek, Marian

2008-01-01

Phenotypic approaches based on metabolic and biological characteristics of Corynebacterium pseudotuberculosis have been limited due to insufficient discrimination between closely related isolates. In this paper we present performance and convenience of three molecular typing methods: BOX-PCR, random amplification of polymorphic DNA (RAPD) and amplification of DNA fragments surrounding rare restriction site (ADSRRS-fingerprinting) in genome analysis of these bacteria. Among examined 61 strains there were distinguished four, eight and 10 different genotypes by BOX-PCR, RAPD and ADSRRS-fingerprinting, respectively. The value of discrimination index was the lowest for BOX-PCR (D = 0.265), much bigger for RAPD (D = 0.539) and the highest for ADSRRS-fingerprinting (D = 0.604). The good discriminatory ability and reproducibility of RAPD and ADSRRS-fingerprinting indicates that those techniques may be particularly applied for epidemiological studies of C. pseudotuberculosis isolates. We found that ADSRRS-fingerprinting is a rapid method offering good discrimination power, excellent reproducibility and may be applied for epidemiological studies of intraspecific genetic relatedness of C. pseudotuberculosis strains.

Fingerprints in Compressed Strings

DEFF Research Database (Denmark)

Bille, Philip; Cording, Patrick Hagge; Gørtz, Inge Li

2013-01-01

The Karp-Rabin fingerprint of a string is a type of hash value that due to its strong properties has been used in many string algorithms. In this paper we show how to construct a data structure for a string S of size N compressed by a context-free grammar of size n that answers fingerprint queries...... derivative that captures LZ78 compression and its variations) we get O(loglogN) query time. Hence, our data structures has the same time and space complexity as for random access in SLPs. We utilize the fingerprint data structures to solve the longest common extension problem in query time O(logNlogℓ) and O....... That is, given indices i and j, the answer to a query is the fingerprint of the substring S[i,j]. We present the first O(n) space data structures that answer fingerprint queries without decompressing any characters. For Straight Line Programs (SLP) we get O(logN) query time, and for Linear SLPs (an SLP...

Study on internal to surface fingerprint correlation using optical coherence tomography and internal fingerprint extraction

CSIR Research Space (South Africa)

Darlow, LN

2015-11-01

Full Text Available of, the above-mentioned works. Internal fingerprint zone detection is an improvement as it uses fuzzy c-means to improve clustering performance, uses better cluster result postprocessing, and improves upon the fine-tuning procedure through... Internal fingerprint extraction consists of two main parts: fingerprint zone detection and extraction. Zone detection uses fuzzy c-means clustering to approximate the location of the papillary junction (i.e., the internal fingerprint zone). Edge detection...

Quantifying sublethal effects of glyphosate and Roundup® to Daphnia magna using a fluorescence based enzyme activity assay and video tracking

DEFF Research Database (Denmark)

Roslev, Peter; R. Hansen, Lone; Ørsted, Michael

Glyphosate (N-(phosphonomethyl)glycine) is the active ingredient in a range of popular broad-spectrum, non-selective herbicide formulations. The toxicity of this herbicide to non-target aquatic organisms such as Daphnia magna is often evaluated using conventional toxicity assays that focus...... on endpoints such as immobility and mortality. In this study, we investigated sublethal effects of glyphosate and Roundup® to D. magna using video tracking for quantifying behavioral changes, and a novel fluorescence based assay for measuring in vivo hydrolytic enzyme activity (FLEA assay). Roundup® exposure...... resulted in concentration-dependent inhibition of alkaline phosphatase activity in D. magna. The inhibition of alkaline phosphatase by Roundup® was temperature-dependent with lowest inhibition at 14 °C and greater inhibition at 20 and 26 °C. Exposure of D. magna to sublethal concentrations of glyphosate...

Modeling Audio Fingerprints : Structure, Distortion, Capacity

NARCIS (Netherlands)

Doets, P.J.O.

2010-01-01

An audio fingerprint is a compact low-level representation of a multimedia signal. An audio fingerprint can be used to identify audio files or fragments in a reliable way. The use of audio fingerprints for identification consists of two phases. In the enrollment phase known content is fingerprinted,

Metabolomic NMR fingerprinting: an exploratory and predictive tool

OpenAIRE

Lauri, Ilaria

2014-01-01

Metabolomics is the comprehensive assessment of low molecular weight organic metabolites within biological system. The identification and characterization of several chemical species, or metabolic fingerprinting, is an emergent approach in metabolomics field that provides a valuable “snapshot” of metabolic profiles. This approach is finding an increasing number of applications in many areas including cancer research, drug discovery and food science. The combined use of NMR spectroscopy, data ...

Fingerprint re-alignment: a solution based on the true fingerprint center point

CSIR Research Space (South Africa)

Msiza, IS

2011-02-01

Full Text Available Solution Based on the True Fingerprint Center Point Ishmael S. Msiza, Brain Leke-Betechuoh, and Tendani Malumedzha Biometrics Research Group ? Information Security CSIR, Modelling & Digital Science Unit Pretoria, Republic of South Africa e... with a pattern that belongs to the Tented Arch (TA) fingerprint class. Fingerprints that belong to the TA class have a single core and a single delta, with the core located almost directly above the delta, as depicted in figure 3 (b). Many singular...

Fingerprint fake detection by optical coherence tomography

Science.gov (United States)

Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

2013-03-01

The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

Classical and quantum fingerprinting strategies

International Nuclear Information System (INIS)

Scott, A.; Walgate, J.; Sanders, B.

2005-01-01

Full text: Fingerprinting enables two parties to infer whether the messages they hold are the same or different when the cost of communication is high: each message is associated with a smaller fingerprint and comparisons between messages are made in terms of their fingerprints alone. When the two parties are forbidden access to a public coin, it is known that fingerprints composed of quantum information can be made exponentially smaller than those composed of classical information. We present specific constructions of classical fingerprinting strategies through the use of constant-weight codes and provide bounds on the worst-case error probability with the help of extremal set theory. These classical strategies are easily outperformed by quantum strategies constructed from line packings and equiangular tight frames. (author)

High pathogenicity and strong immunogenicity of a Chinese isolate of Eimeria magna Pérard, 1925.

Science.gov (United States)

Tao, Geru; Wang, Yunzhou; Li, Chao; Gu, Xiaolong; Cui, Ping; Fang, Sufang; Suo, Xun; Liu, Xianyong

2017-06-01

Coccidia infection of rabbits with one or several species of parasites of the genus Eimeria causes coccidiosis, a disease leading to huge economic losses in the rabbit industry. Eimeria magna, one of the causal agents of rabbit coccidiosis, was characterized as mildly pathogenic and moderately immunogenic in previous studies. In this study, we identified a Chinese isolate of E. magna by testing its biological features (oocyst morphology and size, prepatent time) and sequencing its internal transcribed spacer 1 (ITS-1) DNA fragment. This isolate is highly pathogenic; infection of rabbits with only 1×10 2 oocysts caused a 55% reduction in weight gain in 14days. In addition, immunization with 1×10 2 oocysts prevented body weight loss against re-infection with 5×10 4 oocysts, indicating the high immunogenicity of this isolate. Our study described the distinctive phenotype of the Chinese isolate of E. magna and contributed to the research of geographic variation of rabbit coccidia. Copyright © 2017 Elsevier B.V. All rights reserved.

Fingerprint multicast in secure video streaming.

Science.gov (United States)

Zhao, H Vicky; Liu, K J Ray

2006-01-01

Digital fingerprinting is an emerging technology to protect multimedia content from illegal redistribution, where each distributed copy is labeled with unique identification information. In video streaming, huge amount of data have to be transmitted to a large number of users under stringent latency constraints, so the bandwidth-efficient distribution of uniquely fingerprinted copies is crucial. This paper investigates the secure multicast of anticollusion fingerprinted video in streaming applications and analyzes their performance. We first propose a general fingerprint multicast scheme that can be used with most spread spectrum embedding-based multimedia fingerprinting systems. To further improve the bandwidth efficiency, we explore the special structure of the fingerprint design and propose a joint fingerprint design and distribution scheme. From our simulations, the two proposed schemes can reduce the bandwidth requirement by 48% to 87%, depending on the number of users, the characteristics of video sequences, and the network and computation constraints. We also show that under the constraint that all colluders have the same probability of detection, the embedded fingerprints in the two schemes have approximately the same collusion resistance. Finally, we propose a fingerprint drift compensation scheme to improve the quality of the reconstructed sequences at the decoder's side without introducing extra communication overhead.

Bioavailability and effect of pirimicarb on Daphnia magna in a laboratory freshwater/sediment system

DEFF Research Database (Denmark)

Kusk, K.O.

1996-01-01

In tests with newborn and one-week-old Daphnia magna, 48-h EC(50) values of 21-24 mu g/L and 16 mu g/L pirimicarb, respectively, were found. Older animals thus were as sensitive to pirimicarb as newborn animals. In an experiment with sediment included in the test system, all mother animals survived...... not reduced significantly during the experiment, due to the small amount of sediment used. Accumulation in the sediment was found independent of the water concentration used. This was also the case with bioaccumulation in Daphnia magna, where a bioaccumulation factor of 31-37 was found on a dry weight basis...

Comparative effects of graphene and graphene oxide on copper toxicity to Daphnia magna: Role of surface oxygenic functional groups.

Science.gov (United States)

Liu, Yingying; Fan, Wenhong; Xu, Zhizhen; Peng, Weihua; Luo, Shenglian

2018-05-01

Although the risk of graphene materials to aquatic organisms has drawn wide attention, the combined effects of graphene materials with other contaminants such as toxic metals, which may bring about more serious effects than graphene materials alone, have seldom been explored. Herein, the effects of graphene (GN) and graphene oxide (GO, an important oxidized derivative of graphene) on copper (Cu) toxicity to Daphnia magna were systematically investigated. The results indicated that GN remarkably increased the Cu accumulation in D. magna and enhanced the oxidative stress injury caused by Cu, whereas did not significantly alter D. magna acute mortality within the tested Cu concentrations (0-200 μg L -1 ). On the contrary, GO significantly decreased the Cu accumulation in D. magna and alleviated the oxidative stress injury caused by Cu. Meanwhile, the presence of GO significantly reduced the mortality of D. magna when Cu concentration exceeded 50 μg L -1 . The different effects of GN and GO on Cu toxicity were possibly dependent on the action of surface oxygenic functional group. Because of the introduction of surface oxygenic functional groups, the adsorption ability to metal ions, stability in water and interaction mode with organisms of GO are quite different from that of GN, causing different effects on Cu toxicity. This study provides important information on the bioavailability and toxicity of heavy metals as affected by graphene materials in natural water. Copyright © 2017 Elsevier Ltd. All rights reserved.

Advances in fingerprint analysis.

Science.gov (United States)

Hazarika, Pompi; Russell, David A

2012-04-10

Fingerprints have been used in forensic investigations for the identification of individuals since the late 19th century. However, it is now clear that fingerprints can provide significantly more information about an individual. Here, we highlight the considerable advances in fingerprinting technology that can simultaneously provide chemical information regarding the drugs ingested and the explosives and drugs handled by a person as well as the identity of that individual. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Uptake and effects of microplastic textile fibers on freshwater crustacean Daphnia magna.

Science.gov (United States)

Jemec, Anita; Horvat, Petra; Kunej, Urban; Bele, Marjan; Kržan, Andrej

2016-12-01

Microplastic fibers (MP) from textile weathering and washing are increasingly being recognized as environmental pollutants. The majority of studies on the bioavailability and effects of microplastic focused on small polystyrene spherical plastic particles, while less data are available for fibers and for other materials besides polystyrene. We investigated the ingestion and effects of ground polyethylene terephthalate (PET) textile microfibers (length range: 62-1400 μm, width 31-528 μm, thickness 1-21.5 μm) on the freshwater zooplankton crustacean Daphnia magna after a 48 h exposure and subsequent 24 h of recovery in MP free medium and algae. The majority of ingested fibers by D. magna were around 300 μm, but also some very large twisted MP fibers around 1400 μm were found inside the gut. Exposure to these fibers results in increased mortality of daphnids after 48 h only in the case where daphnids were not pre-fed with algae prior to experiment, but no effect was found when daphnids were fed before the experiments. Regardless of the feeding regime, daphnids were not able to recover from MP exposure after additional 24 h incubation period in a MP free medium with algae. The uptake and effects of PET textile MP on D. magna are presented here for the first time. Copyright © 2016 Elsevier Ltd. All rights reserved.

Influence of Skin Diseases on Fingerprint Recognition

Science.gov (United States)

Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

2012-01-01

There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

Influence of Skin Diseases on Fingerprint Recognition

Directory of Open Access Journals (Sweden)

Martin Drahansky

2012-01-01

Full Text Available There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described.

Flow cytometric fingerprinting for microbial strain discrimination and physiological characterization.

Science.gov (United States)

Buysschaert, Benjamin; Kerckhof, Frederiek-Maarten; Vandamme, Peter; De Baets, Bernard; Boon, Nico

2018-02-01

The analysis of microbial populations is fundamental, not only for developing a deeper understanding of microbial communities but also for their engineering in biotechnological applications. Many methods have been developed to study their characteristics and over the last few decades, molecular analysis tools, such as DNA sequencing, have been used with considerable success to identify the composition of microbial populations. Recently, flow cytometric fingerprinting is emerging as a promising and powerful method to analyze bacterial populations. So far, these methods have primarily been used to observe shifts in the composition of microbial communities of natural samples. In this article, we apply a flow cytometric fingerprinting method to discriminate among 29 Lactobacillus strains. Our results indicate that it is possible to discriminate among 27 Lactobacillus strains by staining with SYBR green I and that the discriminatory power can be increased by combined SYBR green I and propidium iodide staining. Furthermore, we illustrate the impact of physiological changes on the fingerprinting method by demonstrating how flow cytometric fingerprinting is able to discriminate the different growth phases of a microbial culture. The sensitivity of the method is assessed by its ability to detect changes in the relative abundance of a mix of polystyrene beads down to 1.2%. When a mix of bacteria was used, the sensitivity was as between 1.2% and 5%. The presented data demonstrate that flow cytometric fingerprinting is a sensitive and reproducible technique with the potential to be applied as a method for the dereplication of bacterial isolates. © 2017 International Society for Advancement of Cytometry. © 2017 International Society for Advancement of Cytometry.

Fingerprint start the next generation of payment method : Fingerprint payment: a new mode of mobile payment

OpenAIRE

Wu, Chong

2016-01-01

In the generation of mobile internet, fingerprint payment is one of the most popular topics at the moment. China has a big market and many users are using the mobile payment methods. There are a large number of mobile phones equipped with fingerprint recognition technology. As we know, fingerprint payment brings us more convenience and safety. We do not need to use many bankcards, and fingerprint also eliminates the users from the trouble of queuing to pay. However, users send traditional dig...

Reference point detection for improved fingerprint matching

NARCIS (Netherlands)

Ignatenko, T.; Kalker, A.A.C.M.; Veen, van der M.; Bazen, A.; Delp, E.J.; Wong, P.W.

2006-01-01

One of the important stages of fingerprint recognition is the registration of the fingerprints with respect to the original template. This is not a straightforward task as fingerprint images may have been subject to rotations and translations. Popular techniques for fingerprint registration use a

Genetically modified rice Bt-Shanyou63 expressing Cry1Ab/c protein does not harm Daphnia magna.

Science.gov (United States)

Zhang, Li; Guo, Ruqing; Fang, Zhixiang; Liu, Biao

2016-10-01

The genetically modified (GM) rice Bt-ShanYou63 (Bt-SY63) received an official biosafety certificate while its safety remained in dispute. In a lifelong study, Daphnia magna were experimentally fed a basal diet of rice flours from Bt-SY63 or its parental rice ShanYou63 (SY63) at concentrations of 0.2mg, 0.3mg, or 0.4mgC (per individual per day). Overall the survival, body size, and reproduction of the animals were comparable between Bt-SY63 and ShanYou63.. The results showed that no significant differences were observed in growth and reproduction parameters between D. magna fed GM and non-GM flour and no dose-related changes occurred in all the values. Based on the different parameters assessed, the GM rice Bt-SY63 is a safe food source for D. magna that does not differ in quality from non-GM rice. Copyright © 2016. Published by Elsevier Inc.

Acute and Chronic Toxicity of Soluble Fractions of Industrial Solid Wastes on Daphnia magna and Vibrio fischeri

Directory of Open Access Journals (Sweden)

Letícia Flohr

2012-01-01

Full Text Available Industrial wastes may produce leachates that can contaminate the aquatic ecosystem. Toxicity testing in acute and chronic levels is essential to assess environmental risks from the soluble fractions of these wastes, since only chemical analysis may not be adequate to classify the hazard of an industrial waste. In this study, ten samples of solid wastes from textile, metal-mechanic, and pulp and paper industries were analyzed by acute and chronic toxicity tests with Daphnia magna and Vibrio fischeri. A metal-mechanic waste (sample MM3 induced the highest toxicity level to Daphnia magna(CE50,48 h=2.21%. A textile waste induced the highest toxicity level to Vibrio fischeri (sample TX2, CE50,30 min=12.08%. All samples of pulp and paper wastes, and a textile waste (sample TX2 induced chronic effects on reproduction, length, and longevity of Daphnia magna. These results could serve as an alert about the environmental risks of an inadequate waste classification method.

Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

Energy Technology Data Exchange (ETDEWEB)

Redman, R.S.; Rodriguez, R.J. (Geological Survey, Seattle, WA (United States) Univ. of Washington, Seattle, WA (United States). Dept. of Botany); Clifton, D.R.; Morrel, J.; Brown, G. (Geological Survey, Seattle, WA (United States)); Freeman, S. (Volcani Center, Bet Dagan (Israel). Dept. of Plant Pathology)

1999-02-01

A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) plant-defense response were investigated in anthracnose-resistant and-susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h and then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1-colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.

Daphnia magna fitness during low food supply under different water temperature and brownification scenarios

Directory of Open Access Journals (Sweden)

Andrea Gall

2016-11-01

Full Text Available Much of our current knowledge about non-limiting dietary carbon supply for herbivorous zooplankton is based on experimental evidence and typically conducted at ~1 mg C L-1 and ~20°C. Here we ask how low supply of dietary carbon affects somatic growth, reproduction, and survival of Daphnia magna and test effects of higher water temperature (+3 °C relative to ambient and brownification (3X higher than natural water color; both predicted effects of climate change during fall cooling. We predicted that even at very low carbon supply (~5µg C L-1, higher water temperature and brownification will allow D. magna to increase its fitness. Neonates (<24 h old were incubated with lake seston for 4 weeks (October-November 2013 in experimental bottles submerged in outdoor mesocosms to explore effects of warmer and darker water. Higher temperature and brownification did not significantly affect food quality, as assessed by its fatty acid composition. Daphnia exposed to both increased temperature and brownification had highest somatic growth and were the only that reproduced, and higher temperature caused the highest Daphnia survival success. These results suggest that even under low temperature and thus lower physiological activity, low food quantity is more important than its quality for D. magna fitness.

CRISPR/Cas-mediated knock-in via non-homologous end-joining in the crustacean Daphnia magna.

Science.gov (United States)

Kumagai, Hitoshi; Nakanishi, Takashi; Matsuura, Tomoaki; Kato, Yasuhiko; Watanabe, Hajime

2017-01-01

The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated system (Cas) is widely used for mediating the knock-in of foreign DNA into the genomes of various organisms. Here, we report a process of CRISPR/Cas-mediated knock-in via non-homologous end joining by the direct injection of Cas9/gRNA ribonucleoproteins (RNPs) in the crustacean Daphnia magna, which is a model organism for studies on toxicology, ecology, and evolution. First, we confirmed the cleavage activity of Cas9 RNPs comprising purified Cas9 proteins and gRNAs in D. magna. We used a gRNA that targets exon 10 of the eyeless gene. Cas9 proteins were incubated with the gRNAs and the resulting Cas9 RNPs were injected into D. magna eggs, which led to a typical phenotype of the eyeless mutant, i.e., eye deformity. The somatic and heritable mutagenesis efficiencies were up to 96% and 40%, respectively. Second, we tested the CRISPR/Cas-mediated knock-in of a plasmid by the injection of Cas9 RNPs. The donor DNA plasmid harboring the fluorescent reporter gene was designed to contain the gRNA recognition site. The co-injection of Cas9 RNPs together with the donor DNAs resulted in generation of one founder animal that produced fluorescent progenies. This transgenic Daphnia had donor DNA at the targeted genomic site, which suggested the concurrent cleavage of the injected plasmid DNA and genomic DNA. Owing to its simplicity and ease of experimental design, we suggest that the CRISPR/Cas-mediated knock-in method represents a promising tool for studying functional genomics in D. magna.

Genes mirror geography in Daphnia magna.

Science.gov (United States)

Fields, Peter D; Reisser, Céline; Dukić, Marinela; Haag, Christoph R; Ebert, Dieter

2015-09-01

Identifying the presence and magnitude of population genetic structure remains a major consideration in evolutionary biology as doing so allows one to understand the demographic history of a species as well as make predictions of how the evolutionary process will proceed. Next-generation sequencing methods allow us to reconsider previous ideas and conclusions concerning the distribution of genetic variation, and what this distribution implies about a given species evolutionary history. A previous phylogeographic study of the crustacean Daphnia magna suggested that, despite strong genetic differentiation among populations at a local scale, the species shows only moderate genetic structure across its European range, with a spatially patchy occurrence of individual lineages. We apply RAD sequencing to a sample of D. magna collected across a wide swath of the species' Eurasian range and analyse the data using principle component analysis (PCA) of genetic variation and Procrustes analytical approaches, to quantify spatial genetic structure. We find remarkable consistency between the first two PCA axes and the geographic coordinates of individual sampling points, suggesting that, on a continent-wide scale, genetic differentiation is driven to a large extent by geographic distance. The observed pattern is consistent with unimpeded (i.e. no barriers, landscape or otherwise) migration at large spatial scales, despite the fragmented and patchy nature of favourable habitats at local scales. With high-resolution genetic data similar patterns may be uncovered for other species with wide geographic distributions, allowing an increased understanding of how genetic drift and selection have shaped their evolutionary history. © 2015 John Wiley & Sons Ltd.

Data Compression of Fingerprint Minutiae

OpenAIRE

VISHAL SHRIVASTAVA; SUMIT SHARMA

2012-01-01

Biometric techniques have usual advantages over conventional personal identification technique. Among various commercially available biometric techniques such as face, fingerprint, Iris etc., fingerprint-based techniques are the most accepted recognition system. Fingerprints are trace or impression of patterns created byfriction ridges of the skin in the fingers and thumbs. Steganography usually used in smart card is a safe technique for authenticating a person. In steganography, biometric ch...

Assessment of the effects of the carbamazepine on the endogenous endocrine system of Daphnia magna.

Science.gov (United States)

Oropesa, A L; Floro, A M; Palma, P

2016-09-01

In the present study, the endocrine activity of the antiepileptic pharmaceutical carbamazepine (CBZ) in the crustacean Daphnia magna was assessed. To assess the hormonal activity of the drug, we exposed maternal daphnids and embryos to environmental relevant concentrations of CBZ (ranging from 10 to 200 μg/L) and to mixtures of CBZ with fenoxycarb (FEN; 1 μg/L). Chronic exposure to CBZ significantly decreased the reproductive output and the number of molts of D. magna at 200 μg/L. This compound induced the production of male offspring (12 ± 1.7 %), in a non-concentration-dependent manner, acting as a weak juvenile hormone analog. Results showed that this substance, at tested concentrations, did not antagonize the juvenoid action of FEN. Further, CBZ has shown to be toxic to daphnid embryos through maternal exposure interfering with their normal gastrulation and organogenesis stages but not producing direct embryo toxicity. These findings suggest that CBZ could act as an endocrine disruptor in D. magna as it decreases the reproductive output, interferes with sex determination, and causes development abnormality in offspring. Therefore, CBZ could directly affect the population sustainability.

Fingerprint Recognition Using Minutia Score Matching

OpenAIRE

J, Ravi.; Raja, K. B.; R, Venugopal. K.

2010-01-01

The popular Biometric used to authenticate a person is Fingerprint which is unique and permanent throughout a person’s life. A minutia matching is widely used for fingerprint recognition and can be classified as ridge ending and ridge bifurcation. In this paper we projected Fingerprint Recognition using Minutia Score Matching method (FRMSM). For Fingerprint thinning, the Block Filter is used, which scans the image at the boundary to preserves the quality of the image and extract the minutiae ...

Male meiosis in Crustacea: synapsis, recombination, epigenetics and fertility in Daphnia magna.

Science.gov (United States)

Gómez, Rocío; Van Damme, Kay; Gosálvez, Jaime; Morán, Eugenio Sánchez; Colbourne, John K

2016-09-01

We present the first detailed cytological study of male meiosis in Daphnia (Crustacea: Branchiopoda: Cladocera)-an aquatic microcrustacean with a cyclical parthenogenetic life cycle. Using immunostaining of the testes in Daphnia magna for baseline knowledge, we characterized the different stages of meiotic division and spermiogenesis in relation to the distribution of proteins involved in synapsis, early recombination events and sister chromatid cohesion. We also studied post-translational histone modifications in male spermatocytes, in relation to the dynamic chromatin progression of meiosis. Finally, we applied a DNA fragmentation test to measure sperm quality of D. magna, with respect to levels of inbreeding. As a proxy for fertility, this technique may be used to assess the reproductive health of a sentinel species of aquatic ecosystems. Daphnia proves to be a model species for comparative studies of meiosis that is poised to improve our understanding of the cytological basis of sexual and asexual reproduction.

Fingerprint verification prediction model in hand dermatitis.

Science.gov (United States)

Lee, Chew K; Chang, Choong C; Johor, Asmah; Othman, Puwira; Baba, Roshidah

2015-07-01

Hand dermatitis associated fingerprint changes is a significant problem and affects fingerprint verification processes. This study was done to develop a clinically useful prediction model for fingerprint verification in patients with hand dermatitis. A case-control study involving 100 patients with hand dermatitis. All patients verified their thumbprints against their identity card. Registered fingerprints were randomized into a model derivation and model validation group. Predictive model was derived using multiple logistic regression. Validation was done using the goodness-of-fit test. The fingerprint verification prediction model consists of a major criterion (fingerprint dystrophy area of ≥ 25%) and two minor criteria (long horizontal lines and long vertical lines). The presence of the major criterion predicts it will almost always fail verification, while presence of both minor criteria and presence of one minor criterion predict high and low risk of fingerprint verification failure, respectively. When none of the criteria are met, the fingerprint almost always passes the verification. The area under the receiver operating characteristic curve was 0.937, and the goodness-of-fit test showed agreement between the observed and expected number (P = 0.26). The derived fingerprint verification failure prediction model is validated and highly discriminatory in predicting risk of fingerprint verification in patients with hand dermatitis. © 2014 The International Society of Dermatology.

High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

DEFF Research Database (Denmark)

Kokotovic, Branko; On, Stephen L.W.

1999-01-01

A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...

Automated extraction of genomic DNA from medically important yeast species and filamentous fungi by using the MagNA Pure LC system.

Science.gov (United States)

Loeffler, Juergen; Schmidt, Kathrin; Hebart, Holger; Schumacher, Ulrike; Einsele, Hermann

2002-06-01

A fully automated assay was established for the extraction of DNA from clinically important fungi by using the MagNA Pure LC instrument. The test was evaluated by DNA isolation from 23 species of yeast and filamentous fungi and by extractions (n = 28) of serially diluted Aspergillus fumigatus conidia (10(5) to 0 CFU/ml). Additionally, DNA from 67 clinical specimens was extracted and compared to the manual protocol. The detection limit of the MagNA Pure LC assay of 10 CFU corresponded to the sensitivity when DNA was extracted manually; in 9 of 28 runs, we could achieve a higher sensitivity of 1 CFU/ml blood, which was found to be significant (p DNA from all fungal species analyzed could be extracted and amplified by real-time PCR. Negative controls from all MagNA Pure isolations remained negative. Sixty-three clinical samples showed identical results by both methods, whereas in 4 of 67 samples, discordant results were obtained. Thus, the MagNA Pure LC technique offers a fast protocol for automated DNA isolation from numerous fungi, revealing high sensitivity and purity.

An effective one-dimensional anisotropic fingerprint enhancement algorithm

Science.gov (United States)

Ye, Zhendong; Xie, Mei

2012-01-01

Fingerprint identification is one of the most important biometric technologies. The performance of the minutiae extraction and the speed of the fingerprint verification system rely heavily on the quality of the input fingerprint images, so the enhancement of the low fingerprint is a critical and difficult step in a fingerprint verification system. In this paper we proposed an effective algorithm for fingerprint enhancement. Firstly we use normalization algorithm to reduce the variations in gray level values along ridges and valleys. Then we utilize the structure tensor approach to estimate each pixel of the fingerprint orientations. At last we propose a novel algorithm which combines the advantages of onedimensional Gabor filtering method and anisotropic method to enhance the fingerprint in recoverable region. The proposed algorithm has been evaluated on the database of Fingerprint Verification Competition 2004, and the results show that our algorithm performs within less time.

Better Alone or in Ill Company? The Effect of Migration and Inter-Species Comingling on Fascioloides magna Infection in Elk.

Science.gov (United States)

Pruvot, Mathieu; Lejeune, Manigandan; Kutz, Susan; Hutchins, Wendy; Musiani, Marco; Massolo, Alessandro; Orsel, Karin

2016-01-01

Migratory movements and alteration of host communities through livestock production are examples of ecological processes that may have consequences on wildlife pathogens. We studied the effect of co-grazing of cattle and wild elk, and of elk migratory behaviour on the occurrence of the giant liver fluke, Fascioloides magna, in elk. Migratory elk and elk herds with a higher proportion of migratory individuals were significantly less likely to be infected with F. magna. This may indicate a decreased risk of infection for migratory individuals, known as the "migratory escape" hypothesis. Elk herds overlapping with higher cattle densities also had a lower prevalence of this parasite, even after adjustment for landscape and climate variables known to influence its life cycle. Serological evidence suggests that even in low-prevalence areas, F. magna is circulating in both elk and cattle. Cattle are "dead-end" hosts for F. magna, and this may, therefore, indicate a dilution effect where cattle and elk are co-grazing. Migratory behaviour and host community composition have significant effects on the dynamics of this wildlife parasite; emphasizing the potential impacts of decisions regarding the management of migratory corridors and livestock-wildlife interface.

Better Alone or in Ill Company? The Effect of Migration and Inter-Species Comingling on Fascioloides magna Infection in Elk.

Directory of Open Access Journals (Sweden)

Mathieu Pruvot

Full Text Available Migratory movements and alteration of host communities through livestock production are examples of ecological processes that may have consequences on wildlife pathogens. We studied the effect of co-grazing of cattle and wild elk, and of elk migratory behaviour on the occurrence of the giant liver fluke, Fascioloides magna, in elk. Migratory elk and elk herds with a higher proportion of migratory individuals were significantly less likely to be infected with F. magna. This may indicate a decreased risk of infection for migratory individuals, known as the "migratory escape" hypothesis. Elk herds overlapping with higher cattle densities also had a lower prevalence of this parasite, even after adjustment for landscape and climate variables known to influence its life cycle. Serological evidence suggests that even in low-prevalence areas, F. magna is circulating in both elk and cattle. Cattle are "dead-end" hosts for F. magna, and this may, therefore, indicate a dilution effect where cattle and elk are co-grazing. Migratory behaviour and host community composition have significant effects on the dynamics of this wildlife parasite; emphasizing the potential impacts of decisions regarding the management of migratory corridors and livestock-wildlife interface.

Mass spectral chemical fingerprints reveal the molecular dependence of exhaust particulate matters on engine speeds.

Science.gov (United States)

Li, Yi; Zhang, Hua; Zhao, Zongshan; Tian, Yong; Liu, Kun; Jie, Feifan; Zhu, Liang; Chen, Huanwen

2018-05-01

Particulate matters (PMs) emitted by automobile exhaust contribute to a significant fraction of the global PMs. Extractive atmospheric pressure chemical ionization mass spectrometry (EAPCI-MS) was developed to explore the molecular dependence of PMs collected from exhaust gases produced at different vehicle engine speeds. The mass spectral fingerprints of the organic compounds embedded in differentially sized PMs (e.g., 0.22-0.45, 0.45-1.00, 1.00-2.00, 2.00-3.00, 3.00-5.00, and 5.00-10.00μm) generated at different engine speeds (e.g., 1000, 1500, 2000, 2500, and 3000r/min) were chemically profiled in the mass range of mass to charge ratio (m/z) 50-800. Organic compounds, including alcohols, aldehydes, and esters, were detected in all the PMs tested, with varied concentration levels for each individual PM sample. At relatively low engine speeds (≤1500r/min), the total amount of organic species embedded in PMs of 0.22-1.00μm was greater than in PMs of other sizes, while more organic species were found in PMs of 5.00-10.00μm at high engine speeds (≥3000r/min), indicating that the organic compounds distributed in different sizes of PMs strongly correlated with the engine speed. The experimental data showed that the EAPCI-MS technique enables molecular characterization of PMs in exhaust, revealing the chemical dependence of PMs on the engine speeds (i.e., the combustion conditions) of automobiles. Copyright © 2017. Published by Elsevier B.V.

An Introduction to DNA Fingerprinting.

Science.gov (United States)

Hepfer, Carol Ely; And Others

1993-01-01

Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

Nano-TiO2 enhances the toxicity of copper in natural water to Daphnia magna

International Nuclear Information System (INIS)

Fan Wenhong; Cui Minming; Liu Hong; Wang Chuan; Shi Zhiwei; Tan Cheng; Yang Xiuping

2011-01-01

The acute toxicity of engineered nanoparticles (NPs) in aquatic environments at high concentrations has been well-established. This study demonstrates that, at a concentration generally considered to be safe in the environment, nano-TiO 2 remarkably enhanced the toxicity of copper to Daphnia magna by increasing the copper bioaccumulation. Specifically, at 2 mg L -1 nano-TiO 2 , the (LC 50 ) of Cu 2+ concentration observed to kill half the population, decreased from 111 μg L -1 to 42 μg L -1 . Correspondingly, the level of metallothionein decreased from 135 μg g -1 wet weight to 99 μg g -1 wet weight at a Cu 2+ level of 100 μg L -1 . The copper was found to be adsorbed onto the nano-TiO 2 , and ingested and accumulated in the animals, thereby causing toxic injury. The nano-TiO 2 may compete for free copper ions with sulfhydryl groups, causing the inhibition of the detoxification by metallothioneins. - Research highlights: → This study demonstrates that, at a concentration generally considered to be safe in the environment, nano-TiO 2 remarkably enhanced the toxicity of copper to Daphnia magna. → The copper was found to be adsorbed onto the nano-TiO 2 , and ingested and accumulated in the Daphnia magna, thereby causing toxic injury. → The nano-TiO 2 may compete for free copper ions with sulfhydryl groups, causing the inhibition of the detoxification mechanism of metallothionein. - The nano-TiO 2 remarkably enhanced the toxicity of copper to Daphnia magna. The nano-TiO 2 may compete for free copper ions with sulfhydryl groups, causing the inhibition of the detoxification mechanism of metallothionein.

Applications of the rep-PCR DNA fingerprinting technique to study microbial diversity, ecology and evolution.

Science.gov (United States)

Ishii, Satoshi; Sadowsky, Michael J

2009-04-01

A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.

An investigation of fake fingerprint detection approaches

Science.gov (United States)

Ahmad, Asraful Syifaa'; Hassan, Rohayanti; Othman, Razib M.

2017-10-01

The most reliable biometrics technology, fingerprint recognition is widely used in terms of security due to its permanence and uniqueness. However, it is also vulnerable to the certain type of attacks including presenting fake fingerprints to the sensor which requires the development of new and efficient protection measures. Particularly, the aim is to identify the most recent literature related to the fake fingerprint recognition and only focus on software-based approaches. A systematic review is performed by analyzing 146 primary studies from the gross collection of 34 research papers to determine the taxonomy, approaches, online public databases, and limitations of the fake fingerprint. Fourteen software-based approaches have been briefly described, four limitations of fake fingerprint image were revealed and two known fake fingerprint databases were addressed briefly in this review. Therefore this work provides an overview of an insight into the current understanding of fake fingerprint recognition besides identifying future research possibilities.

Studies on Chromatographic Fingerprint and Fingerprinting Profile-Efficacy Relationship of Saxifraga stolonifera Meerb.

Directory of Open Access Journals (Sweden)

Xing-Dong Wu

2015-12-01

Full Text Available This work investigated the spectrum-effect relationships between high performance liquid chromatography (HPLC fingerprints and the anti-benign prostatic hyperplasia activities of aqueous extracts from Saxifraga stolonifera. The fingerprints of S. stolonifera from various sources were established by HPLC and evaluated by similarity analysis (SA, hierarchical clustering analysis (HCA and principal component analysis (PCA. Nine samples were obtained from these 24 batches of different origins, according to the results of SA, HCA and the common chromatographic peaks area. A testosterone-induced mouse model of benign prostatic hyperplasia (BPH was used to establish the anti-benign prostatic hyperplasia activities of these nine S. stolonifera samples. The model was evaluated by analyzing prostatic index (PI, serum acid phosphatase (ACP activity, concentrations of serum dihydrotestosterone (DHT, prostatic acid phosphatase (PACP and type II 5α-reductase (SRD5A2. The spectrum-effect relationships between HPLC fingerprints and anti-benign prostatic hyperplasia activities were investigated using Grey Correlation Analysis (GRA and partial least squares regression (PLSR. The results showed that a close correlation existed between the fingerprints and anti-benign prostatic hyperplasia activities, and peak 14 (chlorogenic acid, peak 17 (quercetin 5-O-β-d-glucopyranoside and peak 18 (quercetin 3-O-β-l-rhamno-pyranoside in the HPLC fingerprints might be the main active components against anti-benign prostatic hyperplasia. This work provides a general model for the study of spectrum-effect relationships of S. stolonifera by combing HPLC fingerprints with a testosterone-induced mouse model of BPH, which can be employed to discover the principle components of anti-benign prostatic hyperplasia bioactivity.

Food mediated life history strategies in Daphnia magna : their relevance to ecotoxicological evaluations

NARCIS (Netherlands)

Enserink, E.L.

1995-01-01

The waterflea Daphnia magna is a widely used test organism in ecotoxicological studies. Acute and chronic laboratory tests yield basic information for the development of water quality standards, assessment of potential hazards of (new) chemicals, waste water licences and

Three-dimensional fingerprint recognition by using convolution neural network

Science.gov (United States)

Tian, Qianyu; Gao, Nan; Zhang, Zonghua

2018-01-01

With the development of science and technology and the improvement of social information, fingerprint recognition technology has become a hot research direction and been widely applied in many actual fields because of its feasibility and reliability. The traditional two-dimensional (2D) fingerprint recognition method relies on matching feature points. This method is not only time-consuming, but also lost three-dimensional (3D) information of fingerprint, with the fingerprint rotation, scaling, damage and other issues, a serious decline in robustness. To solve these problems, 3D fingerprint has been used to recognize human being. Because it is a new research field, there are still lots of challenging problems in 3D fingerprint recognition. This paper presents a new 3D fingerprint recognition method by using a convolution neural network (CNN). By combining 2D fingerprint and fingerprint depth map into CNN, and then through another CNN feature fusion, the characteristics of the fusion complete 3D fingerprint recognition after classification. This method not only can preserve 3D information of fingerprints, but also solves the problem of CNN input. Moreover, the recognition process is simpler than traditional feature point matching algorithm. 3D fingerprint recognition rate by using CNN is compared with other fingerprint recognition algorithms. The experimental results show that the proposed 3D fingerprint recognition method has good recognition rate and robustness.

Latent fingerprints on different type of screen protective films

Directory of Open Access Journals (Sweden)

Yuttana Sudjaroen

2016-07-01

Full Text Available The purpose of this research was to study the quality of latent fingerprint on different types of screen protective films including screen protector, matte screen protector, anti-fingerprint clear screen protector and anti-fingerprint matte screen protector by using black powder method in developing latent fingerprints. The fingerprints were performed by 10 volunteers whose fingers (right index, right thumb, left index and left thumb were stubbing at different types of screen protective films and subsequently latent fingerprints were developed by brushing with black powder. Automated Fingerprint Identification System (AFIS counted the numbers of minutiae points from 320 latent fingerprints. Anti-fingerprint matte screen protective film produced the best quality of latent fingerprint with an average minutiae point 72.65, followed by matte screen protective film, clear screen protective film and anti-fingerprint clear screen protective film with an average minutiae point of 155.2, 135.0 and 72.65 respectively. The quality of latent fingerprints developed between a clear and a matte surface of screen protective films showed a significant difference (sig>0.05, whereas the coat and the non-coat with anti-fingerprint chemical revealed a non-significant difference (sig<0.05 in their number of minutiae points.

Fingerprints in compressed strings

DEFF Research Database (Denmark)

Bille, Philip; Gørtz, Inge Li; Cording, Patrick Hagge

2017-01-01

In this paper we show how to construct a data structure for a string S of size N compressed into a context-free grammar of size n that supports efficient Karp–Rabin fingerprint queries to any substring of S. That is, given indices i and j, the answer to a query is the fingerprint of the substring S......[i,j]. We present the first O(n) space data structures that answer fingerprint queries without decompressing any characters. For Straight Line Programs (SLP) we get O(log⁡N) query time, and for Linear SLPs (an SLP derivative that captures LZ78 compression and its variations) we get O(log⁡log⁡N) query time...

Case study of 3D fingerprints applications.

Directory of Open Access Journals (Sweden)

Feng Liu

Full Text Available Human fingers are 3D objects. More information will be provided if three dimensional (3D fingerprints are available compared with two dimensional (2D fingerprints. Thus, this paper firstly collected 3D finger point cloud data by Structured-light Illumination method. Additional features from 3D fingerprint images are then studied and extracted. The applications of these features are finally discussed. A series of experiments are conducted to demonstrate the helpfulness of 3D information to fingerprint recognition. Results show that a quick alignment can be easily implemented under the guidance of 3D finger shape feature even though this feature does not work for fingerprint recognition directly. The newly defined distinctive 3D shape ridge feature can be used for personal authentication with Equal Error Rate (EER of ~8.3%. Also, it is helpful to remove false core point. Furthermore, a promising of EER ~1.3% is realized by combining this feature with 2D features for fingerprint recognition which indicates the prospect of 3D fingerprint recognition.

Fingerprint Analysis with Marked Point Processes

DEFF Research Database (Denmark)

Forbes, Peter G. M.; Lauritzen, Steffen; Møller, Jesper

We present a framework for fingerprint matching based on marked point process models. An efficient Monte Carlo algorithm is developed to calculate the marginal likelihood ratio for the hypothesis that two observed prints originate from the same finger against the hypothesis that they originate from...... different fingers. Our model achieves good performance on an NIST-FBI fingerprint database of 258 matched fingerprint pairs....

Collusion-resistant multimedia fingerprinting: a unified framework

Science.gov (United States)

Wu, Min; Trappe, Wade; Wang, Z. Jane; Liu, K. J. Ray

2004-06-01

Digital fingerprints are unique labels inserted in different copies of the same content before distribution. Each digital fingerprint is assigned to an inteded recipient, and can be used to trace the culprits who use their content for unintended purposes. Attacks mounted by multiple users, known as collusion attacks, provide a cost-effective method for attenuating the identifying fingerprint from each coluder, thus collusion poses a reeal challenge to protect the digital media data and enforce usage policies. This paper examines a few major design methodologies for collusion-resistant fingerprinting of multimedia, and presents a unified framework that helps highlight the common issues and the uniqueness of different fingerprinting techniques.

Dna fingerprinting - review paper

OpenAIRE

Blundell, Renald

2006-01-01

Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

Lethal/sublethal responses of Daphnia magna to acute norfloxacin contamination and changes in phytoplankton-zooplankton interactions induced by this antibiotic

Science.gov (United States)

Pan, Ying; Yan, Shi-Wei; Li, Ruo-Zhu; Hu, Yi-Wen; Chang, Xue-Xiu

2017-01-01

Although the well-known antibiotic norfloxacin (NOR) is recognized as an important environmental pollutant, little is known about its impacts on ecological processes, particularly on species interactions. In this paper, we quantified Daphnia magna (Crustacea, Cladocera) responses in mortality rate at lethal NOR concentrations (0, 25, 50, 100, 200, 300 and 400 mg L-1), and in heartbeat rate, swimming behavior and feeding rate (on the green alga Chlorella pyrenoidosa) at sublethal NOR concentrations (0, 25, 50 and 100 mg L-1) to determine the effects of this antibiotic in plankton systems. In 96-h-long lethal experiment, mortality rates of D. magna increased significantly with increasing NOR concentration and exposure time. In sublethal experiments, heartbeat rate decreased, while time ratio of vertical to horizontal swimming (TVH) and the duration of quiescence increased in D. magna individuals exposed to increasing NOR concentrations after 4 and 12 h of exposure. These collectively led to decreases in both average swimming ability and feeding rate, consistent with the positive relationship between average swimming ability and feeding rate. Overall, results indicate that, by affecting zooplankton heartbeat rate and behavior, NOR decreased feeding efficiency of D. magna even at low doses, therefore, it might seriously compromise ecosystem health and function.

