WorldWideScience

Sample records for mac conkey agar

  1. Sterilization of MacConkey agar and CLED medium by gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Eisenberg, E; Altmann, G

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.

  2. Sterilization of MacConkey agar and CLED medium by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.

  3. A modified MacConkey agar for selective enumeration of necrotoxigenic E. coli O55 and probiotic E. coli Nissle 1917

    Czech Academy of Sciences Publication Activity Database

    Šplíchalová, Alla; Šplíchal, Igor; Sonnenborn, U.; Rada, V.

    2014-01-01

    Roč. 103, SEP 2014 (2014), s. 82-86 ISSN 0167-7012 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : MacConkey agar * E. coil O55 * NTEC Subject RIV: CE - Biochemistry Impact factor: 2.026, year: 2014

  4. Evaluation of Standard and Modified M-FC, MacConkey, and Teepol Media for Membrane Filtration Counting of Fecal Coliforms in Water

    OpenAIRE

    Grabow, W. O. K.; Hilner, C. A.; Coubrough, P.

    1981-01-01

    MacConkey agar, standard M-FC agar, M-FC agar without rosolic acid, M-FC agar with a resuscitation top layer, Teepol agar, and pads saturated with Teepol broth, were evaluated as growth media for membrane filtration counting of fecal coliform bacteria in water. In comparative tests on 312 samples of water from a wide variety of sources, including chlorinated effluents, M-FC agar without rosolic acid proved the medium of choice because it generally yielded the highest counts, was readily obtai...

  5. Evaluation of standard and modified M-FC, MacConkey, and Teepol media for membrane filtration counting of fecal coliforms in water.

    Science.gov (United States)

    Grabow, W O; Hilner, C A; Coubrough, P

    1981-08-01

    MacConkey agar, standard M-FC agar, M-FC agar without rosolic acid, M-FC agar with a resuscitation top layer, Teepol agar, and pads saturated with Teepol broth, were evaluated as growth media for membrane filtration counting of fecal coliform bacteria in water. In comparative tests on 312 samples of water from a wide variety of sources, including chlorinated effluents, M-FC agar without rosolic acid proved the medium of choice because it generally yielded the highest counts, was readily obtainable, easy to prepare and handle, and yielded clearly recognizable fecal coliform colonies. Identification of 1,139 fecal coliform isolates showed that fecal coliform tests cannot be used to enumerate Escherichia coli because the incidence of E. coli among fecal coliforms varied from an average of 51% for river water to 93% for an activated sludge effluent after chlorination. The incidence of Klebsiella pneumoniae among fecal coliforms varied from an average of 4% for the activated sludge effluent after chlorination to 32% for the river water. The advantages of a standard membrane filtration procedure for routine counting of fecal coliforms in water using M-FC agar without rosolic acid as growth medium, in the absence of preincubation or resuscitation steps, are outlined.

  6. Mac Bible

    CERN Document Server

    Spivey, Dwight

    2009-01-01

    This essential guide answers all your questions on using a Macintosh computer, whether you?re unpacking your very first Mac after switching from a PC or upgrading from an older Mac. You?ll walk through all pre-installed Mac applications, including using Mac OS X, browsing the Web using Safari, downloading music from the iTunes store, troubleshooting Mac-specific problems, organizing photos in iPhoto, organizing calendars in iCal, editing digital video in iMovie, and more.

  7. Role of pH in oxidase variability of Aeromonas hydrophila.

    OpenAIRE

    Hunt, L K; Overman, T L; Otero, R B

    1981-01-01

    Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...

  8. Incidence of bacteraemia following teeth extraction at the dental ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-16

    May 16, 2008 ... genital or acquired heart disease, or those fitted with a valvular prosthesis ... ments published reports on the prevalence, aetiologic agents and risk ... cultured onto plates of blood agar, chocolate agar and MacConkey agar.

  9. Windows for Intel Macs

    CERN Document Server

    Ogasawara, Todd

    2008-01-01

    Even the most devoted Mac OS X user may need to use Windows XP, or may just be curious about XP and its applications. This Short Cut is a concise guide for OS X users who need to quickly get comfortable and become productive with Windows XP basics on their Macs. It covers: Security Networking ApplicationsMac users can easily install and use Windows thanks to Boot Camp and Parallels Desktop for Mac. Boot Camp lets an Intel-based Mac install and boot Windows XP on its own hard drive partition. Parallels Desktop for Mac uses virtualization technology to run Windows XP (or other operating systems

  10. Macs for dummies

    CERN Document Server

    Baig, Edward C

    2014-01-01

    Get the most out of your Mac with this comprehensive guide Macs For Dummies, 13th Edition is the ultimate guide to your Mac, fully updated to include information about the latest updates. The book walks you through troubleshooting, syncing mobile devices, integrating Windows, and more, so you can take advantage of everything Macs have to offer. Whether you're a new user, a recent convert, or you just want to get the most out of your Mac, this book puts all the information you need in one place. Discover what makes Macs superior computing machines. Learn the basics, from mastering the Dock and

  11. Isolation and molecular identification of a Serratia strain from ...

    African Journals Online (AJOL)

    ONOS

    2010-04-05

    Apr 5, 2010 ... family Tupaiidae, mainly found in Southern China, India and Southeast Asia. The 17 known species of tree shrews ... for pathogenic coccus cultivation and nutrient agar culture dish and. MacConkey agar for pathogenic rod ...

  12. Mycobacterium Avium Complex (MAC)

    Science.gov (United States)

    ... sweat, and saliva red-orange (may stain contact lenses); can interfere with birth control pills. Many drug interactions. CAN MAC BE PREVENTED? The bacteria that cause MAC are very common. It is ...

  13. Mac OS X Forensics

    Science.gov (United States)

    Craiger, Philip; Burke, Paul

    This paper describes procedures for conducting forensic examinations of Apple Macs running Mac OS X. The target disk mode is used to create a forensic duplicate of a Mac hard drive and preview it. Procedures are discussed for recovering evidence from allocated space, unallocated space, slack space and virtual memory. Furthermore, procedures are described for recovering trace evidence from Mac OS X default email, web browser and instant messaging applications, as well as evidence pertaining to commands executed from a terminal.

  14. Enterprise Mac administrators guide

    CERN Document Server

    Smith, William

    2015-01-01

    IT departments everywhere will be integrating Macs and Mac OS X into their IT infrastructure and this book will tell them how to do it. It will serve as an authoritative, useful and frequently referenced book on Mac OS X administration.

  15. Enterprise Mac Administrator's Guide

    CERN Document Server

    Edge, Charles; Hunter, Beau

    2009-01-01

    Charles Edge, Zack Smith, and Beau Hunter provide detailed explanations of the technology required for large-scale Mac OS X deployments and show you how to integrate it with other operating systems and applications. Enterprise Mac Administrator's Guide addresses the growing size and spread of Mac OS X deployments in corporations and institutions worldwide. In some cases, this is due to the growth of traditional Mac environments, but for the most part it has to do with "switcher" campaigns, where Windows and/or Linux environments are migrating to Mac OS X. However, there is a steep cu

  16. Mac Security Bible

    CERN Document Server

    Kissell, Joe

    2010-01-01

    Your essential, no-holds-barred guide to Mac security threats and solutions. Myth number one: Macs are safer than PCs. Not really, says author Joe Kissell, named one of MacTech's "25 Most Influential People" in the Mac community for 2008. In this timely guide, he not only takes you beyond the myths, he also delves into the nitty-gritty of each potential threat, helping you weigh the pros and cons of the solutions you might choose. Learn to measure risk versus inconvenience, make informed decisions, and protect your Mac computers, your privacy, and your data with this essential guide.

  17. Mac at Work

    CERN Document Server

    Sparks, David

    2011-01-01

    Bridge the gap between using a Mac at home and at the office. Now that you love your Mac at home, you want to use one at the office without missing a beat of productivity or professionalism. This unique guide shows you how.  You'll find best Mac business practices for handling word processing, spreadsheet and presentation creation, task and project management, and graphics. The book also explores topics such as hardware maintenance, how to synchronize with multiple computers, data backup, and communication with Windows networks.: Covers the nuts and bolts of using a Mac at work, including sync

  18. Enterprise Mac Security Mac OS X Snow Leopard Security

    CERN Document Server

    Edge, Stephen Charles; Hunter, Beau; Sullivan, Gene; LeBlanc, Dee-Ann

    2010-01-01

    A common misconception in the Mac community is that Mac's operating system is more secure than others. While this might be true in certain cases, security on the Mac is still a crucial issue. When sharing is enabled or remote control applications are installed, Mac OS X faces a variety of security threats. Enterprise Mac Security: Mac OS X Snow Leopard is a definitive, expert-driven update of the popular, slash-dotted first edition and was written in part as a companion to the SANS Institute course for Mac OS X. It contains detailed Mac OS X security information, and walkthroughs on securing s

  19. Inoculation Expedition of Agar wood

    International Nuclear Information System (INIS)

    Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

    2015-01-01

    Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

  20. Enterprise Mac Managed Preferences

    CERN Document Server

    Marczak, Edward

    2010-01-01

    Many systems administrators on the Mac need a way to manage machine configuration after initial setup and deployment. Apple's Managed Preferences system (also known as MCX) is under-documented, often misunderstood, and sometimes outright unknown by sys admins. MCX is usually deployed in conjunction with an OS X server, but it can also be used in Windows environments or where no dedicated server exists at all. Enterprise Mac Managed Preferences is the definitive guide to Apple's Managed Client technology. With this book, you'll get the following: * An example-driven guide to Mac OS X Managed Pr

  1. Asymptomatic Vaginal Disease In Pregnancy

    African Journals Online (AJOL)

    1974-04-17

    Apr 17, 1974 ... Eight patients (1,4%) had asymptomatic gonorrhoea. Clinical features ... MacConkey's agar (for identification of Escherichia coli,. Proteus and other .... Another interesting observation was the error in the clinical diagnosis of ...

  2. Short Communication

    African Journals Online (AJOL)

    pond was drained and left empty for two weeks to dry and then lime was added .... using inoculating wire loop and cultured on Blood and MacConkey agar and ... and temperate zones causing Ichthyophthiriasis or 'white spot disease' (Scholz,.

  3. MAC calorimeters and applications

    International Nuclear Information System (INIS)

    MAC Collaboration.

    1982-03-01

    The MAC detector at PEP features a large solid-angle electromagnetic/hadronic calorimeter system, augmented by magnetic charged-particle tracking, muon analysis and scintillator triggering. Its implementation in the context of electron-positron annihilation physics is described, with emphasis on the utilization of calorimetry

  4. Florence Jessie Mac Williams

    Indian Academy of Sciences (India)

    CPMGIKAlBGE-340/2003-05. Resonance - January 2005. Licenced to post WPP No.6 RT Nagar Postoffice. Florence Jessie Mac Williams. (1917 - 1990). Registered with Registrar of Newspapers in India vide Regn. No. 66273/96. ISSN 0971-8044. Price per copy: Rs 40.

  5. Microbial handflora of nursing services workers in a Nigerian ...

    African Journals Online (AJOL)

    The samples were inoculated onto dried Blood agar, MacConkey agar, Mannitol salt agar and Muellar-Hinton agar plates and incubated aerobically at 37°C for 18-24 hours. Overall, 38% of the cultures yielded growth, while 52% of the nurses yielded growth as against 75% of the ward-maids. The bacterial isolates are ...

  6. iMac pocket genius

    CERN Document Server

    Hart-Davis, Guy

    2010-01-01

    If you want to get the very most out of your iMac, put this savvy Portable Genius guide to work. Want to make the most of the new Magic Mouse and the latest iLife apps? Set up a wireless network using your iMac's AirPort card? Watch television on your iMac, or show iMac videos and movies on your television? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you time and let you enjoy your iMac to the max.

  7. MacBook for dummies

    CERN Document Server

    Chambers , Mark L

    2014-01-01

    Make friends with your MacBook the fun and easy way! Ultra-light, ultra-fast, and ultra-powerful, the MacBook is the coolest laptop in town, and longtime Mac guru Mark L. Chambers is just the guy to help you get to know your MacBook in no time. Take a closer look at the latest features, get the lowdown on OS X, unleash your creative forces with iLife, take care of business with the iWork applications, and sync it all with iCloud with the expert advice in this bestselling MacBook guide. Whether this is your first MacBook or your first laptop, period, you''ll learn to navigate the Mac desktop, c

  8. Macs For Dummies, Pocket Edition

    CERN Document Server

    Baig, Edward C

    2011-01-01

    The fun and easy way to make the most of your wonderful Mac. Simply Mac-nificent — all the cool things your Mac can do! This handy guide helps you figure out the nuts and bolts of your Mac. Navigate the Mac desktop, use the Safari Web browser to surf the Internet, e-mail photos to friends and family, create and print documents, rip audio CDs, and more. The fun begins right here!. Open the book and find: How to set up and configure your Mac; Tips for getting around on the Mac desktop; Steps for setting up an e-mail account and browsing the Internet; Details about the free programs that come wit

  9. iMac portable genius

    CERN Document Server

    Hart-Davis, Guy

    2010-01-01

    The most up-to-date coverage on the latest iMac advice, tools, and shortcuts Cool and useful tips, full-color screenshots, and savvy advice show you how to get the most out of your iMac. Fully updated to cover the iMac's latest features and capabilities, this guide is packed with indispensible information on iLife '09 and Mac OS X Snow Leopard, and shows you how to customize your iMac in a way that it will work best for you.Explores all the bells and whistles of the iMac, including the new Magic Mouse, iLife apps such as iPhoto and iMovie, and Mac OS X Snow LeopardShows yo

  10. iMac for dummies

    CERN Document Server

    Chambers, Mark L

    2014-01-01

    Do it all with your iMac and this bestselling For Dummies guide! You're still a little giddy from finally scoring your new iMac, and you can't wait to get started. Even if you're already in love with your iMac, it helps to have a little guidance to really get the most out of this ultimate all-in-one computer. This updated edition of iMac For Dummies is the ideal way to learn the iMac fundamentals from setting up and personalizing your machine to importing files, making FaceTime video calls, surfing the web, using your favorite programs and apps, and everything in between. Trusted Mac guru Mark

  11. Learn Excel 2011 for Mac

    CERN Document Server

    Hart-Davis, Guy

    2011-01-01

    Microsoft Excel 2011 for Mac OS X is a powerful application, but many of its most impressive features can be difficult to find. Learn Excel 2011 for Mac by Guy Hart-Davis is a practical, hands-on approach to learning all of the details of Excel 2011 in order to get work done efficiently on Mac OS X. From using formulas and functions to creating databases, from analyzing data to automating tasks, you'll learn everything you need to know to put this powerful application to use for a variety of tasks. What you'll learn * The secrets of the Excel for Mac interface! * How to create effective workbo

  12. Mac Leod's syndrome

    International Nuclear Information System (INIS)

    Schad, M.; Danesi, C.; Ricci, R.; Galluzzi, S.; Coviello, G.

    1988-01-01

    Mac Leod's syndrome is a rarely diagnosed disease; that is why an accurate differential diagnosis is needed by means of radiological imaging. This paper is aimed at discussing the differential diagnosis, with a special emphasis on the pathogenesis of the syndrome. The phenomenon of air trapping in absence of central bronchial lesions is a typical radiographic finding. Chest X-ray is performed in both inspiration and expiration. Posterior oblique tomography at 55 grade centigrade of the effected side is also performed. Diffuse bronchiolitis obliterans in infancy or early childhood ia widely accepted pathogenetic pattern. Pulmonary hypoventilation causes vasoconstriction and underdevelopment of pulmonary vessels, that are reduced in caliber. Differential diagnosis includes all the diseases resulting in pulmonary hyperlucency, i.e. pulmonary and pleural alterations, and skeletal anomalies

  13. Windowsista Mac-maailmaan

    OpenAIRE

    Sirkiä, Noora-Maria

    2010-01-01

    Nykyään yhä useampi harkitsee erilaisista syistä käyttöjärjestelmän vaihtamista tutusta Windowsista johonkin muuhun käyttöjärjestelmään. Applen Macintosh-tietokoneiden mukana tuleva Mac OS X -käyttöjärjestelmä on hyvä vaihtoehto Windowsille. Ihmiset siirtyvät siihen mm. tietoturvaseikkojen, luotettavuuden, ohjelmiston sekä Applen koneiden ja käyttöjärjestelmän ulkomuodon takia. Microsoftin tuotteista ei myöskään tarvitse luopua kokonaan, sillä monista tutuista Microsoftin ohjelmista (esim. Mi...

  14. Bacteriology of the Anterior Genitalia of the Domestic House Cat ...

    African Journals Online (AJOL)

    The bacteriology of the anterior genitalia of the domestic house cat was determined using vaginal swabs collected from sixty apparently healthy female domestic cats (20 kittens, 20 pregnant and 20 non-pregnant adults). The swabs were streaked on blood agar, Mac Conkey agar and eosin methylene blue agar plates ...

  15. Bacteriology of chronic discharging ears in Port Harcourt, Nigeria ...

    African Journals Online (AJOL)

    Methods: Ear swabs of discharging ears aseptically collected from 102 patients of various age groups attending Ear, Nose, and Throat out-patient clinic at University of Port Harcourt Teaching Hospital were cultured for bacterial agents using blood agar, chocolate agar and MacConkey agar. Culture plates were incubated ...

  16. iMac for dummies

    CERN Document Server

    Chambers, Mark L

    2012-01-01

    The bestselling guide to the ultimate all-in-one computer—now updated and revised throughout! If you're looking for speed, performance, and power, the iMac is the ultimate all-in-one computer. From its superior performance, powerful operating system, and amazing applications, the iMac is one awesome machine, and the fun, friendly, and approachable style of iMac For Dummies is an ideal way to get started with the basics. You'll learn the fundamentals of the iMac including setting up and customizing your iMac and the software that comes with it, importing files from your old computer, send

  17. Gotcha! Macs lose their innocence

    CERN Multimedia

    Computer Security Team

    2012-01-01

    Still believe your Mac is secure because Microsoft PCs fall prey to viruses and worms but Macs don’t? Time to wake up! This year has seen the first major compromise of Macs worldwide*. How is yours doing?   The “Flashback” Trojan is affecting Apple’s own variant of Java and compromises Macs via so-called drive-by infections, i.e. when you visit an appropriately prepared (infected!) website - and this might not necessarily be a site with questionable contents, but could well be a popular, reputable one. Security Companies worldwide have been monitoring this particular Trojan for a while and have estimated that more than half a million Macs were compromised. Connected to a few central command and control servers, the compromised Macs were then supporting the malicious activity of the bad guys! Fortunately, the security companies have now been able to take over those command and control servers and stop their destructive drive. So, Mac users, face the f...

  18. Java and Mac OS X

    CERN Document Server

    Davis, T Gene

    2010-01-01

    Learn the guidelines of integrating Java with native Mac OS X applications with this Devloper Reference book. Java is used to create nearly every type of application that exists and is one of the most required skills of employers seeking computer programmers. Java code and its libraries can be integrated with Mac OS X features, and this book shows you how to do just that. You'll learn to write Java programs on OS X and you'll even discover how to integrate them with the Cocoa APIs.: Shows how Java programs can be integrated with any Mac OS X feature, such as NSView widgets or screen savers; Re

  19. Morphological identification of Candida species on glucose agar, rice extract agar and corn meal agar with and without Tween-80.

    Science.gov (United States)

    Joshi, K R; Solanki, A; Prakash, P

    1993-01-01

    A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.

  20. Mac Programming for Absolute Beginners

    CERN Document Server

    Wang, Wallace

    2011-01-01

    Want to learn how to program on your Mac? Not sure where to begin? Best-selling author Wallace Wang will explain how to get started with Cocoa, Objective-C, and Xcode. Whether you are an experienced Windows coder moving to the Mac, or you are completely new to programming, you'll see how the basic design of a Mac OS X program works, how Objective-C differs from other languages you may have used, and how to use the Xcode development environment. Most importantly, you'll learn how to use elements of the Cocoa framework to create windows, store data, and respond to users in your own Mac programs.

  1. Alistair William MacDonald.

    Science.gov (United States)

    Callegari, Angus

    2018-01-06

    A devoted family man and churchgoer, Alistair MacDonald was a meticulous vet with a great sense of humour. Having served in the RAF during the Second World War, he had plenty of stories to tell. British Veterinary Association.

  2. Fiverr MacGyver

    Science.gov (United States)

    Hut, Rolf; van de Giesen, Nick; Larson, Martha

    2014-05-01

    Crowdsourcing has become popular over the past years, also for scientific endeavors. There are many Citizen Science projects and crowdfunding platforms, such as Kickstarter, that are make helpful contributions to moving environmental science forward. An interesting underused source of useful crowd-derived contributions to research is the website Fiverr.com. On this platform, thousands of people, acting as small-scale freelance contractors, offer their skills in the form of services. The platform offers a chance for people to take a hobby, skill, or pastime and make it something more by reaching out to a wider audience and by receiving a payment in return for services. As is typical of other crowdsourcing platforms, the tasks are small and usually self contained. As the name Fiverr suggests, offers start at US5 to provide a particular service. Services offered range from graphic design, to messages sung or spoken with various styles or accents, to complete apps for Android or iPhone. Skill providers on the platform can accept a range of variation of definition in the tasks, some can be described in general terms, for others it is more appropriate to provide examples. Fiverr provides a central location for those offering skills and those needing services to find each other, it makes it possible to communicate and exchange files, to make payments, and it provides support for resolving disputes. In all cases, it is important to keep expectations aligned with the nature of the platform: quality can and will vary. Ultimately, the critical contribution of Fiverr is not to replace professional services or otherwise save money, but rather to provide access to a large group of people with specialized skills who are able to make a contribution on short notice. In the context of this session, it can be considered a pool of people with MacGyver skills lying in wait of a MacGyyer task to attack. There are many ways in which Fiverr tasks, which are called 'gigs', can be useful in

  3. MacBook Teach Yourself VISUALLY

    CERN Document Server

    Miser, Brad

    2010-01-01

    Like the MacBook itself, Teach Yourself VISUALLY MacBook, Second Edition is designed to be visually appealing, while providing excellent functionality at the same time. By using this book, MacBook users will be empowered to do everyday tasks quickly and easily. From such basic steps as powering on or shutting down the MacBook, working on the Mac desktop with the Dashboard and its widgets to running Windows applications, Teach Yourself VISUALLY MacBook, Second Edition covers all the vital information and provides the help and support a reader needs—in many ways it's like having a Mac Genius at

  4. Mac OS X ja tietoturva

    OpenAIRE

    Herranen, Joni

    2011-01-01

    Tämän opinnäytetyön tavoitteena on luoda kattava kokonaiskuva Mac OS X -käyttöjärjestelmän sisäänrakennetuista tietoturvaratkaisuista ja selvittää miten tietoturvaratkaisut toteuttavat tietoturvan kolmea perustavoitetta eli luottamuksellisuutta, eheyttä ja saatavuutta. Työn kohderyhmäksi on valittu edistyneemmät tietokoneenkäyttäjät, joilla ei ole aikaisempaa Mac-kokemusta. Teoriaosuudessa syvennytään aluksi Apple-yhtiöön sekä Mac OS X -järjestelmän teknisiin ominaisuuksiin. Osuuden pääta...

  5. I-MAC: an incorporation MAC for wireless sensor networks

    Science.gov (United States)

    Zhao, Jumin; Li, Yikun; Li, Dengao; Lin, Xiaojie

    2017-11-01

    This paper proposes an innovative MAC protocol called I-MAC. Protocol for wireless sensor networks, which combines the advantages of collision tolerance and collision cancellation. The protocol increases the number of antenna in wireless sensor nodes. The purpose is to monitor the occurrence of packet collisions by increasing the number of antenna in real time. The built-in identity structure is used in the frame structure in order to help the sending node to identify the location of the receiving node after a data packet collision is detected. Packets can be recovered from where the conflict occurred. In this way, we can monitor the conflict for a fixed period of time. It can improve the channel utilisation through changing the transmission probability of collision nodes and solve the problem of hidden terminal through collision feedback mechanism. We have evaluated our protocol. Our results show that the throughput of I-MAC is 5 percentage points higher than that of carrier sense multiple access/collision notification. The network utilisation of I-MAC is more than 92%.

  6. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    Energy Technology Data Exchange (ETDEWEB)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at

    2016-09-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  7. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    International Nuclear Information System (INIS)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo

    2016-01-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  8. Menu Proposal to Use Powdered Agar

    OpenAIRE

    土屋, ひろ子; 嶋村, 桃子; 小松, 沙霧

    2015-01-01

    The author was involved in the development of the menu items that might be sold at “Taisho Village”, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...

  9. Mr MacDonald's suitcase

    DEFF Research Database (Denmark)

    2017-01-01

    Undervisningsforløbet Mr. MacDonald’s suitcase beskriver læringsmålstyret undervisning i faget engelsk i 1. klasse, hvor der arbejdes med kompetenceområdet mundtlig kommunikation. Undervisningsforløbet er bygget op omkring en engelsk tøjdukke, der besøger klassen og fortæller små historier...

  10. Agar from some Hawaiian red algae

    Energy Technology Data Exchange (ETDEWEB)

    Santos, G.A.; Doty, M.S.

    1983-08-01

    From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).

  11. Evaluation for sterility of four crystalloid solutions used in ...

    African Journals Online (AJOL)

    Pre and post preservation, a loop-full of each solution was cultured on freshly prepared two general purpose media (Blood and nutrient agar) and one selective medium (MacConkey agar). They were incubated at 37 0C for 48 hours after which they were examined for bacterial growth. Histological studies of the preserved ...

  12. A fatal pulmonary infection by Nocardia brasiliensis.

    Science.gov (United States)

    Wadhwa, V; Rai, S; Kharbanda, P; Kabra, S; Gur, R; Sharma, V K

    2006-01-01

    The reported case is of primary pulmonary nocardiosis, caused by Nocardia brasiliensis, in a immunocompromised patient, which ended fatally despite appropriate treatment. The partially acid fast filamentous bacterium was predominant on direct examination of the sputum. It was cultured on blood agar, MacConkey agar and by paraffin baiting technique. The bacterium was resistant to cotrimoxazole, the drug of choice for nocardiosis.

  13. Olaitan and Muhammad (12)

    African Journals Online (AJOL)

    DELL

    various selective media such as MacConkey agar, mannitol salt agar .... Yemen. Journal of Pharmacy and. Pharmacognosy Research.3(1), 6 – 12. Amira, E. E., Abdel, M. E. S. ... of Natural and Social Sciences.2: 54 – 59. Ferreria, A. C., Morais ...

  14. Felege Hiwot Referral Hospital, North West

    African Journals Online (AJOL)

    Rapid spread of resistant microbes affected the effectiveness of antimicrobials creating worldwide problem (1). The condition is serious in developing countries owing to irrational prescription ... Standard operation procedures were checked for laboratory ... Sheep's blood, chocolate agar, mannitol salt agar and. MacConkey ...

  15. Original Article

    African Journals Online (AJOL)

    2013-06-22

    Jun 22, 2013 ... onto blood, MacConkey, and Mannitol salt agar plates and incubated for 18-24 hrs at ... standard 0.5 and spread over the surface of. Mueller-Hinton agar. Antibiotic .... Table 3. Comparison of infection rate in emergency and elective Caesarean Operation in patients at MMSH, Kano. X2 = 8.1 df = 1 p<0.004.

  16. Mastitis pathogens prevalent in dairy cattle at Magadu farm ...

    African Journals Online (AJOL)

    This study was carried out to determine the prevalence of mastitis pathogens at the Magadu Dairy Farm, Sokoine University of Agriculture. A total of 19 milk samples were collected and cultured on blood agar and MacConkey agar followed by identification of bacteria colonies and cells using standard laboratory techniques.

  17. Morphological development of Morchella conica mycelium on different agar media.

    Science.gov (United States)

    Guler, P; Ozkaya, E G

    2009-07-01

    The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.

  18. Identification of Cryptococcus neoformans isolates using Staib agar without creatinine

    OpenAIRE

    Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia

    2005-01-01

    In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...

  19. Mac OS X Lion Server For Dummies

    CERN Document Server

    Rizzo, John

    2011-01-01

    The perfect guide to help administrators set up Apple's Mac OS X Lion Server With the overwhelming popularity of the iPhone and iPad, more Macs are appearing in corporate settings. The newest version of Mac Server is the ideal way to administer a Mac network. This friendly guide explains to both Windows and Mac administrators how to set up and configure the server, including services such as iCal Server, Podcast Producer, Wiki Server, Spotlight Server, iChat Server, File Sharing, Mail Services, and support for iPhone and iPad. It explains how to secure, administer, and troubleshoot the networ

  20. Switching to the Mac The Missing Manual

    CERN Document Server

    Pogue, David

    2010-01-01

    Is Windows giving you pause? Ready to make the leap to the Mac instead? There has never been a better time to switch from Windows to Mac, and this incomparable guide will help you make a smooth transition. New York Times columnist and Missing Manuals creator David Pogue gets you past three challenges: transferring your stuff, assembling Mac programs so you can do what you did with Windows, and learning your way around Mac OS X. Learning to use a Mac is not a piece of cake, but once you do, the rewards are oh-so-much better. No viruses, worms, or spyware. No questionable firewalls, inefficien

  1. Switching to a Mac For Dummies

    CERN Document Server

    Reinhold, Arnold

    2007-01-01

    Thinking of making the switch from your PC to a Mac? Congratulations! You're in for a great, virus-free ride. And Switching to Mac For Dummies makes it smoother than you ever imagined. From buying the Mac that's right for you to transferring your files to breaking your old Windows habits and learning to do things the (much easier) Mac way, it makes the whole process practically effortless. Whether you've been using Windows XP, Vista, or even Linux, you'll find simple, straightforward ways to make your transition go smoothly. That will leave you plenty of time to get familiar with Mac'

  2. Cognitive MAC designs for OSA networks

    CERN Document Server

    Derakhshani, Mahsa

    2014-01-01

    This SpringerBrief presents recent advances in the cognitive MAC designs for opportunistic spectrum access (OSA) networks. It covers the basic MAC functionalities and MAC enhancements of IEEE 802.11. Later chapters discuss the existing MAC protocols for OSA and classify them based on characteristic features. The authors provide new research in adaptive carrier sensing-based MAC designs tailored for OSA, which optimize spectrum utilization and ensure a peaceful coexistence of licensed and unlicensed systems. Analytically devised via optimization and game-theoretic approaches, these adaptive M

  3. Mac OS X for Astronomy

    Science.gov (United States)

    Pierfederici, F.; Pirzkal, N.; Hook, R. N.

    Mac OS X is the new Unix based version of the Macintosh operating system. It combines a high performance DisplayPDF user interface with a standard BSD UNIX subsystem and provides users with simultaneous access to a broad range of applications which were not previously available on a single system such as Microsoft Office and Adobe Photoshop, as well as legacy X11-based scientific tools and packages like IRAF, SuperMongo, MIDAS, etc. The combination of a modern GUI layered on top of a familiar UNIX environment paves the way for new, more flexible and powerful astronomical tools to be developed while assuring compatibility with already existing, older programs. In this paper, we outline the strengths of the Mac OS X platform in a scientific environment, astronomy in particular, and point to the numerous astronomical software packages available for this platform; most notably the Scisoft collection which we have compiled.

  4. STABILITAS ANTOSIANIN JANTUNG PISANG KEPOK (Musa paradisiaca L TERHADAP CAHAYA SEBAGAI PEWARNA AGAR-AGAR

    Directory of Open Access Journals (Sweden)

    Lydia Ninan Lestario

    2015-02-01

    jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna

  5. Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent

    International Nuclear Information System (INIS)

    Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.

    2006-01-01

    Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants ΔH d egree, ΔS d egree and ΔG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)

  6. Extraction of agar from Gelidium sesquipedale (Rhodopyta) and surface characterization of agar based films.

    Science.gov (United States)

    Guerrero, P; Etxabide, A; Leceta, I; Peñalba, M; de la Caba, K

    2014-01-01

    The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Technical Report : ContikiMAC vs X-MAC performance analysis

    OpenAIRE

    Michel, Mathieu; Quoitin, Bruno

    2014-01-01

    This paper try to better understand the performance of ContikiMAC compared to X-MAC. ContikiMAC achieves a transmission by repeatedly transmitting a data packet until the reception of an ACK from the destination. While X-MAC uses a stream of small size strobes to advertise the destination of the incoming transmission. A priori, X-MAC is then less bandwidth consumptive. To better understand the efficiency of ContikiMAC, despite an intuitively more consumptive transmitting procedure, we have co...

  8. Micropipette Deflection Measurements of Agar-Glass Adhesion

    Science.gov (United States)

    Parg, Richard; Shelton, Erin; Dutcher, John

    Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.

  9. Teach yourself visually Mac Mini

    CERN Document Server

    Hart-Davis, Guy

    2012-01-01

    The perfect how-to guide for visual learners Apple?s Mac Mini packs a powerful punch is in a small package, including both HDMI and Thunderbolt ports plus the acclaimed OS X. But if you want to get the very most from all this power and versatility, be sure to get this practical visual guide. With full-color, step-by-step instructions as well as screenshots and illustrations on every page, it clearly shows you how to accomplish tasks rather than burying you in pages of text. Discover helpful visuals and how-tos on the OS, hardware specs, Launchpad, the App Store, multimedia capabilities (such

  10. Web Development with the Mac

    CERN Document Server

    Vegh, Aaron

    2010-01-01

    Learn Web development the Apple way and build a business. With a focus on both coding and creative development, this in-depth guide thoroughly covers what you need to know to build winning websites for clients — from what it takes to bring a business online to how to make your site interactive to how to run a freelance web business. In between, you'll master the technical tools of the trade — such as HTML, CSS, JavaScript, PHP, and Ruby on Rails — and learn how to create beautiful interfaces using Photoshop . This book covers everything a fledgling web developer working on a Mac needs to launc

  11. Identification of E. coli O157:H7 by Using Specific Primers for rfbE and stx2b Genes

    Directory of Open Access Journals (Sweden)

    Mostafa Bakhshi

    2017-07-01

    Sorbitol-MacConkey agar was used to verification of growth ability of selected colonies during PCR. Results: By appearance of the bonds belong to rfbE and stx2B genes on agarose gel, the ability of designed primers in gene detection in samples of E .coli O157:H7 was verified. Colonies which selected during PCR have growth potency on sorbitol-MacConkey agar medium. Conclusion: It was revealed that we can prepare a fast, precise and relative comfortable method for detection of E. coli O157:H7 strain by using PCR technique and specific primers than other available methods.

  12. Prevalence and Characterization of Cephalosporin Resistance in Nonpathogenic Escherichia coli from Food-Producing Animals Slaughtered in Poland

    DEFF Research Database (Denmark)

    Wasyl, Dariusz; Hasman, Henrik; Cavaco, Lina

    2012-01-01

    The prevalence of Escherichia coli with putative extended-spectrum cephalosporin resistance was assessed in cattle, pigs, broilers, layers, and turkey slaughtered in Poland. The occurrence of random E. coli isolates recovered from MacConkey agar plates with non–wild-type minimal inhibitory...... concentrations for cefotaxime and ceftazidime reached 0.6% in layers, 2.3% in turkey, and 4.7% in broilers, whereas all cattle and pigs isolates fell into the wild-type subpopulation. The use of MacConkey agar supplemented with cefotaxime (2 mg/L) increased the recovery of resistant strains up to 33...

  13. Mac OS X Tiger for Unix Geeks

    CERN Document Server

    Jepson, Brian

    2005-01-01

    If you're one of the many Unix developers drawn to Mac OS X for its Unix core, you'll find yourself in surprisingly unfamiliar territory. Unix and Mac OS X are kissing cousins, but there are enough pitfalls and minefields in going from one to another that even a Unix guru can stumble, and most guides to Mac OS X are written for Mac aficionados. For a Unix developer, approaching Tiger from the Mac side is a bit like learning Russian by reading the Russian side of a Russian-English dictionary. Fortunately, O'Reilly has been the Unix authority for over 25 years, and in Mac OS X Tiger for Unix Gee

  14. Take control the Mac OS X lexicon

    CERN Document Server

    Zardetto, Sharon

    2009-01-01

    This ebook explains a little bit of everything; in fact, it's The Mac OS X (and then some) Lexicon because it's never just you and your Mac. It's you and your Mac and the Web, and your email, and that article you just read that threw 17 new acronyms at you or assumed that you knew all sorts of networking terms. Or it's you and your Mac and Finder features you've never touched, such as burn folders, smart folders, or proxy icons, and that mysterious Services submenu. This book is a great guide for Macintosh users everywhere who have trouble keeping up with the latest jargon, fo

  15. Mac protocols for cyber-physical systems

    CERN Document Server

    Xia, Feng

    2015-01-01

    This book provides a literature review of various wireless MAC protocols and techniques for achieving real-time and reliable communications in the context of cyber-physical systems (CPS). The evaluation analysis of IEEE 802.15.4 for CPS therein will give insights into configuration and optimization of critical design parameters of MAC protocols. In addition, this book also presents the design and evaluation of an adaptive MAC protocol for medical CPS, which exemplifies how to facilitate real-time and reliable communications in CPS by exploiting IEEE 802.15.4 based MAC protocols. This book wil

  16. Macs all-in-one for dummies

    CERN Document Server

    Hutsko, Joe

    2014-01-01

    Your all-in-one guide to unleashing your Mac's full potential It's a Mac world out there. But if you haven't read the instruction manual, you may be neglecting some of your computer's coolest features. Turn to Macs All-in-One For Dummies' jam-packed guide to access the incredible tools within your computer. With this fully updated reference, you will learn how to use Launchpad and Mission Control; protect your Mac; back up and restore data with Time Machine; sync across devices in iCloud; import, organize, and share photos; direct in iMovie; compose in GarageBand; and so much more. The possi

  17. Douglas MacArthur Upon Reflection

    National Research Council Canada - National Science Library

    Snitchler, Lowell

    1998-01-01

    .... This research recounts MacArthur's personality development from childhood, investigates his last military campaign, and, finally, applies the diagnosis of narcissistic personality disorder to the assembled data...

