Musculoskeletal disorders in main battle tank personnel
DEFF Research Database (Denmark)
Nissen, Lars Ravnborg; Guldager, Bernadette; Gyntelberg, Finn
2009-01-01
PURPOSE: To compare the prevalence of musculoskeletal disorders of personnel in the main battle tank (MBT) units in the Danish army with those of personnel in other types of army units, and to investigate associations between job function in the tank, military rank, and musculoskeletal problems......, and ankle. RESULTS AND CONCLUSIONS: There were only 4 women in the MBT group; as a consequence, female personnel were excluded from the study. The participation rate was 58.0% (n = 184) in the MBT group and 56.3% (n = 333) in the reference group. The pattern of musculoskeletal disorders among personnel...
Defeating Mechanisms of Armours for Main Battle Tanks
Institute of Scientific and Technical Information of China (English)
Manfred Held
2005-01-01
The fundamental protection principles of the new armours for main battle tanks against kinetic energy projectiles (KE) and chemical energy weapons (CE)--shaped charges are shortly described and their efficiency against both threats discussed. The armour topics can be split into: "perpendicular or zero-degree armours", such as rolled homogeneous armour (RHA), also with extremely high strength, ceramics, glass, liquid filled columns and explosive filled cells,"inclined armours", as spaced RHA plates with their corner effects, bulging armour, additive and integrated explosive reactive armours (ERA) and "hard kill active defence possibilities" in different defeating distances.
Measurements of Gun Tube Motion and Muzzle Pointing Error of Main Battle Tanks
Directory of Open Access Journals (Sweden)
Peter L. McCall
2001-01-01
Full Text Available Beginning in 1990, the US Army Aberdeen Test Center (ATC began testing a prototype cannon mounted in a non-armored turret fitted to an M1A1 Abrams tank chassis. The cannon design incorporated a longer gun tube as a means to increase projectile velocity. A significant increase in projectile impact dispersion was measured early in the test program. Through investigative efforts, the cause of the error was linked to the increased dynamic bending or flexure of the longer tube observed while the vehicle was moving. Research and investigative work was conducted through a collaborative effort with the US Army Research Laboratory, Benet Laboratory, Project Manager – Tank Main Armament Systems, US Army Research and Engineering Center, and Cadillac Gage Textron Inc. New test methods, instrumentation, data analysis procedures, and stabilization control design resulted through this series of investigations into the dynamic tube flexure error source. Through this joint research, improvements in tank fire control design have been developed to improve delivery accuracy. This paper discusses the instrumentation implemented, methods applied, and analysis procedures used to characterize the tube flexure during dynamic tests of a main battle tank and the relationship between gun pointing error and muzzle pointing error.
76 FR 72025 - Noise Compatibility Program Notice for W.M. Kellogg Airport, Battle Creek, MI
2011-11-21
... for W.M. Kellogg Airport, Battle Creek, MI AGENCY: Federal Aviation Administration (FAA), DOT. ACTION... exposure maps submitted by the City of Battle Creek, Michigan for W.K. Kellogg Airport under the provisions... noise compatibility program that was submitted for W.K. Kellogg Airport under part 150 in conjunction...
The Battle of Vukovar: The Battle That Saved Croatia
National Research Council Canada - National Science Library
Sebetovsky, Mario
2002-01-01
The key battle in the Croatian Homeland War that led to Croatia independence was the Battle of Vukovar Despite its importance very little has been written about this battle from a professional military perspective...
Muscle Activity during Unilateral Vs. Bilateral Battle Rope Exercises
DEFF Research Database (Denmark)
Calatayud, J.; Martin, F.; Colado, J. C.
2015-01-01
Calatayud, J, Martin, F, Colado, JC, Benitez, JC, Jakobsen, MD, and Andersen, LL. Muscle activity during unilateral vs. bilateral battle rope exercises. J Strength Cond Res 29(10): 2854-2859, 2015High training intensity is important for efficient strength gains. Although battle rope training is m...
National Research Council Canada - National Science Library
Cort, Brian; Bouchard, Alain; Gouin, Denis; Proulx, Pascale; Wright, William
2006-01-01
.... Visual Battle Rhythm (VBR) is a software prototype which updates the battle rhythm process with modern technology and careful information design to improve the synchronization, situational awareness and decision making ability of commanders...
Lifescience Database Archive (English)
Full Text Available 1M2Q トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Casein Kinase Ii, Alpha Chain; Chain: A; Fragment: Catlytic Subunit; Synonym: Ckii; Engineered: Yes Tr...ansferase 2.7.1.37 (Casein Kinase Ii, Alpha Chain) E.De Moliner, S.Sarno, S.Moro, G.Zagotto, G.Zanotti, L.A....=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai
A review on the gun barrel vibrations and control for a main battle tank
Directory of Open Access Journals (Sweden)
Tolga Dursun
2017-10-01
Full Text Available Achieving high hitting accuracy for a main battle tank is challenging while the tank is on the move. This can be reached by proper design of a weapon control and gun system. In order to design an effective gun system while the tank is moving, better understanding of the dynamic behavior of the gun system is required. In this study, the dynamic behaviour of a gun system is discussed in this respect. Both experimental and numerical applications for the determination of the dynamic behaviour of a tank gun system are investigated. Methods such as the use of muzzle reference system (MRS and vibration absorbers, and active vibration control technology for the control and the reduction of the muzzle tip deflections are also reviewed. For the existing gun systems without making substantial modifications, MRS could be useful in controlling the deflections of gun barrels with estimation/prediction algorithms. The vibration levels could be cut into half by the use of optimised vibration absorbers for an existing gun. A new gun system with a longer barrel can be as accurate as the one with a short barrel with the appropriate structural modifications.
Single-channel ground airborne radio system (SINCGARS) based remote control for the M1 Abrahms
Urda, Joseph R.
1995-04-01
Remote control of the Ml Abrahms Main Battle Tank through a minefield breach operation will remove the vehicle crew from the inherent hazard. A successful remote control system will provide automotive control yet not impair normal operation. This requires a minimum of physical parts, and an unobtrusive installation. Most importantly, a system failure must not impair the regular operation as a manned system. The system itself need not be complex. A minefield breach only requires simple control of automotive function and a mine plow interface. Control hardware for the Ml-Al can be reduced to two linear actuators, an electrical interface for the engine control unit, an interface for the mine plow, and the associated cables. Communication between vehicle control and operator control takes place over the vehicles organic radio (typically SINCGARS). This helps reduce the number of special purpose components for the remote control device. The device is currently awaiting an automotive safety test to prepare for its safety release. Because of the specific nature of the MDL-STD 1553-B data bus the device will not control an M1-A2 Main Battle Tank. The architecture will allow control of the M1-A2 through the 1553-B data bus however the physical hardware has not been constructed. The control scheme will not change. The communication interface will provide greater flexibility when interfacing to the vehicle tactical radio. Operational utility will be determined by U.S. Army Training and Doctrine Command personnel. The obvious benefit is that if a remote tank is lost during a minefield breach the crew is saved.
SOA approach to battle command: simulation interoperability
Mayott, Gregory; Self, Mid; Miller, Gordon J.; McDonnell, Joseph S.
2010-04-01
NVESD is developing a Sensor Data and Management Services (SDMS) Service Oriented Architecture (SOA) that provides an innovative approach to achieve seamless application functionality across simulation and battle command systems. In 2010, CERDEC will conduct a SDMS Battle Command demonstration that will highlight the SDMS SOA capability to couple simulation applications to existing Battle Command systems. The demonstration will leverage RDECOM MATREX simulation tools and TRADOC Maneuver Support Battle Laboratory Virtual Base Defense Operations Center facilities. The battle command systems are those specific to the operation of a base defense operations center in support of force protection missions. The SDMS SOA consists of four components that will be discussed. An Asset Management Service (AMS) will automatically discover the existence, state, and interface definition required to interact with a named asset (sensor or a sensor platform, a process such as level-1 fusion, or an interface to a sensor or other network endpoint). A Streaming Video Service (SVS) will automatically discover the existence, state, and interfaces required to interact with a named video stream, and abstract the consumers of the video stream from the originating device. A Task Manager Service (TMS) will be used to automatically discover the existence of a named mission task, and will interpret, translate and transmit a mission command for the blue force unit(s) described in a mission order. JC3IEDM data objects, and software development kit (SDK), will be utilized as the basic data object definition for implemented web services.
New water guidelines developed to battle nuclear corrosion
International Nuclear Information System (INIS)
Strauss, S.D.
1983-01-01
Discusses methods of preventing degradation of nuclear steam generators due to a combination of impurities and corrosion products in the secondary system. Explains that tube and support-plate corrosion has been the main concern, manifesting itself primarily in the recirculating units used in PWR systems. Points out that the battle against corrosion is closely linked to control of ionic impurities, alkalinity, oxidants, and sludge-copper and iron corrosion products, primarily-in condensate and feedwater systems. Examines a set of secondary-water-chemistry guidelines developed by the Steam Generator Owners Group (SGOG). Presents diagram showing changes at Salem 1 to arrest corrosion, including condenser retubing, addition of condensate polisher and recirculation loop. Table indicates how preventive measures at Salem 1, affected secondary-water chemistry
Dilemma and quantum battle of sexes
International Nuclear Information System (INIS)
Nawaz, Ahmad; Toor, A H
2004-01-01
We analysed quantum version of the game battle of sexes using a general initial quantum state. For a particular choice of initial entangled quantum state it is shown that the classical dilemma of the battle of sexes can be resolved and a unique solution of the game can be obtained
Waging a Battle to Promote Reading
Dix, Suzanne Liacos
2010-01-01
As advocates for reading, librarians cannot help but love a reading program. In this article, the author talks about the Battle of the Books, a reading enrichment program that had been in place since 1996. Battle of the Books promotes reading among middle school students by offering interesting books and a trivia-type competition. The author…
Battle of Kasserine Pass: Defeat is a Matter of Scale
2016-05-26
a ga inst Germany in World War II ; some historians even go so far as to anticipate defeat in the first battles of all major Ameri can wars. Martin ...the battle of Kasserine Pass prove the conventional wisdom that America is doomed to defeat in its first battles? Martin Blumenson, a prominent...Much study of the battle of Kasserine Pass has been done since Martin Blumenson wrote the original history in 1966. The ULTRA and MAGIC intercepts
Coalition Battle Management Language
National Research Council Canada - National Science Library
Tolk, Andreas; Galvin, Kevin; Hieb, Michael; Khimeche, Lionel
2004-01-01
Battle Management Language (BML) is being developed as an unambiguous language to command and control forces and equipment conducting military operations and to provide for situational awareness and a shared common operational picture...
Battle Management as a Basic Air Force Doctrine Operational Function
National Research Council Canada - National Science Library
Rhone, Jon M
2008-01-01
According to JP 1-02, Department of Defense Dictionary of Military and Associated Terms, battle management is "The management of activities within the operational environment, based on the commands...
BVRI main-sequence photometry of the globular cluster M4
International Nuclear Information System (INIS)
Alcaino, G.; Liller, W.
1984-01-01
We present BV and RI photographic photometry of 1421 and 189 stars, respectively, in the intermediate metallicity globular cluster M4 (NGC 6121). This investigation includes the first results of RI main-sequence photometry of a globular cluster. The use of longer wavelengths and longer color baselines provides the potential of improved isochrone fittings and underscores the urgent need for calculations of RI synthetic isochrones to be compared with observations. The Pickering-Racine wedge was used with the ESO 3.6 m telescope, the Las Campanas 2.5 m du Pont telescope, and the CTIO 1 m Yale telescope to extend the photoelectric limit from Vroughly-equal16.1 to Vroughly-equal19.1. We have determined the position of the main-sequence turnoff to lie at V = 16.6 +- 0.2 (m.e.) and B-V = 0.80 +- 0.03 (m.e.). A comparison of our BV observations with the CCD data of Richer and Fahlman shows excellent agreement: the two fifucial main sequences agree at all points to within 0.025 mag and, on average, to 0.013 mag. For the cluster we derive a distance modulus (m-M)/sub V/ = 12.52 +- 0.2 and reddening E(B-V) = 0.44 +- 0.03, results which confirm that at a distance of 2 kpc, M4 is the closest globular clusters to the Sun. Using the isochrones of VandenBerg, we deduce an age 13 +- 2 Gyr. As noted in several other investigations, there is a striking deficiency of stars in certain parts of the color-magnitude diagram; in M4 we find a pronounced gap over approx.0.6 mag at the base of the subgiant branch
1988-09-01
Professional Paper 463 / September 1988 OTIC - EL cOPY V 0- 00 00 N Airland Battle Doctrine DTIC S ELECTE DEC 2 81988D Douglas W. Skinner Dcb A...missiles to ground targets. Initial deployment will be on the Army’s OV-i Bronco and the Air Force’s TR-l and C-18. This is another outgrowth of the
2012-06-01
NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS Approved for public release; distribution is unlimited BATTLE OF NARRATIVES...from the NAVAL POSTGRADUATE SCHOOL June 2012 Author: Lars Ruth Approved by: Prof. Sean F. Everton Thesis Advisor Dr. Hy...are more important than are others. For example, for some, social security and taxes are very important while gun control and LGBT are not. For
The Ukraine Crisis: The Battle of Superpowers
Elmquist-Clausen, Caroline
2016-01-01
This project concerns the Ukraine crisis, and how the crisis can be explained as a battle between Russia and the West. The project takes it departure in neoclassical realism, and uses this theory to understand how the actors in the crisis balance each other. This project concerns the Ukraine crisis, and how the crisis can be explained as a battle between Russia and the West. The project takes it departure in neoclassical realism, and uses this theory to understand how the actors in the cri...
book and video reviews battles in britain and their political
African Journals Online (AJOL)
Illustrated, maps. ISBN I 85326 672 8. R61-00 ... battles fought on British soil from the Norse invasion under King Harold. Hardrada (September ... but also sets each battle against the political and historical background of the time. Seymour ...
Central limit theorems for sequences with m(n)-dependent main part
Nieuwenhuis, G.
1992-01-01
Let (Xi(n); n ϵ N, 1⩽i⩽h(n)) be a double sequence of random variables with h(n)→∞ as n→∞. Suppose that the sequence can be split into two parts: an m(n)-dependent sequence (Xi,m(n); n ϵ N, 1⩽i⩽h(n)) of main terms and a sequence (Xi,m(n); n ϵ N, 1⩽i⩽h(n)) of residual terms. Here (m(n)) may be
Directory of Open Access Journals (Sweden)
Haohan Wang
2016-03-01
Full Text Available Abstract As a critical transcription factor, Six1 plays an important role in the regulation of myogenesis and muscle development. However, little is known about its regulatory mechanism associated with muscular protein synthesis. The objective of this study was to investigate the effects of overexpression ofSix1 on the expression of key protein metabolism-related genes in duck myoblasts. Through an experimental model where duck myoblasts were transfected with a pEGFP-duSix1 construct, we found that overexpression of duckSix1 could enhance cell proliferation activity and increase mRNA expression levels of key genes involved in the PI3K/Akt/mTOR signaling pathway, while the expression of FOXO1, MuRF1and MAFbx was not significantly altered, indicating thatSix1 could promote protein synthesis in myoblasts through up-regulating the expression of several related genes. Additionally, in duck myoblasts treated with LY294002 and rapamycin, the specific inhibitors ofPI3K and mTOR, respectively, the overexpression of Six1 could significantly ameliorate inhibitive effects of these inhibitors on protein synthesis. Especially, the mRNA expression levels of mTOR and S6K1 were observed to undergo a visible change, and a significant increase in protein expression of S6K1 was seen. These data suggested that Six1plays an important role in protein synthesis, which may be mainly due to activation of the mTOR signaling pathway.
2011-06-01
of the Bible “eye-for-an-eye” mentality may have contributed to the political instability and rampant tribal infighting so common during this period...Khaybar (Betrayal), Battle of Karbala (Noble Sacrifice), Shaytan’s ( Satan ) Handiwork, (Ruse), Seventy-two Virgins (Noble Sacrifice), Mahdi (Deliverance...Publishing: 2004. http://www.intelcenter.com/Badr-al-Riyadh- v1-1. pdf Armstrong, Karen. Muhammad: A Prophet For Our Time. New York: Harper Collins, 2006
Douglas Haig and the Battle of the Somme
1984-03-01
4J "insights into tomorrow" AA A A tDSTRIBUTON STATEMENT A Approved fta public rlow800 Diasibution Unlimited 84 0 , 0 DISCLAIMER The views and...Israeli Wars, p. 348. 16 John Keegan, The Face of Battle (New York: Penguin Books, 1976), p. 303. 5 17. has said this is characteristically the American way...Random House, 1982. Keegan, John. The Face of Battle. New York: Penguin Books, 1976. Mao Tse-tung. On the Protracted War. Peking: Foreign Languages
Hecamede: Homeric nurse of the battle-wounded in the Trojan War.
Balanika, Alexia P; Baltas, Christos S
2014-02-01
The Homeric epics present the 10-year lasting Trojan War, offering the description of battle wounds and medical care of injuries. Hecamede is referred by the Homer as a battlefield nurse who had knowledge of the treatment of bleeding battle wounds.
Predicting Battle Outcomes with Classification Trees
National Research Council Canada - National Science Library
Coban, Muzaffer
2001-01-01
... from the actual battlefield, The models built by using classification trees reveal that the objective variables alone cannot explain the outcome of battles, Relative factors, such as leadership, have deep...
Vukovar 1991 Battle and Cultural Memory
Directory of Open Access Journals (Sweden)
Sandra Cvikić
2014-03-01
Full Text Available In this paper it is argued that Vukovar 1991 Battle traumatic memory wearing away process is a social issue and cannot be simply amputated by modernist narratives from accumulated traces of the past. Instead, those traumatic memories are constantly reconstructed, repressed, or transformed in some way or another under the pressure of manipulative power politics and competing ideologies in contemporary Croatian society. Therefore, the question this paper asks is whether war crimes and atrocities committed in Vukovar 1991 have its meaningful place in the Croatian cultural memory and whether social research techniques into contemporary cultural memory in Croatia can afford to avoid testimonial narrations of the Vukovar 1991 Battle and war experiences since they are an integral part of the collective memory?