Genetic diversity analysis of nine chewing cane varieties (lines) and construction of their DNA fingerprints

Science.gov (United States)

In order to provide theoretical basis for variety identification and parental selection during sugarcane breeding process, the present study was conducted to analyze genetic diversity of nine chewing cane varieties (lines) and construct their DNA fingerprints. Combining twenty-one SSR molecular mark...

Electronic fingerprinting of the dead.

Science.gov (United States)

Rutty, G N; Stringer, K; Turk, E E

2008-01-01

To date, a number of methods exist for the capture of fingerprints from cadavers that can then be used in isolation as a primary method for the identification of the dead. We report the use of a handheld, mobile wireless unit used in conjunction with a personal digital assistant (PDA) device for the capture of fingerprints from the dead. We also consider a handheld single-digit fingerprint scanner that utilises a USB laptop connection for the electronic capture of cadaveric fingerprints. Both are single-operator units that, if ridge detail is preserved, can collect a 10-set of finger pad prints in approximately 45 and 90 s, respectively. We present our observations on the restrictions as to when such devices can be used with cadavers. We do, however, illustrate that the images are of sufficient quality to allow positive identification from finger pad prints of the dead. With the development of mobile, handheld, biometric, PDA-based units for the police, we hypothesize that, under certain circumstances, devices such as these could be used for the accelerated acquisition of fingerprint identification data with the potential for rapid near-patient identification in the future.

A Computational Discriminability Analysis on Twin Fingerprints

Science.gov (United States)

Liu, Yu; Srihari, Sargur N.

Sharing similar genetic traits makes the investigation of twins an important study in forensics and biometrics. Fingerprints are one of the most commonly found types of forensic evidence. The similarity between twins’ prints is critical establish to the reliability of fingerprint identification. We present a quantitative analysis of the discriminability of twin fingerprints on a new data set (227 pairs of identical twins and fraternal twins) recently collected from a twin population using both level 1 and level 2 features. Although the patterns of minutiae among twins are more similar than in the general population, the similarity of fingerprints of twins is significantly different from that between genuine prints of the same finger. Twins fingerprints are discriminable with a 1.5%~1.7% higher EER than non-twins. And identical twins can be distinguished by examine fingerprint with a slightly higher error rate than fraternal twins.

Fingerprinting with Wow

Science.gov (United States)

Yu, Eugene; Craver, Scott

2006-02-01

Wow, or time warping caused by speed fluctuations in analog audio equipment, provides a wealth of applications in watermarking. Very subtle temporal distortion has been used to defeat watermarks, and as components in watermarking systems. In the image domain, the analogous warping of an image's canvas has been used both to defeat watermarks and also proposed to prevent collusion attacks on fingerprinting systems. In this paper, we explore how subliminal levels of wow can be used for steganography and fingerprinting. We present both a low-bitrate robust solution and a higher-bitrate solution intended for steganographic communication. As already observed, such a fingerprinting algorithm naturally discourages collusion by averaging, owing to flanging effects when misaligned audio is averaged. Another advantage of warping is that even when imperceptible, it can be beyond the reach of compression algorithms. We use this opportunity to debunk the common misconception that steganography is impossible under "perfect compression."

Successfully resisting a pathogen is rarely costly in Daphnia magna.

Science.gov (United States)

Labbé, Pierrick; Vale, Pedro F; Little, Tom J

2010-11-17

A central hypothesis in the evolutionary ecology of parasitism is that trade-offs exist between resistance to parasites and other fitness components such as fecundity, growth, survival, and predator avoidance, or resistance to other parasites. These trade-offs are called costs of resistance. These costs fall into two broad categories: constitutive costs of resistance, which arise from a negative genetic covariance between immunity and other fitness-related traits, and inducible costs of resistance, which are the physiological costs incurred by hosts when mounting an immune response. We sought to study inducible costs in depth using the crustacean Daphnia magna and its bacterial parasite Pasteuria ramosa. We designed specific experiments to study the costs induced by exposure to this parasite, and we re-analysed previously published data in an effort to determine the generality of such costs. However, despite the variety of genetic backgrounds of both hosts and parasites, and the different exposure protocols and environmental conditions used in these experiment, this work showed that costs of exposure can only rarely be detected in the D. magna-P. ramosa system. We discuss possible reasons for this lack of detectable costs, including scenarios where costs of resistance to parasites might not play a major role in the co-evolution of hosts and parasites.

Greek perceptions of frontier in Magna Graecia: literature and archaeology in dialogue

Directory of Open Access Journals (Sweden)

Airton POLLINI

2013-07-01

Full Text Available The paper deals with Greek perceptions of frontier in Magna Graecia, from a historical archaeological, contextual standpoint. Considering the complex relationship between literary and archaeological evidence, the paper uses as a case study the frontier in Southern Italy, discussing the subjective frontier perceptions by Greeks and Natives in interaction.

Tools for quality control of fingerprint databases

Science.gov (United States)

Swann, B. Scott; Libert, John M.; Lepley, Margaret A.

2010-04-01

Integrity of fingerprint data is essential to biometric and forensic applications. Accordingly, the FBI's Criminal Justice Information Services (CJIS) Division has sponsored development of software tools to facilitate quality control functions relative to maintaining its fingerprint data assets inherent to the Integrated Automated Fingerprint Identification System (IAFIS) and Next Generation Identification (NGI). This paper provides an introduction of two such tools. The first FBI-sponsored tool was developed by the National Institute of Standards and Technology (NIST) and examines and detects the spectral signature of the ridge-flow structure characteristic of friction ridge skin. The Spectral Image Validation/Verification (SIVV) utility differentiates fingerprints from non-fingerprints, including blank frames or segmentation failures erroneously included in data; provides a "first look" at image quality; and can identify anomalies in sample rates of scanned images. The SIVV utility might detect errors in individual 10-print fingerprints inaccurately segmented from the flat, multi-finger image acquired by one of the automated collection systems increasing in availability and usage. In such cases, the lost fingerprint can be recovered by re-segmentation from the now compressed multi-finger image record. The second FBI-sponsored tool, CropCoeff was developed by MITRE and thoroughly tested via NIST. CropCoeff enables cropping of the replacement single print directly from the compressed data file, thus avoiding decompression and recompression of images that might degrade fingerprint features necessary for matching.

The efficacy of intraoperative ultrasonography-assisted microinvasive cisterna magna reconstruction for Chiari malformation typeⅠwith syringomyelia

Directory of Open Access Journals (Sweden)

LI Peng-chao

2012-08-01

Full Text Available Objective To report the method and effect of intraoperative ultrasonography-assisted microinvasive cisterna magna reconstruction for Chiari malformation type Ⅰ with syringomyelia. Methods Ninty-three patients suffered from Chiari malformation typeⅠwith syringomyelia were treated by microinvasive cisterna magna reconstruction. The skin incision was 1.50-3.00 cm. The bone removal of foramen magnum was 1.50 cm × 2.00 cm with C1 reserved. Dura and arachnoid were incised and sutured linearly. All of the patients underwent cerebellar tonsillar resection and exploration of median aperture of fourth ventricle. Intraoperative ultrasonography was performed both before and after cerebellar tonsillar resection to judge the effect of cisterna magna reconstruction. According to Tator method, the curative effect was divided into 3 groups, improved, stable and worsen. MRI were reviewed at the same time, and the result was divided into syrinx disappeared, reduced, no change and expanded. Results The operation was successful in all patients. Postoperative complications included cerebellum hemorrhage (n = 1, cerebral infarction (n = 1, hydrocephalus (n = 1, subcutaneous dropsy (n = 2 and were recovered after specific treatment. All patients were followed up for 6 months to 12 months after operation. Thirty-six cases were improved, 55 cases were stable, and 2 cases got worse. The MRI showed that the syringomyelia shrinked or disappeared in 90 cases, no change in 3 cases and no expansion. Eighty cases were followed up for 30 months to 36 months after operation, 12 stable cases improved, 1 stable case got worse, while the others remained unchanged. The MRI showed no change was compared with previous follow-up imaging. Conclusion Microinvasive cisterna magna reconstruction is a surgical procedure with mininal injury, quick recovery, stable effect, fewer complications, and high security. Intraoperative ultrasonography provides reliable data and is easy to perform.

A comparison of the response of Simocephalus mixtus (Cladocera) and Daphnia magna to contaminated freshwater sediments.

Science.gov (United States)

Martínez-Jerónimo, Fernando; Cruz-Cisneros, Jade Lizette; García-Hernández, Leonardo

2008-09-01

The southeast region of Mexico is characterized by intensive oil industry activities carried out by the national public enterprise Petróleos Mexicanos (PEMEX). The freshwater lagoon "El Limón", located in the municipality of Macuspana, state of Tabasco, Mexico, has received over 40 years discharges of untreated waste waters from the Petrochemical Complex "Ciudad PEMEX", located on the border of the lagoon. To assess the toxicity of the sediments and, hence, to obtain information on the biological effects of these contaminating discharges, the cladoceran Simocephalus mixtus was used as a test organism in acute (48h) and chronic (12d) toxicity assays. For comparison purposes, bioassays were also conducted with the reference cladoceran Daphnia magna. The sediments of this lagoon contain important amounts of metals and hydrocarbons that have been accumulated over time; however, the acute tests only registered reduced lethal effects on the test organisms (maxima of 10% and 17% mortality for D. magna and S. mixtus, respectively). This may be due to low bioavailability of the pollutants present in the sediments. On the other hand, partial or total inhibition and delay in the start of reproduction, reduction in clutch sizes, reduced survival, as well as reduction in the size of adults and offspring were recorded in the chronic assays. The most evident chronic effects were found in S. mixtus; in this species, reproduction was inhibited up to 72%, whereas D. magna was only affected by 24%. We determined that S. mixtus is a more sensitive test organism than D. magna to assess whole-sediment toxicity in tropical environments, and that chronic exposure bioassays are required for an integrated sediment evaluation. The sediments from "El Limón" lagoon induced chronic intoxication responses and, therefore, remediation measures are urgently needed to recover environmental conditions suitable for the development of its aquatic biota.

Enhance Criminal Investigation by Proposed Fingerprint Recognition System

International Nuclear Information System (INIS)

Hashem, S.H.; Maolod, A.T.; Mohammad, A.A.

2014-01-01

Law enforcement officers and forensic specialists spend hours thinking about how fingerprints solve crimes, and trying to find, collect, record and compare these unique identifiers that can connect a specific person to a specific crime. These individuals understand that a basic human feature that most people take for granted, can be one of the most effective tools in crime solving.This research exploits our previous work to be applicable in criminal investigation field. The present study aims to solve the advance crime by strength fingerprint’s criminal investigation to control the alterations happen intentionally to criminals’ fingerprint. That done by suggest strategy introduce an optimal fingerprint image feature’s vector to the person and then considers it to be stored in database for future matching. Selecting optimal fingerprint feature’s vector strategy deal with considering 10 fingerprints for each criminal person (take the fingerprint in different time and different circumstance of criminal such as finger is dirty, wet, trembling, etc.). Proposal begun with apply a proposed enrollment on all 10 fingerprint for each criminal, the enrollment include the following consequence steps; begin with preprocessing step for each of 10 images including enhancement, then two level of feature extraction (first level to extract arches, whorls, and loops, where second level extract minutiae), after that applying proposed Genetic Algorithm to select optimal fingerprint, master fingerprint, which in our point of view present the most universal image which include more detailed features to recognition. Master fingerprint will be feature’s vector which stored in database. Then apply the proposed matching by testing fingerprints with these stored in database.While, measuring of criminal fingerprint investigation performance by calculating False Reject Rate (FRR)and False Accept Rate (FAR) for the traditional system and the proposed in criminal detection field. The

Effects of aqueous stable fullerene nanocrystals (nC60) on the food conversion from Daphnia magna to Danio rerio in a simplified freshwater food chain.

Science.gov (United States)

Tao, Xianji; Li, Cuilan; Zhang, Bo; He, Yiliang

2016-02-01

Understanding the nanomaterial potential to the food conversion of two food chain levels is important in the ecosystem assessment as manufactured nanomaterials are being released into the environment. In this investigation, the food conversion from Daphnia magna (D. magna) (prey) to Danio rerio (D. rerio) (predator) was used as the study object of aqueous stable fullerene nanocrystals (nC60). Accumulated nC60 of D. magna was determined as the nominal initial exposure concentration for D. rerio. The results of 21-d dietary exposure experiment demonstrate that nC60 in D. magna decreased the body weight growths and condition factors of D. rerio, and reduced the food conversion ratio by 20% (from D. magna to D. rerio). Further, the experiments present that nC60 decrease three digestive enzymes activities of trypsinase, lipase, and amylase by 30, 29, and 55% in vivo, and by 60, 90, and 42% in vitro, respectively. Both in vivo and in vitro experiments indicated that nC60 was involved with the decrements of digestive enzymes activities. These decrements in digestive enzymes activities may be due to the deactivation caused by the adsorption of nC60 particles onto the surface or active center of digestive enzymes. Sum up, these results not only describe the nC60 deleterious effects on the food conversion from D. magna to D. rerio, but also provide some information regarding a probable food conversion inhibition mechanism of nC60. Copyright © 2015 Elsevier Ltd. All rights reserved.

ORIENTATION FIELD RECONSTRUCTION OF ALTERED FINGERPRINT USING ORTHOGONAL WAVELETS

Directory of Open Access Journals (Sweden)

Mini M.G.

2016-11-01

Full Text Available Ridge orientation field is an important feature for fingerprint matching and fingerprint reconstruction. Matching of the altered fingerprint against its unaltered mates can be done by extracting the available features in the altered fingerprint and using it along with approximated ridge orientation. This paper presents a method for approximating ridge orientation field of altered fingerprints. In the proposed method, sine and cosine of doubled orientation of the fingerprint is decomposed using orthogonal wavelets and reconstructed back using only the approximation coefficients. No prior information about the singular points is needed for orientation approximation. The method is found suitable for orientation estimation of low quality fingerprint images also.

Toxicity Identification and Evaluation for the Effluent from Wastewater Treatment Plant in Industrial Complex using D.magna

Science.gov (United States)

Lee, S.; Keum, H.; Chun Sang, H.

2015-12-01

In recent years, the interests on the impacts of industrial wastewater on aquatic ecosystem have increased with concern about ecosystem protection and human health. Whole effluent toxicity tests are used to monitor toxicity by unknown toxic chemicals as well as conventional pollutants from industrial effluent discharges. This study describes the application of TIE (toxicity identification evaluation) procedures to an acutely toxic effluent from a wastewater treatment plant in industrial complex which was toxic to Daphnia magna. In TIE phase I (characterization step), the toxic effects by heavy metals, organic compounds, oxidants, volatile organic compounds, suspended solids and ammonia were screened and revealed that the source of toxicity is far from these toxicants group. Chemical analysis (TIE phase II) on TDS showed that the concentration of chloride ion (6,900 mg/L) was substantially higher than that predicted from EC50 for D. magna. In confirmation step (TIE phase III), chloride ion was demonstrated to be main toxicant in this effluent by the spiking approach, species sensitivity approach and deletion approach. Calcium, potassium, magnesium, sodium, fluorine, sulfate ion concentration (450, 100, 80, 5,300, 0.66, 2,200mg/L) was not shown toxicity from D. magna. Finally, we concluded that chloride was the most contributing toxicant in the waste water treatment plant. Further research activities are needed for technical support of toxicity identification and evaluation on the various types of wastewater treatment plant discharge in Korea. Keywords : TIE, D. magna, Industrial waste water Acknowledgement This research was supported by a grant (15IFIP-B089908-02) from Plant Research Program funded by Ministry of Land, Infrastructure and Transport of Korean government

Ultrasound guided double injection of blood into cisterna magna: a rabbit model for treatment of cerebral vasospasm.

Science.gov (United States)

Chen, Yongchao; Zhu, Youzhi; Zhang, Yu; Zhang, Zixuan; Lian, Juan; Luo, Fucheng; Deng, Xuefei; Wong, Kelvin K L

2016-02-06

Double injection of blood into cisterna magna using a rabbit model results in cerebral vasospasm. An unacceptably high mortality rate tends to limit the application of model. Ultrasound guided puncture can provide real-time imaging guidance for operation. The aim of this paper is to establish a safe and effective rabbit model of cerebral vasospasm after subarachnoid hemorrhage with the assistance of ultrasound medical imaging. A total of 160 New Zealand white rabbits were randomly divided into four groups of 40 each: (1) manual control group, (2) manual model group, (3) ultrasound guided control group, and (4) ultrasound guided model group. The subarachnoid hemorrhage was intentionally caused by double injection of blood into their cisterna magna. Then, basilar artery diameters were measured using magnetic resonance angiography before modeling and 5 days after modeling. The depth of needle entering into cisterna magna was determined during the process of ultrasound guided puncture. The mortality rates in manual control group and model group were 15 and 23 %, respectively. No rabbits were sacrificed in those two ultrasound guided groups. We found that the mortality rate in ultrasound guided groups decreased significantly compared to manual groups. Compared with diameters before modeling, the basilar artery diameters after modeling were significantly lower in manual and ultrasound guided model groups. The vasospasm aggravated and the proportion of severe vasospasms was greater in ultrasound guided model group than that of manual group. In manual model group, no vasospasm was found in 8 % of rabbits. The ultrasound guided double injection of blood into cisterna magna is a safe and effective rabbit model for treatment of cerebral vasospasm.

Obesogens beyond Vertebrates: Lipid Perturbation by Tributyltin in the Crustacean Daphnia magna

Science.gov (United States)

Jordão, Rita; Casas, Josefina; Fabrias, Gemma; Campos, Bruno; Piña, Benjamín; Lemos, Marco F.L.; Soares, Amadeu M.V.M.; Tauler, Romà

2015-01-01

Background The analysis of obesogenic effects in invertebrates is limited by our poor knowledge of the regulatory pathways of lipid metabolism. Recent data from the crustacean Daphnia magna points to three signaling hormonal pathways related to the molting and reproductive cycles [retinoic X receptor (RXR), juvenile hormone (JH), and ecdysone] as putative targets for exogenous obesogens. Objective The present study addresses the disruptive effects of the model obesogen tributyltin (TBT) on the lipid homeostasis in Daphnia during the molting and reproductive cycle, its genetic control, and health consequences of its disruption. Methods D. magna individuals were exposed to low and high levels of TBT. Reproductive effects were assessed by Life History analysis methods. Quantitative and qualitative changes in lipid droplets during molting and the reproductive cycle were studied using Nile red staining. Lipid composition and dynamics were analyzed by ultra-performance liquid chromatography coupled to a time-of-flight mass spectrometer. Relative abundances of mRNA from different genes related to RXR, ecdysone, and JH signaling pathways were studied by qRT-PCR. Results and Conclusions TBT disrupted the dynamics of neutral lipids, impairing the transfer of triacylglycerols to eggs and hence promoting their accumulation in adult individuals. TBT’s disruptive effects translated into a lower fitness for offspring and adults. Co-regulation of gene transcripts suggests that TBT activates the ecdysone, JH, and RXR receptor signaling pathways, presumably through the already proposed interaction with RXR. These findings indicate the presence of obesogenic effects in a nonvertebrate species. Citation Jordão R, Casas J, Fabrias G, Campos B, Piña B, Lemos MF, Soares AM, Tauler R, Barata C. 2015. Obesogens beyond vertebrates: lipid perturbation by tributyltin in the crustacean Daphnia magna. Environ Health Perspect 123:813–819; http://dx.doi.org/10.1289/ehp.1409163 PMID

Three-dimensional imaging of artificial fingerprint by optical coherence tomography

Science.gov (United States)

Larin, Kirill V.; Cheng, Yezeng

2008-03-01

Fingerprint recognition is one of the popular used methods of biometrics. However, due to the surface topography limitation, fingerprint recognition scanners are easily been spoofed, e.g. using artificial fingerprint dummies. Thus, biometric fingerprint identification devices need to be more accurate and secure to deal with different fraudulent methods including dummy fingerprints. Previously, we demonstrated that Optical Coherence Tomography (OCT) images revealed the presence of the artificial fingerprints (made from different household materials, such as cement and liquid silicone rubber) at all times, while the artificial fingerprints easily spoofed the commercial fingerprint reader. Also we demonstrated that an analysis of the autocorrelation of the OCT images could be used in automatic recognition systems. Here, we exploited the three-dimensional (3D) imaging of the artificial fingerprint by OCT to generate vivid 3D image for both the artificial fingerprint layer and the real fingerprint layer beneath. With the reconstructed 3D image, it could not only point out whether there exists an artificial material, which is intended to spoof the scanner, above the real finger, but also could provide the hacker's fingerprint. The results of these studies suggested that Optical Coherence Tomography could be a powerful real-time noninvasive method for accurate identification of artificial fingerprints real fingerprints as well.

8 CFR 1236.5 - Fingerprints and photographs.

Science.gov (United States)

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local law...

Near-Optimal Fingerprinting with Constraints

Directory of Open Access Journals (Sweden)

Gulyás Gábor György

2016-10-01

Full Text Available Several recent studies have demonstrated that people show large behavioural uniqueness. This has serious privacy implications as most individuals become increasingly re-identifiable in large datasets or can be tracked, while they are browsing the web, using only a couple of their attributes, called as their fingerprints. Often, the success of these attacks depends on explicit constraints on the number of attributes learnable about individuals, i.e., the size of their fingerprints. These constraints can be budget as well as technical constraints imposed by the data holder. For instance, Apple restricts the number of applications that can be called by another application on iOS in order to mitigate the potential privacy threats of leaking the list of installed applications on a device. In this work, we address the problem of identifying the attributes (e.g., smartphone applications that can serve as a fingerprint of users given constraints on the size of the fingerprint. We give the best fingerprinting algorithms in general, and evaluate their effectiveness on several real-world datasets. Our results show that current privacy guards limiting the number of attributes that can be queried about individuals is insufficient to mitigate their potential privacy risks in many practical cases.

Comparative ovarian microarray analysis of juvenile hormone-responsive genes in water flea Daphnia magna: potential targets for toxicity.

Science.gov (United States)

Toyota, Kenji; Williams, Timothy D; Sato, Tomomi; Tatarazako, Norihisa; Iguchi, Taisen

2017-03-01

The freshwater zooplankton Daphnia magna has been extensively employed in chemical toxicity tests such as OECD Test Guidelines 202 and 211. Previously, it has been demonstrated that the treatment of juvenile hormones (JHs) or their analogues to female daphnids can induce male offspring production. Based on this finding, a rapid screening method for detection of chemicals with JH-activity was recently developed using adult D. magna. This screening system determines whether a chemical has JH-activity by investigating the male offspring inducibility. Although this is an efficient high-throughput short-term screening system, much remains to be discovered about JH-responsive pathways in the ovary, and whether different JH-activators act via the same mechanism. JH-responsive genes in the ovary including developing oocytes are still largely undescribed. Here, we conducted comparative microarray analyses using ovaries from Daphnia magna treated with fenoxycarb (Fx; artificial JH agonist) or methyl farnesoate (MF; a putative innate JH in daphnids) to elucidate responses to JH agonists in the ovary, including developing oocytes, at a JH-sensitive period for male sex determination. We demonstrate that induction of hemoglobin genes is a well-conserved response to JH even in the ovary, and a potential adverse effect of JH agonist is suppression of vitellogenin gene expression, that might cause reduction of offspring number. This is the first report demonstrating different transcriptomics profiles from MF and an artificial JH agonist in D. magna ovary, improving understanding the tissue-specific mode-of-action of JH. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Nutritional value content, biomass production and growth performance of Daphnia magna cultured with different animal wastes resulted from probiotic bacteria fermentation

Science.gov (United States)

Endar Herawati, Vivi; Nugroho, R. A.; Pinandoyo; Hutabarat, Johannes

2017-02-01

Media culture is an important factor for the growth and quality of Daphnia magna nutrient value. This study has purpose to find the increasing of nutritional content, biomass production and growth performance of D. magna using different animal wastes fermented by probiotic bacteria. This study conducted using completely randomized experimental design with 10 treatments and 3 replicates. Those media used different animal manures such as chicken manure, goat manure and quail manure mixed by rejected bread and tofu waste fermented by probiotic bacteria then cultured for 24 days. The results showed that the media which used 50% chicken manure, 100% rejected bread and 50% tofu waste created the highest biomass production, population and nutrition content of D.magna about 2111788.9 ind/L for population; 342 grams biomass production and 68.85% protein content. The highest fatty acid profile is 6.37% of linoleic and the highest essential amino acid is 22.8% of lysine. Generally, the content of ammonia, DO, temperature, and pH during the study were in the good range of D. magna’s life. This research has conclusion that media used 50% chicken manure, 100% rejected bread and 50% tofu waste created the highest biomass production, population and nutrition content of D. magna.

Microbial DNA fingerprinting of human fingerprints: dynamic colonization of fingertip microflora challenges human host inferences for forensic purposes.

Science.gov (United States)

Tims, Sebastian; van Wamel, Willem; Endtz, Hubert P; van Belkum, Alex; Kayser, Manfred

2010-09-01

Human fingertip microflora is transferred to touched objects and may provide forensically relevant information on individual hosts, such as on geographic origins, if endogenous microbial skin species/strains would be retrievable from physical fingerprints and would carry geographically restricted DNA diversity. We tested the suitability of physical fingerprints for revealing human host information, with geographic inference as example, via microbial DNA fingerprinting. We showed that the transient exogenous fingertip microflora is frequently different from the resident endogenous bacteria of the same individuals. In only 54% of the experiments, the DNA analysis of the transient fingertip microflora allowed the detection of defined, but often not the major, elements of the resident microflora. Although we found microbial persistency in certain individuals, time-wise variation of transient and resident microflora within individuals was also observed when resampling fingerprints after 3 weeks. While microbial species differed considerably in their frequency spectrum between fingerprint samples from volunteers in Europe and southern Asia, there was no clear geographic distinction between Staphylococcus strains in a cluster analysis, although bacterial genotypes did not overlap between both continental regions. Our results, though limited in quantity, clearly demonstrate that the dynamic fingerprint microflora challenges human host inferences for forensic purposes including geographic ones. Overall, our results suggest that human fingerprint microflora is too dynamic to allow for forensic marker developments for retrieving human information.

Attendance fingerprint identification system using arduino and single board computer

Science.gov (United States)

Muchtar, M. A.; Seniman; Arisandi, D.; Hasanah, S.

2018-03-01

Fingerprint is one of the most unique parts of the human body that distinguishes one person from others and is easily accessed. This uniqueness is supported by technology that can automatically identify or recognize a person called fingerprint sensor. Yet, the existing Fingerprint Sensor can only do fingerprint identification on one machine. For the mentioned reason, we need a method to be able to recognize each user in a different fingerprint sensor. The purpose of this research is to build fingerprint sensor system for fingerprint data management to be centralized so identification can be done in each Fingerprint Sensor. The result of this research shows that by using Arduino and Raspberry Pi, data processing can be centralized so that fingerprint identification can be done in each fingerprint sensor with 98.5 % success rate of centralized server recording.

Security and matching of partial fingerprint recognition systems

Science.gov (United States)

Jea, Tsai-Yang; Chavan, Viraj S.; Govindaraju, Venu; Schneider, John K.

2004-08-01

Despite advances in fingerprint identification techniques, matching incomplete or partial fingerprints still poses a difficult challenge. While the introduction of compact silicon chip-based sensors that capture only a part of the fingerprint area have made this problem important from a commercial perspective, there is also considerable interest on the topic for processing partial and latent fingerprints obtained at crime scenes. Attempts to match partial fingerprints using singular ridge structures-based alignment techniques fail when the partial print does not include such structures (e.g., core or delta). We present a multi-path fingerprint matching approach that utilizes localized secondary features derived using only the relative information of minutiae. Since the minutia-based fingerprint representation, is an ANSI-NIST standard, our approach has the advantage of being directly applicable to already existing databases. We also analyze the vulnerability of partial fingerprint identification systems to brute force attacks. The described matching approach has been tested on one of FVC2002"s DB1 database11. The experimental results show that our approach achieves an equal error rate of 1.25% and a total error rate of 1.8% (with FAR at 0.2% and FRR at 1.6%).

Entropy based fingerprint for local crystalline order

Science.gov (United States)

Piaggi, Pablo M.; Parrinello, Michele

2017-09-01

We introduce a new fingerprint that allows distinguishing between liquid-like and solid-like atomic environments. This fingerprint is based on an approximate expression for the entropy projected on individual atoms. When combined with local enthalpy, this fingerprint acquires an even finer resolution and it is capable of discriminating between different crystal structures.

Forensic Chemistry: The Revelation of Latent Fingerprints

Science.gov (United States)

Friesen, J. Brent

2015-01-01

The visualization of latent fingerprints often involves the use of a chemical substance that creates a contrast between the fingerprint residues and the surface on which the print was deposited. The chemical-aided visualization techniques can be divided into two main categories: those that chemically react with the fingerprint residue and those…

FINGERPRINT DETECTION AND RECOGNIZATION TECHNIQUES USING GABOR FILTER

OpenAIRE

Yogita Verma*, Prof. Bhagwati Charan Patel

2017-01-01

Fingerprints are most extensively and effectively appropriate for the proof of identity in present days. Mostly because of their uniqueness among the people, public acceptance, originality, stability through life, and their least risk of invasion. Fingerprint technology, which is basically a biometric system, is utilized to identify an individual based on their physical qualities. Fingerprint matching is the trendiest biometric method appropriate to provide authentication. Fingerprint verific...

Interoperability between Fingerprint Biometric Systems: An Empirical Study

OpenAIRE

Gashi, I.; Mason, S.; Lugini, L.; Marasco, E.; Cukic, B.

2014-01-01

Fingerprints are likely the most widely used biometric in commercial as well as law enforcement applications. With the expected rapid growth of fingerprint authentication in mobile devices their importance justifies increased demands for dependability. An increasing number of new sensors,applications and a diverse user population also intensify concerns about the interoperability in fingerprint authentication. In most applications, fingerprints captured for user enrollment with one device may...

A medium resolution fingerprint matching system

Directory of Open Access Journals (Sweden)

Ayman Mohammad Bahaa-Eldin

2013-09-01

Full Text Available In this paper, a novel minutiae based fingerprint matching system is proposed. The system is suitable for medium resolution fingerprint images obtained by low cost commercial sensors. The paper presents a new thinning algorithm, a new features extraction and representation, and a novel feature distance matching algorithm. The proposed system is rotation and translation invariant and is suitable for complete or partial fingerprint matching. The proposed algorithms are optimized to be executed on low resource environments both in CPU power and memory space. The system was evaluated using a standard fingerprint dataset and good performance and accuracy were achieved under certain image quality requirements. In addition, the proposed system was compared favorably to that of the state of the art systems.

A reliable and reproducible technique for DNA fingerprinting in biorepositories: a pilot study from BioBIM.

Science.gov (United States)

Palmirotta, Raffaele; De Marchis, Maria Laura; Ludovici, Giorgia; Ialongo, Cristiano; Leone, Barbara; Lopez, Nadia; Valente, Maria Giovanna; Spila, Antonella; Ferroni, Patrizia; Della-Morte, David; Guadagni, Fiorella

2013-12-17

Standard operating procedures (SOPs) optimization for nucleic acid extraction from stored samples is of crucial importance in a biological repository, considering the large number of collected samples and their future downstream molecular and biological applications. However, the validity of molecular studies using stored specimens depends not only on the integrity of the biological samples, but also on the procedures that ensure the traceability of the same sample, certifying its uniqueness, and ensuring the identification of potential sample contaminations. With this aim, we have developed a rapid, reliable, low-cost, and simple DNA fingerprinting tool for a routine use in quality control of biorepositories samples. The method consists of a double ALU insertion/deletion genotyping panel suitable for uniqueness, identification of sample contaminations, and gender validation. Preliminary data suggest that this easy-to-use DNA fingerprinting protocol could routinely provide assurances of DNA identity and quality in a biorepository setting.

Information Theoretical Analysis of Identification based on Active Content Fingerprinting

OpenAIRE

Farhadzadeh, Farzad; Willems, Frans M. J.; Voloshinovskiy, Sviatoslav

2014-01-01

Content fingerprinting and digital watermarking are techniques that are used for content protection and distribution monitoring. Over the past few years, both techniques have been well studied and their shortcomings understood. Recently, a new content fingerprinting scheme called {\\em active content fingerprinting} was introduced to overcome these shortcomings. Active content fingerprinting aims to modify a content to extract robuster fingerprints than the conventional content fingerprinting....

Fingerprint matching with optical coherence tomography

CSIR Research Space (South Africa)

Moolla, Y

2015-12-01

Full Text Available Fingerprint recognition is an important security technique with a steadily growing usage for the identification and verification of individuals. However, current fingerprint acquisition systems have certain disadvantages, which include...

Copper regulation and homeostasis of Daphnia magna and Pseudokirchneriella subcapitata: influence of acclimation

International Nuclear Information System (INIS)

Bossuyt, Bart T.A.; Janssen, Colin R.

2005-01-01

This study aimed to evaluate (1) the capacity of the green alga Pseudokirchneriella subcapitata and the waterflea Daphnia magna to regulate copper when exposed to environmentally realistic copper concentrations and (2) the influence of multi-generation acclimation to these copper concentrations on copper bioaccumulation and homeostasis. Based on bioconcentration factors, active copper regulation was observed in algae up to 5 μg Cu L -1 and in daphnids up to 35 μg Cu L -1 . Constant body copper concentrations (13 ± 4 μg Cu g DW -1 ) were observed in algae exposed to 1 through 5 μg Cu L -1 and in daphnids exposed to 1 through 12 μg Cu L -1 . At higher exposure concentrations, there was an increase in internal body copper concentration, while no increase was observed in bioconcentration factors, suggesting the presence of a storage mechanism. At copper concentrations of 100 μg Cu L -1 (P. subcapitata) and 150 μg Cu L -1 (D. magna), the significant increases observed in body copper concentrations and in bioconcentration factors may be related to a failure of this regulation mechanism. For both organisms, internal body copper concentrations lower than 13 μg Cu g DW -1 may result in copper deficiency. For P. subcapitata acclimated to 0.5 and 100 μg Cu L -1 , body copper concentrations ranged (mean ± standard deviation) between 5 ± 2 μg Cu g DW -1 and 1300 ± 197 μg Cu g DW -1 , respectively. For D. magna, this value ranged between 9 ± 2 μg Cu g DW -1 and 175 ± 17 μg Cu g DW -1 for daphnids acclimated to 0.5 and 150 μg Cu L -1 . Multi-generation acclimation to copper concentrations ≥12 μg Cu L -1 resulted in a decrease (up to 40%) in body copper concentrations for both organisms compared to the body copper concentration of the first generation. It can be concluded that there is an indication that P. subcapitata and D. magna can regulate their whole body copper concentration to maintain copper homeostasis within their optimal copper range and

Sex Determination from Fingerprint Ridge Density | Gungadin ...

African Journals Online (AJOL)

This study was conducted with an aim to establish a relationship between sex and fingerprint ridge density. The fingerprints were taken from 500 subjects (250 males and 250 females) in the age group of 18-60 years. After taking fingerprints, the ridges were counted in the upper portion of the radial border of each print for all ...

Integrated fingerprinting in secure digital cinema projection

Science.gov (United States)

Delannay, Damien; Delaigle, Jean-Francois; Macq, Benoit M. M.; Quisquater, Jean-Jacques; Mas Ribes, Joan M.; Boucqueau, Jean M.; Nivart, Jean-Francois

2001-12-01

This paper describes the functional model of a combined conditional access and fingerprinting copyright (-or projectionright) protection system in a digital cinema framework. In the cinema industry, a large part of early movie piracy comes from copies made in the theater itself with a camera. The evolution towards digital cinema broadcast enables watermark based fingerprinting protection systems. Besides an appropriate fingerprinting technology, a number of well defined security/cryptographic tools are integrated in order to guaranty the integrity of the whole system. The requirements are two-fold: On one side, we must ensure that the media content is only accessible at exhibition time (under specific authorization obtained after an ad-hoc film rental agreement) and contains the related exhibition fingerprint. At the other end, we must prove our ability to retrieve the fingerprint information from an illegal copy of the media.

Enhancing security of fingerprints through contextual biometric watermarking.

Science.gov (United States)

Noore, Afzel; Singh, Richa; Vatsa, Mayank; Houck, Max M

2007-07-04

This paper presents a novel digital watermarking technique using face and demographic text data as multiple watermarks for verifying the chain of custody and protecting the integrity of a fingerprint image. The watermarks are embedded in selected texture regions of a fingerprint image using discrete wavelet transform. Experimental results show that modifications in these locations are visually imperceptible and maintain the minutiae details. The integrity of the fingerprint image is verified through the high matching scores obtained from an automatic fingerprint identification system. There is also a high degree of visual correlation between the embedded images, and the extracted images from the watermarked fingerprint. The degree of similarity is computed using pixel-based metrics and human visual system metrics. The results also show that the proposed watermarked fingerprint and the extracted images are resilient to common attacks such as compression, filtering, and noise.

Effects of Cylindrospermopsis raciborskii and Aphanizomenon ovalisporum (cyanobacteria) ingestion on Daphnia magna midgut and associated diverticula epithelium

International Nuclear Information System (INIS)

Nogueira, Isabel C.G.; Lobo-da-Cunha, Alexandre; Vasconcelos, Vitor M.

2006-01-01

This article reports a light and electron microscopy investigation of the effects of Cylindrospermopsis raciborskii and Aphanizomenon ovalisporum ingestion on midgut and associated digestive diverticula of Daphnia magna. Additionally, survivorship and growth effects caused by feeding on cyanobacteria were assessed. Three cyanobacteria were used in the experiments: cylindrospermopsin (CYN)-producing C. raciborskii, CYN-producing A. ovalisporum and non-CYN-producing C. raciborskii. In order to discriminate between the alterations due to the low nutritional value of cyanobacteria and toxic effects, a control group was fed on the chlorophyte Ankistrodesmus falcatus and another control group was not fed. In the chlorophyte fed control, the epithelium lining the midgut and associated diverticula is mainly formed by strongly stained cells with an apical microvilli border. Nevertheless, unstained areas in which cell lyses had occurred were also observed. In the unfed control, the unstained areas became predominant due to an increment of cell lyses. All individuals fed on CYN-producing A. ovalisporum and some of those fed on non-CYN-producing C. raciborskii appear similar to the unfed control. However, some individuals fed on non-CYN-producing C. raciborskii showed similarities with the fed control. In contrast, the midgut and digestive diverticula of D. magna fed on CYN-producing C. raciborskii showed a widespread dissociation of epithelial cells, associated with severe intracellular disorganization, but cell lysis was less evident than in controls. These alterations cannot be attributed to CYN, because those effects were not induced by CYN-producing A. ovalisporum. Therefore, data suggest the production of another unidentified active metabolite by CYN-producing C. raciborskii, responsible for the disruption of cell adhesion in the epithelium of D. magna digestive tract. Data also show that the tested cyanobacteria are inadequate as food to D. magna, due to low nutritional

Negative effects of UVB-irradiated phytoplankton on life history traits and fitness of Daphnia magna

NARCIS (Netherlands)

Lange, de H.J.; Reeuwijk, van P.L.

2003-01-01

1. We tested the effect of ultraviolet-B (UVB)-irradiated phytoplankton on life history characteristics of Daphnia magna . Two phytoplankton species were used, Chlamydomonas reinhardtii and Cryptomonas pyrenoidifera . The phytoplankton species were cultured under photosynthetically active radiation

Successfully resisting a pathogen is rarely costly in Daphnia magna

Directory of Open Access Journals (Sweden)

Vale Pedro F

2010-11-01

Full Text Available Abstract Background A central hypothesis in the evolutionary ecology of parasitism is that trade-offs exist between resistance to parasites and other fitness components such as fecundity, growth, survival, and predator avoidance, or resistance to other parasites. These trade-offs are called costs of resistance. These costs fall into two broad categories: constitutive costs of resistance, which arise from a negative genetic covariance between immunity and other fitness-related traits, and inducible costs of resistance, which are the physiological costs incurred by hosts when mounting an immune response. We sought to study inducible costs in depth using the crustacean Daphnia magna and its bacterial parasite Pasteuria ramosa. Results We designed specific experiments to study the costs induced by exposure to this parasite, and we re-analysed previously published data in an effort to determine the generality of such costs. However, despite the variety of genetic backgrounds of both hosts and parasites, and the different exposure protocols and environmental conditions used in these experiment, this work showed that costs of exposure can only rarely be detected in the D. magna-P. ramosa system. Conclusions We discuss possible reasons for this lack of detectable costs, including scenarios where costs of resistance to parasites might not play a major role in the co-evolution of hosts and parasites.

Implementation of Minutiae Based Fingerprint Identification System Using Crossing Number Concept

Directory of Open Access Journals (Sweden)

Atul S. CHAUDHARI

2014-01-01

Full Text Available Biometric system is essentially a pattern recognition system which recognizes a person by determining the authenticity of a specific physiological (e.g., fingerprints, face, retina, iris or behavioral (e.g., gait, signature characteristic possessed by that person. Among all the presently employed biometric techniques, fingerprint identification systems have received the most attention due to the long history of fingerprints and its extensive use in forensics. Fingerprint is reliable biometric characteristic as it is unique and persistence. Fingerprint is the pattern of ridges and valleys on the surface of fingertip. However, recognizing fingerprints in poor quality images is still a very complex job, so the fingerprint image must be preprocessed before matching. It is very difficult to extract fingerprint features directly from gray scale fingerprint image. In this paper we have proposed the system which uses minutiae based matching algorithm for fingerprint identification. There are three main phases in proposed algorithm. First phase enhance the input fingerprint image by preprocessing it. The enhanced fingerprint image is converted into thinned binary image and then minutiae are extracted by using Crossing Number Concept in second phase. Third stage compares input fingerprint image (after preprocessing and minutiae extraction with fingerprint images enrolled in database and makes decision whether the input fingerprint is matched with the fingerprint stored in database or not.

Combining physico-chemical analysis with a Daphnia magna bioassay to evaluate a recycling technology for drinking water treatment plant waste residuals.

Science.gov (United States)

Chen, Ting; Xu, Yongpeng; Zhu, Shijun; Cui, Fuyi

2015-12-01

Recycling water treatment plant (WTP) waste residuals is considered to be a feasible method to enhance the efficiency of pollutant removal. This study also evaluated the safety and water quality of a pilot-DWTP waste residuals recycling technology by combining physical-chemistry analysis with a Daphnia magna assay. The water samples taken from each treatment step were extracted and concentrated by XAD-2 resin and were then analyzed for immobilization and enzyme activity with D. magna. The measured parameters, such as the dissolve organic carbon (DOC), UV254 and THM formation potential (THMFPs) of the recycling process, did not obviously increase over 15 days of continuous operation and were even lower than typical values from a conventional process. The extract concentration ranged from 0 to 2 Leq/ml as measured on the 7th and 15th days and the immobilization of D. magna exposed to water treated by the recycling process was nearly equivalent to that of the conventional process. Both the superoxide dismutase (SOD) and the catalase (CAT) activity assay indicated that a lower dose of water extract (0.5, 1, 1.5 Leq/ml) could stimulate the enzyme activity of D. magna, whereas a higher dose (2 Leq/ml at the sampling point C3, R3, R4 ) inhibits the activity. Moreover, the SOD and CAT activity of D. magna with DOC and UV254 showed a strong concentration-effect relationship, where the concentration range of DOC and UV254 were 4.1-16.2 mg/L and 0.071-4.382 cm(-1), respectively. The results showed that there was no statistically significant difference (p>0.05) between the conventional and recycling treatment processes and the toxicity of water samples in the recycling process did not increase during the 15-day continuous recycling trial. Copyright © 2015 Elsevier Inc. All rights reserved.

Variações fisiológicas da pressão do líquido cefalorraqueano na cisterna magna

Directory of Open Access Journals (Sweden)

A. Spina-França

1963-03-01

Full Text Available É feito estudo de revisão das variações fisiológicas da pressão do LCR ao nível da cisterna magna (punção suboccipital. Em relação à série de 1.500 pacientes com afecções do sistema nervoso e sem sintomatologia de hipotensão ou de hipertensão intracraniana, a pressão média normal do LCR ao nível da cisterna magna foi de 11,9 cm de água (paciente calmo, decúbito lateral horizontal. As variações fisiológicas de pressão, segundo os achados, têm como limites os valôres de 4,1 e 19,7 cm de água. Êsses valôres permitem caracterizar, para a cisterna magna, a existência de hipotensão do LCR quando a pressão fôr menor ou igual a 4 cm de água; a hipertensão é caracterizada por valores iguais ou maiores do que 20 cm de água. A pressão do LCR ao nível da cisterna magna é menor do que no fundo de saco lombar. Para série de 276 pacientes o valor médio achado para êste último nível foi de 16,7 cm de água (decúbito lateral horizontal. A diferença entre as médias foi altamente significativa. Não foram verificadas modificações da pressão do LCR ao nível da cisterna magna que pudessem ser relacionadas ao sexo. Sem que representassem dados de interêsse para a prática, foram verificadas variações ligadas à côr e à idade dos pacientes. Em média a pressão do LCR se mostrou menor entre pacientes prêtos e amarelos que entre os brancos e os mulatos. Um declínio do valor médio da pressão foi verificado à medida em que aumentava a idade dos pacientes. Êste declínio mostrou-se maior para o grupo de pacientes com idade acima de 60 anos.