  18. Quicksilver Power Mac G4

    CERN Document Server

    2001-01-01

    A new generation with a reworked motherboard is launched on 2001 with however the same Graphite box. It also included a processor speed-bump, and brought the DVD-R "SuperDrive" to the mid-level model. The Quicksilver PowerMac was available in three configurations: The 733 MHz model, with 128 MB of RAM, a 40 GB hard drive, and a CD-RW drive, was 1,699 dollars, the 867 MHz configuration, with 128 MB of RAM, a 60 GB hard drive and a DVD-R drive, was 2,499 dollars, and the high-end dual-800 MHz model, with 256 MB of RAM, an 80 GB hard drive and a DVD-R drive, was 3,499 dollars. The 733 MHz model is the first personal computer to have a DVD burner, named SuperDrive at Apple. The design was updated on 2002 with 800 MHz, 933 MHz and dual 1 GHz configurations, becoming the first Mac to reach 1 GHz.

  19. Analysis of 3gpp-MAC and two-key 3gpp-MAC

    DEFF Research Database (Denmark)

    Knudsen, Lars Ramkilde; Mitchell, C.J.

    2003-01-01

    Forgery and key-recovery attacks are described on the 3gpp-MAC scheme, proposed for inclusion in the 3gpp specification. Three main classes of attack are given, all of which operate whether or not truncation is applied to the MAC value. Attacks in the first class use a large number of 'chosen MAC...

  20. George MacDonald's Estimate of Childhood

    Science.gov (United States)

    Pridmore, John

    2007-01-01

    The nineteenth-century fantasy writer George MacDonald believed that "it is better to be a child in a green field than a knight of many orders." In this paper, I shall explore the bearing of this high estimate of childhood on spiritual education. MacDonald explores the spirituality of the child in his essay "A Sketch of Individual Development" and…

  1. 21 CFR 866.4600 - Ouchterlony agar plate.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...

  2. Biopreservative activity of lactic acid bacteria on suya produced from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-10-20

    Oct 20, 2008 ... MRS (pH 5.5) for LAB, potato dextrose agar (PDA) for yeast/mould,. MacConkey agar for coliforms and mannitol salt agar for Staphylo- coccus. The cultures were incubated for 48 h with the exception of yeast and mould (72 h). For FFA determination 5 g of each suya sample was comminuted and the lipid ...

  3. Agar alternatives for micropropagation of African violet ( Saintpaulia ...

    African Journals Online (AJOL)

    Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...

  4. Gari agar as culture media for mycological studies | Okorondu ...

    African Journals Online (AJOL)

    Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...

  5. Mac OS X for Unix Geeks (Leopard)

    CERN Document Server

    Rothman, Ernest E; Rosen, Rich

    2009-01-01

    If you've been lured to Mac OS X because of its Unix roots, this invaluable book serves as a bridge between Apple's Darwin OS and the more traditional Unix systems. The new edition offers a complete tour of Mac OS X's Unix shell for Leopard and Tiger, and helps you find the facilities that replace or correspond to standard Unix utilities. Learn how to compile code, link to libraries, and port Unix software to Mac OS X and much more with this concise guide.

  6. Office 2008 for Mac for dummies

    CERN Document Server

    LeVitus, Bob

    2013-01-01

    Office 2008 for Mac is here, with great new enhancements to all your favorite office productivity tools. Who better than "Dr. Mac, "Bob LeVitus, to show you how to load and use them all? From choosing the best version for your needs to managing your life with your online calendar, Office 2008 For Mac For Dummies covers what you need to know. It compares the Student/Teacher Edition, Standard Edition, and Professional Edition, then walks you through installing your preferred version and keeping it up to date. You'll find out all the things you can do with Word, Excel, PowerPoint, and Entourage,

  7. Learn Office 2011 for Mac OS X

    CERN Document Server

    Hart-Davis, Guy

    2011-01-01

    Office for Mac remains the leading productivity suite for Mac, with Apple's iWork and the free OpenOffice.org trailing far behind. And now it's being updated with a cleaner interface and more compatibility with Exchange and SharePoint. Learn Office 2011 for Mac OS X offers a practical, hands-on approach to using Office 2011 applications to create and edit documents and get work done efficiently. You'll learn how to customize Office, design, create, and share documents, manipulate data in a spreadsheet, and create lively presentations. You'll also discover how to organize your email, contacts,

  8. MACS as a tool for international inspections

    International Nuclear Information System (INIS)

    Curtiss, J.A.; Indusi, J.P.

    1995-01-01

    The MACS/ACRS (Managed Access by Controlled Sensing/Access by Controlled Remote Sensing) system is a collection of communication devices, video capability, and distance-measuring equipment which can effectively substitute for the physical presence of a challenge inspector within a facility. The MACS design allows growth of the prototype, developed in response to the Chemical Weapons Convention (CWC), into a versatile device for inspection of sensitive nuclear facilities under other international arrangements, for example the proposed Fissile Material Cutoff Convention. A MACS/ACRS-type system in a standard, international-recognized configuration could resolve sensitive information and safety concerns through providing a means of achieving the goals of an inspection while excluding the inspector. We believe the technology used to develop MACS for the Defense Nuclear Agency, followed by ACRS for the Department of Energy, is universally adaptable for minimally-intrusive managed-access international inspections of sensitive sites

  9. MACS as a tool for international inspections

    Energy Technology Data Exchange (ETDEWEB)

    Curtiss, J.A.; Indusi, J.P.

    1995-08-01

    The MACS/ACRS (Managed Access by Controlled Sensing/Access by Controlled Remote Sensing) system is a collection of communication devices, video capability, and distance-measuring equipment which can effectively substitute for the physical presence of a challenge inspector within a facility. The MACS design allows growth of the prototype, developed in response to the Chemical Weapons Convention (CWC), into a versatile device for inspection of sensitive nuclear facilities under other international arrangements, for example the proposed Fissile Material Cutoff Convention. A MACS/ACRS-type system in a standard, international-recognized configuration could resolve sensitive information and safety concerns through providing a means of achieving the goals of an inspection while excluding the inspector. We believe the technology used to develop MACS for the Defense Nuclear Agency, followed by ACRS for the Department of Energy, is universally adaptable for minimally-intrusive managed-access international inspections of sensitive sites.

  10. Learn Mac OS X Snow Leopard

    CERN Document Server

    Meyers, Scott

    2009-01-01

    You're smart and savvy, but also busy. This comprehensive guide to Apple's Mac OS X 10.6, Snow Leopard, gives you everything you need to know to live a happy, productive Mac life. Learn Mac OS X Snow Leopard will have you up and connected lickity split. With a minimum of overhead and a maximum of useful information, you'll cover a lot of ground in the time it takes other books to get you plugged in. If this isn't your first experience with Mac OS X, skip right to the "What's New in Snow Leopard" sections. You may also find yourself using this book as a quick refresher course or a way

  11. MAC reduction of isoflurane by sufentanil.

    Science.gov (United States)

    Brunner, M D; Braithwaite, P; Jhaveri, R; McEwan, A I; Goodman, D K; Smith, L R; Glass, P S

    1994-01-01

    We have shown previously that a plasma fentanyl concentration of 1.67 ng ml-1 reduced the MAC of isoflurane by 50%. By comparing equal degrees of MAC reduction by sufentanil, we may determine the potency ratio of these opioids. Seventy-six patients were allocated randomly to receive predetermined infusions of sufentanil, and end-tidal concentrations of isoflurane in oxygen. Blood samples were obtained 10 min after the start of the infusion, and just before and after skin incision. Any purposeful movement by the patient was recorded. The MAC reduction of isoflurane produced by sufentanil was obtained using a logistic regression model. A sufentanil plasma concentration of 0.145 ng ml-1 (95% confidence limits 0.04, 0.26 ng ml-1) resulted in a 50% reduction in the MAC of isoflurane. At a plasma concentration greater than 0.5 ng ml-1, sufentanil exhibited a ceiling effect.

  12. Macintosh Troubleshooting Pocket Guide for Mac OS

    CERN Document Server

    Lerner, David; Corporation, Tekserve

    2009-01-01

    The Macintosh Troubleshooting Pocket Guide covers the most common user hardware and software trouble. It's not just a book for Mac OS X (although it includes tips for OS X and Jaguar), it's for anyone who owns a Mac of any type-- there are software tips going back as far as OS 6. This slim guide distills the answers to the urgent questions that Tekserve's employee's answer every week into a handy guide that fits in your back pocket or alongside your keyboard.

  13. Enhanced Sleep Mode MAC Control for EPON

    DEFF Research Database (Denmark)

    Yan, Ying; Dittmann, Lars

    2011-01-01

    This paper introduces sleep mode operations for EPON. New MAC control functions are proposed to schedule sleep periods. Traffic profiles are considered to optimize energy efficiency and network performances. Simulation results are analyzed in OPNET modeler.......This paper introduces sleep mode operations for EPON. New MAC control functions are proposed to schedule sleep periods. Traffic profiles are considered to optimize energy efficiency and network performances. Simulation results are analyzed in OPNET modeler....

  14. Wound Healing in Mac-1 Deficient Mice

    Science.gov (United States)

    2017-05-01

    Dentistry, University of Illinois at Chicago, Chicago, IL, USA. 2 Department of Defense Biotechnology High Performance Computing Software...study, we used a commercially available Mac-1 deficient strain to examine whether this deficit 5 extends to slightly smaller wounds and incisional...levels of Collagen I and Collagen III in wounds from the two strains of mice at any time point. Unwounded skin from both WT and Mac-1 -/- mice contained

  15. AeroMACS system characterization and demonstrations

    Science.gov (United States)

    Kerczewski, R. J.; Apaza, R. D.; Dimond, R. P.

    This The Aeronautical Mobile Airport Communications System (AeroMACS) is being developed to provide a new broadband wireless communications capability for safety critical communications in the airport surface domain, providing connectivity to aircraft and other ground vehicles as well as connections between other critical airport fixed assets. AeroMACS development has progressed from requirements definition through technology definition, prototype deployment and testing, and now into national and international standards development. The first prototype AeroMACS system has been deployed at the Cleveland Hopkins International Airport (CLE) and the adjacent NASA Glenn Research Center (GRC). During the past three years, extensive technical testing has taken place to characterize the performance of the AeroMACS prototype and provide technical support for the standards development process. The testing has characterized AeroMACS link and network performance over a variety of conditions for both fixed and mobile data transmission and has included basic system performance testing and fixed and mobile applications testing. This paper provides a summary of the AeroMACS performance testing and the status of standardization activities that the testing supports.

  16. Radiation sterilization of triple sugar iron agar

    International Nuclear Information System (INIS)

    Altmann, G.; Eisenberg, E.; Bogokowsky, B.

    1979-01-01

    Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)

  17. Molecular, Serological And Microbiological Profiling Evidence Of ...

    African Journals Online (AJOL)

    All items that the boy had contact with including a laboratory coat, bunch of keys and shoes were swabbed. Finally samples of all the boy's food and drinks were taken. Microbiological, Serological and Polymerase Chain Reaction (PCR) Profiling Assays. l the samples were cultured on Sorbitol - MacConkey (SMAC) agar, ...

  18. Microbial status of smoked fish, scombia scombia sold in Owerri, Imo ...

    African Journals Online (AJOL)

    These were analyzed microbiologically for viable heterotrophic bacteria and fungi count on Nutrient and Potato dextrose agar respectively, using pour plate method and coliform count in MacConkey broth by multiple tube method (MPN). The mean value ... Key words: Bacteria, Yeast, Mould, Smoked fish, Contamination.

  19. v V V V V v

    Indian Academy of Sciences (India)

    Abasaheb Garware College,. Karve Road .... students and teachers goes, that other things are not to be taught. In effect the ... different that I had to say - I don't know. Probably ... MacConkey's agar, they prepared whatever they thought suited.

  20. Prevalence of asymptomatic bacteriuria in students of University of ...

    African Journals Online (AJOL)

    Urine samples were collected from 50 males and 50 females. The samples were cultured on CLED and MacConkey agar. Growth ... significant asymptomatic bacteriuria was higher in females 6 (60%) than males 4 (40%). The organisms isolated were S. aureus; S. epidermidis; E. coli; Pseudomonas spp and Proteus spp.

  1. Potential sources of transmission of hospital acquired infections in ...

    African Journals Online (AJOL)

    The swabs were cultured on Blood, Chocolate and Mac-Conkey agars and incubated for 24hrs at 35±2ºC afterwhich isolates were identified morphologically and biochemically. Results: A total of 187 (88.8%) bacterial isolates were obtained from the swabs (P<0.0017) made up of 55.5% non-pathogenic isolates, 33.3% ...

  2. Mac protocols for wireless sensor network (wsn): a comparative study

    International Nuclear Information System (INIS)

    Arshad, J.; Akram, Q.; Saleem, Y.

    2014-01-01

    Data communication between nodes is carried out under Medium Access Control (MAC) protocol which is defined at data link layer. The MAC protocols are responsible to communicate and coordinate between nodes according to the defined standards in WSN (Wireless Sensor Networks). The design of a MAC protocol should also address the issues of energy efficiency and transmission efficiency. There are number of MAC protocols that exist in the literature proposed for WSN. In this paper, nine MAC protocols which includes S-MAC, T-MAC, Wise-MAC, Mu-MAC, Z-MAC, A-MAC, D-MAC, B-MAC and B-MAC+ for WSN have been explored, studied and analyzed. These nine protocols are classified in contention based and hybrid (combination of contention and schedule based) MAC protocols. The goal of this comparative study is to provide a basis for MAC protocols and to highlight different mechanisms used with respect to parameters for the evaluation of energy and transmission efficiency in WSN. This study also aims to give reader a better understanding of the concepts, processes and flow of information used in these MAC protocols for WSN. A comparison with respect to energy reservation scheme, idle listening avoidance, latency, fairness, data synchronization, and throughput maximization has been presented. It was analyzed that contention based MAC protocols are less energy efficient as compared to hybrid MAC protocols. From the analysis of contention based MAC protocols in term of energy consumption, it was being observed that protocols based on preamble sampling consume lesser energy than protocols based on static or dynamic sleep schedule. (author)

  3. Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton

    Directory of Open Access Journals (Sweden)

    Margaret Ordoñez Smith de Danies

    1993-12-01

    Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.

  4. MacSelfService online tutorial

    CERN Multimedia

    CERN. Geneva

    2016-01-01

    Mac Self-Service is a functionality within the Mac Desktop Service built and maintained to empower CERN users by giving them easy access to applications and configurations through the Self-Service application. This tutorial (text attached to the event page) explains how to install Mac Self-Service and how to use it to install applications and printers. Content owner: Vincent Nicolas Bippus Presenter: Pedro Augusto de Freitas Batista Tell us what you think via e-learning.support at cern.ch More tutorials in the e-learning collection of the CERN Document Server (CDS) https://cds.cern.ch/collection/E-learning%20modules?ln=en All info about the CERN rapid e-learning project is linked from http://twiki.cern.ch/ELearning  

  5. MacBook Pro Portable Genius

    CERN Document Server

    Miser, Brad

    2011-01-01

    Tips and techniques for forward-thinking MacBook Pro users Now that you have a MacBook Pro, you need just one more accessory, your very own copy of MacBook Pro Portable Genius, Third Edition. This handy, compact book lets you in on a wealth of tips and tricks, so you get the very most out of Apple's very popular notebook. Discover the latest on the most recent release of iLife, get the skinny on the new Intel Core i7 and i5 processors in the Pro, see how to go wireless in a smart way, and much more. The book is easy to navigate, doesn't skimp on the essentials, and helps you save time and avoi

  6. A MAC Mode for Lightweight Block Ciphers

    DEFF Research Database (Denmark)

    Luykx, Atul; Preneel, Bart; Tischhauser, Elmar Wolfgang

    2016-01-01

    Lightweight cryptography strives to protect communication in constrained environments without sacrificing security. However, security often conflicts with efficiency, shown by the fact that many new lightweight block cipher designs have block sizes as low as 64 or 32 bits. Such low block sizes lead...... no effect on the security bound, allowing an order of magnitude more data to be processed per key. Furthermore, LightMAC is incredibly simple, has almost no overhead over the block cipher, and is parallelizable. As a result, LightMAC not only offers compact authentication for resource-constrained platforms...

  7. Douglas MacArthur- An Administrative Biography

    OpenAIRE

    Tehan III, William J.

    2002-01-01

    For more than a half century Douglas MacArthur was a servant of the United States. He is best remembered as a general and a soldier, especially for his leadership during World War II and the Korean War. MacArthur was also the Superintendent of West Point, Chief of Staff of the U.S. Army, Generalissimo ( Commander) of the Armed Forces and Military Advisor (Minister of Defense) to the President of the Commonwealth of the Philippines, and the Supreme Commander Allied Powers and the Military Gove...

  8. MacBook Pro Portable Genius

    CERN Document Server

    Miser, Brad

    2012-01-01

    Discover loads of tips and techniques for the newest MacBook Pro You're already ahead of the game with a MacBook Pro. Now you can get even more out the popular Apple notebook with the new edition of this handy, compact book. Crammed with savvy insights and tips on key tools and shortcuts, this book will help you increase your productivity and keep your Apple digital lifestyle on track. From desktop sharing and wireless networking to running Windows applications, this book avoids fluff, doesn't skimp on the essentials, saves you time and hassle, and shows you what you most want to know. Include

  9. Mac OS X Snow Leopard pocket guide

    CERN Document Server

    Seiblod, Chris

    2009-01-01

    Whether you're new to the Mac or a longtime user, this handy book is the quickest way to get up to speed on Snow Leopard. Packed with concise information in an easy-to-read format, Mac OS X Snow Leopard Pocket Guide covers what you need to know and is an ideal resource for problem-solving on the fly. This book goes right to the heart of Snow Leopard, with details on system preferences, built-in applications, and utilities. You'll also find configuration tips, keyboard shortcuts, guides for troubleshooting, lots of step-by-step instructions, and more. Learn about new features and changes s

  10. Seasonal variations of agar extracted from different life stages of ...

    African Journals Online (AJOL)

    Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008–winter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between ...

  11. Methods for identifying lipoxygenase producing microorganisms on agar plates

    NARCIS (Netherlands)

    Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.

    2012-01-01

    Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching

  12. Assessment of Native Agar Gels Extracted from Gracilaria debilis ...

    African Journals Online (AJOL)

    Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...

  13. Results from the MAC Vertex chamber

    International Nuclear Information System (INIS)

    Nelson, H.N.

    1987-05-01

    The design, construction, and performance characteristics of a high precision gaseous drift chamber made of thin walled proportional tubes are described. The device achieved an average spatial resolution of 45 μm in use for physics analysis with the MAC detector. The B-lifetime result obtained with this chamber is discussed

  14. The Big Mac Standard: A statistical Illustration

    OpenAIRE

    Yukinobu Kitamura; Hiroshi Fujiki

    2004-01-01

    We demonstrate a statistical procedure for selecting the most suitable empirical model to test an economic theory, using the example of the test for purchasing power parity based on the Big Mac Index. Our results show that supporting evidence for purchasing power parity, conditional on the Balassa-Samuelson effect, depends crucially on the selection of models, sample periods and economies used for estimations.

  15. MacIntyre, Managerialism and Universities

    Science.gov (United States)

    Stolz, Steven A.

    2017-01-01

    MacIntyre's earlier work and concern with social science enquiry not only exposes its limits, but also provides an insight into how its knowledge claims have been put to ideological use. He maintains that the institutional embodiment of these ideological ideas is the bureaucratic manager who has had a negative role to play in social structures…

  16. Florence Jessie Mac Williams (1917-1990)

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 1. Florence Jessie Mac Williams (1917-1990). Featured Scientist Volume 10 Issue 1 January 2005 pp 98-98. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/010/01/0098-0098. Resonance ...

  17. An Interview with Peter MacDonald.

    Science.gov (United States)

    American Indian Journal, 1979

    1979-01-01

    Peter MacDonald, Chairman of the Navajo Nation, the largest tribe in the United States speaks to such issues as energy development/management, oil companies, Navajo-Hopi relocation legislation, traditionalism, and the role of the Council of Energy Resource Tribes. (RTS)

  18. Lifetime tests for MAC vertex chamber

    International Nuclear Information System (INIS)

    Nelson, H.N.

    1986-07-01

    A vertex chamber for MAC was proposed to increase precision in the measurement of the B hadron and tau lepton lifetimes. Thin-walled aluminized mylar drift tubes were used for detector elements. A study of radiation hardness was conducted under the conditions of the proposed design using different gases and different operating conditions

  19. MACS as a tool for international inspections

    International Nuclear Information System (INIS)

    Curtiss, J.A.; Indusi, J.P.

    1995-01-01

    General acceptance of the challenge provision in the Chemical Weapons Convention has the potential for influence in other arms control areas. While most applications of the challenge inspection may be straightforward, there may be instances where access to the site by inspectors may be problematic. The MACS system described in this paper was developed to respond to these situations. Inspection and verification may be difficult when a host is unwilling,for valid reasons, to permit physical access to a site. We proposed a system of remote sensors which may be used to demonstrate compliance with Chemical Weapons Convention (CWC) challenge inspections even ff the inspector is physically excluded from a sensitive site. The system is based upon alternative-means-of-access provisions of the CWC. The Defense Nuclear Agency (DNA) funded design and construction of a system prototype, designated as MACS for Managed Access by Controlled Sensing. Features of the MACS design allow growth of the prototype into a versatile device for international monitoring of production facilities and other sites. MACS consists of instrumentation and communication equipment allowing site personnel to conduct a facility tour and perform acceptable measurements, while physically excluding the inspector from the facility. MACS consists of a base station used by the inspector, and a mobile unit used within the facility and manipulated by the facility staff. The base station and the mobile unit are at sign ed by a communication system, currently realized as a fiber optic cable. The mobile unit is equipped with television cameras and remote-reading distance-measuring equipment (DME) for use in verifying locations and dimensions. Global Positioning System receivers on the mobile unit provide both precise location and dead reckoning, suitable for tracking the mobile unit's position while within a building when satellite signals are not available

  20. Mammalian Synthetic Biology: Time for Big MACs.

    Science.gov (United States)

    Martella, Andrea; Pollard, Steven M; Dai, Junbiao; Cai, Yizhi

    2016-10-21

    The enabling technologies of synthetic biology are opening up new opportunities for engineering and enhancement of mammalian cells. This will stimulate diverse applications in many life science sectors such as regenerative medicine, development of biosensing cell lines, therapeutic protein production, and generation of new synthetic genetic regulatory circuits. Harnessing the full potential of these new engineering-based approaches requires the design and assembly of large DNA constructs-potentially up to chromosome scale-and the effective delivery of these large DNA payloads to the host cell. Random integration of large transgenes, encoding therapeutic proteins or genetic circuits into host chromosomes, has several drawbacks such as risks of insertional mutagenesis, lack of control over transgene copy-number and position-specific effects; these can compromise the intended functioning of genetic circuits. The development of a system orthogonal to the endogenous genome is therefore beneficial. Mammalian artificial chromosomes (MACs) are functional, add-on chromosomal elements, which behave as normal chromosomes-being replicating and portioned to daughter cells at each cell division. They are deployed as useful gene expression vectors as they remain independent from the host genome. MACs are maintained as a single-copy and can accommodate multiple gene expression cassettes of, in theory, unlimited DNA size (MACs up to 10 megabases have been constructed). MACs therefore enabled control over ectopic gene expression and represent an excellent platform to rapidly prototype and characterize novel synthetic gene circuits without recourse to engineering the host genome. This review describes the obstacles synthetic biologists face when working with mammalian systems and how the development of improved MACs can overcome these-particularly given the spectacular advances in DNA synthesis and assembly that are fuelling this research area.

  1. Comparison of Fatty Acid Methyl Ester Analysis with the Use of API 20E and NFT Strips for Identification of Aquatic Bacteria

    OpenAIRE

    Brown, B. J.; Leff, L. G.

    1996-01-01

    Aquatic bacteria grown on MacConkey agar and modified nutrient agar were identified by using API 20E and NFT strips and fatty acid methyl ester (FAME) analysis. Identifications agreed at the species level 35.7% of the time when API 20E strips and FAME analysis were used and in 4.3% of the cases when API NFT strips and FAME analysis were used. These techniques require further development before extended use in ecological studies.

  2. A fatal pulmonary infection by Nocardia brasiliensis

    Directory of Open Access Journals (Sweden)

    Wadhwa V

    2006-01-01

    Full Text Available The reported case is of primary pulmonary nocardiosis, caused by Nocardia brasiliensis , in a immunocompromised patient, which ended fatally despite appropriate treatment. The partially acid fast filamentous bacterium was predominant on direct examination of the sputum. It was cultured on blood agar, MacConkey agar and by paraffin baiting technique. The bacterium was resistant to cotrimoxazole, the drug of choice for nocardiosis.

  3. AGAR PENULISAN RESEP TETAP UP TO DATE

    Directory of Open Access Journals (Sweden)

    Rahmatini Rahmatini

    2009-09-01

    Full Text Available AbstrakResep adalah suatu permintaan tertulis dari dokter, dokter gigi atau dokter hewan kepada apoteker untuk membuatkan obat dalam bentuk sediaan tertentu dan menyerahkannya kepada pasien. Resep merupakan perwujudan akhir dari kompetensi, pengetahuan dan keahlian dokter dalam menerapkan pengetahuannya dalam bidang farmakologi dan terapi.Penulisan resep harus ditulis dengan jelas sehingga dapat dibaca oleh petugas di apotek. Resep yang ditulis dengan tidak jelas akan menimbulkan terjadinya kesalahan saat peracikan / penyiapan obat dan penggunaan obat yang diresepkan.Ilmu pengetahuan tentang obat selalu berubah, obat – obat baru selalu muncul di pasaran.Secara umum, seorang dokter harus mengikuti perkembangan dalam terapi obat. Bila muncul efek samping akibat obat yang seharusnya diketahui dan dapat dicegah oleh dokter, maka dokter akan berhadapan dengan hukum.Agar penulisan resep tetap up to date, seorang dokter harus mengumpulkan berbagai informasi yang tersedia. Sumber informasi yang dapat digunakan adalah : Buku acuan, Kompendium obat, Daftar Obat Esensial Nasional (DOEN dan Pedoman terapi, Buletin obat, Jurnal Kedokteran, Pusat informasi obat,Informasi melalui komputer, Sumber informasi dari industri farmasi, dan informasi lisan.Bandingkan kelebihan dan kekurangan berbagai sumber informasi. Tugas seorang dokter adalah melakukan cara terbaik untuk tetap up to date dengan mendaftar sumber informasi yang dapat dimanfaatkan. Carilah sedikitnya satu dari yang berikut ini : (1 jurnal kedokteran: (2 buletin obat; (3 buku acuan farmakologi atau acuan klinis; (4 komisi terapi maupun konsultan, atau lulusan pasca sarjana farmakologi. Dengan bekal pengetahuan dan kemampuan untuk melakukan penilaian secara kritis setiap bentuk informasi, diharapkan dokter tetap up to date dalam menulis resepKata kunci : Resep – up to- date.Abstract Prescription is a written request from a doctor, dentist or veterinarian to the pharmacist to make a particular drug

  4. The periplasmic membrane proximal domain of MacA acts as a switch in stimulation of ATP hydrolysis by MacB transporter.

    Science.gov (United States)

    Modali, Sita D; Zgurskaya, Helen I

    2011-08-01

    Escherichia coli MacAB-TolC is a tripartite macrolide efflux transporter driven by hydrolysis of ATP. In this complex, MacA is the periplasmic membrane fusion protein that stimulates the activity of MacB transporter and establishes the link with the outer membrane channel TolC. The molecular mechanism by which MacA stimulates MacB remains unknown. Here, we report that the periplasmic membrane proximal domain of MacA plays a critical role in functional MacA-MacB interactions and stimulation of MacB ATPase activity. Binding of MacA to MacB stabilizes the ATP-bound conformation of MacB, whereas interactions with both MacB and TolC affect the conformation of MacA. A single G353A substitution in the C-terminus of MacA inactivates MacAB-TolC function by changing the conformation of the membrane proximal domain of MacA and disrupting the proper assembly of the MacA-MacB complex. We propose that MacA acts in transport by promoting MacB transition into the closed ATP-bound conformation and in this respect, is similar to the periplasmic solute-binding proteins. © 2011 Blackwell Publishing Ltd.

  5. MacBook All-in-One For Dummies

    CERN Document Server

    Chambers, Mark L

    2011-01-01

    Get comfortable and confident with your MacBook! Combining the fun-but-straightforward content of nine minibooks, this new edition of MacBook All-in-One For Dummies delivers helpful coverage of the rich features and essential tools you need to know to use the MacBook to its fullest potential. You'll learn an array of MacBook basics while veteran author Mark Chambers walks you through setting up your MacBook, running programs, finding files with Finder, searching with Spotlight, keeping track with Address Book, enjoying music with iTunes, creating cool multimedia projects with iLife, and more.

  6. MacBook Pro portable genius

    CERN Document Server

    Gruman, Galen

    2013-01-01

    Learn the skills, tools and shortcuts you need in order to make the most of your MacBook Pro This easy-to-use, compact guide skips the fluff and gets right to the essentials so that you can maximize all the latest features of the MacBook Pro. Packed with savvy insights and tips on key tools and shortcuts, this handy book aims to help you increase your productivity and save you time and hassle. From desktop sharing and wireless networking to running Windows applications and more, this book shows you what you want to know. Includes the latest version of OS X, iCloud, FaceTime, and moreCovers al

  7. Modeling MAC layer for powerline communications networks

    Science.gov (United States)

    Hrasnica, Halid; Haidine, Abdelfatteh

    2001-02-01

    The usage of electrical power distribution networks for voice and data transmission, called Powerline Communications, becomes nowadays more and more attractive, particularly in the telecommunication access area. The most important reasons for that are the deregulation of the telecommunication market and a fact that the access networks are still property of former monopolistic companies. In this work, first we analyze a PLC network and system structure as well as a disturbance scenario in powerline networks. After that, we define a logical structure of the powerline MAC layer and propose the reservation MAC protocols for the usage in the PLC network which provides collision free data transmission. This makes possible better network utilization and realization of QoS guarantees which can make PLC networks competitive to other access technologies.

  8. Millisecond timing on PCs and Macs.

    Science.gov (United States)

    MacInnes, W J; Taylor, T L

    2001-05-01

    A real-time, object-oriented solution for displaying stimuli on Windows 95/98, MacOS and Linux platforms is presented. The program, written in C++, utilizes a special-purpose window class (GLWindow), OpenGL, and 32-bit graphics acceleration; it avoids display timing uncertainty by substituting the new window class for the default window code for each system. We report the outcome of tests for real-time capability across PC and Mac platforms running a variety of operating systems. The test program, which can be used as a shell for programming real-time experiments and testing specific processors, is available at http://www.cs.dal.ca/~macinnwj. We propose to provide researchers with a sense of the usefulness of our program, highlight the ability of many multitasking environments to achieve real time, as well as caution users about systems that may not achieve real time, even under optimal conditions.

  9. Improved b lifetime measurement from MAC

    International Nuclear Information System (INIS)

    Ford, W.T.

    1984-03-01

    Two recent publications, from the MAC and Mark II collaborations, have reported the somewhat surprising result that the lifetime of particles made up of b quarks is in the 1 to 2 picosecond range, or somewhat longer than the lifetimes of charm particles. Although the charm decays are favored transitions while those of b particles depend upon off-diagonal elements of the weak flavor mixing matrix, the smallness of the b decay rates in face of the large available phase space indicates that the off-diagonal elements are indeed very small. The possibility for complete determination of the mixing matrix was brought significantly nearer by the availability of the lifetime information; what is needed now is to reduce the uncertainty of the measurements, which was about 33% for both experiments. We describe here an extension of the b lifetime study with the MAC detector, incorporating some new data and improvements in the analysis. 12 references

  10. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  11. Rheological properties of agar and carrageenan from Ghanaian red seaweeds

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2017-01-01

    spectroscopy (FTIR) analysis on the hydrocolloids extracted from H. musciformis (and K. alvarezii) indicated κ-carrageenan, C. crenulata hydrocolloids were mainly ι-carrageenan, and the H. dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36 °C for the κ-carrageenan hydrocolloid samples...... comparable with κ-carrageenan from K. alvarezii, whereas the H. dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21–26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...

  12. Installing Git under MacOS

    OpenAIRE

    Fitzpatrick, Benjamin

    2015-01-01

    Step by step guide to installing the version control software Git under the Macintosh Operating System MacOS X (and later). Includes a seqeunce of screenshots with hand drawn arrows ;-) These slides are part of the materials for an Introductory course on the R language and environment for statistial computing. Free and Open Source materials for this course hosted on GitHub: https://github.com/brfitzpatrick/Intro_to_R

  13. Hichrom candida agar for identification of candida species

    OpenAIRE

    Baradkar V; Mathur M; Kumar S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...

  14. Visualization of integrin Mac-1 in vivo.

    Science.gov (United States)

    Lim, Kihong; Hyun, Young-Min; Lambert-Emo, Kris; Topham, David J; Kim, Minsoo

    2015-11-01

    β2 integrins play critical roles in migration of immune cells and in the interaction with other cells, pathogens, and the extracellular matrix. Among the β2 integrins, Mac-1 (Macrophage antigen-1), composed of CD11b and CD18, is mainly expressed in innate immune cells and plays a major role in cell migration and trafficking. In order to image Mac-1-expressing cells both in live cells and mouse, we generated a knock-in (KI) mouse strain expressing CD11b conjugated with monomeric yellow fluorescent protein (mYFP). Expression of CD11b-mYFP protein was confirmed by Western blot and silver staining of CD11b-immunoprecipitates and total cell lysates from the mouse splenocytes. Mac-1-mediated functions of the KI neutrophils were comparable with those in WT cells. The fluorescence intensity of CD11b-mYFP was sufficient to image CD11b expressing cells in live mice using intravital two-photon microscopy. In vitro, dynamic changes in the intracellular localization of CD11b molecules could be measured by epifluorescent microscopy. Finally, CD11b-expressing immune cells from tissue were easily detected by flow cytometry without anti-CD11b antibody staining. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Detection of extracellular proteases from microorganisms on agar plates

    Directory of Open Access Journals (Sweden)

    Alane Beatriz Vermelho

    1996-12-01

    Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.

  16. Thermal characterization of magnetically aligned carbonyl iron/agar composites.

    Science.gov (United States)

    Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J

    2014-01-01

    Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Differentiating Agar wood Oil Quality Using Artificial Neural Network

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)

  18. Power Saving MAC Protocols for WSNs and Optimization of S-MAC Protocol

    Directory of Open Access Journals (Sweden)

    Simarpreet Kaur

    2012-11-01

    Full Text Available Low power MAC protocols have received a lot of consideration in the last few years because of their influence on the lifetime of wireless sensor networks. Since, sensors typically operate on batteries, replacement of which is often difficult. A lot of work has been done to minimize the energy expenditure and prolong the sensor lifetime through energy efficient designs, across layers. Meanwhile, the sensor network should be able to maintain a certain throughput in order to fulfill the QoS requirements of the end user, and to ensure the constancy of the network. This paper introduces different types of MAC protocols used for WSNs and proposes S‐MAC, a Medium‐Access Control protocol designed for Wireless Sensor Networks. S‐MAC uses a few innovative techniques to reduce energy consumption and support selfconfiguration. A new protocol is suggested to improve the energy efficiency, latency and throughput of existing MAC protocol for WSNs. A modification of the protocol is then proposed to eliminate the need for some nodes to stay awake longer than the other nodes which improves the energy efficiency, latency and throughput and hence increases the life span of a wireless sensor network.

  19. A comparison of EF-18 agar and modified brilliant green agar with lutensit for isolation of Salmonella from poultry samples

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård

    1997-01-01

    -Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...

  20. Development of high yielding Soybean variety MACS 450 by using Kalitur mutant-MACS 111

    International Nuclear Information System (INIS)

    Raut, V.M.; Taware, S.P.; Halvankar, G.B.; Varghese, Philips

    2000-01-01

    A mutant variety -MACS 111 developed by treating seeds of indigenous black seeded 'Kalitur' variety with gamma irradiation + Ethyleneimine was used in development of high yielding varieties. MACS 450 a promising high yielding variety was selected from Bragg x MACS 111 cross by pedigree selection method. This variety gave the highest average seed yield in station trials (3422 kg/ha), coordinated breeding trials (2361 kg/ha) and varieties cum plant population trial (2215 kg/ha). On the basis of its performance in these trials it was released for commercial cultivation in Southern India. On all India basis, it also recorded the highest seed yield of 4076 kg/ha and 3582 kg/ha in Front line Demonstrations conducted on the farmers' field during 1998 and 1999 respectively. (author)

  1. Agar/collagen membrane as skin dressing for wounds

    Energy Technology Data Exchange (ETDEWEB)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn

    2008-12-15

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  2. Agar/collagen membrane as skin dressing for wounds

    International Nuclear Information System (INIS)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing

    2008-01-01

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  3. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  4. One of the First Portable Macs

    CERN Multimedia

    1989-01-01

    It was one of the first portable macs released. The Portable had many new advances in mobile computing : The display was crispy clear, and looked beautiful when used in daylight ; The Portable came with a Lead-acid gel/cell battery that could run a anywhere from 6 -12 hours ; It supported to internal hard drives, and an external one. The reaction to the laptop was weak because it was slow, it had no capacity for expansion, it weighed heavily, its price was expensive. It has been stayed 1 year and half on the market.