Philostorgius’ Account of the Battle at Mursa
Directory of Open Access Journals (Sweden)
Alenka Cedilnik
2014-07-01
Full Text Available On September 28, 351 AD, Emperor Constantius II defeated the usurper Magnentius in the battle at Mursa. While the battle is described in several ancient sources, the present study focuses on the account given by Philostorgius. Philostorgius is the first known author to have included in his description of the battle the appearance of a cross in the sky, drawing on the writings of an unknown Arian historian. But for all its seemingly miraculous connotations, Philostorgius’ story is no mere figment of the imagination. It is based on a perfectly natural meteorological phenomenon, the parhelia or phantom suns, which had been observed on May 7, 351, in the sky above Jerusalem. They were interpreted at the time as the sign of Christ’s cross, and the contemporary Jerusalem bishop, Cyril, provided a detailed description in a letter to Emperor Constantius. But while the Bishop already saw this phenomenon as a sign of God’s favour to Constantius, the appearance of the cross above Jerusalem was not immediately associated with the slightly later conflict at Mursa. This connection was only established by Arian historians, who used the story of the vision before the Mursa battle to glorify Emperor Constantius, a supporter of Arianism. The earliest source known today is an anonymous Arian historian writing in the late 4th century: his work provided the basis for Philostorgius’ account of the Mursa battle. Still, the association of the visions above Jerusalem and Mursa is perhaps not to be attributed merely to the Arian authors’ partiality to Emperor Constantius. It may have been prompted by two natural but hardly everyday celestial phenomena as well: on May 28, 355, the Balkans, including Mursa, witnessed a total solar eclipse, while August 8, 351, brought a partial eclipse to an area of the Balkans (but not to Mursa. The two eclipses may have influenced Philostorgius’ account of the Mursa battle. While neither the eclipse nor the parhelia visible
Pokémon Battles as a Context for Mathematical Modeling
McGuffey, William
2017-01-01
In this article I explore some of the underlying mathematics of Poke´mon battles and describe ways that teachers at the secondary level could explore concepts of mathematical game theory in this context. I discuss various ways of representing and analyzing a Poke´mon battle using game theory and conclude with an example of applying concepts of…
1988-03-01
ACTIVITY 11. ASSESS RESULTS OF ENCAGENENT TC GNU IDR M Alien battle dauge/c<iua1ttis Check/adJuit MRS Dtttratiw If and how crm ihould bt... UfO Of ring« lino con fco obiorvod on CRT. Kongo It not innounctd, but oppaor on CRT diti oroo. U(0 of ringt lint con bo obior»td on CRT
Low-level Battle Management Language
Alstad, A.; Mevassvik, O.M.; Nielsen, M.N.; Løvlid, R.A.; Henderson, H.C.; Jansen, R.E.J.; Reus, N.M. de
2013-01-01
TNO (The Netherlands) and FFI (Norway) are cooperating in extending a COTS Computer Generated Forces (CGF) tool with a Coalition Battle Management Language (C-BML) interface for executing C-BML orders and issuing reports. Due to the lack of satisfactory models for command and control (C2)/combat
Battling Obesity in K-12 Learners from an Exercise Physiology Perspective
Rattigan, Peter; Biren, Greg
2007-01-01
Physical education practitioners and programs have the opportunity and obligation to help children become physically educated, healthy, and active adults. This article discusses the battle against obesity in K-12 learners from an exercise physiology perspective and focuses on the fact that practitioners have all the tools they need to battle this…
77 FR 29918 - Proposed Amendment of Class E Airspace; Battle Creek, MI
2012-05-21
... airspace is necessary to accommodate new Standard Instrument Approach Procedures (SIAP) at W. K. Kellogg.... Kellogg Airport, Battle Creek, MI. Controlled airspace is needed for the safety and management of IFR... controlled airspace at W.K. Kellogg Airport, Battle Creek, MI. Environmental Review This proposal will be...
... us Outrunning Asthma Football player Rashad Jennings battled childhood asthma with exercise and determination Photo: ABC National Football ... Dancing with the Stars” champion Rashad Jennings battled childhood asthma with grit and determination. He has partnered with ...
Energy Technology Data Exchange (ETDEWEB)
Kim, Kyoung Mi; Cho, Hana [School of Life Sciences and Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Kim, Yoon Ki, E-mail: yk-kim@korea.ac.kr [School of Life Sciences and Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of)
2012-08-03
Highlights: Black-Right-Pointing-Pointer CDKN1A mRNA is a bona fide NMD substrate. Black-Right-Pointing-Pointer The uORF of CDKN1A mRNA is efficiently translated. Black-Right-Pointing-Pointer Translation of downstream main ORF is negatively regulated by translation of uORF in CDKN1A mRNA. -- Abstract: The first round of translation occurs on mRNAs bound by nuclear cap-binding complex (CBC), which is composed of nuclear cap-binding protein 80 and 20 (CBP80/20). During this round of translation, aberrant mRNAs are recognized and downregulated in abundance by nonsense-mediated mRNA decay (NMD), which is one of the mRNA quality control mechanisms. Here, our microarray analysis reveals that the level of cyclin-dependent kinase inhibitor 1A (CDKN1A; also known as Waf1/p21) mRNAs increases in cells depleted of cellular NMD factors. Intriguingly, CDKN1A mRNA contains an upstream open reading frame (uORF), which is a NMD-inducing feature. Using chimeric reporter constructs, we find that the uORF of CDKN1A mRNA negatively modulates translation of the main downstream ORF. These findings provide biological insights into the possible role of NMD in diverse biological pathways mediated by CDKN1A.
Predicting Trainability of M1 Crewmen
1982-10-01
Load Main Gun Clear Main Gun LOAD/UNLOAD M250 GRENADE LAUNCHER ON M1 TANK* Load Grenade Launcher Unload Grenade Launcher PREPARE GUNNER’S STATION...Clear Main Gun LOAD/UNLOAD M250 GRENADE LAUNCHER ON Ml TANK* Load Grenade Launcher Unload Grenade Lauacher PREPARE GUNNER’S STATION FOR OPERATION ON Ml
Operating and support costs and affordability of a 324 ship Naval battle force
Antonucci, Kevin C.
2011-01-01
The purpose of this research was to determine both the added operating and support (OandS) costs and affordability of operating and maintaining a future naval battle force of 324 ships as proposed in the Navy's 30-year shipbuilding plan. Cost estimation including regression, 3-year moving averages, point, expert and analogous modeling was used to capture both historical and future OandS costs from FY1991 to FY2024. With an emphasis on the three main cost drivers, (manpower, fuel and maintena...
Wu, Tso-Ren; Wu, Han; Tsai, Yu-Lin
2016-04-01
In 1661, Chinese navy led by General Zheng Chenggong at the end of Ming Dynasty had a naval battle against Netherlands. This battle was not only the first official sea warfare that China confronted the Western world, but also the only naval battle won by Chinese Navy so far. This event was important because it changed the fate of Taiwan until today. One of the critical points that General Zheng won the battle was entering Luermen bay unexpected. Luermen bay was and is an extreme shallow bay with a 2.1m maximum water depth during the high tide, which was not possible for a fleet of 20,000 marines to across. Therefore, no defense was deployed from the Netherlands side. However, plenty of historical literatures mentioned a strange phenomenon that helped Chinese warships entered the Luermen bay, the rise of water level. In this study, we will discuss the possible causes that might rise the water level, e.g. Tsunami, storm surge, and high tide. We analyzed it based on the knowledge of hydrodynamics. We performed the newly developed Impact Intensify Analysis (IIA) for finding the potential tsunami sources, and the COMCOT tsunami model was adopted for the nonlinear scenario simulations, associated with the high resolution bathymetry data. Both earthquake and mudslide tsunamis were inspected. Other than that, we also collected the information of tide and weather for identifying the effects form high tide and storm surge. After the thorough study, a scenario that satisfy most of the descriptions in the historical literatures will be presented. The results will explain the cause of mysterious event that changed the destiny of Taiwan.
The Battle of Savo Island August 9th, 1942. Strategical and Tactical Analysis. Part I
1950-01-01
Department publIcation SSC-677, Survey of the Bolcmon Islands. March 16, 1943, Confidential. *OCTW 62 personal latter to Captain RC. Parker, USN(Ret...cakiral Jellicu had si&Unalled Ad- miral Oqattr "Wh•re !e the anek-q’s battles Fleet?" and Lsirl Beatty •had repliid la a most v& omnic kid inoomplete m
Fitting Lanchester Equations to the Battles of Kursk and Ardennes
Lucas, Thomas W.; Turkes, Turker
2004-01-01
The article of record as published may be found at http://dx.doi.org/10.1002/nav.10101 Lanchester equations and their extensions are widely used to calculate attrition in models of warfare. This paper examines how Lanchester models fit detailed daily data on the battles of Kursk and Ardennes. The data on Kursk, often called the greatest tank battle in history, was only recently made available. A new approach is used to find the optimal parameter values and gain an understanding...
The Battle of Moscow - Turning Point of World War II
Directory of Open Access Journals (Sweden)
V M Falin
2015-12-01
Full Text Available The article is dedicated to the Battle of Moscow in October- December, 1941. Author analyzes the causes of the failure of German army, who tries to encircle and capture Moscow, the events taking place on the outskirts of Moscow, German troops attempts to encircle Moscow. The author presents data on the speech by Adolf Hitler in Berlin on October 5, 1941, in which he acknowledged the failure of the Blitzkrieg and the Battle for Moscow and its suburbs. The researcher uses the documents of the Wehrmacht High Command, which stated that after the Battle of Moscow, German troops could not on any further stage of the war to restore the quality and morale of the armed forces, with whom Reich rushed to a campaign for world domination. The author, a prominent public and political figure of the USSR, also relies on personal recollections, interviews with prominent generals of World War II, including I. Konev.
The battle of the dumps continues
International Nuclear Information System (INIS)
Anon.
1976-01-01
Although East Rand Gold and Uranium Company is about to start exploitation of the old slimes dams to produce gold, uranium and sulphuric acid, the battle to suppress dust and establish vegetation on the old dumps continues. The physical problems, planning, co-ordination and legal aspects of mine dump reclamation are outlined
Revisiting the Battle of the Little Big Horn
National Research Council Canada - National Science Library
Burns, Matthew
2000-01-01
The Battle of the Little Big Horn has captured the interest of historians, scholars, and military enthusiasts since the day that over 200 United States soldiers under General George Armstrong Custer's...
A Bayesian Decision Model for Battle Damage Assessment
National Research Council Canada - National Science Library
Franzen, Daniel
1999-01-01
Battle damage assessment (BDA) is critical to success in any air campaign. However, Desert Storm highlighted numerous deficiencies in the BDA process, and operations since Desert Storm continue to point out weaknesses...
The Gaugamela Battle Eclipse: An Archaeoastronomical Analysis
Polcaro, V. F.; Valsecchi, G. B.; Verderame, L.
A total lunar eclipse occurred during the night preceding the decisive Battle of Gaugamela (20th September 331 BCE), when the Macedonian army, led by Alexander the Great, finally defeated the Persian king Darius and his army. This astronomical event, well known to historians, had a relevant role on the battle outcome. The eclipse was described in detail by Babylonian astronomers, though, unfortunately, the text of their report has only partially been preserved. We have reconstructed the evolution of the phenomenon as it appeared to the observer in Babylonia, by using the positional astronomy code "Planetario V2.0". On the base of this reconstruction we suggest a number of integrations to the lost part of the text, allowing a finer astrological interpretation of the eclipse and of its influence on the mood of the armies that set against each other on the following morning.
Battle Experience; Solomon Islands Actions Information. Bulletin Number 4
1942-11-01
IS SECONDARY TO TOR- PEDOES . THE FOUR DESTROYERS IN THE REAR COULD HAVE BEEN MORE EFFECTIVELY EMPLOYED IN THE VAN CONCENTRATED WITH THE OTHER...PROPERLY. THEY SHOULD BE USED OFFENSIVELY. THEIR TOR PEDOES ARE THEIR PRIMARY WEAPONS AND SHOULD BE USED PROPERLY AT EVERY OPPORTUNITY. Shortly after...is out in guns #4 and #5 but they still have power and battle lighting. All safety links on the torpedoes failed. Three torpedoes slid out of #1
The Battle of Gallipoli/Çanakkale was Ottoman Albanian and German
Mulaj, Isa
2015-01-01
The Battle of Gallipoli/Çanakkale or the Dardanelles Campaign as one of the greatest catastrophe of World War I (WWI) and major Axis victory, apart from Turkey, received little attention in the history textbooks of European countries until recently. It was most likely neglected because the Allies emerged victorious of WWI in aggregate terms. The belligerents from many nations in the Battle of Çanakkale, especially from the Balkans, ended up in the camp which they fought against – the victorio...
Support for the Confederate Battle Flag in the Southern United States: Racism or Southern Pride?
Directory of Open Access Journals (Sweden)
Joshua D. Wright
2017-05-01
Full Text Available Supporters of the Confederate battle flag often argue that their support is driven by pride in the South, not negative racial attitudes. Opponents of the Confederate battle flag often argue that the flag represents racism, and that support for the flag is an expression of racism and an attempt to maintain oppression of Blacks in the Southern United States. We evaluate these two competing views in explaining attitudes toward the Confederate battle flag in the Southern United States through a survey of 526 Southerners. In the aggregate, our latent variable model suggests that White support for the flag is driven by Southern pride, political conservatism, and blatant negative racial attitudes toward Blacks. Using cluster-analysis we were able to distinguish four distinct sub-groups of White Southerners: Cosmopolitans, New Southerners, Traditionalists, and Supremacists. The greatest support for the Confederate battle flag is seen among Traditionalists and Supremacists; however, Traditionalists do not display blatant negative racial attitudes toward Blacks, while Supremacists do. Traditionalists make up the majority of Confederate battle flag supporters in our sample, weakening the claim that supporters of the flag are generally being driven by negative racial attitudes toward Blacks.
An Approach to Quantifying Pokemon's Entertainment Impact with focus on Battle
Panumate, Chetprayoon; Xiong, Shuo; Iida, Hiroyuki
2015-01-01
This paper explores the attractiveness of Pokemon which is a turn-based Role Playing Game (RPG) and has been very popular for the decades. In this study we focus on Pokemon battle which is the most important component in Pokemon. The game refinement theory is used as a tool to assess the degree of sophistication of Pokemon battle. For this purpose we apply two approaches of game progress modeling to derive game refinement measure, i.e., score limit sports approach and board game approach. We ...
United States 1st Armored Division and Mission Command at the Battle of Faid Pass
2017-04-13
MilitaryReview_20130430_ art008.pdf and John Case, “The Exigency for Mission Command: A Comparison of World War II Command Cultures ,” Small Wars Journal...Borzoi Books, 1943), 229-232. 20 Concurrent to these efforts, the US and United Kingdom continued to mass forces in England for a cross channel...and psychological . The Axis had seized the initiative; the Allies just did not know it yet.154 Preparations for the Battle of Kasserine Pass
The Battle of Algiers: A War of Liberation
Carter, Margaret
1971-01-01
The author describes the film, The Battle of Algiers," and suggests discussion ideas for a classroom analysis: emotional response; labels, e.g., enemy; responsibility; alternatives; justice; warfare and crime. Learning activities and resources are also suggested. (Author/JB)
The Social Structure of Participants of the Battle of Blore Heath (September 23, 1459)
Andrey G. Prazdnikov
2017-01-01
The battle of Blore Heath which took place on September 23, 1459, marked the new stage of the Wars of Roses, which led to the change of dynasties at the English throne in less than two years. As it was not the clash of the main forces of House of Lancaster and House of York, the sources contain poor information about the battle’s participants. However, the analysis different sources let identify the names of 22 participants. Prosopographic study of this group contributes to the study of socia...
The Battle between Battery and Fuel Cell Powered Electric Vehicles: A BWM Approach
Directory of Open Access Journals (Sweden)
Geerten van de Kaa
2017-10-01
Full Text Available The transition to a more sustainable personal transportation sector requires the widespread adoption of electric vehicles. However, a dominant design has not yet emerged and a standards battle is being fought between battery and hydrogen fuel cell powered electric vehicles. The aim of this paper is to analyze which factors are most likely to influence the outcome of this battle, thereby reducing the uncertainty in the industry regarding investment decisions in either of these technologies. We examine the relevant factors for standard dominance and apply a multi-criteria decision-making method, best worst method, to determine the relative importance of these factors. The results indicate that the key factors include technological superiority, compatibility, and brand reputation and credibility. Our findings show that battery powered electric vehicles have a greater chance of winning the standards battle. This study contributes to theory by providing further empirical evidence that the outcome of standards battles can be explained and predicted by applying factors for standard success. We conclude that technology dominance in the automotive industry is mostly driven by technological characteristics and characteristics of the format supporter.
Battle Management Language capable Computer Generated Forces
Bronkers, R.; Henderson, H.; Reus, N.M. de; Alstad, A.; Mevassvik, O.M.; Skogsrud, G.
2011-01-01
The development of Coalition Battle Management Language (C-BML) by SISO and its evaluation by the NATO MSG-085 task group and predecessor NATO MSG-048 has led Norway and the Netherlands to develop C-BML interfaces for their Command and Control Information Systems (C2ISs) NORTaC-C2IS and ISIS. FFI
AN M DWARF COMPANION TO AN F-TYPE STAR IN A YOUNG MAIN-SEQUENCE BINARY
Energy Technology Data Exchange (ETDEWEB)
Eigmüller, Ph.; Csizmadia, Sz.; Erikson, A.; Fridlund, M.; Pasternacki, Th.; Rauer, H. [Institute of Planetary Research, German Aerospace Center Rutherfordstr. 2, D-12489 Berlin (Germany); Eislöffel, J.; Lehmann, H.; Hartmann, M.; Hatzes, A. [Thüringer Landessternwarte Tautenburg Sternwarte 5, D-07778 Tautenburg (Germany); Tkachenko, A. [Instituut voor Sterrenkunde, KU Leuven Celestijnenlaan 200D, 3001 Leuven (Belgium); Voss, H., E-mail: philipp.eigmueller@dlr.de [Universitat de Barcelona, Department of Astronomy and Meteorology Martí i Franquès, 1, E-08028 Barcelona (Spain)
2016-03-15
Only a few well characterized very low-mass M dwarfs are known today. Our understanding of M dwarfs is vital as these are the most common stars in our solar neighborhood. We aim to characterize the properties of a rare F+dM stellar system for a better understanding of the low-mass end of the Hertzsprung–Russel diagram. We used photometric light curves and radial velocity follow-up measurements to study the binary. Spectroscopic analysis was used in combination with isochrone fitting to characterize the primary star. The primary star is an early F-type main-sequence star with a mass of (1.493 ± 0.073) M{sub ⊙} and a radius of (1.474 ± 0.040) R{sub ⊙}. The companion is an M dwarf with a mass of (0.188 ± 0.014) M{sub ⊙} and a radius of (0.234 ± 0.009) R{sub ⊙}. The orbital period is (1.35121 ± 0.00001) days. The secondary star is among the lowest-mass M dwarfs known to date. The binary has not reached a 1:1 spin–orbit synchronization. This indicates a young main-sequence binary with an age below ∼250 Myr. The mass–radius relation of both components are in agreement with this finding.