DNA fingerprinting techniques for the analysis of genetic and epigenetic alterations in colorectal cancer.

Science.gov (United States)

Samuelsson, Johanna K; Alonso, Sergio; Yamamoto, Fumiichiro; Perucho, Manuel

2010-11-10

Genetic somatic alterations are fundamental hallmarks of cancer. In addition to point and other small mutations targeting cancer genes, solid tumors often exhibit aneuploidy as well as multiple chromosomal rearrangements of large fragments of the genome. Whether somatic chromosomal alterations and aneuploidy are a driving force or a mere consequence of tumorigenesis remains controversial. Recently it became apparent that not only genetic but also epigenetic alterations play a major role in carcinogenesis. Epigenetic regulation mechanisms underlie the maintenance of cell identity crucial for development and differentiation. These epigenetic regulatory mechanisms have been found substantially altered during cancer development and progression. In this review, we discuss approaches designed to analyze genetic and epigenetic alterations in colorectal cancer, especially DNA fingerprinting approaches to detect changes in DNA copy number and methylation. DNA fingerprinting techniques, despite their modest throughput, played a pivotal role in significant discoveries in the molecular basis of colorectal cancer. The aim of this review is to revisit the fingerprinting technologies employed and the oncogenic processes that they unveiled. 2010 Elsevier B.V. All rights reserved.

An Efficient Reconfigurable Architecture for Fingerprint Recognition

Directory of Open Access Journals (Sweden)

Satish S. Bhairannawar

2016-01-01

Full Text Available The fingerprint identification is an efficient biometric technique to authenticate human beings in real-time Big Data Analytics. In this paper, we propose an efficient Finite State Machine (FSM based reconfigurable architecture for fingerprint recognition. The fingerprint image is resized, and Compound Linear Binary Pattern (CLBP is applied on fingerprint, followed by histogram to obtain histogram CLBP features. Discrete Wavelet Transform (DWT Level 2 features are obtained by the same methodology. The novel matching score of CLBP is computed using histogram CLBP features of test image and fingerprint images in the database. Similarly, the DWT matching score is computed using DWT features of test image and fingerprint images in the database. Further, the matching scores of CLBP and DWT are fused with arithmetic equation using improvement factor. The performance parameters such as TSR (Total Success Rate, FAR (False Acceptance Rate, and FRR (False Rejection Rate are computed using fusion scores with correlation matching technique for FVC2004 DB3 Database. The proposed fusion based VLSI architecture is synthesized on Virtex xc5vlx30T-3 FPGA board using Finite State Machine resulting in optimized parameters.

Fingerprint and Face Identification for Large User Population

Directory of Open Access Journals (Sweden)

Teddy Ko

2003-06-01

Full Text Available The main objective of this paper is to present the state-of-the-art of the current biometric (fingerprint and face technology, lessons learned during the investigative analysis performed to ascertain the benefits of using combined fingerprint and facial technologies, and recommendations for the use of current available fingerprint and face identification technologies for optimum identification performance for applications using large user population. Prior fingerprint and face identification test study results have shown that their identification accuracies are strongly dependent on the image quality of the biometric inputs. Recommended methodologies for ensuring the capture of acceptable quality fingerprint and facial images of subjects are also presented in this paper.

Fingerprint: A Unique and Reliable Method for Identification

Directory of Open Access Journals (Sweden)

Palash Kumar Bose

2017-01-01

Full Text Available Fingerprints have been the gold standard for personal identification within the forensic community for more than one hundred years. It is still universal in spite of discovery of DNA fingerprint. The science of fingerprint identification has evolved over time from the early use of finger prints to mark business transactions in ancient Babylonia to their use today as core technology in biometric security devices and as scientific evidence in courts of law throughout the world. The science of fingerprints, dactylography or dermatoglyphics, had long been widely accepted, and well acclaimed and reputed as panacea for individualization, particularly in forensic investigations. Human fingerprints are detailed, unique, difficult to alter, and durable over the life of an individual, making them suitable as lifelong markers of human identity. Fingerprints can be readily used by police or other authorities to identify individuals who wish to conceal their identity, or to identify people who are incapacitated or deceased, as in the aftermath of a natural disaster

Environmental sex determination in the branchiopod crustacean Daphnia magna: deep conservation of a Doublesex gene in the sex-determining pathway.

Directory of Open Access Journals (Sweden)

Yasuhiko Kato

2011-03-01

Full Text Available Sex-determining mechanisms are diverse among animal lineages and can be broadly divided into two major categories: genetic and environmental. In contrast to genetic sex determination (GSD, little is known about the molecular mechanisms underlying environmental sex determination (ESD. The Doublesex (Dsx genes play an important role in controlling sexual dimorphism in genetic sex-determining organisms such as nematodes, insects, and vertebrates. Here we report the identification of two Dsx genes from Daphnia magna, a freshwater branchiopod crustacean that parthenogenetically produces males in response to environmental cues. One of these genes, designated DapmaDsx1, is responsible for the male trait development when expressed during environmental sex determination. The domain organization of DapmaDsx1 was similar to that of Dsx from insects, which are thought to be the sister group of branchiopod crustaceans. Intriguingly, the molecular basis for sexually dimorphic expression of DapmaDsx1 is different from that of insects. Rather than being regulated sex-specifically at the level of pre-mRNA splicing in the coding region, DapmaDsx1 exhibits sexually dimorphic differences in the abundance of its transcripts. During embryogenesis, expression of DapmaDsx1 was increased only in males and its transcripts were primarily detected in male-specific structures. Knock-down of DapmaDsx1 in male embryos resulted in the production of female traits including ovarian maturation, whereas ectopic expression of DapmaDsx1 in female embryos resulted in the development of male-like phenotypes. Expression patterns of another D. magna Dsx gene, DapmaDsx2, were similar to those of DapmaDsx1, but silencing and overexpression of this gene did not induce any clear phenotypic changes. These results establish DapmaDsx1 as a key regulator of the male phenotype. Our findings reveal how ESD is implemented by selective expression of a fundamental genetic component that is

OPTIMAL EXPERIMENT DESIGN FOR MAGNETIC RESONANCE FINGERPRINTING

OpenAIRE

Zhao, Bo; Haldar, Justin P.; Setsompop, Kawin; Wald, Lawrence L.

2016-01-01

Magnetic resonance (MR) fingerprinting is an emerging quantitative MR imaging technique that simultaneously acquires multiple tissue parameters in an efficient experiment. In this work, we present an estimation-theoretic framework to evaluate and design MR fingerprinting experiments. More specifically, we derive the Cram��r-Rao bound (CRB), a lower bound on the covariance of any unbiased estimator, to characterize parameter estimation for MR fingerprinting. We then formulate an optimal experi...

Image Processing and Features Extraction of Fingerprint Images ...

African Journals Online (AJOL)

To demonstrate the importance of the image processing of fingerprint images prior to image enrolment or comparison, the set of fingerprint images in databases (a) and (b) of the FVC (Fingerprint Verification Competition) 2000 database were analyzed using a features extraction algorithm. This paper presents the results of ...

Is The Principle Of Magna Carta Regarding Religious Liberties Applied In Macedonia?

Directory of Open Access Journals (Sweden)

Nuhija Bekim

2015-12-01

Full Text Available Human rights were analyzed and described in many writings from older times. If we consider their fame and historical value, most important ones are: Great Charter of Freedoms (Magna Carta Libertatum of 1215, the Law on Rights (Bill of Rights of 1689, the Declaration of Independence of the United States of America (1776 and the Declaration of the Rights of Man and Citizen (1789.

FINGERPRINT MATCHING BASED ON PORE CENTROIDS

Directory of Open Access Journals (Sweden)

S. Malathi

2011-05-01

Full Text Available In recent years there has been exponential growth in the use of bio- metrics for user authentication applications. Automated Fingerprint Identification systems have become popular tool in many security and law enforcement applications. Most of these systems rely on minutiae (ridge ending and bifurcation features. With the advancement in sensor technology, high resolution fingerprint images (1000 dpi pro- vide micro level of features (pores that have proven to be useful fea- tures for identification. In this paper, we propose a new strategy for fingerprint matching based on pores by reliably extracting the pore features The extraction of pores is done by Marker Controlled Wa- tershed segmentation method and the centroids of each pore are con- sidered as feature vectors for matching of two fingerprint images. Experimental results shows that the proposed method has better per- formance with lower false rates and higher accuracy.

Method for modeling post-mortem biometric 3D fingerprints

Science.gov (United States)

Rajeev, Srijith; Shreyas, Kamath K. M.; Agaian, Sos S.

2016-05-01

Despite the advancements of fingerprint recognition in 2-D and 3-D domain, authenticating deformed/post-mortem fingerprints continue to be an important challenge. Prior cleansing and reconditioning of the deceased finger is required before acquisition of the fingerprint. The victim's finger needs to be precisely and carefully operated by a medium to record the fingerprint impression. This process may damage the structure of the finger, which subsequently leads to higher false rejection rates. This paper proposes a non-invasive method to perform 3-D deformed/post-mortem finger modeling, which produces a 2-D rolled equivalent fingerprint for automated verification. The presented novel modeling method involves masking, filtering, and unrolling. Computer simulations were conducted on finger models with different depth variations obtained from Flashscan3D LLC. Results illustrate that the modeling scheme provides a viable 2-D fingerprint of deformed models for automated verification. The quality and adaptability of the obtained unrolled 2-D fingerprints were analyzed using NIST fingerprint software. Eventually, the presented method could be extended to other biometric traits such as palm, foot, tongue etc. for security and administrative applications.

Fingerprint enhancement using a multispectral sensor

Science.gov (United States)

Rowe, Robert K.; Nixon, Kristin A.

2005-03-01

The level of performance of a biometric fingerprint sensor is critically dependent on the quality of the fingerprint images. One of the most common types of optical fingerprint sensors relies on the phenomenon of total internal reflectance (TIR) to generate an image. Under ideal conditions, a TIR fingerprint sensor can produce high-contrast fingerprint images with excellent feature definition. However, images produced by the same sensor under conditions that include dry skin, dirt on the skin, and marginal contact between the finger and the sensor, are likely to be severely degraded. This paper discusses the use of multispectral sensing as a means to collect additional images with new information about the fingerprint that can significantly augment the system performance under both normal and adverse sample conditions. In the context of this paper, "multispectral sensing" is used to broadly denote a collection of images taken under different illumination conditions: different polarizations, different illumination/detection configurations, as well as different wavelength illumination. Results from three small studies using an early-stage prototype of the multispectral-TIR (MTIR) sensor are presented along with results from the corresponding TIR data. The first experiment produced data from 9 people, 4 fingers from each person and 3 measurements per finger under "normal" conditions. The second experiment provided results from a study performed to test the relative performance of TIR and MTIR images when taken under extreme dry and dirty conditions. The third experiment examined the case where the area of contact between the finger and sensor is greatly reduced.

EFFECTIVE CONCENTRATIONS OF 6 CONTAMINANTS TO LEMMA MINOR, PIMEPHALES PROMELA, DAPHNIA MAGNA, AND CERIODAPHNIA DUBIA

Science.gov (United States)

The research presented here resulted in EC50 and LOEC values for the contaminants copper, cadmium, diazinon, atrazine, and cyanide to the species Lemna Minor, Pimephales promelas, Daphnia magna, and Ceriodaphnia dubia. Observed values were used as benchmarks for assessing the se...

Recovery of latent fingerprints and DNA on human skin.

Science.gov (United States)

Färber, Doris; Seul, Andrea; Weisser, Hans-Joachim; Bohnert, Michael

2010-11-01

The project "Latent Fingerprints and DNA on Human Skin" was the first systematic research in Europe dealing with detection of fingerprints and DNA left by offenders on the skin of corpses. One thousand samples gave results that allow general statements on the materials and methods used. The tests were carried out according to a uniform trial structure. Fingerprints were deposited by natural donors on corpses. The latent fingerprints were treated with magnetic powder or black fingerprint powder. Afterward, they were lifted with silicone casting material (Isomark(®)) or gelatine foil. All lifts were swabbed to recover DNA. It was possible to visualize comparable and identifiable fingerprints on the skin of corpses (16%). In the same categories, magnetic powder (18.4%) yielded better results than black fingerprint powder (13.6%). The number of comparable and identifiable fingerprints decreased on the lifts (12.7%). Isomark(®) (14.9%) was the better lifting material in comparison with gelatine foil (10.1%). In one-third of the samples, DNA could be extracted from the powdered and lifted latents. Black fingerprint powder delivered the better result with a rate of 2.2% for full DNA profiles and profiles useful for exclusion in comparison with 1.8% for the magnetic powder traces. Isomark(®) (3.1%) yielded better results than gelatine foil (0.6%). © 2010 American Academy of Forensic Sciences.

Automated Extraction of Genomic DNA from Medically Important Yeast Species and Filamentous Fungi by Using the MagNA Pure LC System

OpenAIRE

Loeffler, Juergen; Schmidt, Kathrin; Hebart, Holger; Schumacher, Ulrike; Einsele, Hermann

2002-01-01

A fully automated assay was established for the extraction of DNA from clinically important fungi by using the MagNA Pure LC instrument. The test was evaluated by DNA isolation from 23 species of yeast and filamentous fungi and by extractions (n = 28) of serially diluted Aspergillus fumigatus conidia (105 to 0 CFU/ml). Additionally, DNA from 67 clinical specimens was extracted and compared to the manual protocol. The detection limit of the MagNA Pure LC assay of 10 CFU corresponded to the sen...

Genetic Fingerprinting of Wheat and Its Progenitors by Mitochondrial Gene orf256

Directory of Open Access Journals (Sweden)

Mona M. Elseehy

2012-04-01

Full Text Available orf256 is a wheat mitochondrial gene associated with cytoplasmic male sterility (CMS that has different organization in various species. This study exploited the orf256 gene as a mitochondrial DNA marker to study the genetic fingerprint of Triticum and Aegilops species. PCR followed by sequencing of common parts of the orf256 gene were employed to determine the fingerprint and molecular evolution of Triticum and Aegilops species. Although many primer pairs were used, two pairs of orf256 specific primers (5:-94/C: 482, 5:253/C: 482, amplified DNA fragments of 576 bp and 230 bp respectively in all species were tested. A common 500 bp of nine species of Triticum and Aegilops were aligned and showed consistent results with that obtained from other similar chloroplast or nuclear genes. Base alignment showed that there were various numbers of base substitutions in all species compared to S. cereal (Sc (the outgroup species. Phylogenetic relationship revealed similar locations and proximity on phylogenetic trees established using plastid and nuclear genes. The results of this study open a good route to use unknown function genes of mitochondria in studying the molecular relationships and evolution of wheat and complex plant genomes.

A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects.

Science.gov (United States)

Schlipalius, D I; Waldron, J; Carroll, B J; Collins, P J; Ebert, P R

2001-12-01

Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability in three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced approximately 50 scoreable polymorphic DNA markers, between individuals of three independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from individual DNA samples that had been combined to create the bulked samples.

Draft Genome Sequence of Serratia sp. Strain DD3, Isolated from the Guts of Daphnia magna

OpenAIRE

Poehlein, Anja; Freese, Heike M.; Daniel, Rolf; Simeonova, Diliana D.

2014-01-01

We report the draft genome sequence of Serratia sp. strain DD3, a gammaproteobacterium from the family Enterobacteriaceae. It was isolated from homogenized guts of Daphnia magna. The genome size is 5,274 Mb. peerReviewed

Growth and Survival Rate of Tilapia (Oreochromis niloticus Larvae Fed by Daphnia magna Cultured With Organic Fertilizer Resulted From Probiotic Bacteria Fermentation

Directory of Open Access Journals (Sweden)

Vivi Endar Herawati

2015-10-01

Full Text Available Daphnia magna is a potential feed for fish. The aim of this research was to find the best treatment and effect of D. magna culture addition from fermented organic fertilizer, to growth and survival rate of Oreochromis niloticus larvae. There were five treatments, each with three repetitions used in the study. All treatments used chicken dung, and different combinations of rice bran, coconut oilcake waste and tilapia larvae. Feeding on tilapia was given by ad libitum method for five times a day until 14 days. Water quality during the research was maintained at temperature 28–29°C, DO 0.3 ppm and pH 8.1–8.2. Observed variables include relative growth rate, survival rate, food consumption rate and water quality. Our results showed that D. magna cultured by fermented organic fertilizer for tilapia larvae (O. niloticus had high significant effect (p < 0.01 on the relative growth rate and survival rate. Treatment of D. magna cultured by 1.2 g/L chicken manure, 0.9 g/L rice bran and 0.3 g/L coconut oilcake showed the highest value on the relative growth rate (10.86%; survival rate (98.46% and food consumption at first week (106.43% and second week (152.76%.

The protective roles of TiO2 nanoparticles against UV-B toxicity in Daphnia magna.

Science.gov (United States)

Liu, Jie; Wang, Wen-Xiong

2017-09-01

Aquatic environments are increasingly under environmental stress due to ultraviolet (UV) radiation and potential inputs of nanoparticles with intense application of nanotechnology. In this study, we investigated the interaction between UV-B radiation and titanium nanoparticles (TiO 2 -NPs) in a model freshwater cladoceran Daphnia magna. UV-B toxicity to Daphnia magna was examined when the daphnids were exposed to a range of TiO 2 -NPs concentrations with an initial 5 or 10min of 200μW/cm 2 UV-B radiation. In addition, UV-B toxicity was also examined in the presence of TiO 2 -NPs in the body of daphnids. Our results demonstrated that the daphnid mortality under UV-B radiation decreased significantly in the presence of TiO 2 -NPs both in the water and in the body, indicating that TiO 2 -NPs had some protective effects on D. magna against UV-B. Such protective effect was mainly caused by the blockage of UV-B by TiO 2 -NPs adsorption. UV-B produced reactive oxygen species (ROS) in the water and in the daphnids, which was not sufficient to cause mortality of daphnids over short periods of radiation. Previous studies focused on the effects of TiO 2 -NPs on the toxicity of total UV radiation, and did not attempt to differentiate the potential diverse roles of UV-A and UV-B. Our study indicated that TiO 2 -NPs may conversely protect the UV-B toxicity to daphnids. Copyright © 2017 Elsevier B.V. All rights reserved.

Towards reconstruction of overlapping fingerprints using plasma spectroscopy

Science.gov (United States)

Yang, Jun-Ho; Choi, Soo-Jin; Yoh, Jack J.

2017-08-01

Chemical analysis is commonly used in the field of forensic science where the precise discrimination of primary evidence is of significant importance. Laser-Induced Breakdown Spectroscopy (LIBS) exceeds other spectroscopic methods in terms of the time required for pre- and post-sample preparation, the insensitivity to sample phase state be it solid, liquid, or gas, and the detection of two-dimensional spectral mapping from real time point measurements. In this research, fingerprint samples on various surface materials are considered in the chemical detection and reconstruction of fingerprints using the two-dimensional LIBS technique. Strong and distinct intensities of specific wavelengths represent visible ink, natural secretion of sweat, and contaminants from the environment, all of which can be present in latent fingerprints. The particular aim of the work presented here is to enhance the precision of the two-dimensional recreation of the fingerprints present on metal, plastic, and artificially prepared soil surface using LIBS with principal component analysis. By applying a distinct wavelength discrimination for two overlapping fingerprint samples, separation into two non-identical chemical fingerprints was successfully performed.

Influence of environmental factors on the response of a natural population of Daphnia magna (Crustacea: Cladocera) to spinosad and Bacillus thuringiensis israelensis in Mediterranean coastal wetlands

Energy Technology Data Exchange (ETDEWEB)

Duchet, C. [Entente Interdepartementale de Demoustication du Littoral Mediterraneen, 165 avenue Paul-Rimbaud, Montpellier F-34184 (France); INRA, UMR985 Ecologie et Sante des Ecosystemes, Equipe Ecotoxicologie et Qualite des Milieux Aquatiques, 65 rue de Saint Brieuc, Rennes F-35042 (France); Caquet, Th. [INRA, UMR985 Ecologie et Sante des Ecosystemes, Equipe Ecotoxicologie et Qualite des Milieux Aquatiques, 65 rue de Saint Brieuc, Rennes F-35042 (France); Franquet, E. [Universite Paul Cezanne, Institut Mediterraneen d' Ecologie et de Paleoecologie, Faculte des Sciences et Techniques Saint Jerome, C31, Marseille F-13397 (France); Lagneau, C. [Entente Interdepartementale de Demoustication du Littoral Mediterraneen, 165 avenue Paul-Rimbaud, Montpellier F-34184 (France); Lagadic, L., E-mail: Laurent.Lagadic@rennes.inra.f [INRA, UMR985 Ecologie et Sante des Ecosystemes, Equipe Ecotoxicologie et Qualite des Milieux Aquatiques, 65 rue de Saint Brieuc, Rennes F-35042 (France)

2010-05-15

The present study was undertaken to assess the impact of a candidate mosquito larvicide, spinosad (8, 17 and 33 mug L{sup -1}) on a field population of Daphnia magna under natural variations of water temperature and salinity, using Bti (0.16 and 0.50 muL L{sup -1}) as the reference larvicide. Microcosms (125 L) were placed in a shallow temporary marsh where D. magna was naturally present. The peak of salinity observed during the 21-day observation period may have been partly responsible for the decrease of daphnid population density in all the microcosms. It is also probably responsible for the absence of recovery in the microcosms treated with spinosad which caused a sharp decrease of D. magna abundance within the first two days following treatment whereas Bti had no effect. These results suggest that it may be difficult for a field population of daphnids to cope simultaneously with natural (water salinity and temperature) and anthropogenic (larvicides) stressors. - Significant interaction between salinity and spinosad exposure impairs the recovery of a natural population of Daphnia magna.

Rapid in vitro labeling procedures for two-dimensional gel fingerprinting

International Nuclear Information System (INIS)

Lee, Y.F.; Fowlks, E.R.

1982-01-01

Improvements of existing in vitro procedures for labeling RNA radioactively, and modifications of the two-dimensional polyacrylamide gel electrophoresis system for making RNA fingerprints are described. These improvements are (a) inactivation of phosphatase with nitric acid at pH 2.0 eliminated the phenol-cholorform extraction step during 5'-end labeling with polynucleotide kinase and [γ- 32 P]ATP; (b) ZnSO 4 inactivation of R Nase T 1 results in a highly efficient procedure for 3'-end labeling with T4 ligase and [5'- 32 P]pCp; and (c) a rapid 4-min procedure for variable quantity range of 125 I and RNA results in a qualitative and quantitative sample for high-molecular weight RNA fingerprinting. Thus, these in vitro procedures become rapid and reproducible when combined with two-dimensional gel electrophoresis which eliminates simultaneously labeled impurities. Each labeling procedure is compared, using tobacco mosaic virus, Brome mosaic virus, and polio RNA. A series of Ap-rich oligonucleotides was discovered in the inner genome of Brome mosaic Virus RNA-3

cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

OpenAIRE

Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

1999-01-01

A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

Cancelable remote quantum fingerprint templates protection scheme

International Nuclear Information System (INIS)

Liao Qin; Guo Ying; Huang Duan

2017-01-01

With the increasing popularity of fingerprint identification technology, its security and privacy have been paid much attention. Only the security and privacy of biological information are insured, the biological technology can be better accepted and used by the public. In this paper, we propose a novel quantum bit (qbit)-based scheme to solve the security and privacy problem existing in the traditional fingerprint identification system. By exploiting the properties of quantm mechanics, our proposed scheme, cancelable remote quantum fingerprint templates protection scheme, can achieve the unconditional security guaranteed in an information-theoretical sense. Moreover, this novel quantum scheme can invalidate most of the attacks aimed at the fingerprint identification system. In addition, the proposed scheme is applicable to the requirement of remote communication with no need to worry about its security and privacy during the transmission. This is an absolute advantage when comparing with other traditional methods. Security analysis shows that the proposed scheme can effectively ensure the communication security and the privacy of users’ information for the fingerprint identification. (paper)

Impact of Finger Type in Fingerprint Authentication

Science.gov (United States)

Gafurov, Davrondzhon; Bours, Patrick; Yang, Bian; Busch, Christoph

Nowadays fingerprint verification system is the most widespread and accepted biometric technology that explores various features of the human fingers for this purpose. In general, every normal person has 10 fingers with different size. Although it is claimed that recognition performance with little fingers can be less accurate compared to other finger types, to our best knowledge, this has not been investigated yet. This paper presents our study on the topic of influence of the finger type into fingerprint recognition performance. For analysis we employ two fingerprint verification software packages (one public and one commercial). We conduct test on GUC100 multi sensor fingerprint database which contains fingerprint images of all 10 fingers from 100 subjects. Our analysis indeed confirms that performance with small fingers is less accurate than performance with the others fingers of the hand. It also appears that best performance is being obtained with thumb or index fingers. For example, performance deterioration from the best finger (i.e. index or thumb) to the worst fingers (i.e. small ones) can be in the range of 184%-1352%.

Relationship between trans-generational effects of tetracycline on Daphnia magna at the physiological and whole organism level

International Nuclear Information System (INIS)

Kim, Hyun Young; Yu, Seungho; Jeong, Tae-yong; Kim, Sang Don

2014-01-01

The effects of pharmaceuticals have been underestimated during single generation exposure. Therefore, in this study, we investigated toxic responses at the physiological and whole organism level in tetracycline-exposed Daphnia magna over four consecutive generational lifecycles. The results showed that tetracycline affected energy-related physiological functions in concentration- and generation-dependent manners, and especially maintenance costs increased. Consequently, multigenerational exposure to tetracycline induced changes in energy balance, resulting in the change of higher levels of biological responses. In contrast, D. magna acclimated to tetracycline exposure over multiple generations, as evidenced by the increased LC 50 values. Transgenerational adaptation was related to the neonatal sensitivity and energy reserves of the organism. The results also emphasized the idea that the number of generation is an important factor for toxicity. The present study confirmed that toxic stress induces metabolic changes in an organism, thereby leading to increased energy consumption that results in adverse effects on reproduction. - Highlights: • Transgenerational adaptation of D. magna to tetracycline was observed. • TCN affected energy-related physiological function and increased maintenance energy. • LC 50 value of TCN increased with increasing concentration and generation. • The number of exposure generation may be an important factor for toxicity. - The change in internal energy balance in daphnids during multigenerational exposure to tetracycline may explain whole organism responses

Distributed construction of quantum fingerprints

OpenAIRE

Ambainis, Andris; Shi, Yaoyun

2003-01-01

Quantum fingerprints are useful quantum encodings introduced by Buhrman, Cleve, Watrous, and de Wolf (Physical Review Letters, Volume 87, Number 16, Article 167902, 2001; quant-ph/0102001) in obtaining an efficient quantum communication protocol. We design a protocol for constructing the fingerprint in a distributed scenario. As an application, this protocol gives rise to a communication protocol more efficient than the best known classical protocol for a communication problem.

Pharmacological and morphological characteristics of the muscular system of the giant liver fluke (Fascioloides magna - Bassi 1875).

Science.gov (United States)

Trailović, Saša M; Marinković, Darko; Trailović, Jelena Nedeljković; Milovanović, Mirjana; Marjanović, Djordje S; Aničić, Milan R

2015-12-01

Motility is required for feeding, reproduction and maintenance of the fluke in the host's liver. According to that, the neuromuscular system can be an attractive drugable target for chemotherapy. Musculature of the Fascioloides magna is organized into three layers, an outer circular layer, beneath this layer the longitudinal layer, and third, the oblique, or diagonal layer underlies the longitudinal layer. In our study, the administration of atropine or caffeine did not cause classic muscle contractions of F. magna muscle strips. However, the Electrical Field Stimulation (EFS) induced stable and repeatable contractions, which enabled us to examine their sensitivity to the various substances. Acetylcholine (ACh) (300 μM and 1 mM), caused only a slight relaxation, without affecting the amplitude of spontaneous contractions or the amplitude of contractions induced by EFS. Contrary to that, atropine (100 μM) caused a significant increase in the basal tone and an increase of EFS-induced contractions. If acetylcholine is an inhibitory neurotransmitter in trematodes, the described effects of atropine are achieved by the blockade of inhibitory neurotransmission. On the other hand, with respect to the process of excitation-contraction coupling, the plant alkaloid ryanodine (30 μM) significantly reduced the basal tone, as well as EFS-induced contractions of F. magna muscle strips. Ryanodine inhibited the potentiating effect of atropine on the basal tone and contractions caused by EFS, which indicates that the contractile effect of atropine is dependent on Ca(++) release from intracellular stores. Caffeine (500 μM) caused relaxation of fluke muscle strips and at the same time significantly enhanced the EFS-induced contractions. Both effects of caffeine can be explained by entry of extracellular Ca(++) into muscle cells. The muscle contractility of F. magna depends both on the entry of extracellular calcium, and calcium release from intracellular stores, which are

Use of SSR markers for DNA fingerprinting and diversity analysis of Pakistani sugarcane (Saccharum spp. hybrids) cultivars

Science.gov (United States)

In recent years SSR markers have been used widely for genetic analysis. The objective of this study was to use an SSR-based marker system to develop the molecular fingerprints and analyze the genetic relationship of sugarcane cultivars grown in Pakistan. Twenty-one highly polymorphic SSR markers wer...

Secure fingerprint identification based on structural and microangiographic optical coherence tomography.

Science.gov (United States)

Liu, Xuan; Zaki, Farzana; Wang, Yahui; Huang, Qiongdan; Mei, Xin; Wang, Jiangjun

2017-03-10

Optical coherence tomography (OCT) allows noncontact acquisition of fingerprints and hence is a highly promising technology in the field of biometrics. OCT can be used to acquire both structural and microangiographic images of fingerprints. Microangiographic OCT derives its contrast from the blood flow in the vasculature of viable skin tissue, and microangiographic fingerprint imaging is inherently immune to fake fingerprint attack. Therefore, dual-modality (structural and microangiographic) OCT imaging of fingerprints will enable more secure acquisition of biometric data, which has not been investigated before. Our study on fingerprint identification based on structural and microangiographic OCT imaging is, we believe, highly innovative. In this study, we performed OCT imaging study for fingerprint acquisition, and demonstrated the capability of dual-modality OCT imaging for the identification of fake fingerprints.

Study of noninvasive detection of latent fingerprints using UV laser

Science.gov (United States)

Li, Hong-xia; Cao, Jing; Niu, Jie-qing; Huang, Yun-gang; Mao, Lin-jie; Chen, Jing-rong

2011-06-01

Latent fingerprints present a considerable challenge in forensics, and noninvasive procedure that captures a digital image of the latent fingerprints is significant in the field of criminal investigation. The capability of photography technologies using 266nm UV Nd:YAG solid state laser as excitation light source to provide detailed images of unprocessed latent fingerprints is demonstrated. Unprocessed latent fingerprints were developed on various non-absorbent and absorbing substrates. According to the special absorption, reflection, scattering and fluorescence characterization of the various residues in fingerprints (fatty acid ester, protein, and carbosylic acid salts etc) to the UV light to weaken or eliminate the background disturbance and increase the brightness contrast of fingerprints with the background, and using 266nm UV laser as excitation light source, fresh and old latent fingerprints on the surface of four types of non-absorbent objects as magazine cover, glass, back of cellphone, wood desktop paintwork and two types of absorbing objects as manila envelope, notebook paper were noninvasive detected and appeared through reflection photography and fluorescence photography technologies, and the results meet the fingerprint identification requirements in forensic science.

Holistic processing of fingerprints by expert forensic examiners.

Science.gov (United States)

Vogelsang, Macgregor D; Palmeri, Thomas J; Busey, Thomas A

2017-01-01

Holistic processing is often characterized as a process by which objects are perceived as a whole rather than a compilation of individual features. This mechanism may play an important role in the development of perceptual expertise because it allows for rapid integration across image regions. The present work explores whether holistic processing is present in latent fingerprint examiners, who compare fingerprints collected from crime scenes against a set of standards taken from a suspect. We adapted a composite task widely used in the face recognition and perceptual expertise literatures, in which participants were asked to match only a particular half of a fingerprint with a previous image while ignoring the other half. We tested both experts and novices, using both upright and inverted fingerprints. For upright fingerprints, we found weak evidence for holistic processing, but with no differences between experts and novices with respect to holistic processing. For inverted fingerprints, we found stronger evidence of holistic processing, with weak evidence for differences between experts and novices. These relatively weak holistic processing effects contrast with robust evidence for holistic processing with faces and with objects in other domains of perceptual expertise. The data constrain models of holistic processing by demonstrating that latent fingerprint experts and novices may not substantively differ in terms of the amount of holistic processing and that inverted stimuli actually produced more evidence for holistic processing than upright stimuli. Important differences between the present fingerprint stimuli and those in the literature include the lack of verbal labels for experts and the absence of strong vertical asymmetries, both of which might contribute to stronger holistic processing signatures in other stimulus domains.

Cognitive Fingerprints

Science.gov (United States)

2015-03-25

is another cognitive fingerprint that has been used extensively for authorship . This work has been ex- tended to authentication by relating keyboard...this work is the inference of high-level features such as personality, gender , and dominant hand but those features have not been integrated to date

Effects of various metals on survival, growth, reproduction, and metabolism of Daphnia magna

Energy Technology Data Exchange (ETDEWEB)

Biesinger, K E; Christensen, G M

1972-01-01

The toxicities of various metals to Daphnia magna were evaluated on the basis of a 48-hr 50% lethal concentration (lc50) 3-week 16% reproductive impairment concentrations (In micrograms per liter) for the metal ions tested were: Na(I), 680,000; Ca(II), 116,000; Mg(II), 82,000; K(I), 53,000; Sr(II), 42,000; Ba(II), 5,800; Fe(III), 4,380; Mn(II), 4,100; As(V), 520; Sn(II), 350; Cr(III), 330; Al(III), 320; Zn(II), 70; Au(III), 60; Ni(II), 30; Pb(II), 30; Cu(II), 22; Pt(IV), 14; Co(II), 10; Hg(II), 3.4; and Cd(II), 0.17. At mental concentrations permitting survival but impairing reproduction, daphnids weighed less than control animals. Amounts of total protein and glutamic oxalacetic transaminase activity varied with the different metals. The negative logarithm of the solubility product constant 8 pksp of the metal sulfides, electronegativity, and the logarithm of the equilibrium constant (log keg) of the metal-ATP complex were positively correlated with toxicity to D. magna. Other physicochemical properties were considered, but no additional correlations were found.

DNA fingerprinting in botany: past, present, future.

Science.gov (United States)

Nybom, Hilde; Weising, Kurt; Rotter, Björn

2014-01-03

Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67-73 and Nature 1985, 316:76-79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined "Fingerprint News" was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on "DNA fingerprinting: approaches and applications". Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting ("the past") was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as "DNA fingerprinting in the present", and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA sequencing

Study on the Effect of Heavy metals toxicity according to changing Hardness concentration using D.magna

Science.gov (United States)

Chun Sang, H.

2016-12-01

n order to determine and prevent the number of ecological effects of heavy metals in the materials, we have to accurately measure the heavy metals present in the water-based protection ecosystems and may determine the effects to humans. Heavy metals occurred in the industrial effluent which is a state in which the monitor, based on the emission standards are made by the Ministry of Environment and managed and waste water contained Copper, Zinc, lead, etc. These heavy metals are able to express the toxic effects only when present in the free-ions in the aqueous condition, which appears differently affected by the degree to hardness change in accordance with the season, precipitation. Generally changing hardness concentration can not precisely evaluate toxic effects of heavy metals in the water system. Anderson announced a study on bioassay for heavy metals from industrial waste water using Daphnia magna(Anderson, 1944, 1948). Breukelman published study the resitivity difference for the mercury Chloride(HgCl2). Braudouin(1974) compared the zooplankton(Daphnia sp.) acute toxicity of the different heavy metals and confirmed the sensitivity. Shcherban(1979) presented for toxicity evaluation results for the heavy metal of the Daphnia magna according to different temperature conditions. In the United States Environmental Protection Agency(EPA) established a standard test method for water fleas, managed and supervised water ecosystems, and announced the adoption of a bioassay standard method. This study was performed to evaluate acute inhibition using the Daphnia magna for the biological effect of heavy metal ions in water-based toxicity in the hardness change. Evaluation methods were conducted in EPA Water Quality process test criteria. TU(Toxic Unit), NOEC (No Observable Effect Concentration), LOEC (Lowest Observable Effect Concentration), EC50 (Median Effective Concentration) was calculated by Toxcalc 5.0 Program. Keywords : D. magna, Hardness, Toxic Unit, Heavy metal

Privacy protection schemes for fingerprint recognition systems

Science.gov (United States)

Marasco, Emanuela; Cukic, Bojan

2015-05-01

The deployment of fingerprint recognition systems has always raised concerns related to personal privacy. A fingerprint is permanently associated with an individual and, generally, it cannot be reset if compromised in one application. Given that fingerprints are not a secret, potential misuses besides personal recognition represent privacy threats and may lead to public distrust. Privacy mechanisms control access to personal information and limit the likelihood of intrusions. In this paper, image- and feature-level schemes for privacy protection in fingerprint recognition systems are reviewed. Storing only key features of a biometric signature can reduce the likelihood of biometric data being used for unintended purposes. In biometric cryptosystems and biometric-based key release, the biometric component verifies the identity of the user, while the cryptographic key protects the communication channel. Transformation-based approaches only a transformed version of the original biometric signature is stored. Different applications can use different transforms. Matching is performed in the transformed domain which enable the preservation of low error rates. Since such templates do not reveal information about individuals, they are referred to as cancelable templates. A compromised template can be re-issued using a different transform. At image-level, de-identification schemes can remove identifiers disclosed for objectives unrelated to the original purpose, while permitting other authorized uses of personal information. Fingerprint images can be de-identified by, for example, mixing fingerprints or removing gender signature. In both cases, degradation of matching performance is minimized.

A novel interaction fingerprint derived from per atom score contributions: exhaustive evaluation of interaction fingerprint performance in docking based virtual screening.

Science.gov (United States)

Jasper, Julia B; Humbeck, Lina; Brinkjost, Tobias; Koch, Oliver

2018-03-16

Protein ligand interaction fingerprints are a powerful approach for the analysis and assessment of docking poses to improve docking performance in virtual screening. In this study, a novel interaction fingerprint approach (PADIF, protein per atom score contributions derived interaction fingerprint) is presented which was specifically designed for utilising the GOLD scoring functions' atom contributions together with a specific scoring scheme. This allows the incorporation of known protein-ligand complex structures for a target-specific scoring. Unlike many other methods, this approach uses weighting factors reflecting the relative frequency of a specific interaction in the references and penalizes destabilizing interactions. In addition, and for the first time, an exhaustive validation study was performed that assesses the performance of PADIF and two other interaction fingerprints in virtual screening. Here, PADIF shows superior results, and some rules of thumb for a successful use of interaction fingerprints could be identified.

Optimal experiment design for magnetic resonance fingerprinting.

Science.gov (United States)

Bo Zhao; Haldar, Justin P; Setsompop, Kawin; Wald, Lawrence L

2016-08-01

Magnetic resonance (MR) fingerprinting is an emerging quantitative MR imaging technique that simultaneously acquires multiple tissue parameters in an efficient experiment. In this work, we present an estimation-theoretic framework to evaluate and design MR fingerprinting experiments. More specifically, we derive the Cramér-Rao bound (CRB), a lower bound on the covariance of any unbiased estimator, to characterize parameter estimation for MR fingerprinting. We then formulate an optimal experiment design problem based on the CRB to choose a set of acquisition parameters (e.g., flip angles and/or repetition times) that maximizes the signal-to-noise ratio efficiency of the resulting experiment. The utility of the proposed approach is validated by numerical studies. Representative results demonstrate that the optimized experiments allow for substantial reduction in the length of an MR fingerprinting acquisition, and substantial improvement in parameter estimation performance.

Exposure of Daphnia magna to trichloroethylene (TCE) and vinyl chloride (VC): evaluation of gene transcription, cellular activity, and life-history parameters.

Science.gov (United States)

Houde, Magali; Douville, Mélanie; Gagnon, Pierre; Sproull, Jim; Cloutier, François

2015-06-01

Trichloroethylene (TCE) is a ubiquitous contaminant classified as a human carcinogen. Vinyl chloride (VC) is primarily used to manufacture polyvinyl chloride and can also be a degradation product of TCE. Very few data exist on the toxicity of TCE and VC in aquatic organisms particularly at environmentally relevant concentrations. The aim of this study was to evaluate the sub-lethal effects (10 day exposure; 0.1; 1; 10 µg/L) of TCE and VC in Daphnia magna at the gene, cellular, and life-history levels. Results indicated impacts of VC on the regulation of genes related to glutathione-S-transferase (GST), juvenile hormone esterase (JHE), and the vitelline outer layer membrane protein (VMO1). On the cellular level, exposure to 0.1, 1, and 10 µg/L of VC significantly increased the activity of JHE in D. magna and TCE increased the activity of chitinase (at 1 and 10 µg/L). Results for life-history parameters indicated a possible tendency of TCE to affect the number of molts at the individual level in D. magna (p=0.051). Measurement of VG-like proteins using the alkali-labile phosphates (ALP) assay did not show differences between TCE treated organisms and controls. However, semi-quantitative measurement using gradient gel electrophoresis (213-218 kDa) indicated significant decrease in VG-like protein levels following exposure to TCE at all three concentrations. Overall, results indicate effects of TCE and VC on genes and proteins related to metabolism, reproduction, and growth in D. magna. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

A fingerprint key binding algorithm based on vector quantization and error correction

Science.gov (United States)

Li, Liang; Wang, Qian; Lv, Ke; He, Ning

2012-04-01

In recent years, researches on seamless combination cryptosystem with biometric technologies, e.g. fingerprint recognition, are conducted by many researchers. In this paper, we propose a binding algorithm of fingerprint template and cryptographic key to protect and access the key by fingerprint verification. In order to avoid the intrinsic fuzziness of variant fingerprints, vector quantization and error correction technique are introduced to transform fingerprint template and then bind with key, after a process of fingerprint registration and extracting global ridge pattern of fingerprint. The key itself is secure because only hash value is stored and it is released only when fingerprint verification succeeds. Experimental results demonstrate the effectiveness of our ideas.

The effects of food availability on growth and reproduction of Daphnia magna exposed to silver nanoparticles

DEFF Research Database (Denmark)

Mackevica, Aiga; Skjolding, Lars Michael; Gergs, A.

) were performed using 30 nm citric acid stabilized AgNP. The aim of the study was, besides providing data for the chronic toxicity of AgNP, to study the influence of the food availability on the reproductive toxicity of AgNP in Daphnia magna. The exposure concentrations applied ranged from 2 to 50 μg...... to controls, whereas concentrations above 10 μgAg/L resulted in inhibition of growth and reproduction as well as an increased mortality. The addition of higher amounts of food showed a beneficial effect on animal survival, growth and reproduction. Similar as in normal food availability treatment, animals......The number of available studies on the acute effects of silver nanoparticles (AgNP) on aquatic organisms has increased dramatically in recent years, but there is still very limited information available on chronic effects. In this study, a series of Daphnia magna 21-days reproduction test (OECD 211...

Missing data reconstruction using Gaussian mixture models for fingerprint images

Science.gov (United States)

Agaian, Sos S.; Yeole, Rushikesh D.; Rao, Shishir P.; Mulawka, Marzena; Troy, Mike; Reinecke, Gary

2016-05-01

Publisher's Note: This paper, originally published on 25 May 2016, was replaced with a revised version on 16 June 2016. If you downloaded the original PDF, but are unable to access the revision, please contact SPIE Digital Library Customer Service for assistance. One of the most important areas in biometrics is matching partial fingerprints in fingerprint databases. Recently, significant progress has been made in designing fingerprint identification systems for missing fingerprint information. However, a dependable reconstruction of fingerprint images still remains challenging due to the complexity and the ill-posed nature of the problem. In this article, both binary and gray-level images are reconstructed. This paper also presents a new similarity score to evaluate the performance of the reconstructed binary image. The offered fingerprint image identification system can be automated and extended to numerous other security applications such as postmortem fingerprints, forensic science, investigations, artificial intelligence, robotics, all-access control, and financial security, as well as for the verification of firearm purchasers, driver license applicants, etc.

Uniqueness: skews bit occurrence frequencies in randomly generated fingerprint libraries.