  5. The periplasmic membrane proximal domain of MacA acts as a switch in stimulation of ATP hydrolysis by MacB transporter

    OpenAIRE

    Modali, Sita D.; Zgurskaya, Helen I.

    2011-01-01

    Escherichia coli MacAB-TolC is a tri-partite macrolide efflux transporter driven by hydrolysis of ATP. In this complex, MacA is the periplasmic membrane fusion protein that stimulates the activity of MacB transporter and establishes the link with the outer membrane channel TolC. The molecular mechanism by which MacA stimulates MacB remains unknown. Here, we report that the periplasmic membrane proximal domain of MacA plays a critical role in functional MacA-MacB interactions and stimulation o...

  6. Turning the Big Mac Index into the Medical MAC Index | Wilson ...

    African Journals Online (AJOL)

    Objective: The purpose of this study was to create a global medical earnings index, called the Medical MAC Index, to enable a comparison of what medical specialists earn in the countries included in the study. Design: The study gathered data on the earnings of specialist anaesthetists employed in state hospitals with five ...

  7. QL-MAC : a Q-learning based MAC for wireless sensor networks

    NARCIS (Netherlands)

    Galzarano, S.; Liotta, A.; Fortino, G.; Aversa, R.; Kolodziej, J.; Zhang, J.; Amato, F.; Fortino, G.

    2013-01-01

    WSNs are becoming an increasingly attractive technology thanks to the significant benefits they can offer to a wide range of application domains. Extending the system lifetime while preserving good network performance is one of the main challenges in WSNs. In this paper, a novel MAC protocol

  8. Essential Mac OS X panther server administration integrating Mac OS X server into heterogeneous networks

    CERN Document Server

    Bartosh, Michael

    2004-01-01

    If you've ever wondered how to safely manipulate Mac OS X Panther Server's many underlying configuration files or needed to explain AFP permission mapping--this book's for you. From the command line to Apple's graphical tools, the book provides insight into this powerful server software. Topics covered include installation, deployment, server management, web application services, data gathering, and more

  9. Photothermal characterization of the gelation process in Gelidium robustum Agar

    Science.gov (United States)

    Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.

    2005-06-01

    Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37°C. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.

  10. Hichrom candida agar for identification of Candida species.

    Science.gov (United States)

    Baradkar, V P; Mathur, M; Kumar, S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  11. Hichrom candida agar for identification of candida species

    Directory of Open Access Journals (Sweden)

    Baradkar V

    2010-01-01

    Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  12. Mac OS X Snow Leopard Server For Dummies

    CERN Document Server

    Rizzo, John

    2009-01-01

    Making Everything Easier!. Mac OS® X Snow Leopard Server for Dummies. Learn to::;. Set up and configure a Mac network with Snow Leopard Server;. Administer, secure, and troubleshoot the network;. Incorporate a Mac subnet into a Windows Active Directory® domain;. Take advantage of Unix® power and security. John Rizzo. Want to set up and administer a network even if you don't have an IT department? Read on!. Like everything Mac, Snow Leopard Server was designed to be easy to set up and use. Still, there are so many options and features that this book will save you heaps of time and effort. It wa

  13. A Mobile Automated Characterization System (MACS) for indoor floor characterization

    International Nuclear Information System (INIS)

    Richardson, B.S.; Haley, D.C.; Dudar, A.M.; Ward, C.R.

    1995-01-01

    The Savannah River Technology Center (SRTC) and Oak Ridge National Laboratory are developing an advanced Mobile Automated Characterization System (MACS) to characterize indoor contaminated floors. MACS is based upon Semi-Intelligent Mobile Observing Navigator (SIMON), an earlier floor characterization system developed at SRTC. MACS will feature enhanced navigation systems, operator interface, and an interface to simplify integration of additional sensors. The enhanced navigation system will provide the capability to survey large open areas much more accurately than is now possible with SIMON, which is better suited for hallways and corridors that provide the means for recalibrating position and heading. MACS operator interface is designed to facilitate MACS's use as a tool for health physicists, thus eliminating the need for additional training in the robot's control language. Initial implementation of MACS will use radiation detectors. Additional sensors, such as PCB sensors currently being developed, will be integrated on MACS in the future. Initial use of MACS will be focused toward obtaining comparative results with manual methods. Surveys will be conducted both manually and with MACS to compare relative costs and data quality. While clear cost benefits anticipated, data quality benefits should be even more significant

  14. Assay for adhesion and agar invasion in S. cerevisiae.

    Science.gov (United States)

    Guldal, Cemile G; Broach, James

    2006-11-08

    Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, biofilms can reduce industrial productivity, destroy structures, and threaten human life. 1-3 On the other hand, harnessing the power of biofilms can help clean the environment and generate sustainable energy. 4-8 The ability of S. cerevisiae to colonize surfaces and participate in complex biofilms was mostly ignored until the rediscovery of the differentiation programs triggered by various signaling pathways and environmental cues in this organism. 9, 10 The continuing interest in using S. cerevisiae as a model organism to understand the interaction and convergence of signaling pathways, such as the Ras-PKA, Kss1 MAPK, and Hog1 osmolarity pathways, quickly placed S. cerevisiae in the junction of biofilm biology and signal transduction research. 11-20 To this end, differentiation of yeast cells into long, adhesive, pseudohyphal filaments became a convenient readout for the activation of signal transduction pathways upon various environmental changes. However, filamentation is a complex collection of phenotypes, which makes assaying for it as if it were a simple phenotype misleading. In the past decade, several assays were successfully adopted from bacterial biofilm studies to yeast research, such as MAT formation assays to measure colony spread on soft agar and crystal violet staining to quantitatively measure cell-surface adherence. 12, 21 However, there has been some confusion in assays developed to qualitatively assess the adhesive and invasive phenotypes of yeast in agar. Here, we present a simple and reliable method for assessing the adhesive and invasive quality of yeast strains with easy-to-understand steps to isolate the adhesion assessment from invasion assessment. Our method, adopted from previous studies, 10, 16 involves growing cells in liquid media and plating on differential nutrient conditions for growth

  15. Preparation of Agar-Agar from the Red Seaweed Pterocladia capillacea off the Coast of Alexandria, Egypt.

    Science.gov (United States)

    Rao, A V; Bekheet, I A

    1976-10-01

    The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.

  16. Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar

    DEFF Research Database (Denmark)

    Høi, L.; Dalsgaard, Inger; Dalsgaard, A.

    1998-01-01

    An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....

  17. Characterization of Gluten-free Bread Prepared From Maize, Rice and Tapioca Flours using the Hydrocolloid Seaweed Agar-Agar

    OpenAIRE

    Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João

    2011-01-01

    Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...

  18. Corn and potato starch as an agar alternative for Solanum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).

  19. How selective are agar cultures for malignant transformation?

    NARCIS (Netherlands)

    Klein, J.C.

    1981-01-01

    In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized

  20. Growth of strontium oxalate crystals in agar–agar gel

    Indian Academy of Sciences (India)

    Growth of strontium oxalate crystals in agar–agar gel. P V DALAL. ∗ and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.

  1. Steven MacCall: Winner of LJ's 2010 Teaching Award

    Science.gov (United States)

    Berry, John N., III

    2010-01-01

    This article profiles Steven L. MacCall, winner of "Library Journal's" 2010 Teaching Award. An associate professor at the School of Library and Information Studies (SLIS) at the University of Alabama, Tuscaloosa, MacCall was nominated by Kathie Popadin, known as "Kpop" to the members of her cohort in the online MLIS program at SLIS. Sixteen of…

  2. Paradox applications integration ATP's for MAC and mass balance programs

    International Nuclear Information System (INIS)

    Russell, V.K.; Mullaney, J.E.

    1994-01-01

    The K Basins Materials Accounting (MAC) and Material Balance (MBA) database system were set up to run under one common applications program. This Acceptance Test Plan (ATP) describes how the code was to be tested to verify its correctness. The scope of the tests is minimal, since both MAC and MBA have already been tested in detail as stand-alone programs

  3. Lifetime tests for MAC vertex chamber

    International Nuclear Information System (INIS)

    Nelson, H.

    1986-01-01

    A vertex chamber for MAC was proposed in fall 1983 to increase precision in the measurement of the B hadron and tau lepton lifetimes. The chamber had to be placed within the existing central drift chamber, making access for repairs difficult and costly. Therefore for detector elements thin-walled aluminized mylar drift tubes (straws) were used because of their simplicity and robustness. The diameter of the drift tubes was 6.9 mm. The radial extent of the proposed chamber was from 3 cm to 10 cm, the inner wall of the central drift. It was clear that radiation levels, from synchrotron x-rays and overfocussed electrons, were potentially high. Since the drift distance is short in the straws, it was desirable to operate them at the highest possible gas gain, to achieve the best spatial resolution. There was a likelihood of drawing large currents in the chamber and thus causing radiation damage. Therefore a study of radiation hardness under the conditions of their proposed design was undertaken. In tests, argon-hydrocarbon mixtures consistently became unusable at ∼0.05 C/cm collected charge, due to anode buildup. Argon-CO 2 mixtures, while underquenched, were operational to 0.25 C/cm, at which point loss of cathode material became intolerable. Argon-xenon-CO 2 proved to be quenched as well as argon-hydrocarbons, but was limited by cathode damage. The MAC vertex chamber has operated at a distance of 4.6 cm from the e + e - interaction point at PEP for two years and has shown no aging effects

  4. Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.

    Science.gov (United States)

    Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young

    2014-10-17

    This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright

  5. TreeMAC: Localized TDMA MAC protocol for real-time high-data-rate sensor networks

    Science.gov (United States)

    Song, W.-Z.; Huang, R.; Shirazi, B.; Husent, R.L.

    2009-01-01

    Earlier sensor network MAC protocols focus on energy conservation in low-duty cycle applications, while some recent applications involve real-time high-data-rate signals. This motivates us to design an innovative localized TDMA MAC protocol to achieve high throughput and low congestion in data collection sensor networks, besides energy conservation. TreeMAC divides a time cycle into frames and frame into slots. Parent determines children's frame assigmnent based on their relative bandwidth demand, and each node calculates its own slot assignment based on its hop-count to the sink. This innovative 2-dimensional frame-slot assignment algorithm has the following nice theory properties. Firstly, given any node, at any time slot, there is at most one active sender in its neighborhood (includ ing itself). Secondly, the packet scheduling with TreelMAC is bufferless, which therefore minimizes the probability of network congestion. Thirdly, the data throughput to gateway is at least 1/3 of the optimum assuming reliable links. Our experiments on a 24 node test bed demonstrate that TreeMAC protocol significantly improves network throughput and energy efficiency, by comparing to the TinyOS's default CSMA MAC protocol and a recent TDMA MAC protocol Funneling-MAC[8]. ?? 2009 IEEE.

  6. GENETIC FINGERPRINTING OF MYCOBACTERIUM AVIUM COMPLEX (MAC) ORGANISMS ISOLATED FROM HOSPITAL PATIENTS AND THE ENVIRONMENT

    Science.gov (United States)

    A particularly pathogenic group of mycobacteria belong to the Mycobacterium avium complex (MAC), which includes M. avium and M. intracellulare. MAC organisms cause disease in children, the elderly, and immuno-compromised individuals. A critical step in preventing MAC infections...

  7. Effects of solid-medium type on routine identification of bacterial isolates by use of matrix-assisted laser desorption ionization-time of flight mass spectrometry.

    Science.gov (United States)

    Anderson, Neil W; Buchan, Blake W; Riebe, Katherine M; Parsons, Lauren N; Gnacinski, Stacy; Ledeboer, Nathan A

    2012-03-01

    Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for the identification of bacteria. Factors that may alter protein profiles, including growth conditions and presence of exogenous substances, could hinder identification. Bacterial isolates identified by conventional methods were grown on various media and identified using the MALDI Biotyper (Bruker Daltonics, Billerica, MA) using a direct smear method and an acid extraction method. Specimens included 23 Pseudomonas isolates grown on blood agar, Pseudocel (CET), and MacConkey agar (MAC); 20 Staphylococcus isolates grown on blood agar, colistin-nalidixic acid agar (CNA), and mannitol salt agar (MSA); and 25 enteric isolates grown on blood agar, xylose lysine deoxycholate agar (XLD), Hektoen enteric agar (HE), salmonella-shigella agar (SS), and MAC. For Pseudomonas spp., the identification rate to genus using the direct method was 83% from blood, 78% from MAC, and 94% from CET. For Staphylococcus isolates, the identification rate to genus using the direct method was 95% from blood, 75% from CNA, and 95% from MSA. For enteric isolates, the identification rate to genus using the direct method was 100% from blood, 100% from MAC, 100% from XLD, 92% from HE, and 87% from SS. Extraction enhanced identification rates. The direct method of MALDI-TOF analysis of bacteria from selective and differential media yields identifications of varied confidence. Notably, Staphylococci spp. from CNA exhibit low identification rates. Extraction enhances identification rates and is recommended for colonies from this medium.

  8. Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Fu, Xiaoting

    2016-12-01

    Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Use of electron beam on aflatoxins degradation in coconut agar

    International Nuclear Information System (INIS)

    Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito

    2009-01-01

    The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1μg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)

  10. Increased NMDA receptor inhibition at an increased Sevoflurane MAC

    Directory of Open Access Journals (Sweden)

    Brosnan Robert J

    2012-06-01

    Full Text Available Abstract Background Sevoflurane potently enhances glycine receptor currents and more modestly decreases NMDA receptor currents, each of which may contribute to immobility. This modest NMDA receptor antagonism by sevoflurane at a minimum alveolar concentration (MAC could be reciprocally related to large potentiation of other inhibitory ion channels. If so, then reduced glycine receptor potency should increase NMDA receptor antagonism by sevoflurane at MAC. Methods Indwelling lumbar subarachnoid catheters were surgically placed in 14 anesthetized rats. Rats were anesthetized with sevoflurane the next day, and a pre-infusion sevoflurane MAC was measured in duplicate using a tail clamp method. Artificial CSF (aCSF containing either 0 or 4 mg/mL strychnine was then infused intrathecally at 4 μL/min, and the post-infusion baseline sevoflurane MAC was measured. Finally, aCSF containing strychnine (either 0 or 4 mg/mL plus 0.4 mg/mL dizocilpine (MK-801 was administered intrathecally at 4 μL/min, and the post-dizocilpine sevoflurane MAC was measured. Results Pre-infusion sevoflurane MAC was 2.26%. Intrathecal aCSF alone did not affect MAC, but intrathecal strychnine significantly increased sevoflurane requirement. Addition of dizocilpine significantly decreased MAC in all rats, but this decrease was two times larger in rats without intrathecal strychnine compared to rats with intrathecal strychnine, a statistically significant (P  Conclusions Glycine receptor antagonism increases NMDA receptor antagonism by sevoflurane at MAC. The magnitude of anesthetic effects on a given ion channel may therefore depend on the magnitude of its effects on other receptors that modulate neuronal excitability.

  11. MacRuby Ruby and Cocoa on OS X

    CERN Document Server

    Aimonetti, Matt

    2011-01-01

    Want to build native Mac OS X applications with a sleek, developer-friendly alternative to Objective-C? MacRuby is an ideal choice. This in-depth guide shows you how Apple's implementation of Ruby gives you access to all the features available to Objective-C programmers. You'll get clear, detailed explanations of MacRuby, including quick programming techniques such as prototyping. Perfect for programmers at any level, this book is packed with code samples and complete project examples. If you use Ruby, you can tap your skills to take advantage of Interface Builder, Cocoa libraries, the Objec

  12. iMac G3 Blueberry 350MHz

    CERN Multimedia

    2000-01-01

    The iMac G3 is an all-in-one personal computer, encompassing both the monitor and the computer in one package. It allowed to revitalize the Apple brand that was in decline and close to financial ruin. Originally released in striking bondi blue and later a range of other translucent plastic envelopes in bright colors. The iMac comes with a keyboard and mouse matching the color of the case. The iMac G3 was sold from 1998 to 2003 and has been updated many times.

  13. Multichannel MAC Layer In Mobile Ad—Hoc Network

    Science.gov (United States)

    Logesh, K.; Rao, Samba Siva

    2010-11-01

    This paper we presented the design objectives and technical challenges in Multichannel MAC protocols in Mobile Ad-hoc Network. In IEEE 802.11 a/b/g standards allow use of multiple channels, only a single channel is popularly used, due to the lack of efficient protocols that enable use of Multiple Channels. Even though complex environments in ad hoc networks require a combined control of physical (PHY) and medium access control (MAC) layers resources in order to optimize performance. And also we discuss the characteristics of cross-layer frame and give a multichannel MAC approach.

  14. The MacNuclide nuclear data environment

    International Nuclear Information System (INIS)

    Stone, C.A.

    1992-01-01

    Advance in technology have produced intriguing tools that can be applied to problems in nuclear science. Information management in nuclear science is an example of how technology is not quickly exploited. The U.S. Department of Energy supports an extensive program to evaluate published nuclear properties and store them in an electronic data base. Much of the evaluation effort has focused on producing the journal Nuclear Data Sheets and the publication Table of Isotopes. Although the electronic data base can itself be a valuable source of information, the software used to access is was designed using decades-old technologies. The authors of this paper have developed a novel data-base management system for nuclear properties. The application is known as MacNuclide. It is a nuclear data-base environment that uses the highly interactive and intuitive windowing environmentsof desk-top computers. The environment is designed around that image of the chart of nuclides. Questions are posed to the data base by placing constraints on properties and defining collections of nuclides to be used in data-base seraches. Results are displayed either as a simple list of nuclides that meet the imposed constraints or as a color chart of nuclides

  15. Infecting Windows, Linux & Mac in one go

    CERN Multimedia

    Computer Security Team

    2012-01-01

    Still love bashing on Windows as you believe it is an insecure operating system? Hold on a second! Just recently, a vulnerability has been published for Java 7.   It affects Windows/Linux PCs and Macs, Internet Explorer, Safari and Firefox. In fact, it affects all computers that have enabled the Java 7 plug-in in their browser (Java 6 and earlier is not affected). Once you visit a malicious website (and there are plenty already out in the wild), your computer is infected… That's "Game Over" for you.      And this is not the first time. For a while now, attackers have not been targeting the operating system itself, but rather aiming at vulnerabilities inherent in e.g. your Acrobat Reader, Adobe Flash or Java programmes. All these are standard plug-ins added into your favourite web browser which make your web-surfing comfortable (or impossible when you un-install them). A single compromised web-site, however, is sufficient to prob...

  16. Antimicrobial-resistant faecal Escherichia coli in wild mammals in central Europe: multiresistant Escherichia coli producing extended-spectrum ß-lactamases in wild boars

    DEFF Research Database (Denmark)

    Literak, I.; Dolejska, Monika; Radimersky, T.

    2010-01-01

    Aims: To determine the presence of antibiotic-resistant faecal Escherichia coli in populations of wild mammals in the Czech Republic and Slovakia. Methods and Results: Rectal swabs or faeces collected during 2006-2008 from wild mammals were spread on MacConkey agar and MacConkey agar containing 2...... mg l-1 of cefotaxime. From plates with positive growth, one isolate was recovered and identified as E. coli. Susceptibility to 12 antibiotics was tested using the disk diffusion method. Resistance genes, class 1 and 2 integrons and gene cassettes were detected in resistant isolates by polymerase...... of resistant isolates was 6%. Class 1 and 2 integrons with various gene cassettes were recorded in resistant isolates. From wild boars, five (2%, n(rectal smears) = 293) multiresistant isolates producing ESBL were recovered: one isolate with bla(CTX-M-1) + bla(TEM-1), three with bla(CTX-M-1) and one with bla...

  17. Competition at the Wireless Sensor Network MAC Layer: Low Power Probing interfering with X-MAC

    International Nuclear Information System (INIS)

    Zacharias, Sven; Newe, Thomas

    2011-01-01

    Wireless Sensor Networks (WSNs) combine sensors with computer networks and enable very dense, in-situ and live measurements of data over a large area. Since this emerging technology has the potential to be embedded almost everywhere for numberless applications, interference between different networks can become a serious issue. For most WSNs, it is assumed today that the network medium access is non-competitive. On the basis of X-MAC interfered by Low Power Probing, this paper shows the danger and the effects of different sensor networks communicating on a single wireless channel of the 2.4 GHz band, which is used by the IEEE 802.15.4 standard.

  18. Competition at the Wireless Sensor Network MAC Layer: Low Power Probing interfering with X-MAC

    Energy Technology Data Exchange (ETDEWEB)

    Zacharias, Sven; Newe, Thomas, E-mail: Sven.Zacharias@ul.ie [University of Limerick (Ireland)

    2011-08-17

    Wireless Sensor Networks (WSNs) combine sensors with computer networks and enable very dense, in-situ and live measurements of data over a large area. Since this emerging technology has the potential to be embedded almost everywhere for numberless applications, interference between different networks can become a serious issue. For most WSNs, it is assumed today that the network medium access is non-competitive. On the basis of X-MAC interfered by Low Power Probing, this paper shows the danger and the effects of different sensor networks communicating on a single wireless channel of the 2.4 GHz band, which is used by the IEEE 802.15.4 standard.

  19. Competition at the Wireless Sensor Network MAC Layer: Low Power Probing interfering with X-MAC

    Science.gov (United States)

    Zacharias, Sven; Newe, Thomas

    2011-08-01

    Wireless Sensor Networks (WSNs) combine sensors with computer networks and enable very dense, in-situ and live measurements of data over a large area. Since this emerging technology has the potential to be embedded almost everywhere for numberless applications, interference between different networks can become a serious issue. For most WSNs, it is assumed today that the network medium access is non-competitive. On the basis of X-MAC interfered by Low Power Probing, this paper shows the danger and the effects of different sensor networks communicating on a single wireless channel of the 2.4 GHz band, which is used by the IEEE 802.15.4 standard.

  20. Recovery of Lactobacillus bulgaricus and Streptococcus thermophilus on Nine Commonly Used Agar Media1

    Science.gov (United States)

    Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.

    1974-01-01

    Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006

  1. MAC mini acceptance test procedure, software Version 3.0

    International Nuclear Information System (INIS)

    Russell, V.K.

    1994-01-01

    The K Basins Materials Accounting (MAC) programs had some major improvements made to it to organize the main-tables by Location, Canister, and Material. This ATP describes how the code was to be tested to verify its correctness

  2. Mechatronical Aided Concept (MAC) in Intelligent Transport Vehicles Design

    OpenAIRE

    Pavel Pavlasek

    2003-01-01

    This article deals with the principles of synergy effect of mechatronical aided concept (MAC) to the design of intelligent transport vehicles products applying CA technologies and virtual reality design methods. Also includes presentation of intelligent railway vehicle development.

  3. Mac OS X : Tiger edition the missing manual

    CERN Document Server

    Pogue, David

    2005-01-01

    You can set your watch to it: As soon as Apple comes out with another version of Mac OS X, David Pogue hits the streets with another meticulous Missing Manual to cover it with a wealth of detail. The new Mac OS X 10.4, better known as Tiger, is faster than its predecessors, but nothing's too fast for Pogue and Mac OS X: The Missing Manual. There are many reasons why this is the most popular computer book of all time. With its hallmark objectivity, the Tiger Edition thoroughly explores the latest features to grace the Mac OS. Which ones work well and which do not? What should you look for? Th

  4. MAC layer security issues in wireless mesh networks

    Science.gov (United States)

    Reddy, K. Ganesh; Thilagam, P. Santhi

    2016-03-01

    Wireless Mesh Networks (WMNs) have emerged as a promising technology for a broad range of applications due to their self-organizing, self-configuring and self-healing capability, in addition to their low cost and easy maintenance. Securing WMNs is more challenging and complex issue due to their inherent characteristics such as shared wireless medium, multi-hop and inter-network communication, highly dynamic network topology and decentralized architecture. These vulnerable features expose the WMNs to several types of attacks in MAC layer. The existing MAC layer standards and implementations are inadequate to secure these features and fail to provide comprehensive security solutions to protect both backbone and client mesh. Hence, there is a need for developing efficient, scalable and integrated security solutions for WMNs. In this paper, we classify the MAC layer attacks and analyze the existing countermeasures. Based on attacks classification and countermeasures analysis, we derive the research directions to enhance the MAC layer security for WMNs.

  5. Nora Tully MacAlvay--Her Life in the Theatre.

    Science.gov (United States)

    Webb, Dorothy

    1996-01-01

    Recounts the life and times of a pioneer children's theater playwright and fiction author, Nora Tully MacAlvay (1900-86). Points out that her interest in children's theater and children's literature was lifelong and intense. (PA)

  6. MacMillan Pier Transportation Center Feasibility Study.

    Science.gov (United States)

    2006-06-01

    The MacMillan Pier Transportation Center Feasibility Study examines two potential sites (landside and waterside) for a transportation center that provides a range of tourist and traveler information. It would serve as a gateway for Provincetown and t...

  7. After MacIntyre : Kaasaegsest vooruseetikast / Meego Remmel

    Index Scriptorium Estoniae

    Remmel, Meego

    2006-01-01

    Alasdair MacIntyre panus 20. sajandi eetikasse. Tema käsitlus vooruseetikast ja vooruseetilisest perspektiivist, mida on võimalik näha komplekselt, vaadeldes voorust, praktikat, narratiivi ja traditsiooni mõisteid

  8. Big Mac arvestab raha ostujõudu / Harli Uljas

    Index Scriptorium Estoniae

    Uljas, Harli

    2005-01-01

    The Economist võrdleb maailma valuutade suhestamiseks Big Mac'i burgeri hindu 120 riigis, kuna see meetod võimaldab saada ülevaate riikide elanikkonna tegelikust ostujõust. Tabel: Hamburgeri standard

  9. Aeronautical Mobile Airport Communications System (AeroMACS)

    Science.gov (United States)

    Budinger, James M.; Hall, Edward

    2011-01-01

    To help increase the capacity and efficiency of the nation s airports, a secure wideband wireless communications system is proposed for use on the airport surface. This paper provides an overview of the research and development process for the Aeronautical Mobile Airport Communications System (AeroMACS). AeroMACS is based on a specific commercial profile of the Institute of Electrical and Electronics Engineers (IEEE) 802.16 standard known as Wireless Worldwide Interoperability for Microwave Access or WiMAX (WiMax Forum). The paper includes background on the need for global interoperability in air/ground data communications, describes potential AeroMACS applications, addresses allocated frequency spectrum constraints, summarizes the international standardization process, and provides findings and recommendations from the world s first AeroMACS prototype implemented in Cleveland, Ohio, USA.

  10. Speciation of Candida using chromogenic and cornmeal agar with determination of fluconazole sensitivity

    OpenAIRE

    Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli

    2013-01-01

    Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...

  11. Influence of Culture Media on Detection of Carbapenem Hydrolysis by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry.

    Science.gov (United States)

    Ramos, Ana Carolina; Carvalhaes, Cecília Godoy; Cordeiro-Moura, Jhonatha Rodrigo; Rockstroh, Anna Carolina; Machado, Antonia Maria Oliveira; Gales, Ana Cristina

    2016-07-01

    In this study, we evaluated the influence of distinct bacterial growth media on detection of carbapenemase hydrolysis by matrix-assisted laser desorption ionization-time of flight mass spectrometry. False-negative results were observed for OXA-25-, OXA-26-, and OXA-72-producing Acinetobacter baumannii isolates grown on MacConkey agar medium. The other culture media showed 100% sensitivity and 100% specificity for detecting carbapenemase. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. A Mac Protocol Implementation for Wireless Sensor Network

    Directory of Open Access Journals (Sweden)

    Jamila Bhar

    2015-01-01

    Full Text Available IEEE 802.15.4 is an important standard for Low Rate Wireless Personal Area Network (LRWPAN. The IEEE 802.15.4 presents a flexible MAC protocol that provides good efficiency for data transmission by adapting its parameters according to characteristics of different applications. In this research work, some restrictions of this standard are explained and an improvement of traffic efficiency by optimizing MAC layer is proposed. Implementation details for several blocks of communication system are carefully modeled. The protocol implementation is done using VHDL language. The analysis gives a full understanding of the behavior of the MAC protocol with regard to backoff delay, data loss probability, congestion probability, slot effectiveness, and traffic distribution for terminals. Two ideas are proposed and tested to improve efficiency of CSMA/CA mechanism for IEEE 802.15.4 MAC Layer. Primarily, we dynamically adjust the backoff exponent (BE according to queue level of each node. Secondly, we vary the number of consecutive clear channel assessment (CCA for packet transmission. We demonstrate also that slot compensation provided by the enhanced MAC protocol can greatly avoid unused slots. The results show the significant improvements expected by our approach among the IEEE 802.15.4 MAC standards. Synthesis results show also hardware performances of our proposed architecture.

  13. NMR spectroscopy study of agar-based polymers electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica

    2012-07-01

    Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)

  14. Quantitative SIMS Imaging of Agar-Based Microbial Communities.

    Science.gov (United States)

    Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2018-05-01

    After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

  15. Effects of extracellular matrix proteins on macrophage differentiation, growth, and function: comparison of liquid and agar culture systems

    Science.gov (United States)

    Armstrong, J. W.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Both spaceflight and skeletal unloading suppress the haematopoietic differentiation of macrophages (Sonnenfeld et al., Aviat. Space Environ. Med., 61:648-653, 1990; Armstrong et al., J. Appl. Physiol., 75:2734-2739, 1993). The mechanism behind this reduction in haematopoiesis has yet to be elucidated. However, changes in bone marrow extracellular matrix (ECM) may be involved. To further understand the role of ECM products in macrophage differentiation, we have performed experiments evaluating the effects of fibronectin, laminin, collagen type I, and collagen type IV on macrophage development and function. Bone marrow-derived macrophages cultured on four different ECM substrates in liquid culture medium showed less growth than those cultured on plastic. Significant morphological differences were seen on each of the substrates used. Phenotypically and functionally, as measured by class II major histocompatibility molecule (MHCII) expression, MAC-2 expression, and the secretion of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha), these macrophages were similar. In contrast, bone marrow-derived macrophages cultured in suspension, using agar, showed no difference in growth when exposed to ECM proteins. However, IL-6 and TNF-alpha secretion was affected by fibronectin, laminin, collagen type I, and collagen type IV in a concentration-dependent manner. We conclude that the ECM products fibronectin, laminin, collagen type I, and collagen type IV have profound effects on macrophage development and function. Additionally, we suggest that an ECM-supplemented agar culture system provides an environment more analogous to in vivo bone marrow than does a traditional liquid culture system.

  16. Connectivity-Based Reliable Multicast MAC Protocol for IEEE 802.11 Wireless LANs

    Directory of Open Access Journals (Sweden)

    Woo-Yong Choi

    2009-01-01

    Full Text Available We propose the efficient reliable multicast MAC protocol based on the connectivity information among the recipients. Enhancing the BMMM (Batch Mode Multicast MAC protocol, the reliable multicast MAC protocol significantly reduces the RAK (Request for ACK frame transmissions in a reasonable computational time and enhances the MAC performance. By the analytical performance analysis, the throughputs of the BMMM protocol and our proposed MAC protocol are derived. Numerical examples show that our proposed MAC protocol increases the reliable multicast MAC performance for IEEE 802.11 wireless LANs.

  17. The routine use of modified Borelli's lactritmel agar (MBLA).

    Science.gov (United States)

    Kaminski, G W

    1985-07-01

    The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.

  18. Learning Unix for Mac OS X Tiger Unlock the Power of Unix

    CERN Document Server

    Taylor, Dave

    2005-01-01

    Thoroughly revised and updated for Mac OS X Tiger, this new edition introduces Mac users to the Terminal application and shows you how to navigate the command interface, explore hundreds of Unix applications that come with the Mac, and, most importantly, how to take advantage of both the Mac and Unix interfaces. If you want to master the command-line, this gentle guide to using Unix on Mac OS X Tiger is well worth its cover price

  19. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  20. Element distribution of the barley plant grown in an agar slice suspended culture

    International Nuclear Information System (INIS)

    Makino-Nakanishi, Tomoko; Matsumoto, Satoshi

    1991-01-01

    An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)

  1. Comparative study of bio-ethanol production from mahula (Madhuca latifolia L.) flowers by Saccharomyces cerevisiae cells immobilized in agar agar and Ca-alginate matrices

    Energy Technology Data Exchange (ETDEWEB)

    Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)

    2010-01-15

    Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)

  2. Victor Bérard et la Macédoine

    Directory of Open Access Journals (Sweden)

    Ivan Savev

    2011-01-01

    Full Text Available Un helléniste convaincu, Victor Bérard, en vient, au début du XXe siècle à soutenir l’existence de « Macédoniens » et le slogan « la Macédoine aux Macédoniens”.Le Congrès de Berlin en 1878 avait laissé la Macédoine aux mains des Ottomans. La Grèce, la Serbie et la Bulgarie, parvenues à ses limites et prévoyant le retrait futur des Ottomans peaufinent les arguments linguistiques et historiques qui justifieront leurs revendications territoriales. Victor Bérard, un helléniste respecté et bon connaisseur de la région sud balkanique, effectue des enquêtes en Macédoine en 1896 et 1903 qu’il publie à Paris.Cette étude montre comment, dans le contexte de la propagande nationaliste des prétendants à la possession de la Macédoine, Victor Bérard en vient progressivement à affirmer qu’il existe une population autochtone, les Macédoniens. Il soutient leur programme pour la constitution d’une fédération ou confédération avec le slogan « la Macédoine aux Macédoniens » ce qui fait toute l’actualité de ses ouvrages.In 1878, the Congress of Berlin had left Macedonia in the hands of the Ottomans. Greece, Serbia and Bulgaria had reached its limits. Anticipating the Ottoman retreat, they polish language and historical arguments that will justify their territorial claims. Victor Bérard, a respected Hellenist and a good expert of the southern Balkans, is doing researches in Macedonia in 1896 and 1903. These will be later published in Paris.This study shows how, in the context of the nationalist propaganda build-up made by the candidates for the possession of Macedonia, Victor Bérard comes progressively to assert the existence of a native population: the Macedonians. He supports their program for the forming of a federation or confederation which slogan would be “Macedonia to Macedonians”. This makes his works very topical.

  3. Design and FPGA implementation for MAC layer of Ethernet PON

    Science.gov (United States)

    Zhu, Zengxi; Lin, Rujian; Chen, Jian; Ye, Jiajun; Chen, Xinqiao

    2004-04-01

    Ethernet passive optical network (EPON), which represents the convergence of low-cost, high-bandwidth and supporting multiple services, appears to be one of the best candidates for the next-generation access network. The work of standardizing EPON as a solution for access network is still underway in the IEEE802.3ah Ethernet in the first mile (EFM) task force. The final release is expected in 2004. Up to now, there has been no standard application specific integrated circuit (ASIC) chip available which fulfills the functions of media access control (MAC) layer of EPON. The MAC layer in EPON system has many functions, such as point-to-point emulation (P2PE), Ethernet MAC functionality, multi-point control protocol (MPCP), network operation, administration and maintenance (OAM) and link security. To implement those functions mentioned above, an embedded real-time operating system (RTOS) and a flexible programmable logic device (PLD) with an embedded processor are used. The software and hardware functions in MAC layer are realized through programming embedded microprocessor and field programmable gate array(FPGA). Finally, some experimental results are given in this paper. The method stated here can provide a valuable reference for developing EPON MAC layer ASIC.

  4. Calibration of the BASS acoustic current meter with carrageenan agar

    Science.gov (United States)

    Morrison, A.T.; Williams, A.J.; Martini, M.

    1993-01-01

    The BASS current meter can measure currents down to the millimeter per second range. Due to the dependence of zero offset on pressure, determining a sensor referenced velocity requires accurate in situ zeroing of the meter. Previously, flow was restricted during calibration by placing plastic bags around the acoustic volume. In this paper, bacterial grade and carrageenan agars are used in the laboratory to create a zero flow condition during calibration and are shown to be acoustically transparent. Additionally, the results of open ocean and dockside carrageenan and plastic bag comparisons are presented. Carrageenan is shown to reliably provide a low noise, zero mean flow environment that is largely independent of ambient conditions. The improved zeros make millimeter per second accuracy possible under field conditions.

  5. Dolphin natures, human virtues: MacIntyre and ethical naturalism.

    Science.gov (United States)

    Glackin, Shane Nicholas

    2008-09-01

    Can biological facts explain human morality? Aristotelian 'virtue' ethics has traditionally assumed so. In recent years Alasdair MacIntyre has reintroduced a form of Aristotle's 'metaphysical biology' into his ethics. He argues that the ethological study of dependence and rationality in other species--dolphins in particular--sheds light on how those same traits in the typical lives of humans give rise to the moral virtues. However, some goal-oriented dolphin behaviour appears both dependent and rational in the precise manner which impresses MacIntyre, yet anything but ethically 'virtuous'. More damningly, dolphin ethologists consistently refuse to evaluate such behaviour in the manner MacIntyre claims is appropriate to moral judgement. In light of this, I argue that virtues--insofar as they name a biological or ethological category--do not name a morally significant one.