Culture and Remembrance of War: the Battle of Vukovar and Its Social Repercussions
Directory of Open Access Journals (Sweden)
Mateo Žanić
2016-08-01
of remembrance, especially the verdicts for the “Vukovar Three”(V. Šljivančanin, M. Mrkšić and M. Radić. However, when Generals A. Gotovina and M. Markač were acquitted of war crimes on 16 November 2012, many concluded that Croatia won the legal war as well, and that the truth about the aggressors and victims was finally confirmed. In the third stage, after 2013, the main aspect of the remembrance culture is the discussion of the importance of the Battle of Vukovar for national identity and inside politics. The results of the 2011 Census showed that there were 34.9% of Serbs in Vukovar. The representatives of the Independent Democratic Serb Party demanded to be allowed to use Serbian language and the Cyrillic alphabet on the basis of that data. That caused debates in Croatian public, because it meant that the city that had been occupied until 1998, would again have street names in Cyrillic. That led to disagreements about the implementation of The Constitutional Act on The Rights of National Minorities in the Republic of Croatia in Vukovar. The attention was mostly focused on the valuation of heroic deeds and victim suffering in the Croatian War of Independence in comparison to other national goals. The division was especially noticeable during the memorial service for the Vukovar Remembrance Day in 2013. Vukovar then became an important part of the national identity and politics, where one side believed that the biggest problem was the lack of respect towards the victims, while the other side was more concerned about the fact that the civil rights of minorities were not respected. This period is predominated by the tension surrounding the rutinization of memory. Rutinization is a process predominated by debates about whether one historical event should be reconstructed using facts and given over to institutions, or it should get wider symbolic value, important for formation or preservation of the group’s opinion about itself. Some of the participants
Directory of Open Access Journals (Sweden)
Juan Carlos Iglesias-Zoido
2013-05-01
Full Text Available This article analyzes the way in which Lope de Vega conceives in his theater the pre-battle harangue, the most characteristic speech in ancient and renaissance historiography. Having this aim in mind, I have analyzed the role played by this type of speech in a group of plays dealing with historical and military subjects. These plays were written in a period when Lope was particularly interested in historical issues: La Santa Liga (1598-1603, Arauco domado (1599, El asalto de Mastrique (1595-1606 and Los Guanches de Tenerife (1604-1606.
Main sequence of the metal-poor globular cluster M30 (NGC 7099)
International Nuclear Information System (INIS)
Alcaino, G.; Liller, W.
1980-01-01
We present photographic photometry for 673 stars in the metal-poor globular cluster M30 (NGC 7099). The Racine wedge was used with the CTIO 1-m Yale telescope (Δm=3/sup m/.60), the CTIO 4-m telescope (Δm=6/sup m/.83), and the ESO 3.6-m telescope (Δm=4/sup m/.12) to extend the photoelectric limit from Vapprox. =16.3 to Vapprox. =20.4. For the main-sequence turn-off, we have determined its position to lie at V=18.4 +- 0.1 (m.e.) and B-V=0.49 +- 0.03 (m.e.). From these values, we calculate the intrinsic values M/sub v/ =3.87 and (B-V) 0 =0.47. For the cluster as a whole, we derive a distance modulus (m-M)/sub V/=14.53 +- 0.15 and reddening E(B-V)=0.02 +- 0.02. Using the models of Iben and Rood [Astrophys. J. 159, 605 (1970)] and the isochrones of Demarque and McClure [(1977), in Evolution of Galaxies and Stellar Populations, edited by B. Tinsley and R. B. Larson (Yale University Observatory, New Haven), p. 199], we deduce the cluster's age to be 14.5( +- 4.0) x 10 9 yr. The large uncertainty in this value emphasizes the dire need for more work on cluster evolution
John Pope - Failure at Second Battle of Bull Run
National Research Council Canada - National Science Library
Morio, Daniel
2002-01-01
Was the failure of the Army of Virginia at the Second Battle of Bull Run a result of General John Pope being a failure as a leader or were there other circumstances that helped him in his loss? Conclusion...
The Battle for Okinawa: A Direct Approach for Direct Defeat
National Research Council Canada - National Science Library
Robling, Terry
1995-01-01
Throughout the fall of 1944 and early spring of 1945, the Japanese defenders of Okinawa prepared a defensive battle strategy that resulted in Japanese defeat and the most casualties for both forces...
True Stories of Censorship Battles in America's Libraries
Nye, Valerie, Ed.; Barco, Kathy, Ed.
2012-01-01
Intellectual freedom is a core value of librarianship, but fighting to keep controversial materials on the shelves can sometimes feel like a lonely battle. And not all censorship controversies involve the public objecting to a book in the collection--libraries are venues for displays and meetings, and sometimes library staff themselves are tempted…
Operationalizing Air-Sea Battle in the Pacific
2015-02-01
Joumall 25 \\/ FEATURE Ballard, Harysch, Cole, & Hall Operationalizing Ait’-Sea Battle in the Pacific tribes and nomadic marauders such as the...communications in general, the former focuses on the digital data links between different platforms. The original CSBA operational con- cept touches on this...very capable fourth-generation fighters; and it has fielded layers of upgraded and double- digit surface-to-air missile systems and antiaircraft
Hicks, Madelyn Hsiao-Rei; Lee, Uih Ran; Sundberg, Ralph; Spagat, Michael
2011-01-01
Warring groups that compete to dominate a civilian population confront contending behavioral options: target civilians or battle the enemy. We aimed to describe degrees to which combatant groups concentrated lethal behavior into intentionally targeting civilians as opposed to engaging in battle with opponents in contemporary armed conflict. We identified all 226 formally organized state and non-state groups (i.e. actors) that engaged in lethal armed conflict during 2002-2007: 43 state and 183 non-state. We summed civilians killed by an actor's intentional targeting with civilians and combatants killed in battles in which the actor was involved for total fatalities associated with each actor, indicating overall scale of armed conflict. We used a Civilian Targeting Index (CTI), defined as the proportion of total fatalities caused by intentional targeting of civilians, to measure the concentration of lethal behavior into civilian targeting. We report actor-specific findings and four significant trends: 1.) 61% of all 226 actors (95% CI 55% to 67%) refrained from targeting civilians. 2.) Logistic regression showed actors were more likely to have targeted civilians if conflict duration was three or more years rather than one year. 3.) In the 88 actors that targeted civilians, multiple regressions showed an inverse correlation between CTI values and the total number of fatalities. Conflict duration of three or more years was associated with lower CTI values than conflict duration of one year. 4.) When conflict scale and duration were accounted for, state and non-state actors did not differ. We describe civilian targeting by actors in prolonged conflict. We discuss comparable patterns found in nature and interdisciplinary research. Most warring groups in 2002-2007 did not target civilians. Warring groups that targeted civilians in small-scale, brief conflict concentrated more lethal behavior into targeting civilians, and less into battles, than groups in larger
Battle Management Language: Proof of Principle and Future Developments
Reus, N. M.de; Krom, P.P.J. de; Schade, U.; Pullen, J.M.
2008-01-01
The NATO Modeling and Simulation Group Technical Activity 048 (MSG-048) was chartered in 2006 to investigate the potential of a Coalition Battle Management Language (C-BML) for Multinational and NATO interoperation of command and control systems with Modeling and Simulation. At its May, 2007
International Nuclear Information System (INIS)
Bussac, M.N.; Pellat, R.; Edery, D.; Soule, J.L.
1977-01-01
A linear analysis is presented of the toroidal coupling between the internal resistive modes (m=1, n=1) and (m=2, n=1) in the tokamak with circular cross-section. The resistive and diamagnetic effects are included in the singular layers where the safety factor q takes respectively the values one and two. By expanding the MHD equations in powers of epsilon, the local inverse of the aspect ratio, a system of two coupled equations is obtained for the harmonic amplitudes. When the shear is finite on q=1 the toroidal coupling is negligible. In the opposite limit, one can explain (a) the experimental behaviour of the (m=1, n=1) mode before the internal disruption, and (b) the simultaneous observation of the modes (m=1, n=1) and (m=2, n=1) before the main disruption. (author)
The Gunboat ‘Delgado Pareho’: Creation and Battle Path
Directory of Open Access Journals (Sweden)
Alejandro Anca Alamillo
2014-09-01
Full Text Available On the base of official data and archives, the battle path of the Spanish 3 class gunboat ‘Delgado Pareho’, previously ‘Dart’ yacht purchased in the USA in 1895, was restored. The shows the influence of the gunboat during the Spanish-American War.
The Battle Command Sustainment Support System: Initial Analysis Report
2016-09-01
products including jet fuels, distillate fuels, residual fuels, automotive gasoline , specified bulk lubricating oils, aircraft engine oils, fuel...contained within this report. 15. SUBJECT TERMS Mission command Software Tactical applications (TacApps) Command post ...computing environment (CPCE) Command post client Battle command sustainment support System (BCS3) Logistics
The Effects of Automation on Battle Manager Workload and Performance
National Research Council Canada - National Science Library
Soller, Amy; Morrison, John
2008-01-01
...) can moderate this degradation. The sources for this survey range from studies that describe the basic limits of human memory capacity to those that assess the number of battle managers needed to operate a partially automated missile defense system...
Virtual Close Quarter Battle (CQB) Graphical Decision Trainer
2002-09-01
leave a gap in what would traditionally be thought of as an ideal locomotion device. Research has shown that the introduction of vestibular cues in...NAVAL POSTGRADUATE SCHOOL Monterey, California THESIS VIRTUAL CLOSE QUARTER BATTLE (CQB) GRAPHICAL DECISION TRAINER by Jordan Reece...including suggestions for reducing this burden, to Washington headquarters Services, Directorate for Information Operations and Reports, 1215 Jefferson
Directory of Open Access Journals (Sweden)
Paredes, Cecilia
2014-12-01
Full Text Available This contribution is devoted to the tapestry cycle of the Battle of Pavia conserved at the Museo Capodimonte in Naples. Seven tapestries compose this prestigious tapestry set that commemorates the first military success of Charles V: the battle held in Pavia on 24 February 1525. Up to now the tapestries have been interpreted as independent panels representing different episodes of the battle. In this contribution we will show that the seven panels actually originated in one single design, which we rediscovered by assembling them in a different sequence. In fact, the panels provide a description of the battle in a fabulous and unique panoramic landscape: the most monumental siege city view ever conceived in the sixteenth century. This discovery not only changes our lecture of the tapestries, but also raises numerous questions that should be addressed in future studies.
On the other side of the battle: Russian nurses in the Crimean War.
Benson, E R
1992-01-01
One redeeming feature that emerged from the horrors of the Crimean War was the skilled and compassionate nursing care provided by women. The work of Florence Nightingale and her nurses with the British forces is a familiar story. What is less well-known is that the fighting forces on the other side of the battle lines also had their contingent of nurses who helped to alleviate the suffering of their sick and wounded. This paper discusses the events leading up to the organization of Russia's volunteer nurses who provided care on their side of the battle.
CASE STUDY: China — Young researchers battle poverty and ...
International Development Research Centre (IDRC) Digital Library (Canada)
2010-12-14
Dec 14, 2010 ... CASE STUDY: China — Young researchers battle poverty and bureaucracy in rural China ... And the “three pig rule” is just one example of the problems the local people ... Revenues were applied to system maintenance and all financial ... The researchers, of course, were trained in science, fieldwork, and ...
THE 76-MM GUN M1A1 AND M1A2: AN ANALYSIS OF U.S. ANTI-TANK CAPABILITIES DURING WORLD WAR II
2018-01-01
ballistic analysis is used to corroborate the battlefield history and gain an understanding of the physical and technological factors that spurred the...capabilities against the German Panther tank. Battle history indicates there was a technological capability gap against upgraded Panzer armor. This report...Engineering Technology Center Picatinny Arsenal, New Jersey UNCLASSIFIED UNCLASSIFIED The views, opinions, and/or
The battle of Gallipoli: The politics of remembering and forgetting in Turkey
Directory of Open Access Journals (Sweden)
Yücel Yanıkdağ
2015-02-01
Full Text Available Differences in the competing versions of public memory for the Battle of Gallipoli have become more pronounced as we approach 18 March 2015 (in Turkey 18 March, the naval battle, marks the anniversary, not the landing of 25 April. For many decades, the official nationalist narrative portrayed Gallipoli as a “rehearsal” for or even as part of the War of Independence (1919-1922. The victory was due almost solely to the military genius of Mustafa Kemal. This public memory might have been dominant for decades, but competing versions also developed. This article will largely deal with what can be called the Islamized or “religionised” memory of Gallipoli. For some who adhere to this view, Gallipoli is where the “Turkish” soldier stopped the last Crusaders. For others, their version of the battle does not include Mustafa Kemal. Yet, both sides have something in common as they prepare to celebrate the victory. Both the nationalist and the Islamist memories ignore the possible connections to another event which is remembered on 24 April, the day before the Entente landing in Gallipoli: the order given for the deportation of Anatolian Armenians. The “celebration” for one is likely to overwhelm the remembrance and mourning of the other.
Automotive IC reliability: Elements of the battle towards zero defects
Kuper, F.G.
2008-01-01
The battle towards zero defects consists of fast response to PPM signals, prevention of incidents and continuous improvement. In this paper elements of all three branches are treated. A PPM analysis tool called quality crawl charts is introduced that enables prediction of customer complaint levels
The Battle over Pastures: The Hidden War in Afghanistan
Directory of Open Access Journals (Sweden)
Liz Alden Wily
2013-06-01
Full Text Available Rangelands (‘pastures’ constitute a large and valuable natural resource in Afghanistan. Millions of rural people shape their agro-pastoral or pastoral livelihoods around this asset. In many ways, the territorial history of Afghanistan may be written through the lens of ancient and continuing battles between ethnic groups for possession of alpine pastures. In more recent times, this battle has centred on control of the Hindu Kush, the rich highland pastures of central Afghanistan. This paper focuses on the worsening conflict over this resource and the diminishing opportunities for its resolution, as new pressures mount. Despite numerous government initiatives, the Karzai Administration has failed to get to grips with the ownership issues underpinning this contestation and the associated seasonal armed conflict. As rangelands are made more available for purchase in the marketplace and as a surge in mining developments eats into pastures, more conflict may be expected, deepening divisions not only between ethnicities, but also between rich and poor, and between the people and the state.
Directory of Open Access Journals (Sweden)
Madelyn Hsiao-Rei Hicks
Full Text Available BACKGROUND: Warring groups that compete to dominate a civilian population confront contending behavioral options: target civilians or battle the enemy. We aimed to describe degrees to which combatant groups concentrated lethal behavior into intentionally targeting civilians as opposed to engaging in battle with opponents in contemporary armed conflict. METHODOLOGY/PRINCIPAL FINDINGS: We identified all 226 formally organized state and non-state groups (i.e. actors that engaged in lethal armed conflict during 2002-2007: 43 state and 183 non-state. We summed civilians killed by an actor's intentional targeting with civilians and combatants killed in battles in which the actor was involved for total fatalities associated with each actor, indicating overall scale of armed conflict. We used a Civilian Targeting Index (CTI, defined as the proportion of total fatalities caused by intentional targeting of civilians, to measure the concentration of lethal behavior into civilian targeting. We report actor-specific findings and four significant trends: 1. 61% of all 226 actors (95% CI 55% to 67% refrained from targeting civilians. 2. Logistic regression showed actors were more likely to have targeted civilians if conflict duration was three or more years rather than one year. 3. In the 88 actors that targeted civilians, multiple regressions showed an inverse correlation between CTI values and the total number of fatalities. Conflict duration of three or more years was associated with lower CTI values than conflict duration of one year. 4. When conflict scale and duration were accounted for, state and non-state actors did not differ. We describe civilian targeting by actors in prolonged conflict. We discuss comparable patterns found in nature and interdisciplinary research. CONCLUSIONS/SIGNIFICANCE: Most warring groups in 2002-2007 did not target civilians. Warring groups that targeted civilians in small-scale, brief conflict concentrated more lethal
Interface Heuristics and Style Guide Design: An Air Battle Management Case Study
National Research Council Canada - National Science Library
Nelson, W. T; Bolia, Robert S
2005-01-01
This paper describes the development of a human-machine interface style guide designed to promote a common look and feel among operator interfaces employed by air battle managers in the United States...
The Airpower Tenet of Centralized Control From Organizational and Battle Management Perspectives
National Research Council Canada - National Science Library
Depalmer, Steven
1997-01-01
.... The tenet is examined from both an organizational and a battle management aspect. The organizational aspect refers to the command and procedural arrangements that permit a Joint Forces Air Component Commander (JFACC...
de Zwaan, K.; gerber, adrian
2016-01-01
This article offers a cross-national analysis of the historical reception of the American war film The Battle Cry of Peace (J. Stuart Blackton and Wilfred North/Vitagraph, 1915) in the neutral countries of the Netherlands and Switzerland during World War I. Treating propaganda as a mode de lecture,
National Research Council Canada - National Science Library
Hedegaard, Michael
2001-01-01
The Battle of Powder River occurred on 17 March 1876 in southeastern Montana. Historians and researchers have consistently overlooked the importance of this battle on the outcome of the Great Sioux War of 1876. Colonel Joseph J...
The battle of "nano" paclitaxel.
Sofias, Alexandros Marios; Dunne, Michael; Storm, Gert; Allen, Christine
2017-12-01
Paclitaxel (PTX) is one of the three most widely used chemotherapeutic agents, together with doxorubicin and cisplatin, and is first or second line treatment for several types of cancers. In 2000, Taxol, the conventional formulation of PTX, became the best-selling cancer drug of all time with annual sales of 1.6 billion. In 2005, the introduction of the albumin-based formulation of PTX, known as Abraxane, ended Taxol's monopoly of the PTX market. Abraxane's ability to push the Taxol innovator and generic formulations aside attracted fierce competition amongst competitors worldwide to develop their own unique, new and improved formulation of PTX. At this time there are at least 18 companies focused on pre-clinical and/or clinical development of nano-formulations of PTX. These pharmaceutical companies are investing substantial capital to capture a share of the lucrative global PTX market. It is hoped that any formulation that dominates the market will result in tangible benefits to patients in terms of both survival and quality of life. Given all of this activity, here we address the question: Who is going to win the battle of "nano" paclitaxel? Copyright © 2017 Elsevier B.V. All rights reserved.
Player Skill Decomposition in Multiplayer Online Battle Arenas
Chen, Zhengxing; Sun, Yizhou; El-nasr, Magy Seif; Nguyen, Truong-Huy D.
2017-01-01
Successful analysis of player skills in video games has important impacts on the process of enhancing player experience without undermining their continuous skill development. Moreover, player skill analysis becomes more intriguing in team-based video games because such form of study can help discover useful factors in effective team formation. In this paper, we consider the problem of skill decomposition in MOBA (MultiPlayer Online Battle Arena) games, with the goal to understand what player...
78 FR 68699 - Establishment of Class E Airspace; Battle Mountain, NV
2013-11-15
...) navigation aid, Battle Mountain, NV. A favorable comment from the National Business Aviation Association...-4537. SUPPLEMENTARY INFORMATION: History The FAA published a final rule in the Federal Register... Final Rule Accordingly, pursuant to the authority delegated to me, the description under the History...