Science.gov (United States)

Chen, Nelson G

2016-08-01

Requiring that randomly generated chemical fingerprint libraries have unique fingerprints such that no two fingerprints are identical causes a systematic skew in bit occurrence frequencies, the proportion at which specified bits are set. Observed frequencies (O) at which each bit is set within the resulting libraries systematically differ from frequencies at which bits are set at fingerprint generation (E). Observed frequencies systematically skew toward 0.5, with the effect being more pronounced as library size approaches the compound space, which is the total number of unique possible fingerprints given the number of bit positions each fingerprint contains. The effect is quantified for varying library sizes as a fraction of the overall compound space, and for changes in the specified frequency E. The cause and implications for this systematic skew are subsequently discussed. When generating random libraries of chemical fingerprints, the imposition of a uniqueness requirement should either be avoided or taken into account.

Application of molecular markers to find out classificatory ...

African Journals Online (AJOL)

The present communication is aimed to find out determinants of molecular marker based classification of rice (Oryza sativa L) germplasm using the available data from an experiment conducted for development of molecular fingerprints of diverse varieties of Basmati and non Basmati rice adapted to irrigated and aerobic ...

Fingerprint recognition system by use of graph matching

Science.gov (United States)

Shen, Wei; Shen, Jun; Zheng, Huicheng

2001-09-01

Fingerprint recognition is an important subject in biometrics to identify or verify persons by physiological characteristics, and has found wide applications in different domains. In the present paper, we present a finger recognition system that combines singular points and structures. The principal steps of processing in our system are: preprocessing and ridge segmentation, singular point extraction and selection, graph representation, and finger recognition by graphs matching. Our fingerprint recognition system is implemented and tested for many fingerprint images and the experimental result are satisfactory. Different techniques are used in our system, such as fast calculation of orientation field, local fuzzy dynamical thresholding, algebraic analysis of connections and fingerprints representation and matching by graphs. Wed find that for fingerprint database that is not very large, the recognition rate is very high even without using a prior coarse category classification. This system works well for both one-to-few and one-to-many problems.

Utilizing AFIS searching tools to reduce errors in fingerprint casework.

Science.gov (United States)

Langenburg, Glenn; Hall, Carey; Rosemarie, Quincy

2015-12-01

Fifty-six (56) adjudicated, property crime cases involving fingerprint evidence were reviewed using a case-specific AFIS database tool. This tool allowed fingerprint experts to search latent prints in the cases against a database of friction ridge exemplars limited to only the individuals specific to that particular case. We utilized three different methods to encode and search the latent prints: automatic feature extraction, manual encoding performed by a student intern, and manual encoding performed by a fingerprint expert. Performance in the study was strongest when the encoding was conducted by the fingerprint expert. The results of the study showed that while the AFIS tools failed to locate all of the identifications originally reported by the initial fingerprint expert that worked the case, the AFIS tools helped to identify 7 additional latent prints that were not reported by the initial fingerprint expert. We conclude that this technology, when combined with fingerprint expertise, will reduce the number of instances where an erroneous exclusion could occur, increase the efficiency of a fingerprint unit, and be a useful tool for reviewing active or cold cases for missed opportunities to report identifications. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

On the introduction of secondary fingerprint classification

CSIR Research Space (South Africa)

Msiza, IS

2011-07-01

Full Text Available The concept of fingerprint classification is an important one because of the need to, before executing a database search procedure, virtually break the fingerprint template database into smaller, manageable partitions. This is done in order to avoid...

Multi-generation cadmium acclimation and tolerance in Daphnia magna Straus

International Nuclear Information System (INIS)

Muyssen, Brita T.A.; Janssen, Colin R.

2004-01-01

The cladoceran Daphnia magna was acclimated for seven generations to cadmium concentrations ranging from 0 (control) to 250 μg/l Cd (corresponding to a free ion activity of 4.60 nM Cd 2+ ). Acute and chronic cadmium tolerance as well as cadmium accumulation were monitored as a function of acclimation time. After two to three generations of acclimation to concentrations ranging from 0.23 to 1.11 nM Cd 2+ increases in acute tolerance were maximal (factor 7.2) and significant. Acclimation for seven generations to the same acclimation concentrations did result in an increased chronic cadmium tolerance (21 days EC 50 values increased). Organisms acclimated to 1.93 nM Cd 2+ were equally or more sensitive than non-acclimated daphnids in acute and chronic toxicity tests. Cadmium contents in D. magna increased significantly as a function of the acclimation concentration. Maximum body burdens of 236±30 μg Cd/g dry weight were measured in organisms exposed to 4.60 nM Cd 2+ , but detoxification mechanisms were only successful up to 82±20 μg Cd/g dry weight as this concentration did not cause major decreases in survival and reproduction in chronic toxicity tests. As the potential positive effect of acclimation on cadmium tolerance disappeared with successive acclimation generations and increasing acclimation concentrations, it is concluded that multi-generation acclimation studies are important for the evaluation of the long-term effects of environmental toxicants. - Multi-generation acclimation studies are important for evaluating long-term effects of aquatic pollutants

The development of pathogen resistance in Daphnia magna: implications for disease spread in age-structured populations.

Science.gov (United States)

Garbutt, Jennie S; O'Donoghue, Anna J P; McTaggart, Seanna J; Wilson, Philip J; Little, Tom J

2014-11-01

Immunity in vertebrates is well established to develop with time, but the ontogeny of defence in invertebrates is markedly less studied. Yet, age-specific capacity for defence against pathogens, coupled with age structure in populations, has widespread implications for disease spread. Thus, we sought to determine the susceptibility of hosts of different ages in an experimental invertebrate host-pathogen system. In a series of experiments, we show that the ability of Daphnia magna to resist its natural bacterial pathogen Pasteuria ramosa changes with host age. Clonal differences make it difficult to draw general conclusions, but the majority of observations indicate that resistance increases early in the life of D. magna, consistent with the idea that the defence system develops with time. Immediately following this, at about the time when a daphnid would be most heavily investing in reproduction, resistance tends to decline. Because many ecological factors influence the age structure of Daphnia populations, our results highlight a broad mechanism by which ecological context can affect disease epidemiology. We also show that a previously observed protective effect of restricted maternal food persists throughout the entire juvenile period, and that the protective effect of prior treatment with a small dose of the pathogen ('priming') persists for 7 days, observations that reinforce the idea that immunity in D. magna can change over time. Together, our experiments lead us to conclude that invertebrate defence capabilities have an ontogeny that merits consideration with respect to both their immune systems and the epidemic spread of infection. © 2014. Published by The Company of Biologists Ltd.

Snake Model Based on Improved Genetic Algorithm in Fingerprint Image Segmentation

Directory of Open Access Journals (Sweden)

Mingying Zhang

2016-12-01

Full Text Available Automatic fingerprint identification technology is a quite mature research field in biometric identification technology. As the preprocessing step in fingerprint identification, fingerprint segmentation can improve the accuracy of fingerprint feature extraction, and also reduce the time of fingerprint preprocessing, which has a great significance in improving the performance of the whole system. Based on the analysis of the commonly used methods of fingerprint segmentation, the existing segmentation algorithm is improved in this paper. The snake model is used to segment the fingerprint image. Additionally, it is improved by using the global optimization of the improved genetic algorithm. Experimental results show that the algorithm has obvious advantages both in the speed of image segmentation and in the segmentation effect.

Artificial fingerprint recognition by using optical coherence tomography with autocorrelation analysis

Science.gov (United States)

Cheng, Yezeng; Larin, Kirill V.

2006-12-01

Fingerprint recognition is one of the most widely used methods of biometrics. This method relies on the surface topography of a finger and, thus, is potentially vulnerable for spoofing by artificial dummies with embedded fingerprints. In this study, we applied the optical coherence tomography (OCT) technique to distinguish artificial materials commonly used for spoofing fingerprint scanning systems from the real skin. Several artificial fingerprint dummies made from household cement and liquid silicone rubber were prepared and tested using a commercial fingerprint reader and an OCT system. While the artificial fingerprints easily spoofed the commercial fingerprint reader, OCT images revealed the presence of them at all times. We also demonstrated that an autocorrelation analysis of the OCT images could be potentially used in automatic recognition systems.

A fingerprint classification algorithm based on combination of local and global information

Science.gov (United States)

Liu, Chongjin; Fu, Xiang; Bian, Junjie; Feng, Jufu

2011-12-01

Fingerprint recognition is one of the most important technologies in biometric identification and has been wildly applied in commercial and forensic areas. Fingerprint classification, as the fundamental procedure in fingerprint recognition, can sharply decrease the quantity for fingerprint matching and improve the efficiency of fingerprint recognition. Most fingerprint classification algorithms are based on the number and position of singular points. Because the singular points detecting method only considers the local information commonly, the classification algorithms are sensitive to noise. In this paper, we propose a novel fingerprint classification algorithm combining the local and global information of fingerprint. Firstly we use local information to detect singular points and measure their quality considering orientation structure and image texture in adjacent areas. Furthermore the global orientation model is adopted to measure the reliability of singular points group. Finally the local quality and global reliability is weighted to classify fingerprint. Experiments demonstrate the accuracy and effectivity of our algorithm especially for the poor quality fingerprint images.

Efficient Filtering of Noisy Fingerprint Images

Directory of Open Access Journals (Sweden)

Maria Liliana Costin

2016-01-01

Full Text Available Fingerprint identification is an important field in the wide domain of biometrics with many applications, in different areas such: judicial, mobile phones, access systems, airports. There are many elaborated algorithms for fingerprint identification, but none of them can guarantee that the results of identification are always 100 % accurate. A first step in a fingerprint image analysing process consists in the pre-processing or filtering. If the result after this step is not by a good quality the upcoming identification process can fail. A major difficulty can appear in case of fingerprint identification if the images that should be identified from a fingerprint image database are noisy with different type of noise. The objectives of the paper are: the successful completion of the noisy digital image filtering, a novel more robust algorithm of identifying the best filtering algorithm and the classification and ranking of the images. The choice about the best filtered images of a set of 9 algorithms is made with a dual method of fuzzy and aggregation model. We are proposing through this paper a set of 9 filters with different novelty designed for processing the digital images using the following methods: quartiles, medians, average, thresholds and histogram equalization, applied all over the image or locally on small areas. Finally the statistics reveal the classification and ranking of the best algorithms.

Acute and chronic toxicity of four frequently used UV filter substances for Desmodesmus subspicatus and Daphnia magna.

Science.gov (United States)

Sieratowicz, Agnes; Kaiser, Dominic; Behr, Maximilian; Oetken, Matthias; Oehlmann, Jörg

2011-01-01

As a consequence of growing public concern about UV radiation effects on human health chemical and physical UV filters are increasingly used in personal care and other products. The release of these lipophilic and often persistent compounds into surface waters may pose a risk for aquatic organisms. The aim of the study was to determine effects of four frequently used UV filters on primary aquatic producers and consumers, the green alga Desmodesmus subspicatus and the crustacean Daphnia magna. Exposure to benzophenone 3 (BP3), ethylhexyl methoxycinnamate (EHMC), 3-benzylidene camphor (3-BC) and 3-(4'-methylbenzylidene)-camphor (4-MBC) resulted in growth inhibition of D. subspicatus with 72 h IC(10) values of 0.56 mg/L (BP 3), 0.24 mg/L (EHMC), 0.27 mg/L (3-BC) and 0.21 mg/L (4-MBC). EC(50) concentrations in the acute test with D. magna were 1.67, 0.57, 3.61 and 0.80 mg/L for BP3, EHMC, 3-BC and 4-MBC, respectively. Chronic exposure of D. magna resulted in NOECs of 0.04 mg/L (EHMC) and 0.1 mg/L (3-BC and 4-MBC). BP 3 showed no effects on neonate production or the length of adults. Rapid dissipation of these substances from the water phase was observed indicating the need for more frequent test medium renewal in chronic tests or the use of flow-through test systems.

Study on Accuracy of Judgments by Chinese Fingerprint Examiners

Directory of Open Access Journals (Sweden)

Shiquan Liu

2015-01-01

Full Text Available The interpretation of fingerprint evidence depends on the judgments of fingerprint examiners. This study assessed the accuracy of different judgments made by fingerprint examiners following the Analysis, Comparison, and Evaluation (ACE process. Each examiner was given five marks for analysis, comparison, and evaluation. We compared the experts′ judgments against the ground truth and used an annotation platform to evaluate how Chinese fingerprint examiners document their comparisons during the identification process. The results showed that different examiners demonstrated different accuracy of judgments and different mechanisms to reach them.

Fingerprint Sensors: Liveness Detection Issue and Hardware based Solutions

Directory of Open Access Journals (Sweden)

Shahzad Memon

2012-01-01

Full Text Available Securing an automated and unsupervised fingerprint recognition system is one of the most critical and challenging tasks in government and commercial applications. In these systems, the detection of liveness of a finger placed on a fingerprint sensor is a major issue that needs to be addressed in order to ensure the credibility of the system. The main focus of this paper is to review the existing fingerprint sensing technologies in terms of liveness detection and discusses hardware based ‘liveness detection’ techniques reported in the literature for automatic fingerprint biometrics.

Fingerprints as a Proxy for Readership of Sales Flyers

DEFF Research Database (Denmark)

Schmidt, Marcus J.; Krause, Niels; Solgaard, Hans Stubbe

2007-01-01

  Can readership of sales flyers and free newspapers be estimated by revealing fingerprints? In this paper we report the results of an empirical analysis based on 4604 flyer-pages conducted to assess the feasibility of the method. Results are encouraging, and indicate that the method presently may...... serve as a conservative estimate of readership. Advertising management may thus use the fingerprints-approach as an alternative audience measure and thereby assess the convergent validity of the traditional interview method and the fingerprint approach. While the fingerprint method appears valid...

Evaluation of fingerprint deformation using optical coherence tomography

Science.gov (United States)

Gutierrez da Costa, Henrique S.; Maxey, Jessica R.; Silva, Luciano; Ellerbee, Audrey K.

2014-02-01

Biometric identification systems have important applications to privacy and security. The most widely used of these, print identification, is based on imaging patterns present in the fingers, hands and feet that are formed by the ridges, valleys and pores of the skin. Most modern print sensors acquire images of the finger when pressed against a sensor surface. Unfortunately, this pressure may result in deformations, characterized by changes in the sizes and relative distances of the print patterns, and such changes have been shown to negatively affect the performance of fingerprint identification algorithms. Optical coherence tomography (OCT) is a novel imaging technique that is capable of imaging the subsurface of biological tissue. Hence, OCT may be used to obtain images of subdermal skin structures from which one can extract an internal fingerprint. The internal fingerprint is very similar in structure to the commonly used external fingerprint and is of increasing interest in investigations of identify fraud. We proposed and tested metrics based on measurements calculated from external and internal fingerprints to evaluate the amount of deformation of the skin. Such metrics were used to test hypotheses about the differences of deformation between the internal and external images, variations with the type of finger and location inside the fingerprint.

A network identity authentication system based on Fingerprint identification technology

Science.gov (United States)

Xia, Hong-Bin; Xu, Wen-Bo; Liu, Yuan

2005-10-01

Fingerprint verification is one of the most reliable personal identification methods. However, most of the automatic fingerprint identification system (AFIS) is not run via Internet/Intranet environment to meet today's increasing Electric commerce requirements. This paper describes the design and implementation of the archetype system of identity authentication based on fingerprint biometrics technology, and the system can run via Internet environment. And in our system the COM and ASP technology are used to integrate Fingerprint technology with Web database technology, The Fingerprint image preprocessing algorithms are programmed into COM, which deployed on the internet information server. The system's design and structure are proposed, and the key points are discussed. The prototype system of identity authentication based on Fingerprint have been successfully tested and evaluated on our university's distant education applications in an internet environment.

Capacity and optimal collusion attack channels for Gaussian fingerprinting games

Science.gov (United States)

Wang, Ying; Moulin, Pierre

2007-02-01

In content fingerprinting, the same media covertext - image, video, audio, or text - is distributed to many users. A fingerprint, a mark unique to each user, is embedded into each copy of the distributed covertext. In a collusion attack, two or more users may combine their copies in an attempt to "remove" their fingerprints and forge a pirated copy. To trace the forgery back to members of the coalition, we need fingerprinting codes that can reliably identify the fingerprints of those members. Researchers have been focusing on designing or testing fingerprints for Gaussian host signals and the mean square error (MSE) distortion under some classes of collusion attacks, in terms of the detector's error probability in detecting collusion members. For example, under the assumptions of Gaussian fingerprints and Gaussian attacks (the fingerprinted signals are averaged and then the result is passed through a Gaussian test channel), Moulin and Briassouli1 derived optimal strategies in a game-theoretic framework that uses the detector's error probability as the performance measure for a binary decision problem (whether a user participates in the collusion attack or not); Stone2 and Zhao et al. 3 studied average and other non-linear collusion attacks for Gaussian-like fingerprints; Wang et al. 4 stated that the average collusion attack is the most efficient one for orthogonal fingerprints; Kiyavash and Moulin 5 derived a mathematical proof of the optimality of the average collusion attack under some assumptions. In this paper, we also consider Gaussian cover signals, the MSE distortion, and memoryless collusion attacks. We do not make any assumption about the fingerprinting codes used other than an embedding distortion constraint. Also, our only assumptions about the attack channel are an expected distortion constraint, a memoryless constraint, and a fairness constraint. That is, the colluders are allowed to use any arbitrary nonlinear strategy subject to the above

Uniform Local Binary Pattern for Fingerprint Liveness Detection in the Gaussian Pyramid

Directory of Open Access Journals (Sweden)

Yujia Jiang

2018-01-01

Full Text Available Fingerprint recognition schemas are widely used in our daily life, such as Door Security, Identification, and Phone Verification. However, the existing problem is that fingerprint recognition systems are easily tricked by fake fingerprints for collaboration. Therefore, designing a fingerprint liveness detection module in fingerprint recognition systems is necessary. To solve the above problem and discriminate true fingerprint from fake ones, a novel software-based liveness detection approach using uniform local binary pattern (ULBP in spatial pyramid is applied to recognize fingerprint liveness in this paper. Firstly, preprocessing operation for each fingerprint is necessary. Then, to solve image rotation and scale invariance, three-layer spatial pyramids of fingerprints are introduced in this paper. Next, texture information for three layers spatial pyramids is described by using uniform local binary pattern to extract features of given fingerprints. The accuracy of our proposed method has been compared with several state-of-the-art methods in fingerprint liveness detection. Experiments based on standard databases, taken from Liveness Detection Competition 2013 composed of four different fingerprint sensors, have been carried out. Finally, classifier model based on extracted features is trained using SVM classifier. Experimental results present that our proposed method can achieve high recognition accuracy compared with other methods.

Spectral SAR Ecotoxicology of Ionic Liquids: The Daphnia magna Case

International Nuclear Information System (INIS)

Putz, M.V.; Lacrama, A.M.; Ostafe, V.; Lacrama, A.M.

2007-01-01

Aiming to provide a unified theory of ionic liquids eco toxicity, the recent spectral structure activity relationship (S-SAR) algorithm is employed for testing the two additive models of anionic-cationic interaction containing ionic liquid activity: the causal and the endpoint, |0+> and |1+> models, respectively. As a working system, the Daphnia magna eco toxicity was characterized through the formulated and applied spectral chemical-eco biological interaction principles. Specific anionic-cationic-ionic-liquid rules of interaction along the developed mechanistic hypersurface map of the main eco toxicity paths together with the so-called resonance limitation of the standard statistical correlation analysis were revealed.

Chemical Fingerprinting of Materials Developed Due To Environmental Issues

Science.gov (United States)

Smith, Doris A.; McCool, A. (Technical Monitor)

2000-01-01

This paper presents viewgraphs on chemical fingerprinting of materials developed due to environmental issues. Some of the topics include: 1) Aerospace Materials; 2) Building Blocks of Capabilities; 3) Spectroscopic Techniques; 4) Chromatographic Techniques; 5) Factors that Determine Fingerprinting Approach; and 6) Fingerprinting: Combination of instrumental analysis methods that diagnostically characterize a material.

[Studies on fingerprinting of Flos Buddleja by RP-HPLC].

Science.gov (United States)

Han, Peng; Cui, Ya-jun; Guo, Hong-zhu; Guo, De-an

2004-10-01

To establish fingerprinting of Flos Buddleja by using RP-HPLC for the quality control. The HPLC condition was as follows: Inertsil ODS-3 C18 analytical column (4.6 mm x 250 mm, 5 microm), gredient eluation with MeCN (0.1% TFA)-H2O (0.1%TFA), flow rate 1.0 mL x min(-1), detection wavelength 254 nm. 10 commercial samples were analyzed to establish a fingerprinting. Among the obtained fingerprinting, most of the detected peaks were separated effectively. The accuracy, repeatability and stability of this method were satisfied. The RSDs of relative retention time and area of aimed peaks which existed in all samples wereless than 5%. Theresults were in accordance with the request of fingerprinting. The established fingerprinting can be used for the quality control of Flos Buddleja.

The positively phototactic reaction of daphnia magna straus: A contribution to the understanding of diurnal vertical migration

NARCIS (Netherlands)

Ringelberg, J.

1964-01-01

The present investigation was aimed at gaining more insight into the physiological mechanism underlying the diurnal vertical migration of planktonic animals. The experiments were carried out on Daphnia magna. Only reactions to decreases in light intensity were studied. Kinetical

Fingerprint matching on smart card: A review

CSIR Research Space (South Africa)

Baruni, Kedimotse P

2016-12-01

Full Text Available Fingerprint Match-on-Card (MoC) offers the highest degree of privacy and security to cardholders as the fingerprint never leaves the secure environment of a smart card. The level of security of a biometric system is evaluated by the location where...

Laser mass spectrometry for DNA fingerprinting for forensic applications

Energy Technology Data Exchange (ETDEWEB)

Chen, C.H.; Tang, K.; Taranenko, N.I.; Allman, S.L.; Chang, L.Y.

1994-12-31

The application of DNA fingerprinting has become very broad in forensic analysis, patient identification, diagnostic medicine, and wildlife poaching, since every individual`s DNA structure is identical within all tissues of their body. DNA fingerprinting was initiated by the use of restriction fragment length polymorphisms (RFLP). In 1987, Nakamura et al. found that a variable number of tandem repeats (VNTR) often occurred in the alleles. The probability of different individuals having the same number of tandem repeats in several different alleles is very low. Thus, the identification of VNTR from genomic DNA became a very reliable method for identification of individuals. DNA fingerprinting is a reliable tool for forensic analysis. In DNA fingerprinting, knowledge of the sequence of tandem repeats and restriction endonuclease sites can provide the basis for identification. The major steps for conventional DNA fingerprinting include (1) specimen processing (2) amplification of selected DNA segments by PCR, and (3) gel electrophoresis to do the final DNA analysis. In this work we propose to use laser desorption mass spectrometry for fast DNA fingerprinting. The process and advantages are discussed.

FPRandom: Randomizing core browser objects to break advanced device fingerprinting techniques

OpenAIRE

Laperdrix , Pierre; Baudry , Benoit; Mishra , Vikas

2017-01-01

International audience; The rich programming interfaces (APIs) provided by web browsers can be diverted to collect a browser fingerprint. A small number of queries on these interfaces are sufficient to build a fingerprint that is statistically unique and very stable over time. Consequently, the fingerprint can be used to track users. Our work aims at mitigating the risk of browser fingerprinting for users privacy by 'breaking' the stability of a fingerprint over time. We add randomness in the...

Straightforward fabrication of black nano silica dusting powder for latent fingerprint imaging

Science.gov (United States)

Komalasari, Isna; Krismastuti, Fransiska Sri Herwahyu; Elishian, Christine; Handayani, Eka Mardika; Nugraha, Willy Cahya; Ketrin, Rosi

2017-11-01

Imaging of latent fingerprint pattern (aka fingermark) is one of the most important and accurate detection methods in forensic investigation because of the characteristic of individual fingerprint. This detection technique relies on the mechanical adherence of fingerprint powder to the moisture and oily component of the skin left on the surface. The particle size of fingerprint powder is one of the critical parameter to obtain excellent fingerprint image. This study develops a simple, cheap and straightforward method to fabricate Nano size black dusting fingerprint powder based on Nano silica and applies the powder to visualize latent fingerprint. The nanostructured silica was prepared from tetraethoxysilane (TEOS) and then modified with Nano carbon, methylene blue and sodium acetate to color the powder. Finally, as a proof-of-principle, the ability of this black Nano silica dusting powder to image latent fingerprint is successfully demonstrated and the results show that this fingerprint powder provides clearer fingerprint pattern compared to the commercial one highlighting the potential application of the nanostructured silica in forensic science.

An Investigation on the Problem of Thinning in Fingerprint Processing

Directory of Open Access Journals (Sweden)

I. O. Omeiza

2012-06-01

Full Text Available A high-integrity thinning procedure for binarised fingerprints is proposed in this paper. Several authors and software developers have approached the thinning problems in fingerprint-processing differently. Their approach produced in most cases, fingerprint skeletons with low reliability and thus require additional minutiae-pruning stage to discard the erroneous minutiae in the obtained skeletons. The work involves a careful blending of some already existing algorithms to achieve optimal performance in thinning binarised fingerprint images. The algorithms considered are as follows. The "Zhang and Suen" parallel algorithm for thinning digital patterns, the improved parallel thinning algorithm by Holt and company and template-based thinning algorithm by Stentiford and Mortimer. The idea of combining these stand-alone algorithms to improve the quality of obtained objects skeleton in general image processing was first suggested in a text by Parker in 1998. However, his work does not specifically address the fingerprint problem. This work has examined and proves the plausibility of this thinning approach in the particular case of fingerprint application domain. The thinning procedure obtained satisfactory skeletons for fingerprint applications.

Construction and bootstrap analysis of DNA fingerprinting-based phylogenetic trees with the freeware program FreeTree: application to trichomonad parasites

Czech Academy of Sciences Publication Activity Database

Hampl, V.; Pavlíček, Adam; Flegr, J.

2001-01-01

Roč. 51, - (2001), s. 731-735 ISSN 1466-5026 R&D Projects: GA MŠk VS96142 Grant - others:GA UK(XC) 107/1998 Keywords : FreeTree software * fingerprinting * Trichomonas Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.004, year: 2001

Making DNA Fingerprints.

Science.gov (United States)

Nunley, Kathie F.

1996-01-01

Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

Ecotoxicological assessment of Roundup-ready soybean agriculture investigated in a D. magna model

OpenAIRE

Cuhra, Marek

2015-01-01

Paper III of this thesis is not available i Munin: III: M. Cuhra, T. Traavik & T. Bøhn. 2014. 'Life cycle fitness differences in Daphnia magna fed Roundup-Ready soybean or conventional soybean or organic soybean', available in Aquaculture Nutrition Transgenic glyphosate tolerant soybeans are constituents of an industrial production system with specific agricultural practices and supplementary agrochemicals as interwoven additional elements. Thus the material produced should not be see...

Vitality detection in personal authentication systems using fingerprints

OpenAIRE

Coli, Pietro

2008-01-01

Fingerprints are considered as the sign of each human being, and this has contributed the development of biometric applications based on such features. Since 2002, an important vulnerability has been shown: it is possible to deceive fingerprint scanners through artificial replicas of fingertips. In order to address this shortcoming it is need to recognize a spoofing attempt with artificial fingers looking for some “life signs” each time an user submit a fingerprint (vitality detection problem...

Caracterização de genótipos de tomateiro resistentes a begomovírus por marcador molecular co-dominante ligado ao gene Ty-1 Fingerprinting of tomato genotypes resistant to begomovirus by a codominant molecular marker linked to Ty-1 gene

Directory of Open Access Journals (Sweden)

Daniela Aparecida de Castro Nizio

2008-12-01

Full Text Available O objetivo deste trabalho foi avaliar genótipos de tomateiro, quanto à resistência a begomovírus, e caracterizar, por meio do marcador molecular SSR-47, híbridos de tomate de mesa portadores do alelo de resistência ao begomovírus Ty-1, com potencial comercial. Os 24 híbridos experimentais, heterozigotos no loco Ty-1, depois de infectados via enxertia, apresentaram sintomas intermediários, em comparação aos identificados pelas linhagens homozigotas Ty-1/Ty-1 e pelos genótipos suscetíveis Ty-1+/Ty-1+, o que indica a dominância incompleta do alelo Ty-1. Esses híbridos foram considerados como parcialmente tolerantes a begomovírus. Os híbridos experimentais TEX-246, TEX-261, TEX-253, TEX-256, TEX-262, TEX-252, TEX-251 e TEX-268 aliaram médias elevadas de produção total e de massa média dos frutos; e os híbridos TEX-246, TEX-253, TEX-256, TEX-262 e TEX-252 apresentaram valores elevados também para meia-vida da firmeza e foram, portanto, considerados competitivos em comparação aos padrões comerciais usados como testemunhas. O marcador molecular SSR-47 foi eficiente em caracterizar genótipos portadores do alelo Ty-1. A infecção do begomovírus, induzida via enxertia, manifestou sintomas, nos genótipos testados, condizentes com os resultados obtidos com o marcador molecular SSR-47.The objectives of this study were to evaluate tomato genotypes for begomovirus resistance and to assess SSR-47 fingerprinting patterns associated with alleles Ty-1, in hybrids of fresh-market tomato with commercial potential. Twenty-four experimental genotypes, heterozygous at Ty-1 locus, were infected with begomovirus via grafting, and showed intermediate symptoms compared to the ones identified by homozygous Ty-1/Ty-1 lines and by susceptible genotypes Ty-1+/Ty-1+, which indicates the incomplete dominance of the Ty-1 allele. These hybrids were considered to possess partial resistance to begomovirus. The experimental hybrids TEX-246, TEX-261, TEX

Huella genética vs. Huella dactilar/Geneticprint vs. Fingerprint

Directory of Open Access Journals (Sweden)

Israel Estrada Camacho

2015-01-01

Full Text Available From the earliest times of history, man has struggled to establish an identification system that would differentiate it from their peers. To this end it has established specific techniques and methods. This study was intended precisely to know them the advantages and disadvantages presented two foolproof methods to identify the geneticprint and the traditional fingerprint. For which was conducted a bibliography search specialized in human identification methods, also had personal communication with experts in the field of Dactiloscopy expert and genetics forensic, with the intention of obtaining data, anecdotes and experiences that provide data for the development of this research, in order to know in depth each technique therefore in conclusion is considered that the time factor is still a great advantage of the use of the Dactiloscopy, since in a few minutes at a low cost and reliable results can be obtained. Unlike the previous main disadvantages of DNA analysis are high cost and time to perform your analysis. Still have to consider that the application of molecular techniques in the identification of persons allowed to solve those cases which could not solved using classical techniques of identification (fingerprint, dental chart, etc..

The thermodynamics of latent fingerprint corrosion of metal elements and alloys.

Science.gov (United States)

Bond, John W

2008-11-01

Redox reactions taking place between the surface of a metal and fingerprint residue have been expressed thermodynamically in terms of both the Nernst equation for reduction potential and the complexation constant for the formation of complex metal halide ions in aqueous solution. These expressions are used to explain experimental results for the corrosion of 10 different metal elements by fingerprint residue in air at room temperature. Corrosion of noble metals, such as silver and gold, supports the proposition that the degree of metal corrosion is enhanced by the presence of chloride ions in eccrine sweat. Extending the experiments to include 10 metal alloys enabled the construction of a fingerprint corrosion series for 20 different metals. Fingerprint corrosion on metals alloyed with > approximately 40% copper was found to display third level fingerprint detail. A comparison of both conventional ink on paper and digital (Livescan) fingerprinting techniques with fingerprints deposited on 9 Karat gold alloy has shown that gold alloy depositions are least susceptible to third level detail obliteration by poor fingerprint capturing techniques.

Screen Fingerprints as a Novel Modality for Active Authentication

Science.gov (United States)

2014-03-01

Screen fingerprint is the new cyber biometric modality that we have proposed to measure and analyze active authentication. The screen finger ...as a new biometric modality for active authentication. Such a fingerprint is acquired by taking a screen recording of the computer being used and...extracting discriminative visual feature from the recording. 15. SUBJECT TERMS Active authentication, screen fingerprints, biometrics 16. SECURITY

Fingerprinting Mobile Devices Using Personalized Configurations

Directory of Open Access Journals (Sweden)

Kurtz Andreas

2016-01-01

Full Text Available Recently, Apple removed access to various device hardware identifiers that were frequently misused by iOS third-party apps to track users. We are, therefore, now studying the extent to which users of smartphones can still be uniquely identified simply through their personalized device configurations. Using Apple’s iOS as an example, we show how a device fingerprint can be computed using 29 different configuration features. These features can be queried from arbitrary thirdparty apps via the official SDK. Experimental evaluations based on almost 13,000 fingerprints from approximately 8,000 different real-world devices show that (1 all fingerprints are unique and distinguishable; and (2 utilizing a supervised learning approach allows returning users or their devices to be recognized with a total accuracy of 97% over time

Development of an efficient retrotransposon-based fingerprinting method for rapid pea variety identification.

Science.gov (United States)

Smýkal, Petr

2006-01-01

Fast and efficient DNA fingerprinting of crop cultivars and individuals is frequently used in both theoretical population genetics and in practical breeding. Numerous DNA marker technologies exist and the ratio of speed, cost and accuracy are of importance. Therefore even in species where highly accurate and polymorphic marker systems are available, such as microsatellite SSR (simple sequence repeats), also alternative methods may be of interest. Thanks to their high abundance and ubiquity, temporary mobile retrotransposable elements come into recent focus. Their properties, such as genome wide distribution and well-defined origin of individual insertions by descent, predetermine them for use as molecular markers. In this study, several Ty3-gypsy type retrotransposons have been developed and adopted for the inter-retrotransposon amplified polymorphism (IRAP) method, which is suitable for fast and efficient pea cultivar fingerprinting. The method can easily distinguish even between genetically closely related pea cultivars and provide high polymorphic information content (PIC) in a single PCR analysis.

Ecotoxicological assessment of grey water treatment systems with Daphnia magna and Chironomus riparius.

Science.gov (United States)

Hernández Leal, L; Soeter, A M; Kools, S A E; Kraak, M H S; Parsons, J R; Temmink, H; Zeeman, G; Buisman, C J N

2012-03-15

In order to meet environmental quality criteria, grey water was treated in four different ways: 1) aerobic 2) anaerobic+aerobic 3) aerobic+activated carbon 4) aerobic+ozone. Since each treatment has its own specific advantages and disadvantages, the aim of this study was to compare the ecotoxicity of differently treated grey water using Chironomus riparius (96 h test) and Daphnia magna (48 h and 21d test) as test organisms. Grey water exhibited acute toxicity to both test organisms. The aerobic and combined anaerobic+aerobic treatment eliminated mortality in the acute tests, but growth of C. riparius was still affected by these two effluents. Post-treatment by ozone and activated carbon completely removed the acute toxicity from grey water. In the chronic toxicity test the combined anaerobic+aerobic treatment strongly affected D. magna population growth rate (47%), while the aerobic treatment had a small (9%) but significant effect. Hence, aerobic treatment is the best option for biological treatment of grey water, removing most of the toxic effects of grey water. If advanced treatment is required, the treatment with either ozone or GAC were shown to be very effective in complete removal of toxicity from grey water. Copyright © 2011 Elsevier Ltd. All rights reserved.

An investigation on the problem of thinning in fingerprint processing ...

African Journals Online (AJOL)

A high-integrity thinning procedure for binarised fingerprints is proposed in this paper. Several authors and software developers have approached the thinning problems in fingerprint-processing differently. Their approach produced in most cases, fingerprint skeletons with low reli abi lity and thus require additional ...

Towards a complete rule-based classification approach for flat fingerprints

CSIR Research Space (South Africa)

Webb, L

2014-12-01

Full Text Available fingerprints. This work implements an algorithm which includes new rules to account for more instances of flat fingerprints with missing singular points, specifically when the delta of a Right Loop or Left Loop fingerprint is not captured, when one of the loops...

Is acetylcholinesterase a biomarker of susceptibility in Daphnia magna (Crustacea, Cladocera) after deltamethrin exposure?

Science.gov (United States)

Toumi, Héla; Boumaiza, Moncef; Millet, Maurice; Radetski, Claudemir Marcos; Felten, Vincent; Férard, Jean François

2015-02-01

In the present study, we explored the possibility of using the acetylcholinesterase (AChE) as a biomarker after deltamethrin (pyrethroid insecticide) exposure with three strains of the cladoceran Daphnia magna. Four calculated time-weighted deltamethrin concentrations (20.1, 40.3, 80.6 and 161.3 ng L(-1)) were compared against control acetylcholinesterase activity. Our results showed that after 48 h of deltamethrin exposure, all treatments induced a significant decrease of AChE activities whatever the three considered strains. However, diverse responses were registered in terms of lowest observed effect concentrations (LOEC: 80.6 ng L(-1) for strain 1 and 20.1 ng L(-1) for strains 2 and 3) revealing differences in sensitivity among the three tested strains of D. magna. Our results suggest that after deltamethrin exposure, the AChE activity responses can be also used as a biomarker of susceptibility (i.e., variation of strain specific response). Moreover, our results show that strain 1 is the less sensitive in terms of IC50-48 h of AChE, whereas it became the most sensitive when considering the EC50-48 h estimated in the standard ecotoxicity test. Copyright © 2014 Elsevier Ltd. All rights reserved.

Extracting subsurface fingerprints using optical coherence tomography

CSIR Research Space (South Africa)

Akhoury, SS

2015-02-01

Full Text Available Subsurface Fingerprints using Optical Coherence Tomography Sharat Saurabh Akhoury, Luke Nicholas Darlow Modelling and Digital Science, Council for Scientific and Industrial Research, Pretoria, South Africa Abstract Physiologists have found... approach to extract the subsurface fingerprint representation using a high-resolution imaging technology known as Optical Coherence Tomography (OCT). ...

Detection and analysis of diamond fingerprinting feature and its application

Energy Technology Data Exchange (ETDEWEB)

Li Xin; Huang Guoliang; Li Qiang; Chen Shengyi, E-mail: tshgl@tsinghua.edu.cn [Department of Biomedical Engineering, the School of Medicine, Tsinghua University, Beijing, 100084 (China)

2011-01-01

Before becoming a jewelry diamonds need to be carved artistically with some special geometric features as the structure of the polyhedron. There are subtle differences in the structure of this polyhedron in each diamond. With the spatial frequency spectrum analysis of diamond surface structure, we can obtain the diamond fingerprint information which represents the 'Diamond ID' and has good specificity. Based on the optical Fourier Transform spatial spectrum analysis, the fingerprinting identification of surface structure of diamond in spatial frequency domain was studied in this paper. We constructed both the completely coherent diamond fingerprinting detection system illuminated by laser and the partially coherent diamond fingerprinting detection system illuminated by led, and analyzed the effect of the coherence of light source to the diamond fingerprinting feature. We studied rotation invariance and translation invariance of the diamond fingerprinting and verified the feasibility of real-time and accurate identification of diamond fingerprint. With the profit of this work, we can provide customs, jewelers and consumers with a real-time and reliable diamonds identification instrument, which will curb diamond smuggling, theft and other crimes, and ensure the healthy development of the diamond industry.

Quality and matching performance analysis of three-dimensional unraveled fingerprints

Science.gov (United States)

Wang, Yongchang; Hao, Qi; Fatehpuria, Abhishika; Hassebrook, Laurence G.; Lau, Daniel L.

2010-07-01

The use of fingerprints as a biometric is both the oldest mode of computer-aided personal identification and the most-relied-on technology in use today. However, current acquisition methods have some challenging and peculiar difficulties. For higher performance fingerprint data acquisition and verification, a novel noncontact 3-D fingerprint scanner is investigated, where both the detailed 3-D and albedo information of the finger is obtained. The obtained high-resolution 3-D prints are further converted into 3-D unraveled prints, to be compatible with traditional 2-D automatic fingerprint identification systems. As a result, many limitations imposed on conventional fingerprint capture and processing can be reduced by the unobtrusiveness of this approach and the extra depth information acquired. To compare the quality and matching performances of 3-D unraveled with traditional 2-D plain fingerprints, we collect both 3-D prints and their 2-D plain counterparts. The print quality and matching performances are evaluated and analyzed by using National Institute of Standard Technology fingerprint software. Experimental results show that the 3-D unraveled print outperforms the 2-D print in both quality and matching performances.

Exploring the role of quantum chemical descriptors in modeling acute toxicity of diverse chemicals to Daphnia magna.

Science.gov (United States)

Reenu; Vikas

2015-09-01

Various quantum-mechanically computed molecular and thermodynamic descriptors along with physico-chemical, electrostatic and topological descriptors are compared while developing quantitative structure-activity relationships (QSARs) for the acute toxicity of 252 diverse organic chemicals towards Daphnia magna. QSAR models based on the quantum-chemical descriptors, computed with routinely employed advanced semi-empirical and ab-initio methods, along with the electron-correlation contribution (CORR) of the descriptors, are analyzed for the external predictivity of the acute toxicity. The models with reliable internal stability and external predictivity are found to be based on the HOMO energy along with the physico-chemical, electrostatic and topological descriptors. Besides this, the total energy and electron-correlation energy are also observed as highly reliable descriptors, suggesting that the intra-molecular interactions between the electrons play an important role in the origin of the acute toxicity, which is in fact an unexplored phenomenon. The models based on quantum-chemical descriptors such as chemical hardness, absolute electronegativity, standard Gibbs free energy and enthalpy are also observed to be reliable. A comparison of the robust models based on the quantum-chemical descriptors computed with various quantum-mechanical methods suggests that the advanced semi-empirical methods such as PM7 can be more reliable than the ab-initio methods which are computationally more expensive. Copyright © 2015 Elsevier Inc. All rights reserved.

3D fingerprint imaging system based on full-field fringe projection profilometry

Science.gov (United States)

Huang, Shujun; Zhang, Zonghua; Zhao, Yan; Dai, Jie; Chen, Chao; Xu, Yongjia; Zhang, E.; Xie, Lili

2014-01-01

As an unique, unchangeable and easily acquired biometrics, fingerprint has been widely studied in academics and applied in many fields over the years. The traditional fingerprint recognition methods are based on the obtained 2D feature of fingerprint. However, fingerprint is a 3D biological characteristic. The mapping from 3D to 2D loses 1D information and causes nonlinear distortion of the captured fingerprint. Therefore, it is becoming more and more important to obtain 3D fingerprint information for recognition. In this paper, a novel 3D fingerprint imaging system is presented based on fringe projection technique to obtain 3D features and the corresponding color texture information. A series of color sinusoidal fringe patterns with optimum three-fringe numbers are projected onto a finger surface. From another viewpoint, the fringe patterns are deformed by the finger surface and captured by a CCD camera. 3D shape data of the finger can be obtained from the captured fringe pattern images. This paper studies the prototype of the 3D fingerprint imaging system, including principle of 3D fingerprint acquisition, hardware design of the 3D imaging system, 3D calibration of the system, and software development. Some experiments are carried out by acquiring several 3D fingerprint data. The experimental results demonstrate the feasibility of the proposed 3D fingerprint imaging system.

Generation of DNA profiles from fingerprints developed with columnar thin film technique.

Science.gov (United States)

Plazibat, Stephanie L; Roy, Reena; Swiontek, Stephen E; Lakhtakia, Akhlesh

2015-12-01

Partial-bloody fingerprints and partial fingerprints with saliva are often encountered at crime scenes, potentially enabling the combination of fingerprint and DNA analyses for absolute identification, provided that the development technique for fingerprint analysis does not inhibit DNA analysis. 36 partial-bloody fingerprints and 30 fingerprints wetted with saliva, all deposited on brass, were first developed using the columnar-thin-film (CTF) technique and then subjected to short tandem repeat (STR) DNA analysis. Equal numbers of samples were subjected to the same DNA analysis without development. Tris (8-hydroxyquinolinato) aluminum, or Alq3, was evaporated to deposit CTFs for development of the prints. DNA was extracted from all 132 samples, quantified, and amplified with AmpFlSTR(®) Identifiler Plus Amplification Kit. Additionally, DNA analyses were conducted on four blood smears on un-fingerprinted brass that had been subjected to CTF deposition and four blood smears on un-fingerprinted brass that had not been subjected to CTF deposition. Complete and concordant autosomal STR profiles of the same quality were obtained from both undeveloped and CTF-developed fingerprints, indicating that CTF development of fingerprints preserves DNA and does not inhibit subsequent DNA analysis. Even when there were no fingerprints, CTF deposition did not lead to inhibition of DNA analysis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

On Realistically Attacking Tor with Website Fingerprinting

Directory of Open Access Journals (Sweden)

Wang Tao

2016-10-01

Full Text Available Website fingerprinting allows a local, passive observer monitoring a web-browsing client’s encrypted channel to determine her web activity. Previous attacks have shown that website fingerprinting could be a threat to anonymity networks such as Tor under laboratory conditions. However, there are significant differences between laboratory conditions and realistic conditions. First, in laboratory tests we collect the training data set together with the testing data set, so the training data set is fresh, but an attacker may not be able to maintain a fresh data set. Second, laboratory packet sequences correspond to a single page each, but for realistic packet sequences the split between pages is not obvious. Third, packet sequences may include background noise from other types of web traffic. These differences adversely affect website fingerprinting under realistic conditions. In this paper, we tackle these three problems to bridge the gap between laboratory and realistic conditions for website fingerprinting. We show that we can maintain a fresh training set with minimal resources. We demonstrate several classification-based techniques that allow us to split full packet sequences effectively into sequences corresponding to a single page each. We describe several new algorithms for tackling background noise. With our techniques, we are able to build the first website fingerprinting system that can operate directly on packet sequences collected in the wild.