  6. Office for iPad and Mac for dummies

    CERN Document Server

    Weverka, Peter

    2015-01-01

    The easy way to work with Office on your iPad or Mac Are you a Mac user who isn't accustomed to working with Microsoft Office? Consider this friendly guide your go-to reference! Written in plain English and packed with easy-to-follow, step-by-step instructions, Office for iPad and Mac For Dummies walks you through every facet of Office, from installing the software and opening files to working with Word, Excel, PowerPoint, and Outlook-and beyond. Plus, you'll discover how to manage files, share content and collaborate online through social media, and find help when you need it. Two things a

  7. Performance analysis and improvement of WPAN MAC for home networks.

    Science.gov (United States)

    Mehta, Saurabh; Kwak, Kyung Sup

    2010-01-01

    The wireless personal area network (WPAN) is an emerging wireless technology for future short range indoor and outdoor communication applications. The IEEE 802.15.3 medium access control (MAC) is proposed to coordinate the access to the wireless medium among the competing devices, especially for short range and high data rate applications in home networks. In this paper we use analytical modeling to study the performance analysis of WPAN (IEEE 802.15.3) MAC in terms of throughput, efficient bandwidth utilization, and delay with various ACK policies under error channel condition. This allows us to introduce a K-Dly-ACK-AGG policy, payload size adjustment mechanism, and Improved Backoff algorithm to improve the performance of the WPAN MAC. Performance evaluation results demonstrate the impact of our improvements on network capacity. Moreover, these results can be very useful to WPAN application designers and protocol architects to easily and correctly implement WPAN for home networking.

  8. Performance Analysis and Improvement of WPAN MAC for Home Networks

    Directory of Open Access Journals (Sweden)

    Saurabh Mehta

    2010-03-01

    Full Text Available The wireless personal area network (WPAN is an emerging wireless technology for future short range indoor and outdoor communication applications. The IEEE 802.15.3 medium access control (MAC is proposed to coordinate the access to the wireless medium among the competing devices, especially for short range and high data rate applications in home networks. In this paper we use analytical modeling to study the performance analysis of WPAN (IEEE 802.15.3 MAC in terms of throughput, efficient bandwidth utilization, and delay with various ACK policies under error channel condition. This allows us to introduce a K-Dly-ACK-AGG policy, payload size adjustment mechanism, and Improved Backoff algorithm to improve the performance of the WPAN MAC. Performance evaluation results demonstrate the impact of our improvements on network capacity. Moreover, these results can be very useful to WPAN application designers and protocol architects to easily and correctly implement WPAN for home networking.

  9. Activity Modelling and Comparative Evaluation of WSN MAC Security Attacks

    DEFF Research Database (Denmark)

    Pawar, Pranav M.; Nielsen, Rasmus Hjorth; Prasad, Neeli R.

    2012-01-01

    and initiate security attacks that disturb the normal functioning of the network in a severe manner. Such attacks affect the performance of the network by increasing the energy consumption, by reducing throughput and by inducing long delays. Of all existing WSN attacks, MAC layer attacks are considered...... the most harmful as they directly affect the available resources and thus the nodes’ energy consumption. The first endeavour of this paper is to model the activities of MAC layer security attacks to understand the flow of activities taking place when mounting the attack and when actually executing it....... The second aim of the paper is to simulate these attacks on hybrid MAC mechanisms, which shows the performance degradation of aWSN under the considered attacks. The modelling and implementation of the security attacks give an actual view of the network which can be useful in further investigating secure...

  10. SACRB-MAC: A High-Capacity MAC Protocol for Cognitive Radio Sensor Networks in Smart Grid.

    Science.gov (United States)

    Yang, Zhutian; Shi, Zhenguo; Jin, Chunlin

    2016-03-31

    The Cognitive Radio Sensor Network (CRSN) is considered as a viable solution to enhance various aspects of the electric power grid and to realize a smart grid. However, several challenges for CRSNs are generated due to the harsh wireless environment in a smart grid. As a result, throughput and reliability become critical issues. On the other hand, the spectrum aggregation technique is expected to play an important role in CRSNs in a smart grid. By using spectrum aggregation, the throughput of CRSNs can be improved efficiently, so as to address the unique challenges of CRSNs in a smart grid. In this regard, we proposed Spectrum Aggregation Cognitive Receiver-Based MAC (SACRB-MAC), which employs the spectrum aggregation technique to improve the throughput performance of CRSNs in a smart grid. Moreover, SACRB-MAC is a receiver-based MAC protocol, which can provide a good reliability performance. Analytical and simulation results demonstrate that SACRB-MAC is a promising solution for CRSNs in a smart grid.

  11. Vehicle Health Management Communications Requirements for AeroMACS

    Science.gov (United States)

    Kerczewski, Robert J.; Clements, Donna J.; Apaza, Rafael D.

    2012-01-01

    As the development of standards for the aeronautical mobile airport communications system (AeroMACS) progresses, the process of identifying and quantifying appropriate uses for the system is progressing. In addition to defining important elements of AeroMACS standards, indentifying the systems uses impacts AeroMACS bandwidth requirements. Although an initial 59 MHz spectrum allocation for AeroMACS was established in 2007, the allocation may be inadequate; studies have indicated that 100 MHz or more of spectrum may be required to support airport surface communications. Hence additional spectrum allocations have been proposed. Vehicle health management (VHM) systems, which can produce large volumes of vehicle health data, were not considered in the original bandwidth requirements analyses, and are therefore of interest in supporting proposals for additional AeroMACS spectrum. VHM systems are an emerging development in air vehicle safety, and preliminary estimates of the amount of data that will be produced and transmitted off an aircraft, both in flight and on the ground, have been prepared based on estimates of data produced by on-board vehicle health sensors and initial concepts of data processing approaches. This allowed an initial estimate of VHM data transmission requirements for the airport surface. More recently, vehicle-level systems designed to process and analyze VHM data and draw conclusions on the current state of vehicle health have been undergoing testing and evaluation. These systems make use of vehicle system data that is mostly different from VHM data considered previously for airport surface transmission, and produce processed system outputs that will be also need to be archived, thus generating additional data load for AeroMACS. This paper provides an analysis of airport surface data transmission requirements resulting from the vehicle level reasoning systems, within the context of overall VHM data requirements.

  12. Mapping of MAC Address with Moving WiFi Scanner

    Directory of Open Access Journals (Sweden)

    Arief Hidayat

    2017-10-01

    Full Text Available Recently, Wifi is one of the most useful technologies that can be used for detecting and counting MAC Address. This paper described using of WiFi scanner which carried out seven times circulated the bus. The method used WiFi and GPS are to counting MAC address as raw data from the pedestrian smartphone, bus passenger or WiFi devices near from the bus as long as the bus going around the route. There are seven processes to make map WiFi data.

  13. MacVEE - the intimate Macintosh-VME system

    International Nuclear Information System (INIS)

    Taylor, B.G.

    1986-01-01

    The marriage of a mass-produced personal computer with the versatile VMEbus and CAMAC systems creates a cost-effective solution to many laboratory small system requirements. This paper describes MacVEE (Microcomputer Applied to the Control of VME Electronic Equipment), a novel system in which an Apple Macintosh computer is equipped with a special interface which allows it direct memory-mapped access to single or multiple VME and CAMAC crates interconnected by a ribbon cable bus. The bus is driven by an electronics plinth called MacPlinth, which attaches to the computer and becomes an integral part of it. (Auth.)

  14. MacIntyre's Moral Theory and Moral Relativism

    OpenAIRE

    Ali Abedi Renani

    2017-01-01

    In this paper, I seek to explain the similarity and disparity between MacIntyre’s moral theory and moral relativism. I will argue that MacIntyre’s moral theory can escape the charge of moral relativism because both his earlier social and his later metaphysical approaches appeal to some criteria, the human telos or universal human qualities respectively. The notion of telos is wider than the notion of function which is defined in social contexts. If there is a context-transcending notion of te...

  15. Comparison of different fungal agar for the environmental monitoring of pharmaceutical-grade cleanrooms.

    Science.gov (United States)

    Gebala, Barbara; Sandle, Tim

    2013-01-01

    In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.

  16. EVALUACIÓN POR MÉTODO ECOMÉTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS

    Directory of Open Access Journals (Sweden)

    A. Villalobos

    2007-12-01

    Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.

  17. Directional Medium Access Control (MAC Protocols in Wireless Ad Hoc and Sensor Networks: A Survey

    Directory of Open Access Journals (Sweden)

    David Tung Chong Wong

    2015-06-01

    Full Text Available This survey paper presents the state-of-the-art directional medium access control (MAC protocols in wireless ad hoc and sensor networks (WAHSNs. The key benefits of directional antennas over omni-directional antennas are longer communication range, less multipath interference, more spatial reuse, more secure communications, higher throughput and reduced latency. However, directional antennas lead to single-/multi-channel directional hidden/exposed terminals, deafness and neighborhood, head-of-line blocking, and MAC-layer capture which need to be overcome. Addressing these problems and benefits for directional antennas to MAC protocols leads to many classes of directional MAC protocols in WAHSNs. These classes of directional MAC protocols presented in this survey paper include single-channel, multi-channel, cooperative and cognitive directional MACs. Single-channel directional MAC protocols can be classified as contention-based or non-contention-based or hybrid-based, while multi-channel directional MAC protocols commonly use a common control channel for control packets/tones and one or more data channels for directional data transmissions. Cooperative directional MAC protocols improve throughput in WAHSNs via directional multi-rate/single-relay/multiple-relay/two frequency channels/polarization, while cognitive directional MAC protocols leverage on conventional directional MAC protocols with new twists to address dynamic spectrum access. All of these directional MAC protocols are the pillars for the design of future directional MAC protocols in WAHSNs.

  18. Link-layer Jamming Attacks on S-MAC

    NARCIS (Netherlands)

    Law, Y.W.; Hartel, Pieter H.; den Hartog, Jeremy; Havinga, Paul J.M.

    2004-01-01

    We argue that among denial-of-service (DoS) attacks, link-layer jamming is a more attractive option to attackers than radio jamming is. By exploiting the semantics of the link-layer protocol (aka MAC protocol), an attacker can achieve better efficiency than blindly jamming the radio signals alone.

  19. Link-layer jamming attacks on S-MAC

    NARCIS (Netherlands)

    Law, Y.W.; Hartel, Pieter H.; den Hartog, Jeremy; Havinga, Paul J.M.

    We argue that among denial-of-service (DoS) attacks, link-layer jamming is a more attractive option to attackers than radio jamming is. By exploiting the semantics of the link-layer protocol (aka MAC protocol), an attacker can achieve better efficiency than blindly jamming the radio signals alone.

  20. Traffic Adaptive MAC Protocols in Wireless Body Area Networks

    Directory of Open Access Journals (Sweden)

    Farhan Masud

    2017-01-01

    Full Text Available In Wireless Body Area Networks (WBANs, every healthcare application that is based on physical sensors is responsible for monitoring the vital signs data of patient. WBANs applications consist of heterogeneous and dynamic traffic loads. Routine patient’s observation is described as low-load traffic while an alarming situation that is unpredictable by nature is referred to as high-load traffic. This paper offers a thematic review of traffic adaptive Medium Access Control (MAC protocols in WBANs. First, we have categorized them based on their goals, methods, and metrics of evaluation. The Zigbee standard IEEE 802.15.4 and the baseline MAC IEEE 802.15.6 are also reviewed in terms of traffic adaptive approaches. Furthermore, a comparative analysis of the protocols is made and their performances are analyzed in terms of delay, packet delivery ratio (PDR, and energy consumption. The literature shows that no review work has been done on traffic adaptive MAC protocols in WBANs. This review work, therefore, could add enhancement to traffic adaptive MAC protocols and will stimulate a better way of solving the traffic adaptivity problem.

  1. God, Sport Philosophy, Kinesiology: A MacIntyrean Examination

    Science.gov (United States)

    Twietmeyer, Gregg

    2015-01-01

    Sport philosophy is in crisis. This subdiscipline of kinesiology garners little to no respect and few tenure track lines in kinesiology departments. Why is this the case? Why isn't philosophy held in greater esteem? Is it possible that philosopher Alasdair MacIntyre's (2009) diagnosis found in "God, Philosophy, Universities" could…

  2. Florence Jessie MacWilliams (1917-1990)

    Indian Academy of Sciences (India)

    famous mathematician Oscar Zariski, well known for his work in algebraic geometry, at. Johns Hopkins University, following him to Harvard University to study with him for a year. There was a break in her studies for many years following her marriage in 1941 to. W al ter Mac Williams, an engineer, and the birth and raising of ...

  3. Evaluation of the MacDonald scabbler for highway use.

    Science.gov (United States)

    1975-01-01

    The MacDonald Scabbler is a small, hand held machine suitable for use in cleaning and roughening concrete surfaces, It weighs 308 pounds (140 kg), has 11 cutting heads, and, as a power source, requires a compressor capable of delivering 365 cubic foo...

  4. Integrated, Kerberized Login on MacOS X

    Science.gov (United States)

    Hotz, Henry B.

    2006-01-01

    Context for this information. MacOS X login process and available hooks. Authorization Services configuration. Authorization Services plug-in s. Kerberos plug-in s. Other bugs and recommendations. Authorization Services Called by loginwindow, screen saver and fast user switching. It calls Directory Services, Login Hook, and Login Items (System Preferences).

  5. Increasing the permeability of Escherichia coli using MAC13243

    DEFF Research Database (Denmark)

    Muheim, Claudio; Götzke, Hansjörg; Eriksson, Anna U.

    2017-01-01

    molecules that make the outer membrane of Escherichia coli more permeable. We identified MAC13243, an inhibitor of the periplasmic chaperone LolA that traffics lipoproteins from the inner to the outer membrane. We observed that cells were (1) more permeable to the fluorescent probe 1-N...

  6. Mechatronical Aided Concept (MAC in Intelligent Transport Vehicles Design

    Directory of Open Access Journals (Sweden)

    Pavel Pavlasek

    2003-01-01

    Full Text Available This article deals with the principles of synergy effect of mechatronical aided concept (MAC to the design of intelligent transport vehicles products applying CA technologies and virtual reality design methods. Also includes presentation of intelligent railway vehicle development.

  7. MAC mini acceptance test procedures, software Version 3.3

    International Nuclear Information System (INIS)

    Russell, V.K.

    1994-01-01

    The K Basins Materials Accounting (MAC) programs had some improvements made to it to to change slightly the access authorized users had to the modification of critical data. This ATP describes how the code was to be tested to verify its correctness

  8. Screening agars for MRSA: evaluation of a stepwise diagnostic approach with two different selective agars for the screening for methicillin-resistant Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen

    2015-01-01

    Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low

  9. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ²-lactamase. A total of 96.5% of ²-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 µgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 µgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 µgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 µgml-1 for cefoxitin, < 0.06 µgml-1 for cefotaxime, < 0.25 µgml-1 for norfloxacin, < 10 µgml-1 for cephaloridine, < 10 µgml-1 for cephalexin, and < 50 µgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucumán, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucumán since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  10. Heavy metal accumulation by carrageenan and agar producing algae

    Energy Technology Data Exchange (ETDEWEB)

    Burdin, K.S. [Moscow State Univ. (Russian Federation). Faculty of Biology; Bird, K.T. [North Carolina Univ., Wilmington, NC (United States). Center for Marine Science Research

    1994-09-01

    The accumulation of six heavy metals Cu, Cd, Ni, Zn, Mn and Pb was measured in living and lzophilized algal thalli. The agar producing algae were Gracilaria tikvahiae and Gelidium pusillum. The carrageenan producing macroalgae were Agardhiella subulata and the gametophyte and tetrasporophyte phases of Chondrus crispus. These produce primarily iota, kappa and lambda carrageenans, respectively. At heavy metal concentrations of 0.5 mg L{sup -1}, living thalli of Gracilaria tikvahiae generally showed the greatest amount of accumulation of the 6 heavy metals tested. The accumulation of Pb was greater in the living thalli of all four species than in the lyophilized thalli. Except for Agardhiella subulata, lyophilized thalli showed greater accumulation of Ni, Cu and Zn. There was no difference in heavy metal accumulation between living and lyophilized thalli in the accumulation of Cd. Manganese showed no accumulation at the tested concentration. There did not appear to be a relationship between algal hydrocolloid characteristics and the amounts of heavy metals accumulated. (orig.)

  11. TR-MAC: an energy-efficient MAC protocol for wireless sensor networks exploiting noise-based transmitted reference modulation

    NARCIS (Netherlands)

    Morshed, S.; Dimitrova, D.C.; Brogle, M.; Braun, T.; Heijenk, Gerhard J.

    Energy-constrained behavior of sensor nodes is one of the most important criteria for successful deployment of wireless sensor net- works. The medium access control (MAC) protocol determines the time a sensor node transceiver spends listening or transmitting, and hence the energy consumption of the

  12. Library Signage: Applications for the Apple Macintosh and MacPaint.

    Science.gov (United States)

    Diskin, Jill A.; FitzGerald, Patricia

    1984-01-01

    Describes specific applications of the Macintosh computer at Carnegie-Mellon University Libraries, where MacPaint was used as a flexible, easy to use, and powerful tool to produce informational, instructional, and promotional signage. Profiles of system hardware and software, an evaluation of the computer program MacPaint, and MacPaint signage…

  13. Design of an autonomous decentralized MAC protocol for wireless sensor networks

    NARCIS (Netherlands)

    van Hoesel, L.F.W.; Dal Pont, L.; Havinga, Paul J.M.

    In this document the design of a MAC protocol for wireless sensor networks is discussed. The autonomous decentralized TDMA based MAC protocol minimizes power consumtion by efficiency implementing unicast/omnicast, scheduled rendezvous times and wakeup calls. The MAC protocol is an ongoing research

  14. Teaching a Classic for All Ages: Fairy Tales and Stories of George MacDonald.

    Science.gov (United States)

    Sadler, Glenn Edward

    1995-01-01

    Discusses the life and writings of George MacDonald (1824-1905). Suggests that the most striking feature of MacDonald's children's books is his sensitivity toward spiritual values and the power of change within the lives of his characters. Appends a list of questions to stimulate student response to MacDonald's writings. (RS)

  15. Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.

    Science.gov (United States)

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F

    2012-12-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  16. Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7

    OpenAIRE

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.

    2012-01-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  17. Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme

    Directory of Open Access Journals (Sweden)

    Murdinah murdinah

    2008-06-01

    Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121°C dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.

  18. Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.

    Science.gov (United States)

    Chang, S S; Park, S H; Kang, D H

    2013-06-03

    The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms

    NARCIS (Netherlands)

    Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart

    2016-01-01

    Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.

  20. McMAC: Towards a MAC Protocol with Multi-Constrained QoS Provisioning for Diverse Traffic in Wireless Body Area Networks

    OpenAIRE

    Monowar, Muhammad; Hassan, Mohammad; Bajaber, Fuad; Al-Hussein, Musaed; Alamri, Atif

    2012-01-01

    The emergence of heterogeneous applications with diverse requirements for resource-constrained Wireless Body Area Networks (WBANs) poses significant challenges for provisioning Quality of Service (QoS) with multi-constraints (delay and reliability) while preserving energy efficiency. To address such challenges, this paper proposes McMAC, a MAC protocol with multi-constrained QoS provisioning for diverse traffic classes in WBANs. McMAC classifies traffic based on their multi-constrained QoS de...

  1. Una lectura interpretativa de Tras la virtud, de Alasdair MacIntyre - An Interpretive Reading of After Virtue, by Alasdair MacIntyre

    Directory of Open Access Journals (Sweden)

    Fernando Fernández-Llebrez

    2010-12-01

    Full Text Available This article centers on the thought of Alasdair MacIntyre, whose most prominente work, After Virtue, is considered a classic of political science. In contrast with other reviews, this article will examine After Virtue within the broader context of MacIntyre’s thinking and publications. An overview of MacIntyre’s literary corpus and the evolution of his thinking will shed light on the volume examined and trace certain ideas that are characteristic of this Scottish political philosopher. Matters that remained unsettled in After Virtue have become over time more defined in MacIntyre’s thinking, such as the influence exerted upon him by Thomas Aquinas.

  2. Mac OS X Snow Leopard for Power Users Advanced Capabilities and Techniques

    CERN Document Server

    Granneman, Scott

    2010-01-01

    Mac OS X Snow Leopard for Power Users: Advanced Capabilities and Techniques is for Mac OS X users who want to go beyond the obvious, the standard, and the easy. If want to dig deeper into Mac OS X and maximize your skills and productivity using the world's slickest and most elegant operating system, then this is the book for you. Written by Scott Granneman, an experienced teacher, developer, and consultant, Mac OS X for Power Users helps you push Mac OS X to the max, unveiling advanced techniques and options that you may have not known even existed. Create custom workflows and apps with Automa

  3. Affordability of cataract surgery using the Big Mac prices

    OpenAIRE

    Van C. Lansingh; Marissa J. Carter; Kristen A. Eckert; Kevin L. Winthrop; João M. Furtado; Serge Resnikoff

    2015-01-01

    Purpose: One barrier to cataract surgery is its high price in some countries. This study aims to understand to what extent the price of cataract surgery is over- or undervalued and whether it varies in relation to GDP using The Economist newspaper Big Mac Index (BMcI) methodology, which measures the purchasing power parity between different currencies. Methods: Peer-reviewed articles containing information on cataract surgery prices were searched from 1993 to June 2012 in databases. Ophtha...

  4. ITER management advisory committee (MAC) meeting in Naka

    International Nuclear Information System (INIS)

    Yoshikawa, M.

    2000-01-01

    The ITER Management Advisory Committee (MAC) Meeting was held on 28 June 2000 in Moskow, Russia. The main topics were the consideration of the report by the director on the ITER EDA status, the review of the work program, the review of the joint fund, the review of a schedule of ITER meetings and initial discussion and consideration on the disposition of R and D hardware and facilities and other dispositions relating to the termination of the EDA

  5. Detomidine reduces isoflurane anesthetic requirement (MAC) in horses.

    Science.gov (United States)

    Steffey, Eugene P; Pascoe, Peter J

    2002-10-01

    To quantitate the dose- and time-related magnitude of the anesthetic sparing effect of, and selected physiological responses to detomidine during isoflurane anesthesia in horses. Randomized cross-over study. Three, healthy, young adult horses weighing 485 ± 14 kg. Horses were anesthetized on two occasions to determine the minimum alveolar concentration (MAC) of isoflurane in O 2 and then to measure the anesthetic sparing effect (time-related MAC reduction) following IV detomidine (0.03 and 0.06 mg kg -1 ). Selected common measures of cardiopulmonary function, blood glucose and urinary output were also recorded. Isoflurane MAC was 1.44 ± 0.07% (mean ± SEM). This was reduced by 42.8 ± 5.4% and 44.8 ± 3.0% at 83 ± 23 and 125 ± 36 minutes, respectively, following 0.03 and 0.06 mg kg -1 , detomidine. The MAC reduction was detomidine dose- and time-dependent. There was a tendency for mild cardiovascular and respiratory depression, especially following the higher detomidine dose. Detomidine increased both blood glucose and urine flow; the magnitude of these changes was time- and dose-dependent CONCLUSIONS: Detomidine reduces anesthetic requirement for isoflurane and increases blood glucose concentration and urine flow in horses. These changes were dose- and time-related. The results imply potent anesthetic sparing actions by detomidine. The detomidine-related increased urine flow should be considered in designing anesthetic protocols for individual horses. Copyright © 2002 Association of Veterinary Anaesthetists and American College of Veterinary Anesthesia and Analgesia. Published by Elsevier Ltd. All rights reserved.

  6. Performance of MAC protocols in beaconing Mobile Adhoc Multibroadcast Networks

    OpenAIRE

    Rico García, Cristina; Lehner, Andreas; Robertson, Patrick; Strang, Thomas

    2010-01-01

    The investigation of infrastructureless safety applications in dierent transportation systems is a hot research topic. The nodes in thevnetwork are designed to advertise to the rest of the nodes informationabout the current traffic situation by means of short beacon messages containing speed, direction, positions and other relevant safety information. The scheduling should be organized by the MAC layer so that the transmitted messages arrive successfully as soon as possible at the recei...

  7. LHC@home online tutorial for Mac users - recording

    CERN Multimedia

    CERN. Geneva

    2016-01-01

    A step-by-step online tutorial about LHC@home for Mac users by Alexandre Racine. It contains detailed instructions on how-to-join this volunteer computing project.  There are 3 screen capture videos with the real installation process accelerated attached to the event page. This 5' video is linked from http://lhcathome.web.cern.ch/join-us Also from the CDS e-learning category.

  8. MacWilliams Identity for M-Spotty Weight Enumerator

    Science.gov (United States)

    Suzuki, Kazuyoshi; Fujiwara, Eiji

    M-spotty byte error control codes are very effective for correcting/detecting errors in semiconductor memory systems that employ recent high-density RAM chips with wide I/O data (e.g., 8, 16, or 32bits). In this case, the width of the I/O data is one byte. A spotty byte error is defined as random t-bit errors within a byte of length b bits, where 1 le t ≤ b. Then, an error is called an m-spotty byte error if at least one spotty byte error is present in a byte. M-spotty byte error control codes are characterized by the m-spotty distance, which includes the Hamming distance as a special case for t =1 or t = b. The MacWilliams identity provides the relationship between the weight distribution of a code and that of its dual code. The present paper presents the MacWilliams identity for the m-spotty weight enumerator of m-spotty byte error control codes. In addition, the present paper clarifies that the indicated identity includes the MacWilliams identity for the Hamming weight enumerator as a special case.

  9. Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.

    Science.gov (United States)

    Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon

    2017-07-01

    Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.

  10. AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM

    Directory of Open Access Journals (Sweden)

    SIEW-LING HII

    2016-07-01

    Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.

  11. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.

    Science.gov (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong

    2015-01-01

    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  12. MacA, a periplasmic membrane fusion protein of the macrolide transporter MacAB-TolC, binds lipopolysaccharide core specifically and with high affinity.

    Science.gov (United States)

    Lu, Shuo; Zgurskaya, Helen I

    2013-11-01

    The Escherichia coli MacAB-TolC transporter has been implicated in efflux of macrolide antibiotics and secretion of enterotoxin STII. In this study, we found that purified MacA, a periplasmic membrane fusion protein, contains one tightly bound rough core lipopolysaccharide (R-LPS) molecule per MacA molecule. R-LPS was bound specifically to MacA protein with affinity exceeding that of polymyxin B. Sequence analyses showed that MacA contains two high-density clusters of positively charged amino acid residues located in the cytoplasmic N-terminal domain and the periplasmic C-terminal domain. Substitutions in the C-terminal cluster reducing the positive-charge density completely abolished binding of R-LPS. At the same time, these substitutions significantly reduced the functionality of MacA in the protection of E. coli against macrolides in vivo and in the in vitro MacB ATPase stimulation assays. Taken together, our results suggest that R-LPS or a similar glycolipid is a physiological substrate of MacAB-TolC.

  13. Identification and discrimination of Pseudomonas aeruginosa bacteria grown in blood and bile by laser-induced breakdown spectroscopy

    International Nuclear Information System (INIS)

    Rehse, Steven J.; Diedrich, Jonathan; Palchaudhuri, Sunil

    2007-01-01

    Pseudomonas aeruginosa bacteria colonies have been analyzed by laser-induced breakdown spectroscopy using nanosecond laser pulses. LIBS spectra were obtained after transferring the bacteria from a nutrient-rich culture medium to a nutrient-free agar plate for laser ablation. To study the dependence of the LIBS spectrum on growth and environmental conditions, colonies were cultured on three different nutrient media: a trypticase soy agar (TSA) plate, a blood agar plate, and a medium chosen deliberately to induce bacteria membrane changes, a MacConkey agar plate containing bile salts. Nineteen atomic and ionic emission lines in the LIBS spectrum, which was dominated by inorganic elements such as calcium, magnesium and sodium, were used to identify and classify the bacteria. A discriminant function analysis was used to discriminate between the P. aeruginosa bacteria and two strains of E. coli: a non-pathogenic environmental strain and the pathogenic strain enterohemorrhagic E. coli 0157:H7 (EHEC). Nearly identical spectra were obtained from P. aeruginosa grown on the TSA plate and the blood agar plate, while the bacteria grown on the MacConkey plate exhibited easily distinguishable differences from the other two. All P. aeruginosa samples, independent of initial growth conditions, were readily discriminated from the two E. coli strains

  14. Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)

    2010-11-05

    Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.

  15. Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)

    1997-04-01

    Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.

  16. TMAC: Timestamp-Ordered MAC Protocol for Wireless Mesh Networks

    KAUST Repository

    Nawab, Faisal

    2011-05-01

    Wireless Mesh Networks (WMNs) have emerged to meet a need for a self-organized and self-configured multi-hop wireless network infrastructure. Low cost infrastructure and ease of deployment have made WMNs an attractive technology for last mile access. However, 802.11 based WMNs are subject to serious fairness issues. With backlogged TCP traffic, nodes which are two or more hops away from the gateway are subject to starvation, while the one-hop away node saturates the channel with its own local traffic. We study the interactions of TCP and IEEE 802.11 MAC in WMNs to aid us in understanding and overcoming the unfairness problem. We propose a Markov chain to capture the behavior of TCP sessions, particularly the impact on network throughput performance due to the effect of queue utilization and packet relaying. A closed form solution is derived to numerically derive the throughput. Based on the developed model, we propose a distributed MAC protocol called Timestamp-ordered MAC (TMAC), aiming to alleviate the unfairness problem in WMNs via a manipulative per-node scheduling mechanism which takes advantage of the age of each packet as a priority metric. Simulation is conducted to validate our model and to illustrate the fairness characteristics of TMAC. Our results show that TMAC achieves excellent resource allocation fairness while maintaining above 90% of maximum link capacity in parking lot and large grid topologies. Our work illuminates the factors affecting TCP fairness in WMNs. Our theoretical and empirical findings can be used in future research to develop more fairness-aware protocols for WMNs.

  17. A radiobiological comparison of human tumor soft-agar clonogenic assays.

    Science.gov (United States)

    West, C M; Sutherland, R M

    1986-06-15

    Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.

  18. Effect of Red Seaweed Polysaccharides Agar (Gracilaria changii) on Thermal Properties and Microstructure of Wheat Starch

    International Nuclear Information System (INIS)

    Faizal, P.K.

    2009-01-01

    This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (ΔH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (ΔH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)

  19. Intelligent Cooperative MAC Protocol for Balancing Energy Consumption

    Science.gov (United States)

    Wu, S.; Liu, K.; Huang, B.; Liu, F.

    To extend the lifetime of wireless sensor networks, we proposed an intelligent balanced energy consumption cooperative MAC protocol (IBEC-CMAC) based on the multi-node cooperative transmission model. The protocol has priority to access high-quality channels for reducing energy consumption of each transmission. It can also balance the energy consumption among cooperative nodes by using high residual energy nodes instead of excessively consuming some node's energy. Simulation results show that IBEC-CMAC can obtain longer network lifetime and higher energy utilization than direct transmission.

  20. Mac configuration management at the Los Alamos National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Marcus, Allan B [Los Alamos National Laboratory

    2010-01-01

    The Los Alamos National Laboratory (LANL) had a need for central configuration management of non-Windows computers. LANL has three to five thousand Macs and an equal number of Linux based systems. The primary goal was to be able to inventory all non-windows systems and patch Mc OS X systems. LANL examined a number of commercial and open source solutions and ultimately selected Puppet. This paper will discuss why we chose Puppet, how we implemented it, and some lessons we learned along the way.

  1. An Optimized Virtual Scheme for Reducing Collisions in MAC Layer

    OpenAIRE

    M. Sivakumar; S. Saravanan

    2015-01-01

    The main function of Medium Access Control (MAC) is to share the channel efficiently between all nodes. In the real-time scenario, there will be certain amount of wastage in bandwidth due to back-off periods. More bandwidth will be wasted in idle state if the back-off period is very high and collision may occur if the back-off period is small. So, an optimization is needed for this problem. The main objective of the work is to reduce delay due to back-off period thereby reducing collision and...

  2. MAC/FAC: A Model of Similarity-Based Retrieval

    Science.gov (United States)

    1994-10-01

    Grapes (0.28) 327 Sour Grapes, analog The Taming of the Shrew (0.22), Merry Wives 251 (0.18), S[11 stories], Sour Grapes (-0.19) Sour Grapes, literal... The Institute for the 0 1 Learning Sciences Northwestern University CD• 00 MAC/FAC: A MODEL OF SIMILARITY-BASED RETRIEVAL Kenneth D. Forbus Dedre...Gentner Keith Law Technical Report #59 • October 1994 94-35188 wit Establisthed in 1989 with the support of Andersen Consulting Form Approved REPORT

  3. ETEEM- Extended Traffic Aware Energy Efficient MAC Scheme for WSNs

    OpenAIRE

    Younas Khan; Sheeraz Ahmed; Fakhri Alam Khan; Imran Ahmad; Saqib Shahid Rahim; M. Irfan Khattak

    2016-01-01

    Idle listening issue arises when a sensor node listens to medium despite the absence of data which results in consumption of energy. ETEEM is a variant of Traffic Aware Energy Efficient MAC protocol (TEEM) which focuses on energy optimization due to reduced idle listening time and much lesser overhead on energy sources. It uses a novel scheme for using idle listening time of sensor nodes. The nodes are only active for small amount of time and most of the time, will be in sleep mode when no da...

  4. Planeamiento Estratégico para Rímac Seguros

    OpenAIRE

    Alvitez Muñoz, Julio César; Esquivel Porras, César Augusto; Slocovich Salcedo, Erick Rodolfo

    2005-01-01

    El presente trabajo desarrolla una propuesta de valor en el ámbito del mercado de seguros de vida para ser implementada en Rímac Seguros, permitiendo asegurar a la empresa la sostenibilidad de su liderazgo a través del incremento de su participación en el mercado y la fidelización de sus clientes. Las condiciones en las que se desarrolla la industria de seguros en el mundo y en el Perú en particular, como la séptima en volumen de primas a nivel latinoamericano ofrece un mercado reducido ba...

  5. Power-Controlled MAC Protocols with Dynamic Neighbor Prediction for Ad hoc Networks

    Institute of Scientific and Technical Information of China (English)

    LI Meng; ZHANG Lin; XIAO Yong-kang; SHAN Xiu-ming

    2004-01-01

    Energy and bandwidth are the scarce resources in ad hoc networks because most of the mobile nodes are battery-supplied and share the exclusive wireless medium. Integrating the power control into MAC protocol is a promising technique to fully exploit these precious resources of ad hoc wireless networks. In this paper, a new intelligent power-controlled Medium Access Control (MAC) (iMAC) protocol with dynamic neighbor prediction is proposed. Through the elaborate design of the distributed transmit-receive strategy of mobile nodes, iMAC greatly outperforms the prevailing IEEE 802.11 MAC protocols in not only energy conservation but also network throughput. Using the Dynamic Neighbor Prediction (DNP), iMAC performs well in mobile scenes. To the best of our knowledge, iMAC is the first protocol that considers the performance deterioration of power-controlled MAC protocols in mobile scenes and then proposes a solution. Simulation results indicate that DNP is important and necessary for power-controlled MAC protocols in mobile ad hoc networks.

  6. A Fair Cooperative MAC Protocol in IEEE 802.11 WLAN

    Directory of Open Access Journals (Sweden)

    Seyed Davoud Mousavi

    2018-05-01

    Full Text Available Cooperative communication techniques have recently enabled wireless technologies to overcome their challenges. The main objective of these techniques is to improve resource allocation. In this paper, we propose a new protocol in medium access control (MAC of the IEEE 802.11 standard. In our new protocol, which is called Fair Cooperative MAC (FC-MAC, every relay node participates in cooperation proportionally to its provided cooperation gain. This technique improves network resource allocation by exploiting the potential capacity of all relay candidates. Simulation results demonstrate that the FC-MAC protocol presents better performance in terms of throughput, fairness, and network lifetime.

  7. Learning Microsoft Excel 2011 for Mac video training DVD

    CERN Document Server

    Vaccaro, Guy

    2011-01-01

    In this video tutorial for Microsoft Excel 2011 For Mac, expert author Guy Vaccaro teaches you to effectively utilize the features and functions of Excel through project based learning. You will complete various projects, and along they way learn to leverage the power of the most important features Excel 2011 has to offer the Mac user. Starting your training course with the creation of a spreadsheet to record and monitor sales data, you will learn the basics of what you can do with a spreadsheet. You will then move on to creating a Profit and Loss report, learning formulas along the way. Moving to score sheets for a sports day, you will discover conditional based formatting, lookups, and more. You then create a functional expense claim form, advancing your Excel expertise. Moving on to a sales contact management sheet, you will discover how you can manipulate text, and even create mail merges from Excel. Finally, you will utilize all your knowledge thus far to create a sales report, including charts, pivot ta...

  8. Autonomous Power Control MAC Protocol for Mobile Ad Hoc Networks

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Battery energy limitation has become a performance bottleneck for mobile ad hoc networks. IEEE 802.11 has been adopted as the current standard MAC protocol for ad hoc networks. However, it was developed without considering energy efficiency. To solve this problem, many modifications on IEEE 802.11 to incorporate power control have been proposed in the literature. The main idea of these power control schemes is to use a maximum possible power level for transmitting RTS/CTS and the lowest acceptable power for sending DATA/ACK. However, these schemes may degrade network throughput and reduce the overall energy efficiency of the network. This paper proposes autonomous power control MAC protocol (APCMP, which allows mobile nodes dynamically adjusting power level for transmitting DATA/ACK according to the distances between the transmitter and its neighbors. In addition, the power level for transmitting RTS/CTS is also adjustable according to the power level for DATA/ACK packets. In this paper, the performance of APCMP protocol is evaluated by simulation and is compared with that of other protocols.

  9. Is Kyoto Fatally Flawed? An Analysis with MacGEM

    International Nuclear Information System (INIS)

    Eyckmans, J.; Van Regemorter, D.; Van Steenberghe, V.