Hicks, Madelyn Hsiao-Rei; Lee, Uih Ran; Sundberg, Ralph; Spagat, Michael
2011-01-01
Background Warring groups that compete to dominate a civilian population confront contending behavioral options: target civilians or battle the enemy. We aimed to describe degrees to which combatant groups concentrated lethal behavior into intentionally targeting civilians as opposed to engaging in battle with opponents in contemporary armed conflict. Methodology/Principal Findings We identified all 226 formally organized state and non-state groups (i.e. actors) that engaged in lethal armed conflict during 2002–2007: 43 state and 183 non-state. We summed civilians killed by an actor's intentional targeting with civilians and combatants killed in battles in which the actor was involved for total fatalities associated with each actor, indicating overall scale of armed conflict. We used a Civilian Targeting Index (CTI), defined as the proportion of total fatalities caused by intentional targeting of civilians, to measure the concentration of lethal behavior into civilian targeting. We report actor-specific findings and four significant trends: 1.) 61% of all 226 actors (95% CI 55% to 67%) refrained from targeting civilians. 2.) Logistic regression showed actors were more likely to have targeted civilians if conflict duration was three or more years rather than one year. 3.) In the 88 actors that targeted civilians, multiple regressions showed an inverse correlation between CTI values and the total number of fatalities. Conflict duration of three or more years was associated with lower CTI values than conflict duration of one year. 4.) When conflict scale and duration were accounted for, state and non-state actors did not differ. We describe civilian targeting by actors in prolonged conflict. We discuss comparable patterns found in nature and interdisciplinary research. Conclusions/Significance Most warring groups in 2002–2007 did not target civilians. Warring groups that targeted civilians in small-scale, brief conflict concentrated more lethal behavior into
Enacting Informal Science Learning: Exploring the Battle for Informal Learning
Clapham, Andrew
2016-01-01
Informal Science Learning (ISL) is a policy narrative of interest in the United Kingdom and abroad. This paper explores how a group of English secondary school science teachers, enacted ISL science clubs through employing the Periodic Table of Videos. It examines how these teachers "battled" to enact ISL policy in performative conditions…
Dictatorship of Virtue: Multiculturalism and the Battle for America's Future.
Bernstein, Richard
This book addresses the issue of multicultural education and the political battles waged over it in U.S. schools. The volume examines the perspectives of both advocates and critics and applauds the true meaning of multiculturalism equality of opportunity and social justice. The fear is there is pulling away from certain cultural norms…
Adding Reports to Coalition Battle Management Language for NATO MSG-048
Pullen, J.M.; Corner, D.; Singapogo, S.S.; Clarc, N.; Cordonnier, N.; Menane, M.; Khimeche, L.; Mevassvik, O.M.; Alstad, A.; Schad, U.; Frey, M.; Reus, N. M. de; Krom, P.P.J. de; Grand, N.P. le; Brook, A.
2009-01-01
The NATO Modeling and Simulation Group Technical Activity 48 (MSG-048) was chartered in 2006 to investigate the potential of a Coalition Battle Management Language for multinational and NATO interoperation of command and control systems with modeling and simulation. Its initial work in defining and
Budget Period 1 Summary Report: Hywind Maine Project
Energy Technology Data Exchange (ETDEWEB)
Keiser, Meagan [Statoil, Stavanger (Norway)
2014-02-28
In accordance with the Statement of Project Objectives (SOPO) agreed to between the Department of Energy (“DOE”) and Statoil for the Hywind Maine project, Statoil hereby submits a Budget Period 1 Summary Report which includes accomplishments for the project. The report includes summaries of the other submitted reports (see Section 1.2-2) and progress regarding innovations leading to potential reductions in the Cost of Energy (see Section 3). The Hywind Demo project, the world’s first full-scale 2.3 megawatts (MW) floating wind turbine, installed at a water depth of 200 meter (m), 10 kilometer (km) off the coast of Norway, has proven that the Hywind floating substructure is a suitable platform for conventional multi- MW turbines. A principal goal of the Hywind Maine Project was to leverage that experience, both to demonstrate the commercial feasibility of the technology and to further develop and optimize the technology all in order to bring the costs down in a larger scale development. With the Hywind Maine Project, Statoil planned to deploy four turbines of 3 MW in approximately 140 meters water depth. Although the project in Maine will not move forward, much value was gained through the BP1 work package. Advanced modeling related to the design basis, which will have applicability beyond the Maine project, was completed. In addition, initial supply chain analyses were conducted, which will help assist with development of updated cost of energy models. Geophysical and various environmental surveys were also conducted, the results of which Statoil has committed to share publicly, and which will help build a database of information that future developers may be able to access. Finally, Statoil gained a greater understanding of the US offshore wind industry and related markets, which will assist the company as it looks for full-scale, commercial opportunities.
The Social Structure of Participants of the Battle of Blore Heath (September 23, 1459
Directory of Open Access Journals (Sweden)
Andrey G. Prazdnikov
2017-03-01
Full Text Available The battle of Blore Heath which took place on September 23, 1459, marked the new stage of the Wars of Roses, which led to the change of dynasties at the English throne in less than two years. As it was not the clash of the main forces of House of Lancaster and House of York, the sources contain poor information about the battle’s participants. However, the analysis different sources let identify the names of 22 participants. Prosopographic study of this group contributes to the study of social behavior models, the degree of influence of the Wars of Roses on English society, the activity of representatives of different social strata. The social structure of the group, most of which are the representatives of the English gentry, is the object of the article. There is information in the sources about the origin of the knights. The House of York under the command of Earl of Salisbury were mostly from Northern and North-Western counties (Yorkshire, Westmorland, whereas House of Lancaster formed their troops in Cheshire, Staffordshire and Lancashire. As a rule, officers in the army of the Earl of Salisbury, were in close personal or family ties with him. The study of further lives of the participants of the battle and biographies of their children showed that the adherence of the chosen dynasty was preserved by generations and change of the parties was rather a deviation from the norm. English nobility of the second half of the 15th century had a high opinion of the value of loyalty and honor.
The face of war: Trauma analysis of a mass grave from the Battle of Lützen (1632.
Directory of Open Access Journals (Sweden)
Nicole Nicklisch
Full Text Available Contemporary accounts of battles are often incomplete or even erroneous because they reflect the-often biased-viewpoints of the authors. Battlefield archaeology faces the task of compiling an historical analysis of a battle and of gathering all the available facts. Besides cultural historical evidence and artefacts, the human remains of those who have fallen in battle also provide invaluable information. In studying mass graves from a military context, the injury types and patterns are significant. They allow us to reconstruct the circumstances surrounding the soldiers' deaths and provide information on the hostilities that occurred on the battlefield. One such mass grave was discovered in 2011 at Lützen, Saxony-Anhalt (Germany. Based on its geographical location and on the results obtained from archaeological examinations carried out in the area, the grave could be dated to the Thirty Years War (1618-1648. Further archaeological research confirmed that the dead had been soldiers from the Battle of Lützen (1632. The mass grave was block-lifted and then comprehensively examined at the State Museum of Prehistory in Halle (Saale. As well as osteological examinations to determine age, sex, height, state of health, i.e. diseases or injuries, imaging methods were also employed and histological and isotopic analyses carried out. The focus of this study was on the injuries sustained by the soldiers both prior to and during the battle. The results revealed that the 47 deceased had been between the ages of 15 and 50 when they died. Numerous healed injuries showed that the men had often been involved in violent encounters. Approximately three in every four soldiers had injuries that could have been fatal. Wounds inflicted by handguns, particularly to the skull, were predominant. The integrative analysis of the archaeological and anthropological data allowed us to conclude that the majority had been killed during a cavalry attack.
Yoshida, Keisuke; Hasegawa, Akira; Saito, Tatsuhiko; Asano, Youichi; Tanaka, Sachiko; Sawazaki, Kaoru; Urata, Yumi; Fukuyama, Eiichi
2016-10-01
A shallow M7.3 event with a M6.5 foreshock occurred along the Futagawa-Hinagu fault zone in Kyushu, SW Japan. We investigated the spatiotemporal variation of the stress orientations in and around the source area of this 2016 Kumamoto earthquake sequence by inverting 1218 focal mechanisms. The results show that the σ3 axis in the vicinity of the fault plane significantly rotated counterclockwise after the M6.5 foreshock and rotated clockwise after the M7.3 main shock in the Hinagu fault segment. This observation indicates that a significant portion of the shear stress was released both by the M6.5 foreshock and M7.3 main shock. It is estimated that the stress release by the M6.5 foreshock occurred in the shallower part of the Hinagu fault segment, which brought the stress concentration in its deeper part. This might have caused the M7.3 main shock rupture mainly along the deeper part of the Hinagu fault segment after 28 h.
77 FR 46283 - Amendment of Class E Airspace; Battle Creek, MI
2012-08-03
...) Standard Instrument Approach Procedures at W.K. Kellogg Airport. The airport's geographic coordinates also... controlled airspace at W.K. Kellogg Airport (77 FR 29918) Docket No. FAA-2011-1110. Interested parties were... instrument approach procedures at W.K. Kellogg Airport, Battle Creek, MI. This action is necessary for the...
battle on the lomba, 1987 the day a south african armoured battalion
African Journals Online (AJOL)
plt
navigate between perceptions and reality and to find the truth in the debate about ... such, the book focuses mostly on major events and actions augmented by ... mobile battle in the dense bushes of Angola in the absence of air superiority and.
Lifescience Database Archive (English)
Full Text Available Molecule: Sulfolipid Biosynthesis (Sqd1) Protein; Chain: A; Engineered: Yes Isomerase A.M.Mulichak, M.J.Thei...IASIHDRISRWKALTGKSIELYVGDICDFEFLAESFKSFEPDSVVHFGEQRSAPYSMIDRSRAVYTQHNNVIGTLNVLFAIKEFGEECHLVKLGTMGEYGTPNIDIEE...LNRFCVQAAVGHPLTVYGKGGQTRGYLDIRDTVQCVEIAIANPAKAGEFRVFNQFTEQFSVNELASLVTKAGSKLGLDVKKMTVPNPRVEAEEHYYNAKHTKLMELGLEPHYLSDSLLDSLLNFAVQFKDRVDTKQIMPSVSWKKIGVKTKSMTT arabi_1QRR.jpg ...
The ultimate solution to the quantum Battle of the Sexes game
International Nuclear Information System (INIS)
Frackiewicz, Piotr
2009-01-01
We present the unique solution to the quantum Battle of the Sexes game. We show the best result to be achieved when the game is played according to Marinatto and Weber's scheme. The result which we put forward does not surrender the criticism of previous works on the same topic.
The DAG project, a 4m class telescope: the telescope main structure performances
Marchiori, G.; Busatta, A.; Ghedin, L.; Marcuzzi, E.; Manfrin, C.; Battistel, C.; Pirnay, O.; Flebus, Carlo; Yeşilyaprak, C.; Keskin, O.; Yerli, S.
2016-07-01
Dogu Anatolu Gözlemevi (DAG-Eastern Anatolia Observatory) Project is a 4m class optical, near-infrared Telescope and suitable enclosure which will be located at an altitude of 3.170m in Erzurum, Turkey. The DAG telescope is a project fully funded by Turkish Ministry of Development and the Atatürk University of Astrophysics Research Telescope - ATASAM. The Project is being developed by the Belgian company AMOS (project leader), which is also the optics supplier and EIE GROUP, the Telescope Main Structure supplier and responsible for the final site integration. The design of the Telescope Main Structure fits in the EIE TBO Program which aims at developing a Dome/Telescope systemic optimization process for both performances and competitive costs based on previous project commitments like NTT, VLT, VST and ASTRI. The optical Configuration of the DAG Telescope is a Ritchey-Chretien with two Nasmyth foci and a 4m primary thin mirror controlled in shape and position by an Active Optic System. The main characteristics of the Telescope Main Structure are an Altitude-Azimuth light and rigid structure system with Direct Drive Systems for both axis, AZ Hydrostatic Bearing System and Altitude standard bearing system; both axes are equipped with Tape Encoder System. An innovative Control System characterizes the telescope performance.
National Research Council Canada - National Science Library
Staker, R
2003-01-01
This report demonstrates the application of a Bayesian Belief Network decision support method for Force Level Systems Engineering to a collection of projects related to Aerospace Surveillance and Battle Management...
Physical Training Program Guidelines for U.S. Navy Recruits: Preparing Recruits for Battle Stations
National Research Council Canada - National Science Library
Trone, D
1999-01-01
...) a directive instructing RDCs to ensure that the physical conditioning program for women is sufficient to prepare them for successful completion of the final physical readiness test and Battle Stations...
Towards Computing the Battle for Hearts and Minds: Lessons from the Vendée
Hurwitz, Roger
We analyze the conditions and processes that spawned a historic case of insurgency in the context of regime change. The analysis is an early step in the development of formal models that capture the complex dynamics of insurgencies, resistance and other conflicts that are often characterized as "battles for hearts and minds" (henceforth BHAM). The characterization, however, flattens the complexities of the conflict. It suggests bloodless engagements where victories come from public relations and demonstration projects that foster positive attitudes among a subject population. Officials conducting these battles sometimes use the label to mask their ignorance of the complexities and sometimes with the intention of minimizing their difficulties in dealing with them. Modeling can therefore be a constructive step in overcoming their impoverished thinking.
The battle of Britain - as it really was | Esterhuyse | Scientia Militaria ...
African Journals Online (AJOL)
Scientia Militaria: South African Journal of Military Studies. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 20, No 4 (1990) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. The battle of Britain - as it really ...
Directory of Open Access Journals (Sweden)
Rigo Hoencamp
Full Text Available OBJECTIVES: Units deployed to armed conflicts are at high risk for exposure to combat events. Many battle casualties (BCs have been reported in the recent deployment to Afghanistan. The long-term impact of these combat injuries, at their five-year end point, is currently unknown. To date, no systematic inventory has been performed of an identified group of BCs in comparison to non-injured service members from the same operational theatre. DESIGN: Observational cross-sectional cohort study. SETTING: Open online survey among Dutch BCs that deployed to Afghanistan (2006-2010. PARTICIPANTS: The Dutch BCs (n = 62 were compared to two control groups of non-injured combat groups (battle exposed [n = 53], and non-battle exposed [n = 73]. MAIN OUTCOME MEASURES: Participants rated their impact of trauma exposure (Impact of Events [IES], post deployment reintegration (Post Deployment Reintegration Scale [PDRS], general symptoms of distress (Symptom Checklist 90 [SCL-90], as well as their current perceived quality of life (EuroQol-6D [EQ-6D]. Also cost effectiveness (Short From health survey [SF-36] and care consumption were assessed (Trimbos/iMTA questionnaire. RESULTS: Over 90% of BCs were still in active duty. The mean scores of all questionnaires (IES, EQ-6D, SF-36, and SCL-90 of the BC group were significantly higher than in the control groups (p<0.05. The PDRS showed a significantly lower (p<0.05 outcome in the negative subscales. The mean consumption of care was triple that of both control groups. A lower score on quality of life was related to higher levels of distress and impact of trauma exposure. CONCLUSIONS: This study showed a clear long-term impact on a wide range of scales that contributes to a reduced quality of life in a group of BCs. Low perceived cost effectiveness matched with high consumption of care in the BC group in comparison to the control groups. These results warrant continuous monitoring of BCs.
Oiling and cleanup issues in wetlands, M/T Julie N spill, Portland, Maine
International Nuclear Information System (INIS)
Michel, J.; Lehmann, S.M.; Henry, C.B.Jr.
1998-01-01
The clean up and environmental assessment techniques which were used following the September 1996 oil spill from the M/T Julie N in Portland Harbor, Maine were reviewed and documented. The spill resulted in heavy oiling of wetland. Aerial photography, ground-truth surveys, transects and chemical sampling were conducted to try to assess the impact to wetlands and to decide on appropriate cleanup options. A range of cleanup methods were attempted including low-pressure flushing, shoreline cleaning agents, vegetation cutting, and natural recovery. 9 refs., 3 tabs., 1 fig
Two Approaches to Developing a Multi-Agent System for Battle Command Simulation
Løvlid, R.A.; Alstad, A.; Mevassvik, O.M.; Reus, N.M. de; Henderson, H.C.; Vecht, B.van der; Luik, T.T.
2013-01-01
In the military, Command and Control Information Systems (C2ISs) are used for issuing commands to subordinate units. In training or decision support, simulations are used instead of live military forces. The Coalition Battle Management Language (C-BML) is currently being developed as an interface
Effects of social support and battle intensity on loneliness and breakdown during combat.
Solomon, Z; Mikulincer, M; Hobfoll, S E
1986-12-01
A sample of 382 Israeli soldiers who developed combat stress reactions (CSR) during the 1982 Israel-Lebanon War were compared with groups of carefully matched controls who did not develop CSR. Lack of social support from officers was found to be related to greater feelings of loneliness and greater likelihood of CSR in soldiers. Lack of social support from buddies was found to be related to greater loneliness. Intensity of battle was also found to be related to greater feelings of loneliness and increased likelihood of CSR. A path model was tested and supported. The model suggests that battle intensity and officer support lead to CSR directly and indirectly by causing increased feelings of loneliness. Possible cognitive and psychodynamic explanations for the findings are offered. The limitations of making causal statements from retrospective perceptions is discussed.
Letizia, Angelo
2013-01-01
Higher education is one of the last democratic institutions in society and it is currently under attack by advocates of neo-liberalism. The purpose of this paper is to illustrate how this "battle" can be framed as a battle over the direction of the Enlightenment. Critical Theory and neoliberalism both emerged from academia in response to…
National Research Council Canada - National Science Library
Wampler, Richard
1998-01-01
This report documents the methodology and lessons learned in the development of the Innovative Tools and Techniques for Brigade and Below Staff Training II - Battle Staff Training System II (ITTBBST-BSTS II...