Efficient internal and surface fingerprint extraction and blending using optical coherence tomography.

Science.gov (United States)

Darlow, Luke Nicholas; Connan, James

2015-11-01

Optical coherence tomography provides a 3D representation of fingertip skin where surface and internal fingerprints are found. These fingerprints are topographically identical. However, the surface skin is prone to damage, distortion, and spoofing; and the internal fingerprint is difficult to access and extract. This research presents a novel scaling-resolution approach to fingerprint zone detection and extraction. Furthermore, a local-quality-based blending procedure is also proposed. The accuracy of the zone-detection algorithm is comparable to an earlier work, yielding a mean-squared error of 25.9 and structural similarity of 95.8% (compared to a ground-truth estimate). Blending the surface and internal fingerprints improved the National Institute of Science and Technology's Fingerprint Image Quality scores and the average maximum match scores (when matched against conventional surface counterparts). The fingerprint blending procedure was able to combine high-quality regions from both fingerprints, thus mitigating surface wrinkles and anomalous poor-quality regions. Furthermore, spoof detection via a surface-to-internal fingerprint comparison was proposed and tested.

DNA Fingerprinting in a Forensic Teaching Experiment

Science.gov (United States)

Wagoner, Stacy A.; Carlson, Kimberly A.

2008-01-01

This article presents an experiment designed to provide students, in a classroom laboratory setting, a hands-on demonstration of the steps used in DNA forensic analysis by performing DNA extraction, DNA fingerprinting, and statistical analysis of the data. This experiment demonstrates how DNA fingerprinting is performed and how long it takes. It…

8 CFR 236.5 - Fingerprints and photographs.

Science.gov (United States)

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... photographs shall be made available to Federal, State, and local law enforcement agencies upon request to the...

Sucralose induces biochemical responses in Daphnia magna.

Directory of Open Access Journals (Sweden)

Ann-Kristin Eriksson Wiklund

Full Text Available The intense artificial sweetener sucralose has no bioconcentration properties, and no adverse acute toxic effects have been observed in standard ecotoxicity tests, suggesting negligible environmental risk. However, significant feeding and behavioural alterations have been reported in non-standard tests using aquatic crustaceans, indicating possible sublethal effects. We hypothesized that these effects are related to alterations in acetylcholinesterase (AChE and oxidative status in the exposed animals and investigated changes in AChE and oxidative biomarkers (oxygen radical absorbing capacity, ORAC, and lipid peroxidation, TBARS in the crustacean Daphnia magna exposed to sucralose (0.0001-5 mg L(-1. The sucralose concentration was a significant positive predictor for ORAC, TBARS and AChE in the daphnids. Moreover, the AChE response was linked to both oxidative biomarkers, with positive and negative relationships for TBARS and ORAC, respectively. These joint responses support our hypothesis and suggest that exposure to sucralose may induce neurological and oxidative mechanisms with potentially important consequences for animal behaviour and physiology.

Application of DNA fingerprints for cell-line individualization.

Science.gov (United States)

Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

1990-09-01

DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they differ. The average percent difference (APD) among pairwise combinations from the population of 33 unrelated cell lines was 76.9%, compared with the APD in band sharing among cell lines derived from the same individual (less than or equal to 1.2%). Included in this survey were nine additional cell lines previously implicated as HeLa cell derivatives, and these lines were clearly confirmed as such by DNA fingerprints (APD less than or equal to 0.6%). On the basis of fragment frequencies in the tested cell line population, a simple genetic model was developed to estimate the frequencies of each DNA fingerprint in the population. The median incidence was 2.9 X 10(-17), and the range was 2.4 X 10(-21) to 6.6 X 10(-15). This value approximates the probability that a second cell line selected at random from unrelated individuals will match a given DNA fingerprint. Related calculations address the chance that any two DNA fingerprints would be identical among a large group of cell lines. This estimate is still very slight; for example, the chance of two or more common DNA fingerprints among 1 million distinct individuals is less than .001. The procedure provides a straightforward, easily interpreted, and statistically robust method for identification and individualization of human cells.

The Ins and Outs of DNA Fingerprinting the Infectious Fungi

Science.gov (United States)

Soll, David R.

2000-01-01

DNA fingerprinting methods have evolved as major tools in fungal epidemiology. However, no single method has emerged as the method of choice, and some methods perform better than others at different levels of resolution. In this review, requirements for an effective DNA fingerprinting method are proposed and procedures are described for testing the efficacy of a method. In light of the proposed requirements, the most common methods now being used to DNA fingerprint the infectious fungi are described and assessed. These methods include restriction fragment length polymorphisms (RFLP), RFLP with hybridization probes, randomly amplified polymorphic DNA and other PCR-based methods, electrophoretic karyotyping, and sequencing-based methods. Procedures for computing similarity coefficients, generating phylogenetic trees, and testing the stability of clusters are then described. To facilitate the analysis of DNA fingerprinting data, computer-assisted methods are described. Finally, the problems inherent in the collection of test and control isolates are considered, and DNA fingerprinting studies of strain maintenance during persistent or recurrent infections, microevolution in infecting strains, and the origin of nosocomial infections are assessed in light of the preceding discussion of the ins and outs of DNA fingerprinting. The intent of this review is to generate an awareness of the need to verify the efficacy of each DNA fingerprinting method for the level of genetic relatedness necessary to answer the epidemiological question posed, to use quantitative methods to analyze DNA fingerprint data, to use computer-assisted DNA fingerprint analysis systems to analyze data, and to file data in a form that can be used in the future for retrospective and comparative studies. PMID:10756003

Partial Device Fingerprints

NARCIS (Netherlands)

Ciere, M.; Hernandez Ganan, C.; van Eeten, M.J.G.

2017-01-01

In computing, remote devices may be identified by means of device fingerprinting, which works by collecting a myriad of clientside attributes such as the device’s browser and operating system version, installed plugins, screen resolution, hardware artifacts, Wi-Fi settings, and anything else

Diversity of DNA fingerprints in Cryptococcus neoformans.

Science.gov (United States)

Varma, A; Swinne, D; Staib, F; Bennett, J E; Kwon-Chung, K J

1995-07-01

DNA fingerprint patterns of 156 Cryptococcus neoformans isolates (26 AIDS patients, 46 non-AIDS patients, and 40 environmental sources) from both varieties (126 C. neoformans var. neoformans and 30 C. neoformans var. gattii isolates) and from seven countries were analyzed by using the DNA probe UT-4p. Nine and twelve distinct DNA fingerprint patterns were observed for isolates of the C. neoformans var. neoformans and var. gattii, respectively. No pattern was unique to AIDS patients, non-AIDS patients, or the environment. Pattern II was observed more often in non-AIDS patients (8 of 23) than in AIDS patients (0 of 25). Pattern V was the most prevalent pattern (42 of 82) in clinical and environmental isolates. Isolates from three AIDS patients in Burundi and Zaire exhibited patterns identical to each other but different from those of isolates collected from their houses (i.e., dust of floors, walls, etc.) or a nearby pigeon coop. DNA fingerprint stability was determined for 53 isolates from nine non-AIDS patients at different time intervals during 5 to 128 weeks of antifungal therapy. For eight patients, the fingerprint pattern was stable while the ninth may have had a mixed infection. Pattern II was observed in 4 of 9 patients, which is similar to 4 of 14 in other non-AIDS patients as reported here. In spite of the extensive pattern heterogeneity among 15 C. neoformans var. gattii isolates in Australia, the patterns observed in seven California isolates were quite different from those in Australia. Among isolates of C. neoformans var. gattii, one fingerprint pattern (designated b) was observed in several countries of the Far East. The fingerprint patterns of two of three environmental isolates from Eucalyptus camaldulensis trees in Australia were identical to those of 2 of the 12 clinical isolates from the country.

Evaluation of fingerprinting techniques to assess genotype variation among Zygosaccharomyces strains.

Science.gov (United States)

Dakal, Tikam Chand; Solieri, Lisa; Giudici, Paolo

2018-06-01

Molecular typing techniques are key tools in surveillance of food spoilage yeasts, in investigations on intra-species population diversity, and in tracing selected starters during fermentation. Unlike previous works on strain typing of Zygosaccharomyces spoilage species, here Zygosaccharomyces mellis and the Zygosaccharoymces rouxii complex yeasts, which include Z. rouxii, Zygosaccharomyces sapae, and a mosaic lineage (ML) of putatively hybrids, were evaluated by three typing methods for intra- and inter-species resolution. Overall these yeasts are relevant for food fermentation and spoilage, but are quite difficult to discriminate at strain and species level as they evolved by reticulation. A pool of 76 strains from different sources were typed by M13 and (GTG) 5 MSP-PCR fingerprinting and PCR-RFLP of ribosomal intergenic spacer region (IGS). We demonstrated that M13 overcame (GTG) 5 fingerprinting to group Z. sapae, Z. rouxii, Z. mellis and the ML isolates in congruent distinct clusters. Even if (GTG) 5 primer yielded a number of DNA fingerprints comparable with those obtained by M13 primer, it failed to discriminate Z. sapae, Z. mellis and Z. rouxii at species level. Clustering of IGS RFLP patterns obtained with three endonucleases produced groups congruent with species assignment and highlighted intra-species diversity similar to that observed by M13 fingerprinting. However, IGS PCR amplification failed for 14 ML and 6 Z. mellis strains under the experimental conditions tested here, indicating that this marker could be less easy to use in fast typing protocol. Finally, our results posit that the genetic diversity within Z. sapae and Z. mellis could be shaped by isolation source. The information generated in this study would facilitate the monitoring of these yeasts during food processing and storage, and provides preliminary evidences about Z. sapae and Z. mellis intra-species diversity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Discrimination of Single-Copy IS6110 DNA Fingerprints of Mycobacterium tuberculosis Isolates by High-Resolution Minisatellite-Based Typing

OpenAIRE

Lee, Ann S. G.; Tang, Lynn L. H.; Lim, Irene H. K.; Bellamy, Richard; Wong, Sin-Yew

2002-01-01

Seven isoniazid-resistant isolates with mutations in the NADH dehydrogenase (ndh) gene were molecularly typed by IS6110-based restriction fragment length polymorphism analysis. All seven isolates with the R268H mutation had identical 1.4-kb IS6110 fingerprints. High-resolution minisatellite-based typing discriminated five of these isolates; two isolates were identical.

Discrimination of single-copy IS6110 DNA fingerprints of Mycobacterium tuberculosis isolates by high-resolution minisatellite-based typing.

Science.gov (United States)

Lee, Ann S G; Tang, Lynn L H; Lim, Irene H K; Bellamy, Richard; Wong, Sin-Yew

2002-02-01

Seven isoniazid-resistant isolates with mutations in the NADH dehydrogenase (ndh) gene were molecularly typed by IS6110-based restriction fragment length polymorphism analysis. All seven isolates with the R268H mutation had identical 1.4-kb IS6110 fingerprints. High-resolution minisatellite-based typing discriminated five of these isolates; two isolates were identical.

Studies on Chromatographic Fingerprint and Fingerprinting Profile-Efficacy Relationship of Polygoni Perfoliati Herba

Directory of Open Access Journals (Sweden)

Li Tian

2013-01-01

Full Text Available Polygoni Perfoliati Herba is widely used in China with antibacterium, anti-inflammatory, expectorant, antitumor, and antivirus activities. To reveal the mechanisms of the activities of Polygoni Perfoliati Herba, the relationship between the fingerprinting profile and its bioactivities was investigated. In the present study, high-performance liquid chromatographic (HPLC fingerprinting method was developed. The established method was applied to analyze 51 batches of Polygoni Perfoliati Herba samples collected from different locations or in different harvesting times in China. Chemometrics, including similarity analysis, hierarchical clustering analysis, and principal component analysis, were used to express their similarities. It was found that similarity values of the samples were in the range of 0.432–0.998. The results of analgesic tests indicated that Polygoni Perfoliati Herba could significantly inhibit pain induced by hot plate and acetic acid in mice. The results of anti-inflammatory tests showed that Polygoni Perfoliati Herba had good anti-inflammatory effects (P < 0.01 in two models including dimethyl benzene-induced ear edema and acetic acid-induced peritoneal permeability in mice. Combining the results from chromatographic fingerprints with those from bioactivities, we found that seven peaks from Polygoni Perfoliati Herba were mainly responsible for analgesic and anti-inflammatory activities.

Teaching DNA Fingerprinting using a Hands-on Simulation.

Science.gov (United States)

Schug, Thatcher

1998-01-01

Presents an inexpensive hands-on lesson in DNA fingerprinting that can be completed in a single class period. Involves students in solving a murder in which a drop of blood is fingerprinted and matched with the blood of the murderer. (DDR)

The genetic basis of resistance and matching-allele interactions of a host-parasite system: The Daphnia magna-Pasteuria ramosa model.

Directory of Open Access Journals (Sweden)

Gilberto Bento

2017-02-01

Full Text Available Negative frequency-dependent selection (NFDS is an evolutionary mechanism suggested to govern host-parasite coevolution and the maintenance of genetic diversity at host resistance loci, such as the vertebrate MHC and R-genes in plants. Matching-allele interactions of hosts and parasites that prevent the emergence of host and parasite genotypes that are universally resistant and infective are a genetic mechanism predicted to underpin NFDS. The underlying genetics of matching-allele interactions are unknown even in host-parasite systems with empirical support for coevolution by NFDS, as is the case for the planktonic crustacean Daphnia magna and the bacterial pathogen Pasteuria ramosa. We fine-map one locus associated with D. magna resistance to P. ramosa and genetically characterize two haplotypes of the Pasteuria resistance (PR- locus using de novo genome and transcriptome sequencing. Sequence comparison of PR-locus haplotypes finds dramatic structural polymorphisms between PR-locus haplotypes including a large portion of each haplotype being composed of non-homologous sequences resulting in haplotypes differing in size by 66 kb. The high divergence of PR-locus haplotypes suggest a history of multiple, diverse and repeated instances of structural mutation events and restricted recombination. Annotation of the haplotypes reveals striking differences in gene content. In particular, a group of glycosyltransferase genes that is present in the susceptible but absent in the resistant haplotype. Moreover, in natural populations, we find that the PR-locus polymorphism is associated with variation in resistance to different P. ramosa genotypes, pointing to the PR-locus polymorphism as being responsible for the matching-allele interactions that have been previously described for this system. Our results conclusively identify a genetic basis for the matching-allele interaction observed in a coevolving host-parasite system and provide a first insight into

The genetic basis of resistance and matching-allele interactions of a host-parasite system: The Daphnia magna-Pasteuria ramosa model.

Science.gov (United States)

Bento, Gilberto; Routtu, Jarkko; Fields, Peter D; Bourgeois, Yann; Du Pasquier, Louis; Ebert, Dieter

2017-02-01

Negative frequency-dependent selection (NFDS) is an evolutionary mechanism suggested to govern host-parasite coevolution and the maintenance of genetic diversity at host resistance loci, such as the vertebrate MHC and R-genes in plants. Matching-allele interactions of hosts and parasites that prevent the emergence of host and parasite genotypes that are universally resistant and infective are a genetic mechanism predicted to underpin NFDS. The underlying genetics of matching-allele interactions are unknown even in host-parasite systems with empirical support for coevolution by NFDS, as is the case for the planktonic crustacean Daphnia magna and the bacterial pathogen Pasteuria ramosa. We fine-map one locus associated with D. magna resistance to P. ramosa and genetically characterize two haplotypes of the Pasteuria resistance (PR-) locus using de novo genome and transcriptome sequencing. Sequence comparison of PR-locus haplotypes finds dramatic structural polymorphisms between PR-locus haplotypes including a large portion of each haplotype being composed of non-homologous sequences resulting in haplotypes differing in size by 66 kb. The high divergence of PR-locus haplotypes suggest a history of multiple, diverse and repeated instances of structural mutation events and restricted recombination. Annotation of the haplotypes reveals striking differences in gene content. In particular, a group of glycosyltransferase genes that is present in the susceptible but absent in the resistant haplotype. Moreover, in natural populations, we find that the PR-locus polymorphism is associated with variation in resistance to different P. ramosa genotypes, pointing to the PR-locus polymorphism as being responsible for the matching-allele interactions that have been previously described for this system. Our results conclusively identify a genetic basis for the matching-allele interaction observed in a coevolving host-parasite system and provide a first insight into its molecular basis.

DNA fingerprinting of the NCI-60 cell line panel.

Science.gov (United States)

Lorenzi, Philip L; Reinhold, William C; Varma, Sudhir; Hutchinson, Amy A; Pommier, Yves; Chanock, Stephen J; Weinstein, John N

2009-04-01

The National Cancer Institute's NCI-60 cell line panel, the most extensively characterized set of cells in existence and a public resource, is frequently used as a screening tool for drug discovery. Because many laboratories around the world rely on data from the NCI-60 cells, confirmation of their genetic identities represents an essential step in validating results from them. Given the consequences of cell line contamination or misidentification, quality control measures should routinely include DNA fingerprinting. We have, therefore, used standard DNA microsatellite short tandem repeats to profile the NCI-60, and the resulting DNA fingerprints are provided here as a reference. Consistent with previous reports, the fingerprints suggest that several NCI-60 lines have common origins: the melanoma lines MDA-MB-435, MDA-N, and M14; the central nervous system lines U251 and SNB-19; the ovarian lines OVCAR-8 and OVCAR-8/ADR (also called NCI/ADR); and the prostate lines DU-145, DU-145 (ATCC), and RC0.1. Those lines also show that the ability to connect two fingerprints to the same origin is not affected by stable transfection or by the development of multidrug resistance. As expected, DNA fingerprints were not able to distinguish different tissues-of-origin. The fingerprints serve principally as a barcodes.

Evaluation of Baffle Fixes Film up Flow Sludge Blanket Filtration (BFUSBF) System in Treatment of Wastewaters from Phenol and 2,4-Dinitrophenol Using Daphnia Magna Bioassay

OpenAIRE

Mohammad Javad Ghannadzadeh; Ahmad Jonidi Jafari; Abbas Rezaee; Fatemeh Eftekharian; Ali Koolivand

2016-01-01

Background: Phenol and nitrophenol are common compounds found in different types of industrial wastewater known as serious threats to human health and natural environment. In this study, Daphnia magna was used to evaluate the effectiveness of "baffle fixes film up flow sludge blanket filtration" (BFUSBF) system in elimination of phenolic compounds from water. Methods: D. magna cultures were used as toxicity index of phenol and 2,4-DNP mixtures after treatment by a pilot BFUSBF system which...

Trans-generational effects induced by alpha and gamma ionizing radiations at Daphnia magna

International Nuclear Information System (INIS)

Parisot, Florian

2015-01-01

Anthropogenic activities related to the nuclear industry contribute to continuous discharges of radionuclides into terrestrial and aquatic ecosystems. Over the past decades, the ecological risk of ionizing radiation has become a growing public, regulatory and scientific concern for ecosystems protection. Until recently, only few studies focus on exposure situations at low doses of irradiation, although these situations are representative of realistic environmental conditions. Understanding how ionizing radiation affects species over several generations and at various levels of biological organization is a major research goal in radioecology. The aim of this PhD was to bring new knowledge on the effects of ionizing radiation during a multi-generational expose of the aquatic invertebrate, Daphnia magna. A two-step strategy was implemented. First, an external gamma radiation at environmentally relevant dose rates was performed on D. magna over three successive generations (F0, F1 and F2). The objective of this experiment was to examine whether low dose rates of radiation induced increasing effects on survival, growth and reproduction of daphnids over generations and to test a possible accumulation and transmission of DNA alterations from adults to offspring. Results showed an accumulation and a transmission of DNA alterations over generations, together with an increase in effect severity on growth and reproduction from generation F0 to generation F2. Transiently more efficient DNA repair leading to some recovery at the organism level was suggested in generation F1. Second, data from the external gamma irradiation and those from an earlier study of internal alpha contamination were analyzed with DEBtox models (Dynamic Energy Budget applied to toxicology), to identify and compare the causes of the trans-generational increase in effect severity between the two types of radiation. In each case, two distinct metabolic modes of action were necessary to explain effects on

Long-term evaluation of lethal and sublethal toxicity of industrial effluents using Daphnia magna and Moina macrocopa.

Science.gov (United States)

Yi, Xianliang; Kang, Sung-Wook; Jung, Jinho

2010-06-15

Acute toxicity and feeding rate inhibition of effluent from a wastewater treatment plant and its adjacent stream water on Daphnia magna and Moina macrocopa were comparatively studied. The acute toxicity of the final effluent (FE) fluctuated greatly over the sampling period from January to August 2009. Toxicity identification results of the FE in July 2009 showed that Cu originating from the Fenton's reagent was likely a key toxicant. In addition, the feeding rate of both species was still inhibited by the FEs in which acute toxicity was not observed. These findings indicate that the feeding response would be a useful tool for monitoring sublethal effects of industrial effluents. For the acute toxicity test, M. macrocopa was more sensitive than D. magna, but the opposite result was true in the case of the feeding rate inhibition. These suggest that different species have different sensitivities to toxic chemicals and to the test methods. Copyright 2010 Elsevier B.V. All rights reserved.

An Efficient Automatic Attendance System Using Fingerprint Reconstruction Technique

OpenAIRE

Ramakrishnan, Josphineleela; Ramakrishnan, M.

2012-01-01

Biometric time and attendance system is one of the most successful applications of biometric technology. One of the main advantage of a biometric time and attendance system is it avoids "buddy-punching". Buddy punching was a major loophole which will be exploiting in the traditional time attendance systems. Fingerprint recognition is an established field today, but still identifying individual from a set of enrolled fingerprints is a time taking process. Most fingerprint-based biometric syste...

Friction ridge skin - Automated Fingerprint Identification System (AFIS)

NARCIS (Netherlands)

Meuwly, Didier

2013-01-01

This contribution describes the development and the forensic use of automated fingerprint identification systems (AFISs). AFISs were initially developed in order to overcome the limitations of the paper-based fingerprint collections, by digitizing the ten-print cards in computerized databases and to

Rotation-invariant fingerprint matching using radon and DCT

Indian Academy of Sciences (India)

Sangita Bharkad

2017-11-20

Nov 20, 2017 ... [6] Bazen A and Gerez S 2003 Fingerprint matching by thin- plate spline modeling of elastic deformations. Pattern. Recogn. 36(8): 1859–1867. [7] Jain A, Hong L and Bolle R 1997 On-line fingerprint veri- fication. IEEE Trans.

The Development Of Mathematical Model For Automated Fingerprint Identification Systems Analysis

International Nuclear Information System (INIS)

Ardisasmita, M. Syamsa

2001-01-01

Fingerprint has a strong oriented and periodic structure composed of dark lines of raised skin (ridges) and clear lines of lowered skin (furrows)that twist to form a distinct pattern. Although the manner in which the ridges flow is distinctive, other characteristics of the fingerprint called m inutiae a re what are most unique to the individual. These features are particular patterns consisting of terminations or bifurcations of the ridges. To assert if two fingerprints are from the same finger or not, experts detect those minutiae. AFIS (Automated Fingerprint Identification Systems) extract and compare these features for determining a match. The classic methods of fingerprints recognition are not suitable for direct implementation in form of computer algorithms. The creation of a finger's model was however the necessity of development of new, better algorithms of analysis. This paper presents a new numerical methods of fingerprints' simulation based on mathematical model of arrangement of dermatoglyphics and creation of minutiae. This paper describes also the design and implementation of an automated fingerprint identification systems which operates in two stages: minutiae extraction and minutiae matching

Practical Fingerprinting Localization for Indoor Positioning System by Using Beacons

Directory of Open Access Journals (Sweden)

Santosh Subedi

2017-01-01

Full Text Available Recent developments in the fields of smartphones and wireless communication technologies such as beacons, Wi-Fi, and ultra-wideband have made it possible to realize indoor positioning system (IPS with a few meters of accuracy. In this paper, an improvement over traditional fingerprinting localization is proposed by combining it with weighted centroid localization (WCL. The proposed localization method reduces the total number of fingerprint reference points over the localization space, thus minimizing both the time required for reading radio frequency signals and the number of reference points needed during the fingerprinting learning process, which eventually makes the process less time-consuming. The proposed positioning has two major steps of operation. In the first step, we have realized fingerprinting that utilizes lightly populated reference points (RPs and WCL individually. Using the location estimated at the first step, WCL is run again for the final location estimation. The proposed localization technique reduces the number of required fingerprint RPs by more than 40% compared to normal fingerprinting localization method with a similar localization estimation error.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Performance characterization of structured light-based fingerprint scanner

Science.gov (United States)

Hassebrook, Laurence G.; Wang, Minghao; Daley, Raymond C.

2013-05-01

Our group believes that the evolution of fingerprint capture technology is in transition to include 3-D non-contact fingerprint capture. More specifically we believe that systems based on structured light illumination provide the highest level of depth measurement accuracy. However, for these new technologies to be fully accepted by the biometric community, they must be compliant with federal standards of performance. At present these standards do not exist for this new biometric technology. We propose and define a set of test procedures to be used to verify compliance with the Federal Bureau of Investigation's image quality specification for Personal Identity Verification single fingerprint capture devices. The proposed test procedures include: geometric accuracy, lateral resolution based on intensity or depth, gray level uniformity and flattened fingerprint image quality. Several 2-D contact analogies, performance tradeoffs and optimization dilemmas are evaluated and proposed solutions are presented.

A Fingerprint Encryption Scheme Based on Irreversible Function and Secure Authentication

Directory of Open Access Journals (Sweden)

Yijun Yang

2015-01-01

Full Text Available A fingerprint encryption scheme based on irreversible function has been designed in this paper. Since the fingerprint template includes almost the entire information of users’ fingerprints, the personal authentication can be determined only by the fingerprint features. This paper proposes an irreversible transforming function (using the improved SHA1 algorithm to transform the original minutiae which are extracted from the thinned fingerprint image. Then, Chinese remainder theorem is used to obtain the biokey from the integration of the transformed minutiae and the private key. The result shows that the scheme has better performance on security and efficiency comparing with other irreversible function schemes.

Comparative ecotoxicity of potential biofuels to water flea (Daphnia magna), zebrafish (Danio rerio) and Chinese hamster (Cricetulus griseus) V79 cells.

Science.gov (United States)

Heger, Sebastian; Du, Miaomiao; Bauer, Kevin; Schäffer, Andreas; Hollert, Henner

2018-08-01

The ecotoxicity of two biofuel candidates (1‑octanol and 2‑butanone) was investigated by an integrative test strategy using three bioassays: the acute immobilisation test with water flea (D. magna), the fish embryo acute toxicity test with zebrafish (Danio rerio) and the in vitro micronucleus assay with Chinese hamster (Cricetulus griseus) V79 cells. The median effective concentration (EC 50 ) values were 14.9±0.66mgL -1 for 1‑octanol, and 2152.1±44.6mgL -1 for 2‑butanone in the D. magna test. Both 1‑octanol and 2‑butanone caused teratogenic and lethal effects on zebrafish embryos, while exposure to 1‑octanol significantly induced these effects at concentrations ≥2.0mgL -1 . These results indicate that 1‑octanol exert much higher ecotoxicity than 2‑butanone to D. magna and zebrafish embryos. Moreover, both 1‑octanol and 2‑butanone did not cause significant genotoxic effects, while their metabolites significantly induced micronuclei in V79 cells. The present study proposed an integrative test approach to evaluate the potential ecotoxicity of biofuels using simple, quick and inexpensive bioassays. Copyright © 2018 Elsevier B.V. All rights reserved.

Silver nanoparticles and silver nitrate induce high toxicity to Pseudokirchneriella subcapitata, Daphnia magna and Danio rerio

International Nuclear Information System (INIS)

Ribeiro, Fabianne; Gallego-Urrea, Julián Alberto; Jurkschat, Kerstin; Crossley, Alison; Hassellöv, Martin; Taylor, Cameron; Soares, Amadeu M.V.M.; Loureiro, Susana

2014-01-01

Silver nanoparticles (AgNP) have gained attention over the years due to the antimicrobial function of silver, which has been exploited industrially to produce consumer goods that vary in type and application. Undoubtedly the increase of production and consumption of these silver-containing products will lead to the entry of silver compounds into the environment. In this study we have used Pseudokirchneriella subcapitata, Daphnia magna and Danio rerio as model organisms to investigate the toxicity of AgNP and AgNO 3 by assessing different biological endpoints and exposure periods. Organisms were exposed following specific and standardized protocols for each species/endpoints, with modifications when necessary. AgNP were characterized in each test-media by Transmission Electron Microscopy (TEM) and experiments were performed by Dynamic Light Scattering (DLS) to investigate the aggregation and agglomeration behavior of AgNP under different media chemical composition and test-period. TEM images of AgNP in the different test-media showed dissimilar patterns of agglomeration, with some agglomerates inside an organic layer, some loosely associated particles and also the presence of some individual particles. The toxicity of both AgNO 3 and AgNP differ significantly based on the test species: we found no differences in toxicity for algae, a small difference for zebrafish and a major difference in toxicity for Daphnia magna. - Highlights: •Effects of silver nanoparticles and nitrate were compared in three aquatic species. •The presence of food on the immobilization assay for Daphnia magna significantly decreased AgNP toxicity. •AgNP and AgNO 3 differ in toxicity according to the test species and endpoint. •AgNP and AgNO 3 induced dissimilar abnormalities on zebrafish embryos' development. •AgNP behavior in the test media will rule its bioavailability and uptake and therefore toxicity

Silver nanoparticles and silver nitrate induce high toxicity to Pseudokirchneriella subcapitata, Daphnia magna and Danio rerio

Energy Technology Data Exchange (ETDEWEB)

Ribeiro, Fabianne, E-mail: ribeiro.f@ua.pt [Department of Biology and CESAM, University of Aveiro. Campus Universitario de Santiago, 3810-193. Aveiro (Portugal); Gallego-Urrea, Julián Alberto [Department of Chemistry and Molecular Biologyx, University of Gothenburg, Kemivägen 4, 41296 Gothenburg (Sweden); Jurkschat, Kerstin; Crossley, Alison [Department of Materials, Oxford University Begbroke Science Park OX5 1PF (United Kingdom); Hassellöv, Martin [Department of Chemistry and Molecular Biologyx, University of Gothenburg, Kemivägen 4, 41296 Gothenburg (Sweden); Taylor, Cameron [Department of Materials, Oxford University Begbroke Science Park OX5 1PF (United Kingdom); Soares, Amadeu M.V.M.; Loureiro, Susana [Department of Biology and CESAM, University of Aveiro. Campus Universitario de Santiago, 3810-193. Aveiro (Portugal)

2014-01-01

Silver nanoparticles (AgNP) have gained attention over the years due to the antimicrobial function of silver, which has been exploited industrially to produce consumer goods that vary in type and application. Undoubtedly the increase of production and consumption of these silver-containing products will lead to the entry of silver compounds into the environment. In this study we have used Pseudokirchneriella subcapitata, Daphnia magna and Danio rerio as model organisms to investigate the toxicity of AgNP and AgNO{sub 3} by assessing different biological endpoints and exposure periods. Organisms were exposed following specific and standardized protocols for each species/endpoints, with modifications when necessary. AgNP were characterized in each test-media by Transmission Electron Microscopy (TEM) and experiments were performed by Dynamic Light Scattering (DLS) to investigate the aggregation and agglomeration behavior of AgNP under different media chemical composition and test-period. TEM images of AgNP in the different test-media showed dissimilar patterns of agglomeration, with some agglomerates inside an organic layer, some loosely associated particles and also the presence of some individual particles. The toxicity of both AgNO{sub 3} and AgNP differ significantly based on the test species: we found no differences in toxicity for algae, a small difference for zebrafish and a major difference in toxicity for Daphnia magna. - Highlights: •Effects of silver nanoparticles and nitrate were compared in three aquatic species. •The presence of food on the immobilization assay for Daphnia magna significantly decreased AgNP toxicity. •AgNP and AgNO{sub 3} differ in toxicity according to the test species and endpoint. •AgNP and AgNO{sub 3} induced dissimilar abnormalities on zebrafish embryos' development. •AgNP behavior in the test media will rule its bioavailability and uptake and therefore toxicity.

Development of quality control system for fingerprint comparison processes

Directory of Open Access Journals (Sweden)

Shiquan Liu

2017-01-01

Full Text Available Fingerprint evidence played an important role in investigation, prosecution, and trial process due to the belief of its uniqueness and unchanged characteristics. However, in recent years, the science behind the process of fingerprint comparisons has been questioned. Main research questions have been focusing on the opaqueness within the comparison processes, subjective judgments, lack of universal standards, no error rate expression on final conclusions, and poor scientific fundamental research data. Facing the above-mentioned questions, this paper aims to suggest a quality control system (QCS for fingerprint comparison processes. This QCS is based on the use of software (PiAnoS and its technological features, being able to provide a data management model to increase the transparency and quality of fingerprint comparison processes.

Network-based Fingerprint Authentication System Using a Mobile Device

OpenAIRE

Zhang, Qihu

2016-01-01

Abstract—　Fingerprint-based user authentication is highly effective in networked services such as electronic payment, but conventional authentication solutions have problems in cost, usability and security. To resolve these problems, we propose a touch-less fingerprint authentication solution, in which a mobile device's built-in camera is used to capture fingerprint image, and then it is sent to the server to determine the identity of the user. We designed and implemented a prototype as an a...

Research of acute influence of new fertlizer «Rost-concentrate» on the hydrobionts Сyprinus carpio L. and Daphnia magna Straus

Directory of Open Access Journals (Sweden)

N. Tson

2016-12-01

Full Text Available Purpose. To establish and assess acute toxicity parameters of "ROST-concentrate (10+7+7" acute toxicity for planktonic crustacean Daphnia magna Straus and carp fingerlings Cyprinus carpio L. Methodology."ROST-concentrate (10+7+7" contains macronutrients (nitrogen, phosphorus, potassium, which are valuable for the pond ecosystem, and trace elements in environmentally safe chelate form. We determined the vital (LC0, absolutely lethal (LC100 and median (LC50 drug concentrations on the test organisms such as crustacean D. magna (Cladocera and carp fingerlings C. carpio. The determination of acute lethal toxicity on D. magna was conducted according to DSTU 4173: 2003 that corresponded to the international standard ISO 6341: 2012, MOD [7]. The temperature of the experiment was 20±0.5 oC. The exposure time - 96 hours. Daphnia were not fed. Following "ROST-concentrate (10+7+7" concentrations were tested: 100; 75; 50; 25; 10; 1; 0.5; 0.1; 0.05; 0.01; 0,005; 0,001 ml/dm3. We also determined the acute lethal toxicity on carp fingerings with an average weight of 6.78±0.63 grams following the standardized procedure [8]. Pond water was used in the experiment. Ten fish were placed into a 40 L aquarium. Following concentrations of "ROST-concentrate (10+7+7" were investigated: 0,5; 1; 2; 3; 4; 5; 6; 7; 8; 9; 10; 15; 20; 30; 40 mg/L. The exposure time was 24 hours. Water temperature was 19±1oC. LC50 drug median concentration was calculated according to G. Kerber method. Findings. The parameters of integral acute toxicity of "ROST-concentrate (10+7+7" on typical organisms of fish pond ecosystems.With 96 h exposure on juvenile cladoceran D. magna, lethal concentration was LC100 = 5,00 ml/dm3, median concentration was LC50 = 0,15 ml/dm3, vital concentration was LC0 = 0,01 ml/dm3. According to the classification of toxic substances, the "ROST-concentrate (10+7+7" is characterized by low toxicity on juvenile cladoceran D. magna. With 24 h exposure on carp

Semantically transparent fingerprinting for right protection of digital cinema

Science.gov (United States)

Wu, Xiaolin

2003-06-01

Digital cinema, a new frontier and crown jewel of digital multimedia, has the potential of revolutionizing the science, engineering and business of movie production and distribution. The advantages of digital cinema technology over traditional analog technology are numerous and profound. But without effective and enforceable copyright protection measures, digital cinema can be more susceptible to widespread piracy, which can dampen or even prevent the commercial deployment of digital cinema. In this paper we propose a novel approach of fingerprinting each individual distribution copy of a digital movie for the purpose of tracing pirated copies back to their source. The proposed fingerprinting technique presents a fundamental departure from the traditional digital watermarking/fingerprinting techniques. Its novelty and uniqueness lie in a so-called semantic or subjective transparency property. The fingerprints are created by editing those visual and audio attributes that can be modified with semantic and subjective transparency to the audience. Semantically-transparent fingerprinting or watermarking is the most robust kind among all existing watermarking techniques, because it is content-based not sample-based, and semantically-recoverable not statistically-recoverable.

ULTRAVIOLET RAMAN SPECTRAL SIGNATURE ACQUISITION: UV RAMAN SPECTRAL FINGERPRINTS.

Energy Technology Data Exchange (ETDEWEB)

SEDLACEK,III, A.J.FINFROCK,C.

2002-09-01

As a member of the science-support part of the ITT-lead LISA development program, BNL is tasked with the acquisition of UV Raman spectral fingerprints and associated scattering cross-sections for those chemicals-of-interest to the program's sponsor. In support of this role, the present report contains the first installment of UV Raman spectral fingerprint data on the initial subset of chemicals. Because of the unique nature associated with the acquisition of spectral fingerprints for use in spectral pattern matching algorithms (i.e., CLS, PLS, ANN) great care has been undertaken to maximize the signal-to-noise and to minimize unnecessary spectral subtractions, in an effort to provide the highest quality spectral fingerprints. This report is divided into 4 sections. The first is an Experimental section that outlines how the Raman spectra are performed. This is then followed by a section on Sample Handling. Following this, the spectral fingerprints are presented in the Results section where the data reduction process is outlined. Finally, a Photographs section is included.

The Effect of Fermentation Time with Probiotic Bacteria on Organic Fertilizer as Daphnia magna Cultured Medium towards Nutrient Quality, Biomass Production and Growth Performance Enhancement

Science.gov (United States)

Endar Herawati, Vivi; Agung Nugroho, Ristiawan; Pinandoyo; Darmanto, YS; Hutabarat, Johannes

2018-02-01

The nutrient quality and growth performance of D. magna are highly depend on the organic fertilizer which is used in its culture medium. The objective of this study was to identify the best fermentation time by using probiotic bacteria on organic fertilizer as mass culture medium to improve its nutrient quality, biomass production, and growth performance. This study was conducted using completely randomized experimental design with five treatments and three repetitions. Organic fertilizers used cultured medium with chicken manure, rejected bread and tofu waste fermented by probiotic bacteria then cultured for 0, 7, 14, 21 and 28 days. The results showed that medium which used 25% chicken manure, 25% tofu waste and 50% rejected bread cultured for 28 days created the highest biomass production, population density and nutrient content of D. magna those are 233,980 ind/L for population density; 134.60 grams for biomass production, 0.574% specific growth rate; 68.06% protein content and 6.91% fat. The highest fatty acid profile is 4.83% linoleic and 3.54% linolenic acid. The highest essential amino acid is 53.94 ppm lysine. In general, the content of ammonia, DO, temperature, and pH during the study were in the good range of D. magna life. The conclusion of this research is medium which used 25% chicken manure, 25% tofu waste and 50% rejected bread cultured for 28 days created the highest biomass production, population and nutrient content of D. magna.

A Karnaugh-Map based fingerprint minutiae extraction method

Directory of Open Access Journals (Sweden)

Sunil Kumar Singla

2010-07-01

Full Text Available Fingerprint is one of the most promising method among all the biometric techniques and has been used for thepersonal authentication for a long time because of its wide acceptance and reliability. Features (Minutiae are extracted fromthe fingerprint in question and are compared with the features already stored in the database for authentication. Crossingnumber (CN is the most commonly used minutiae extraction method for fingerprints. In this paper, a new Karnaugh-Mapbased fingerprint minutiae extraction method has been proposed and discussed. In the proposed algorithm the 8 neighborsof a pixel in a 33 window are arranged as 8 bits of a byte and corresponding hexadecimal (hex value is calculated. Thesehex values are simplified using standard Karnaugh-Map (K-map technique to obtain the minimized logical expression.Experiments conducted on the FVC2002/Db1_a database reveals that the developed method is better than the crossingnumber (CN method.

Chemical characterization of fingerprints from adults and children

Energy Technology Data Exchange (ETDEWEB)

Buchanan, M.V.; Asano, K. [Oak Ridge National Lab., TN (United States); Bohanon, A. [Knoxville Police Dept., TN (United States)

1996-12-31

Observation that children`s fingerprints disappear from surfaces more quickly than adults`, initiated a study to characterize the chemical components in fingerprints. Samples were obtained from about 50 individuals ranging in age from 3 to 64 by extracting chemicals from the fingertips using rubbing alcohol. Using combined gas chromatography/mass spectrometry, a wide range of compounds were identified. Samples from children contained higher levels of relatively volatile free fatty acids, while those from adults had higher levels of less volatile long chain esters of fatty acids. These esters are thought to originate from sebaceous glands located on the face and levels of these compounds increase substantially after puberty. Also, other compounds were observed that could be used to develop improved methods for fingerprint detection at a crime scene. Further, observation of specific compounds raises the possibility of being able to identify personal traits (gender, habits, diseases, etc. ) via analysis of components in fingerprints and/or skin.

High Resolution Ultrasonic Method for 3D Fingerprint Representation in Biometrics

Science.gov (United States)

Maev, R. Gr.; Bakulin, E. Y.; Maeva, E. Y.; Severin, F. M.

Biometrics is an important field which studies different possible ways of personal identification. Among a number of existing biometric techniques fingerprint recognition stands alone - because very large database of fingerprints has already been acquired. Also, fingerprints are an important evidence that can be collected at a crime scene. Therefore, of all automated biometric techniques, especially in the field of law enforcement, fingerprint identification seems to be the most promising. Ultrasonic method of fingerprint imaging was originally introduced over a decade as the mapping of the reflection coefficient at the interface between the finger and a covering plate and has shown very good reliability and free from imperfections of previous two methods. This work introduces a newer development of the ultrasonic fingerprint imaging, focusing on the imaging of the internal structures of fingerprints (including sweat pores) with raw acoustic resolution of about 500 dpi (0.05 mm) using a scanning acoustic microscope to obtain images and acoustic data in the form of 3D data array. C-scans from different depths inside the fingerprint area of fingers of several volunteers were obtained and showed good contrast of ridges-and-valleys patterns and practically exact correspondence to the standard ink-and-paper prints of the same areas. Important feature reveled on the acoustic images was the clear appearance of the sweat pores, which could provide additional means of identification.

Symbiotic bacteria contribute to increasing the population size of a freshwater crustacean, Daphnia magna.

Science.gov (United States)

Peerakietkhajorn, Saranya; Tsukada, Koji; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

2015-04-01

The filter-feeding crustacean Daphnia is a key organism in freshwater ecosystems. Here, we report the effect of symbiotic bacteria on ecologically important life history traits, such as population dynamics and longevity, in Daphnia magna. By disinfection of the daphniid embryos with glutaraldehyde, aposymbiotic daphniids were prepared and cultured under bacteria-free conditions. Removal of bacteria from the daphniids was monitored by quantitative polymerase chain reaction for bacterial 16S rRNA gene. The population of aposymbiotic daphniids was reduced 10-folds compared with that of the control daphniids. Importantly, re-infection with symbiotic bacteria caused daphniids to regain bacteria and increase their fecundity to the level of the control daphniids, suggesting that symbiotic bacteria regulate Daphnia fecundity. To identify the species of symbiotic bacteria, 16S rRNA genes of bacteria in daphniids were sequenced. This revealed that 50% of sequences belonged to the Limnohabitans sp. of the Betaproteobacteria class and that the diversity of bacterial taxa was relatively low. These results suggested that symbiotic bacteria have a beneficial effect on D. magna, and that aposymbiotic Daphnia are useful tools in understanding the role of symbiotic bacteria in the environmental responses and evolution of their hosts. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Defense of fake fingerprint attacks using a swept source laser optical coherence tomography setup

Science.gov (United States)

Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

2013-03-01

The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

Transparency of Reporting in Molecular Diagnostics

Directory of Open Access Journals (Sweden)

Stephen Bustin

2013-07-01

Full Text Available The major advances made over the past few years in molecular and cell biology are providing a progressively more detailed understanding of the molecular pathways that control normal processes and become dysregulated in disease [1]. This has resulted in the documentation of numerous genetic, epigenetic, transcriptomic, proteomic and metabolomic biomarkers that promise earlier disease detection, more accurate patient stratification and better prognosis [2–5]. Furthermore, molecular fingerprinting of diseases can be predictive of drug response and so assist with specific targeting of drugs against disease-associated molecules and function [6]. [...