    2002-06-01

    In this paper we present some numerical simulations with the MacGEM model to evaluate the consequences of the recent Marrakesh agreements and the defection of the USA for the Kyoto Protocol. MacGEM is a global marginal abatement cost model for carbon emissions from fossil fuel use based on the GEM-E3-World general equilibrium. Nonparticipation of the USA causes the equilibrium carbon price in Annex B countries to fall by approximately 50% since an important share of permit demand falls out. Carbon sinks enhancement activities enable Parties to fulfil their reduction commitment at lower compliance costs and cause the equilibrium permit price to decrease by 40%. Finally, it is shown that the former Soviet Union and central European countries have substantial monopoly power in the Kyoto carbon permit market. We conclude that the recent accords have eroded completely the Kyoto Protocol's emission targets but that they have the merit to have saved the international climate change negotiation framework

  10. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    Directory of Open Access Journals (Sweden)

    Marol Serhat

    2003-10-01

    Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  11. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.

    Science.gov (United States)

    Yücesoy, Mine; Marol, Serhat

    2003-10-29

    The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  12. Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development

    Directory of Open Access Journals (Sweden)

    Wahyu Ramadhan

    2017-04-01

    Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that  the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g – 35.76 g/100 g, color intensity L*, a*, b* with ΔE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.

  13. Comparison of selective agars recommended by method ISO 11290-1 and chromogenic agars for the isolation of Listeria sp. in refrigerated sausages

    Directory of Open Access Journals (Sweden)

    Thalyta Marina Benetti

    2012-12-01

    Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at

  14. C-MAC compared with direct laryngoscopy for intubation in patients with cervical spine immobilization: A manikin trial.

    Science.gov (United States)

    Smereka, Jacek; Ladny, Jerzy R; Naylor, Amanda; Ruetzler, Kurt; Szarpak, Lukasz

    2017-08-01

    The aim of this study was to compare C-MAC videolaryngoscopy with direct laryngoscopy for intubation in simulated cervical spine immobilization conditions. The study was designed as a prospective randomized crossover manikin trial. 70 paramedics with immobilization (Scenario A); manual inline cervical immobilization (Scenario B); cervical immobilization using cervical extraction collar (Scenario C). Scenario A: Nearly all participants performed successful intubations with both MAC and C-MAC on the first attempt (95.7% MAC vs. 100% C-MAC), with similar intubation times (16.5s MAC vs. 18s C-MAC). Scenario B: The results with C-MAC were significantly better than those with MAC (pimmobilization. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.

    Science.gov (United States)

    Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena

    2015-05-01

    Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (ε'), loss factor (ε"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 °C. The ε' and ε" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m °C, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 °C in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. © 2015 Institute of Food Technologists®

  16. Antimicrobial and physical-mechanical properties of agar-based films incorporated with grapefruit seed extract.

    Science.gov (United States)

    Kanmani, Paulraj; Rhim, Jong-Whan

    2014-02-15

    The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 μg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Strategies to improve the mechanical strength and water resistance of agar films for food packaging applications.

    Science.gov (United States)

    Sousa, Ana M M; Gonçalves, Maria P

    2015-11-05

    Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Time domain NMR study of Agar-gelatin blends; Estudo por RMN no dominio do tempo de blendas de Agar- gelatina

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica

    2015-07-01

    This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)

  19. Accuracy of the MacArthur competence assessment tool for clinical research (MacCAT-CR) for measuring children's competence to consent to clinical research.

    Science.gov (United States)

    Hein, Irma M; Troost, Pieter W; Lindeboom, Robert; Benninga, Marc A; Zwaan, C Michel; van Goudoever, Johannes B; Lindauer, Ramón J L

    2014-12-01

    An objective assessment of children's competence to consent to research participation is currently not possible. Age limits for asking children's consent vary considerably between countries, and, to our knowledge, the correlation between competence and children's age has never been systematically investigated. To test a standardized competence assessment instrument for children by modifying the MacArthur Competence Assessment Tool for Clinical Research (MacCAT-CR), to investigate its reliability and validity, and to examine the correlation of its assessment with age and estimate cutoff ages. This prospective study included children and adolescents aged 6 to 18 years in the inpatient and outpatient departments of allergology, gastroenterology, oncology, ophthalmology, and pulmonology from January 1, 2012, through January 1, 2014. Participants were eligible for clinical research studies, including observational studies and randomized clinical trials. Competence judgments by experts aware of the 4 relevant criteria-understanding, appreciation, reasoning, and choice-were used to establish the reference standard. The index test was the MacCAT-CR, which used a semistructured interview format. Interrater reliability, validity, and dimensionality of the MacCAT-CR and estimated cutoff ages for competence. Of 209 eligible patients, we included 161 (mean age, 10.6 years; 47.2% male). Good reproducibility of MacCAT-CR total and subscale scores was observed (intraclass correlation coefficient range, 0.68-0.92). We confirmed unidimensionality of the MacCAT-CR. By the reference standard, we judged 54 children (33.5%) to be incompetent; by the MacCAT-CR, 61 children (37.9%). Criterion-related validity of MacCAT-CR scores was supported by high overall accuracy in correctly classifying children as competent against the reference standard (area under the receiver operating characteristics curve, 0.78). Age was a good predictor of competence on the MacCAT-CR (area under the receiver

  20. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  1. Antimoulting Activity of Eremanthus erythropappus (DC. MacLeisch

    Directory of Open Access Journals (Sweden)

    Danielle Barbosa

    2012-06-01

    Resumo. Os extratos e metabólitos secundários de plantas podem agir como agentes tóxicos e inibidores do da alimentação e do desenvolvimento em insetos. Neste estudo foi utilizado Oncopeltus fasciatus (Dallas (Hemiptera como modelo experimental a fim de avaliar as atividades do extrato etanólico bruto e frações obtidos das flores ou caules de Eremanthus erythropappus (DC. MacLeisch (Asteraceae, na mortalidade e sobre o desenvolvimento do inseto. A fração butanólica obtida do extrato etanólico mostrou toxidade sobre as ninfas de O. fasciatus, bem como atividade de inibição do crescimento. Os resultados sugerem que a fração butanólica de E. erythropappus possui substâncias ativas sobre a fisiologia, crescimento e desenvolvimento de insetos.

  2. The Virtues of Scientific Practice: MacIntyre,

    Science.gov (United States)

    Hicks, Daniel J; Stapleford, Thomas A

    2016-09-01

    “Practice” has become a ubiquitous term in the history of science, and yet historians have not always reflected on its philosophical import and in particular on its potential connections with ethics. This essay draws on the work of the virtue ethicist Alasdair MacIntyre to develop a theory of “communal practices” and explore how such an approach can inform the history of science, including allegations about the corruption of science by wealth or power, consideration of scientific ethics or “moral economies,” the role of values in science, the ethical distinctiveness (or not) of scientific vocations, and the relationship between history of science and the practice of science itself.

  3. Rocket measurements of electron density irregularities during MAC/SINE

    Science.gov (United States)

    Ulwick, J. C.

    1989-01-01

    Four Super Arcas rockets were launched at the Andoya Rocket Range, Norway, as part of the MAC/SINE campaign to measure electron density irregularities with high spatial resolution in the cold summer polar mesosphere. They were launched as part of two salvos: the turbulent/gravity wave salvo (3 rockets) and the EISCAT/SOUSY radar salvo (one rocket). In both salvos meteorological rockets, measuring temperature and winds, were also launched and the SOUSY radar, located near the launch site, measured mesospheric turbulence. Electron density irregularities and strong gradients were measured by the rocket probes in the region of most intense backscatter observed by the radar. The electron density profiles (8 to 4 on ascent and 4 on descent) show very different characteristics in the peak scattering region and show marked spatial and temporal variability. These data are intercompared and discussed.

  4. MACS low-background doubly focusing neutron monochromator

    CERN Document Server

    Smee, S A; Scharfstein, G A; Qiu, Y; Brand, P C; Anand, D K; Broholm, C L

    2002-01-01

    A novel doubly focusing neutron monochromator has been developed as part of the Multi-Analyzer Crystal Spectrometer (MACS) at the NIST Center for Neutron Research. The instrument utilizes a unique vertical focusing element that enables active vertical and horizontal focusing with a large, 357-crystal (1428 cm sup 2), array. The design significantly reduces the amount of structural material in the beam path as compared to similar instruments. Optical measurements verify the excellent focal performance of the device. Analytical and Monte Carlo simulations predict that, when mounted at the NIST cold-neutron source, the device should produce a monochromatic beam (DELTA E=0.2 meV) with flux phi>10 sup 8 n/cm sup 2 s. (orig.)

  5. On PHY and MAC Performance in Body Sensor Networks

    Directory of Open Access Journals (Sweden)

    Higgins Henry

    2009-01-01

    Full Text Available Abstract This paper presents an empirical investigation on the performance of body implant communication using radio frequency (RF technology. In body implant communication, the electrical properties of the body influence the signal propagation in several ways. We use a Perspex body model (30 cm diameter, 80 cm height and 0.5 cm thickness filled with a liquid that mimics the electrical properties of the basic body tissues. This model is used to observe the effects of body tissue on the RF communication. We observe best performance at 3cm depth inside the liquid. We further present a simulation study of several low-power MAC protocols for an on-body sensor network and discuss the derived results. Also, the traditional preamble-based TMDA protocol is extended towards a beacon-based TDMA protocol in order to avoid preamble collision and to ensure low-power communication.

  6. On PHY and MAC Performance in Body Sensor Networks

    Directory of Open Access Journals (Sweden)

    Sana Ullah

    2009-01-01

    Full Text Available This paper presents an empirical investigation on the performance of body implant communication using radio frequency (RF technology. In body implant communication, the electrical properties of the body influence the signal propagation in several ways. We use a Perspex body model (30 cm diameter, 80 cm height and 0.5 cm thickness filled with a liquid that mimics the electrical properties of the basic body tissues. This model is used to observe the effects of body tissue on the RF communication. We observe best performance at 3cm depth inside the liquid. We further present a simulation study of several low-power MAC protocols for an on-body sensor network and discuss the derived results. Also, the traditional preamble-based TMDA protocol is extended towards a beacon-based TDMA protocol in order to avoid preamble collision and to ensure low-power communication.

  7. Effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of stone casts.

    Science.gov (United States)

    Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru

    2007-05-01

    This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.

  8. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    2015-01-01

    Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  9. 76 FR 71797 - Federal Agricultural Mortgage Corporation Funding and Fiscal Affairs; Farmer Mac Investments and...

    Science.gov (United States)

    2011-11-18

    ... diligence procedures that are required for investments, but we do not intend to change the fundamental... Federal Agricultural Mortgage Corporation Funding and Fiscal Affairs; Farmer Mac Investments and Liquidity... Mortgage Corporation Funding and Fiscal Affairs; Farmer Mac Investments and Liquidity Management AGENCY...

  10. A MacWilliams Identity for Convolutional Codes: The General Case

    OpenAIRE

    Gluesing-Luerssen, Heide; Schneider, Gert

    2008-01-01

    A MacWilliams Identity for convolutional codes will be established. It makes use of the weight adjacency matrices of the code and its dual, based on state space realizations (the controller canonical form) of the codes in question. The MacWilliams Identity applies to various notions of duality appearing in the literature on convolutional coding theory.

  11. A MacWilliams Identity for Convolutional Codes : The General Case

    NARCIS (Netherlands)

    Gluesing-Luerssen, Heide; Schneider, Gert

    A MacWilliams Identity for convolutional codes will be established. It makes use of the weight adjacency matrices of the code and its dual, based on state space realizations (the controller canonical form) of the codes in question. The MacWilliams Identity applies to various notions of duality

  12. Poincaré-MacMillan Equations of Motion for a Nonlinear Nonholonomic Dynamical System

    Science.gov (United States)

    Amjad, Hussain; Syed Tauseef, Mohyud-Din; Ahmet, Yildirim

    2012-03-01

    MacMillan's equations are extended to Poincaré's formalism, and MacMillan's equations for nonlinear nonholonomic systems are obtained in terms of Poincaré parameters. The equivalence of the results obtained here with other forms of equations of motion is demonstrated. An illustrative example of the theory is provided as well.

  13. Public Relations as "Practice": Applying the Theory of Alasdair MacIntyre.

    Science.gov (United States)

    Leeper, Roy V.; Leeper, Kathie A.

    2001-01-01

    Considers how public relation's search for a unifying theory may be fulfilled through application of Alasdair MacIntyre's concept of a "practice," a very specific and value-laden concept. Explores what it would mean to be a public relations practice in MacIntyre's concept of the term and argues that such an approach to public relations…

  14. 78 FR 5320 - Federal Agricultural Mortgage Corporation Funding and Fiscal Affairs; Farmer Mac Capital Planning

    Science.gov (United States)

    2013-01-25

    ... the business planning period a required discussion of how factors might impact Farmer Mac's current... discussion of any expected changes to Farmer Mac's business plan that are likely to have a material impact on... conditions that cause increases in delinquency rates caused by any variety of factors (e.g., widespread...

  15. Geochemistry and petrography of the MacAlpine Hills lunar meteorites

    Science.gov (United States)

    Lindstrom, Marilyn M.; Mckay, David S.; Wentworth, Susan J.; Martinez, Rene R.; Mittlefehldt, David W.; Wang, Ming-Sheng; Lipschutz, Michael E.

    1991-01-01

    MacAlpine Hills 88104 and 88105, anorthositic lunar meteorites recovered form the same area in Antartica, are characterized. Petrographic studies show that MAC88104/5 is a polymict breccia dominated by impact melt clasts. It is better classified as a fragmental breccia than a regolith breccia. The bulk composition is ferroan and highly aluminous (Al2O3-28 percent).

  16. Optimization and Verification of the TR-MAC Protocol for Wireless Sensor Networks

    NARCIS (Netherlands)

    Morshed, S.; Heijenk, Geert

    2015-01-01

    Energy-efficiency is an important requirement in the design of communication protocols for wireless sensor networks (WSN). TR-MAC is an energy-efficient medium access control (MAC) layer protocol for low power WSN that exploits transmitted-reference (TR) modulation in the physical layer. The

  17. THE EFFECT OF TEMPERATURE ON THE GROWTH OF MYCOBACTERIUM AVIUM COMPLEX (MAC) ORGANISMS

    Science.gov (United States)

    MAC organisms are able to grow, persist, and colonize in water distribution systems and may amplify in hospital hot water systems. This study examined the response of MAC organisms (M. avium, M. intracellulare, and MX) to a range of temperatures commonly associated with drinking...

  18. Scheduled MAC in Beacon Overlay Networks for Underwater Localization and Time-Synchronization

    NARCIS (Netherlands)

    van Kleunen, W.A.P.; Meratnia, Nirvana; Havinga, Paul J.M.

    2011-01-01

    In this article we introduce a MAC protocol designed for underwater localization and time-synchronisation. The MAC protocol assumes a network of static reference nodes and allows blind nodes to be localized by listening-only to the beacon messages. Such a system is known to be very scalable. We show

  19. Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo J. Licea Moreno

    2001-04-01

    Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture

  20. Identifying The Purchasing Power Parity of Indonesia Rupiah (IDR based on BIG MAC Index

    Directory of Open Access Journals (Sweden)

    Tongam Sihol Nababan

    2016-12-01

    Full Text Available The aim of this study is to identify : (1 profile of exchange rate and purchasing power parity of IDR against US $ based on Big Mac Index compared to the exchange rate of other countries, and (2 the position of the Big Mac Affordability of  Indonesia compared to other ASEAN countries. The results showed that based on Big Mac index during the period April 1998 up to January 2015, IDR exchange rate tends to be undervalued against the USA dollar. The cause of the currency tends to be in a position of undervalued due to the components of non-tradable have not been included in Big Mac index. The index of Big Mac Affordability indicates that there is a great disparity of income between Singapore and five other ASEAN countries. The purchasing power of the real income of the people in Singapore is nearly five times the real income of the people in Indonesia.

  1. Impact of MAC Delay on AUV Localization: Underwater Localization Based on Hyperbolic Frequency Modulation Signal.

    Science.gov (United States)

    Kim, Sungryul; Yoo, Younghwan

    2018-01-26

    Medium Access Control (MAC) delay which occurs between the anchor node's transmissions is one of the error sources in underwater localization. In particular, in AUV localization, the MAC delay significantly degrades the ranging accuracy. The Cramer-Rao Low Bound (CRLB) definition theoretically proves that the MAC delay significantly degrades the localization performance. This paper proposes underwater localization combined with multiple access technology to decouple the localization performance from the MAC delay. Towards this goal, we adopt hyperbolic frequency modulation (HFM) signal that provides multiplexing based on its good property, high-temporal correlation. Owing to the multiplexing ability of the HFM signal, the anchor nodes can transmit packets without MAC delay, i.e., simultaneous transmission is possible. In addition, the simulation results show that the simultaneous transmission is not an optional communication scheme, but essential for the localization of mobile object in underwater.

  2. Interference Analysis Status and Plans for Aeronautical Mobile Airport Communications System (AeroMACS)

    Science.gov (United States)

    Kerczewski, Robert J.; Wilson, Jeffrey D.

    2010-01-01

    Interference issues related to the operation of an aeronautical mobile airport communications system (AeroMACS) in the C-Band (specifically 5091-5150 MHz) is being investigated. The issue of primary interest is co-channel interference from AeroMACS into mobile-satellite system (MSS) feeder uplinks. The effort is focusing on establishing practical limits on AeroMACS transmissions from airports so that the threshold of interference into MSS is not exceeded. The analyses are being performed with the software package Visualyse Professional, developed by Transfinite Systems Limited. Results with omni-directional antennas and plans to extend the models to represent AeroMACS more accurately will be presented. These models should enable realistic analyses of emerging AeroMACS designs to be developed from NASA Test Bed, RTCA 223, and European results.

  3. Reliable Multicast MAC Protocol for IEEE 802.11 Wireless LANs with Extended Service Range

    Science.gov (United States)

    Choi, Woo-Yong

    2011-11-01

    In this paper, we propose the efficient reliable multicast MAC protocol by which the AP (Access Point) can transmit reliably its multicast data frames to the recipients in the AP's one-hop or two-hop transmission range. The AP uses the STAs (Stations) that are directly associated with itself as the relays for the data delivery to the remote recipients that cannot be reached directly from itself. Based on the connectivity information among the recipients, the reliable multicast MAC protocol optimizes the number of the RAK (Request for ACK) frame transmissions in a reasonable computational time. Numerical examples show that our proposed MAC protocol significantly enhances the MAC performance compared with the BMMM (Batch Mode Multicast MAC) protocol that is extended to support the recipients that are in the AP's one-hop or two-hop transmission range in IEEE 802.11 wireless LANs.

  4. Radiation effects on agar, alginates and carrageenan to be used as food additives

    International Nuclear Information System (INIS)

    Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del

    2000-01-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  5. Radiation effects on agar, alginates and carrageenan to be used as food additives

    Energy Technology Data Exchange (ETDEWEB)

    Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del

    2000-03-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  6. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    Science.gov (United States)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  7. Functional characterization of the copper transcription factor AfMac1 from Aspergillus fumigatus.

    Science.gov (United States)

    Park, Yong-Sung; Kim, Tae-Hyoung; Yun, Cheol-Won

    2017-07-03

    Although copper functions as a cofactor in many physiological processes, copper overload leads to harmful effects in living cells. Thus, copper homeostasis is tightly regulated. However, detailed copper metabolic pathways have not yet been identified in filamentous fungi. In this report, we investigated the copper transcription factor AfMac1 ( A spergillus f umigatus Mac1 homolog) and identified its regulatory mechanism in A. fumigatus AfMac1 has domains homologous to the DNA-binding and copper-binding domains of Mac1 from Saccharomyces cerevisiae , and AfMac1 efficiently complemented Mac1 in S. cerevisiae Expression of Afmac1 resulted in CTR1 up-regulation, and mutation of the DNA-binding domain of Afmac1 failed to activate CTR1 expression in S. cerevisiae The Afmac1 deletion strain of A. fumigatus failed to grow in copper-limited media, and its growth was restored by introducing ctrC We found that AfMac1 specifically bound to the promoter region of ctrC based on EMSA. The AfMac1-binding motif 5'-TGTGCTCA-3' was identified from the promoter region of ctrC , and the addition of mutant ctrC lacking the AfMac1-binding motif failed to up-regulate ctrC in A. fumigatus Furthermore, deletion of Afmac1 significantly reduced strain virulence and activated conidial killing activity by neutrophils and macrophages. Taken together, these results suggest that AfMac1 is a copper transcription factor that regulates cellular copper homeostasis in A. fumigatus . © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  8. Spencer et al., Afr. J. Infect. Dis.

    African Journals Online (AJOL)

    cadewumi

    Conclusion: In conclusion, Pelvic inflammatory disease is a major health problem in ... cultivated on Blood agar, McConkey agar and Chocolate agar media and .... had mean cidal effects of 80%, 76% and 54% respectively against all the ...

  9. Comparison of Sabouraud dextrose and Pagano-Levin agar media for detection and isolation of yeasts from oral samples.

    OpenAIRE

    Samaranayake, L P; MacFarlane, T W; Williamson, M I

    1987-01-01

    The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...

  10. Comparison of the Cellient(™) automated cell block system and agar cell block method.

    Science.gov (United States)

    Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

    2014-12-01

    To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

  11. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  12. Investigation of dental alginate and agar impression materials as a brain simulant for ballistic testing.

    Science.gov (United States)

    Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil

    2016-06-01

    Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films

    Directory of Open Access Journals (Sweden)

    Esam A. El-Hefian

    2011-01-01

    Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.

  14. Medium dependant production of corymbiferone a novel product from Penicillium hordei cultured on plant tissue agar

    DEFF Research Database (Denmark)

    Overy, David Patrick; Zidorn, C.; Petersen, B.O.

    2005-01-01

    Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...

  15. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  16. Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Mogensen, Jesper Mølgaard; Thrane, Ulf

    2009-01-01

    A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...

  17. Cell cytotoxicity and mycotoxin and secondary metabolite production by common penicillia on cheese agar

    DEFF Research Database (Denmark)

    Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    2002-01-01

    Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...

  18. Phenotypic differentiation of species from Aspergillus section Flavi on neutral red desiccated coconut agar

    DEFF Research Database (Denmark)

    Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.

    2014-01-01

    In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...

  19. Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.

    Science.gov (United States)

    Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W

    2012-01-01

    A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 µg/g in samples taken on day 19, 16.4 µg/g in samples taken 3 months after exposure, 13.4 µg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 µg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.

  20. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    Science.gov (United States)

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  1. Immediate differentiation of salmonella-resembling colonies on brilliant green agar

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2000-01-01

    A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...

  2. Effects of season on the yield and quality of agar from Gelidium ...

    African Journals Online (AJOL)

    The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...

  3. Can serums be replaced by Mueller‑Hinton agar in germ tube test?

    African Journals Online (AJOL)

    2016-03-03

    Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‑Hinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the ...

  4. Colony formation in agar: in vitro assay for haemopoietic stem cells

    NARCIS (Netherlands)

    Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

    1971-01-01

    Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

  5. Growth and study of barium oxalate single crystals in agar gel

    Indian Academy of Sciences (India)

    Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...

  6. Antibiotic Resistance Mediated by the MacB ABC Transporter Family: A Structural and Functional Perspective

    Directory of Open Access Journals (Sweden)

    Nicholas P. Greene

    2018-05-01

    Full Text Available The MacB ABC transporter forms a tripartite efflux pump with the MacA adaptor protein and TolC outer membrane exit duct to expel antibiotics and export virulence factors from Gram-negative bacteria. Here, we review recent structural and functional data on MacB and its homologs. MacB has a fold that is distinct from other structurally characterized ABC transporters and uses a unique molecular mechanism termed mechanotransmission. Unlike other bacterial ABC transporters, MacB does not transport substrates across the inner membrane in which it is based, but instead couples cytoplasmic ATP hydrolysis with transmembrane conformational changes that are used to perform work in the extra-cytoplasmic space. In the MacAB-TolC tripartite pump, mechanotransmission drives efflux of antibiotics and export of a protein toxin from the periplasmic space via the TolC exit duct. Homologous tripartite systems from pathogenic bacteria similarly export protein-like signaling molecules, virulence factors and siderophores. In addition, many MacB-like ABC transporters do not form tripartite pumps, but instead operate in diverse cellular processes including antibiotic sensing, cell division and lipoprotein trafficking.

  7. Antibiotic Resistance Mediated by the MacB ABC Transporter Family: A Structural and Functional Perspective

    Science.gov (United States)

    Greene, Nicholas P.; Kaplan, Elise; Crow, Allister; Koronakis, Vassilis

    2018-01-01

    The MacB ABC transporter forms a tripartite efflux pump with the MacA adaptor protein and TolC outer membrane exit duct to expel antibiotics and export virulence factors from Gram-negative bacteria. Here, we review recent structural and functional data on MacB and its homologs. MacB has a fold that is distinct from other structurally characterized ABC transporters and uses a unique molecular mechanism termed mechanotransmission. Unlike other bacterial ABC transporters, MacB does not transport substrates across the inner membrane in which it is based, but instead couples cytoplasmic ATP hydrolysis with transmembrane conformational changes that are used to perform work in the extra-cytoplasmic space. In the MacAB-TolC tripartite pump, mechanotransmission drives efflux of antibiotics and export of a protein toxin from the periplasmic space via the TolC exit duct. Homologous tripartite systems from pathogenic bacteria similarly export protein-like signaling molecules, virulence factors and siderophores. In addition, many MacB-like ABC transporters do not form tripartite pumps, but instead operate in diverse cellular processes including antibiotic sensing, cell division and lipoprotein trafficking. PMID:29892271

  8. A Cross-Layer Duty Cycle MAC Protocol Supporting a Pipeline Feature for Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Young-Chon Kim

    2011-05-01

    Full Text Available Although the conventional duty cycle MAC protocols for Wireless Sensor Networks (WSNs such as RMAC perform well in terms of saving energy and reducing end-to-end delivery latency, they were designed independently and require an extra routing protocol in the network layer to provide path information for the MAC layer. In this paper, we propose a new cross-layer duty cycle MAC protocol with data forwarding supporting a pipeline feature (P-MAC for WSNs. P-MAC first divides the whole network into many grades around the sink. Each node identifies its grade according to its logical hop distance to the sink and simultaneously establishes a sleep/wakeup schedule using the grade information. Those nodes in the same grade keep the same schedule, which is staggered with the schedule of the nodes in the adjacent grade. Then a variation of the RTS/CTS handshake mechanism is used to forward data continuously in a pipeline fashion from the higher grade to the lower grade nodes and finally to the sink. No extra routing overhead is needed, thus increasing the network scalability while maintaining the superiority of duty-cycling. The simulation results in OPNET show that P-MAC has better performance than S-MAC and RMAC in terms of packet delivery latency and energy efficiency.

  9. A Priority-Based Adaptive MAC Protocol for Wireless Body Area Networks

    Directory of Open Access Journals (Sweden)

    Sabin Bhandari

    2016-03-01

    Full Text Available In wireless body area networks (WBANs, various sensors and actuators are placed on/inside the human body and connected wirelessly. WBANs have specific requirements for healthcare and medical applications, hence, standard protocols like the IEEE 802.15.4 cannot fulfill all the requirements. Consequently, many medium access control (MAC protocols, mostly derived from the IEEE 802.15.4 superframe structure, have been studied. Nevertheless, they do not support a differentiated quality of service (QoS for the various forms of traffic coexisting in a WBAN. In particular, a QoS-aware MAC protocol is essential for WBANs operating in the unlicensed Industrial, Scientific, and Medical (ISM bands, because different wireless services like Bluetooth, WiFi, and Zigbee may coexist there and cause severe interference. In this paper, we propose a priority-based adaptive MAC (PA-MAC protocol for WBANs in unlicensed bands, which allocates time slots dynamically, based on the traffic priority. Further, multiple channels are effectively utilized to reduce access delays in a WBAN, in the presence of coexisting systems. Our performance evaluation results show that the proposed PA-MAC outperforms the IEEE 802.15.4 MAC and the conventional priority-based MAC in terms of the average transmission time, throughput, energy consumption, and data collision ratio.

  10. A Priority-Based Adaptive MAC Protocol for Wireless Body Area Networks.

    Science.gov (United States)

    Bhandari, Sabin; Moh, Sangman

    2016-03-18

    In wireless body area networks (WBANs), various sensors and actuators are placed on/inside the human body and connected wirelessly. WBANs have specific requirements for healthcare and medical applications, hence, standard protocols like the IEEE 802.15.4 cannot fulfill all the requirements. Consequently, many medium access control (MAC) protocols, mostly derived from the IEEE 802.15.4 superframe structure, have been studied. Nevertheless, they do not support a differentiated quality of service (QoS) for the various forms of traffic coexisting in a WBAN. In particular, a QoS-aware MAC protocol is essential for WBANs operating in the unlicensed Industrial, Scientific, and Medical (ISM) bands, because different wireless services like Bluetooth, WiFi, and Zigbee may coexist there and cause severe interference. In this paper, we propose a priority-based adaptive MAC (PA-MAC) protocol for WBANs in unlicensed bands, which allocates time slots dynamically, based on the traffic priority. Further, multiple channels are effectively utilized to reduce access delays in a WBAN, in the presence of coexisting systems. Our performance evaluation results show that the proposed PA-MAC outperforms the IEEE 802.15.4 MAC and the conventional priority-based MAC in terms of the average transmission time, throughput, energy consumption, and data collision ratio.

  11. Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.

    Science.gov (United States)

    Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max

    2016-07-01

    Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  12. McMAC: towards a MAC protocol with multi-constrained QoS provisioning for diverse traffic in Wireless Body Area Networks.

    Science.gov (United States)

    Monowar, Muhammad Mostafa; Hassan, Mohammad Mehedi; Bajaber, Fuad; Al-Hussein, Musaed; Alamri, Atif

    2012-11-12

    The emergence of heterogeneous applications with diverse requirements for resource-constrained Wireless Body Area Networks (WBANs) poses significant challenges for provisioning Quality of Service (QoS) with multi-constraints (delay and reliability) while preserving energy efficiency. To address such challenges, this paper proposes McMAC,a MAC protocol with multi-constrained QoS provisioning for diverse traffic classes in WBANs. McMAC classifies traffic based on their multi-constrained QoS demands and introduces a novel superframe structure based on the "transmit-whenever-appropriate"principle, which allows diverse periods for diverse traffic classes according to their respective QoS requirements. Furthermore, a novel emergency packet handling mechanism is proposedto ensure packet delivery with the least possible delay and the highest reliability. McMAC is also modeled analytically, and extensive simulations were performed to evaluate its performance. The results reveal that McMAC achieves the desired delay and reliability guarantee according to the requirements of a particular traffic class while achieving energy efficiency.

  13. MAC Version 3.2, MBA Version 1.3 acceptance test summary report

    International Nuclear Information System (INIS)

    Russell, V.K.

    1994-01-01

    The K Basins Materials Accounting (MAC) and Materials Balance (MBA) programs had the Paradox Conversion to 4.0 ATP run to check out the systems. This report describes the results of the test and provides the signoff sheets associated with the testing. The test primarily concentrated on verifying that MAC and MBA software would run properly in the Paradox 4.0 environment. Changes in the MAC and MBA programs were basically limited to superficial items needed to accommodate the enhanced method of execution

  14. Learn AppleScript The Comprehensive Guide to Scripting and Automation on MAC OS X

    CERN Document Server

    Rosenthal, Hanaan

    2009-01-01

    AppleScript is an English-like, easy-to-understand scripting language built into every Mac. AppleScript can automate hundreds of AppleScriptable applications, performing tasks both large and small, complex and simple. Learn AppleScript: The Comprehensive Guide to Scripting and Automation on Mac OS X, Third Edition has been completely updated for Mac OS X Snow Leopard. It's all here, with an emphasis on practical information that will help you solve any automation problem-from the most mundane repetitive tasks to highly integrated workflows of complex systems. * Friendly enough for beginners, d

  15. Are hamburgers harmless? : the Big Mac Index in the twenty-first century

    OpenAIRE

    Soo, Kwok Tong

    2016-01-01

    We make use of The Economist’s Big Mac Index (BMI) to investigate the Law of One Price (LOP) and whether the BMI can be used to predict future exchange rate and price changes. Deviations from Big Mac parity decay quickly, in approximately 1 year. The BMI is a better predictor of relative price changes than of exchange rate changes, and performs best when predicting a depreciation of a currency relative to the US dollar. Convergence to Big Mac parity occurs more rapidly for currencies with som...

  16. Identifying The Purchasing Power Parity of Indonesia Rupiah (IDR) based on BIG MAC Index

    OpenAIRE

    Tongam Sihol Nababan

    2016-01-01

    The aim of this study is to identify : (1) profile of exchange rate and purchasing power parity of IDR against US $ based on Big Mac Index compared to the exchange rate of other countries, and (2) the position of the Big Mac Affordability of Indonesia compared to other ASEAN countries. The results showed that based on Big Mac index during the period April 1998 up to January 2015, IDR exchange rate tends to be undervalued against the USA dollar. The cause of the currency tends to be in a posi...

  17. MAC Protocol for Ad Hoc Networks Using a Genetic Algorithm

    Science.gov (United States)

    Elizarraras, Omar; Panduro, Marco; Méndez, Aldo L.

    2014-01-01

    The problem of obtaining the transmission rate in an ad hoc network consists in adjusting the power of each node to ensure the signal to interference ratio (SIR) and the energy required to transmit from one node to another is obtained at the same time. Therefore, an optimal transmission rate for each node in a medium access control (MAC) protocol based on CSMA-CDMA (carrier sense multiple access-code division multiple access) for ad hoc networks can be obtained using evolutionary optimization. This work proposes a genetic algorithm for the transmission rate election considering a perfect power control, and our proposition achieves improvement of 10% compared with the scheme that handles the handshaking phase to adjust the transmission rate. Furthermore, this paper proposes a genetic algorithm that solves the problem of power combining, interference, data rate, and energy ensuring the signal to interference ratio in an ad hoc network. The result of the proposed genetic algorithm has a better performance (15%) compared to the CSMA-CDMA protocol without optimizing. Therefore, we show by simulation the effectiveness of the proposed protocol in terms of the throughput. PMID:25140339

  18. MAC Protocol for Ad Hoc Networks Using a Genetic Algorithm

    Directory of Open Access Journals (Sweden)

    Omar Elizarraras

    2014-01-01

    Full Text Available The problem of obtaining the transmission rate in an ad hoc network consists in adjusting the power of each node to ensure the signal to interference ratio (SIR and the energy required to transmit from one node to another is obtained at the same time. Therefore, an optimal transmission rate for each node in a medium access control (MAC protocol based on CSMA-CDMA (carrier sense multiple access-code division multiple access for ad hoc networks can be obtained using evolutionary optimization. This work proposes a genetic algorithm for the transmission rate election considering a perfect power control, and our proposition achieves improvement of 10% compared with the scheme that handles the handshaking phase to adjust the transmission rate. Furthermore, this paper proposes a genetic algorithm that solves the problem of power combining, interference, data rate, and energy ensuring the signal to interference ratio in an ad hoc network. The result of the proposed genetic algorithm has a better performance (15% compared to the CSMA-CDMA protocol without optimizing. Therefore, we show by simulation the effectiveness of the proposed protocol in terms of the throughput.

  19. Emergency Handling for MAC Protocol in Human Body Communication

    Directory of Open Access Journals (Sweden)

    Kwon Youngmi

    2011-01-01

    Full Text Available The human body communication (HBC is a technology that enables short range data communication using the human body as a medium, like an electrical wire. Thus it removes the need for a traditional antenna. HBC may be used as a type of data communication in body area network (BAN, while the devices are being in contact with body. One of important issues in BAN is an emergency alarm because it may be closely related to human life. For emergency data communication, the most critical factor is the time constraint. IEEE 802.15.6 specifies that the emergency alarm for the BAN must be notified in less than 1 sec and must provide prioritization mechanisms for emergency traffic and notification. As one type of BAN, the HBC must follow this recommendation, too. Existing emergency handling methods in BAN are based on the carrier sensing capability on radio frequencies to detect the status of channels. However, PHY protocol in HBC does not provide the carrier sensing. So the previous methods are not well suitable for HBC directly. Additionally, in the environment that the emergency rate is very low, the allocation of dedicated slot(s for emergency in each superframe is very wasteful. In this work, we proposed specific emergency handling operation for human body communication's medium access control (HBC-MAC protocol to meet the emergency requirements for BAN. We also showed the optimal number of emergency slots for the various combinations of beacon intervals and emergency rates.

  20. Bit Level Synchronized MAC Protocol for Multireader RFID Networks

    Directory of Open Access Journals (Sweden)

    Namboodiri Vinod

    2010-01-01

    Full Text Available The operation of multiple RFID readers in close proximity results in interference between the readers. This issue is termed the reader collision problem and cannot always be solved by assigning them to different frequency channels due to technical and regulatory limitations. The typical solution is to separate the operation of such readers across time. This sequential operation, however, results in a long delay to identify all tags. We present a bit level synchronized (BLSync MAC protocol for multi-reader RFID networks that allows multiple readers to operate simultaneously on the same frequency channel. The BLSync protocol solves the reader collision problem by allowing all readers to transmit the same query at the same time. We analyze the performance of using the BLSync protocol and demonstrate benefits of 40%–50% in terms of tag reading delay for most settings. The benefits of BLSync, first demonstrated through analysis, are then validated and quantified through simulations on realistic reader-tag layouts.