2011-12-01
Schade et al 2010), Joint Battle Management Lan - guage (JBML) (Levine et al 2007), Integrated Battle Management Language (IBML), and NATO Model...the format and content of an XML document containing C-BML expressions conform to the lan - guage specification described by the XML schema). Furthermore...loosely based on the Open Systems Interconnection ( OSI ) stack and the Transmission Control Protocol / Internet Protocol (TCP/IP) model, which
Battling Obesity with Quality Elementary Physical Education: From Exposure to Competence
Bott, Timothy S.; Mitchell, Murray
2015-01-01
Sedentary behaviors contribute to the obesity epidemic in this country and physical educators can play an important role in the battle to improve the quality of life of our citizens. Motor skill competency is a substantive factor in a person's decision to be active or not, and a quality physical education program can tip the balance in favor of…
Professor M. M. Zagorulko’s school of economic and military history of Russia
Directory of Open Access Journals (Sweden)
Redkina Olga Yurievna
2013-10-01
Full Text Available Maxim Matveyevich Zagorulko is the first rector of Volgograd State University, the veteran of the Great Patriotic War, the Honorable Citizen of Volgograd. He is the founder and the head of the scientific school studying various aspects of the Fatherland’s history. In the 1960s, M.M. Zagorulko united researches in the field of an economic history of Russia and the Great Patriotic War history. He had chosen as a subject of his doctoral dissertation a history of operation of economy of temporarily occupied territories of the USSR by fascists. In 1970, M.M. Zagorulko in a co-authorship with the Moscow scholar, the active participant of guerrilla movement A.F. Yudenkov published the monograph “Crash of Economic Plans of Fascist Germany on Temporarily Occupied Territory of the USSR”. Soon it was translated into the Czech language. In 1974, there was the second, added and modified edition of the book by M.M. Zagorulko and A.F. Yudenkov – “Crash of the «Oldenburg» Plan”. The third edition of this book was issued in 1980 in the Russian and Czech languages in Moscow and Bratislava. In 1975, Maxim M. Zagorulko defended his doctoral dissertation in the Dissertation Council of Leningrad State University on the subject “Economic Policy of Fascist Germany in the Occupied Territory of the USSR and Its Crash”. M.M. Zagorulko, his pupils and adherents conduct scientific researches in the field of an Economic History of Russia, History of military captivity in the USSR, History of the Battle of Stalingrad and so forth. Under his management multivolume collections of documents were published, monographs were written and dissertations were defended. The fundamental Encyclopedia of the Battle of Stalingrad created by him was declared in 2010 as “The best book of Russia”. In all these projects, theses and monographs M.M. Zagorulko is the organizer and inspirer of scientific researches.
mTORC1 directly phosphorylates and regulates human MAF1.
Michels, Annemieke A; Robitaille, Aaron M; Buczynski-Ruchonnet, Diane; Hodroj, Wassim; Reina, Jaime H; Hall, Michael N; Hernandez, Nouria
2010-08-01
mTORC1 is a central regulator of growth in response to nutrient availability, but few direct targets have been identified. RNA polymerase (pol) III produces a number of essential RNA molecules involved in protein synthesis, RNA maturation, and other processes. Its activity is highly regulated, and deregulation can lead to cell transformation. The human phosphoprotein MAF1 becomes dephosphorylated and represses pol III transcription after various stresses, but neither the significance of the phosphorylations nor the kinase involved is known. We find that human MAF1 is absolutely required for pol III repression in response to serum starvation or TORC1 inhibition by rapamycin or Torin1. The protein is phosphorylated mainly on residues S60, S68, and S75, and this inhibits its pol III repression function. The responsible kinase is mTORC1, which phosphorylates MAF1 directly. Our results describe molecular mechanisms by which mTORC1 controls human MAF1, a key repressor of RNA polymerase III transcription, and add a new branch to the signal transduction cascade immediately downstream of TORC1.
Apolipoprotein M mediates sphingosine-1-phosphate efflux from erythrocytes
DEFF Research Database (Denmark)
Christensen, Pernille M.; Bosteen, Markus H.; Hajny, Stefan
2017-01-01
Sphingosine-1-phosphate (S1P) is a bioactive lipid implicated in e.g. angiogenesis, lymphocyte trafficking, and endothelial barrier function. Erythrocytes are a main source of plasma S1P together with platelets and endothelial cells. Apolipoprotein M (apoM) in HDL carries 70% of plasma S1P, whereas...... 30% is carried by albumin. The current aim was to investigate the role of apoM in export of S1P from human erythrocytes. Erythrocytes exported S1P more efficiently to HDL than to albumin, particularly when apoM was present in HDL. In contrast, export of sphingosine to HDL was unaffected...... by the presence of apoM. The specific ability of apoM to promote export of S1P was independent of apoM being bound in HDL particles. Treatment with MK-571, an inhibitor of the ABCC1 transporter, effectively reduced export of S1P from human erythrocytes to apoM, whereas the export was unaffected by inhibitors...
Battles and Borders. : Perspectives on Cultural Transmission and Literature in Minor Language Areas
Broomans, Pieternella; Jensma, Goffe; Jiresch, Esther; Klok, Janna; van Elswijk, Roald
2015-01-01
Battles and Borders. Perspectives on Cultural Transmission and Literature in Minor Language Areas is about literature on the fringes of Europe. The authors all discuss the often unique ways in which literary history and cultural transfer function in peripheral and central regions against the
Which Battle of the Somme? War and neutrality in Dutch cinemas, 1914-1918
Dibbets, K.; Groot, W.
2010-01-01
While the Netherlands tried to maintain neutrality during World War I, the belligerent nations watched the country and its public opinion closely. At the same time, the French, English, and German authorities used propaganda to influence Dutch public opinion. The famous documentary film The Battle
Calculation of three proposals in the framework of the Green Tax Battle
International Nuclear Information System (INIS)
Schroten, A.
2011-09-01
In the Green Tax Battle a team of professors, a team of professional accountants and a team of social and environmental organizations compete with each other to present the most effective and innovative proposal for a further greening of the tax system in the Netherlands. The emphasis is on commuter traffic. [nl
Challenging the 'King of the Road' - exploring mobility battles between cars and bikes in the USA
DEFF Research Database (Denmark)
Mikkelsen, Jacob Bjerre; Smith, Shelley; Jensen, Ole B.
This paper is explorative in both theoretical and empirical terms. Theoretically the paper explores the potential of merging and including ‘assemblage theories’ into mobilities research. Empirically the paper explores the battle of mobilities between bikes and cars in the USA. With the bicycle...... mobility practices (Furness 2010). In a contribution to the repositioning of the bicycle, the qualities and positive impacts of bicycling on urban life are discussed (Jensen 2007, Petersen, 2007). Repositioning and reevaluating the car in American society implies examination and discussion of the main...... Assemblages’ of American cities are related to the existing hegemonic systems, norms, and practices related to the car. This paper contains empirical field studies conducted in the city of Philadelphia, USA where the ongoing dispute between car-drivers and bicyclists, in news media termed ‘bike wars...
Infrared photometry of upper main sequence stars in M39
International Nuclear Information System (INIS)
Manteiga, M.; Martinez-Roger, C.; Morales, C.; Sabau, L.
1991-01-01
Infrared photometry of 19 Main sequence stars in the open cluster M39 is presented. Infrared-infrared and optical-infrared colour-colour and colour-magnitude diagrams are presented and compared with mean intrinsic colours for Population I stars. An interstellar reddening of E(B - V) = 0.01 is obtained by analysis of the colour-colour diagrams. Comparison with a set of theoretical isochrones leads to an age estimate for the cluster between 2.4 and 4.8 x 10 8 years
Infrared photometry of upper main sequence stars in M39
Energy Technology Data Exchange (ETDEWEB)
Manteiga, M.; Martinez-Roger, C. (Instituto de Astrofisica de Canarias, Tenerife, (ES)); Morales, C.; Sabau, L. (Instituto de Tecnica Aeroespacial, Madrid, (ES))
1991-03-01
Infrared photometry of 19 Main sequence stars in the open cluster M39 is presented. Infrared-infrared and optical-infrared colour-colour and colour-magnitude diagrams are presented and compared with mean intrinsic colours for Population I stars. An interstellar reddening of E(B - V) = 0.01 is obtained by analysis of the colour-colour diagrams. Comparison with a set of theoretical isochrones leads to an age estimate for the cluster between 2.4 and 4.8 x 10{sup 8} years.
The battle between battery and fuel cell powered electric vehicles : A BWM approach
van de Kaa, G.; Scholten, D.J.; Rezaei, J.; Milchram, C.
2017-01-01
The transition to a more sustainable personal transportation sector requires the widespread adoption of electric vehicles. However, a dominant design has not yet emerged and a standards battle is being fought between battery and hydrogen fuel cell powered electric vehicles. The aim of this paper
The Battle of Orsha – court propaganda or chivalric epic? (English version
Directory of Open Access Journals (Sweden)
Hucul, Volodymyr
2014-07-01
Full Text Available The Battle of Orsha, part of the collection of the National Museum in Warsaw, an example of panel painting (1525–1535, is of paramount importance for the study of the military, as well as for the research in art history, material history, and the history of political and military elites of Central-Eastern Europe during the Renaissance. The article describes the ways Ruthenian and Lithuanian-Polish elites used material and intellectual products of chivalric culture, and tackles the problem of documentary and propagandist role of visual narrative. Since the publication of works by David Freedberg and Peter Burke the necessity to recreate the context of making, functioning, and reception of images has become evident. Daniel Arasse has further expanded methodological tools of this type of research. However, there are still numerous artworks whose historical and social context has either remained untouched by research, or has been researched insufficiently. Repeatedly, it has led to misinterpretations of such artworks in spite of their major position in culture. The Battle of Orsha is a spectacular example of this process.
Directory of Open Access Journals (Sweden)
Olesya A. Gomanenko
2018-02-01
Full Text Available This paper is devoted to the study of the Stalingrad Group of Troops. That military division was created after the end of the Battle of Stalingrad. The the Group’s creation was aimed at rest and training of the soldiers and officers who had left bloody battles to prepare them for the further military operations. For the first time in the Great Patriotic War the Group faced the practical challenge to help the civil authorities and administration to restore the economy and infrastructure of the region including the network of river lines, railways and highways. The Stalingrad Group of Troops had to carry out mine clearing of the area of military operations, to participate in collecting trophies, burial of the remains of fallen soldiers. Process of mine clearing was assigned to engineering parts of the 62nd, 64th, 66th armies. Four engineering and mine crews, two specialized battalions and one company, staff of Osoaviakhim, Management of People’s Commissariat for Internal Affairs were connected. The volume of the required works was considerable. The special plan was prepared, the territory was differentiated, terms were determined. During interrogations new developments of the German designers – mines, radio-controlled from Hamburg, and the jumping mines were found. Work on mine clearing of the district and collecting explosive objects continued during the whole reconstruction period. Activity of the Stalingrad Group of Troops allowed earlier beginning of the main reconstruction work in the city and the region.
Cabibel, Vincent; Muthalib, Makii; Teo, Wei-Peng; Perrey, Stephane
2018-04-01
The crossed-facilitation (CF) effect refers to when motor-evoked potentials (MEPs) evoked in the relaxed muscles of one arm are facilitated by contraction of the opposite arm. The aim of this study was to determine whether high-definition transcranial direct-current stimulation (HD-tDCS) applied to the right primary motor cortex (M1) controlling the left contracting arm [50% maximum voluntary isometric contraction (MVIC)] would further facilitate CF toward the relaxed right arm. Seventeen healthy right-handed subjects participated in an anodal and cathodal or sham HD-tDCS session of the right M1 (2 mA for 20 min) separated by at least 48 h. Single-pulse transcranial magnetic stimulation (TMS) was used to elicit MEPs and cortical silent periods (CSPs) from the left M1 at baseline and 10 min into and after right M1 HD-tDCS. At baseline, compared with resting, CF (i.e., right arm resting, left arm 50% MVIC) increased left M1 MEP amplitudes (+97%) and decreased CSPs (-11%). The main novel finding was that right M1 HD-tDCS further increased left M1 excitability (+28.3%) and inhibition (+21%) from baseline levels during CF of the left M1, with no difference between anodal and cathodal HD-tDCS sessions. No modulation of CSP or MEP was observed during sham HD-tDCS sessions. Our findings suggest that CF of the left M1 combined with right M1 anodal or cathodal HD-tDCS further facilitated interhemispheric interactions during CF from the right M1 (contracting left arm) toward the left M1 (relaxed right arm), with effects on both excitatory and inhibitory processing. NEW & NOTEWORTHY This study shows modulation of the nonstimulated left M1 by right M1 HD-tDCS combined with crossed facilitation, which was probably achieved through modulation of interhemispheric interactions.
Light Infantry: A Tactical Deep Battle Asset for Central Europe.
1985-12-02
that overview siptgficant lessons will be extracted with a view toward modern day applicability. A brief review of current capabilities for U. S. o...Genral Boldin wrote about a forty-five day operation in the enemy’s rear in which he establisad caummications with friendly forces and was able to...between the lessons extracted above n the hb fits of deep battle operations identified by LT Holder. lie contends that the principal benefLts of d v-p
Espinosa, J A; Kosnik, L K; Kraitsik, M; Dillow, J C
1997-01-01
In our efforts to reduce cardiac morbidity and mortality we often use terms such as the "battle" or "war" on heart disease. If we believe efforts to reduce cardiac disease are the moral equivalent of war, then perhaps we should explore ways that military strategic and tactical metaphors can be applied through technology to the cardiac battle. In this article we explore three major areas for technological advancement: adaptation of the strategies of outcomes management and evidence-based medicine, computer simulation and animation efforts to create horizontal and vertical integration of strategic efforts, and use of interactive multimedia in "recruiting an army" through community empowerment. The overall goal is to find ways to lift "the fog of war" in the battle on heart disease, in order to further the integration of our various efforts.
mTORC1 Directly Phosphorylates and Regulates Human MAF1▿
Michels, Annemieke A.; Robitaille, Aaron M.; Buczynski-Ruchonnet, Diane; Hodroj, Wassim; Reina, Jaime H.; Hall, Michael N.; Hernandez, Nouria
2010-01-01
mTORC1 is a central regulator of growth in response to nutrient availability, but few direct targets have been identified. RNA polymerase (pol) III produces a number of essential RNA molecules involved in protein synthesis, RNA maturation, and other processes. Its activity is highly regulated, and deregulation can lead to cell transformation. The human phosphoprotein MAF1 becomes dephosphorylated and represses pol III transcription after various stresses, but neither the significance of the phosphorylations nor the kinase involved is known. We find that human MAF1 is absolutely required for pol III repression in response to serum starvation or TORC1 inhibition by rapamycin or Torin1. The protein is phosphorylated mainly on residues S60, S68, and S75, and this inhibits its pol III repression function. The responsible kinase is mTORC1, which phosphorylates MAF1 directly. Our results describe molecular mechanisms by which mTORC1 controls human MAF1, a key repressor of RNA polymerase III transcription, and add a new branch to the signal transduction cascade immediately downstream of TORC1. PMID:20516213
Lifescience Database Archive (English)
Full Text Available m of GT-1 may be achieved through direct interaction between TFIIA and GT-1; Binding of GT-1-like factors to the PR-1a promoter influ...ences the level of SA-inducible gene expression; GT-1; light; TATA; TFIIA; TBP; HR;
Techniques used detection and quantification of aflatoxin M1 in milk
Adriana Frizzarin; Keila Maria Roncato Duarte
2012-01-01
Aflatoxin is a group of toxic substances produced by fungi, mainly Aspergillus flavus and Aspergillus parasiticus. It can be developed in agriculture products such as grains or processed food, when environment conditions of humidity and air humidity are favorable. Aflatoxins can be presented as several forms. In Milk, are called M1 and M2, resulting from aflatoxins B1 and B2 metabolism. Aflatoxin M1 (AFM1) is classified as a possible carcinogen to humans, so the occurrence of aflatoxin M1 in ...
Infinitely many N=1 dualities from m+1−m=1
Energy Technology Data Exchange (ETDEWEB)
Agarwal, Prarit; Intriligator, Kenneth; Song, Jaewon [Department of Physics, University of California,San Diego, La Jolla, CA 92093 (United States)
2015-10-06
We discuss two infinite classes of 4d supersymmetric theories, T{sub N}{sup (m)} and U{sub N}{sup (m)}, labelled by an arbitrary non-negative integer, m. The T{sub N}{sup (m)} theory arises from the 6d, A{sub N−1} type N=(2,0) theory reduced on a 3-punctured sphere, with normal bundle given by line bundles of degree (m+1,−m); the m=0 case is the N=2 supersymmetric T{sub N} theory. The novelty is the negative-degree line bundle. The U{sub N}{sup (m)} theories likewise arise from the 6d N=(2,0) theory on a 4-punctured sphere, and can be regarded as gluing together two (partially Higgsed) T{sub N}{sup (m)} theories. The T{sub N}{sup (m)} and U{sub N}{sup (m)} theories can be represented, in various duality frames, as quiver gauge theories, built from T{sub N} components via gauging and nilpotent Higgsing. We analyze the RG flow of the U{sub N}{sup (m)} theories, and find that, for all integer m>0, they end up at the same IR SCFT as SU(N) SQCD with 2N flavors and quartic superpotential. The U{sub N}{sup (m)} theories can thus be regarded as an infinite set of UV completions, dual to SQCD with N{sub f}=2N{sub c}. The U{sub N}{sup (m)} duals have different duality frame quiver representations, with 2m+1 gauge nodes.
Lifescience Database Archive (English)
Full Text Available me=Ltp1; Synonyms=Papi; Hordeum Vulgare Molecule: Lipid Transfer Protein; Chain: Null; Synonym: Ltp Lipid Tr...ansport M.H.Lerche, F.M.Poulsen M.H.Lerche, F.M.Poulsen Two Different Binding Modes Of Palmitate In The Homologous Mai
Memorials, Shrines and Umbrellas in the Rain: Poetry and 11-M
Directory of Open Access Journals (Sweden)
Jill Robbins
2012-06-01
Full Text Available This project examines the representations in recent Spanish poetry of violence, solidarity, and memory, as these intersect with ethnic, linguistic and religious otherness, globalization, communication technology, and nationalisms. The lens through which the analysis is refracted is the poetic response to the Islamist terrorist bombings of working-class commuter trains in Madrid on March 11, 2004 (known in Spain as 11-M. This event, which occurred days before national elections, exposed the contradictory cultural forces that underlie notions of the national identity, economic transformation, the role of the media, and the social contract in Spain today. This became apparent in the massive demonstrations against neoliberalism, Spain’s alliance with the US in the “war on terror,” and Basque terrorism on 12-M. These popular protests were soon followed by police investigations, legal battles, and, finally, cultural memorials. Still, the battle to give meaning to these events continues to rage in politic circles, in cultural artifacts, and in the press.
The battle for centre stage: Women's football in South Africa
DEFF Research Database (Denmark)
Engh, Mari Haugaa
2010-01-01
From when the first official South African Women's National Football team was established in 1993, Banyana Banyana have been 'making it happen' for women's football in South Africa. National team players have become inspirational icons and role models for thousands of South African women and girl....... Highlighting examples of battles for power and leadership, homophobic attitudes and attempts to feminise the bodies of women footballers, this Focus illustrates the hard fought victories and disappointing losses in the history of South African women's football....
DEFF Research Database (Denmark)
Fonseca, Bruno; Zakaria, Chadi; Jia, J J
2015-01-01
is incompletely understood. Here, we report that LARP1 functions as a key repressor of TOP mRNA translation downstream of mTORC1. Our data show the following: (i) LARP1 associates with mTORC1 via RAPTOR; (ii) LARP1 interacts with TOP mRNAs in an mTORC1-dependent manner; (iii) LARP1 binds the 5′TOP motif...