'Fingerprints' of central stimulatory drug effects by means of quantitative radioelectroencephalography in the rat (tele-stereo-EEG).

Science.gov (United States)

Dimpfel, W; Spüler, M; Nickel, B; Tibes, U

1986-01-01

The new electrophysiological model earlier described as stereo-EEG is extended now to allow recording from the freely moving rat by means of a telemetric device. Chronic implantation of 4 electrodes into the brain allows simultaneous transmission of field potentials from frontal cortex, hippocampus, striatum and reticular formation. Frequency analysis of these potentials results in a drug-specific 'fingerprint' which cannot only be used to compare different chemicals with each other but also to detect onset and time dependence of drug actions. Application of the model to the question if fenetylline has its own intrinsic mode of action or merely develops its stimulatory effect after metabolic separation into its molecular moieties amphetamine and theophylline (prodrug hypothesis) revealed that fenetylline indeed displays its own stimulatory effect to the same extent and at a similar time course as amphetamine and theophylline. The 'fingerprint' as obtained by the analysis of the action of fenetylline in the rat resembles closely that obtained after the application of theophylline with respect to decreased alpha activity, but resembles amphetamine with respect to beta 1 activity. Thus the applied method allows studying structure function relationships as the action of fenetylline seems to reflect both its molecular moieties.

Trophic transfer of differently functionalized zinc oxide nanoparticles from crustaceans (Daphnia magna) to zebrafish (Danio rerio)

DEFF Research Database (Denmark)

Skjolding, Lars Michael; Winther-Nielsen, M.; Baun, Anders

2014-01-01

) higher than toxic levels reported for zinc in D. magna. Consequently, the zinc recovered in the animals was not solely due to soluble zinc, but agglomerates/aggregates of ZnO NP or ZnO-octyl NP contributed to the body burdens. The trophic transfer study showed uptake of both ZnO NP and ZnO-octyl NP...

Non-destructive forensic latent fingerprint acquisition with chromatic white light sensors

Science.gov (United States)

Leich, Marcus; Kiltz, Stefan; Dittmann, Jana; Vielhauer, Claus

2011-02-01

Non-destructive latent fingerprint acquisition is an emerging field of research, which, unlike traditional methods, makes latent fingerprints available for additional verification or further analysis like tests for substance abuse or age estimation. In this paper a series of tests is performed to investigate the overall suitability of a high resolution off-the-shelf chromatic white light sensor for the contact-less and non-destructive latent fingerprint acquisition. Our paper focuses on scanning previously determined regions with exemplary acquisition parameter settings. 3D height field and reflection data of five different latent fingerprints on six different types of surfaces (HDD platter, brushed metal, painted car body (metallic and non-metallic finish), blued metal, veneered plywood) are experimentally studied. Pre-processing is performed by removing low-frequency gradients. The quality of the results is assessed subjectively; no automated feature extraction is performed. Additionally, the degradation of the fingerprint during the acquisition period is observed. While the quality of the acquired data is highly dependent on surface structure, the sensor is capable of detecting the fingerprint on all sample surfaces. On blued metal the residual material is detected; however, the ridge line structure dissolves within minutes after fingerprint placement.

Integrating Fingerprint Verification into the Smart Card-Based Healthcare Information System

Directory of Open Access Journals (Sweden)

Jin-Won Park

2009-01-01

Full Text Available As VLSI technology has been improved, a smart card employing 32-bit processors has been released, and more personal information such as medical, financial data can be stored in the card. Thus, it becomes important to protect personal information stored in the card. Verification of the card holder's identity using a fingerprint has advantages over the present practices of Personal Identification Numbers (PINs and passwords. However, the computational workload of fingerprint verification is much heavier than that of the typical PIN-based solution. In this paper, we consider three strategies to implement fingerprint verification in a smart card environment and how to distribute the modules of fingerprint verification between the smart card and the card reader. We first evaluate the number of instructions of each step of a typical fingerprint verification algorithm, and estimate the execution time of several cryptographic algorithms to guarantee the security/privacy of the fingerprint data transmitted in the smart card with the client-server environment. Based on the evaluation results, we analyze each scenario with respect to the security level and the real-time execution requirements in order to implement fingerprint verification in the smart card with the client-server environment.

Integrating Fingerprint Verification into the Smart Card-Based Healthcare Information System

Science.gov (United States)

Moon, Daesung; Chung, Yongwha; Pan, Sung Bum; Park, Jin-Won

2009-12-01

As VLSI technology has been improved, a smart card employing 32-bit processors has been released, and more personal information such as medical, financial data can be stored in the card. Thus, it becomes important to protect personal information stored in the card. Verification of the card holder's identity using a fingerprint has advantages over the present practices of Personal Identification Numbers (PINs) and passwords. However, the computational workload of fingerprint verification is much heavier than that of the typical PIN-based solution. In this paper, we consider three strategies to implement fingerprint verification in a smart card environment and how to distribute the modules of fingerprint verification between the smart card and the card reader. We first evaluate the number of instructions of each step of a typical fingerprint verification algorithm, and estimate the execution time of several cryptographic algorithms to guarantee the security/privacy of the fingerprint data transmitted in the smart card with the client-server environment. Based on the evaluation results, we analyze each scenario with respect to the security level and the real-time execution requirements in order to implement fingerprint verification in the smart card with the client-server environment.

Human matching performance of genuine crime scene latent fingerprints.

Science.gov (United States)

Thompson, Matthew B; Tangen, Jason M; McCarthy, Duncan J

2014-02-01

There has been very little research into the nature and development of fingerprint matching expertise. Here we present the results of an experiment testing the claimed matching expertise of fingerprint examiners. Expert (n = 37), intermediate trainee (n = 8), new trainee (n = 9), and novice (n = 37) participants performed a fingerprint discrimination task involving genuine crime scene latent fingerprints, their matches, and highly similar distractors, in a signal detection paradigm. Results show that qualified, court-practicing fingerprint experts were exceedingly accurate compared with novices. Experts showed a conservative response bias, tending to err on the side of caution by making more errors of the sort that could allow a guilty person to escape detection than errors of the sort that could falsely incriminate an innocent person. The superior performance of experts was not simply a function of their ability to match prints, per se, but a result of their ability to identify the highly similar, but nonmatching fingerprints as such. Comparing these results with previous experiments, experts were even more conservative in their decision making when dealing with these genuine crime scene prints than when dealing with simulated crime scene prints, and this conservatism made them relatively less accurate overall. Intermediate trainees-despite their lack of qualification and average 3.5 years experience-performed about as accurately as qualified experts who had an average 17.5 years experience. New trainees-despite their 5-week, full-time training course or their 6 months experience-were not any better than novices at discriminating matching and similar nonmatching prints, they were just more conservative. Further research is required to determine the precise nature of fingerprint matching expertise and the factors that influence performance. The findings of this representative, lab-based experiment may have implications for the way fingerprint examiners testify in

Comparing Categorical and Probabilistic Fingerprint Evidence.

Science.gov (United States)

Garrett, Brandon; Mitchell, Gregory; Scurich, Nicholas

2018-04-23

Fingerprint examiners traditionally express conclusions in categorical terms, opining that impressions do or do not originate from the same source. Recently, probabilistic conclusions have been proposed, with examiners estimating the probability of a match between recovered and known prints. This study presented a nationally representative sample of jury-eligible adults with a hypothetical robbery case in which an examiner opined on the likelihood that a defendant's fingerprints matched latent fingerprints in categorical or probabilistic terms. We studied model language developed by the U.S. Defense Forensic Science Center to summarize results of statistical analysis of the similarity between prints. Participant ratings of the likelihood the defendant left prints at the crime scene and committed the crime were similar when exposed to categorical and strong probabilistic match evidence. Participants reduced these likelihoods when exposed to the weaker probabilistic evidence, but did not otherwise discriminate among the prints assigned different match probabilities. © 2018 American Academy of Forensic Sciences.

Optical Methods in Fingerprint Imaging for Medical and Personality Applications.

Science.gov (United States)

Wang, Chia-Nan; Wang, Jing-Wein; Lin, Ming-Hsun; Chang, Yao-Lang; Kuo, Chia-Ming

2017-10-23

Over the years, analysis and induction of personality traits has been a topic for individual subjective conjecture or speculation, rather than a focus of inductive scientific analysis. This study proposes a novel framework for analysis and induction of personality traits. First, 14 personality constructs based on the "Big Five" personality factors were developed. Next, a new fingerprint image algorithm was used for classification, and the fingerprints were classified into eight types. The relationship between personality traits and fingerprint type was derived from the results of the questionnaire survey. After comparison of pre-test and post-test results, this study determined the induction ability of personality traits from fingerprint type. Experimental results showed that the left/right thumbprint type of a majority of subjects was left loop/right loop and that the personalities of individuals with this fingerprint type were moderate with no significant differences in the 14 personality constructs.

Molecular Vibration-Activity Relationship in the Agonism of Adenosine Receptors

OpenAIRE

Chee, Hyun Keun; Oh, S. June

2013-01-01

The molecular vibration-activity relationship in the receptor-ligand interaction of adenosine receptors was investigated by structure similarity, molecular vibration, and hierarchical clustering in a dataset of 46 ligands of adenosine receptors. The resulting dendrogram was compared with those of another kind of fingerprint or descriptor. The dendrogram result produced by corralled intensity of molecular vibrational frequency outperformed four other analyses in the current study of adenosine ...

Enhancement of plant metabolite fingerprinting by machine learning.

Science.gov (United States)

Scott, Ian M; Vermeer, Cornelia P; Liakata, Maria; Corol, Delia I; Ward, Jane L; Lin, Wanchang; Johnson, Helen E; Whitehead, Lynne; Kular, Baldeep; Baker, John M; Walsh, Sean; Dave, Anuja; Larson, Tony R; Graham, Ian A; Wang, Trevor L; King, Ross D; Draper, John; Beale, Michael H

2010-08-01

Metabolite fingerprinting of Arabidopsis (Arabidopsis thaliana) mutants with known or predicted metabolic lesions was performed by (1)H-nuclear magnetic resonance, Fourier transform infrared, and flow injection electrospray-mass spectrometry. Fingerprinting enabled processing of five times more plants than conventional chromatographic profiling and was competitive for discriminating mutants, other than those affected in only low-abundance metabolites. Despite their rapidity and complexity, fingerprints yielded metabolomic insights (e.g. that effects of single lesions were usually not confined to individual pathways). Among fingerprint techniques, (1)H-nuclear magnetic resonance discriminated the most mutant phenotypes from the wild type and Fourier transform infrared discriminated the fewest. To maximize information from fingerprints, data analysis was crucial. One-third of distinctive phenotypes might have been overlooked had data models been confined to principal component analysis score plots. Among several methods tested, machine learning (ML) algorithms, namely support vector machine or random forest (RF) classifiers, were unsurpassed for phenotype discrimination. Support vector machines were often the best performing classifiers, but RFs yielded some particularly informative measures. First, RFs estimated margins between mutant phenotypes, whose relations could then be visualized by Sammon mapping or hierarchical clustering. Second, RFs provided importance scores for the features within fingerprints that discriminated mutants. These scores correlated with analysis of variance F values (as did Kruskal-Wallis tests, true- and false-positive measures, mutual information, and the Relief feature selection algorithm). ML classifiers, as models trained on one data set to predict another, were ideal for focused metabolomic queries, such as the distinctiveness and consistency of mutant phenotypes. Accessible software for use of ML in plant physiology is highlighted.

Multiple chromatographic fingerprinting and its application to the quality control of herbal medicines

International Nuclear Information System (INIS)

Fan Xiaohui; Cheng Yiyu; Ye Zhengliang; Lin Ruichao; Qian Zhongzhi

2006-01-01

Recently, chromatographic fingerprinting has become one of the most powerful approaches to quality control of herbal medicines. However, the performance of reported chromatographic fingerprinting constructed by single chromatogram sometimes turns out to be inadequate for complex herbal medicines, such as multi-herb botanical drug products. In this study, multiple chromatographic fingerprinting, which consists of more than one chromatographic fingerprint and represents the whole characteristics of chemical constitutions of the complex medicine, is proposed as a potential strategy in this complicated case. As a typical example, a binary chromatographic fingerprinting of 'Danshen Dropping Pill' (DSDP), the best-sold traditional Chinese medicine in China, was developed. First, two HPLC fingerprints that, respectively, represent chemical characteristics of depsides and saponins of DSDP were developed, which were used to construct binary chromatographic fingerprints of DSDP. Moreover, the authentication and validation of the binary fingerprints were performed. Then, a data-level information fusion method was employed to capture the chemical information encoded in two chromatographic fingerprints. Based on the fusion results, the lot-to-lot consistency and frauds can be determined either using similarity measure or by chemometrics approach. The application of binary chromatographic fingerprinting to consistency assessment and frauds detection of DSDP clearly demonstrated that the proposed method was a powerful approach to quality control of complex herbal medicines

Diversity of DNA fingerprints of Mycobacterium tuberculosis isolates in the United States.

Science.gov (United States)

Yang, Z; Barnes, P F; Chaves, F; Eisenach, K D; Weis, S E; Bates, J H; Cave, M D

1998-04-01

To investigate the diversity of IS6110 fingerprints of Mycobacterium tuberculosis isolates in the United States and to determine if matching IS6110 fingerprints represent recent interstate tuberculosis transmission, we performed restriction fragment length polymorphism analysis of M. tuberculosis isolates from 1,326 patients in three geographically separated states. Seven hundred ninety-five different IS6110 fingerprint patterns were generated, and pattern diversity was similar in each state. Ninety-six percent of the fingerprint patterns were observed in only one state, demonstrating that most IS6110 fingerprint patterns are confined to a single geographic location. Of the IS6110 fingerprint patterns that were shared by isolates from more than one state, most isolates with 1 to 5 IS6110 copies were separable by pTBN12 fingerprinting whereas those with > 15 copies were not. One high-copy-number M. tuberculosis strain had identical IS6110 and pTBN12 fingerprints and included 57 isolates from three states. Epidemiological data demonstrated significant recent transmission of tuberculosis within each city but not among the states. This suggests that identical fingerprints of isolates from geographically separate locations most likely reflect interstate tuberculosis transmission in the past, with subsequent intrastate spread of disease. Further evaluation of M. tuberculosis strains that cause outbreaks in different geographic locations will provide insight into the epidemiological and bacteriological factors that facilitate the spread of tuberculosis.

Fast Fingerprint Database Maintenance for Indoor Positioning Based on UGV SLAM

Directory of Open Access Journals (Sweden)

Jian Tang

2015-03-01

Full Text Available Indoor positioning technology has become more and more important in the last two decades. Utilizing Received Signal Strength Indicator (RSSI fingerprints of Signals of OPportunity (SOP is a promising alternative navigation solution. However, as the RSSIs vary during operation due to their physical nature and are easily affected by the environmental change, one challenge of the indoor fingerprinting method is maintaining the RSSI fingerprint database in a timely and effective manner. In this paper, a solution for rapidly updating the fingerprint database is presented, based on a self-developed Unmanned Ground Vehicles (UGV platform NAVIS. Several SOP sensors were installed on NAVIS for collecting indoor fingerprint information, including a digital compass collecting magnetic field intensity, a light sensor collecting light intensity, and a smartphone which collects the access point number and RSSIs of the pre-installed WiFi network. The NAVIS platform generates a map of the indoor environment and collects the SOPs during processing of the mapping, and then the SOP fingerprint database is interpolated and updated in real time. Field tests were carried out to evaluate the effectiveness and efficiency of the proposed method. The results showed that the fingerprint databases can be quickly created and updated with a higher sampling frequency (5Hz and denser reference points compared with traditional methods, and the indoor map can be generated without prior information. Moreover, environmental changes could also be detected quickly for fingerprint indoor positioning.

Optical Methods in Fingerprint Imaging for Medical and Personality Applications

Directory of Open Access Journals (Sweden)

Chia-Nan Wang

2017-10-01

Full Text Available Over the years, analysis and induction of personality traits has been a topic for individual subjective conjecture or speculation, rather than a focus of inductive scientific analysis. This study proposes a novel framework for analysis and induction of personality traits. First, 14 personality constructs based on the “Big Five” personality factors were developed. Next, a new fingerprint image algorithm was used for classification, and the fingerprints were classified into eight types. The relationship between personality traits and fingerprint type was derived from the results of the questionnaire survey. After comparison of pre-test and post-test results, this study determined the induction ability of personality traits from fingerprint type. Experimental results showed that the left/right thumbprint type of a majority of subjects was left loop/right loop and that the personalities of individuals with this fingerprint type were moderate with no significant differences in the 14 personality constructs.

[HPLC characteristic fingerprints of sedi linearis herba and sedi herba].

Science.gov (United States)

Lu, Lan-Qing; Mei, Qing; Wan, Ding-Rong; Yang, Xin-Zhou; Qiao, Shu; Zhao, Yu-Dan

2014-04-01

To study HPLC characteristic fingerprint of Sedum lineare from different harvest periods, and to compare with its related species Sedum sarmentosum. The HPLC fingerprints of Sedum lineare from different collecting periods were established and compared with Sedum sarmentosum by the same detection method. Hyperin, isoquercitrin and astragaloside were identified from the HPLC fingerprint of Sedum lineare. The fingerprint of Sedum lineare growing in the same area but different environment were basically identical; while there were remarkable differences of Sedum lineare growing in the same place but from different harvest periods, with the area of most common peaks changing from little to great, and slightly different peak number. The HPLC fingerprint of the two Sedum species had four common peaks, but could be distinguished from each other. The optimal harvest period of these two species should be full-bloom stage. The established method can provide reference for identification and quality analysis of Sedum lineare.

Identification and Quality Assessment of Chrysanthemum Buds by CE Fingerprinting

Directory of Open Access Journals (Sweden)

Xiaoping Xing

2015-01-01

Full Text Available A simple and efficient fingerprinting method for chrysanthemum buds was developed with the aim of establishing a quality control protocol based on biochemical makeup. Chrysanthemum bud samples were successively extracted by water and alcohol. The fingerprints of the chrysanthemum buds samples were obtained using capillary electrophoresis and electrochemical detection (CE-ED employing copper and carbon working electrodes to capture all of the chemical information. 10 batches of chrysanthemum buds were collected from different regions and various factories to establish the baseline fingerprint. The experimental data of 10 batches electropherogram buds by CE were analyzed by correlation coefficient and the included angle cosine methods. A standard chrysanthemum bud fingerprint including 24 common peaks was established, 12 from each electrode, which was successfully applied to identify and distinguish between chrysanthemum buds from 2 other chrysanthemum species. These results demonstrate that fingerprint analysis can be used as an important criterion for chrysanthemum buds quality control.

Optical Methods in Fingerprint Imaging for Medical and Personality Applications

Science.gov (United States)

Wang, Jing-Wein; Lin, Ming-Hsun; Chang, Yao-Lang; Kuo, Chia-Ming

2017-01-01

Over the years, analysis and induction of personality traits has been a topic for individual subjective conjecture or speculation, rather than a focus of inductive scientific analysis. This study proposes a novel framework for analysis and induction of personality traits. First, 14 personality constructs based on the “Big Five” personality factors were developed. Next, a new fingerprint image algorithm was used for classification, and the fingerprints were classified into eight types. The relationship between personality traits and fingerprint type was derived from the results of the questionnaire survey. After comparison of pre-test and post-test results, this study determined the induction ability of personality traits from fingerprint type. Experimental results showed that the left/right thumbprint type of a majority of subjects was left loop/right loop and that the personalities of individuals with this fingerprint type were moderate with no significant differences in the 14 personality constructs. PMID:29065556

Oriented diffusion filtering for enhancing low-quality fingerprint images

KAUST Repository

Gottschlich, C.; Schönlieb, C.-B.

2012-01-01

To enhance low-quality fingerprint images, we present a novel method that first estimates the local orientation of the fingerprint ridge and valley flow and next performs oriented diffusion filtering, followed by a locally adaptive contrast enhancement step. By applying the authors' new approach to low-quality images of the FVC2004 fingerprint databases, the authors are able to show its competitiveness with other state-of-the-art enhancement methods for fingerprints like curved Gabor filtering. A major advantage of oriented diffusion filtering over those is its computational efficiency. Combining oriented diffusion filtering with curved Gabor filters led to additional improvements and, to the best of the authors' knowledge, the lowest equal error rates achieved so far using MINDTCT and BOZORTH3 on the FVC2004 databases. The recognition performance and the computational efficiency of the method suggest to include oriented diffusion filtering as a standard image enhancement add-on module for real-time fingerprint recognition systems. In order to facilitate the reproduction of these results, an implementation of the oriented diffusion filtering for Matlab and GNU Octave is made available for download. © 2012 The Institution of Engineering and Technology.

Oriented diffusion filtering for enhancing low-quality fingerprint images

KAUST Repository

Gottschlich, C.

2012-01-01

To enhance low-quality fingerprint images, we present a novel method that first estimates the local orientation of the fingerprint ridge and valley flow and next performs oriented diffusion filtering, followed by a locally adaptive contrast enhancement step. By applying the authors\\' new approach to low-quality images of the FVC2004 fingerprint databases, the authors are able to show its competitiveness with other state-of-the-art enhancement methods for fingerprints like curved Gabor filtering. A major advantage of oriented diffusion filtering over those is its computational efficiency. Combining oriented diffusion filtering with curved Gabor filters led to additional improvements and, to the best of the authors\\' knowledge, the lowest equal error rates achieved so far using MINDTCT and BOZORTH3 on the FVC2004 databases. The recognition performance and the computational efficiency of the method suggest to include oriented diffusion filtering as a standard image enhancement add-on module for real-time fingerprint recognition systems. In order to facilitate the reproduction of these results, an implementation of the oriented diffusion filtering for Matlab and GNU Octave is made available for download. © 2012 The Institution of Engineering and Technology.

Aspects of physicochemical methods for the detection of latent fingerprints

International Nuclear Information System (INIS)

Knowles, A.M.

1978-01-01

This paper reviews physicochemical methods of detecting latent finger-prints on a wide range of materials commonly found at the scene of a crime, with particular emphasis placed on the newer autoradiographic techniques. This is set against a description of studies on the fundamental nature of the latent fingerprint and its host substrate, with a brief review of the history of reagents used in latent fingerprint examination. (author)

Multiple chromatographic fingerprinting and its application to the quality control of herbal medicines

Energy Technology Data Exchange (ETDEWEB)

Fan Xiaohui [Pharmaceutical Informatics Institute, College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310027 (China); Cheng Yiyu [Pharmaceutical Informatics Institute, College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310027 (China)]. E-mail: chengyy@zju.edu.cn; Ye Zhengliang [Pharmaceutical Informatics Institute, College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310027 (China); Lin Ruichao [National Institute for the Control of Pharmaceutical and Biological Products, Beijing 100050 (China); Qian Zhongzhi [Committee of Chinese Pharmacopoeia, Beijing 100061 (China)

2006-01-12

Recently, chromatographic fingerprinting has become one of the most powerful approaches to quality control of herbal medicines. However, the performance of reported chromatographic fingerprinting constructed by single chromatogram sometimes turns out to be inadequate for complex herbal medicines, such as multi-herb botanical drug products. In this study, multiple chromatographic fingerprinting, which consists of more than one chromatographic fingerprint and represents the whole characteristics of chemical constitutions of the complex medicine, is proposed as a potential strategy in this complicated case. As a typical example, a binary chromatographic fingerprinting of 'Danshen Dropping Pill' (DSDP), the best-sold traditional Chinese medicine in China, was developed. First, two HPLC fingerprints that, respectively, represent chemical characteristics of depsides and saponins of DSDP were developed, which were used to construct binary chromatographic fingerprints of DSDP. Moreover, the authentication and validation of the binary fingerprints were performed. Then, a data-level information fusion method was employed to capture the chemical information encoded in two chromatographic fingerprints. Based on the fusion results, the lot-to-lot consistency and frauds can be determined either using similarity measure or by chemometrics approach. The application of binary chromatographic fingerprinting to consistency assessment and frauds detection of DSDP clearly demonstrated that the proposed method was a powerful approach to quality control of complex herbal medicines.

A Large-Scale Study of Fingerprint Matching Systems for Sensor Interoperability Problem

Directory of Open Access Journals (Sweden)

Helala AlShehri

2018-03-01

Full Text Available The fingerprint is a commonly used biometric modality that is widely employed for authentication by law enforcement agencies and commercial applications. The designs of existing fingerprint matching methods are based on the hypothesis that the same sensor is used to capture fingerprints during enrollment and verification. Advances in fingerprint sensor technology have raised the question about the usability of current methods when different sensors are employed for enrollment and verification; this is a fingerprint sensor interoperability problem. To provide insight into this problem and assess the status of state-of-the-art matching methods to tackle this problem, we first analyze the characteristics of fingerprints captured with different sensors, which makes cross-sensor matching a challenging problem. We demonstrate the importance of fingerprint enhancement methods for cross-sensor matching. Finally, we conduct a comparative study of state-of-the-art fingerprint recognition methods and provide insight into their abilities to address this problem. We performed experiments using a public database (FingerPass that contains nine datasets captured with different sensors. We analyzed the effects of different sensors and found that cross-sensor matching performance deteriorates when different sensors are used for enrollment and verification. In view of our analysis, we propose future research directions for this problem.

A Large-Scale Study of Fingerprint Matching Systems for Sensor Interoperability Problem.

Science.gov (United States)

AlShehri, Helala; Hussain, Muhammad; AboAlSamh, Hatim; AlZuair, Mansour

2018-03-28

The fingerprint is a commonly used biometric modality that is widely employed for authentication by law enforcement agencies and commercial applications. The designs of existing fingerprint matching methods are based on the hypothesis that the same sensor is used to capture fingerprints during enrollment and verification. Advances in fingerprint sensor technology have raised the question about the usability of current methods when different sensors are employed for enrollment and verification; this is a fingerprint sensor interoperability problem. To provide insight into this problem and assess the status of state-of-the-art matching methods to tackle this problem, we first analyze the characteristics of fingerprints captured with different sensors, which makes cross-sensor matching a challenging problem. We demonstrate the importance of fingerprint enhancement methods for cross-sensor matching. Finally, we conduct a comparative study of state-of-the-art fingerprint recognition methods and provide insight into their abilities to address this problem. We performed experiments using a public database (FingerPass) that contains nine datasets captured with different sensors. We analyzed the effects of different sensors and found that cross-sensor matching performance deteriorates when different sensors are used for enrollment and verification. In view of our analysis, we propose future research directions for this problem.

Analysis of cellular and extracellular DNA in fingerprints

Energy Technology Data Exchange (ETDEWEB)

Button, Julie M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2014-09-09

It has been previously shown that DNA can be recovered from latent fingerprints left on various surfaces [R. A. H. van Oorschot and M. K. Jones, Nature 387, 767 (1997)]. However, the source of the DNA, extracellular versus cellular origin, is difficult to determine. If the DNA is cellular, it is believed to belong to skin cells while extracellular DNA is believed to originate from body fluids such as sweat [D. J. Daly et. al, Forensic Sci. Int. Genet. 6, 41-46 (2012); V. V. Vlassov et. al, BioEssays 29, 654-667 (2007)]. The origin of the DNA in fingerprints has implications for processing and interpretation of forensic evidence. The determination of the origin of DNA in fingerprints is further complicated by the fact that the DNA in fingerprints tends to be at a very low quantity [R. A. H. van Oorschot and M. K. Jones, Nature 387, 767 (1997)]. This study examined fingerprints from five volunteers left on sterilized glass slides and plastic pens. Three fingerprints were left on each glass slide (thumb, index, and middle fingers) while the pens were held as if one was writing with them. The DNA was collected from the objects using the wet swabbing technique (TE buffer). Following collection, the cellular and extracellular components of each sample were separated using centrifugation and an acoustofluidics system. Centrifugation is still the primary separation technique utilized in forensics laboratories, while acoustic focusing uses sound waves to focus large particles (cells) into low pressure nodes, separating them from the rest of the sample matrix. After separation, all samples were quantified using real-time quantitative PCR (qPCR). The overall trend is that there is more DNA in the extracellular fractions than cellular fractions for both centrifugation and acoustofluidic processing. Additionally, more DNA was generally collected from the pen samples than the samples left on glass slides.

Fast probabilistic file fingerprinting for big data.

Science.gov (United States)

Tretyakov, Konstantin; Laur, Sven; Smant, Geert; Vilo, Jaak; Prins, Pjotr

2013-01-01

Biological data acquisition is raising new challenges, both in data analysis and handling. Not only is it proving hard to analyze the data at the rate it is generated today, but simply reading and transferring data files can be prohibitively slow due to their size. This primarily concerns logistics within and between data centers, but is also important for workstation users in the analysis phase. Common usage patterns, such as comparing and transferring files, are proving computationally expensive and are tying down shared resources. We present an efficient method for calculating file uniqueness for large scientific data files, that takes less computational effort than existing techniques. This method, called Probabilistic Fast File Fingerprinting (PFFF), exploits the variation present in biological data and computes file fingerprints by sampling randomly from the file instead of reading it in full. Consequently, it has a flat performance characteristic, correlated with data variation rather than file size. We demonstrate that probabilistic fingerprinting can be as reliable as existing hashing techniques, with provably negligible risk of collisions. We measure the performance of the algorithm on a number of data storage and access technologies, identifying its strengths as well as limitations. Probabilistic fingerprinting may significantly reduce the use of computational resources when comparing very large files. Utilisation of probabilistic fingerprinting techniques can increase the speed of common file-related workflows, both in the data center and for workbench analysis. The implementation of the algorithm is available as an open-source tool named pfff, as a command-line tool as well as a C library. The tool can be downloaded from http://biit.cs.ut.ee/pfff.

[HPTLC fingerprint analysis of andrographolides from Andrographis paniculata].

Science.gov (United States)

Shao, Yan-Hua; Wang, Jian-Gang; Lai, Xiao-Ping; Wu, Xiang-Wei; Ding, Ping

2014-02-01

To establish the high-performance thin layer chromatography (HPTLC) fingerprint of andrographolides from Andrographis paniculata, and to valuate the fingerprint similarity of samples from different habitats, markets, used parts and so on. Chromatographic conditions were as follows: stationary phase: precoated HPTLC GF254 silica-gel plate (20 cm x 10 cm); developing solvent system: chloroform-toluene-methanol (80:10:15); Relative humidity: 42%; Color development reagent: 5% H2SO4 ethanolic solution, heating at 105 degrees C and observing the fluorescent chromatogram in a UV cabinet at 366 nm. The common patterns of HPTLC fingerprint were obtained through CHROMAP 1.5 solution software. The HPTLC fingerprint of andrographolides was consisted of 9 characteristic peaks (fluorescent bands) including andrographolide, neoandrographolide and dehydroandrographolide which were chemical reference substances. The investigation and analysis of 51 batches of Andrographis paniculata showed that there were remarkable differences among different samples, so was the content of andrographolide and total lactones. This method is simple and rapid, which can serve as an effective identification and quality assessment method for Andrographis paniculata.

The Fluid Dynamical Performance of the Carpentier-Edwards PERIMOUNT Magna Ease Prosthesis

Directory of Open Access Journals (Sweden)

Philipp Marx

2018-01-01

Full Text Available The aim of the present in vitro study was the evaluation of the fluid dynamical performance of the Carpentier-Edwards PERIMOUNT Magna Ease depending on the prosthetic size (21, 23, and 25 mm and the cardiac output (3.6–6.4 L/min. A self-constructed flow channel in combination with particle image velocimetry (PIV enabled precise results with high reproducibility, focus on maximal and local peek velocities, strain, and velocity gradients. These flow parameters allow insights into the generation of forces that act on blood cells and the aortic wall. The results showed that the 21 and 23 mm valves have a quite similar performance. Maximal velocities were 3.03±0.1 and 2.87±0.13 m/s; maximal strain Exx, 913.81±173.25 and 896.15±88.16 1/s; maximal velocity gradient Eyx, 1203.14±221.84 1/s and 1200.81±61.83 1/s. The 25 mm size revealed significantly lower values: maximal velocity, 2.47±0.15 m/s; maximal strain Exx, 592.98±155.80 1/s; maximal velocity gradient Eyx, 823.71±38.64 1/s. In summary, the 25 mm Magna Ease was able to create a wider, more homogenous flow with lower peak velocities especially for higher flow rates. Despite the wider flow, the velocity values close to the aortic walls did not exceed the level of the smaller valves.

Gene transcription in Daphnia magna: effects of acute exposure to a carbamate insecticide and an acetanilide herbicide.

Science.gov (United States)

Pereira, Joana Luísa; Hill, Christopher J; Sibly, Richard M; Bolshakov, Viacheslav N; Gonçalves, Fernando; Heckmann, Lars-Henrik; Callaghan, Amanda

2010-05-05

Daphnia magna is a key invertebrate in the freshwater environment and is used widely as a model in ecotoxicological measurements and risk assessment. Understanding the genomic responses of D. magna to chemical challenges will be of value to regulatory authorities worldwide. Here we exposed D. magna to the insecticide methomyl and the herbicide propanil to compare phenotypic effects with changes in mRNA expression levels. Both pesticides are found in drainage ditches and surface water bodies standing adjacent to crops. Methomyl, a carbamate insecticide widely used in agriculture, inhibits acetylcholinesterase, a key enzyme in nerve transmission. Propanil, an acetanilide herbicide, is used to control grass and broad-leaf weeds. The phenotypic effects of single doses of each chemical were evaluated using a standard immobilisation assay. Immobilisation was linked to global mRNA expression levels using the previously estimated 48h-EC(1)s, followed by hybridization to a cDNA microarray with more than 13,000 redundant cDNA clones representing >5000 unique genes. Following exposure to methomyl and propanil, differential expression was found for 624 and 551 cDNAs, respectively (one-way ANOVA with Bonferroni correction, P

Sequence Conservation and Sexually Dimorphic Expression of the Ftz-F1 Gene in the Crustacean Daphnia magna.

Directory of Open Access Journals (Sweden)

Nur Syafiqah Mohamad Ishak

Full Text Available Identifying the genes required for environmental sex determination is important for understanding the evolution of diverse sex determination mechanisms in animals. Orthologs of Drosophila orphan receptor Fushi tarazu factor-1 (Ftz-F1 are known to function in genetic sex determination. In contrast, their roles in environmental sex determination remain unknown. In this study, we have cloned and characterized the Ftz-F1 ortholog in the branchiopod crustacean Daphnia magna, which produces males in response to environmental stimuli. Similar to that observed in Drosophila, D. magna Ftz-F1 (DapmaFtz-F1 produces two splicing variants, αFtz-F1 and βFtz-F1, which encode 699 and 777 amino acids, respectively. Both isoforms share a DNA-binding domain, a ligand-binding domain, and an AF-2 activation domain and differ only at the A/B domain. The phylogenetic position and genomic structure of DapmaFtz-F1 suggested that this gene has diverged from an ancestral gene common to branchiopod crustacean and insect Ftz-F1 genes. qRT-PCR showed that at the one cell and gastrulation stages, both DapmaFtz-F1 isoforms are two-fold more abundant in males than in females. In addition, in later stages, their sexual dimorphic expressions were maintained in spite of reduced expression. Time-lapse imaging of DapmaFtz-F1 RNAi embryos was performed in H2B-GFP expressing transgenic Daphnia, demonstrating that development of the RNAi embryos slowed down after the gastrulation stage and stopped at 30-48 h after ovulation. DapmaFtz-F1 shows high homology to insect Ftz-F1 orthologs based on its amino acid sequence and exon-intron organization. The sexually dimorphic expression of DapmaFtz-F1 suggests that it plays a role in environmental sex determination of D. magna.

Partial Fingerprint Image Enhancement using Region Division Technique and Morphological Transform

International Nuclear Information System (INIS)

Ahmad, A.; Arshad, I.; Raja, G.

2015-01-01

Fingerprints are the most renowned biometric trait for identification and verification. The quality of fingerprint image plays a vital role in feature extraction and matching. Existing algorithms work well for good quality fingerprint images and fail for partial fingerprint images as they are obtained from excessively dry fingers or affected by disease resulting in broken ridges. We propose an algorithm to enhance partial fingerprint images using morphological operatins with region division technique. The proposed method divides low quality image into six regions from top to bottom. Morphological operations choose an appropriate Structuring Element (SE) that joins broken ridges and thus enhance the image for further processing. The proposed method uses SE line with suitable angle theta and radius r in each region based on the orientation of the ridges. The algorithm is applied to 14 low quality fingerprint images from FVC-2002 database. Experimental results show that percentage accuracy has been improved using the proposed algorithm. The manual markup has been reduced and accuracy of 76.16% with Equal Error Rate (EER) of 3.16% is achieved. (author)

To flee or not to flee: detection, avoidance and attraction of profitable resources by Daphnia magna studied with olfactometer

Directory of Open Access Journals (Sweden)

Johann P. Müller

2013-10-01

Full Text Available The cladoceran herbivore Daphnia magna is a major consumer of phytoplankton in lakes. Therefore, this organism may control the phytoplankton community and the proliferation of some algae or cyanobacteria. Cladoceran behaviour and migration in relation to temperature, light or presence of planktivorous fishes have been well studied. In particular, it is known that the detection of kairomones produced by predators may induce avoidance. Avoidance could also occur with other semiochemicals such as cyanotoxins. In order to explore this hypothesis, we used an olfactometer to observe and measure the exploratory behaviour of D. magna individuals based on the motivation for food. Daphnids were allowed to choose between different compounds: water, a pure cyanotoxin, i.e. the microcystin-RR [(MC-RR], extracts of one MC-producing strain (PMC 75.02 and one MC-free strain (PMC 87.02 of Planktothrix agardhii, or a green algae Scenedesmus obliquus. With this experimental design, we observed that i cladocerans are able to detect resources with different qualities, ii they can explore before exhibiting preferences, and iii daphnids are able to avoid compounds that are potentially toxic (e.g., microcystins. First, daphnids explored the environment, subsequently (after about 1.5 h, they showed a significant tendency to stay where there is a profitable resource such as S. obliquus. These results also suggest that specimens of D. magna cannot detect MC compounds from P. agardhii, but they respond to it as a food resource. The study of zooplankton ability to explore the environment when exposed to semiochemicals needs further investigation. 

Selected endocrine disrupting compounds (vinclozolin, flutamide, ketoconazole and dicofol): effects on survival, occurrence of males, growth, molting and reproduction of Daphnia magna.

Science.gov (United States)

Haeba, Maher H; Hilscherová, Klára; Mazurová, Edita; Bláha, Ludek

2008-05-01

Pollution-induced endocrine disruption in vertebrates and invertebrates is a worldwide environmental problem, but relatively little is known about effects of endocrine disrupting compounds (EDCs) in planktonic crustaceans (including Daphnia magna). Aims of the present study were to investigate acute 48 h toxicity and sub-chronic (4-6 days) and chronic (21 days) effects of selected EDCs in D. magna. We have investigated both traditional endpoints as well as other parameters such as sex determination, maturation, molting or embryogenesis in order to evaluate the sensitivity and possible use of these endpoints in ecological risk assessment. We have studied effects of four model EDCs (vinclozolin, flutamide, ketoconazole and dicofol) on D. magna using (i) an acute 48 h immobilization assay, (ii) a sub-chronic, 4-6 day assay evaluating development and the sex ratio of neonates, and (iii) a chronic, 21 day assay studying number of neonates, sex of neonates, molting frequency, day of maturation and the growth of maternal organisms. Acute EC50 values in the 48 h immobilization test were as follows (mg/L): dicofol 0.2, ketoconazole 1.5, flutamide 2.7, vinclozolin >3. Short-term, 4-6 day assays with sublethal concentrations showed that the sex ratio in Daphnia was modulated by vinclozolin (decreased number of neonate males at 1 mg/L) and dicofol (increase in males at 0.1 mg/L). Flutamide (up to 1 mg/L) had no effect on the sex of neonates, but inhibited embryonic development at certain stages during chronic assay, resulting in abortions. Ketoconazole had no significant effects on the studied processes up to 1 mg/L. Sex ratio modulations by some chemicals (vinclozolin and dicofol) corresponded to the known action of these compounds in vertebrates (i.e. anti-androgenicity and anti-oestrogenicity, respectively). Our study revealed that some chemicals known to affect steroid-regulated processes in vertebrates can also affect sublethal endpoints (e.g. embryonic sex determination

Novel fingerprint re-alignment solution that uses the TFCP as a reference

CSIR Research Space (South Africa)

Msiza, IS

2011-08-01

Full Text Available , independent, and efficient for all types of fingerprints. It, in particular, is useful when dealing with the type of fingerprints that belong to the Plain Arch (PA) fingerprint class. The credibility of this proposed solution is interrogated through its...

Recognition of explosives fingerprints on objects for courier services using machine learning methods and laser-induced breakdown spectroscopy.

Science.gov (United States)

Moros, J; Serrano, J; Gallego, F J; Macías, J; Laserna, J J

2013-06-15

During recent years laser-induced breakdown spectroscopy (LIBS) has been considered one of the techniques with larger ability for trace detection of explosives. However, despite of the high sensitivity exhibited for this application, LIBS suffers from a limited selectivity due to difficulties in assigning the molecular origin of the spectral emissions observed. This circumstance makes the recognition of fingerprints a latent challenging problem. In the present manuscript the sorting of six explosives (chloratite, ammonal, DNT, TNT, RDX and PETN) against a broad list of potential harmless interferents (butter, fuel oil, hand cream, olive oil, …), all of them in the form of fingerprints deposited on the surfaces of objects for courier services, has been carried out. When LIBS information is processed through a multi-stage architecture algorithm built from a suitable combination of 3 learning classifiers, an unknown fingerprint may be labeled into a particular class. Neural network classifiers trained by the Levenberg-Marquardt rule were decided within 3D scatter plots projected onto the subspace of the most useful features extracted from the LIBS spectra. Experimental results demonstrate that the presented algorithm sorts fingerprints according to their hazardous character, although its spectral information is virtually identical in appearance, with rates of false negatives and false positives not beyond of 10%. These reported achievements mean a step forward in the technology readiness level of LIBS for this complex application related to defense, homeland security and force protection. Copyright © 2013 Elsevier B.V. All rights reserved.

Laser speckle decorrelation for fingerprint acquisition

International Nuclear Information System (INIS)

Schirripa Spagnolo, Giuseppe; Cozzella, Lorenzo

2012-01-01

Biometry is gaining popularity as a physical security approach in situations where a high level of security is necessary. Currently, biometric solutions are embedded in a very large and heterogeneous group of applications. One of the most sensible is for airport security access to boarding gates. More airports are introducing biometric solutions based on face, fingerprint or iris recognition for passenger identification. In particular, fingerprints are the most widely used biometric, and they are mandatorily included in electronic identification documents. One important issue, which is difficult to address in traditional fingerprint acquisition systems, is preventing contact between subsequent users; sebum, which can be a potential vector for contagious diseases. Currently, non-contact devices are used to overcome this problem. In this paper, a new contact device based on laser speckle decorrelation is presented. Our system has the advantage of being compact and low-cost compared with an actual contactless system, allowing enhancement of the sebum pattern imaging contrast in a simple and low-cost way. Furthermore, it avoids the spreading of contagious diseases. (paper)

Efficient and Secure Fingerprint Verification for Embedded Devices

Directory of Open Access Journals (Sweden)

Sakiyama Kazuo

2006-01-01

Full Text Available This paper describes a secure and memory-efficient embedded fingerprint verification system. It shows how a fingerprint verification module originally developed to run on a workstation can be transformed and optimized in a systematic way to run real-time on an embedded device with limited memory and computation power. A complete fingerprint recognition module is a complex application that requires in the order of 1000 M unoptimized floating-point instruction cycles. The goal is to run both the minutiae extraction and the matching engines on a small embedded processor, in our case a 50 MHz LEON-2 softcore. It does require optimization and acceleration techniques at each design step. In order to speed up the fingerprint signal processing phase, we propose acceleration techniques at the algorithm level, at the software level to reduce the execution cycle number, and at the hardware level to distribute the system work load. Thirdly, a memory trace map-based memory reduction strategy is used for lowering the system memory requirement. Lastly, at the hardware level, it requires the development of specialized coprocessors. As results of these optimizations, we achieve a 65% reduction on the execution time and a 67% reduction on the memory storage requirement for the minutiae extraction process, compared against the reference implementation. The complete operation, that is, fingerprint capture, feature extraction, and matching, can be done in real-time of less than 4 seconds

Piezoelectric micromachined ultrasonic transducers for fingerprint sensing

Science.gov (United States)

Lu, Yipeng

Fingerprint identification is the most prevalent biometric technology due to its uniqueness, universality and convenience. Over the past two decades, a variety of physical mechanisms have been exploited to capture an electronic image of a human fingerprint. Among these, capacitive fingerprint sensors are the ones most widely used in consumer electronics because they are fabricated using conventional complementary metal oxide semiconductor (CMOS) integrated circuit technology. However, capacitive fingerprint sensors are extremely sensitive to finger contamination and moisture. This thesis will introduce an ultrasonic fingerprint sensor using a PMUT array, which offers a potential solution to this problem. In addition, it has the potential to increase security, as it allows images to be collected at various depths beneath the epidermis, providing images of the sub-surface dermis layer and blood vessels. Firstly, PMUT sensitivity is maximized by optimizing the layer stack and electrode design, and the coupling coefficient is doubled via series transduction. Moreover, a broadband PMUT with 97% fractional bandwidth is achieved by utilizing a thinner structure excited at two adjacent mechanical vibration modes with overlapping bandwidth. In addition, we proposed waveguide PMUTs, which function to direct acoustic waves, confine acoustic energy, and provide mechanical protection for the PMUT array. Furthermore, PMUT arrays were fabricated with different processes to form the membrane, including front-side etching with a patterned sacrificial layer, front-side etching with additional anchor, cavity SOI wafers and eutectic bonding. Additionally, eutectic bonding allows the PMUT to be integrated with CMOS circuits. PMUTs were characterized in the mechanical, electrical and acoustic domains. Using transmit beamforming, a narrow acoustic beam was achieved, and high-resolution (sub-100 microm) and short-range (~1 mm) pulse-echo ultrasonic imaging was demonstrated using a steel

The Principle Of Justice In Magna Carta Libertatum And Its Influence On The Law In General

Directory of Open Access Journals (Sweden)

Zendeli Emine

2015-12-01

Full Text Available This article aims to expound the principle of justice, as a fundamental value and as an immanent category of law, as well as one of the fundamental human rights, prescribed and guaranteed by a myriad of international instruments and documents. After a brief historical account, by focusing on Article 40 of the Magna Carta Libertatum, which states that: “To No One Will we Sell, To No One Will we refuse or delay, right or justice”, this article claims to show the importance of incorporation of this principle in the provisions of the Magna Carta and its impact on the development of theory and legislation in the past and present. Moreover, the article intends to explore the extent of influence that the priciple of justice has on the functioning of the law in general. Since justice implicates the permanent and constant will to render each person his due, and this achieved through equality, it results that justice means being equal. In this context, the article will explore the concept of equality as a precondition of justice, as well as the conditions and modalities for its implementation.