  1. LAMAN: Load Adaptable MAC for Ad Hoc Networks

    Directory of Open Access Journals (Sweden)

    Realp Marc

    2005-01-01

    Full Text Available In mobile ad hoc radio networks, mechanisms on how to access the radio channel are extremely important in order to improve network efficiency. In this paper, the load adaptable medium access control for ad hoc networks (LAMAN protocol is described. LAMAN is a novel decentralized multipacket MAC protocol designed following a cross-layer approach. Basically, this protocol is a hybrid CDMA-TDMA-based protocol that aims at throughput maximization in multipacket communication environments by efficiently combining contention and conflict-free protocol components. Such combination of components is used to adapt the nodes' access priority to changes on the traffic load while, at the same time, accounting for the multipacket reception (MPR capability of the receivers. A theoretical analysis of the system is developed presenting closed expressions of network throughput and packet delay. By simulations the validity of our analysis is shown and the performances of a LAMAN-based system and an Aloha-CDMA-based one are compared.

  2. Effect of gamma irradiation on the sensitivities of escherichia coli at deep frozen conditions

    International Nuclear Information System (INIS)

    Takigami, Machiko; Ito, Hitoshi

    1996-01-01

    Phosphate buffer suspensions of three strains of Escherichia coli were irradiated with gamma-rays at room temperature and deep frozen conditions. They were inoculated on MacConkey agar plates to see the comparative sensitivities to the irradiation. Compared to the irradiation at room temperature, the sensitivities of the strains decreased by irradiation at deep frozen conditions. Addition of glycerol to the E. coli suspensions decreased the sensitivities of E. coli to gamma-rays not only at room temperature but also at deep frozen conditions. These phenomena were elucidated by the decrease of production and mobility of OH radicals at deep frozen conditions. (author)

  3. Differentiating non-0157:H7 STEC serogroups from ground beef plated on agar media by hyperspetral imaging

    Science.gov (United States)

    Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...

  4. Discolored Red Seaweed Pyropia yezoensis with Low Commercial Value Is a Novel Resource for Production of Agar Polysaccharides.

    Science.gov (United States)

    Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji

    2018-04-26

    The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.

  5. Effect of lignin on water vapor barrier, mechanical, and structural properties of agar/lignin composite films.

    Science.gov (United States)

    Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan

    2015-11-01

    Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus

    NARCIS (Netherlands)

    Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.

    2016-01-01

    An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water

  7. On the quantitative Amido Black B staining of protein spots in agar gel at low local protein concentrations

    NARCIS (Netherlands)

    Jansen, M.T.

    1962-01-01

    Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected

  8. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    International Nuclear Information System (INIS)

    Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio

    2010-01-01

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  9. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus.

    Directory of Open Access Journals (Sweden)

    Bob Laarhoven

    Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.

  10. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)

    2010-10-15

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  11. Behavioral Modeling of WSN MAC Layer Security Attacks: A Sequential UML Approach

    DEFF Research Database (Denmark)

    Pawar, Pranav M.; Nielsen, Rasmus Hjorth; Prasad, Neeli R.

    2012-01-01

    is the vulnerability to security attacks/threats. The performance and behavior of a WSN are vastly affected by such attacks. In order to be able to better address the vulnerabilities of WSNs in terms of security, it is important to understand the behavior of the attacks. This paper addresses the behavioral modeling...... of medium access control (MAC) security attacks in WSNs. The MAC layer is responsible for energy consumption, delay and channel utilization of the network and attacks on this layer can introduce significant degradation of the individual sensor nodes due to energy drain and in performance due to delays....... The behavioral modeling of attacks will be beneficial for designing efficient and secure MAC layer protocols. The security attacks are modeled using a sequential diagram approach of Unified Modeling Language (UML). Further, a new attack definition, specific to hybrid MAC mechanisms, is proposed....

  12. Experimental Evaluation of Simulation Abstractions for Wireless Sensor Network MAC Protocols

    Directory of Open Access Journals (Sweden)

    G. P. Halkes

    2010-01-01

    Full Text Available The evaluation of MAC protocols for Wireless Sensor Networks (WSNs is often performed through simulation. These simulations necessarily abstract away from reality in many ways. However, the impact of these abstractions on the results of the simulations has received only limited attention. Moreover, many studies on the accuracy of simulation have studied either the physical layer and per link effects or routing protocol effects. To the best of our knowledge, no other work has focused on the study of the simulation abstractions with respect to MAC protocol performance. In this paper, we present the results of an experimental study of two often used abstractions in the simulation of WSN MAC protocols. We show that a simple SNR-based reception model can provide quite accurate results for metrics commonly used to evaluate MAC protocols. Furthermore, we provide an analysis of what the main sources of deviation are and thereby how the simulations can be improved to provide even better results.

  13. A new architecture and MAC protocol for fully flexible hybrid WDM/TDM PON

    NARCIS (Netherlands)

    Das, G.; Lannoo, B.; Jung, H.D.; Koonen, A.M.J.; Colle, D.; Pickavet, M.; Demeester, P.

    2009-01-01

    In this paper we propose a novel architecture and MAC protocol for a scalable, cost effective WDM / TDM PON providing fully flexible dynamic bandwidth allocation for upstream and downstream data transmission.

  14. Evaluation of video transmission of MAC protocols in wireless sensor network

    Science.gov (United States)

    Maulidin, Mahmuddin, M.; Kamaruddin, L. M.; Elsaikh, Mohamed

    2016-08-01

    Wireless Sensor Network (WSN) is a wireless network which consists of sensor nodes scattered in a particular area which are used to monitor physical or environment condition. Each node in WSN is also scattered in sensor field, so an appropriate scheme of MAC protocol should have to develop communication link for data transferring. Video transmission is one of the important applications for the future that can be transmitted with low aspect in side of cost and also power consumption. In this paper, comparison of five different MAC WSN protocol for video transmission namely IEEE 802.11 standard, IEEE 802.15.4 standard, CSMA/CA, Berkeley-MAC, and Lightweight-MAC protocol are studied. Simulation experiment has been conducted in OMNeT++ with INET network simulator software to evaluate the performance. Obtained results indicate that IEEE 802.11 works better than other protocol in term of packet delivery, throughput, and latency.

  15. Corrections to "Connectivity-Based Reliable Multicast MAC Protocol for IEEE 802.11 Wireless LANs"

    Directory of Open Access Journals (Sweden)

    Choi Woo-Yong

    2010-01-01

    Full Text Available We have found the errors in the throughput formulae presented in our paper "Connectivity-based reliable multicast MAC protocol for IEEE 802.11 wireless LANs". We provide the corrected formulae and numerical results.

  16. Analysis of an Adaptive P-Persistent MAC Scheme for WLAN Providing Delay Fairness

    Science.gov (United States)

    Yen, Chih-Ming; Chang, Chung-Ju; Chen, Yih-Shen; Huang, Ching Yao

    The paper proposes and analyzes an adaptive p-persistent-based (APP) medium access control (MAC) scheme for IEEE 802.11 WLAN. The APP MAC scheme intends to support delay fairness for every station in each access, denoting small delay variance. It differentiates permission probabilities of transmission for stations which are incurred with various packet delays. This permission probability is designed as a function of the numbers of retransmissions and re-backoffs so that stations with larger packet delay are endowed with higher permission probability. Also, the scheme is analyzed by a Markov-chain analysis, where the collision probability, the system throughput, and the average delay are successfully obtained. Numerical results show that the proposed APP MAC scheme can attain lower mean delay and higher mean throughput. In the mean time, simulation results are given to justify the validity of the analysis, and also show that the APP MAC scheme can achieve more delay fairness than conventional algorithms.

  17. 78 FR 26711 - Federal Agricultural Mortgage Corporation Funding and Fiscal Affairs; Farmer Mac Liquidity...

    Science.gov (United States)

    2013-05-08

    ... Funding and Fiscal Affairs; Farmer Mac Liquidity Management ACTION: Proposed rule; reopening of comment... proposed rule that would amend its liquidity management regulations for the Federal Agricultural Mortgage... comment on the proposed liquidity regulations. [[Page 26712

  18. A Critique of MacIntyrean Morality From a Kantian Perspective

    OpenAIRE

    Krishna Mani Pathak

    2014-01-01

    This article is a critical examination of MacIntyre’s notion of morality in reference to Kant’s deontological moral theory. The examination shows that MacIntyre (a) criticizes Kant’s moral theory to defend virtue ethics or neo-Aristotelian ethics with a weak notion of morality; (b) favors the idea of local morality, which does not leave any room for moral assessment and reciprocity in an intercultural domain; and (c) f...

  19. Strategy, Operational Art and MacArthur in the Southwest Pacific 1944

    Science.gov (United States)

    2016-05-26

    Guinea Campaign.11 It studies the campaign exclusively from the February 1944 through October 1944. The choice in dates argues that the campaign...the Pacific. King continued to maintain that MacArthur’s line of operation in SWPA, toward the Philippines to the exclusion of the central Pacific...with Nimitz allowed MacArthur the rare luxury of aircraft carriers providing a protective bubble over both the Morotai and Palaus operations. Escort

  20. Are Rural Costs of Living Lower? Evidence from a Big Mac Index Approach

    OpenAIRE

    Scott Loveridge; Dusan Paredes

    2015-01-01

    Rural leaders can point to low housing costs as a reason that their area should be competitive for business attraction. To what extent do rural housing costs offset transportation and other locational disadvantages in costs structures? The US lacks information to systematically answer the question. We adapt a strategy employed by The Economist in exploring purchasing power parity: the Big Mac Index. We gather information on Big Mac prices with a random sample of restaurants across the contigu...

  1. Profile of a leader. Alena Jean MacMaster: administrator, educator, professional activist and community advocate.

    Science.gov (United States)

    Gautreau, G; Winans, P

    1999-01-01

    This paper profiles Alena Jean MacMaster, an extraordinary nurse leader, activist, visionary and humanitarian from New Brunswick. Her determination and drive were instrumental in fostering the development and progression of health care, nursing education and nursing services at the local, provincial, federal and international levels. "First, loyalty to the institution in which you serve. The patient is the most important person in the entire institution," was Miss MacMaster's guiding principle throughout her career.

  2. MAC Version 3.3, MBA Version 1.3 acceptance test summary report

    International Nuclear Information System (INIS)

    Russell, V.K.

    1994-01-01

    The K Basins Materials Accounting (MAC) and Materials Balance (MBA) programs had the Paradox Code Cleanup ATP run to check out the systems. This report describes the results of the test and provides the signoff sheets associated with the testing. The Acceptance Test results indicate that the MAC and MBA systems are ready for operation using the cleaned up code. The final codes were removed to the production space on the customer server on April 15th

  3. Control of the pattern of perithecium development in Sordaria fimicola on agar medium.

    Science.gov (United States)

    Pollock, R T

    1975-06-01

    In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.

  4. Substances used as gelling agent alternative to the agar in culture media for in vitro propagation

    Directory of Open Access Journals (Sweden)

    Darío Alonso Martin Gordo

    2012-10-01

    Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.

  5. A Full-Duplex MAC Tailored for 5G Wireless Networks

    Directory of Open Access Journals (Sweden)

    Lucas de Melo Guimarães

    2018-01-01

    Full Text Available The increasing demands for high-data rate traffic stimulated the development of the fifth-generation (5G mobile networks. The envisioned 5G network is expected to meet its challenge by devising means to further improve spectrum usage. Many alternatives to enhance spectrum usage are being researched, such as massive MIMO, operation in mmWave frequency, cognitive radio, and the employment of full-duplex antennas. Efficient utilization of the potential of any of these technologies faces a set of challenges related to medium access control (MAC schemes. This work focuses on MAC schemes tailored for full-duplex antennas, since they are expected to play a major role in the foreseeable 5G networks. In this context, this paper presents a MAC layer technique to improve total transmission time when full-duplex antennas are employed. Several evaluations in different scenarios are conducted to assess the proposed MAC scheme. Numerical results show that the proposed scheme provides gains up to 156% when compared to a state-of-the-art full-duplex antenna MAC protocol. Compared to traditional half-duplex antenna MAC protocols, the proposed scheme yields gain up to 412%.

  6. Ophthalmic ester removal in the agar state giant molecule; Kantenjo kobunshi de futarusan esuteru jokyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    Matsubara professors of Tokyo College of Pharmacy developed the technique which simply removed phthalic ester from the solution. The property in which the giant molecule called the poly N isopropyl acrylamide cohered like the agar, when 32 degrees C is exceeded, was utilized, and the phthalic ester of poor solubility is taken in the flocculation stage. It is expected with that it can be utilized for wastewater treatment and solicitation quantity thing analysis in the environment. (translated by NEDO)

  7. Comparison of the Etest and the routine multi-disc agar diffusion ...

    African Journals Online (AJOL)

    Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.

  8. Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.

    2013-01-01

    Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30°C in 5% CO2 for 2 days prior to continuous culture in air at 30°C. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 μg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772

  9. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    OpenAIRE

    Marol Serhat; Yücesoy Mine

    2003-01-01

    Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...

  10. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    International Nuclear Information System (INIS)

    Losse, G.; Mueller, F.; Fischer, S.

    1989-01-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)

  11. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    International Nuclear Information System (INIS)

    Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun

    2005-01-01

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic

  12. Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.

    OpenAIRE

    Moskowitz, L B; Chester, B

    1982-01-01

    A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.

  13. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    Energy Technology Data Exchange (ETDEWEB)

    Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E

    1989-05-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).

  14. Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ▿

    OpenAIRE

    Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael

    2010-01-01

    BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.

  15. Comparing the disk-diffusion and agar dilution tests for Neisseria gonorrhoeae antimicrobial susceptibility testing

    Directory of Open Access Journals (Sweden)

    Hsi Liu

    2016-11-01

    Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest® (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer’s standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest® were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest®, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC’s were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest® were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.

  16. Preparation of amine-impregnated silica foams using agar as the gelling agent

    Energy Technology Data Exchange (ETDEWEB)

    Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5° andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)

    2016-10-15

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  17. Preparation of amine-impregnated silica foams using agar as the gelling agent

    International Nuclear Information System (INIS)

    Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.

    2016-01-01

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  18. An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.

    Directory of Open Access Journals (Sweden)

    Emma R Cold

    Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.

  19. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar

    Directory of Open Access Journals (Sweden)

    Fabíola Silveira-Gomes

    2011-08-01

    Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  20. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar.

    Science.gov (United States)

    Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena

    2011-01-01

    Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  1. Calibration of Ge(Li) semiconductor detector by method using agar volume source

    International Nuclear Information System (INIS)

    Yanase, Nobuyuki; Kasai, Atsushi

    1979-12-01

    The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 μCi and 0.2 μCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)

  2. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  3. Functional Implications of an Intermeshing Cogwheel-like Interaction between TolC and MacA in the Action of Macrolide-specific Efflux Pump MacAB-TolC*

    Science.gov (United States)

    Xu, Yongbin; Song, Saemee; Moeller, Arne; Kim, Nahee; Piao, Shunfu; Sim, Se-Hoon; Kang, Mooseok; Yu, Wookyung; Cho, Hyun-Soo; Chang, Iksoo; Lee, Kangseok; Ha, Nam-Chul

    2011-01-01

    Macrolide-specific efflux pump MacAB-TolC has been identified in diverse Gram-negative bacteria including Escherichia coli. The inner membrane transporter MacB requires the outer membrane factor TolC and the periplasmic adaptor protein MacA to form a functional tripartite complex. In this study, we used a chimeric protein containing the tip region of the TolC α-barrel to investigate the role of the TolC α-barrel tip region with regard to its interaction with MacA. The chimeric protein formed a stable complex with MacA, and the complex formation was abolished by substitution at the functionally essential residues located at the MacA α-helical tip region. Electron microscopic study delineated that this complex was made by tip-to-tip interaction between the tip regions of the α-barrels of TolC and MacA, which correlated well with the TolC and MacA complex calculated by molecular dynamics. Taken together, our results demonstrate that the MacA hexamer interacts with TolC in a tip-to-tip manner, and implies the manner by which MacA induces opening of the TolC channel. PMID:21325274

  4. Functional implications of an intermeshing cogwheel-like interaction between TolC and MacA in the action of macrolide-specific efflux pump MacAB-TolC.

    Science.gov (United States)

    Xu, Yongbin; Song, Saemee; Moeller, Arne; Kim, Nahee; Piao, Shunfu; Sim, Se-Hoon; Kang, Mooseok; Yu, Wookyung; Cho, Hyun-Soo; Chang, Iksoo; Lee, Kangseok; Ha, Nam-Chul

    2011-04-15

    Macrolide-specific efflux pump MacAB-TolC has been identified in diverse gram-negative bacteria including Escherichia coli. The inner membrane transporter MacB requires the outer membrane factor TolC and the periplasmic adaptor protein MacA to form a functional tripartite complex. In this study, we used a chimeric protein containing the tip region of the TolC α-barrel to investigate the role of the TolC α-barrel tip region with regard to its interaction with MacA. The chimeric protein formed a stable complex with MacA, and the complex formation was abolished by substitution at the functionally essential residues located at the MacA α-helical tip region. Electron microscopic study delineated that this complex was made by tip-to-tip interaction between the tip regions of the α-barrels of TolC and MacA, which correlated well with the TolC and MacA complex calculated by molecular dynamics. Taken together, our results demonstrate that the MacA hexamer interacts with TolC in a tip-to-tip manner, and implies the manner by which MacA induces opening of the TolC channel.

  5. McMAC: Towards a MAC Protocol with Multi-Constrained QoS Provisioning for Diverse Traffic in Wireless Body Area Networks

    Directory of Open Access Journals (Sweden)

    Muhammad Mostafa Monowar

    2012-11-01

    Full Text Available The emergence of heterogeneous applications with diverse requirements forresource-constrained Wireless Body Area Networks (WBANs poses significant challengesfor provisioning Quality of Service (QoS with multi-constraints (delay and reliability whilepreserving energy efficiency. To address such challenges, this paper proposes McMAC,a MAC protocol with multi-constrained QoS provisioning for diverse traffic classes inWBANs. McMAC classifies traffic based on their multi-constrained QoS demands andintroduces a novel superframe structure based on the "transmit-whenever-appropriate"principle, which allows diverse periods for diverse traffic classes according to their respectiveQoS requirements. Furthermore, a novel emergency packet handling mechanism is proposedto ensure packet delivery with the least possible delay and the highest reliability. McMACis also modeled analytically, and extensive simulations were performed to evaluate itsperformance. The results reveal that McMAC achieves the desired delay and reliabilityguarantee according to the requirements of a particular traffic class while achieving energyefficiency.

  6. Antibiotic resistance of microbial contaminations isolated from husbandry animals and foodstuffs

    Directory of Open Access Journals (Sweden)

    Lukáš Hleba

    2014-05-01

    Full Text Available In this paper the antibiotic resistance of microbial contaminations isolated from husbandry animals and foodstuffs were investigated. Microorganisms isolated from animals and foodstuffs were contaminations of selective media as MacConkey agar for Enterobacteriaceae genera and MRS agar for lactobacilli strains. Microorganisms were isolated and puryfied by agar four ways streak plate method. Identification of isolated microorganisms was done by mass-spectrometry method in MALDI-TOF MS Biotyper. For investigation of antibiotic resistance disc diffusion method by EUCAST was used. In this study Gram-negative and Gram-positive bacteria were identified. The most resistant or multi-resistant bacteria as Pseudomonas aeruginosa, Acinetobacter lwoffi, Lysinibacillus sphaericus, Staphylococcus aureus and Staphylococcus epidermis were determined. Other identified microorganisms were resistant to one antibiotic or not at all.

  7. Opportunistic microorganisms in patients undergoing antibiotic therapy for pulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Silvia Maria Rodrigues Querido

    2011-12-01

    Full Text Available Antimicrobial therapy may cause changes in the resident oral microbiota, with the increase of opportunistic pathogens. The aim of this study was to compare the prevalence of Candida, Staphylococcus, Pseudomonas and Enterobacteriaceae in the oral cavity of fifty patients undergoing antibiotic therapy for pulmonary tuberculosis and systemically healthy controls. Oral rinsing and subgingival samples were obtained, plated in Sabouraud dextrose agar with chloramphenicol, mannitol agar and MacConkey agar, and incubated for 48 h at 37ºC. Candida spp. and coagulase-positive staphylococci were identified by phenotypic tests, C. dubliniensis, by multiplex PCR, and coagulase-negative staphylococci, Enterobacteriaceae and Pseudomonas spp., by the API systems. The number of Candida spp. was significantly higher in tuberculosis patients, and C. albicans was the most prevalent specie. No significant differences in the prevalence of other microorganisms were observed. In conclusion, the antimicrobial therapy for pulmonary tuberculosis induced significant increase only in the amounts of Candida spp.

  8. The Role Of Staphylococcus Haemolyticus In Men Infertility

    Science.gov (United States)

    AL-Ghizzawi, Ghaed’a. J.; Jomaa, Zahraa K.

    2018-05-01

    A total of 80 samples of seminal fluid from infertile men who were admitted to clinics and attended laboratories in Omara City during the period from 1 June 2016 to 1 December 2016, samples were subjected to semen analysis as recommended by WHO. The age of patients was from 20 – 59 year. Another 25 semen samples were collected from fertilized men considered as the control group. For this purpose seminal fluid were cultured on MacConkey agar, Blood agar, Chocolate agar. Within the 80 samples recorded S. haemolyticus appeared in 14 cases and the rate of infection was 18%, all strains was diagnosed by Vitek system 2 Double. The highest percent (64%) was recorded in the age group 30 – 39. Primary infertility recorded 94% while 6% was recorded for secondary infertility. Also, different species of bacterial isolates were identified in 32 cases by Vitek system 2 Double. The bacterial infection of the male genital system affected fertility.

  9. MacDonald Dam reconstruction : using roller-compacted concrete

    Energy Technology Data Exchange (ETDEWEB)

    O' Neil, E. [AMEC Earth and Environmental Ltd., Sydney, NS (Canada)

    2007-04-01

    Located in Nova Scotia, the MacDonald Dam was commissioned in 1928. The dam consists of a 122 metre-long, 16 metre-high concrete structure comprised of an intake structure, stoplog openings, and a 34 metre-long free-overflow spillway. A 488 metre-long power canal was added as an upgrade in the 1950s. This paper provided details of the roller-compact concrete (RCC) used in the dam's recent rehabilitation following a dam failure analysis in 2003 by Nova Scotia Power Inc. RCC was chosen to help keep the dam's construction project on schedule. The layout and cross-section of the spillway was selected with consideration given to the RCC placing operation. A lift thickness of 0.20 m was selected. A formed ogee crest consisting of conventional reinforced concrete was constructed on top of the RCC. The downstream steps of the spillway were also covered with cast-in-place concrete. A low level sluice was designed to resist the weight of the wet RCC. The design compressive strength of the RCC was 20 MPa. The forms used to support the cast-in-place facing concrete on the upstream face of the dam were constructed full height and were braced back to the downstream face of the existing concrete structure prior to the start of RCC placement. Formwork inserts were placed in the facing concrete as construction progressed. Crack inducers were pre-placed on the forms. Aggregates from a local source were transported to a pug mill as the RCC construction progressed. The RCC was spread into 0.20 m lifts using a small bull-dozer, and the facing concrete was vibrated into the lift below. RCC lifts were compacted using a 9 tonne vibratory drum roller. The RCC placing operation was completed over a period of 10 days. Following the completion of the RCC portion of the dam, the remainder of the cast-in-place concrete was completed. It was concluded that the RCC provided a durable, low-maintenance structure that was completed at a lower price and in a shorter time-frame than

  10. MacDUST - a powder diffraction package developed for the ''ADONE'' high resolution diffraction station

    International Nuclear Information System (INIS)

    Burattini, E.; Cappuccio, G.; Maistrelli, P.; Simeoni, S.

    1993-01-01

    A High Resolution Powder Diffraction Station (PO.DI.STA.) was installed at the beginning of 1991 on the ADONE-Wiggler magnet beam line. The station and the first powder diffraction spectra, collected with synchrotron radiation, were presented at the EPDIC-1 Conference. More details can also be found in. For this station, a very sophisticated software package ''MacDUST'' has been developed on an Apple Macintosh computer, using the Microsoft QuickBASIC compiler. It allows very easy and comfortable operations by means of a graphical user interface environment, typical of the Macintosh system. The package consists of five major programs. The main program, MacDIFF, performs all the graphic operations on the experimental data, including zooming, overlapping, cursor scanning and editing of patterns, control of output operations to printers and HPGL plotters. It also includes several analysis routines for data smoothing, a first derivative peak search algorithm, two background subtraction routines and two profile fitting programs: one based on the simplex method and the other on the Marquardt modification of a least-square algorithm. MacPDF and MacRIC are both dedicated to phase identification. The first program is an archive manager for searching, displaying and printing phase records; MacRIC is a graphic aided search-match program based on the Hanawalt algorithm. Mac3-DIM is a plot program, useful, e.g., for representing kinetics three dimensionally. MacRIET is a Macintosh version of the well known Rietveld refinement program. This version, besides conventional structure refinements, also allows the determination of micro structural parameters, i.e. micro strain and crystallite size. The program can also be used to simulate a pattern, once the structure of the compound is known. Taking advantage of the very intuitive Macintosh graphic user interface, through dialog and alert boxes, the program allows straightforward introduction and modification of the structure

  11. An energy-efficient MAC protocol using dynamic queue management for delay-tolerant mobile sensor networks.

    Science.gov (United States)

    Li, Jie; Li, Qiyue; Qu, Yugui; Zhao, Baohua

    2011-01-01

    Conventional MAC protocols for wireless sensor network perform poorly when faced with a delay-tolerant mobile network environment. Characterized by a highly dynamic and sparse topology, poor network connectivity as well as data delay-tolerance, delay-tolerant mobile sensor networks exacerbate the severe power constraints and memory limitations of nodes. This paper proposes an energy-efficient MAC protocol using dynamic queue management (EQ-MAC) for power saving and data queue management. Via data transfers initiated by the target sink and the use of a dynamic queue management strategy based on priority, EQ-MAC effectively avoids untargeted transfers, increases the chance of successful data transmission, and makes useful data reach the target terminal in a timely manner. Experimental results show that EQ-MAC has high energy efficiency in comparison with a conventional MAC protocol. It also achieves a 46% decrease in packet drop probability, 79% increase in system throughput, and 25% decrease in mean packet delay.

  12. AgarTrap: a simplified Agrobacterium-mediated transformation method for sporelings of the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Tsuboyama, Shoko; Kodama, Yutaka

    2014-01-01

    The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.

  13. Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.

    Directory of Open Access Journals (Sweden)

    V. O. Antonyuk

    2014-08-01

    Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3β-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid сhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric

  14. Outside-In Signal Transmission by Conformational Changes in Integrin Mac-11

    Science.gov (United States)

    Lefort, Craig T.; Hyun, Young-Min; Schultz, Joanne B.; Law, Foon-Yee; Waugh, Richard E.; Knauf, Philip A.; Kim, Minsoo

    2010-01-01

    Intracellular signals associated with or triggered by integrin ligation can control cell survival, differentiation, proliferation, and migration. Despite accumulating evidence that conformational changes regulate integrin affinity to its ligands, how integrin structure regulates signal transmission from the outside to the inside of the cell remains elusive. Using fluorescence resonance energy transfer, we addressed whether conformational changes in integrin Mac-1 are sufficient to transmit outside-in signals in human neutrophils. Mac-1 conformational activation induced by ligand occupancy or activating Ab binding, but not integrin clustering, triggered similar patterns of intracellular protein tyrosine phosphorylation, including Akt phosphorylation, and inhibited spontaneous neutrophil apoptosis, indicating that global conformational changes are critical for Mac-1-dependent outside-in signal transduction. In neutrophils and myeloid K562 cells, ligand ICAM-1 or activating Ab binding promoted switchblade-like extension of the Mac-1 extracellular domain and separation of the αM and β2 subunit cytoplasmic tails, two structural hallmarks of integrin activation. These data suggest the primacy of global conformational changes in the generation of Mac-1 outside-in signals. PMID:19864611

  15. Eliminating the Heart from the Curcumin Molecule: Monocarbonyl Curcumin Mimics (MACs)

    Science.gov (United States)

    Shetty, Dinesh; Kim, Yong Joon; Shim, Hyunsuk; Snyder, James P.

    2015-01-01

    Curcumin is a natural product with several thousand years of heritage. Its traditional Asian application to human ailments has been subjected in recent decades to worldwide pharmacological, biochemical and clinical investigations. Curcumin’s Achilles heel lies in its poor aqueous solubility and rapid degradation at pH ~ 7.4. Researchers have sought to unlock curcumin’s assets by chemical manipulation. One class of molecules under scrutiny are the monocarbonyl analogs of curcumin (MACs). A thousand plus such agents have been created and tested primarily against cancer and inflammation. The outcome is clear. In vitro, MACs furnish a 10–20 fold potency gain vs. curcumin for numerous cancer cell lines and cellular proteins. Similarly, MACs have successfully demonstrated better pharmacokinetic (PK) profiles in mice and greater tumor regression in cancer xenografts in vivo than curcumin. The compounds reveal limited toxicity as measured by murine weight gain and histopathological assessment. To our knowledge, MAC members have not yet been monitored in larger animals or humans. However, Phase 1 clinical trials are certainly on the horizon. The present review focuses on the large and evolving body of work in cancer and inflammation, but also covers MAC structural diversity and early discovery for treatment of bacteria, tuberculosis, Alzheimer’s disease and malaria. PMID:25547726

  16. Crystallization and preliminary X-ray crystallographic analysis of MacA from Actinobacillus actinomycetemcomitans

    International Nuclear Information System (INIS)

    Piao, Shunfu; Xu, Yongbin; Ha, Nam-Chul

    2008-01-01

    A periplasmic membrane-fusion protein MacA from Actinobacillus actinomycetemcomitans, an essential component of the multidrug efflux pump in Gram-negative bacteria, was crystallized. Periplasmic membrane-fusion proteins (MFPs) are an essential component of the multidrug efflux pump in Gram-negative bacteria. They play a crucial role in bridging the outer membrane porin TolC and two distinct types of inner membrane transporters. The MFP MacA bridges the inner membrane ABC-type multidrug transporter MacB and the outer membrane porin TolC. MacA from the pathogenic bacterium Actinobacillus actinomycetemcomitans was expressed in Escherichia coli B834 (DE3) and the recombinant protein was purified using Ni–NTA affinity, Q anion-exchange and gel-filtration chromatography. The purified MacA protein was crystallized using the vapour-diffusion method. A MAD diffraction data set was collected to a resolution of 3.0 Å at 100 K. The crystal belongs to space group P622, with unit-cell parameters a = b = 109.2, c = 255.4 Å, α = β = 90, γ = 120°, and contains one molecule in the asymmetric unit

  17. A Power-Optimized Cooperative MAC Protocol for Lifetime Extension in Wireless Sensor Networks.

    Science.gov (United States)

    Liu, Kai; Wu, Shan; Huang, Bo; Liu, Feng; Xu, Zhen

    2016-10-01

    In wireless sensor networks, in order to satisfy the requirement of long working time of energy-limited nodes, we need to design an energy-efficient and lifetime-extended medium access control (MAC) protocol. In this paper, a node cooperation mechanism that one or multiple nodes with higher channel gain and sufficient residual energy help a sender relay its data packets to its recipient is employed to achieve this objective. We first propose a transmission power optimization algorithm to prolong network lifetime by optimizing the transmission powers of the sender and its cooperative nodes to maximize their minimum residual energy after their data packet transmissions. Based on it, we propose a corresponding power-optimized cooperative MAC protocol. A cooperative node contention mechanism is designed to ensure that the sender can effectively select a group of cooperative nodes with the lowest energy consumption and the best channel quality for cooperative transmissions, thus further improving the energy efficiency. Simulation results show that compared to typical MAC protocol with direct transmissions and energy-efficient cooperative MAC protocol, the proposed cooperative MAC protocol can efficiently improve the energy efficiency and extend the network lifetime.

  18. Efficient MAC Protocol for Hybrid Wireless Network with Heterogeneous Sensor Nodes

    Directory of Open Access Journals (Sweden)

    Md. Nasre Alam

    2016-01-01

    Full Text Available Although several Directional Medium Access Control (DMAC protocols have been designed for use with homogeneous networks, it can take a substantial amount of time to change sensor nodes that are equipped with an omnidirectional antenna for sensor nodes with a directional antenna. Thus, we require a novel MAC protocol for use with an intermediate wireless network that consists of heterogeneous sensor nodes equipped with either an omnidirectional antenna or a directional antenna. The MAC protocols that have been designed for use in homogeneous networks are not suitable for use in a hybrid network due to deaf, hidden, and exposed nodes. Therefore, we propose a MAC protocol that exploits the characteristics of a directional antenna and can also work efficiently with omnidirectional nodes in a hybrid network. In order to address the deaf, hidden, and exposed node problems, we define RTS/CTS for the neighbor (RTSN/CTSN and Neighbor Information (NIP packets. The performance of the proposed MAC protocol is evaluated through a numerical analysis using a Markov model. In addition, the analytical results of the MAC protocol are verified through an OPNET simulation.

  19. Eliminating the Heart from the Curcumin Molecule: Monocarbonyl Curcumin Mimics (MACs

    Directory of Open Access Journals (Sweden)

    Dinesh Shetty

    2014-12-01

    Full Text Available Curcumin is a natural product with several thousand years of heritage. Its traditional Asian application to human ailments has been subjected in recent decades to worldwide pharmacological, biochemical and clinical investigations. Curcumin’s Achilles heel lies in its poor aqueous solubility and rapid degradation at pH ~ 7.4. Researchers have sought to unlock curcumin’s assets by chemical manipulation. One class of molecules under scrutiny are the monocarbonyl analogs of curcumin (MACs. A thousand plus such agents have been created and tested primarily against cancer and inflammation. The outcome is clear. In vitro, MACs furnish a 10–20 fold potency gain vs. curcumin for numerous cancer cell lines and cellular proteins. Similarly, MACs have successfully demonstrated better pharmacokinetic (PK profiles in mice and greater tumor regression in cancer xenografts in vivo than curcumin. The compounds reveal limited toxicity as measured by murine weight gain and histopathological assessment. To our knowledge, MAC members have not yet been monitored in larger animals or humans. However, Phase 1 clinical trials are certainly on the horizon. The present review focuses on the large and evolving body of work in cancer and inflammation, but also covers MAC structural diversity and early discovery for treatment of bacteria, tuberculosis, Alzheimer’s disease and malaria.

  20. Crystallization and preliminary X-ray crystallographic analysis of MacA from Actinobacillus actinomycetemcomitans

    Energy Technology Data Exchange (ETDEWEB)

    Piao, Shunfu; Xu, Yongbin; Ha, Nam-Chul, E-mail: hnc@pusan.ac.kr [College of Pharmacy and Research Institute for Drug Development, Pusan National University, Jangjeon-dong, Geumjeong-gu, Busan 609-735 (Korea, Republic of)

    2008-05-01

    A periplasmic membrane-fusion protein MacA from Actinobacillus actinomycetemcomitans, an essential component of the multidrug efflux pump in Gram-negative bacteria, was crystallized. Periplasmic membrane-fusion proteins (MFPs) are an essential component of the multidrug efflux pump in Gram-negative bacteria. They play a crucial role in bridging the outer membrane porin TolC and two distinct types of inner membrane transporters. The MFP MacA bridges the inner membrane ABC-type multidrug transporter MacB and the outer membrane porin TolC. MacA from the pathogenic bacterium Actinobacillus actinomycetemcomitans was expressed in Escherichia coli B834 (DE3) and the recombinant protein was purified using Ni–NTA affinity, Q anion-exchange and gel-filtration chromatography. The purified MacA protein was crystallized using the vapour-diffusion method. A MAD diffraction data set was collected to a resolution of 3.0 Å at 100 K. The crystal belongs to space group P622, with unit-cell parameters a = b = 109.2, c = 255.4 Å, α = β = 90, γ = 120°, and contains one molecule in the asymmetric unit.

  1. MAP, MAC, and vortex-rings configurations in the Weinberg-Salam model

    Science.gov (United States)

    Teh, Rosy; Ng, Ban-Loong; Wong, Khai-Ming

    2015-11-01

    We report on the presence of new axially symmetric monopoles, antimonopoles and vortex-rings solutions of the SU(2)×U(1) Weinberg-Salam model of electromagnetic and weak interactions. When the ϕ-winding number n = 1, and 2, the configurations are monopole-antimonopole pair (MAP) and monopole-antimonopole chain (MAC) with poles of alternating sign magnetic charge arranged along the z-axis. Vortex-rings start to appear from the MAP and MAC configurations when the winding number n = 3. The MAP configurations possess zero net magnetic charge whereas the MAC configurations possess net magnetic charge of 4 πn / e. In the MAP configurations, the monopole-antimonopole pair is bounded by the Z0 field flux string and there is an electromagnetic current loop encircling it. The monopole and antimonopole possess magnetic charges ± 4πn/e sin2θW respectively. In the MAC configurations there is no string connecting the monopole and the adjacent antimonopole and they possess magnetic charges ± 4 πn/e respectively. The MAC configurations possess infinite total energy and zero magnetic dipole moment whereas the MAP configurations which are actually sphalerons possess finite total energy and magnetic dipole moment. The configurations were investigated for varying values of Higgs self-coupling constant 0 ≤ λ ≤ 40 at Weinberg angle θW = π/4.

  2. Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

    International Nuclear Information System (INIS)

    Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

    2012-01-01

    Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

  3. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr

    2005-05-15

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.

  4. Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.

    Science.gov (United States)

    Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia

    2015-02-01

    For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from

  5. Effect of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel

    International Nuclear Information System (INIS)

    Palaniandavar, N.; Gnanam, F.D.; Ramasamy, P.