Lifescience Database Archive (English)
Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai
[War Relief of Japanese Red Cross Nurses in the Lost Battle of Burma].
Kawahara, Yukari
2015-12-01
This paper aims to reveal changes in the relief support of the Japanese Red Cross relief units dispatched to Burma during the Second World War, from the beginning of fighting in Burma to the Japanese withdrawal. Japanese Red Cross relief units began their relief support when Japan invaded Burma in February of 1942. Counterattacks by the British, Indian and Chinese armies from December 1942 caused an increase in the number of patients. There were also many cases of malnutrition and malaria due to the extreme shortage of medical supplies as a result of the Battle of Imphal, which began in March of 1944. Bomb raids became even more intense after the battle ended in July 1944, and patients were carried into bomb shelters and caves on a daily basis. Just prior to invasion by enemy troops, they were ordered to evacuate to neighboring Thailand. Nurses from the Wakayama group hid their identity as members of the Red Cross and evacuated, with 15 out of 23 dying or being reported missing in action.
Capital versus talent. The battle that's reshaping business.
Martin, Roger L; Moldoveanu, Mihnea C
2003-07-01
For much of the twentieth century, labor and capital fought bitterly for control of the industrialized economy. The titans of industry ultimately won a resounding victory over the unions, but the story doesn't end there. In today's economy, value is largely the product of knowledge and information. Companies cannot generate profits without the ideas, skills, and leadership capabilities of knowledge workers. It's these factors--not technologies, not factories, and certainly not capital--that give the most successful companies their unique advantages. As knowledge workers come to realize this, and see that the demand for their talent outstrips the supply, they are steadily wresting more and more of the profits from shareholders. This time the battle is between the sources of capital and the producers of value, and how it will end is far from clear. The roots of the current conflict lie in the twentieth-century shift from industrial to managerial capitalism and the creation of a new class of professional talent, the authors explain. Since the arrival of the information-based economy in the past decade, tensions have escalated. The dramatic rise of CEO pay--and the public fire it has drawn--is a telling symptom. With this new battle, we're also witnessing a fundamental change in the political alignment of capital. The Left is now siding with "the common shareholder" against the well-compensated top tier of the labor pool. Shareholders seeing an unprecedented proportion of the return on their investments siphoned off to employees may well ask, is there no end to it? Increasingly, it's human capital that is the basis of value, and financial capital has become far more generic than shareholders would like to believe. The growing tensions between shareholders and managers cannot be ignored, and capitalism is at a crossroads--again.
Hatzinger, M; Stastny, M; Haferkamp, A
2011-03-01
Apparently unimportant diseases of some prominent figures can have a considerable effect on the course of time at turning points in world history. It is quite conceivable that the Battle of Waterloo on 18 June 1815 had been lost by France because Napoleon was not in full possession of his powers, because he was suffering from acute cystitis. Adverse weather conditions with continuous rain and coldness in advance of the battle, extremely primitive hygienic conditions and more than simple quarters for the night led to the development of cystitis. Based on the records of his biographers, his personal physician and the letters to his brother, we know that Napoleon was not able to give the command to attack in the early morning as intended, but in the early noon, only because of his bad general condition. This delay of several hours led, as we all know, to the intervention of Prussia and the devastating defeat of France. Thus it appears that a relatively unimportant urological disease influenced the course of world history crucially.
Lifescience Database Archive (English)
Full Text Available 1EQK イネ Rice Oryza sativa L. Cysteine Proteinase Inhibitor-I Oryza Sativa Molecule: Oryzacystatin-I; Chai...n: A; Engineered: Yes Hydrolase Inhibitor K.Nagata, N.Kudo, K.Abe, S.Arai, M.Tanokura ...K.Nagata, N.Kudo, K.Abe, S.Arai, M.Tanokura Three-Dimensional Solution Structure Of Oryzacystatin-I, A Cyste
The Italian Submarine Force in the Battle of the Atlantic: Left in the Dark
2014-12-12
ADM Admiral ASW Anti-submarine warfare BDA Battle damage assessment C2 Command and Control CDR Commander HF/DF High frequency direction finder...damage assessment ( BDA ) if you will, the submarine captain decided if further action might be warranted, and made a decision as to how to engage
Occurrence of B1 Aflatoxin in diet and M1 Aflatoxin in bovine milk
Adriana Frizzarin; Thiago Pereira Motta; Thamires Martins; Livia Castelani; Heloisa Solda de Azevedo; Cláudia Rodrigues Pozzi
2012-01-01
Ensuring food quality is one of the principles of food safety. Food for dairy cattle may be contaminated by fungi of the genus Aspergillus, which produce aflatoxins. The B1 aflatoxin, when ingested by animals, is biotransformed in liver in several other toxic metabolites, including M1 aflatoxin which is excreted in milk. M1 aflatoxin has a carcinogenic effect, which the presence in milk poses a serious risk to public health because milk and dairy products are consumed mainly by children, preg...
Lifescience Database Archive (English)
Full Text Available m Vulgare Molecule: Beta-D-Glucan Glucohydrolase Isoenzyme Exo1; Chain: A; Synonym: Beta-D-Glucan Exohydrola...Of A Plant Beta-D-Glucan Glucohydrolase Structure V. 9 1005 2001 2-Domain Fold GB:AAD23382,4566505|EMBL; AF1
National Oceanic and Atmospheric Administration, Department of Commerce — In 2008, the Monitor National Marine Sanctuary (MNMS) commenced a multiyear project focusing on shipwreck sites associated with the Battle of the Atlantic. During...
Steadman, Bob; Finklea, John; Kershaw, James; Loughman, Cathy; Shaffner, Patti; Frost, Dean; Deller, Sean
2014-06-01
Textron's Advanced MicroObserver(R) is a next generation remote unattended ground sensor system (UGS) for border security, infrastructure protection, and small combat unit security. The original MicroObserver(R) is a sophisticated seismic sensor system with multi-node fusion that supports target tracking. This system has been deployed in combat theaters. The system's seismic sensor nodes are uniquely able to be completely buried (including antennas) for optimal covertness. The advanced version adds a wireless day/night Electro-Optic Infrared (EOIR) system, cued by seismic tracking, with sophisticated target discrimination and automatic frame capture features. Also new is a field deployable Gateway configurable with a variety of radio systems and flexible networking, an important upgrade that enabled the research described herein. BattleHawkTM is a small tube launched Unmanned Air Vehicle (UAV) with a warhead. Using transmitted video from its EOIR subsystem an operator can search for and acquire a target day or night, select a target for attack, and execute terminal dive to destroy the target. It is designed as a lightweight squad level asset carried by an individual infantryman. Although BattleHawk has the best loiter time in its class, it's still relatively short compared to large UAVs. Also it's a one-shot asset in its munition configuration. Therefore Textron Defense Systems conducted research, funded internally, to determine if there was military utility in having the highly persistent MicroObserver(R) system cue BattleHawk's launch and vector it to beyond visual range targets for engagement. This paper describes that research; the system configuration implemented, and the results of field testing that was performed on a government range early in 2013. On the integrated system that was implemented, MicroObserver(R) seismic detections activated that system's camera which then automatically captured images of the target. The geo-referenced and time-tagged Micro
Directory of Open Access Journals (Sweden)
Shoichi Fukui
2018-01-01
Full Text Available ObjectivesWe investigated the relationships among M1 monocytes, M2 monocytes, osteoclast (OC differentiation ability, and clinical characteristics in patients with rheumatoid arthritis (RA.MethodsPeripheral blood mononuclear cells (PBMCs were isolated from RA patients and healthy donors, and we then investigated the number of M1 monocytes or M2 monocytes by fluorescence-activated cell sorting. We also obtained and cultured CD14-positive cells from PBMCs from RA patients and healthy donors to investigate OC differentiation in vitro.ResultsForty RA patients and 20 healthy donors were included. Twenty-two patients (55% were anticitrullinated protein antibody (ACPA positive. The median M1/M2 ratio was 0.59 (0.31–1.11, interquartile range. There were no significant differences between the RA patients and healthy donors. There was a positive correlation between the M1/M2 ratio and the differentiated OC number in vitro in RA patients (ρ = 0.81, p < 0.001. The ACPA-positive patients had significantly higher M1/M2 ratios in vivo (p = 0.028 and significantly greater numbers of OCs in vitro (p = 0.005 than the ACPA-negative patients. Multivariable regression analysis revealed that the M1/M2 ratio was the sole significant contribution factor to in vitro osteoclastogenesis. RA patients with M1/M2 ratios >1 (having relatively more M1 monocytes had higher C-reactive protein and erythrocyte sedimentation rates than RA patients with M1/M2 ratios ≤1. M1-dominant monocytes in vitro produced higher concentrations of interleukin-6 upon stimulation with lipopolysaccharide than M2 monocytes.ConclusionM1/M2 monocytes imbalance strongly contributes to osteoclastogenesis of RA patients. Our findings cast M1 and M2 monocyte subsets in a new light as a new target of treatments for RA to prevent progression of osteoclastic bone destruction.
Neutron back scattering for the search of the Battle of Anghiari
International Nuclear Information System (INIS)
Bom, V.R.; Cosentino, A.; Seracini, M.; Rosa, R.
2010-01-01
The 'Battle of Anghiari' is a wall painting made by Leonardo Da Vinci around 1505. Its present day location is unknown but some indications suggest that the mural might be concealed behind a brick wall. Test measurements are presented demonstrating that neutron back scattering (NBS) can be used to search through the wall for the painting. NBS is a non-destructive technique to establish the presence of the hydrogen contained in the painting materials that were probably used by Da Vinci.
Health physics aspects of the 1.5M cyclotron
International Nuclear Information System (INIS)
Song, W.J.; Du, H.L.; Wei, Z.Q.; Xia, X.S.; Zheng, H.Z.; Jiang, G.F.; Liu, Y.Y.
1987-01-01
The 1.5m cyclotron in Institute of Modern Physics, Academia Sinica had operated for about 20 years until 1984 then converted to 1.7m sector focusing cyclotron. In this period it mainly used for fast neutron physics, light ion induced nucleus reactions, radioisotope production and heavy ion reactions. The health physics performed on this cyclotron including personnel dose monitoring, area monitoring (radiation field, radioactive aerosol, surface contamination and activated components etc.), maintenance inspection, environment survey and waste disposal is presented in this paper
International Nuclear Information System (INIS)
Kuznetsov, A.V.; Gorshkov, I.Yu.; Evsenin, A.V.; Osetrov, O.I.; Vakhtin, D.N.; Cosentino, A.; Seracini, M.
2009-01-01
Between 1505 and 1506 Leonardo Da Vinci painted his masterpiece, the Battle of Anghiari, in Palazzo Vecchio's Hall of 500 in Florence. The unfinished mural remained visible until 1563, when architect Giorgio Vasari undertook a renovation of the Hall and all traces of the Battle of Anghiari were lost. However, scholarly interpretation and scientific evidence suggest that the mural could be on the eastern wall, hidden behind a brick wall built in 1563 by Vasari. This paper discusses the possibility of using NNA/APT (Nanosecond Neutron Analysis/Associated Particle Technique) to establish the presence of the masterpiece by identifying behind the Vasari's wall chemical elements from the gesso preparation layer of the mural and possibly from its pigments. This paper reports on the experiments run with a simple NNA/APT system and the Monte Carlo simulations that have been carried out in order to outline the experimental setup of an advanced NNA/APT able to detect and locate the tiny amount of gesso and pigments.
The Latest Battle: Depictions of the Calormen in The Chronicles of Narnia
Directory of Open Access Journals (Sweden)
Howe Andrew
2017-12-01
Full Text Available Two books in C.S. Lewis’s young adult fantasy series Chronicles of Narnia - The Horse and His Boy and The Last Battle - paint an uncomfortable portrait of the Calormen, the traditional foil for the Narnians. Throughout the text, the Calormen are clearly marked both culturally and racially as Middle Eastern, perhaps specifically as Turkish or Arab in their socio-political power structure with harems, arranged marriages, and facial hair designating status. Even Tashbaan, the capital city of Calormen, reads somewhat like a description of Istanbul. Throughout these two books, the Calormen are portrayed as a sinister and conquest-driven culture threatening the freedom enjoyed by Narnia. This textual indictment is fairly consistent. In demonizing this group, Lewis took part in a literary tradition extending back hundreds of years, a tradition that has enjoyed renewed resonance with increased fears over the growth of Islam. From Sir John Mandeville to post-9/11 concerns over terrorism, western depictions of Islam have often revolved around fear and distrust. The Last Battle is particularly problematic in its allegorical depictions of Islam, as Lewis seems to suggest that salvation is only reserved for those who follow the lion Aslan, clearly marked throughout the series as a stand-in for Jesus Christ.
The battle over workers' compensation.
Ellenberger, J N
2000-01-01
Faced with lower profits and rapidly increasing premium costs in the 1980s, insurers and employer organizations cleverly parlayed the public perception of worker fraud and abuse in the workers' compensation system (that they helped to create) into massive legislative changes. Over the last decade, state legislators and governors, Republican and Democrat alike, have jumped on this bandwagon, one that workers and their allies have dubbed the workers' compensation "deform" movement. Alleging a "game plan" and a calculated campaign on the part of insurers and employers, the author looks at the major components of changes that were made, examines the elements of workers' compensation over which employers and insurers have gained control, and discusses Newt Gingrich's efforts to capitalize on employer and insurer fervor over the system. This campaign whistled through the country until it goaded the labor movement, injured workers, the trial bar, and others in Ohio in 1997 to organize themselves to stand up to employers by defeating the deform law through a ballot initiative. The article details that battle and suggests that similar voices can be achieved through a return to grassroots organizing and mobilization.
STELLAR DIAMETERS AND TEMPERATURES. II. MAIN-SEQUENCE K- AND M-STARS
Energy Technology Data Exchange (ETDEWEB)
Boyajian, Tabetha S.; McAlister, Harold A.; Jones, Jeremy; White, Russel; Henry, Todd; Gies, Douglas; Jao, Wei-Chun; Parks, J. Robert [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 4106, Atlanta, GA 30302-4106 (United States); Von Braun, Kaspar; Kane, Stephen R.; Ciardi, David [NASA Exoplanet Science Institute, California Institute of Technology, MC 100-22, Pasadena, CA 91125 (United States); Van Belle, Gerard [Lowell Observatory, Flagstaff, AZ 86001 (United States); Ten Brummelaar, Theo A.; Schaefer, Gail; Sturmann, Laszlo; Sturmann, Judit [The CHARA Array, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Muirhead, Philip S. [Department of Astronomy, California Institute of Technology, 1200 East California Boulevard, MC 249-17, Pasadena, CA 91125 (United States); Lopez-Morales, Mercedes [Institut de Ciencies de L' Espai (CSIC-IEEC), E-08193 Bellaterra (Spain); Ridgway, Stephen [National Optical Astronomy Observatory, P.O. Box 26732, Tucson, AZ 85726-6732 (United States); Rojas-Ayala, Barbara [Department of Astrophysics, Division of Physical Sciences, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024 (United States); and others
2012-10-01
We present interferometric angular diameter measurements of 21 low-mass, K- and M-dwarfs made with the CHARA Array. This sample is enhanced by adding a collection of radius measurements published in the literature to form a total data set of 33 K-M-dwarfs with diameters measured to better than 5%. We use these data in combination with the Hipparcos parallax and new measurements of the star's bolometric flux to compute absolute luminosities, linear radii, and effective temperatures for the stars. We develop empirical relations for {approx}K0 to M4 main-sequence stars that link the stellar temperature, radius, and luminosity to the observed (B - V), (V - R), (V - I), (V - J), (V - H), and (V - K) broadband color index and stellar metallicity [Fe/H]. These relations are valid for metallicities ranging from [Fe/H] = -0.5 to +0.1 dex and are accurate to {approx}2%, {approx}5%, and {approx}4% for temperature, radius, and luminosity, respectively. Our results show that it is necessary to use metallicity-dependent transformations in order to properly convert colors into stellar temperatures, radii, and luminosities. Alternatively, we find no sensitivity to metallicity on relations we construct to the global properties of a star omitting color information, e.g., temperature-radius and temperature-luminosity. Thus, we are able to empirically quantify to what order the star's observed color index is impacted by the stellar iron abundance. In addition to the empirical relations, we also provide a representative look-up table via stellar spectral classifications using this collection of data. Robust examinations of single star temperatures and radii compared to evolutionary model predictions on the luminosity-temperature and luminosity-radius planes reveal that models overestimate the temperatures of stars with surface temperatures <5000 K by {approx}3%, and underestimate the radii of stars with radii <0.7 R{sub Sun} by {approx}5%. These conclusions additionally
Lifescience Database Archive (English)
Full Text Available sterase; Chain: A, B; Engineered: Yes Hydrolase 3.1.4.- (Cyclic Phosphodiesterase) A.Hofmann, M.Grella, I.Bo...tos, W.Filipowicz, A.Wlodawer A.Hofmann, M.Grella, I.Botos, W.Filipowicz, A.Wloda
Building the Will to Fight -- Prerequisite to Winning the AirLand Battle,
1986-12-01
Shakespeare Henry V ~d. J4 44.4. V 4. 44 4.~44. -44 4. 4.4 .44 4.44.’C.? 444 -’ 44 4.’! .4. ~44* *44 4% 44. 4..’ 4.p4,441 44 .4 4~ .4. * . 4~4 44* 4...proud of himself, of his companions in uniform, and of those who had fought and Won the battle honors that graced his regiment’s colours or drums
International Nuclear Information System (INIS)
Anon.
1993-01-01
The Fermilab Main Injector (FMI) project is the centerpiece of the Laboratory's Fermilab III programme for the 1990s. Designed to support a luminosity of at least 5x10 31 cm -2 s -1 in the Tevatron collider, it will also provide new capabilities for rare neutral kaon decay and neutrino oscillation studies. The Fermilab Main Injector 8-150 GeV synchrotron is designed to replace the existing Main Ring which seriously limits beam intensities for the Tevatron and the antiproton production target. The project has passed several significant milestones and is now proceeding rapidly towards construction. The project received a $11.65M appropriation in 1992 and has been given $15M for the current fiscal year. Through the Energy Systems Acquisition Advisory Board (ESAAB) process, the US Department of Energy (DoE) has authorized funds for construction of the underground enclosure and service building where the Main Injector will touch the Tevatron, and to the preparation of bids for remaining project construction
Directory of Open Access Journals (Sweden)
Wei-qin LI
2017-04-01
Full Text Available Critical care medicine is an emerging unique specialty developed from the later 20th century, since then, it has been enriched with theoretical and practical experiences and becomes the most active subject in the field of clinical medicine. Critical care medicine of the PLA has attained significant achievements in the treatment and research of severe trauma, sepsis, severe heat stroke, multiple organ failure and severe acute pancreatitis. Besides, it stands in the leading position in the organ function maintenance of critically ill patients, continuous hemofiltration and nutrition support in China. Furthermore, critical care medicine plays an important role in the rescue of critically ill patients, medical support and disaster relief. As the relationship between battle wound rescue system and critical care medicine has been increasingly close, transition in the form of war in the new period brings new tasks to battle wound treatment constantly. Combined with the characteristics of information-oriented war condition in the future, developing the PLA critical care medicine and advancing the level of battle wound treatment in the new period point out the direction for the future work of critical care medicine. DOI: 10.11855/j.issn.0577-7402.2017.02.01
A report from America: Baby M.