Effect of carbaryl (carbamate insecticide) on acetylcholinesterase activity of two strains of Daphnia magna (Crustacea, Cladocera).

Science.gov (United States)

Toumi, Hela; Bejaoui, Mustapha; Touaylia, Samir; Burga Perez, Karen F; Ferard, Jean François

2016-11-01

The present study was designed to investigate the effect of carbaryl (carbamate insecticide) on the acetylcholinesterase activity in two strains (same clone A) of the crustacean cladoceran Daphnia magna. Four carbaryl concentrations (0.4, 0.9, 1.8 and 3.7 µg L(-1)) were compared against control AChE activity. Our results showed that after 48 h of carbaryl exposure, all treatments induced a significant decrease of AChE activities whatever the two considered strains. However, different responses were registered in terms of lowest observed effect concentrations (LOEC: 0.4 µg L(-1) for strain 1 and 0.9 µg L(-1) for strains 2) revealing differences in sensitivity among the two tested strains of D. magna. These results suggest that after carbaryl exposure, the AChE activity responses can be also used as a biomarker of susceptibility. Moreover, our results show that strain1 is less sensitive than strain 2 in terms of IC50-48 h of AChE activity. Comparing the EC50-48 h of standard ecotoxicity test and IC50-48 h of AChE inhibition, there is the same order of sensitivity with both strains.

Ridge Width Correlations between Inked Prints and Powdered Latent Fingerprints.

Science.gov (United States)

De Alcaraz-Fossoul, Josep; Barrot-Feixat, Carme; Zapico, Sara C; Mancenido, Michelle; Broatch, Jennifer; Roberts, Katherine A; Carreras-Marin, Clara; Tasker, Jack

2017-10-03

A methodology to estimate the time of latent fingerprint deposition would be of great value to law enforcement and courts. It has been observed that ridge topography changes as latent prints age, including the widths of ridges that could be measured as a function of time. Crime suspects are commonly identified using fingerprint databases that contain reference inked tenprints (flat and rolled impressions). These can be of interest in aging studies as they provide baseline information relating to the original (nonaged) ridges' widths. In practice, the age of latent fingerprints could be estimated following a comparison process between the evidentiary aged print and the corresponding reference inked print. The present article explores possible correlations between inked and fresh latent fingerprints deposited on different substrates and visualized with TiO 2 . The results indicate that the ridge width of flat inked prints is most similar to fresh latent fingerprints , and these should be used as the comparison standard for future aging studies. © 2017 American Academy of Forensic Sciences.

How cyclophosphamide at environmentally relevant concentration influences Daphnia magna life history and its proteome.

Directory of Open Access Journals (Sweden)

Małgorzata Grzesiuk

Full Text Available The waste of commonly used medicines is known to contaminate freshwater ecosystems. Pharmaceuticals can be toxic, mutagenic, or modifying to freshwater organisms even at low concentrations if consider their permanent presence in the environment. Chemotherapeutics used to treat cancer, and in particular alkylating agents, contribute significantly to this form of pollution, the latter introducing cytotoxic and/or mutagenic lesions to the DNA and RNA of organisms which can be disruptive to their cells. The aim of the present study was to investigate the influence of the alkylating anticancer agent cyclophosphamide (CP on Daphnia magna clones. We evaluated the life history parameters and protein profiles of this crustacean following exposure to environmentally relevant CP concentration of 10 ng L-1. Even at this low concentration, the alkylating agent caused modification of the life history parameters and proteome profile of the Daphnia. These changes were clone-specific and involved growth rate, age at first reproduction, neonate number, and proteins related to cell cycle and redox state regulation. The disturbance caused by pharmaceuticals contaminating freshwater ecosystem is probably weaker and unlikely to be cytotoxic in character due to the high dilution of these substances in the water. However, our results indicate that prolonged exposure of organisms to these toxins may lead to modifications on the organismal and molecular levels with unpredictable significance for the entire ecosystem.

Dual Contrast - Magnetic Resonance Fingerprinting (DC-MRF): A Platform for Simultaneous Quantification of Multiple MRI Contrast Agents.

Science.gov (United States)

Anderson, Christian E; Donnola, Shannon B; Jiang, Yun; Batesole, Joshua; Darrah, Rebecca; Drumm, Mitchell L; Brady-Kalnay, Susann M; Steinmetz, Nicole F; Yu, Xin; Griswold, Mark A; Flask, Chris A

2017-08-16

Injectable Magnetic Resonance Imaging (MRI) contrast agents have been widely used to provide critical assessments of disease for both clinical and basic science imaging research studies. The scope of available MRI contrast agents has expanded over the years with the emergence of molecular imaging contrast agents specifically targeted to biological markers. Unfortunately, synergistic application of more than a single molecular contrast agent has been limited by MRI's ability to only dynamically measure a single agent at a time. In this study, a new Dual Contrast - Magnetic Resonance Fingerprinting (DC - MRF) methodology is described that can detect and independently quantify the local concentration of multiple MRI contrast agents following simultaneous administration. This "multi-color" MRI methodology provides the opportunity to monitor multiple molecular species simultaneously and provides a practical, quantitative imaging framework for the eventual clinical translation of molecular imaging contrast agents.

Multifragment alleles in DNA fingerprints of the parrot, Amazona ventralis

Science.gov (United States)

Brock, M.K.; White, B.N.

1991-01-01

Human DNA probes that identify variable numbers of tandem repeat loci are being used to generate DNA fingerprints in many animal and plant species. In most species the majority of the sc rable autoradiographic bands of the DNA fingerprint represent alleles from numerous unlinked loci. This study was initiated to use DNA fingerprints to determine the amount of band-sharing among captive Hispaniolan parrots (Amazona ventralis) with known genetic relationships. This would form the data base to examine DNA fingerprints of the closely related and endangered Puerto Rican parrot (A. vittata) and to estimate the degree of inbreeding in the relic population. We found by segregation analysis of the bands scored in the DNA fingerprints of the Hispaniolan parrots that there may be as few as two to five loci identified by the human 33.15 probe. Furthermore, at one locus we identified seven alleles, one of which is represented by as many as 19 cosegregating bands. It is unknown how common multiband alleles might be in natural populations, and their existence will cause problems in the assessment of relatedness by band-sharing analysis. We believe, therefore, that a pedigree analysis should be included in all DNA fingerprinting studies, where possible, in order to estimate the number of loci identified by a minisatellite DNA probe and to examine the nature of their alleles.

Comparison of Powder Dusting and Cyanoacrylate Fuming Techniques in Retrieving Latent Fingerprint Exposed to Environment Conditions

International Nuclear Information System (INIS)

Mayalvanan, Y.; Sri Pawita Albakri Amir Hamzah; Chuan, L.L.; Muhamad Hilmi Baba; Amidon Anan

2014-01-01

Latent fingerprints are one of the best evidence to prove the presence of an individuals presence at the crime scene. There are many techniques available for a successful fingerprint lifting. Two of the most common ones are fingerprint powder dusting and cyanoacrylate fuming. This research aims to compare both techniques and determine which has a higher success rate in retrieving fingerprints exposed to local environmental conditions for three days. Fingerprint samples were collected from 18 subjects on glass, perspex and aluminium slides. These samples were then exposed to local environmental conditions for three days. The fingerprints were then developed using the aforementioned techniques. Based on the results, it can be safely said that, fuming results in clearer fingerprints and more minutiae can be found from the retrieved fingerprints even with exposure to less than optimum local conditions. This proves that fuming is a better fingerprint lifting method to resolve latent fingerprint compared to powder dusting. Surface on which the fingerprint is retrieved from influences the quality of clarity of a latent fingerprint. (author)

Quality improvement of fingerprints of decayed corpses by local thanatopractical processing (Thanatoprint

Directory of Open Access Journals (Sweden)

Gahr, Britta

2013-11-01

Full Text Available Thanatopractical processing allows morphological reconstruction of even advanced decayed bodies. By extracting fluids from the body’s tissue antemortem tenseness and volume can be restored. If bodies are partly subject to thanatopractical processing in the hand region (“Thanatoprint”, fingerprints of high quality can be gathered even in cases of advanced decay. Without this treatment fingerprinting can be extremely difficult, if not impossible. Thanatopractical processing could be applied successfully in cases of partial to subtotal detachment of the epidermis as well. In an interdisciplinary study 400 fingerprints of bodies in various states of decay were examined after application of Thanatoprint. In 76.75% fingerprints were applicable for data entry into AFIS (Automated Fingerprint Identification System; another 11.00% of the fingerprints could be used for the process of non-elimination. Further advantages of the method are low invasivity while maintaining the integrity of the corpse, less time- and material requirement as well as its long-lasting effect.

Distortion Estimation in Compressed Music Using Only Audio Fingerprints

NARCIS (Netherlands)

Doets, P.J.O.; Lagendijk, R.L.

2008-01-01

An audio fingerprint is a compact yet very robust representation of the perceptually relevant parts of an audio signal. It can be used for content-based audio identification, even when the audio is severely distorted. Audio compression changes the fingerprint slightly. We show that these small

A preliminary study of DTI Fingerprinting on stroke analysis.

Science.gov (United States)

Ma, Heather T; Ye, Chenfei; Wu, Jun; Yang, Pengfei; Chen, Xuhui; Yang, Zhengyi; Ma, Jingbo

2014-01-01

DTI (Diffusion Tensor Imaging) is a well-known MRI (Magnetic Resonance Imaging) technique which provides useful structural information about human brain. However, the quantitative measurement to physiological variation of subtypes of ischemic stroke is not available. An automatically quantitative method for DTI analysis will enhance the DTI application in clinics. In this study, we proposed a DTI Fingerprinting technology to quantitatively analyze white matter tissue, which was applied in stroke classification. The TBSS (Tract Based Spatial Statistics) method was employed to generate mask automatically. To evaluate the clustering performance of the automatic method, lesion ROI (Region of Interest) is manually drawn on the DWI images as a reference. The results from the DTI Fingerprinting were compared with those obtained from the reference ROIs. It indicates that the DTI Fingerprinting could identify different states of ischemic stroke and has promising potential to provide a more comprehensive measure of the DTI data. Further development should be carried out to improve DTI Fingerprinting technology in clinics.

Transparent Fingerprint Sensor System for Large Flat Panel Display.

Science.gov (United States)

Seo, Wonkuk; Pi, Jae-Eun; Cho, Sung Haeung; Kang, Seung-Youl; Ahn, Seong-Deok; Hwang, Chi-Sun; Jeon, Ho-Sik; Kim, Jong-Uk; Lee, Myunghee

2018-01-19

In this paper, we introduce a transparent fingerprint sensing system using a thin film transistor (TFT) sensor panel, based on a self-capacitive sensing scheme. An armorphousindium gallium zinc oxide (a-IGZO) TFT sensor array and associated custom Read-Out IC (ROIC) are implemented for the system. The sensor panel has a 200 × 200 pixel array and each pixel size is as small as 50 μm × 50 μm. The ROIC uses only eight analog front-end (AFE) amplifier stages along with a successive approximation analog-to-digital converter (SAR ADC). To get the fingerprint image data from the sensor array, the ROIC senses a capacitance, which is formed by a cover glass material between a human finger and an electrode of each pixel of the sensor array. Three methods are reviewed for estimating the self-capacitance. The measurement result demonstrates that the transparent fingerprint sensor system has an ability to differentiate a human finger's ridges and valleys through the fingerprint sensor array.

Examination of Zinc Oxide Nanoparticles as a Fluorescent Fingerprint Detection Powder

International Nuclear Information System (INIS)

Tun Tun Lin

2010-12-01

Detection of latent fingerprint was performed using zinc oxide nanoparticles which were produced by simple and efficient method in aqueous media from zinc nitrate. Synthesized ZnO nanoparticles were characterized by XRD, SEM and AFM for ZnO purification and particle size examination. In this paper an effort has been made to compare the results of using ZnO nanoparticles and conventional fingerprint powders such as ZnO bulk powder, CaO, TiO2, printer toner powder and graphite. Fingerprints on different materials were also examined by the use of ZnO and Graphite powder, which is currently used in the Central Intelligence Department of Myanmar Police Force.From this research, it was observed that zinc oxide nanoparticles powder produced a much clearer picture of the fingerprints, compared to conventional powders and it has very good quality at sticking to the fingerprint residue but not to the background surface.

Classification of solid industrial waste based on ecotoxicology tests using Daphnia magna: an alternative

OpenAIRE

William Gerson Matias; Vanessa Guimarães Machado; Cátia Regina Silva de Carvalho-Pinto; Débora Monteiro Brentano; Letícia Flohr

2005-01-01

The adequate treatment and final disposal of solid industrial wastes depends on their classification into class I or II. This classification is proposed by NBR 10.004; however, it is complex and time-consuming. With a view to facilitating this classification, the use of assays with Daphnia magna is proposed. These assays make possible the identification of toxic chemicals in the leach, which denotes the presence of one of the characteristics described by NBR 10.004, the toxicity, which is a s...

Establishment of dna fingerprinting in clonal tea improved cultivars from yunnan of china using issr markers

International Nuclear Information System (INIS)

Liu, B.Y.; Zhao, C.M.; Sun, X.M.; Jiang, H.B.

2015-01-01

In this study, DNA fingerprints were constructed by using ISSR markers for 20 clonal improved varieties developed by two breeding institutes in Yunnan province. Seven core ISSR primers were selected from 15 primers. A total of 110 bands were generated by PAGE with seven core primers, 93 of which were polymorphic bands, the percentage of polymorphic band (PPB) was 84.54%, and the mean value of polymorphism information content (PIC) reached 0.417; the genetic similarity coefficient of the cultivars was 0.574-0.854. The two primers, UBC835 and ISSR2, had high PIC values, and could be used to distinguish all cultivars, presenting the most efficient single primers. Among the all of primer combinations from the seven core primers, the three combinations, UBC835/UBC811, UBC835/ISSR2, and UBC835/ISSR3 showed lower similar coefficients, and more efficient in identifying the 20 improved varieties than the other primer combinations. Then these three primer combinations were further scored in 15 traditional cultivars. The results showed that UBC835/ISSR2 was the optimal primer combination, which could be used to distinguish each material among the 20 clonal improved varieties and 15 traditional cultivals. Finally, the DNA fingerprints of the 20 clonal improved varieties were constructed based on country and region code, breeding institute, core primer name and ISSR marker data. The established fingerprints could provide reliable scientific base for the protection of intellectual property right for these clonal improved varieties, and the important molecular information contained in these fingerprints would be useful for the authenticity identification and genetic relationship analysis of tea varieties. (author)

Daphnia magna shows reduced infection upon secondary exposure to a pathogen.

Science.gov (United States)

McTaggart, Seanna J; Wilson, Philip J; Little, Tom J

2012-12-23

Previous pathogen exposure is an important predictor of the probability of becoming infected. This is deeply understood for vertebrate hosts, and increasingly so for invertebrate hosts. Here, we test if an initial pathogen exposure changes the infection outcome to a secondary pathogen exposure in the natural host-pathogen system Daphnia magna and Pasteuria ramosa. Hosts were initially exposed to an infective pathogen strain, a non-infective pathogen strain or a control. The same hosts underwent a second exposure, this time to an infective pathogen strain, either immediately after the initial encounter or 48 h later. We observed that an initial encounter with a pathogen always conferred protection against infection compared with controls.

dna and seed proteins fingerprinting of egyptian crop plants

African Journals Online (AJOL)

Dr. Haddad

2012-11-01

Nov 1, 2012 ... combinations were used for fingerprinting six cultivars which belongs to barley, rice and wheat cultivars leading to the production of numerous AFLP bands, 300 of them were polymorphic. Thirty SSR markers were obtained from fingerprinting eight cultivars belonging to the five studied species using 11.

DNA fingerprinting in botany: past, present, future

OpenAIRE

Nybom, Hilde; Weising, Kurt; Rotter, Björn

2014-01-01

Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67–73 and Nature 1985, 316:76–79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the n...

Examining the effects of a DNA fingerprinting workshop on science teachers' professional development and student learning

Science.gov (United States)

Sonmez, Duygu

The 21st century has become the age of biology with the completion of the human genome project and other milestone discoveries. Recent progress has redefined what it means to be scientifically literate, which is the ultimate goal in science education. "What students should know?" "What needs to be taught?" These questions lead to reformulation of the science curriculum due to the changing nature of scientific knowledge. Molecular biology is increasingly emphasized in the science curriculum along with applications of the latest developments within our daily lives, such as medicine or legal matters. However, many schools and classrooms exclude the latest advances in molecular genetics from science curriculum and even teach biology as a non-laboratory science. Many science educators wonder what can be done to help every child gain meaningful experiences with molecular genetics. Limited content knowledge among teachers due to the changing nature of scientific knowledge, and the rapid discoveries in technology are known to be a part of the problem for teachers, especially for teachers who have been in the workforce for many years. A major aim of professional development is to help teachers cope with the advances in scientific knowledge and provide paths for teachers to continually improve their knowledge and skills. The expectation is that increased knowledge and skills among teachers will be reflected in student achievement. Professional development is typically offered in a variety of formats, from short-term, one-shot workshop approaches to long term courses. The effectiveness of short-term exposures, though, is in many cases is questionable. One of the issues appears to be the gap between the incidence of teachers' attendance at professional development programs and the incidence of implementation in participants' classrooms. This study focuses on this issue by exploring the relationship between teachers' professional development attendance and their implementation

Accessible biometrics: A frustrated total internal reflection approach to imaging fingerprints.

Science.gov (United States)

Smith, Nathan D; Sharp, James S

2017-05-01

Fingerprints are widely used as a means of identifying persons of interest because of the highly individual nature of the spatial distribution and types of features (or minuta) found on the surface of a finger. This individuality has led to their wide application in the comparison of fingerprints found at crime scenes with those taken from known offenders and suspects in custody. However, despite recent advances in machine vision technology and image processing techniques, fingerprint evidence is still widely being collected using outdated practices involving ink and paper - a process that can be both time consuming and expensive. Reduction of forensic service budgets increasingly requires that evidence be gathered and processed more rapidly and efficiently. However, many of the existing digital fingerprint acquisition devices have proven too expensive to roll out on a large scale. As a result new, low-cost imaging technologies are required to increase the quality and throughput of the processing of fingerprint evidence. Here we describe an inexpensive approach to digital fingerprint acquisition that is based upon frustrated total internal reflection imaging. The quality and resolution of the images produced are shown to be as good as those currently acquired using ink and paper based methods. The same imaging technique is also shown to be capable of imaging powdered fingerprints that have been lifted from a crime scene using adhesive tape or gel lifters. Copyright © 2017 The Chartered Society of Forensic Sciences. Published by Elsevier B.V. All rights reserved.

Solving the Mystery of Fading Fingerprints with London Dispersion Forces.

Science.gov (United States)

Kimbrough, Doris R.; DeLorenzo, Ronald

1998-01-01

Focuses on the kidnapping of a child whose fingerprints were not found inside the crime vehicle. Discusses the investigation that followed and led to knowledge of the differences between the fingerprints of children and adults. (DDR)

Fingerprinting and diversity of bacterial copA genes in response to soil types, soil organic status and copper contamination.

Science.gov (United States)

Lejon, David P H; Nowak, Virginie; Bouko, Sabrina; Pascault, Noémie; Mougel, Christophe; Martins, Jean M F; Ranjard, Lionel

2007-09-01

A molecular fingerprinting assay was developed to assess the diversity of copA genes, one of the genetic determinants involved in bacterial resistance to copper. Consensus primers of the copA genes were deduced from an alignment of sequences from proteobacterial strains. A PCR detection procedure was optimized for bacterial strains and allowed the description of a novel copA genetic determinant in Pseudomonas fluorescens. The copA DNA fingerprinting procedure was optimized for DNA directly extracted from soils differing in their physico-chemical characteristics and in their organic status (SOS). Particular copA genetic structures were obtained for each studied soil and a coinertia analysis with soil physico-chemical characteristics revealed the strong influence of pH, soil texture and the quality of soil organic matter. The molecular phylogeny of copA gene confirmed that specific copA genes clusters are specific for each SOS. Furthermore, this study demonstrates that this approach was sensitive to short-term responses of copA gene diversity to copper additions to soil samples, suggesting that community adaptation is preferentially controlled by the diversity of the innate copA genes rather than by the bioavailability of the metal.

Tannin fingerprinting in vegetable tanned leather by solid state NMR spectroscopy and comparison with leathers tanned by other processes.

Science.gov (United States)

Romer, Frederik H; Underwood, Andrew P; Senekal, Nadine D; Bonnet, Susan L; Duer, Melinda J; Reid, David G; van der Westhuizen, Jan H

2011-01-28

Solid state ¹³C-NMR spectra of pure tannin powders from four different sources--mimosa, quebracho, chestnut and tara--are readily distinguishable from each other, both in pure commercial powder form, and in leather which they have been used to tan. Groups of signals indicative of the source, and type (condensed vs. hydrolyzable) of tannin used in the manufacture are well resolved in the spectra of the finished leathers. These fingerprints are compared with those arising from leathers tanned with other common tanning agents. Paramagnetic chromium (III) tanning causes widespread but selective disappearance of signals from the spectrum of leather collagen, including resonances from acidic aspartyl and glutamyl residues, likely bound to Cr (III) structures. Aluminium (III) and glutaraldehyde tanning both cause considerable leather collagen signal sharpening suggesting some increase in molecular structural ordering. The ²⁷Al-NMR signal from the former material is consistent with an octahedral coordination by oxygen ligands. Solid state NMR thus provides easily recognisable reagent specific spectral fingerprints of the products of vegetable and some other common tanning processes. Because spectra are related to molecular properties, NMR is potentially a powerful tool in leather process enhancement and quality or provenance assurance.

Interactive effects of a bacterial parasite and the insecticide carbaryl to life-history and physiology of two Daphnia magna clones differing in carbaryl sensitivity

International Nuclear Information System (INIS)

De Coninck, Dieter I.M.; De Schamphelaere, Karel A.C.; Jansen, Mieke; De Meester, Luc; Janssen, Colin R.

2013-01-01

Highlights: ► Interactive effects between a bacterial parasite and an insecticide in Daphnia magna. ► Two D. magna clones differing strongly in their sensitivity to the insecticide. ► Effects studied on various life-history and physiological endpoints. ► Genetic differences in strength and direction of interaction effects. -- Abstract: Natural and chemical stressors occur simultaneously in the aquatic environment. Their combined effects on biota are usually difficult to predict from their individual effects due to interactions between the different stressors. Several recent studies have suggested that synergistic effects of multiple stressors on organisms may be more common at high compared to low overall levels of stress. In this study, we used a three-way full factorial design to investigate whether interactive effects between a natural stressor, the bacterial parasite Pasteuria ramosa, and a chemical stressor, the insecticide carbaryl, were different between two genetically distinct clones of Daphnia magna that strongly differ in their sensitivity to carbaryl. Interactive effects on various life-history and physiological endpoints were assessed as significant deviations from the reference Independent Action (IA) model, which was implemented by testing the significance of the two-way carbaryl × parasite interaction term in two-way ANOVA's on log-transformed observational data for each clone separately. Interactive effects (and thus significant deviations from IA) were detected in both the carbaryl-sensitive clone (on survival, early reproduction and growth) and in the non-sensitive clone (on growth, electron transport activity and prophenoloxidase activity). No interactions were found for maturation rate, filtration rate, and energy reserve fractions (carbohydrate, protein, lipid). Furthermore, only antagonistic interactions were detected in the non-sensitive clone, while only synergistic interactions were observed in the carbaryl sensitive clone. Our

Interactive effects of a bacterial parasite and the insecticide carbaryl to life-history and physiology of two Daphnia magna clones differing in carbaryl sensitivity

Energy Technology Data Exchange (ETDEWEB)

De Coninck, Dieter I.M., E-mail: Dieter.DeConinck@UGent.be [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, J. Plateaustraat 22, B-9000 Ghent (Belgium); De Schamphelaere, Karel A.C. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, J. Plateaustraat 22, B-9000 Ghent (Belgium); Jansen, Mieke; De Meester, Luc [Laboratory of Aquatic Ecology, Evolution and Conservation, University of Leuven, Ch. Deberiotstraat 32, B-3000 Leuven (Belgium); Janssen, Colin R. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, J. Plateaustraat 22, B-9000 Ghent (Belgium)

2013-04-15

Highlights: ► Interactive effects between a bacterial parasite and an insecticide in Daphnia magna. ► Two D. magna clones differing strongly in their sensitivity to the insecticide. ► Effects studied on various life-history and physiological endpoints. ► Genetic differences in strength and direction of interaction effects. -- Abstract: Natural and chemical stressors occur simultaneously in the aquatic environment. Their combined effects on biota are usually difficult to predict from their individual effects due to interactions between the different stressors. Several recent studies have suggested that synergistic effects of multiple stressors on organisms may be more common at high compared to low overall levels of stress. In this study, we used a three-way full factorial design to investigate whether interactive effects between a natural stressor, the bacterial parasite Pasteuria ramosa, and a chemical stressor, the insecticide carbaryl, were different between two genetically distinct clones of Daphnia magna that strongly differ in their sensitivity to carbaryl. Interactive effects on various life-history and physiological endpoints were assessed as significant deviations from the reference Independent Action (IA) model, which was implemented by testing the significance of the two-way carbaryl × parasite interaction term in two-way ANOVA's on log-transformed observational data for each clone separately. Interactive effects (and thus significant deviations from IA) were detected in both the carbaryl-sensitive clone (on survival, early reproduction and growth) and in the non-sensitive clone (on growth, electron transport activity and prophenoloxidase activity). No interactions were found for maturation rate, filtration rate, and energy reserve fractions (carbohydrate, protein, lipid). Furthermore, only antagonistic interactions were detected in the non-sensitive clone, while only synergistic interactions were observed in the carbaryl sensitive clone. Our

Interactive effects of a bacterial parasite and the insecticide carbaryl to life-history and physiology of two Daphnia magna clones differing in carbaryl sensitivity

Energy Technology Data Exchange (ETDEWEB)

De Coninck, Dieter I.M., E-mail: Dieter.DeConinck@UGent.be [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, J. Plateaustraat 22, B-9000 Ghent (Belgium); De Schamphelaere, Karel A.C. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, J. Plateaustraat 22, B-9000 Ghent (Belgium); Jansen, Mieke; De Meester, Luc [Laboratory of Aquatic Ecology, Evolution and Conservation, University of Leuven, Ch. Deberiotstraat 32, B-3000 Leuven (Belgium); Janssen, Colin R. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, J. Plateaustraat 22, B-9000 Ghent (Belgium)

2013-04-15

Highlights: ► Interactive effects between a bacterial parasite and an insecticide in Daphnia magna. ► Two D. magna clones differing strongly in their sensitivity to the insecticide. ► Effects studied on various life-history and physiological endpoints. ► Genetic differences in strength and direction of interaction effects. -- Abstract: Natural and chemical stressors occur simultaneously in the aquatic environment. Their combined effects on biota are usually difficult to predict from their individual effects due to interactions between the different stressors. Several recent studies have suggested that synergistic effects of multiple stressors on organisms may be more common at high compared to low overall levels of stress. In this study, we used a three-way full factorial design to investigate whether interactive effects between a natural stressor, the bacterial parasite Pasteuria ramosa, and a chemical stressor, the insecticide carbaryl, were different between two genetically distinct clones of Daphnia magna that strongly differ in their sensitivity to carbaryl. Interactive effects on various life-history and physiological endpoints were assessed as significant deviations from the reference Independent Action (IA) model, which was implemented by testing the significance of the two-way carbaryl × parasite interaction term in two-way ANOVA's on log-transformed observational data for each clone separately. Interactive effects (and thus significant deviations from IA) were detected in both the carbaryl-sensitive clone (on survival, early reproduction and growth) and in the non-sensitive clone (on growth, electron transport activity and prophenoloxidase activity). No interactions were found for maturation rate, filtration rate, and energy reserve fractions (carbohydrate, protein, lipid). Furthermore, only antagonistic interactions were detected in the non-sensitive clone, while only synergistic interactions were observed in the carbaryl sensitive clone

Spectrum-effect relationship between HPLC fingerprints and hypolipidemic effect of Curcuma aromatica.

Science.gov (United States)

Liu, Meiqiong; Wu, Youjiao; Huang, Shushi; Liu, Huagang; Feng, Jie

2018-02-23

Curcuma aromatica is used as a traditional Chinese medicine, and it is mainly distributed in Guangxi, China. In this study, 10 batches of C. aromatica were collected from different origins in Guangxi. The fingerprints were established by HPLC technique to investigate the quality stability of C. aromatica. The spectrum-effect relationship between HPLC fingerprints and hypolipidemic effect of C. aromatica was assessed by similarity analysis, gray relational analysis and multiple linear regression analysis. From the results, the similarity values between each batch of C. aromatica and reference fingerprint were >0.880, indicating the good quality stability of the 10 batches of C. aromatica. Twenty common peaks were selected as the fingerprints to evaluate the quality and hypolipidemic effect of C. aromatica. The results of spectrum-effect relationship showed that peaks 10, 18, 13, 15 and 17 in the fingerprints were closely related to hypolipidemic effect. This study successfully established the spectrum-effect relationship between HPLC fingerprints and hypolipidemic effect of C. aromatica, which provided methods for quality control and more effectively studies on bioactive compounds of C. aromatica. It could also provide a new simple and effective method for utilizing the fingerprints to optimize the Chinese prescription and develop traditional Chinese medicine. Copyright © 2018 John Wiley & Sons, Ltd.

The critical importance of defined media conditions in Daphnia magna nanotoxicity studies.

Science.gov (United States)

Römer, Isabella; Gavin, Alex J; White, Thomas A; Merrifield, Ruth C; Chipman, James K; Viant, Mark R; Lead, Jamie R

2013-10-23

Due to the widespread use of silver nanoparticles (AgNPs), the likelihood of them entering the environment has increased and they are known to be potentially toxic. Currently, there is little information on the dynamic changes of AgNPs in ecotoxicity exposure media and how this may affect toxicity. Here, the colloidal stability of three different sizes of citrate-stabilized AgNPs was assessed in standard strength OECD ISO exposure media, and in 2-fold (media2) and 10-fold (media10) dilutions by transmission electron microscopy (TEM) and atomic force microscopy (AFM) and these characteristics were related to their toxicity towards Daphnia magna. Aggregation in undiluted media (media1) was rapid, and after diluting the medium by a factor of 2 or 10, aggregation was reduced, with minimal aggregation over 24h occurring in media10. Acute toxicity measurements were performed using 7nm diameter particles in media1 and media10. In media10 the EC50 of the 7nm particles for D. magna neonates was calculated to be 7.46μgL(-1) with upper and lower 95% confidence intervals of 6.84μgL(-1) and 8.13μgL(-1) respectively. For media1, an EC50 could not be calculated, the lowest observed adverse effect concentration (LOAEC) of 11.25μgL(-1) indicating a significant reduction in toxicity compared to that in media10. The data suggest the increased dispersion of nanoparticles leads to enhanced toxicity, emphasising the importance of appropriate media composition to fully assess nanoparticle toxicity in aquatic ecotoxicity tests. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Filming of zooplankton: a case study of rotifer males and Daphnia magna

Directory of Open Access Journals (Sweden)

Pierluigi Colangeli

2015-11-01

Full Text Available Filming live organisms can give new insights into the hidden life of plankton. Accessibly priced digital cameras are now available for a large range of users. Here, we demonstrate the technical setup and workflow of using a single-lens reflex (DSLR camera to film the behaviour of males of two rotifer species, Brachionus angularis Gosse (1851 and Keratella cochlearis Gosse (1851, and of the cladoceran Daphnia magna Straus (1820. Rotifers are cyclical parthenogens that produce males only under certain environmental conditions. Thus, knowledge on rotifer males is still limited because of their ephemeral nature and because they are often smaller than females. We filmed males of B. angularis and K. cochlearis with a DSLR camera connected to a compound microscope to better understand their morphology and behaviour in comparison to conspecific females. While written descriptions have their scientific value, seeing is complementary because everyone can verify what has been described. We made our videos publicly accessible through links connected to the paper. Our videos are, to our best knowledge, the first on males of B. angularis and K. cochlearis. Furthermore, we filmed the behavioural response of D. magna to ultraviolet (UV radiation with a macro lens attached to the DSLR camera. Approaches like this are valuable tools in environmental teaching. To see live organisms with one’s own eyes may contribute to raising public awareness about the value of water resources and their hidden communities. In summary, filming can be a valuable tool to ignite scientific discussion, but the videos need an open-access platform where they can be referenced in a topic-related order.

A Modified Electrostatic Adsorption Apparatus for Latent Fingerprint Development on Unfired Cartridge Cases.

Science.gov (United States)

Xu, Jingyang; Zhang, Ziyuan; Zheng, Xiaochun; Bond, John W

2017-05-01

Visualization of latent fingerprints on metallic surfaces by the method of applying electrostatic charging and adsorption is considered as a promising chemical-free method, which has the merit of nondestruction, and is considered to be effective for some difficult situations such as aged fingerprint deposits or those exposed to environmental extremes. In fact, a portable electrostatic generator can be easily accessible in a local forensic technology laboratory, which is already widely used in the visualization of footwear impressions. In this study, a modified version of this electrostatic apparatus is proposed for latent fingerprint development and has shown great potential in visualizing fingerprints on metallic surfaces such as cartridge cases. Results indicate that this experimental arrangement can successfully develop aged latent fingerprints on metal surfaces, and we demonstrate its effectiveness compared with existing conventional fingerprint recovery methods. © 2016 American Academy of Forensic Sciences.

Self-Organizing Maps for Fingerprint Image Quality Assessment

DEFF Research Database (Denmark)

Olsen, Martin Aastrup; Tabassi, Elham; Makarov, Anton

2013-01-01

Fingerprint quality assessment is a crucial task which needs to be conducted accurately in various phases in the biometric enrolment and recognition processes. Neglecting quality measurement will adversely impact accuracy and efficiency of biometric recognition systems (e.g. verification and iden......Fingerprint quality assessment is a crucial task which needs to be conducted accurately in various phases in the biometric enrolment and recognition processes. Neglecting quality measurement will adversely impact accuracy and efficiency of biometric recognition systems (e.g. verification...... machine learning techniques. We train a self-organizing map (SOM) to cluster blocks of fingerprint images based on their spatial information content. The output of the SOM is a high-level representation of the finger image, which forms the input to a Random Forest trained to learn the relationship between...

Detecting anthropogenic climate change with an optimal fingerprint method

International Nuclear Information System (INIS)

Hegerl, G.C.; Storch, H. von; Hasselmann, K.; Santer, B.D.; Jones, P.D.

1994-01-01

We propose a general fingerprint strategy to detect anthropogenic climate change and present application to near surface temperature trends. An expected time-space-variable pattern of anthropogenic climate change (the 'signal') is identified through application of an appropriate optimally matched space-time filter (the 'fingerprint') to the observations. The signal and the fingerprint are represented in a space with sufficient observed and simulated data. The signal pattern is derived from a model-generated prediction of anthropogenic climate change. Application of the fingerprint filter to the data yields a scalar detection variable. The statistically optimal fingerprint is obtained by weighting the model-predicted pattern towards low-noise directions. A combination of model output and observations is used to estimate the noise characteristics of the detection variable, arising from the natural variability of climate in the absence of external forcing. We test then the null hypothesis that the observed climate change is part of natural climate variability. We conclude that a statistically significant externally induced warming has been observed, with the caveat of a possibly inadequate estimate of the internal climate variability. In order to attribute this warming uniquely to anthropogenic greenhouse gas forcing, more information on the climate's response to other forcing mechanisms (e.g. changes in solar radiation, volcanic or anthropogenic aerosols) and their interaction is needed. (orig./KW)

Establishment and application of milk fingerprint by gel filtration chromatography.

Science.gov (United States)

Gao, P; Li, J; Li, Z; Hao, J; Zan, L

2016-12-01

Raw milk adulteration frequently occurs in undeveloped countries. It not only reduces the nutritional value of milk, but it is also harmful to consumers. In this paper, we focused on investigating an efficient method for the quality control of raw milk protein. A gel filtration chromatography (GFC) fingerprint method combined with chemometrics was developed for fingerprint analysis of raw milk. To optimize the GFC conditions, milk fat was removed by centrifugation, and GFC analysis was performed on a Superdex 75 10/300GL column (Just Scientific, Shanghai, China) with 0.2 M NaH 2 PO 4 -Na 2 HPO 4 buffer (pH 7.0) as the mobile phase. The flow rate was 0.5mL/min, and the detection wavelength was set at 280 nm. Ten batches of 120 raw milk samples were analyzed to establish the GFC fingerprint under optimal conditions. Six major peaks common to the chromatogram of each raw milk sample were selected for fingerprint analysis, and the characteristic peaks were used to establish a standard chromatographic fingerprint. Principal component analysis was then applied to classify GFC information of adulterated milk and raw milk, allowing adulterated samples to be effectively screened out from the raw milk in principal component analysis scores plot. The fingerprint method demonstrates promising features in detecting milk protein adulteration. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Polarization-based and specular-reflection-based noncontact latent fingerprint imaging and lifting

Science.gov (United States)

Lin, Shih-Schön; Yemelyanov, Konstantin M.; Pugh, Edward N., Jr.; Engheta, Nader

2006-09-01

In forensic science the finger marks left unintentionally by people at a crime scene are referred to as latent fingerprints. Most existing techniques to detect and lift latent fingerprints require application of a certain material directly onto the exhibit. The chemical and physical processing applied to the fingerprint potentially degrades or prevents further forensic testing on the same evidence sample. Many existing methods also have deleterious side effects. We introduce a method to detect and extract latent fingerprint images without applying any powder or chemicals on the object. Our method is based on the optical phenomena of polarization and specular reflection together with the physiology of fingerprint formation. The recovered image quality is comparable to existing methods. In some cases, such as the sticky side of tape, our method shows unique advantages.

Preparation of mixed molecularly imprinted polymer magnetic nanoparticles and its application in separation of Chinese traditional medicine

Science.gov (United States)

Xie, Yihui; Ma, Yajuan; Bai, Wenting; Zhu, Xiaofang; Liu, Min; Huang, Liping

2017-08-01

A mixed imprinted polymer which can rapidly adsorb all flavonoids from raspberry extract was prepared and recycled. The hybrid molecular surface imprinted polymers were prepared by using quercetin as the template molecule and Fe3O4 magnetic nanospheres as the carrier. The molecular imprinting polymer was prepared by using the "initial template molecule, molecularly imprinted polymer, mixed template molecule, molecularly imprint ted polymers (MIPS)". The adsorption performance and durability of the hybrid molecularly imprinted polymers were investigated by using the fingerprints of the ethyl acetate fraction of raspberry as an index. The adsorption of flavonoids from raspberry extract, lindenoside, cis-lindenin, quercetin, kaempferol and other flavonoids was completely adsorbed by mixed molecular-imprinted polymer, and the other components were basically adsorbed. When Mix-IMPs were repeatedly used 10 times, the fingerprints showed that the content and content of flavonoids were basically the same. The experimental results show that Mix-IMPs has good adsorption performance, can be recycled and used for rapid enrichment of flavonoids in raspberry.

Ubiquity of Wi-Fi: Crowdsensing Properties for Urban Fingerprint Positioning

Directory of Open Access Journals (Sweden)

LECA, C. L.

2017-11-01

Full Text Available Positioning systems based on location fingerprinting have become an area of intense research, mainly with the aim of providing indoor localization. Many challenges arise when trying to deploy location fingerprinting to an outdoor environment. The main problem is achieving coverage of large outdoor spaces, which needs an intensive data gathering effort. This paper proposes the use of mobile crowdsensing in order to build a fingerprint database consisting of Wi-Fi networks received signal strength measurements. Mobile crowdsensing is represented by the usage of smart-phones equipped with GPS and Wi-Fi sensors for the collection of fingerprints. The primary objective of this work is to prove the feasibility of urban positioning using Wi-Fi crowdsensed data by showing that Wi-Fi networks are ubiquitous in urban areas. We then examine the gathered data and report our findings on challenges in building and maintaining a large-scale fingerprint database, the influence of the data collection method on the Wi-Fi data and the influence of fading on measurements. As Wi-Fi access-points are shown to exhibit mobility, we also propose and analyze methods for detecting and classification of mobile and static access-points.

Whole genome sequencing of Mycobacterium bovis to obtain molecular fingerprints in human and cattle isolates from Baja California, Mexico.

Science.gov (United States)

Sandoval-Azuara, Sarai Estrella; Muñiz-Salazar, Raquel; Perea-Jacobo, Ricardo; Robbe-Austerman, Suelee; Perera-Ortiz, Alejandro; López-Valencia, Gilberto; Bravo, Doris M; Sanchez-Flores, Alejandro; Miranda-Guzmán, Daniela; Flores-López, Carlos Alberto; Zenteno-Cuevas, Roberto; Laniado-Laborín, Rafael; de la Cruz, Fabiola Lafarga; Stuber, Tod P

2017-10-01

To determine genetic diversity by comparing the whole genome sequences of cattle and human Mycobacterium bovis isolates from Baja California. A whole genome sequencing strategy was used to obtain the molecular fingerprints of 172 isolates of M. bovis obtained from Baja California, Mexico; 155 isolates were from cattle and 17 isolates were from humans. Spoligotypes were characterized in silico and single nucleotide polymorphism (SNP) differences between the isolates were evaluated. A total of 12 M. bovis spoligotype patterns were identified in cattle and humans. Two predominant spoligotypes patterns were seen in both cattle and humans: SB0145 and SB1040. The SB0145 spoligotype represented 59% of cattle isolates (n=91) and 65% of human isolates (n=11), while the SB1040 spoligotype represented 30% of cattle isolates (n=47) and 30% of human isolates (n=5). When evaluating SNP differences, the human isolates were intimately intertwined with the cattle isolates. All isolates from humans had spoligotype patterns that matched those observed in the cattle isolates, and all human isolates shared common ancestors with cattle in Baja California based on SNP analysis. This suggests that most human tuberculosis caused by M. bovis in Baja California is derived from M. bovis circulating in Baja California cattle. These results reinforce the importance of bovine tuberculosis surveillance and control in this region. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Hyperbolic Location Fingerprinting: A Calibration-Free Solution for Handling Differences in Signal Strength

DEFF Research Database (Denmark)

Kjærgaard, Mikkel Baun; Munk, Carsten Valdemar

2008-01-01

records fingerprints as signal-strength ratios between pairs of base stations instead of absolute signal-strength values. The proposed solution has been evaluated by extending two well-known location fingerprinting techniques to hyperbolic location fingerprinting. The extended techniques have been tested...

CarcinoPred-EL: Novel models for predicting the carcinogenicity of chemicals using molecular fingerprints and ensemble learning methods.