    1986-01-01

    The interrelated effects of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel medium have been investigated. The main parameters are concentration of electrolytes, pH of the medium, density of the gel, the concentration of parasitic electrolyte and the concentration of additives. The pattern formation is explained on the basis of electrical double layer theory coupled with diffusion. Using Shinohara's revised coagulation concept, the flocculation value is calculated. With suitable combinations of parameter values, dendritic growth and spherulitic growth of cadmium hydroxide crystals have been observed. (author)

  6. Detection of constitutive heterodimerization of the integrin Mac-1 subunits by fluorescence resonance energy transfer in living cells

    International Nuclear Information System (INIS)

    Fu Guo; Yang Huayan; Wang Chen; Zhang Feng; You Zhendong; Wang Guiying; He Cheng; Chen Yizhang; Xu Zhihan

    2006-01-01

    Macrophage differentiation antigen associated with complement three receptor function (Mac-1) belongs to β 2 subfamily of integrins that mediate important cell-cell and cell-extracellular matrix interactions. Biochemical studies have indicated that Mac-1 is a constitutive heterodimer in vitro. Here, we detected the heterodimerization of Mac-1 subunits in living cells by means of two fluorescence resonance energy transfer (FRET) techniques (fluorescence microscopy and fluorescence spectroscopy) and our results demonstrated that there is constitutive heterodimerization of the Mac-1 subunits and this constitutive heterodimerization of the Mac-1 subunits is cell-type independent. Through FRET imaging, we found that heterodimers of Mac-1 mainly localized in plasma membrane, perinuclear, and Golgi area in living cells. Furthermore, through analysis of the estimated physical distances between cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) fused to Mac-1 subunits, we suggested that the conformation of Mac-1 subunits is not affected by the fusion of CFP or YFP and inferred that Mac-1 subunits take different conformation when expressed in Chinese hamster ovary (CHO) and human embryonic kidney (HEK) 293T cells, respectively

  7. Biofilm Removal and Antimicrobial Activities of Agar Hydrogel Containing Colloid Nano-Silver against Staphylococcus aureus and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Leyla Sadat Bouryabaf

    2017-10-01

    Full Text Available Background:    Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods:      The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results:    The MIC value was 125 µg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion:     We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.

  8. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  9. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  10. MAC-layer protocol for TCP fairness in Wireless Mesh Networks

    KAUST Repository

    Nawab, Faisal

    2012-08-01

    In this paper we study the interactions of TCP and IEEE 802.11 MAC in Wireless Mesh Networks (WMNs). We use a Markov chain to capture the behavior of TCP sessions, particularly the impact on network throughput performance due to the effect of queue utilization and packet relaying. A closed form solution is derived to numerically determine the throughput. Based on the developed model, we propose a distributed MAC protocol to alleviate the unfairness problem in WMNs. Our protocol uses the age of packet as a priority metric for packet scheduling. Simulation is conducted to validate our model and to illustrate the fairness characteristics of our proposed MAC protocol. We conclude that we can achieve fairness with only little impact on network capacity.

  11. Microcrystallography, high-pressure cryocooling and BioSAXS at MacCHESS

    Energy Technology Data Exchange (ETDEWEB)

    Englich, Ulrich, E-mail: ue22@cornell.edu; Kriksunov, Irina A. [MacCHESS (Macromolecular Diffraction Facility at CHESS), Cornell University, Ithaca, NY 14853 (United States); Cerione, Richard A. [MacCHESS (Macromolecular Diffraction Facility at CHESS), Cornell University, Ithaca, NY 14853 (United States); Department of Chemistry and Chemical Biology, Cornell University, Ithaca, NY 14853 (United States); Cornell High Energy Synchrotron Source (CHESS), Cornell University, Ithaca, NY 14853 (United States); Cook, Michael J.; Gillilan, Richard [MacCHESS (Macromolecular Diffraction Facility at CHESS), Cornell University, Ithaca, NY 14853 (United States); Gruner, Sol M. [Field of Biophysics, Cornell University, Ithaca, NY 14853 (United States); Physics Department, Cornell University, Ithaca, NY 14853 (United States); Huang, Qingqui; Kim, Chae Un; Miller, William; Nielsen, Soren; Schuller, David; Smith, Scott; Szebenyi, Doletha M. E. [MacCHESS (Macromolecular Diffraction Facility at CHESS), Cornell University, Ithaca, NY 14853 (United States)

    2011-01-01

    Three research initiatives pursued by the Macromolecular Diffraction Facility at the Cornell High Energy Synchrotron Source (MacCHESS) are presented. The Macromolecular Diffraction Facility at the Cornell High Energy Synchrotron Source (MacCHESS) is a national research resource supported by the National Center for Research Resources of the US National Institutes of Health. MacCHESS is pursuing several research initiatives designed to benefit both CHESS users and the wider structural biology community. Three initiatives are presented in further detail: microcrystallography, which aims to improve the collection of diffraction data from crystals a few micrometers across, or small well diffracting regions of inhomogeneous crystals, so as to obtain high-resolution structures; pressure cryocooling, which can stabilize transient structures and reduce lattice damage during the cooling process; and BioSAXS (small-angle X-ray scattering on biological solutions), which can extract molecular shape and other structural information from macromolecules in solution.

  12. Learn Objective-C on the Mac for OS X and iOS

    CERN Document Server

    Knaster, Scott; Malik, Waqar

    2012-01-01

    Learn to write apps for some of today's hottest technologies, including the iPhone and iPad (using iOS), as well as the Mac (using OS X). It starts with Objective-C, the base language on which the native iOS software development kit (SDK) and the OS X are based. Learn Objective-C on the Mac: For OS X and iOS, Second Edition updates a best selling book and is an extensive, newly updated guide to Objective-C. Objective-C is a powerful, object-oriented extension of C, making this update the perfect follow-up to Dave Mark's bestselling Learn C on the Mac. Whether you're an experienced C programmer

  13. Side channel analysis of some hash based MACs:A response to SHA-3 requirements

    DEFF Research Database (Denmark)

    The forthcoming NIST's Advanced Hash Standard (AHS) competition to select SHA-3 hash function requires that each candidate hash function submission must have at least one construction to support FIPS 198 HMAC application. As part of its evaluation, NIST is aiming to select either a candidate hash...... function which is more resistant to known side channel attacks (SCA) when plugged into HMAC, or that has an alternative MAC mode which is more resistant to known SCA than the other submitted alternatives. In response to this, we perform differential power analysis (DPA) on the possible smart card...... implementations of some of the recently proposed MAC alternatives to NMAC (a fully analyzed variant of HMAC) and HMAC algorithms and NMAC/HMAC versions of some recently proposed hash and compression function modes. We show that the recently proposed BNMAC and KMDP MAC schemes are even weaker than NMAC...

  14. Macular telangiectasia type 2 (MacTel) in a 34-year-old patient.

    Science.gov (United States)

    Nicolai, Heleen; Wirix, Mieke; Spielberg, Leigh; Leys, Anita

    2014-09-23

    We report macular telangiectasia type 2 (MacTel) in a 34-year-old man, the youngest patient so far published with MacTel type 2. The patient presented with metamorphopsia and impaired reading ability. Diagnosis was based on bilateral abnormal macular autofluorescence, perifoveal telangiectasia with fluorescein angiographic hyperfluorescence without cystoid oedema, a small foveal avascular zone, asymmetric configuration of the foveal pit, disruptions in the inner segment/outer segment layer and hyper-reflective haze and spots in the outer nuclear layer. Although MacTel usually manifests with a slowly progressive decrease in visual acuity in the fifth to seventh decades of life, younger patients may occasionally be diagnosed with the disease. Awareness of subtle signs of the condition is essential for early diagnosis. 2014 BMJ Publishing Group Ltd.

  15. A network architecture for precision formation flying using the IEEE 802.11 MAC Protocol

    Science.gov (United States)

    Clare, Loren P.; Gao, Jay L.; Jennings, Esther H.; Okino, Clayton

    2005-01-01

    Precision Formation Flying missions involve the tracking and maintenance of spacecraft in a desired geometric formation. The strong coupling of spacecraft in formation flying control requires inter-spacecraft communication to exchange information. In this paper, we present a network architecture that supports PFF control, from the initial random deployment phase to the final formation. We show that a suitable MAC layer for the application protocol is IEEE's 802.11 MAC protocol. IEEE 802.11 MAC has two modes of operations: DCF and PCF. We show that DCF is suitable for the initial deployment phase while switching to PCF when the spacecraft are in formation improves jitter and throughput. We also consider the effect of routing on protocol performance and suggest when it is profitable to turn off route discovery to achieve better network performance.

  16. LFA-1 and Mac-1 integrins bind to the serine/threonine-rich domain of thrombomodulin

    Energy Technology Data Exchange (ETDEWEB)

    Kawamoto, Eiji [Department of Molecular Pathobiology and Cell Adhesion Biology, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie 514-8507 (Japan); Emergency and Critical Care Center, Mie University Hospital, 2-174 Edobashi, Tsu 514-8507 (Japan); Okamoto, Takayuki, E-mail: okamotot@doc.medic.mie-u.ac.jp [Department of Molecular Pathobiology and Cell Adhesion Biology, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie 514-8507 (Japan); Takagi, Yoshimi [Department of Molecular Pathobiology and Cell Adhesion Biology, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie 514-8507 (Japan); Honda, Goichi [Medical Affairs Department, Asahi Kasei Pharma Corporation, 1-105 Kanda Jinbo-cho, Chiyoda-ku, Tokyo 101-8101 (Japan); Suzuki, Koji [Faculty of Pharmaceutical Science, Suzuka University of Medical Science, 3500-3, Minamitamagaki-cho, Suzuka, Mie 513-8679 (Japan); Imai, Hiroshi [Emergency and Critical Care Center, Mie University Hospital, 2-174 Edobashi, Tsu 514-8507 (Japan); Shimaoka, Motomu, E-mail: shimaoka@doc.medic.mie-u.ac.jp [Department of Molecular Pathobiology and Cell Adhesion Biology, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie 514-8507 (Japan)

    2016-05-13

    LFA-1 (αLβ2) and Mac-1 (αMβ2) integrins regulate leukocyte trafficking in health and disease by binding primarily to IgSF ligand ICAM-1 and ICAM-2 on endothelial cells. Here we have shown that the anti-coagulant molecule thrombomodulin (TM), found on the surface of endothelial cells, functions as a potentially new ligand for leukocyte integrins. We generated a recombinant extracellular domain of human TM and Fc fusion protein (TM-domains 123-Fc), and showed that pheripheral blood mononuclear cells (PBMCs) bind to TM-domains 123-Fc dependent upon integrin activation. We then demonstrated that αL integrin-blocking mAb, αM integrin-blocking mAb, and β2 integrin-blocking mAb inhibited the binding of PBMCs to TM-domains 123-Fc. Furthermore, we show that the serine/threonine-rich domain (domain 3) of TM is required for the interaction with the LFA-1 (αLβ2) and Mac-1 (αMβ2) integrins to occur on PBMCs. These results demonstrate that the LFA-1 and Mac-1 integrins on leukocytes bind to TM, thereby establishing the molecular and structural basis underlying LFA-1 and Mac-1 integrin interaction with TM on endothelial cells. In fact, integrin-TM interactions might be involved in the dynamic regulation of leukocyte adhesion with endothelial cells. - Highlights: • LFA-1 and Mac-1 integrins bind to the anti-coagulant molecule thrombomodulin. • The serine/threonine-rich domain of thrombomodulin is essential to interact with the LFA-1 and Mac-1 integrins on PBMCs. • Integrin-TM interactions might be involved in the dynamic regulation of leukocyte adhesion with endothelial cells.

  17. Conformational stability analyses of alpha subunit I domain of LFA-1 and Mac-1.

    Directory of Open Access Journals (Sweden)

    Debin Mao

    Full Text Available β₂ integrin of lymphocyte function-associated antigen-1 (LFA-1 or macrophage-1 antigen (Mac-1 binds to their common ligand of intercellular adhesion molecule-1 (ICAM-1 and mediates leukocyte-endothelial cell (EC adhesions in inflammation cascade. Although the two integrins are known to have distinct functions, the corresponding micro-structural bases remain unclear. Here (steered-molecular dynamics simulations were employed to elucidate the conformational stability of α subunit I domains of LFA-1 and Mac-1 in different affinity states and relevant I domain-ICAM-1 interaction features. Compared with low affinity (LA Mac-1, the LA LFA-1 I domain was unstable in the presence or absence of ICAM-1 ligand, stemming from diverse orientations of its α₇-helix with different motifs of zipper-like hydrophobic junction between α₁- and α₇-helices. Meanwhile, spontaneous transition of LFA-1 I domain from LA state to intermediate affinity (IA state was first visualized. All the LA, IA, and high affinity (HA states of LFA-1 I domain and HA Mac-1 I domain were able to bind to ICAM-1 ligand effectively, while LA Mac-1 I domain was unfavorable for binding ligand presumably due to the specific orientation of S144 side-chain that capped the MIDAS ion. These results furthered our understanding in correlating the structural bases with their functions of LFA-1 and Mac-1 integrins from the viewpoint of I domain conformational stability and of the characteristics of I domain-ICAM-1 interactions.

  18. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen

    2012-01-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

    Science.gov (United States)

    Kim, Kyunghoon; Kim, Jung Kyung

    2015-08-26

    Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

  20. Mechanical and water barrier properties of agar/κ-carrageenan/konjac glucomannan ternary blend biohydrogel films.

    Science.gov (United States)

    Rhim, Jong-Whan; Wang, Long-Feng

    2013-07-01

    Multicomponent hydrogel films composed of agar, κ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(®) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and κ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Gamma radiation effect on agar viscosity for use in food industry

    International Nuclear Information System (INIS)

    Aliste, Antonio J.; Del Mastro, Nelida L.

    1999-01-01

    The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)

  2. Mechanical response of agar gel irradiated with Nd:YAG nanosecond laser pulses

    Science.gov (United States)

    Pérez-Gutiérrez, Francisco G.; Evans, Rodger; Camacho-López, Santiago; Aguilar, Guillermo

    2010-02-01

    Nanosecond long laser pulses are used in medical applications where precise tissue ablation with minimal thermal and mechanical collateral damage is required. When a laser pulse is incident on a material, optical energy will be absorbed by a combination of linear and nonlinear absorption according to both: laser light intensity and material properties. In the case of water or gels, the first results in heat generation and thermoelastic expansion; while the second results in an expanding plasma formation that launches a shock wave and a cavitation/boiling bubble. Plasma formation due to nonlinear absorption of nanosecond laser pulses is originated by a combination of multiphoton ionization and thermionic emission of free electrons, which is enhanced when the material has high linear absorption coefficient. In this work, we present measurements of pressure transients originated when 6 ns laser pulses are incident on agar gels with varying linear absorption coefficient, mechanical properties and irradiation geometry using laser radiant exposures above threshold for bubble formation. The underlying hypothesis is that pressure transients are composed of the superposition of both: shock wave originated by hot expanding plasma resulting from nonlinear absorption of optical energy and, thermoelastic expansion originated by heat generation due to linear absorption of optical energy. The objective of this work is to evaluate the relative contribution of each absorption mechanism to mechanical effects in agar gel. Real time pressure transients are recorded with PVDF piezoelectric sensors and time-resilved imaging from 50 μm to 10 mm away from focal point.

  3. An agar gel membrane-PDMS hybrid microfluidic device for long term single cell dynamic study.

    Science.gov (United States)

    Wong, Ieong; Atsumi, Shota; Huang, Wei-Chih; Wu, Tung-Yun; Hanai, Taizo; Lam, Miu-Ling; Tang, Ping; Yang, Jian; Liao, James C; Ho, Chih-Ming

    2010-10-21

    Significance of single cell measurements stems from the substantial temporal fluctuations and cell-cell variability possessed by individual cells. A major difficulty in monitoring surface non-adherent cells such as bacteria and yeast is that these cells tend to aggregate into clumps during growth, obstructing the tracking or identification of single-cells over long time periods. Here, we developed a microfluidic platform for long term single-cell tracking and cultivation with continuous media refreshing and dynamic chemical perturbation capability. The design highlights a simple device-assembly process between PDMS microchannel and agar membrane through conformal contact, and can be easily adapted by microbiologists for their routine laboratory use. The device confines cell growth in monolayer between an agar membrane and a glass surface. Efficient nutrient diffusion through the membrane and reliable temperature maintenance provide optimal growth condition for the cells, which exhibited fast exponential growth and constant distribution of cell sizes. More than 24 h of single-cell tracking was demonstrated on a transcription-metabolism integrated synthetic biological model, the gene-metabolic oscillator. Single cell morphology study under alcohol toxicity allowed us to discover and characterize cell filamentation exhibited by different E. coli isobutanol tolerant strains. We believe this novel device will bring new capabilities to quantitative microbiology, providing a versatile platform for single cell dynamic studies.

  4. Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.

    Directory of Open Access Journals (Sweden)

    Lai Kuan Tan

    Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.

  5. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane

    2012-12-26

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.

    Science.gov (United States)

    Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen

    2013-02-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. An electrochemical approach to monitor pH change in agar media during plant tissue culture.

    Science.gov (United States)

    Wang, Min; Ha, Yang

    2007-05-15

    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  8. Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp

    Science.gov (United States)

    Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin

    2014-01-01

    Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941

  9. High-contrast MacNeille-PBS-based LCOS projection systems

    Science.gov (United States)

    Chen, Jianmin; Robinson, Michael G.; Sharp, Gary D.

    2005-04-01

    Contrast limits are investigated for MacNeille PBS based LCOS projection systems that use retarder stack filters (RSF). The two contributing factors are considered separately; namely the color management system and the panel port. To enhance performance of the former, skew ray compensated RSFs are introduced. For the latter, a general methodology is presented to optimize contrast by compensating the LCOS panel. It is shown that the orientation of the LCOS panel and compensator, relative to the MacNeille PBS, is critical. The significant impact of AR coating performance on system contrast is also revealed. A high contrast architecture will be presented by way of example.

  10. The MacNew Heart Disease health-related quality of life instrument: A summary

    Directory of Open Access Journals (Sweden)

    Guyatt Gordon

    2004-01-01

    Full Text Available Abstract Background The measurement of health, the effects of disease, and the impact of health care include not only an indication of changes in disease frequency and severity but also an estimate of patients' perception of health status before and after treatment. One of the more important developments in health care in the past decade may be the recognition that the patient's perspective is as legitimate and valid as the clinician's in monitoring health care outcomes. This has lead to the development of instruments to quantify the patients' perception of their health status before and after treatment. Methods We review evidence supporting the measurement properties of the MacNew Heart Disease Health-related Quality of Life [MacNew] Questionnaire which was designed to evaluate how daily activities and physical, emotional, and social functioning are affected by coronary heart disease and its treatment. Results Reliability was demonstrated by using internal consistency and the intraclass correlation coefficients for the three domains in the Dutch, English, Farsi, German, and Spanish versions of the MacNew. With internal consistency and intraclass correlation coefficients =>0.73, reliability is high. Validity of the MacNew was examined with factor analysis and three core underlying factors, physical, emotional, and social, were identified, explaining 63.0 – 66.5% of the observed variance and replicated in the translations with psychometric data. Construct validity of the MacNew was further demonstrated by extensive substantiation of the logical relationships, defined a priori, between items and other comparison tools. The MacNew is responsive and sensitive to changes in HRQL following various interventions for patients with heart disease with 11 of 13 effect size statistics >0.80. Taking an average of 10 minutes or less to complete, the respondent-burden for the MacNew is low and its acceptability is demonstrated by response rates of over 90

  11. A DUAL RESERVATION CDMA-BASED MAC PROTOCOL WITH POWER CONTROL FOR AD HOC NETWORKS

    Institute of Scientific and Technical Information of China (English)

    Jia Min; Chen Huimin; Yuan Yuhua

    2007-01-01

    This paper proposes a new multi-channel Medium Access Control (MAC) protocol named as Dual Reservation Code Division Multiple Access (CDMA) based MAC protocol with Power Control (DRCPC). The code channel is divided into common channel, broadcast channel and several data channels. And dynamic power control mechanism is implemented to reduce near-far interference. Compared with IEEE 802.11 Distributed Coordination Function (DCF) protocol, the results show that the proposed mechanism improves the average throughput and limits the transmission delay efficiently.

  12. Learn Xcode Tools for Mac OS X and iPhone Development

    CERN Document Server

    Piper, I

    2010-01-01

    This book will give you a thorough grounding in the principal and supporting tools and technologies that make up the Xcode Developer Tools suite. Apple has provided a comprehensive collection of developer tools, and this is the first book to examine the complete Apple programming environment for both Mac OS X and iPhone. * Comprehensive coverage of all the Xcode developer tools * Additional coverage of useful third-party development tools* Not just a survey of features, but a serious examination of the complete development process for Mac OS X and iPhone applications What you'll learn* The boo

  13. Burgernomics: a big MacT guide to purchasing power parity

    OpenAIRE

    Michael R. Pakko; Patricia S. Pollard

    2003-01-01

    The theory of purchasing power parity (PPP) has long been a staple of international economic analysis. Recent years have seen the rise in popularity of a tongue-in-cheek, fast-food version of PPP: The Big Mac™ index. In this article, Michael Pakko and Patricia Pollard describe how comparisons of Big Mac prices around the world contain the ingredients necessary to demonstrate the fundamental principles of PPP. They show that the Big Mac index does nearly as well as more comprehensive measures ...

  14. Using The Economist’s Big Mac Index for Instruction

    OpenAIRE

    Stegelin, Forrest E.

    2012-01-01

    The Economist first launched the concept of the Big Mac Index in 1986 as a guide to whether currencies were at their correct exchange rate; it is not intended to be a precise predictor of currency movements around the globe, but simply a way to make exchange-rate theory and discussions a bit more digestible. First used as a humorous illustration, the term “burgernomics†was coined and the Big Mac index became an annual occurrence. It is based upon one of the oldest concepts in internationa...

  15. Survey is based on Synchronized and Asynchronized Approach of MAC Protocols in WSN

    Directory of Open Access Journals (Sweden)

    Soni Chaurasia

    2010-07-01

    Full Text Available A wireless network is made of spatially distributed autonomous devices. These devices are called sensors. The sensor is used for monitoring physical or environmental conditions. The potential application of wireless sensor network is environmental monitoring, healthcare applications and tactical systems. In this paper focus is on the MAC protocol for WSN. Wireless sensor network is deployed for wide range to send and receive data with the help of medium. Here literature survey of MAC protocol based on the synchronized and asynchronized approach is described which is used to meet different objective like access a medium, statistical channel allocation, spectrum utilization

  16. CoCoMac 2.0 and the future of tract-tracing databases

    OpenAIRE

    Rembrandt eBakker; Rembrandt eBakker; Rembrandt eBakker; Thomas eWachtler; Markus eDiesmann; Markus eDiesmann; Markus eDiesmann

    2012-01-01

    The CoCoMac database contains the results of published axonal tract-tracing studies in the macaque brain. The combined data are used to construct the macaque macro-connectome. We discuss the redevelopment of CoCoMac and compare it to six connectome-related projects: two resources that provide online access to raw tracing data in rodents, a connectome viewer for advanced 3d graphics, a partial but highly detailed rat connectome, a brain data management system that generates custom connectivity...

  17. The Mac'OS X command line Unix under the hood

    CERN Document Server

    McElhearn, Kirk

    2006-01-01

    The Mac command line offers a faster, easier way to accomplish many tasks. It''s also the medium for many commands that aren''t accessible using the GUI. The Mac OS X Command Line is a clear, concise, tutorial-style introduction to all the major functionality provided by the command line. It''s also packed with information the experienced users need, including little-known shortcuts and several chapters devoted to advanced topics. This is a book to get you started, but also a book you won't soon outgrow.

  18. A Critique of MacIntyrean Morality From a Kantian Perspective

    Directory of Open Access Journals (Sweden)

    Krishna Mani Pathak

    2014-04-01

    Full Text Available This article is a critical examination of MacIntyre’s notion of morality in reference to Kant’s deontological moral theory. The examination shows that MacIntyre (a criticizes Kant’s moral theory to defend virtue ethics or neo-Aristotelian ethics with a weak notion of morality; (b favors the idea of local morality, which does not leave any room for moral assessment and reciprocity in an intercultural domain; and (c fails to provide good arguments for his moral historicism and against Kant’s moral universalism.

  19. A hybrid path-oriented code assignment CDMA-based MAC protocol for underwater acoustic sensor networks.

    Science.gov (United States)

    Chen, Huifang; Fan, Guangyu; Xie, Lei; Cui, Jun-Hong

    2013-11-04

    Due to the characteristics of underwater acoustic channel, media access control (MAC) protocols designed for underwater acoustic sensor networks (UWASNs) are quite different from those for terrestrial wireless sensor networks. Moreover, in a sink-oriented network with event information generation in a sensor field and message forwarding to the sink hop-by-hop, the sensors near the sink have to transmit more packets than those far from the sink, and then a funneling effect occurs, which leads to packet congestion, collisions and losses, especially in UWASNs with long propagation delays. An improved CDMA-based MAC protocol, named path-oriented code assignment (POCA) CDMA MAC (POCA-CDMA-MAC), is proposed for UWASNs in this paper. In the proposed MAC protocol, both the round-robin method and CDMA technology are adopted to make the sink receive packets from multiple paths simultaneously. Since the number of paths for information gathering is much less than that of nodes, the length of the spreading code used in the POCA-CDMA-MAC protocol is shorter greatly than that used in the CDMA-based protocols with transmitter-oriented code assignment (TOCA) or receiver-oriented code assignment (ROCA). Simulation results show that the proposed POCA-CDMA-MAC protocol achieves a higher network throughput and a lower end-to-end delay compared to other CDMA-based MAC protocols.

  20. A Hybrid Path-Oriented Code Assignment CDMA-Based MAC Protocol for Underwater Acoustic Sensor Networks

    Directory of Open Access Journals (Sweden)

    Huifang Chen

    2013-11-01

    Full Text Available Due to the characteristics of underwater acoustic channel, media access control (MAC protocols designed for underwater acoustic sensor networks (UWASNs are quite different from those for terrestrial wireless sensor networks. Moreover, in a sink-oriented network with event information generation in a sensor field and message forwarding to the sink hop-by-hop, the sensors near the sink have to transmit more packets than those far from the sink, and then a funneling effect occurs, which leads to packet congestion, collisions and losses, especially in UWASNs with long propagation delays. An improved CDMA-based MAC protocol, named path-oriented code assignment (POCA CDMA MAC (POCA-CDMA-MAC, is proposed for UWASNs in this paper. In the proposed MAC protocol, both the round-robin method and CDMA technology are adopted to make the sink receive packets from multiple paths simultaneously. Since the number of paths for information gathering is much less than that of nodes, the length of the spreading code used in the POCA-CDMA-MAC protocol is shorter greatly than that used in the CDMA-based protocols with transmitter-oriented code assignment (TOCA or receiver-oriented code assignment (ROCA. Simulation results show that the proposed POCA-CDMA-MAC protocol achieves a higher network throughput and a lower end-to-end delay compared to other CDMA-based MAC protocols.

  1. Education for Personal Life: John MacMurray on Why Learning to Be Human Requires Emotional Discipline

    Science.gov (United States)

    MacAllister, James

    2014-01-01

    In this article I discuss the philosophy of John MacMurray, and in particular, his little-examined writings on discipline and emotion education. It is argued that discipline is a vital element in the emotion education MacMurray thought central to learning to be human, because for him it takes concerted effort to overcome the human tendency toward…

  2. Medicinal, Aromatic and Cosmetic (MAC) plants for community health and bio-cultural diversity conservation in Bali, Indonesia

    NARCIS (Netherlands)

    Leurs, Liesbeth Nathalie

    2010-01-01

    The general aim of this ethno-botanical study is to document, describe and analyse the Balinese community members’ knowledge, belief and practices with regard to medicinal, aromatic and cosmetic (MAC) plants in relation to community health and bio-cultural diversity conservation of MAC plants. This

  3. An Application of MacLaury's Vantage Theory to Abstract Categories: Identity and the Process of Categorisation

    Science.gov (United States)

    Fabiszak, Malgorzata

    2010-01-01

    This paper is an application of Robert E. MacLaury's Vantage Theory (VT) to the analysis of real life spoken discourse. It utilizes Dennis R. Preston's (1994) modification of MacLaury's VT. It elucidates how cognitive processes of coordinate selection and combination contribute to the on-line construction of category membership in the abstract…

  4. Evaluation of Bruker Biotyper and Vitek MS for the identification of Candida tropicalis on different solid culture media.

    Science.gov (United States)

    Wang, He; Li, Ying; Fan, Xin; Chiueh, Tzong-Shi; Xu, Ying-Chun; Hsueh, Po-Ren

    2017-11-11

    The aim of this study was to investigate the performance of the Bruker Biotyper matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and Vitek MS systems for identification of genetically-confirmed blood isolates of Candida tropicalis that had been grown on several types of culture media commonly used for primary fungal isolation. Isolates included 105 from the National China Hospital Invasive Fungal Surveillance Net program (CHIF-NET) and 120 from National Taiwan University Hospital (NTUH). Culture media tested for CHIF-NET isolates included trypticase soy agar supplemented with 5% sheep blood (BAP), Sabouraud dextrose agar (SDA-C), CHROMagar, China blue agar (CBA), chocolate agar supplemented with vancomycin (CAP-VA), and MacConkey agar (MAC). Culture media used for NTUH isolates included BAP, SDA, CHROMagar, eosin methylene blue (EMB), inhibitory mold agar (IMA), Mycosel agar, and cornmeal agar (CMA). The Bruker Biotyper correctly identified all CHIF-NET isolates to the species level on all six agar media tested and correctly identified the majority of NTUH isolates with the exception of isolates grown on SDA (85.8%) and CMA (52.5%). The Vitek MS system correctly identified all CHIF-NET isolates to the species level with the exception of isolates grown on CHROMagar (84.8%), and correctly identified the majority of NTUH isolates with the exception of isolates grown on SDA (51.7%), Mycosel agar (57.5%), and CMA (9.2%) for NTUH isolates. Clinical microbiologists should be aware that different culture media can affect the performance of the Bruker Biotyper MALDI-TOF MS and Vitek MS systems in identifying C. tropicalis. Copyright © 2017. Published by Elsevier B.V.

  5. Colonyzer: automated quantification of micro-organism growth characteristics on solid agar

    Directory of Open Access Journals (Sweden)

    Young Alexander

    2010-05-01

    Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by

  6. The effect of magnetic nanoparticles on the acoustic properties of tissue-mimicking agar-gel phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Józefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kubovčíková, M. [Institute of Experimental Physics, Slovak Academy of Sciences, Košice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland)

    2017-06-01

    In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: • Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. • The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. • Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.

  7. Mobile Device Management horizons for CERN Managed iOS and Mac Self-Service

    CERN Multimedia

    CERN. Geneva; MUSZKOWSKI, Maciek; BIPPUS, Vincent Nicolas

    2015-01-01

    Overview of the MDM (Mobile Device Mamagement) market in the context of the CERN needs and a discussion of technical capabilities of a range of MDM products, followed by a presentation of two new functionalities implemented using an MDM: Self-service Kiosk for Mac and delegated-management solution for professional tablets.

  8. A Survey of MAC Protocols for Cognitive Radio Body Area Networks.

    Science.gov (United States)

    Bhandari, Sabin; Moh, Sangman

    2015-04-20

    The advancement in electronics, wireless communications and integrated circuits has enabled the development of small low-power sensors and actuators that can be placed on, in or around the human body. A wireless body area network (WBAN) can be effectively used to deliver the sensory data to a central server, where it can be monitored, stored and analyzed. For more than a decade, cognitive radio (CR) technology has been widely adopted in wireless networks, as it utilizes the available spectra of licensed, as well as unlicensed bands. A cognitive radio body area network (CRBAN) is a CR-enabled WBAN. Unlike other wireless networks, CRBANs have specific requirements, such as being able to automatically sense their environments and to utilize unused, licensed spectra without interfering with licensed users, but existing protocols cannot fulfill them. In particular, the medium access control (MAC) layer plays a key role in cognitive radio functions, such as channel sensing, resource allocation, spectrum mobility and spectrum sharing. To address various application-specific requirements in CRBANs, several MAC protocols have been proposed in the literature. In this paper, we survey MAC protocols for CRBANs. We then compare the different MAC protocols with one another and discuss challenging open issues in the relevant research.

  9. Modeling a content-aware LTE MAC downlink scheduler with heterogeneous traffic

    DEFF Research Database (Denmark)

    Artuso, Matteo; Christiansen, Henrik Lehrmann

    2013-01-01

    The scheduling policy adopted in the LTE (Long Term Evolution) MAC layer is the most valuable degree of freedom left from the 3GPP (3rd Generation Partnership Project) consortium to the industry and the research community . This paper presents an OPNET model of the downlink scheduling in a one...

  10. Energy Efficient MAC Scheme for Wireless Sensor Networks with High-Dimensional Data Aggregate

    Directory of Open Access Journals (Sweden)

    Seokhoon Kim

    2015-01-01

    Full Text Available This paper presents a novel and sustainable medium access control (MAC scheme for wireless sensor network (WSN systems that process high-dimensional aggregated data. Based on a preamble signal and buffer threshold analysis, it maximizes the energy efficiency of the wireless sensor devices which have limited energy resources. The proposed group management MAC (GM-MAC approach not only sets the buffer threshold value of a sensor device to be reciprocal to the preamble signal but also sets a transmittable group value to each sensor device by using the preamble signal of the sink node. The primary difference between the previous and the proposed approach is that existing state-of-the-art schemes use duty cycle and sleep mode to save energy consumption of individual sensor devices, whereas the proposed scheme employs the group management MAC scheme for sensor devices to maximize the overall energy efficiency of the whole WSN systems by minimizing the energy consumption of sensor devices located near the sink node. Performance evaluations show that the proposed scheme outperforms the previous schemes in terms of active time of sensor devices, transmission delay, control overhead, and energy consumption. Therefore, the proposed scheme is suitable for sensor devices in a variety of wireless sensor networking environments with high-dimensional data aggregate.

  11. Experimental Evaluation of Simulation Abstractions for Wireless Sensor Network MAC Protocols

    NARCIS (Netherlands)

    Halkes, G.P.; Langendoen, K.G.

    2010-01-01

    The evaluation ofMAC protocols forWireless Sensor Networks (WSNs) is often performed through simulation. These simulations necessarily abstract away from reality inmany ways. However, the impact of these abstractions on the results of the simulations has received only limited attention. Moreover,

  12. Debating Inclusion in Synecdoche, New York: A Response to Gresham and MacMillan.

    Science.gov (United States)

    Ferguson, Dianne L.; Ferguson, Philip M.

    1997-01-01

    A comprehensive review of the debate over the inclusion of children with disabilities in educational programs needs to explore research and issues beyond those considered by F. Gresham and D. MacMillan. Some of those issues are reviewed, focusing on a shift away from the medical deficit model. (SLD)

  13. The baby has not come: obstructed labour | MacKeith | South Sudan ...

    African Journals Online (AJOL)

    The baby has not come: obstructed labour. Nancy MacKeith, Wal Bichiok Wur. Abstract. No Abstract. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's ...

  14. 76 FR 35138 - Federal Agricultural Mortgage Corporation Funding and Fiscal Affairs; Farmer Mac Risk-Based...

    Science.gov (United States)

    2011-06-16

    ... Funding and Fiscal Affairs; Farmer Mac Risk-Based Capital Stress Test, Version 5.0 AGENCY: Farm Credit... credit rating agency) in regulations addressing the Risk-Based Capital Stress Test (RBCST or stress test...) (repealing and replacing Pub. L. 110-234). B. Risk-Based Capital and Credit Ratings Under our rules, Farmer...

  15. Elevated levels of homocysteine increase IL-6 production in monocytic Mono Mac 6 cells

    NARCIS (Netherlands)

    van Aken, B. E.; Jansen, J.; van Deventer, S. J.; Reitsma, P. H.

    2000-01-01

    Hyperhomocysteinemia is a risk factor for atherosclerosis and thrombosis. The aim of this study was to analyze if exposure of monocytic cells to increased levels of homocysteine (HCY) induces the accumulation of inflammatory mediators. Interleukin (IL)-6 production by monocytic cell line Mono Mac 6

  16. Knowledge, Power, and Social Policy: John M. MacEachran and Alberta's 1928 Sexual Sterilization Act

    Science.gov (United States)

    Puplampu, Korbla P.

    2008-01-01

    This article examines how academic knowledge and power have shaped the discourse on human classification and how political authorities use academic knowledge producers to legitimize public policy. Specifically, the article draws on the role of John M. MacEachran, a former academic at the University of Alberta, in the implementation of the Alberta…

  17. 78 FR 65541 - Federal Agricultural Mortgage Corporation Funding and Fiscal Affairs; Farmer Mac Liquidity...

    Science.gov (United States)

    2013-11-01

    ... attention issues and concerns that they believe warrant further or heightened FCA scrutiny. The second...; Divide the 90-day liquidity reserve into three tiers so Farmer Mac has a sufficient amount of cash and... that can be traded at fair value and an explicit public backstop.'' From the FCA's perspective, whether...