Rachels, James
1987-10-01
Rachels reviews the social and legal facts of the celebrated "Baby M" case, in which surrogate Mary Beth Whitehead attempted to keep the daughter she had borne under contract to William Stern. The first phase of the legal battle between the parents ended in March 1988, when New Jersey Superior Court Judge Harvey R. Sorkow upheld the validity of the surrogacy contract, terminated Whitehead's parental rights, and awarded custody of the child to Stern. Rachels comments on public reaction to "Baby M," on Sorkow's decision, and on the impact the case may have on legislative attempts to regulate surrogacy. He also uses the example of "Baby M," as well as that of California heart transplant patient "Baby Jesse," to discuss how the media sensationalize controversial issues.
The apolipoprotein m-sphingosine-1-phosphate axis
DEFF Research Database (Denmark)
Arkensteijn, Bas W C; Berbée, Jimmy F P; Rensen, Patrick C N
2013-01-01
Apolipoprotein M (apoM) is a plasma apolipoprotein that mainly associates with high-density lipoproteins. Hence, most studies on apoM so far have investigated its effect on and association with lipid metabolism and atherosclerosis. The insight into apoM biology recently took a major turn. Apo...
International Nuclear Information System (INIS)
Brunish, W.M.; Guzik, J.A.; Willson, L.A.; Bowen, G.
1987-01-01
It has been hypothesized that variable stars may experience mass loss, driven, at least in part, by oscillations. The class of stars we are discussing here are the δ Scuti variables. These are variable stars with masses between about 1.2 and 2.25 M/sub θ/, lying on or very near the main sequence. According to this theory, high rotation rates enhance the rate of mass loss, so main sequence stars born in this mass range would have a range of mass loss rates, depending on their initial rotation velocity and the amplitude of the oscillations. The stars would evolve rapidly down the main sequence until (at about 1.25 M/sub θ/) a surface convection zone began to form. The presence of this convective region would slow the rotation, perhaps allowing magnetic braking to occur, and thus sharply reduce the mass loss rate. 7 refs
Kuznetsov, A. V.; Gorshkov, I. Yu.; Evsenin, A. V.; Osetrov, O. I.; Vakhtin, D. N.; Cosentino, A.; Seracini, M.
2009-12-01
Between 1505 and 1506 Leonardo Da Vinci painted his masterpiece, the Battle of Anghiari, in Palazzo Vecchio's Hall of 500 in Florence. The unfinished mural remained visible until 1563, when architect Giorgio Vasari undertook a renovation of the Hall and all traces of the Battle of Anghiari were lost. However, scholarly interpretation and scientific evidence suggest that the mural could be on the eastern wall, hidden behind a brick wall built in 1563 by Vasari. This paper discusses the possibility of using NNA/APT (Nanosecond Neutron Analysis/Associated Particle Technique) to establish the presence of the masterpiece by identifying behind the Vasari's wall chemical elements from the gesso preparation layer of the mural and possibly from its pigments. This paper reports on the experiments run with a simple NNA/APT system and the Monte Carlo simulations that have been carried out in order to outline the experimental setup of an advanced NNA/APT able to detect and locate the tiny amount of gesso and pigments.
Murtiyoso, A.; Grussenmeyer, P.; Guillemin, S.; Prilaux, G.
2017-08-01
The Battle of Vimy Ridge was a military engagement between the Canadian Corps and the German Empire during the Great War (1914-1918). In this battle, Canadian troops fought as a single unit and won the day. It marked an important point in Canadian history as a nation. The year 2017 marks the centenary of this battle. In commemoration of this event, the Pas-de-Calais Departmental Council financed a 3D recording mission for one of the underground tunnels (souterraines) used as refuge by the Canadian soldiers several weeks prior to the battle. A combination of Terrestrial Laser Scanner (TLS) and close-range photogrammetry techniques was employed in order to document not only the souterraine, but also the various carvings and graffitis created by the soldiers on its walls. The resulting point clouds were registered to the French national geodetic system, and then meshed and textured in order to create a precise 3D model of the souterraine. In this paper, the workflow taken during the project as well as several results will be discussed. In the end, the resulting 3D model was used to create derivative products such as maps, section profiles, and also virtual visit videos. The latter helps the dissemination of the 3D information and thus aids in the preservation of the memory of the Great War for Canada.
International Nuclear Information System (INIS)
Schulte, R.
1996-01-01
Defining notoriety, or the level of public agitation, continues to be a difficult venture. It was like this ten years ago, when construction of the Brokdorf Nuclear Power Station was completed. The controversial decisions in energy policy preceding the start of power operation are almost forgotten, or have been dismissed, by now. In the early eighties, newspaper archives reserved many meters of shelf space to these topics. In late 1982, the press coverage exceeded everybody's imagination. The archive of the HEW utility at that time held some 11,000 press clippings in 30 files, and this collection was far from being complete. After all, Brokdorf was a hot topic not only in Germany. News about Brokdorf was published all over the globe, in Australia, the United States, Argentina, and Alaska. It is hard to unterstand today why Brokdorf had such a catalytic action at that time, causing either complete rejection or raising the question whether a measure of energy policy once approved was to be upheld by politics. Yet, the protests launched at that time still read like instructions to anybody wanting to exploit emotions for purposes of shaping policy. Rarely has there been a similar case in the history of industry of a company polarized, politicized and, in certain phases, even paralyzed like this. This makes the 'Battle of Brokdorf' a fascinating, little known piece of contemporary controversial energy policy. (orig.) [de
Lifescience Database Archive (English)
Full Text Available m Vulgare Molecule: Beta-D-Glucan Glucohydrolase Isoenzyme Exo1; Chain: A; Synonym: Beta-D-Glucan Exohydrola...Beta-D-Glucan Glucohydrolase Structure V. 9 1005 2001 2-Domain Fold GB:AAD23382,4566505|EMBL; AF102868; AAD2
The battle against nasopharyngeal cancer
International Nuclear Information System (INIS)
Lee, Anne W.M.; Ng, W.T.; Chan, Y.H.; Sze, Henry; Chan, Connie; Lam, T.H.
2012-01-01
This is a review of the evolving efforts to understand and combat nasopharyngeal carcinoma (NPC), a most peculiar cancer with a distinctly skewed geographic and ethnic distribution. Multifactorial etiology with dynamic interplay of genetic predisposition, Epstein–Barr virus (EBV) infection and environmental carcinogens is suggested. With changing lifestyle in Hong Kong, the age-standardized incidence rate has decreased by more than 50% during the past 30 years. The advent of megavoltage radiotherapy has transformed this once lethal cancer into one that is readily curable. Advances in technology and addition of chemotherapy have led to gratifying improvements. Overall survival exceeding 75% at 5 years could now be achieved; series using advanced technique with intensity-modulation consistently achieved excellent locoregional control. Studies are on-going to develop more potent systemic therapy for distant control. Serious late toxicities remain a serious concern demanding further improvement in radiotherapy technique and optimization of dose fractionation. Translational researches are increasingly important for the ideal goals of prevention, early detection and more accurate prognostication/prediction to work toward personalized medicine. The battle against NPC is one of the most fascinating successes in oncology, it is highly hopeful that with international collaborations and concerted efforts, we can totally conquer this cancer.
Energy Technology Data Exchange (ETDEWEB)
Anon.
1993-06-15
The Fermilab Main Injector (FMI) project is the centerpiece of the Laboratory's Fermilab III programme for the 1990s. Designed to support a luminosity of at least 5x10{sup 31} cm{sup -2} s{sup -1} in the Tevatron collider, it will also provide new capabilities for rare neutral kaon decay and neutrino oscillation studies. The Fermilab Main Injector 8-150 GeV synchrotron is designed to replace the existing Main Ring which seriously limits beam intensities for the Tevatron and the antiproton production target. The project has passed several significant milestones and is now proceeding rapidly towards construction. The project received a $11.65M appropriation in 1992 and has been given $15M for the current fiscal year. Through the Energy Systems Acquisition Advisory Board (ESAAB) process, the US Department of Energy (DoE) has authorized funds for construction of the underground enclosure and service building where the Main Injector will touch the Tevatron, and to the preparation of bids for remaining project construction.
What could have been done? reflections on the radioactive waste battle as seen from below
International Nuclear Information System (INIS)
Rosenberg, T.
2002-01-01
How best to describe the three-year long battle between Posiva, the company promoting final disposal of spent nuclear fuel, on one hand, and the local resistance, mobilized in a citizen movement, on the other? A battle undoubtedly reminding that of Goliath versus David, i.e., rather uneven what comes to resources, influence and knowledge. Probably one word is enough, and that is 'theater'. This because so much in the whole process, especially concerning the environmental impact assessment (EIA), reminded a dramatic spectacle with everything written in advance: the parts, the complicated and stepwise choreography and, above all, the whole narrative, from the very beginning to the (from the resisters' point of view) bitter end. In my speech, I will try to describe the spectacle as seen from below, especially from the activists' point of view. I will do this by accounting for the strategy adopted by the Lovisa movement, the citizen movement rapidly mobilized against Posiva's deposit plans, as soon as they became public the 4 January 1997. (author)
Directory of Open Access Journals (Sweden)
Victor Pickard
2014-11-01
Full Text Available This contribution is a recording of the CAMRI research seminar held at the University of Westminster on November 19, 2014, in which Victor Pickard presented his book "America’s Battle for Media Democracy: The Triumph of Corporate Libertarianism and the Future of Media Reform": http://www.cambridge.org/gb/academic/subjects/politics-international-relations/american-government-politics-and-policy/americas-battle-media-democracy-triumph-corporate-libertarianism-and-future-media-reform Why do American media have so few public interest regulations? How did the American media system become dominated by a few corporations, and why are structural problems like market failures routinely avoided in media policy discourse? By tracing the answers to many of these questions back to media policy battles in the 1940s, Victor Pickard explains how this happened and why it matters today. Drawing from extensive archival research, the book uncovers the American media system’s historical roots and normative foundations. His book charts the rise and fall of a forgotten media reform movement to recover alternatives and paths not taken. As much about the present and future as it is about the past, the book proposes policies for remaking media based on democratic values for the digital age. Victor Pickard is an assistant professor at the Annenberg School for Communication at the University of Pennsylvania. Previously he taught media studies at NYU and the University of Virginia, and he worked on media policy in Washington, D.C. as a Senior Research Fellow at the media reform organization Free Press, the public policy think tank the New America Foundation, and Congresswoman Diane Watson’s office. He has published numerous journal articles and book chapters on the history and political economy of media institutions and media reform activism. His op-eds on media policy debates and the future of journalism have appeared in news outlets like The Guardian, The Seattle
Techniques used detection and quantification of aflatoxin M1 in milk
Directory of Open Access Journals (Sweden)
Adriana Frizzarin
2012-02-01
Full Text Available Aflatoxin is a group of toxic substances produced by fungi, mainly Aspergillus flavus and Aspergillus parasiticus. It can be developed in agriculture products such as grains or processed food, when environment conditions of humidity and air humidity are favorable. Aflatoxins can be presented as several forms. In Milk, are called M1 and M2, resulting from aflatoxins B1 and B2 metabolism. Aflatoxin M1 (AFM1 is classified as a possible carcinogen to humans, so the occurrence of aflatoxin M1 in milk of lactating cows is a public health issue, and because of its importance several techniques are used for its detection and quantification. These techniques include the physical-chemical as thin layer chromatography and high performance liquid chromatography and the biological techniques including immunoassays such as RIA and ELISA. This review aimed to present the techniques used to quantify aflatoxins M1 and M2 in milk and dairy products.
Pottel, Hans; Hoste, Liesbeth; Delanaye, Pierre
2015-05-01
The chronic kidney disease (CKD) classification system for children is similar to that for adults, with both mainly based on estimated glomerular filtration rate (eGFR) combined with fixed cut-off values. The main cut-off eGFR value used to define CKD is 60 mL/min/1.73 m(2), a value that is also applied for children older than 2 years of age, adolescents and young adults. Based on a literature search, we evaluated inclusion criteria for eGFR in clinical trials or research studies on CKD for children. We also collected information on direct measurements of GFR (mGFR) in children and adolescents, with the aim to estimate the normal reference range for GFR. Using serum creatinine (Scr) normal reference values and Scr-based eGFR-equations, we also evaluated the correspondence between Scr normal reference values and (e)GFR normal reference values. Based on our literature search, the inclusion of children in published CKD studies has been based on cut-off values for eGFR of >60 mL/min/1.73 m(2). The lower reference limits for mGFR far exceed this adult threshold. Using eGFR values calculated using Scr-based formulas, we found that abnormal Scr levels in children already correspond to eGFR values that are below a cut-off of 75 mL/min/1.73 m(2). Abnormal GFR in children, adolescents and young adults starts below 75 mL/min/1.73 m(2), and as abnormality is a sign of disease, we recommend referring children, adolescents and young adults with an (e)GFR of <75 mL/min/1.73 m(2) for further clinical assessment.
Flavonoids with M1 Muscarinic Acetylcholine Receptor Binding Activity
Directory of Open Access Journals (Sweden)
Meyyammai Swaminathan
2014-06-01
Full Text Available Muscarinic acetylcholine receptor-active compounds have potential for the treatment of Alzheimer’s disease. In this study, a series of natural and synthetic flavones and flavonols was assayed in vitro for their ability to inhibit radioligand binding at human cloned M1 muscarinic receptors. Several compounds were found to possess competitive binding affinity (Ki = 40–110 µM, comparable to that of acetylcholine (Ki = 59 µM. Despite the fact that these compounds lack a positively-charged ammonium group under physiological conditions, molecular modelling studies suggested that they bind to the orthosteric site of the receptor, mainly through non-polar interactions.
Chen, Zhengxing; Xu, Yuyu; Nguyen, Truong-Huy D.; Sun, Yizhou; El-Nasr, Magy Seif
2018-01-01
Multiplayer Online Battle Arena (MOBA) games have received increasing worldwide popularity recently. In such games, players compete in teams against each other by controlling selected game avatars, each of which is designed with different strengths and weaknesses. Intuitively, putting together game avatars that complement each other (synergy) and suppress those of opponents (opposition) would result in a stronger team. In-depth understanding of synergy and opposition relationships among game ...
Thermoelectric properties of p-type Ag{sub 1−x}(Pb{sub 1−y}Sn{sub y}){sub m}Sb{sub 1−z}Te{sub m+2}
Energy Technology Data Exchange (ETDEWEB)
Ahn, Kyunghan [Department of Chemistry, Northwestern University, Evanston, IL 60208 (United States); Center for Nanoparticle Research, Institute for Basic Science, (IBS), Seoul 151-742 (Korea, Republic of); Kong, Huijun; Uher, Ctirad [Department of Physics, University of Michigan, Ann Arbor, MI 48109 (United States); Kanatzidis, Mercouri G., E-mail: m-kanatzidis@northwestern.edu [Department of Chemistry, Northwestern University, Evanston, IL 60208 (United States)
2016-10-15
The thermoelectric properties of Ag{sub 1−x}(Pb{sub 1−y}Sn{sub y}){sub m}Sb{sub 1−z}Te{sub m+2} (4≤m≤16, −0.1≤x≤0.3, 1/3≤y≤2/3, 0.2≤z≤0.4; Lead Antimony Silver Tellurium Tin, LASTT-m) compositions were investigated in the temperature range of 300 to ~670 K. All samples crystallize in the average NaCl-type structure without any noticeable second phase and exhibit very narrow bandgaps of <0.1 eV. We studied a range of m values, silver concentrations (x), Pb/Sn ratios (y), and antimony concentrations (z) to determine their effects on the thermoelectric properties. The samples were investigated as melt grown polycrystalline ingots. Varying the Ag contents, the Pb/Sn ratios, and the Sb contents off-stoichiometry allowed us to control the electrical conductivity, the Seebeck coefficient, and the thermal conductivity. The electrical conductivity tends to decrease with decreasing m values. The highest ZT of ~1.1 was achieved at ~660 K for Ag{sub 0.9}Pb{sub 5}Sn{sub 5}Sb{sub 0.8}Te{sub 12} mainly due to the very low lattice thermal conductivity of ~0.4 W/(m K) around 660 K. Also, samples with charge-balanced stoichiometries, Ag(Pb{sub 1−y}Sn{sub y}){sub m}SbTe{sub m+2}, were studied and found to exhibit a lower power factor and higher lattice thermal conductivity than the Ag{sub 1−x}(Pb{sub 1−y}Sn{sub y}){sub m}Sb{sub 1−z}Te{sub m+2} compositions. - Graphical abstract: The Ag{sub 1−x}(Pb{sub 1−y}Sn{sub y}){sub m}Sb{sub 1−z}Te{sub m+2} system defines a complex and flexible class of tunable thermoelectric class of materials with high performance.
Plowes, Nicola J.R; Adams, Eldridge S
2005-01-01
Lanchester's models of attrition describe casualty rates during battles between groups as functions of the numbers of individuals and their fighting abilities. Originally developed to describe human warfare, Lanchester's square law has been hypothesized to apply broadly to social animals as well, with important consequences for their aggressive behaviour and social structure. According to the square law, the fighting ability of a group is proportional to the square of the number of individuals, but rises only linearly with fighting ability of individuals within the group. By analyzing mortality rates of fire ants (Solenopsis invicta) fighting in different numerical ratios, we provide the first quantitative test of Lanchester's model for a non-human animal. Casualty rates of fire ants were not consistent with the square law; instead, group fighting ability was an approximately linear function of group size. This implies that the relative numbers of casualties incurred by two fighting groups are not strongly affected by relative group sizes and that battles do not disproportionately favour group size over individual prowess. PMID:16096093
Shibutani, Shusaku; Okazaki, Hana; Iwata, Hiroyuki
2017-11-03
The mechanistic target of rapamycin complex 1 (mTORC1) is a master regulator of protein synthesis and potential target for modifying cellular metabolism in various conditions, including cancer and aging. mTORC1 activity is tightly regulated by the availability of extracellular amino acids, and previous studies have revealed that amino acids in the extracellular fluid are transported to the lysosomal lumen. There, amino acids induce recruitment of cytoplasmic mTORC1 to the lysosome by the Rag GTPases, followed by mTORC1 activation by the small GTPase Ras homolog enriched in brain (Rheb). However, how the extracellular amino acids reach the lysosomal lumen and activate mTORC1 remains unclear. Here, we show that amino acid uptake by dynamin-dependent endocytosis plays a critical role in mTORC1 activation. We found that mTORC1 is inactivated when endocytosis is inhibited by overexpression of a dominant-negative form of dynamin 2 or by pharmacological inhibition of dynamin or clathrin. Consistently, the recruitment of mTORC1 to the lysosome was suppressed by the dynamin inhibition. The activity and lysosomal recruitment of mTORC1 were rescued by increasing intracellular amino acids via cycloheximide exposure or by Rag overexpression, indicating that amino acid deprivation is the main cause of mTORC1 inactivation via the dynamin inhibition. We further show that endocytosis inhibition does not induce autophagy even though mTORC1 inactivation is known to strongly induce autophagy. These findings open new perspectives for the use of endocytosis inhibitors as potential agents that can effectively inhibit nutrient utilization and shut down the upstream signals that activate mTORC1. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Marcello Garzaniti
2016-04-01
Full Text Available The Narration of the Battle with Mamai (Skazanie o Mamaevom poboišče, dedicated to the famous Russian military victory over the Tatars on the Kulikovo Field (1380, is generally considered the central work of the Kulikovo cycle. The anonymous author develops a consistent reinterpretation of the historical event in a liturgical and commemorative key by constantly adopting forms of prayer and of hagiographic narrative. The analysis of the numerous biblical quotations that weave the plot introduces the deeper meaning of Narration: the final incorporation of the Hellenistic-Christian chronotope in the Slavic "Orthodox Christianity" in which Moscow and "Russian land" have become central.