Science.gov (United States)

Zhang, Li; Ai, Haixin; Chen, Wen; Yin, Zimo; Hu, Huan; Zhu, Junfeng; Zhao, Jian; Zhao, Qi; Liu, Hongsheng

2017-05-18

Carcinogenicity refers to a highly toxic end point of certain chemicals, and has become an important issue in the drug development process. In this study, three novel ensemble classification models, namely Ensemble SVM, Ensemble RF, and Ensemble XGBoost, were developed to predict carcinogenicity of chemicals using seven types of molecular fingerprints and three machine learning methods based on a dataset containing 1003 diverse compounds with rat carcinogenicity. Among these three models, Ensemble XGBoost is found to be the best, giving an average accuracy of 70.1 ± 2.9%, sensitivity of 67.0 ± 5.0%, and specificity of 73.1 ± 4.4% in five-fold cross-validation and an accuracy of 70.0%, sensitivity of 65.2%, and specificity of 76.5% in external validation. In comparison with some recent methods, the ensemble models outperform some machine learning-based approaches and yield equal accuracy and higher specificity but lower sensitivity than rule-based expert systems. It is also found that the ensemble models could be further improved if more data were available. As an application, the ensemble models are employed to discover potential carcinogens in the DrugBank database. The results indicate that the proposed models are helpful in predicting the carcinogenicity of chemicals. A web server called CarcinoPred-EL has been built for these models ( http://ccsipb.lnu.edu.cn/toxicity/CarcinoPred-EL/ ).

Fingerprint Recognition using Fuzzy Logic with Triangular Pattern Template

DEFF Research Database (Denmark)

Hussain, Dil Muhammad Akbar

2006-01-01

A fingerprint is a pattern of ridges and valleys that exist on the surface of the finger. The uniqueness of a fingerprint is typically determined by the overall pattern of ridges and valleys as well as the local ridge structures e.g., a ridge bifurcation or a ridge ending, which are called minutiae...

Zone-based RSS Reporting for Location Fingerprinting

DEFF Research Database (Denmark)

Kjærgaard, Mikkel Baun; Treu, Georg; Linnhoff–Popien, Claudia

2007-01-01

In typical location fingerprinting systems a tracked terminal reports sampled Received Signal Strength (RSS) values to a location server, which estimates its position based on a database of pre-recorded RSS fingerprints. So far, poll-based and periodic RSS reporting has been proposed. However......, for supporting proactive Location-based Services (LBSs), triggered by pre-defined spatial events, the periodic protocol is inefficient. Hence, this paper introduces zone-based RSS reporting: the location server translates geographical zones defined by the LBS into RSS-based representations, which are dynamically...

Extracting valley-ridge lines from point-cloud-based 3D fingerprint models.

Science.gov (United States)

Pang, Xufang; Song, Zhan; Xie, Wuyuan

2013-01-01

3D fingerprinting is an emerging technology with the distinct advantage of touchless operation. More important, 3D fingerprint models contain more biometric information than traditional 2D fingerprint images. However, current approaches to fingerprint feature detection usually must transform the 3D models to a 2D space through unwrapping or other methods, which might introduce distortions. A new approach directly extracts valley-ridge features from point-cloud-based 3D fingerprint models. It first applies the moving least-squares method to fit a local paraboloid surface and represent the local point cloud area. It then computes the local surface's curvatures and curvature tensors to facilitate detection of the potential valley and ridge points. The approach projects those points to the most likely valley-ridge lines, using statistical means such as covariance analysis and cross correlation. To finally extract the valley-ridge lines, it grows the polylines that approximate the projected feature points and removes the perturbations between the sampled points. Experiments with different 3D fingerprint models demonstrate this approach's feasibility and performance.

Graphene Nanopres for DNA Fingerprinting

Science.gov (United States)

Ahmed, Towfiq; Balatsky, Alexander V.; Haraldsen, J. T.; Schuller, Ivan K.; di Ventra, M.; Wikfeldt, K. T.

2013-03-01

The recent progress in nanopore experiments with transverse current is important for the development of fast, accurate and cheap finger-printing techniques for single nucleotide. Despite its enormous potential for the next generation DNA sequencing technology, the presence of large noise in the temporal spectrum of transverse current remains a big challenge for getting highly accurate interpretation of data. In this paper we present our abinitio calculations, and propose graphene based device for DNA fingerprinting. We calculate transmission current through graphene for each DNA base (A,C,G,T). As shown in our work, a proper time-series analysis of a signal provides a higher quality information in identifying single bio-molecule is translocating through the nanopores. This work is supported by LANL, Nordita, US DOE, AFOSR, and NIH.

Fissile fingerprints

International Nuclear Information System (INIS)

Edwards, R.

1995-01-01

This article looks at recent research which may allow police and customs officers to detect smuggled weapons-grade plutonium and uranium. Contrary to popular opinion, nuclear materials do not have a nuclear ''fingerprint'' but enough information can be gleaned from sources to confirm what has been learnt from other data. Indeed, two leading nuclear laboratories can look at the same analytical results and draw different conclusions. The case of a lead cylinder seized from a German garage is examined to illustrate the confusion. (UK)

Performance analysis of a hybrid fingerprint extracted from optical coherence tomography fingertip scans

CSIR Research Space (South Africa)

Darlow, Luke N

2016-06-01

Full Text Available The Hybrid fingerprint is a local-quality-specific blend of the surface and internal fingerprints, extracted from optical coherence tomography scans. Owing to its origin, and the manner in which it is obtained, the Hybrid fingerprint is a high...

Assessing mandated credit programs: Case study of the Magna Carta in the Philippines

Directory of Open Access Journals (Sweden)

Ryan Jacildo

2016-09-01

Full Text Available We examine the effects of a mandated credit program to small and medium enterprises in the Philippines (Magna Carta Law using a panel dataset compiled from official data published by the Bangko Sentral ng Pilipinas. The final sample of 109 financial institutions represented over 90% of total finance sector assets in the Philippines. We highlight three important findings. First, although the total lending levels to micro, small, and medium enterprises (MSMEs grew slightly, the percentage shares of loans allocated to MSMEs declined drastically from a peak of 30% of total loans in 2002 to 16.4% in 2010. Second, following the upwards revision of the loan target (from 6% to 8% for smaller firms in 2008, there was a sharp increase in noncompliance especially amongst universal and commercial banks. On the other hand, total loans to medium enterprises were still more than threefold larger than the targeted 2%. Third, there is an increased heterogeneity in optimal loan portfolio across banks. Most surprisingly, the absolute level of MSME lending by rural and cooperative banks declined since 2008. Direct compliance amongst universal and commercial banks decreased beginning in the late 2007, while that of thrift banks increased to almost 100%. Abolishing the Magna Carta targets for medium-sized enterprise loans would most likely yield little adverse effects. Meanwhile, efforts to improve financial access to MSMEs should focus on alternative nondistortionary ways to increase financing supply, such as improving institutional framework for informational availability and development of equity and bond markets for MSMEs.

Investigation of gamma-ray fingerprint identifying mechanism for the types of radiation sources

CERN Document Server

Liu Su Ping; Gu Dang Chang; Gong-Jian; Hao Fan Hua; Hu Guang Chun

2002-01-01

Radiation fingerprints sometimes can be used to label and identify the radiation resources. For instance, in a future nuclear reduction treaty that requires verification of irreversible dismantling of reduced nuclear warheads, the radiation fingerprints of nuclear warheads are expected to play a key role in labelling and identifying the reduced warheads. It would promote the development of nuclear warheads deep-cuts verification technologies if authors start right now some investigations on the issues related to the radiation fingerprints. The author dedicated to the investigation of gamma-ray fingerprint identifying mechanism for the types of radiation resources. The purpose of the identifying mechanism investigation is to find a credible way to tell whether any two gamma-ray spectral fingerprints that are under comparison are radiated from the same resource. The authors created the spectrum pattern comparison (SPC) to study the comparability of the two radiation fingerprints. Guided by the principle of SPC,...

The FBI wavelet/scalar quantization standard for gray-scale fingerprint image compression

Energy Technology Data Exchange (ETDEWEB)

Bradley, J.N.; Brislawn, C.M. [Los Alamos National Lab., NM (United States); Hopper, T. [Federal Bureau of Investigation, Washington, DC (United States)

1993-05-01

The FBI has recently adopted a standard for the compression of digitized 8-bit gray-scale fingerprint images. The standard is based on scalar quantization of a 64-subband discrete wavelet transform decomposition of the images, followed by Huffman coding. Novel features of the algorithm include the use of symmetric boundary conditions for transforming finite-length signals and a subband decomposition tailored for fingerprint images scanned at 500 dpi. The standard is intended for use in conjunction with ANSI/NBS-CLS 1-1993, American National Standard Data Format for the Interchange of Fingerprint Information, and the FBI`s Integrated Automated Fingerprint Identification System.

Transparent Fingerprint Sensor System for Large Flat Panel Display

Directory of Open Access Journals (Sweden)

Wonkuk Seo

2018-01-01

Full Text Available In this paper, we introduce a transparent fingerprint sensing system using a thin film transistor (TFT sensor panel, based on a self-capacitive sensing scheme. An armorphousindium gallium zinc oxide (a-IGZO TFT sensor array and associated custom Read-Out IC (ROIC are implemented for the system. The sensor panel has a 200 × 200 pixel array and each pixel size is as small as 50 μm × 50 μm. The ROIC uses only eight analog front-end (AFE amplifier stages along with a successive approximation analog-to-digital converter (SAR ADC. To get the fingerprint image data from the sensor array, the ROIC senses a capacitance, which is formed by a cover glass material between a human finger and an electrode of each pixel of the sensor array. Three methods are reviewed for estimating the self-capacitance. The measurement result demonstrates that the transparent fingerprint sensor system has an ability to differentiate a human finger’s ridges and valleys through the fingerprint sensor array.

Selected endocrine disrupting compounds (vinclozolin, flutamide, ketoconazole and dicofol): Effects on survival, occurrence of males, growth, molting and reproduction of Daphnia magna

Czech Academy of Sciences Publication Activity Database

Haeba, M. H.; Hilscherová, Klára; Mazurová, E.; Bláha, Luděk

2008-01-01

Roč. 15, č. 3 (2008), s. 222-227 ISSN 0944-1344 Institutional research plan: CEZ:AV0Z60050516 Keywords : Daphnia magna * dicofol * endocrine disruption Subject RIV: EF - Botanics Impact factor: 2.492, year: 2008

Finger-vein and fingerprint recognition based on a feature-level fusion method

Science.gov (United States)

Yang, Jinfeng; Hong, Bofeng

2013-07-01

Multimodal biometrics based on the finger identification is a hot topic in recent years. In this paper, a novel fingerprint-vein based biometric method is proposed to improve the reliability and accuracy of the finger recognition system. First, the second order steerable filters are used here to enhance and extract the minutiae features of the fingerprint (FP) and finger-vein (FV). Second, the texture features of fingerprint and finger-vein are extracted by a bank of Gabor filter. Third, a new triangle-region fusion method is proposed to integrate all the fingerprint and finger-vein features in feature-level. Thus, the fusion features contain both the finger texture-information and the minutiae triangular geometry structure. Finally, experimental results performed on the self-constructed finger-vein and fingerprint databases are shown that the proposed method is reliable and precise in personal identification.

A novel hand-type detection technique with fingerprint sensor

Science.gov (United States)

Abe, Narishige; Shinzaki, Takashi

2013-05-01

In large-scale biometric authentication systems such as the US-Visit (USA), a 10-fingerprints scanner which simultaneously captures four fingerprints is used. In traditional systems, specific hand-types (left or right) are indicated, but it is difficult to detect hand-type due to the hand rotation and the opening and closing of fingers. In this paper, we evaluated features that were extracted from hand images (which were captured by a general optical scanner) that are considered to be effective for detecting hand-type. Furthermore, we extended the knowledge to real fingerprint images, and evaluated the accuracy with which it detects hand-type. We obtained an accuracy of about 80% with only three fingers (index, middle, ring finger).

Visualization of latent fingerprints beneath opaque electrical tapes by optical coherence tomography

Science.gov (United States)

Liu, Kangkang; Zhang, Ning; Meng, Li; Li, Zhigang; Xu, Xiaojing

2018-03-01

Electrical tape is found as one type of important trace evidence in crime scene. For example, it is very frequently used to insulate wires in explosive devices in many criminal cases. The fingerprints of the suspects were often left on the adhesive side of the tapes, which can provide very useful clues for the investigation and make it possible for individual identification. The most commonly used method to detect and visualize those latent fingerprints is to peel off each layer of the tapes first and then adopt the chemical methods to develop the fingerprints on the tapes. However, the peeling-off and chemical development process would degrade and contaminate the fingerprints and thus adversely affect the accuracy of identification. Optical coherence tomography (OCT) is a novel forensic imaging modality based on lowcoherence interferometry, which has the advantages of non-destruction, micrometer-level high resolution and crosssectional imaging. In this study, a fiber-based spectral-domain OCT (SD-OCT) system with {6μm resolution was employed to obtain the image of fingerprint sandwiched between two opaque electrical tapes without any pre-processing procedure like peeling-off. Three-dimensional (3D) OCT reconstruction was performed and the subsurface image was produced to visualize the latent fingerprints. The results demonstrate that OCT is a promising tool for recovering the latent fingerprints hidden beneath opaque electrical tape non-destructively and rapidly.

DNA fingerprinting in forensics: past, present, future.

Science.gov (United States)

Roewer, Lutz

2013-11-18

DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting.

DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

Science.gov (United States)

Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

2012-01-01

DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

Mimicking Daphnia magna bioassay performance by an electronic tongue for urban water quality control

Energy Technology Data Exchange (ETDEWEB)

Kirsanov, Dmitry, E-mail: d.kirsanov@gmail.com [Laboratory of Chemical Sensors, St. Petersburg State University, St. Petersburg (Russian Federation); Laboratory of Artificial Sensor Systems, ITMO University, St. Petersburg (Russian Federation); Legin, Evgeny [Laboratory of Artificial Sensor Systems, ITMO University, St. Petersburg (Russian Federation); Sensor Systems LLC, St. Petersburg (Russian Federation); Zagrebin, Anatoly; Ignatieva, Natalia; Rybakin, Vladimir [Institute of Limnology, Russian Academy of Sciences, St. Petersburg (Russian Federation); Legin, Andrey [Laboratory of Chemical Sensors, St. Petersburg State University, St. Petersburg (Russian Federation); Laboratory of Artificial Sensor Systems, ITMO University, St. Petersburg (Russian Federation)

2014-05-01

Highlights: • -Daphnia magna bioassay can be simulated with multisensor system. • Urban water toxicity can be predicted from potentiometric ET data. • Independent test set validation confirms statistical significance of the results. - Abstract: Toxicity is one of the key parameters of water quality in environmental monitoring. However, being evaluated as a response of living beings (as their mobility, fertility, death rate, etc.) to water quality, toxicity can only be assessed with the help of these living beings. This imposes certain restrictions on toxicity bioassay as an analytical method: biotest organisms must be properly bred, fed and kept under strictly regulated conditions and duration of tests can be quite long (up to several days), thus making the whole procedure the prerogative of the limited number of highly specialized laboratories. This report describes an original application of potentiometric multisensor system (electronic tongue) when the set of electrochemical sensors was calibrated against Daphnia magna death rate in order to perform toxicity assessment of urban waters without immediate involvement of living creatures. PRM (partial robust M) and PLS (projections on latent structures) regression models based on the data from this multisensor system allowed for prediction of toxicity of unknown water samples in terms of biotests but in the fast and simple instrumental way. Typical errors of water toxicity predictions were below 20% in terms of Daphnia death rate which can be considered as a good result taking into account the complexity of the task.

Cisterna magna microdialysis of 22Na to evaluate ion transport and cerebrospinal fluid dynamics

International Nuclear Information System (INIS)

Knuckey, N.W.; Fowler, A.G.; Johanson, C.E.; Nashold, J.R.; Epstein, M.H.

1991-01-01

Microdialysis is used in vivo for measuring compounds in brain interstitial fluid. The authors describe another application of this technique to the central nervous system, namely microprobe dialysis in the cisterna magna to study the dynamics of ion transport and cerebrospinal fluid (CSF) formation in the rat. The choroid plexus is the major source of CSF, which is produced by active transport of Na from blood into the cerebral ventricles. Formation of CSF is directly proportional to the blood-to-CSF transport of Na. By injecting 22 Na into the systemic circulation and quantifying its movement into CSF by microdialysis, one can reliably estimate alterations in the rate of CSF formation. The sensitivity of this system was determined by administering acetazolamide, a standard inhibitor of CSF production. Because acetazolamide is known to decrease CSF formation by 40% to 50%, the cisternal microdialysis system in animals treated with this drug should detect a corresponding decrease in the amount of 22 Na dialyzed. This hypothesis is supported by the 22 Na uptake curves for control versus treated animals: that is, by the acetazolamide-induced average diminution of about 45% in both the rate and extent of tracer accession to dialysate. Bumetanide, a loop diuretic, reduced by 30% the 22 Na entry into dialysate. Microprobe dialysis of fluid in the cisterna magna is thus a minimally invasive and economical method for evaluating effects of drugs and hormones on the choroid plexus-CSF system

RF-Based Location Using Interpolation Functions to Reduce Fingerprint Mapping

Science.gov (United States)

Ezpeleta, Santiago; Claver, José M.; Pérez-Solano, Juan J.; Martí, José V.

2015-01-01

Indoor RF-based localization using fingerprint mapping requires an initial training step, which represents a time consuming process. This location methodology needs a database conformed with RSSI (Radio Signal Strength Indicator) measures from the communication transceivers taken at specific locations within the localization area. But, the real world localization environment is dynamic and it is necessary to rebuild the fingerprint database when some environmental changes are made. This paper explores the use of different interpolation functions to complete the fingerprint mapping needed to achieve the sought accuracy, thereby reducing the effort in the training step. Also, different distributions of test maps and reference points have been evaluated, showing the validity of this proposal and necessary trade-offs. Results reported show that the same or similar localization accuracy can be achieved even when only 50% of the initial fingerprint reference points are taken. PMID:26516862

DNA Fingerprinting Using PCR: A Practical Forensic Science Activity

Science.gov (United States)

Choi, Hyun-Jung; Ahn, Jung Hoon; Ko, Minsu

2008-01-01

This paper describes a forensic science simulation programme applicable for use in colleges. Students were asked to find a putative suspect by DNA fingerprinting using a simple protocol developed in this study. DNA samples were obtained from a hair root and a drop of blood, common sources of DNA in forensic science. The DNA fingerprinting protocol…

Relationships between acute toxicities of para nitrophenol (p-NP) and nitrobenzene (NB) to Daphnia magna and Photobacterium phosphoreum: Physicochemical properties and metabolites under anaerobic/aerobic sequentials

International Nuclear Information System (INIS)

Sponza, Delia Teresa; Kuscu, Ozlem Selcuk

2011-01-01

In this study, the acute toxicities of nitrobenzene (NB) and para nitrophenol (p-NP) were investigated in a high rate sequential anaerobic migrating blanket (AMBR)/aerobic completely stirred tank reactor (CSTR) using Microtox and Daphnia magna tests. After sequential anaerobic and aerobic treatments, the inhibitions in the Microtox bacteria decreased from an initial 78.10-48.20% and 4.00%, respectively, in wastewater containing 40.00 mg/L p-NP. The inhibitions of the influent wastewater containing 60.00 mg/L NB decreased from 72.10% to 45.30% and to 4.00% after anaerobic and aerobic treatment, respectively. The acute toxicity removals were 94% and 93% in the effluent of the whole sequential system, for p-NP and NB, respectively. The acute toxicity in the influent was dependent on the parent NB and p-NP concentrations and ons their physicochemical properties such as hydrophobicity, octanol/water partition coefficient and vapour density for both Microtox bacteria and Daphnia magna while the toxicity in the effluent of the anaerobic reactor was strongly dependent on the metabolites of p-NP (p-amino phenol, phenol, NH 4 -N) and NB (aniline) for Microtox test. This effluent was not toxic to Daphnia magna.

THE INVESTIGATION OF THE RELATIONSHIP BETWEEN FINGERPRINT PATTERNS AND CRIME TYPES

OpenAIRE

DELİCE, Murat; DUMAN, Ali; ÖZEL, Şaban Ali

2014-01-01

The exclusivity of prints at the tip of each individuals fingers is known for thousands of years and these prints are used for security purposes for a long time. Recent developments have pointed out that fingerprint patterns are related to gender, heredity, diseases, blood types and even character. However, the relationship between fingerprint patterns and crime types has not been explored. In order to meet this need, this research study examines the fingerprint patterns of suspects who are i...

Estimates of population genetic diversity in brown bullhead catfish by DNA fingerprinting

Energy Technology Data Exchange (ETDEWEB)

Roth, A.C.; Wessendarp, T.K.; Gordon, D.A.; Smith, M.K. [Environmental Protection Agency, Cincinnati, OH (United States); Lattier, D.L. [Oak Ridge Inst. for Science and Education, Cincinnati, OH (United States); Hertzberg, V.; Leonard, A. [Univ. of Cincinnati, OH (United States). Dept. of Environmental Health

1994-12-31

Estimates of population genetic diversity may be a sensitive indicator of environmental impact, since limiting the effective breeding population by any means will result in loss of some variant genotypes, as has been demonstrated by allozyme analysis. DNA fingerprinting techniques are also coming into use for population analyses, and the authors chose to apply fingerprinting analysis three populations of brown bullhead catfish collected in Northern Ohio. DNA was isolated from the red blood cells of individual fish. Purified DNAs were digested with EcoR1 restriction enzyme; the digests were then sized on a 1% agarose gel, transferred to nylon membranes and probed with a radiolabeled M13 probe using the Westneat hybridization protocol (Southern blotting). This method effects fragments containing VNTR (variable number of tandem repeat) sequences complementary to the M13, which are highly variable among individual catfish. Hybridized bands were visualized by a Molecular Dynamics phosphorimager and recorded and analyzed with its proprietary Imagequant image analysis program, Excel and SAS. A total of 10 variable bands were identified and their presence or absence scored in each individual. These data were analyzed to determine between and within-population similarity indices as well as population heterozygosity and genetic diversity measures.

Automatic selection of atomic fingerprints and reference configurations for machine-learning potentials

Science.gov (United States)

Imbalzano, Giulio; Anelli, Andrea; Giofré, Daniele; Klees, Sinja; Behler, Jörg; Ceriotti, Michele

2018-06-01

Machine learning of atomic-scale properties is revolutionizing molecular modeling, making it possible to evaluate inter-atomic potentials with first-principles accuracy, at a fraction of the costs. The accuracy, speed, and reliability of machine learning potentials, however, depend strongly on the way atomic configurations are represented, i.e., the choice of descriptors used as input for the machine learning method. The raw Cartesian coordinates are typically transformed in "fingerprints," or "symmetry functions," that are designed to encode, in addition to the structure, important properties of the potential energy surface like its invariances with respect to rotation, translation, and permutation of like atoms. Here we discuss automatic protocols to select a number of fingerprints out of a large pool of candidates, based on the correlations that are intrinsic to the training data. This procedure can greatly simplify the construction of neural network potentials that strike the best balance between accuracy and computational efficiency and has the potential to accelerate by orders of magnitude the evaluation of Gaussian approximation potentials based on the smooth overlap of atomic positions kernel. We present applications to the construction of neural network potentials for water and for an Al-Mg-Si alloy and to the prediction of the formation energies of small organic molecules using Gaussian process regression.

AAV9-mediated central nervous system–targeted gene delivery via cisterna magna route in mice

Directory of Open Access Journals (Sweden)

Vera Lukashchuk

2016-01-01

Full Text Available Current barriers to the use of adeno-associated virus serotype 9 (AAV9 in clinical trials for treating neurological disorders are its high expression in many off-target tissues such as liver and heart, and lack of cell specificity within the central nervous system (CNS when using ubiquitous promoters such as human cytomegalovirus (CMV or chicken-β-actin hybrid (CAG. To enhance targeting the transgene expression in CNS cells, self-complementary (sc AAV9 vectors, scAAV9-GFP vectors carrying neuronal Hb9 and synapsin 1, and nonspecific CMV and CAG promoters were constructed. We demonstrate that synapsin 1 and Hb9 promoters exclusively targeted neurons in vitro, although their strengths were up to 10-fold lower than that of CMV. In vivo analyses of mouse tissue after scAAV9-GFP vector delivery via the cisterna magna revealed a significant advantage of synapsin 1 promoter over both Hb9 variants in targeting neurons throughout the brain, since Hb9 promoters were driving gene expression mainly within the motor-related areas of the brain stem. In summary, this study demonstrates that cisterna magna administration is a safe alternative to intracranial or intracerebroventricular vector delivery route using scAAV9, and introduces a novel utility of the Hb9 promoter for the targeted gene expression for both in vivo and in vitro applications.

Resistance to a bacterial parasite in the crustacean Daphnia magna shows Mendelian segregation with dominance.

Science.gov (United States)

Luijckx, P; Fienberg, H; Duneau, D; Ebert, D

2012-05-01

The influence of host and parasite genetic background on infection outcome is a topic of great interest because of its pertinence to theoretical issues in evolutionary biology. In the present study, we use a classical genetics approach to examine the mode of inheritance of infection outcome in the crustacean Daphnia magna when exposed to the bacterial parasite Pasteuria ramosa. In contrast to previous studies in this system, we use a clone of P. ramosa, not field isolates, which allows for a more definitive interpretation of results. We test parental, F1, F2, backcross and selfed parental clones (total 284 genotypes) for susceptibility against a clone of P. ramosa using two different methods, infection trials and the recently developed attachment test. We find that D. magna clones reliably exhibit either complete resistance or complete susceptibility to P. ramosa clone C1 and that resistance is dominant, and inherited in a pattern consistent with Mendelian segregation of a single-locus with two alleles. The finding of a single host locus controlling susceptibility to P. ramosa suggests that the previously observed genotype-genotype interactions in this system have a simple genetic basis. This has important implications for the outcome of host-parasite co-evolution. Our results add to the growing body of evidence that resistance to parasites in invertebrates is mostly coded by one or few loci with dominance.

Molecular vibration-activity relationship in the agonism of adenosine receptors.

Science.gov (United States)

Chee, Hyun Keun; Oh, S June

2013-12-01

The molecular vibration-activity relationship in the receptor-ligand interaction of adenosine receptors was investigated by structure similarity, molecular vibration, and hierarchical clustering in a dataset of 46 ligands of adenosine receptors. The resulting dendrogram was compared with those of another kind of fingerprint or descriptor. The dendrogram result produced by corralled intensity of molecular vibrational frequency outperformed four other analyses in the current study of adenosine receptor agonism and antagonism. The tree that was produced by clustering analysis of molecular vibration patterns showed its potential for the functional classification of adenosine receptor ligands.

Application of DNA fingerprints for cell-line individualization.

OpenAIRE

Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

1990-01-01

DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

A new method of artificial latent fingerprint creation using artificial sweat and inkjet printer.

Science.gov (United States)

Hong, Sungwook; Hong, Ingi; Han, Aleum; Seo, Jin Yi; Namgung, Juyoung

2015-12-01

In order to study fingerprinting in the field of forensic science, it is very important to have two or more latent fingerprints with identical chemical composition and intensity. However, it is impossible to obtain identical fingerprints, in reality, because fingerprinting comes out slightly differently every time. A previous research study had proposed an artificial fingerprint creation method in which inkjet ink was replaced with amino acids and sodium chloride solution: the components of human sweat. But, this method had some drawbacks: divalent cations were not added while formulating the artificial sweat solution, and diluted solutions were used for creating weakly deposited latent fingerprint. In this study, a method was developed for overcoming the drawbacks of the methods used in the previous study. Several divalent cations were added in this study because the amino acid-ninhydrin (or some of its analogues) complex is known to react with divalent cations to produce a photoluminescent product; and, similarly, the amino acid-1,2-indanedione complex is known to be catalyzed by a small amount of zinc ions to produce a highly photoluminescent product. Also, in this study, a new technique was developed which enables to adjust the intensity when printing the latent fingerprint patterns. In this method, image processing software is used to control the intensity of the master fingerprint patterns, which adjusts the printing intensity of the latent fingerprints. This new method opened the way to produce a more realistic artificial fingerprint in various strengths with one artificial sweat working solution. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

Science.gov (United States)

Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

2007-03-01

Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

Nucleus fingerprinting for the unique identification of Feulgen-stained nuclei

Science.gov (United States)

Friedrich, David; Brozio, Matthias; Bell, André; Biesterfeld, Stefan; Böcking, Alfred; Aach, Til

2012-03-01

DNA Image Cytometry is a method for non-invasive cancer diagnosis which measures the DNA content of Feulgen-stained nuclei. DNA content is measured using a microscope system equipped with a digital camera as a densitometer and estimating the DNA content from the absorption of light when passing through the nuclei. However, a DNA Image Cytometry measurement is only valid if each nucleus is only measured once. To assist the user in preventing multiple measurements of the same nucleus, we have developed a unique digital identifier for the characterization of Feulgen-stained nuclei, the so called Nucleus Fingerprint. Only nuclei with a new fingerprint can be added to the measurement. This fingerprint is based on basic nucleus features, the contour of the nucleus and the spatial relationship to nuclei in the vicinity. Based on this characterization, a classifier for testing two nuclei for identity is presented. In a pairwise comparison of ~40000 pairs of mutually different nuclei, 99.5% were classified as different. In another 450 tests, the fingerprints of the same nucleus recorded a second time were in all cases judged identical. We therefore conclude that our Nucleus Fingerprint approach robustly prevents the repeated measurement of nuclei in DNA Image Cytometry.

The Role of AChE in Swimming Behavior of Daphnia magna: Correlation Analysis of Both Parameters Affected by Deltamethrin and Methomyl Exposure

Directory of Open Access Journals (Sweden)

Qing Ren

2017-01-01

Full Text Available The unpredictable toxicity of insecticides may cause behavior disorder of biological organisms. In order to assess the role of acetylcholinesterase (AChE in swimming behavior of Daphnia magna, a correlation analysis of both parameters in 24 h exposure of deltamethrin (DM and methomyl (MT was investigated. The behavior responses of D. magna in DM (13.36 μg/L and 33.40 μg/L and MT (19.66 μg/L and 49.15 μg/L suggested that recovery behavior in the adjustment phase was crucial, and behavior homeostasis provided them with an optimal way to achieve a wider tolerance against environmental stress. During the experiment, positive effects on AChE activity occurred in the beginning of the exposure. Even though the de novo synthesis of AChE in D. magna might help it recover, the AChE inhibition in different treatments could be observed. Some induction effects on AChE activity at the beginning of exposure occurred, and a 50% decrease may cause toxic effects on behavior. In most treatments, the results showed that both behavior strength and AChE activity stayed in the same field within a correlation circle. These results illustrated that the environmental stress caused by both DM and MT could inhibit AChE activity and subsequently induce a stepwise behavior response, though both pesticides affect it as direct and indirect inhibitors, respectively.

Fingerprint Image Enhancement Based on Second Directional Derivative of the Digital Image

Directory of Open Access Journals (Sweden)

Onnia Vesa

2002-01-01

Full Text Available This paper presents a novel approach of fingerprint image enhancement that relies on detecting the fingerprint ridges as image regions where the second directional derivative of the digital image is positive. A facet model is used in order to approximate the derivatives at each image pixel based on the intensity values of pixels located in a certain neighborhood. We note that the size of this neighborhood has a critical role in achieving accurate enhancement results. Using neighborhoods of various sizes, the proposed algorithm determines several candidate binary representations of the input fingerprint pattern. Subsequently, an output binary ridge-map image is created by selecting image zones, from the available binary image candidates, according to a MAP selection rule. Two public domain collections of fingerprint images are used in order to objectively assess the performance of the proposed fingerprint image enhancement approach.

The FBI wavelet/scalar quantization standard for gray-scale fingerprint image compression

Energy Technology Data Exchange (ETDEWEB)

Bradley, J.N.; Brislawn, C.M. (Los Alamos National Lab., NM (United States)); Hopper, T. (Federal Bureau of Investigation, Washington, DC (United States))

1993-01-01

The FBI has recently adopted a standard for the compression of digitized 8-bit gray-scale fingerprint images. The standard is based on scalar quantization of a 64-subband discrete wavelet transform decomposition of the images, followed by Huffman coding. Novel features of the algorithm include the use of symmetric boundary conditions for transforming finite-length signals and a subband decomposition tailored for fingerprint images scanned at 500 dpi. The standard is intended for use in conjunction with ANSI/NBS-CLS 1-1993, American National Standard Data Format for the Interchange of Fingerprint Information, and the FBI's Integrated Automated Fingerprint Identification System.

[Baking method of Platycladi Cacumen Carbonisatum based on similarity of UPLC fingerprints].

Science.gov (United States)

Shan, Mingqiu; Chen, Chao; Yao, Xiaodong; Ding, Anwei

2010-09-01

To establish a baking method of Platycladi Cacumen Carbonisatum for providing a new idea to Carbonic Herbs' research. Samples were prepared in an oven for different time at different temperatures separately. Then the fingerprints of the samples were determined by UPLC. According to the standard fingerprint, the similarities of the samples' fingerprints were compared. The similarities of 3 samples, which were baked at 230 degrees C for 20 min, 30 min and at 240 degrees C for 20 min, were above 0.96. According to the similarities of the fingerprints and in view of the appearances, Platycladi Cacumen Carbonizing should be baked at 230 degrees C for 20 min.

Fingerprint matching algorithm for poor quality images

Directory of Open Access Journals (Sweden)

Vedpal Singh

2015-04-01

Full Text Available The main aim of this study is to establish an efficient platform for fingerprint matching for low-quality images. Generally, fingerprint matching approaches use the minutiae points for authentication. However, it is not such a reliable authentication method for low-quality images. To overcome this problem, the current study proposes a fingerprint matching methodology based on normalised cross-correlation, which would improve the performance and reduce the miscalculations during authentication. It would decrease the computational complexities. The error rate of the proposed method is 5.4%, which is less than the two-dimensional (2D dynamic programming (DP error rate of 5.6%, while Lee's method produces 5.9% and the combined method has 6.1% error rate. Genuine accept rate at 1% false accept rate is 89.3% but at 0.1% value it is 96.7%, which is higher. The outcome of this study suggests that the proposed methodology has a low error rate with minimum computational effort as compared with existing methods such as Lee's method and 2D DP and the combined method.

Fingerprint Matching by Thin-plate Spline Modelling of Elastic Deformations

NARCIS (Netherlands)

Bazen, A.M.; Gerez, Sabih H.

2003-01-01

This paper presents a novel minutiae matching method that describes elastic distortions in fingerprints by means of a thin-plate spline model, which is estimated using a local and a global matching stage. After registration of the fingerprints according to the estimated model, the number of matching

AIR-MRF: Accelerated iterative reconstruction for magnetic resonance fingerprinting.

Science.gov (United States)

Cline, Christopher C; Chen, Xiao; Mailhe, Boris; Wang, Qiu; Pfeuffer, Josef; Nittka, Mathias; Griswold, Mark A; Speier, Peter; Nadar, Mariappan S

2017-09-01

Existing approaches for reconstruction of multiparametric maps with magnetic resonance fingerprinting (MRF) are currently limited by their estimation accuracy and reconstruction time. We aimed to address these issues with a novel combination of iterative reconstruction, fingerprint compression, additional regularization, and accelerated dictionary search methods. The pipeline described here, accelerated iterative reconstruction for magnetic resonance fingerprinting (AIR-MRF), was evaluated with simulations as well as phantom and in vivo scans. We found that the AIR-MRF pipeline provided reduced parameter estimation errors compared to non-iterative and other iterative methods, particularly at shorter sequence lengths. Accelerated dictionary search methods incorporated into the iterative pipeline reduced the reconstruction time at little cost of quality. Copyright © 2017 Elsevier Inc. All rights reserved.

Arginine kinase in the cladoceran Daphnia magna: cDNA sequencing and expression is associated with resistance to toxic Microcystis.

Science.gov (United States)

Lyu, Kai; Zhang, Lu; Zhu, Xuexia; Cui, Guilian; Wilson, Alan E; Yang, Zhou

2015-03-01

Nutrient loading derived from anthropogenic activities into lakes have increased the frequency, severity and duration of toxic cyanobacterial blooms around the world. Although herbivorous zooplankton are generally considered to be unable to control toxic cyanobacteria, populations of some zooplankton, including Daphnia, have been shown to locally adapt to toxic cyanobacteria and suppress cyanobacterial bloom formation. However, little is known about the physiology of zooplankton behind this phenomenon. One possible explanation is that some zooplankton may induce more tolerance by elevating energy production, thereby adding more energy allocation to detoxification expenditure. It is assumed that arginine kinase (AK) serves as a core in temporal and spatial adenosine triphosphate (ATP) buffering in cells with high fluctuating energy requirements. To test this hypothesis, we studied the energetic response of a single Daphnia magna clone exposed to a toxic strain of Microcystis aeruginosa, PCC7806. Arginine kinase of D. magna (Dm-AK) was successfully cloned. An ATP-gua PtransN domain which was described as a guanidine substrate specificity domain and an ATP-gua Ptrans domain which was responsible for binding ATP were both identified in the Dm-AK. Phylogenetic analysis of AKs in a range of arthropod taxa suggested that Dm-AK was as dissimilar to other crustaceans as it was to insects. Dm-AK transcript level and ATP content in the presence of M. aeruginosa were significantly lower than those in the control diet containing only the nutritious chlorophyte, Scenedesmus obliquus, whereas the two parameters in the neonates whose mothers had been previously exposed to M. aeruginosa were significantly higher than those of mothers fed with pure S. obliquus. These findings suggest that Dm-AK might play an essential role in the coupling of energy production and utilization and the tolerance of D. magna to toxic cyanobacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

Reducing Prosthesis-Patient Mismatch With Edwards Magna Prosthesis for Aortic Valve Replacement.

Science.gov (United States)

Kume, Yuta; Fujita, Tomoyuki; Fukushima, Satsuki; Hata, Hiroki; Shimahara, Yusuke; Matsumoto, Yorihiko; Yamashita, Kizuku; Kobayashi, Junjiro

2017-03-24

Prosthesis-patient mismatch (PPM) is associated with increased mid-term and long-term mortality rates after aortic valve replacement (AVR). This study aimed to evaluate the efficacy of the Carpentier-Edwards Perimount Magna and Magna Ease (CEPMs) aortic bioprostheses to reduce the incidence of PPM.Methods and Results:Altogether, 282 consecutive patients (113 women, mean age 69.9±9.9 years) underwent AVR with a CEPMs between 2008 and 2015. They were divided into 3 groups based on the risk of PPM as a result of their body surface area and aortic annular diameter (BSA/AnnD ratio): low-risk (LR) group: 0.64±0.05 m 2 /cm (n=94); medium-risk (MR) group: 0.73±0.02 m 2 /cm (n=94); high-risk (HR) group: 0.83±0.05 m 2 /cm (n=94). The 30-day mortality rate was 0.4%. The 5-year actuarial survival rates were 93.2%, 92.3%, and 94.8% for groups LR, MR, and HR, respectively. No explants as a result of structural valve deterioration occurred. No patients showed severe PPM, defined as a measured effective orifice area index (EOAI) <0.65 cm 2 /m 2 . Although there were significant (P<0.05) differences in EOAI (0.98±0.2, 0.90±0.21, and 0.88±0.1 cm 2 /m 2 among the LR, MR, and HR groups, respectively), the corresponding transvalvular mean pressure gradients (13.0±5.5, 12.3±4.0, 12.7±5.3 mmHg) and regression rates of the left ventricular mass (29.8%, 28.7%, 28.9%) were similar among groups. CEPMs provide low surgical risk and reduce the risks of PPM, even in HR patients, with excellent hemodynamics.

DNA fingerprinting of sugarcane for detecting molecular evidence of somaclonal variation

International Nuclear Information System (INIS)

Ramos Leal, M.; Canales, E.; Michel, R.; Coto, O.; Cornide, M.T.

1998-01-01

Molecular characterisation of eight sugarcane mutants which tolerate 1% NaCl, was performed by means of restriction fragment length polymorphism (RFLP) analysis at the genomic level, using a group of molecular probes for ribosomal DNAs and two others, Δ-pyrroline-5-carboxylate reductase (ΔP5CR) and ATPase, probably related to salinity stress tolerance. Results showed the molecular evidence of genetic changes in comparison to the susceptible donor variety and the possible presence of more that one mechanism to tolerate salt stress. (author)

Multi-ingredients determination and fingerprint analysis of leaves from Ilex latifolia using ultra-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry.

Science.gov (United States)

Fan, Chunlin; Deng, Jiewei; Yang, Yunyun; Liu, Junshan; Wang, Ying; Zhang, Xiaoqi; Fai, Kuokchiu; Zhang, Qingwen; Ye, Wencai

2013-10-01

An ultra-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UPLC-QTOF-MS) method integrating multi-ingredients determination and fingerprint analysis has been established for quality assessment and control of leaves from Ilex latifolia. The method possesses the advantages of speediness, efficiency, accuracy, and allows the multi-ingredients determination and fingerprint analysis in one chromatographic run within 13min. Multi-ingredients determination was performed based on the extracted ion chromatograms of the exact pseudo-molecular ions (with a 0.01Da window), and fingerprint analysis was performed based on the base peak chromatograms, obtained by negative-ion electrospray ionization QTOF-MS. The method validation results demonstrated our developed method possessing desirable specificity, linearity, precision and accuracy. The method was utilized to analyze 22 I. latifolia samples from different origins. The quality assessment was achieved by using both similarity analysis (SA) and principal component analysis (PCA), and the results from SA were consistent with those from PCA. Our experimental results demonstrate that the strategy integrated multi-ingredients determination and fingerprint analysis using UPLC-QTOF-MS technique is a useful approach for rapid pharmaceutical analysis, with promising prospects for the differentiation of origin, the determination of authenticity, and the overall quality assessment of herbal medicines. Copyright © 2013 Elsevier B.V. All rights reserved.

Binary similarity measures for fingerprint analysis of qualitative metabolomic profiles.

Science.gov (United States)

Rácz, Anita; Andrić, Filip; Bajusz, Dávid; Héberger, Károly

2018-01-01

Contemporary metabolomic fingerprinting is based on multiple spectrometric and chromatographic signals, used either alone or combined with structural and chemical information of metabolic markers at the qualitative and semiquantitative level. However, signal shifting, convolution, and matrix effects may compromise metabolomic patterns. Recent increase in the use of qualitative metabolomic data, described by the presence (1) or absence (0) of particular metabolites, demonstrates great potential in the field of metabolomic profiling and fingerprint analysis. The aim of this study is a comprehensive evaluation of binary similarity measures for the elucidation of patterns among samples of different botanical origin and various metabolomic profiles. Nine qualitative metabolomic data sets covering a wide range of natural products and metabolomic profiles were applied to assess 44 binary similarity measures for the fingerprinting of plant extracts and natural products. The measures were analyzed by the novel sum of ranking differences method (SRD), searching for the most promising candidates. Baroni-Urbani-Buser (BUB) and Hawkins-Dotson (HD) similarity coefficients were selected as the best measures by SRD and analysis of variance (ANOVA), while Dice (Di1), Yule, Russel-Rao, and Consonni-Todeschini 3 ranked the worst. ANOVA revealed that concordantly and intermediately symmetric similarity coefficients are better candidates for metabolomic fingerprinting than the asymmetric and correlation based ones. The fingerprint analysis based on the BUB and HD coefficients and qualitative metabolomic data performed equally well as the quantitative metabolomic profile analysis. Fingerprint analysis based on the qualitative metabolomic profiles and binary similarity measures proved to be a reliable way in finding the same/similar patterns in metabolomic data as that extracted from quantitative data.

Fingerprint-based structure retrieval using electron density.

Science.gov (United States)

Yin, Shuangye; Dokholyan, Nikolay V

2011-03-01

We present a computational approach that can quickly search a large protein structural database to identify structures that fit a given electron density, such as determined by cryo-electron microscopy. We use geometric invariants (fingerprints) constructed using 3D Zernike moments to describe the electron density, and reduce the problem of fitting of the structure to the electron density to simple fingerprint comparison. Using this approach, we are able to screen the entire Protein Data Bank and identify structures that fit two experimental electron densities determined by cryo-electron microscopy. Copyright © 2010 Wiley-Liss, Inc.

Fingerprint extraction from interference destruction terahertz spectrum.

Science.gov (United States)

Xiong, Wei; Shen, Jingling

2010-10-11

In this paper, periodic peaks in a terahertz absorption spectrum are confirmed to be induced from interference effects. Theoretically, we explained the periodic peaks and calculated the locations of them. Accordingly, a technique was suggested, with which the interference peaks in a terahertz spectrum can be eliminated and therefore a real terahertz absorption spectrum can be obtained. Experimentally, a sample, Methamphetamine, was investigated and its terahertz fingerprint was successfully extracted from its interference destruction spectrum. This technique is useful in getting samples' terahertz fingerprint spectra, and furthermore provides a fast nondestructive testing method using a large size terahertz beam to identify materials.