  18. Muusikamaailm : James Levine 25 aastat Metis. Taveneri ja MacMillani millenniumiteosed. Avafestival Sydneys / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2000-01-01

    J. Harbisoni ooperi "The Great Gatsby" esmalavastusega tähistab New Yorgi Metropolitan Opera oma 25-aastast koostööd J. Levine'iga. J. Taveneri uudisteosest "The Fall and Resurrection", J. MacMillani millenniumiteose "Magnificat" maailmaesiettekandest. 5.-26. jaan. toimuvast Sydney muusikafestivalist

  19. Multiple-Antenna Interference Cancellation for WLAN with MAC Interference Avoidance in Open Access Networks

    Directory of Open Access Journals (Sweden)

    Alexandr M. Kuzminskiy

    2007-10-01

    Full Text Available The potential of multiantenna interference cancellation receiver algorithms for increasing the uplink throughput in WLAN systems such as 802.11 is investigated. The medium access control (MAC in such systems is based on carrier sensing multiple-access with collision avoidance (CSMA/CA, which itself is a powerful tool for the mitigation of intrasystem interference. However, due to the spatial dependence of received signal strengths, it is possible for the collision avoidance mechanism to fail, resulting in packet collisions at the receiver and a reduction in system throughput. The CSMA/CA MAC protocol can be complemented in such scenarios by interference cancellation (IC algorithms at the physical (PHY layer. The corresponding gains in throughput are a result of the complex interplay between the PHY and MAC layers. It is shown that semiblind interference cancellation techniques are essential for mitigating the impact of interference bursts, in particular since these are typically asynchronous with respect to the desired signal burst. Semiblind IC algorithms based on second- and higher-order statistics are compared to the conventional no-IC and training-based IC techniques in an open access network (OAN scenario involving home and visiting users. It is found that the semiblind IC algorithms significantly outperform the other techniques due to the bursty and asynchronous nature of the interference caused by the MAC interference avoidance scheme.

  20. Multiple-Antenna Interference Cancellation for WLAN with MAC Interference Avoidance in Open Access Networks

    Directory of Open Access Journals (Sweden)

    Kuzminskiy Alexandr M

    2007-01-01

    Full Text Available The potential of multiantenna interference cancellation receiver algorithms for increasing the uplink throughput in WLAN systems such as 802.11 is investigated. The medium access control (MAC in such systems is based on carrier sensing multiple-access with collision avoidance (CSMA/CA, which itself is a powerful tool for the mitigation of intrasystem interference. However, due to the spatial dependence of received signal strengths, it is possible for the collision avoidance mechanism to fail, resulting in packet collisions at the receiver and a reduction in system throughput. The CSMA/CA MAC protocol can be complemented in such scenarios by interference cancellation (IC algorithms at the physical (PHY layer. The corresponding gains in throughput are a result of the complex interplay between the PHY and MAC layers. It is shown that semiblind interference cancellation techniques are essential for mitigating the impact of interference bursts, in particular since these are typically asynchronous with respect to the desired signal burst. Semiblind IC algorithms based on second- and higher-order statistics are compared to the conventional no-IC and training-based IC techniques in an open access network (OAN scenario involving home and visiting users. It is found that the semiblind IC algorithms significantly outperform the other techniques due to the bursty and asynchronous nature of the interference caused by the MAC interference avoidance scheme.

  1. TMAC: Timestamp-Ordered MAC for CSMA/CA Wireless Mesh Networks

    KAUST Repository

    Nawab, Faisal Saud Yousef; Jamshaid, Kamran; Shihada, Basem; Ho, Pin-Han

    2011-01-01

    We propose TMAC, a timestamp-ordered MAC protocol for Wireless Mesh Networks (WMNs). TMAC extends CSMA/CA by scheduling data packets based on their age. Prior to transmitting a data packet, a transmitter broadcasts a request control message appended

  2. MAC-layer protocol for TCP fairness in Wireless Mesh Networks

    KAUST Repository

    Nawab, Faisal; Jamshaid, Kamran; Shihada, Basem; Ho, Pin-Han

    2012-01-01

    In this paper we study the interactions of TCP and IEEE 802.11 MAC in Wireless Mesh Networks (WMNs). We use a Markov chain to capture the behavior of TCP sessions, particularly the impact on network throughput performance due to the effect of queue

  3. Endotoxin testing of proteins for parenteral administration using the Mono Mac 6 assay

    DEFF Research Database (Denmark)

    Moesby, Lise; Hansen, E W; Christensen, J D

    2000-01-01

    Pharmaceutical products containing proteins cause problems in testing for endotoxin and pyrogens. Many proteins interfere with the LAL test and the proteins are immunogenic in rabbits. The monocytic cell line Mono Mac 6 is an alternative assay for detection of endotoxin and other pyrogens....

  4. Implantable Body Sensor Network MAC Protocols Using Wake-up Radio – Evaluation in Animal Tissue

    NARCIS (Netherlands)

    Karuppiah Ramachandran, Vignesh Raja; van der Zwaag, B.J.; Meratnia, Nirvana; Havinga, Paul J.M.

    Applications of implantable sensor networks in the health-care industry have increased tremendously over the last decade. There are different types of medium access control (MAC) protocols that are designed for implantable body sensor networks, using different physical layer technologies such as

  5. Not the Sum of Its Parts: A Critical Review of the MacDonald Triad.

    Science.gov (United States)

    Parfitt, Charlotte Hannah; Alleyne, Emma

    2018-01-01

    The MacDonald triad posits that animal cruelty, fire setting, and bed wetting in childhood is indicative of later aggressive and violent behavior in adults. Researchers refer to this phenomenon as a precursor to later antisocial behaviors including serial and sexual murder; while practitioners cite the triad in clinical formulations and risk assessments. However, there is yet to be a critical review and consolidation of the literature that establishes whether there is empirical support. This article explores the validity of the triad. We conducted a narrative review of the relevant studies examining the MacDonald triad and its individual constituents. There is evidence that any one of the triad behaviors could predict future violent offending, but it is very rare to find all three behaviors together as predictors. Thus, the empirical research on the MacDonald triad does not fully substantiate its premise. Rather, it would appear that the triad, or its individual constituents, is better used as an indicator of dysfunctional home environments, or poor coping skills in children. Future research is needed with robust and rigorous methodologies (e.g., adequate control groups, longitudinal designs) to fully establish the MacDonald triad's validity. Finally, further consideration is needed as to whether the triad behaviors are more indicative of other problematic outcomes (e.g., maladaptive coping to life stressors).

  6. The Big Mac and Teaching about Japan. Footnotes. Volume 8, Number 5

    Science.gov (United States)

    Ellington, Lucien

    2003-01-01

    The Big Mac can be effective tool in helping students achieve a better understanding of Japan. It can defeat Orientalist stereotypes about the Japanese--and also challenge young people who might have oversimplified notions of what exactly occurs when U.S. fast food chains take root in another culture. Many deride McDonald's as a villain…

  7. Detecting DIF in Polytomous Items Using MACS, IRT and Ordinal Logistic Regression

    Science.gov (United States)

    Elosua, Paula; Wells, Craig

    2013-01-01

    The purpose of the present study was to compare the Type I error rate and power of two model-based procedures, the mean and covariance structure model (MACS) and the item response theory (IRT), and an observed-score based procedure, ordinal logistic regression, for detecting differential item functioning (DIF) in polytomous items. A simulation…

  8. Ultrasonication of pyrogenic microorganisms improves the detection of pyrogens in the Mono Mac 6 assay

    DEFF Research Database (Denmark)

    Moesby, Lise; Hansen, E W; Christensen, J D

    2000-01-01

    The monocytic cell line Mono Mac 6 is sensitive to pyrogens. When exposed to pyrogens secretion of interleukin-6 is induced. However, some eukaryotic pyrogenic microorganisms are not detectable. The aim of this study is to introduce a pretreatment of samples to expand the detection range of the a...

  9. Dependence of AeroMACS Interference on Airport Radiation Pattern Characteristics

    Science.gov (United States)

    Wilson, Jeffrey D.

    2012-01-01

    AeroMACS (Aeronautical Mobile Airport Communications System), which is based upon the IEEE 802.16e mobile wireless standard, is expected to be implemented in the 5091 to 5150 MHz frequency band. As this band is also occupied by Mobile Satellite Service (MSS) feeder uplinks, AeroMACS must be designed to avoid interference with this incumbent service. The aspects of AeroMACS operation that present potential interference are under analysis in order to enable the definition of standards that assure that such interference will be avoided. In this study, the cumulative interference power distribution at low earth orbit from AeroMACS transmitters at the 497 major airports in the contiguous United States was simulated with the Visualyse Professional software. The dependence of the interference power on the number of antenna beams per airport, gain patterns, and beam direction orientations was simulated. As a function of these parameters, the simulation results are presented in terms of the limitations on transmitter power required to maintain the cumulative interference power under the established threshold.

  10. 78 FR 65145 - Federal Agricultural Mortgage Corporation Funding and Fiscal Affairs; Farmer Mac Capital Planning

    Science.gov (United States)

    2013-10-31

    ... capital adequacy and capital planning. \\4\\ Bank for International Settlements, Basel Committee on Banking....60--Corporate Business Planning The Farm Credit Council commented that our reference to ``goals and.... 652.60 to read as follows: Sec. 652.60 Corporate business planning. (a) Farmer Mac's board of...

  11. Detecting and Preventing Beacon Replay Attacks in Receiver-Initiated MAC Protocols for Energy Efficient WSNs

    DEFF Research Database (Denmark)

    Di Mauro, Alessio; Fafoutis, Xenofon; Mödersheim, Sebastian Alexander

    2013-01-01

    In receiver-initiated MAC protocols for Wireless Sensor Networks (WSNs), communication is initiated by the receiver of the data through beacons containing the receiver's identity. In this paper, we consider the case of a network intruder that captures and replays such beacons towards legitimate...

  12. Nuclear power history calculation for subcritical systems using Euler-MacLaurin formula

    International Nuclear Information System (INIS)

    Henrice Junior, Edson; Goncalves, Alessandro da Cruz

    2013-01-01

    This paper presents an efficient method for calculating the reactivity using inverse point kinetic equation for subcritical systems by applying the Euler-MacLaurin summation formula to calculate the nuclear power history. In accordance with the accuracy of the numerical results, this method does not require a large number of points for calculation, providing accurate results with low computational cost. (author)

  13. Scalable Video Streaming Adaptive to Time-Varying IEEE 802.11 MAC Parameters

    Science.gov (United States)

    Lee, Kyung-Jun; Suh, Doug-Young; Park, Gwang-Hoon; Huh, Jae-Doo

    This letter proposes a QoS control method for video streaming service over wireless networks. Based on statistical analysis, the time-varying MAC parameters highly related to channel condition are selected to predict available bitrate. Adaptive bitrate control of scalably-encoded video guarantees continuity in streaming service even if the channel condition changes abruptly.

  14. Dynamic Channel Slot Allocation Scheme and Performance Analysis of Cyclic Quorum Multichannel MAC Protocol

    Directory of Open Access Journals (Sweden)

    Xing Hu

    2017-01-01

    Full Text Available In high diversity node situation, multichannel MAC protocol can improve the frequency efficiency, owing to fewer collisions compared with single-channel MAC protocol. And the performance of cyclic quorum-based multichannel (CQM MAC protocol is outstanding. Based on cyclic quorum system and channel slot allocation, it can avoid the bottleneck that others suffered from and can be easily realized with only one transceiver. To obtain the accurate performance of CQM MAC protocol, a Markov chain model, which combines the channel-hopping strategy of CQM protocol and IEEE 802.11 distributed coordination function (DCF, is proposed. The results of numerical analysis show that the optimal performance of CQM protocol can be obtained in saturation bound situation. And then we obtain the saturation bound of CQM system by bird swarm algorithm. In addition, to improve the performance of CQM protocol in unsaturation situation, a dynamic channel slot allocation of CQM (DCQM protocol is proposed, based on wavelet neural network. Finally, the performance of CQM protocol and DCQM protocol is simulated by Qualnet platform. And the simulation results show that the analytic and simulation results match very well; the DCQM performs better in unsaturation situation.

  15. A Very Low Power MAC (VLPM Protocol for Wireless Body Area Networks

    Directory of Open Access Journals (Sweden)

    Kyung Sup Kwak

    2011-03-01

    Full Text Available Wireless Body Area Networks (WBANs consist of a limited number of battery operated nodes that are used to monitor the vital signs of a patient over long periods of time without restricting the patient’s movements. They are an easy and fast way to diagnose the patient’s status and to consult the doctor. Device as well as network lifetime are among the most important factors in a WBAN. Prolonging the lifetime of the WBAN strongly depends on controlling the energy consumption of sensor nodes. To achieve energy efficiency, low duty cycle MAC protocols are used, but for medical applications, especially in the case of pacemakers where data have time-limited relevance, these protocols increase latency which is highly undesirable and leads to system instability. In this paper, we propose a low power MAC protocol (VLPM based on existing wakeup radio approaches which reduce energy consumption as well as improving the response time of a node. We categorize the traffic into uplink and downlink traffic. The nodes are equipped with both a low power wake-up transmitter and receiver. The low power wake-up receiver monitors the activity on channel all the time with a very low power and keeps the MCU (Micro Controller Unit along with main radio in sleep mode. When a node [BN or BNC (BAN Coordinator] wants to communicate with another node, it uses the low-power radio to send a wakeup packet, which will prompt the receiver to power up its primary radio to listen for the message that follows shortly. The wake-up packet contains the desired node’s ID along with some other information to let the targeted node to wake-up and take part in communication and let all other nodes to go to sleep mode quickly. The VLPM protocol is proposed for applications having low traffic conditions. For high traffic rates, optimization is needed. Analytical results show that the proposed protocol outperforms both synchronized and unsynchronized MAC protocols like T-MAC, SCP-MAC, B-MAC

  16. Diffusion of manganese ions in agar gel containing alkali metal chlorides

    International Nuclear Information System (INIS)

    Borhade, A.V.

    2000-01-01

    The obstruction effect for tracer-diffusion of Mn 2+ ions in the presence of different supporting electrolytes (LiCl, NaCl, KCl, CsCl) at various concentrations has been studied at 25 deg C using the zone diffusion technique. It has been observed that the obstruction effect determined in terms of α increases with concentration of the electrolyte. Further, for a given concentration it is found to decrease with increasing charge density of the cation. We also report here on the effect of temperature on obstruction and found that is constant over the temperature range studied (25-45 deg C). These observations are explained on the basis of competitive hydration between ions and agar macromolecules. (author)

  17. Antimicrobial Disk Susceptibility Testing of Leptospira spp. Using Leptospira Vanaporn Wuthiekanun (LVW) Agar.

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Langla, Sayan; White, Nicholas J; Day, Nicholas P J; Limmathurotsakul, Direk; Peacock, Sharon J

    2015-08-01

    Leptospira Vanaporn Wuthiekanun (LVW) agar was used to develop a disk diffusion assay for Leptospira spp. Ten pathogenic Leptospira isolates were tested, all of which were susceptible to 17 antimicrobial agents (amoxicillin/clavulanic acid, amoxicillin, azithromycin, cefoxitin, ceftazidime, ceftriaxone, chloramphenicol, ciprofloxacin, clindamycin, doripenem, doxycycline, gentamicin, linezolid, nitrofurantoin, penicillin, piperacillin/tazobactam, and tetracycline). All 10 isolates had no zone of growth inhibition for four antimicrobials (fosfomycin, nalidixic acid, rifampicin, and trimethoprim/sulfamethoxazole). Of the ten Leptospira, seven had a growth inhibition zone of ≤ 21 mm for aztreonam, the zone diameter susceptibility break point for Enterobacteriaceae. This assay could find utility as a simple screening method during the epidemiological surveillance of antimicrobial resistance in Leptospira spp. © The American Society of Tropical Medicine and Hygiene.

  18. Perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on pigeon manure filtrate agar

    Energy Technology Data Exchange (ETDEWEB)

    Staib, F.

    1981-02-01

    To enable studies of the dependence of Cryptococcus neoformans and its perfect and imperfect states upon bird manure as a habitat of this pathogen, a nutrient medium closely resembling natural conditions was prepared. As sole nutrient, the water soluble ingredients of manure from pigeons (Columbia livia) were used. There was no heat sterilization of the manure filtrate. Using a standard pair of C. neoformans strains for mating, it could be demonstrated that the perfect state of the fungus developed on this so called pigeon manure filtrate agar within 48 h at 26 degrees C. This medium is supposed to help in the elucidation of the epidemiological significance of the perfect and imperfect states of this pathogen.

  19. Agar hydrogel with silver nanoparticles to prolong the shelf life of Fior di Latte cheese.

    Science.gov (United States)

    Incoronato, A L; Conte, A; Buonocore, G G; Del Nobile, M A

    2011-04-01

    The objective of this work was to evaluate the effectiveness of an antimicrobial packaging system containing active nanoparticles on the quality deterioration of Fior di Latte cheese. To this aim, 3 concentrations of silver montmorillonite embedded in agar were used. The cell loads of spoilage and useful microorganisms were monitored during a refrigerated storage period. Moreover, cheese sensory quality (i.e., odor, color, consistency, and overall quality) was evaluated by means of a panel test. Results showed that the active packaging system markedly increased the shelf life of Fior di Latte cheese, due to the ability of silver cations to control microbial proliferation, without affecting the functional dairy microbiota and the sensory characteristics of the product. The active packaging system developed in this work could be used to prolong the shelf life of Fior di Latte and boost its distribution beyond local market borders. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  20. Diagnostic Value of Processing Cytologic Aspirates of Renal Tumors in Agar Cell (Tissue) Blocks

    DEFF Research Database (Denmark)

    Smedts, F.; Schrik, M.; Horn, T.

    2010-01-01

    smears were prepared after each aspiration for conventional cytology and the remaining aspirate was processed for the improved agar microbiopsy (AM) method. Conventional cytology slides, AM slides and surgical specimens were diagnosed separately, after which the diagnoses were compared....... Immunohistochemistry was performed as required on the AM sections. Surgical specimens served as the gold standard. Results In 53% of conventional cytologic smears, the cellular yield was sufficient to render a correct diagnosis. In 12% the diagnosis was incorrect, in 21% only a differential diagnosis could be fin......-initiated, and in 14% too few diagnostic cells were present in the conventional smears for cytologic diagnosis. It was, however, possible to correctly diagnose histologic sections from 97% of AM tissue blocks. In 11 cases this was facilitated with immunochemistry. In only 1 case did the AM tissue block contain too few...

  1. Optimasi Waktu Proses Hidrolisis dan Fermentasi dalam Produksi Bioetanol dari Limbah Pengolahan Agar (Gracilaria sp. Industri

    Directory of Open Access Journals (Sweden)

    Rodiah Nurbaya Sari

    2013-12-01

    menggunakan kapang Trichoderma viride dan khamir Saccharomyces cerevisiae. Penelitian yang dilakukan terdiri dari beberapa tahap yaitu karakterisasi limbah agar industri, hidrolisis enzimatis menggunakan kapang Trichoderma viride penghasil selulase, dan fermentasi dengan khamir Saccharomyces cerevisiae. Hasilnya menunjukkan bahwa waktu optimal untuk hidrolisis enzimatis adalah 4 hari pada suhu 28 oC dan pH 3,91; aktivitas CMCase 210,48 IU/ml dan menghasilkan total gula pereduksi 6,74 mg/ml. Sedangkan untuk waktu fermentasi yang optimal adalah 2 hari pada suhu 32 oC dan pH 4,66 dengan nilai OD 600 nm 0,0181 menghasilkan etanol kasar dengan kadar 0,47% (b/b.

  2. The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

    DEFF Research Database (Denmark)

    Burmølle, Mette; Johnsen, Kaare; Abu Al-Soud, Waleed Mohamad Abdel F

    2009-01-01

    Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial...... cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect...... of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain...

  3. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  4. Effects of Antifungal Soaked Silicone Hydrogel Contact Lenses on Candida albicans in an Agar Eye Model.

    Science.gov (United States)

    Phan, Chau-Minh; Bajgrowicz, Magdalena; McCanna, David J; Subbaraman, Lakshman N; Jones, Lyndon

    2016-09-01

    To evaluate the effects of two commercial silicone hydrogel contact lenses (CLs) soaked with natamycin (NA) or fluconazole (FL) on the growth of Candida albicans in an in vitro eye model. Three-D printed molds were used as a cast for making eye-shaped models comprising potato dextrose agar. Senofilcon A (SA) and lotrafilcon B (LB) CLs were incubated with either 2 mL of NA or FL at a concentration of 1 mg/mL for 24 hr. To simulate a fungal infection, the eye models were coated with C. albicans. The drug-soaked lenses were placed on top of the eye models. Seven experimental conditions were examined: (1) NA-SA, (2) NA-LB, (3) FL-SA, (4) FL-LB, (5) SA, (6) LB, and (7) control-no lens. At specified time points (t=1, 8, 16, 24, 48 hr), the agar eyes from each experimental condition were removed from the incubator and photographed. The yeast cells from the 24 and 48 hr time point were also analyzed using light microscopy. At 24 and 48 hr, there was considerable growth observed for all conditions except for the NA-SA and NA-LB conditions. When observed under the microscope at 24 and 48 hr, the morphology of the yeast cells in the FL-SA and SA condition were similar to that of the control (oval shaped). There was limited hyphae growth observed for LB and significant visible hyphae growth for the NA-LB group. For NA-SA, NA-LB, and FL-LB groups, the cells were significantly smaller compared with the control. For NA-SA and NA-LB, there was limited growth of C. albicans observed on the eye models even after 48 hr. Under the microscope, the cell morphology differ noticeably between each testing condition, and is dependent on drug-lens combinations.

  5. Copper removal by algae Gelidium, agar extraction algal waste and granulated algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2008-03-01

    Biosorption of copper ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). The effects of contact time, pH, ionic strength (IS) and temperature on the biosorption process have been studied. Equilibrium data follow both Langmuir and Langmuir-Freundlich models. The parameters of Langmuir equilibrium model were: q(max)=33.0mgg(-1), K(L)=0.015mgl(-1); q(max)=16.7mgg(-1), K(L)=0.028mgl(-1) and q(max)=10.3mgg(-1), K(L)=0.160mgl(-1) respectively for Gelidium, algal waste and composite material at pH=5.3, T=20 degrees C and IS=0.001M. Increasing the pH, the number of deprotonated active sites increases and so the uptake capacity of copper ions. In the case of high ionic strengths, the contribution of the electrostatic component to the overall binding decreases, and so the uptake capacity. The temperature has little influence on the uptake capacity principally for low equilibrium copper concentrations. Changes in standard enthalpy, Gibbs energy and entropy during biosorption were determined. Kinetic data at different solution pH (3, 4 and 5.3) were fitted to pseudo-first-order and pseudo-second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model, which successfully predicts Cu(II) concentration profiles.

  6. MacA is a second cytochrome c peroxidase of Geobacter sulfurreducens.

    Science.gov (United States)

    Seidel, Julian; Hoffmann, Maren; Ellis, Katie E; Seidel, Antonia; Spatzal, Thomas; Gerhardt, Stefan; Elliott, Sean J; Einsle, Oliver

    2012-04-03

    The metal-reducing δ-proteobacterium Geobacter sulfurreducens produces a large number of c-type cytochromes, many of which have been implicated in the transfer of electrons to insoluble metal oxides. Among these, the dihemic MacA was assigned a central role. Here we have produced G. sulfurreducens MacA by recombinant expression in Escherichia coli and have solved its three-dimensional structure in three different oxidation states. Sequence comparisons group MacA into the family of diheme cytochrome c peroxidases, and the protein indeed showed hydrogen peroxide reductase activity with ABTS(-2) as an electron donor. The observed K(M) was 38.5 ± 3.7 μM H(2)O(2) and v(max) was 0.78 ± 0.03 μmol of H(2)O(2)·min(-1)·mg(-1), resulting in a turnover number k(cat) = 0.46 · s(-1). In contrast, no Fe(III) reductase activity was observed. MacA was found to display electrochemical properties similar to other bacterial diheme peroxidases, in addition to the ability to electrochemically mediate electron transfer to the soluble cytochrome PpcA. Differences in activity between CcpA and MacA can be rationalized with structural variations in one of the three loop regions, loop 2, that undergoes conformational changes during reductive activation of the enzyme. This loop is adjacent to the active site heme and forms an open loop structure rather than a more rigid helix as in CcpA. For the activation of the protein, the loop has to displace the distal ligand to the active site heme, H93, in loop 1. A H93G variant showed an unexpected formation of a helix in loop 2 and disorder in loop 1, while a M297H variant that altered the properties of the electron transfer heme abolished reductive activation.

  7. Manual Ability Classification System (MACS: reliability between therapists and parents in Brazil

    Directory of Open Access Journals (Sweden)

    Daniela B. R. Silva

    2015-02-01

    Full Text Available BACKGROUND: The Manual Ability Classification System (MACS has been widely used to describe the manual ability of children with cerebral palsy (CP; however its reliability has not been verified in Brazil. OBJECTIVE: To establish the inter- and intra-rater reliability of the Portuguese-Brazil version of the MACS by comparing the classifications given by therapists and parents of children with CP. METHOD: Data were obtained from 90 children with CP between the ages of 4 and 18 years, who were treated at the neurology and rehabilitation clinics of a Brazilian hospital. Therapists (an occupational therapist and a student classified manual ability (MACS through direct observation and information provided by parents. Therapists and parents used the Portuguese-Brazil version of the MACS. Intra- and inter-rater reliability was obtained using unweighted Kappa coefficient (k and intra-class correlation coefficient (ICC. The Chi-square test was used to identify the predominance of disagreements in the classification of parents and therapists. RESULTS: An almost perfect agreement resulted among therapists [K=0.90 (95% CI 0.83-0.97; ICC=0.97 (95%CI 0.96-0.98], as well as with intra-rater (therapists, with Kappa ranging between 0.83 and 0.95 and ICC between 0.96 and 0.99 for the evaluator with more and less experience in rehabilitation, respectively. The agreement between therapists and parents was fair [K=0.36 (95% CI 0.22-0.50; ICC=0.79 (95% CI 0.70-0.86]. CONCLUSIONS: The Portuguese version of the MACS is a reliable instrument to be used jointly by parents and therapists.

  8. Assessment of manual material handling using Iranian MMH regulations and comparison with NIOSH equation and MAC method in one of the metal casting industries in Tehran, 2011

    Directory of Open Access Journals (Sweden)

    2013-08-01

    Result: Results showed an acceptable agreement between Iranian regulation and MAC method as well as Iranian regulation and NIOSH equation. However, no acceptable agreement was observed between MAC method and NIOSH equation.

  9. Zinc-air cell with KOH-treated agar layer between electrode and electrolyte containing hydroponics gel

    Energy Technology Data Exchange (ETDEWEB)

    Otham, R. [International Islamic University, Kuala Lumpur (Malaysia); Yahaya, A. H. [University of Malaya, Dept. of Chemistry, Kuala Lumpur (Malaysia); Arof, A. K. [University of Malaya, Dept. of Physics, Kuala Lumpur (Malaysia)

    2002-07-01

    Zinc-air electrochemical power sources possess the highest density compared to other zinc anode batteries, due their free and unlimited supply from the ambient air. In this experiment zinc-air cells have been fabricated employing hydroponics gel as an alternative alkaline electrolyte gelling agent. Thin KOH-treated agar layer was applied between the electrode-electrolyte interfaces which produced significant enhancement of the cells' capacities, indicating that the application of thin agar layer will improve the electrode-gelled electrolyte interfaces. Promising results have been achieved with porous zinc anode prepared from dried zinc-graphite-gelatinized agar paste; e g. a zinc-air cell employing a porous zinc anode has demonstrated a capacity of 1470 mAh rated at 0.1 A continuous discharge. 32 refs., 9 figs.

  10. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Science.gov (United States)

    Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo

    2009-07-03

    Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to

  11. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Directory of Open Access Journals (Sweden)

    Ellen Yeh

    Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost

  12. Enhanced chlorine resistance of tap water-adapted Legionella pneumophila as compared with agar medium-passaged strains.

    Science.gov (United States)

    Kuchta, J M; States, S J; McGlaughlin, J E; Overmeyer, J H; Wadowsky, R M; McNamara, A M; Wolford, R S; Yee, R B

    1985-07-01

    Previous studies have shown that bacteria maintained in a low-nutrient "natural" environment such as swimming pool water are much more resistant to disinfection by various chemical agents than strains maintained on rich media. In the present study a comparison was made of the chlorine (Cl2) susceptibility of hot-water tank isolates of Legionella pneumophila maintained in tap water and strains passaged on either nonselective buffered charcoal-yeast extract or selective differential glycine-vancomycin-polymyxin agar medium. Our earlier work has shown that environmental and clinical isolates of L. pneumophila maintained on agar medium are much more resistant to Cl2 than coliforms are. Under the present experimental conditions (21 degrees C, pH 7.6 to 8.0, and 0.25 mg of free residual Cl2 per liter, we found the tap water-maintained L. pneumophila strains to be even more resistant than the agar-passaged isolates. Under these conditions, 99% kill of tap water-maintained strains of L. pneumophila was usually achieved within 60 to 90 min compared with 10 min for agar-passaged strains. Samples from plumbing fixtures in a hospital yielded legionellae which were "super"-chlorine resistant when assayed under natural conditions. After one agar passage their resistance dropped to levels of comparable strains which had not been previously exposed to additional chlorination. These studies more closely approximate natural conditions than our previous work and show that tap water-maintained L. pneumophila is even more resistant to Cl2 than its already resistant agar medium-passaged counterpart.

  13. Variation in the excitability of developed D. discoideum cells as a function of agar concentration in the substrate

    Science.gov (United States)

    Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard

    2010-03-01

    In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.

  14. PERFIL ETIOLÓGICO DA MASTITE BOVINA NA BACIA LEITEIRA DE SANTA IZABEL DO OESTE, PARANÁ

    Directory of Open Access Journals (Sweden)

    Lucianne Leigue dos Santos

    2010-12-01

    Full Text Available Clinical or sub-clinical mastitis are the main illnesses that affect dairy herds, with impact on the economy, the industry, and with consequence to public health. Considering that the city of Santa Izabel do Oeste is located in the second bigger milk region of Paraná state, and that mastitis cases are epidemiologically classified as ambient or contagious, the purpose of this study was to identify possible etiologic agents of bovine mastitis, by the use of a preliminary, fast and cheap diagnostic method to differentiate these types of illness, to orient treatment and prophylactic measures. Two triplates were employed. Triplate I was composed by blood agar, bile-esculine agar and mannitol-salt agar, while triplate II was composed by MacConkey agar; Baird-Parker agar and sabouraud-dextrose agar with cloranfenicol. Additionally, a tube with sabouraud-dextrose agar with cloranfenicol incubated at room temperature temperature was used for the research of filamentous moulds. It was observed that the great majority of the isolated samples had Staphylococcus coagulase negative, coliforms, Staphylococcus aureus, no-fermenters bacilli gram negative, Coryneforms, Streptococcus spp. and Streptococcus agalactiae.

  15. THE ISOLATION AND IDENTIFICATION OF MYCOBACTERIUM AVIUM COMPLEX (MAC) RECOVERED FROM LOS ANGELES POTABLE WATER, A POSSIBLE SOURCE OF INFECTION IN AIDS PATIENTS

    Science.gov (United States)

    Los Angeles water was investigated as a possible source of Mycobacterium avium complex (MAC) infection in patients with AIDS. MAC consists of M.avium (MA), M. intracellulare (MI) and Mycobacterium X (MX)(positive for MAC by DNA probe but not MA or MI). The study included 13 reser...

  16. [Spanish validation of the MacArthur Competence Assessment Tool for Treatment interview to assess patients competence to consent treatment].

    Science.gov (United States)

    Alvarez Marrodán, Ignacio; Baón Pérez, Beatriz; Navío Acosta, Mercedes; López-Antón, Raul; Lobo Escolar, Elena; Ventura Faci, Tirso

    2014-09-09

    To validate the MacArthur Competence Assessment Tool for Treatment (MacCAT-T) Spanish version, which assesses the mental capacity of patients to consent treatment, by examining 4 areas (Understanding, Appreciation, Reasoning and Expressing a choice). 160 subjects (80 Internal Medicine inpatients, 40 Psychiatric inpatients and 40 healthy controls). MacCAT-T, Mini-Mental Status Examination (MMSE). Feasibility study, reliability and validity calculations (against to gold standard of clinical expert). Mean duration of the MacCAT-T interview was 18min. Inter-rater reliability: Intraclass correlation coefficient for Understanding=0.98, Appreciation=0.97, Reasoning=0.98, Expressing a choice=0.91. Internal consistency (Cronbach's alpha): Understanding=0.87, for Appreciation=0.76, for Reasoning=0.86. Patients considered to be incapable (gold standard) scored lower in all the MacCAT-T areas. Poor performance on the MacCAT-T was related to cognitive impairment assessed by MMSE. Spanish version of the MacCAT-T is feasible, reliable, and valid for assessing the capacity of patients to consent treatment. Copyright © 2013 Elsevier España, S.L. All rights reserved.

  17. Matrix-assisted cocrystallization (MAC) simultaneous production and formulation of pharmaceutical cocrystals by hot-melt extrusion.

    Science.gov (United States)

    Boksa, Kevin; Otte, Andrew; Pinal, Rodolfo

    2014-09-01

    A novel method for the simultaneous production and formulation of pharmaceutical cocrystals, matrix-assisted cocrystallization (MAC), is presented. Hot-melt extrusion (HME) is used to create cocrystals by coprocessing the drug and coformer in the presence of a matrix material. Carbamazepine (CBZ), nicotinamide (NCT), and Soluplus were used as a model drug, coformer, and matrix, respectively. The MAC product containing 80:20 (w/w) cocrystal:matrix was characterized by differential scanning calorimetry, Fourier transform infrared spectroscopy, and powder X-ray diffraction. A partial least squares (PLS) regression model was developed for quantifying the efficiency of cocrystal formation. The MAC product was estimated to be 78% (w/w) cocrystal (theoretical 80%), with approximately 0.3% mixture of free (unreacted) CBZ and NCT, and 21.6% Soluplus (theoretical 20%) with the PLS model. A physical mixture (PM) of a reference cocrystal (RCC), prepared by precipitation from solution, and Soluplus resulted in faster dissolution relative to the pure RCC. However, the MAC product with the exact same composition resulted in considerably faster dissolution and higher maximum concentration (∼five-fold) than those of the PM. The MAC product consists of high-quality cocrystals embedded in a matrix. The processing aspect of MAC plays a major role on the faster dissolution observed. The MAC approach offers a scalable process, suitable for the continuous manufacturing and formulation of pharmaceutical cocrystals. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

  18. Extracción, identificación y prueba microbiológica del agar extraído de Gracilaria fortissima dawson (rhodophyta, gigartinales, gracilariaceae (ING

    Directory of Open Access Journals (Sweden)

    M.V. Sánchez

    2016-03-01

    Full Text Available The red seaweed Gracilaria fortissima colected in the caribean coast of Costa Rica, was studied for the extraction, identification and microbiological performance of the agar contend of this plant, as well as the mineral contend. The research was done focused on the agar quality included pH, % extraction, geling point, fusion point and gel strength, as well as infrared analysis and the performance as a microbiological culture of bacteria and fungus and compared with commercial agar from BDH chemicals.

  19. Short-term hydro generation scheduling of Three Gorges–Gezhouba cascaded hydropower plants using hybrid MACS-ADE approach

    International Nuclear Information System (INIS)

    Mo, Li; Lu, Peng; Wang, Chao; Zhou, Jianzhong

    2013-01-01

    Highlights: • MACS and ADE algorithms are hybridized as MACS-ADE method for solving STHGS problem. • An adaptive mutation is integrated into the proposed algorithm to avoid premature convergence. • MACS and ADE are run in parallel in search of better solution. • Several effective heuristic strategies are designed for dealing with various constraints of STHGS problem. - Abstract: Short-term hydro generation scheduling (STHGS) aims at determining optimal hydro generation scheduling to obtain minimum water consumption for one day or week while meeting various system constraints. In this paper, the STHGS problem is decomposed into two sub-problems: (i) unit commitment (UC) sub-problem; (ii) economic load dispatch (ELD) sub-problem. Then, we present a hybrid algorithm based on multi ant colony system (MACS) and differential evolution (DE) for solving the STHGS problem. First, MACS is used for dealing with UC sub-problem. A set of cooperating ant colonies cooperate to choose the unit state over the scheduled time horizon. Then, the adaptive differential evolution (ADE) is used to solve ELD sub-problem. MACS and ADE are run in parallel with adjusting their solutions in search of a better solution. Meanwhile, local and global pheromone updating rules in MACS and adaptive dynamic parameter adjusting strategy in DE are applied for enhancing the search ability of MACS-ADE. Finally, the proposed method is implemented to solve STHGS problem of Three Gorges–Gezhouba cascaded hydropower plants to verify the feasibility and effectiveness. Compared with other established methods, the simulation results reveal that the proposed MACS-ADE approach has the best convergence property, computational efficiency with less water consumption

  20. What are the key drivers of MAC curves? A partial-equilibrium modelling approach for the UK

    International Nuclear Information System (INIS)

    Kesicki, Fabian

    2013-01-01

    Marginal abatement cost (MAC) curves are widely used for the assessment of costs related to CO 2 emissions reduction in environmental economics, as well as domestic and international climate policy. Several meta-analyses and model comparisons have previously been performed that aim to identify the causes for the wide range of MAC curves. Most of these concentrate on general equilibrium models with a focus on aspects such as specific model type and technology learning, while other important aspects remain almost unconsidered, including the availability of abatement technologies and level of discount rates. This paper addresses the influence of several key parameters on MAC curves for the United Kingdom and the year 2030. A technology-rich energy system model, UK MARKAL, is used to derive the MAC curves. The results of this study show that MAC curves are robust even to extreme fossil fuel price changes, while uncertainty around the choice of the discount rate, the availability of key abatement technologies and the demand level were singled out as the most important influencing factors. By using a different model type and studying a wider range of influencing factors, this paper contributes to the debate on the sensitivity of MAC curves. - Highlights: ► A partial-equilibrium model is employed to test key sensitivities of MAC curves. ► MAC curves are found to be robust to wide-ranging changes in fossil fuel prices. ► Most influencing factors are the discount rate, availability of key technologies. ► Further important uncertainty in MAC curves is related to demand changes