Guzman, L.; Baeza-Blancas, E.; Reyes, I.; Angulo Brown, F.; Rudolf Navarro, A.
2017-12-01
By studying the magnitude earthquake catalogs, previous studies have reported evidence that some changes in the spatial and temporal organization of earthquake activity is observedbefore and after of a main-shock. These previous studies have used different approach methods for detecting clustering behavior and distance-events density in order topoint out the asymmetric behavior of before shocks and aftershocks. Here, we present a statistical analysis of the seismic activity related to the M8.2 and M7.1 earthquakes occurredon Sept. 7th and Sept. 19th, respectively. First, we calculated the interevent time and distance for the period Sept. 7th 2016 until Oct. 20th 2017 for each seismic region ( a radius of 150 km centeredat coordinates of the M8.1 and M7.1). Next, we calculated the "velocity" of the walker as the ratio between the interevent distance and interevent time, and similarly, we also constructed the"acceleration". A slider pointer is considered to estimate some statistical features within time windows of size τ for the velocity and acceleration sequences before and after the main shocks. Specifically, we applied the fractal dimension method to detect changes in the correlation (persistence) behavior of events in the period before the main events.Our preliminary results pointed out that the fractal dimension associated to the velocity and acceleration sequences exhibits changes in the persistence behavior before the mainshock, while thescaling dimension values after the main events resemble a more uncorrelated behavior. Moreover, the relationship between the standard deviation of the velocity and the local mean velocity valuefor a given time window-size τ is described by an exponent close to 1.5, and the cumulative distribution of velocity and acceleration are well described by power law functions after the crash and stretched-exponential-like distribution before the main shock. On the other hand, we present an analysis of patterns of seismicquiescence
Dynamic models of reduced order of main components of a M SR
International Nuclear Information System (INIS)
Garcia B, F. B.; Morales S, J. B.; Polo L, M. A.; Espinosa P, G.
2011-11-01
The reactors of melted salts called Molten Salt Fast Reactor (MSFR), have seen a resurgence of interest in the last decade. This design is one of the six proposed for the IV generation reactors. The most active development was in the middle of 1950 and principles of 1970 in the Oak Ridge National Laboratories (ORNL). In this work the mathematician modeling of the main components in the primary and secondary circuits of a M SR is presented. In particular the dynamics of the heat exchanger is analyzed and they are considered several materials to optimize the system thermodynamically. (Author)
Battle of the Retail Channels: How Product Selection and Geography Drive Cross-Channel Competition
Erik Brynjolfsson; Yu (Jeffrey) Hu; Mohammad S. Rahman
2009-01-01
A key question for Internet commerce is the nature of competition with traditional brick-and-mortar retailers. Although traditional retailers vastly outsell Internet retailers in most product categories, research on Internet retailing has largely neglected this fundamental dimension of competition. Is cross-channel competition significant, and if so, how and where can Internet retailers win this battle? This paper attempts to answer these questions using a unique combination of data sets. We ...
Searching for Boudica's last battle: an approach via terrain analysis, hydrology and marching camps.
Steve Kaye
2013-01-01
Poster presented at conference, 'On Boudica's Trail', Atherstone Civic Soc. at Warwick University, UK. First, take Tacitus’ description of the battle site - a defile facing an open plain - and as objectively as possible search the terrain of southern Britain for matching sites. Second, compute the river flows across Britain in August; calculate the water requirements for the protagonists; use both to identify rivers capable of supplying sufficient water to the Romans and Britons. Third, c...
Chinese education in the novel by A. Chua Battle hymn of the tiger mother
Magda Wieteska
2017-01-01
Chinese culture and tradition stand in direct opposition to American and European cultures. Chinese children must live according to the principles of metaconfucianism from an early age. Failure to do so threatens social ostracism. Amy Chua in her autobiographical novel Battle Hymn of the Tiger Mother describes the education of her two daughters living in America according to the principles present in China. The educational methods used by Chua are considered controversial by western parent...
Rates of E1, E2, M1, and M2 transitions in Ni II
Cassidy, C. M.; Hibbert, A.; Ramsbottom, C. A.
2016-03-01
Aims: We present rates for all E1, E2, M1, and M2 transitions among the 295 fine-structure levels of the configurations 3d9, 3d84s, 3d74s2, 3d84p, and 3d74s4p, determined through an extensive configuration interaction calculation. Methods: The CIV3 code developed by Hibbert and coworkers is used to determine for these levels configuration interaction wave functions with relativistic effects introduced through the Breit-Pauli approximation. Results: Two different sets of calculations have been undertaken with different 3d and 4d functions to ascertain the effect of such variation. The main body of the text includes a representative selection of data, chosen so that key points can be discussed. Some analysis to assess the accuracy of the present data has been undertaken, including comparison with earlier calculations and the more limited range of experimental determinations. The full set of transition data is given in the supplementary material as it is very extensive. Conclusions: We believe that the present transition data are the best currently available. Full Table 4 and Tables 5-8 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/587/A107
National Research Council Canada - National Science Library
Sanders, Mary; Fitzhugh, Elisabeth
2005-01-01
...) DO 6, Commander's Decision Aids for Predictive Battle-Space Awareness, (CDA4PBA) is to identify system requirements necessary to capture the entire software and systems engineering process from concept...
Properties of M1-M2-Si-Al-O-N glasses (M1 = La or Nd, M2 = Y or Er)
Energy Technology Data Exchange (ETDEWEB)
Pomeroy, M.J.; Nestor, E.; Hampshire, S. [Limerick Univ. (Ireland). Materials and Surface Science Inst.; Ramesh, R. [Littelfuse Ireland, Dundalk, Co. Louth (Ireland)
2002-07-01
Mixed lanthanide cation oxynitride glasses have been prepared in the M1 - M2 - Si-Al-O-N systems where M1 = La or Nd and M2 = Y or Er. The densities ({rho}), Young's moduli (E), microhardnesses (H{sub v}), glass transition temperatures (T{sub g}), dilatometric softening temperatures (T{sub dil}) and coefficients of thermal expansion (CTE) of 13 glasses were determined. The molar volume values (MV) calculated from density data, E, H{sub v}, T{sub g}, T{sub dil} and CTE values were all found to vary linearly with the effective cation field strength arising from the M1 and M2 modifier cations. Least squares intercept and slope values are presented which correlate each property to effective cation field strength together with error values which arise from glass and specimen preparation and measurement inconsistencies. These linear correlations clearly indicate that the overall glass structure remains the same for each of the thirteen glasses with only the modifier cation(s) having any influence. This influence appears to be a cross-linking effect, the strength of which increases as the effective cation field strength of the M1, M2 modifiers increases. (orig.)
2013-08-16
... (group) tactical movement techniques, and to detect, identify, engage, and defeat stationary and moving... of an Infantry Platoon Battle Course at P[omacr]hakuloa Training Area, Hawai`i AGENCY: Department of... Course (IPBC) and associated infrastructure at P[omacr]hakuloa Training Area (PTA), Hawai`i. This...
Wu, Wei; Saunders, Richard C; Mishkin, Mortimer; Turchi, Janita
2012-07-01
Microinfusions of the nonselective muscarinic antagonist scopolamine into perirhinal cortex impairs performance on visual recognition tasks, indicating that muscarinic receptors in this region play a pivotal role in recognition memory. To assess the mnemonic effects of selective blockade in perirhinal cortex of muscarinic receptor subtypes, we locally infused either the m1-selective antagonist pirenzepine or the m2-selective antagonist methoctramine in animals performing one-trial visual recognition, and compared these scores with those following infusions of equivalent volumes of saline. Compared to these control infusions, injections of pirenzepine, but not of methoctramine, significantly impaired recognition accuracy. Further, similar doses of scopolamine and pirenzepine yielded similar deficits, suggesting that the deficits obtained earlier with scopolamine were due mainly, if not exclusively, to blockade of m1 receptors. The present findings indicate that m1 and m2 receptors have functionally dissociable roles, and that the formation of new visual memories is critically dependent on the cholinergic activation of m1 receptors located on perirhinal cells. Published by Elsevier Inc.
2014-09-01
Better Buying Power BCA business case analysis BDA battle damage assessment BII Business Innovation Initiative BSA battle space awareness C&C command...developed and used USVs for purposes such as minesweeping and battle damage assessment ( BDA ) (James 2012). At the same time, the U.S. Navy developed...rint’ Corps mot1Vt1 media by Lat)’"~,: Cpl. Juancnnqw Combat Camera/Released) Monnes and SailorS asstaned 10 1he 261h M:mnc: E~pc.:ditionary Unil
HIV-positive father wins visitation battle in Maryland.
1995-03-24
[Name removed], after a four-year court battle, has been awarded visitation rights with his three daughters. [Name removed] separated from his wife [name removed] in [name removed] 1991 after telling her he was diagnosed with HIV. The custody dispute originally centered around not only [name removed]'s HIV status, but also his homosexuality (he had left his wife for the family friend and godfather to one of the couple's daughter's). Custody judge Audrey E. Melbourne allowed [name removed] to see his daughters at his home, excluding overnight, weekday or holiday visits. [Name removed]'s appeal focused on the medical aspects of HIV transmission in the household. Since Mrs. [Name removed]' expert witness conceded that he knew of no recorded instances of a person transmitting HIV to another person through bathing, cooking or breathing, the judge agreed the risk of transmission was so small as to pose no threat to the children's safety. [Name removed] was awarded visitation on alternating weekends, plus alternating Federal holidays.
Bullet dents – “Proof marks” or battle damage
Directory of Open Access Journals (Sweden)
Williams, Alan
2006-12-01
Full Text Available It is well known that the breastplates of many armours from the later 161">th century and the 171">th century bear the hemispherical dents generally known as proof marks. It has been taken as axiomatic that these marks were made in order to demonstrate the armours’ effectiveness against firearms. If however some of these dents are compared with dents which are the result of battle damage, it appears that they were made by energy levels of a different order of magnitude, and offer little guarantee as to the “proof” of the armour. Como es bien sabido, muchos petos de armaduras de finales del siglo XVI y del XVII tienen abolladuras semiesféricas conocidas como pruebas de arcabuz. Se ha considerado axiomático que estas abolladuras fueron hechas para demostrar la efectividad de las armaduras frente a las armas de fuego. Sin embargo, si se comparan con otras debidas a daños en combate, parece que fueron producidas por energías de diferente orden o magnitud, al tiempo que ofrecen pocas garantías como “pruebas” de las armaduras.
2014-03-27
Access (OFDMA) signal so that jamming effectiveness can be assessed; referred to in this research as Battle Damage Assessment ( BDA ). The research extends...the 802.16 Wireless Metropolitan Area Network (MAN) OFDMA standard, and presents a novel method for performing BDA via observation of Sub Carrier (SC...interferer is also evaluated where the blind demodulator’s performance is degraded. BDA is achieved via observing SC LA modulation behavior of the
Kott, Alexander
2018-01-01
Numerous, artificially intelligent, networked things will populate the battlefield of the future, operating in close collaboration with human warfighters, and fighting as teams in highly adversarial environments. This paper explores the characteristics, capabilities and intelligence required of such a network of intelligent things and humans - Internet of Battle Things (IOBT). It will experience unique challenges that are not yet well addressed by the current generation of AI and machine lear...
Energy Technology Data Exchange (ETDEWEB)
Kuznetsov, A.V.; Gorshkov, I.Yu.; Evsenin, A.V.; Osetrov, O.I.; Vakhtin, D.N. [Applied Science and Technology Center (APSTEC Ltd.), Office 213, Gzhatskaya, 27, Saint-Petersburg 195220 (Russian Federation); Cosentino, A., E-mail: tonycosentino@yahoo.i [CISA3, Center of Interdisciplinary Science for Art, Architecture and Archaeology, University of California, San Diego, 9500 Gilman Dr. La Jolla, CA 92093-0436 (United States); Seracini, M. [CISA3, Center of Interdisciplinary Science for Art, Architecture and Archaeology, University of California, San Diego, 9500 Gilman Dr. La Jolla, CA 92093-0436 (United States)
2009-12-15
Between 1505 and 1506 Leonardo Da Vinci painted his masterpiece, the Battle of Anghiari, in Palazzo Vecchio's Hall of 500 in Florence. The unfinished mural remained visible until 1563, when architect Giorgio Vasari undertook a renovation of the Hall and all traces of the Battle of Anghiari were lost. However, scholarly interpretation and scientific evidence suggest that the mural could be on the eastern wall, hidden behind a brick wall built in 1563 by Vasari. This paper discusses the possibility of using NNA/APT (Nanosecond Neutron Analysis/Associated Particle Technique) to establish the presence of the masterpiece by identifying behind the Vasari's wall chemical elements from the gesso preparation layer of the mural and possibly from its pigments. This paper reports on the experiments run with a simple NNA/APT system and the Monte Carlo simulations that have been carried out in order to outline the experimental setup of an advanced NNA/APT able to detect and locate the tiny amount of gesso and pigments.
Final report on bilateral comparison EURAMET.M.T-S3: Torque wrenches (10 N m - 1 kN m)
Röske, Dirk; Medina, Nieves
2011-01-01
A bilateral comparison from 10 N m up to 1000 N m has been carried out between Physikalisch-Technische Bundesanstalt (PTB) and Centro Español de Metrología (CEM) for reference torque wrenches calibrated according to DKD-R 3-7. The transfer standards have been two reference torque wrenches, 10 N m and 1000 N m respectively, that have been measured between November and December 2010. The results presented here demonstrate the metrological equivalence, within the quoted uncertainties, of both participant laboratories. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by EURAMET, according to the provisions of the CIPM Mutual Recognition Arrangement (MRA).
Winter variability in the western Gulf of Maine: Part 1: Internal tides
Brown, W. S.
2011-09-01
During the winter 1997-1998, a field program was conducted in Wilkinson Basin-western Gulf of Maine-as part of a study of winter convective mixing. The field program consisted of (1) Wilkinson basin-scale hydrographic surveys, (2) a tight three-mooring array with ˜100 m separations measured temperature and conductivity at rates of 2-15 min and (3) a single pair of upward/downward-looking pair acoustic Doppler current profiling (ADCP) instruments measured currents with 8 m vertical resolution over the 270 m water column in north-central Wilkinson basin at a rate of 10 min. The moored array measurements below the mixed layer (˜100 m depth) between 11 January and 6 February 1998 were dominated by a combination of the relatively strong semidiurnal external (depth-independent or barotropic) tide; upon which were superposed a weaker phase-locked semidiurnal internal tide and a very weak water column mean currents of about 1 cm/s southward or approximately across the local isobaths. The harmonic analysis of a vertical average of the relatively uniform ADCP velocities in the well-mixed upper 123 m of the water column, defined the external tidal currents which were dominated by a nearly rectilinear, across-isobath (326°T) M 2 semidiurnal tidal current of about 15 cm/s. The depth-dependent residual current field, which was created by subtracting the external tidal current, consisted of (1) clockwise-rotating semidiurnal internal tidal currents of about 5 cm/s below the mixed layer; (2) clockwise-rotating inertial currents; and (3) a considerably less energetic subtidal current variability. The results from both frequency-domain empirical orthogonal function and tidal harmonic analyses of the of isotherm displacement series at each of the three moorings in the 100 m array mutually confirm an approximate east-northeastward phase propagation of the dominant M 2 semidiurnal internal tide across Wilkinson Basin. Further investigation supports the idea that this winter internal
Main functions and taxonomic distribution of virulence genes in Brucella melitensis 16 M.
Directory of Open Access Journals (Sweden)
Aniel Jessica Leticia Brambila-Tapia
Full Text Available Many virulence genes have been detected in attenuated mutants of Brucella melitensis 16 M; nevertheless, a complete report of these genes, including the main Cluster of Orthologous Groups (COG represented as well as the taxonomical distribution among all complete bacterial and archaeal genomes, has not been analyzed. In this work a total of 160 virulence genes that have been reported in attenuated mutants in B. melitensis were included and analyzed. Additionally, we obtained 250 B. melitensis randomly selected genes as a reference group for the taxonomical comparisons. The COGs and the taxonomical distribution profile for 789 nonredundant bacterial and archaeal genomes were obtained and compared with the whole-genome COG distribution and with the 250 randomly selected genes, respectively. The main COGs associated with virulence genes corresponded to the following: intracellular trafficking, secretion and vesicular transport (U; cell motility (N; nucleotide transport and metabolism (F; transcription (K; and cell wall/membrane/envelope biogenesis (M. In addition, we found that virulence genes presented a higher proportion of orthologs in the Euryarchaeota and Proteobacteria phyla, with a significant decrease in Chlamydiae, Bacteroidetes, Tenericutes, Firmicutes and Thermotogae. In conclusion, we found that genes related to specific functions are more relevant to B. melitensis virulence, with the COG U the most significant. Additionally, the taxonomical distribution of virulence genes highlights the importance of these genes in the related Proteobacteria, being less relevant in distant groups of organisms with the exception of Euryarchaeota.
Patton, Madeline
2015-01-01
Data breach prevention is a battle, rarely plain and never simple. For higher education institutions, the Sisyphean aspects of the task are more complex than for industry and business. Two-year colleges have payrolls and vendor contracts like those enterprises. They also have public record and student confidentiality requirements. Colleges must…
Institute of Scientific and Technical Information of China (English)
刘金林; 曾凡明; 李彦强
2013-01-01
Because of the importance and the emergency of the research on the theory and technology for the repairing of the battle-damaged marine, the framework of the intelligent repair decision support system for the marine was built based on the analysis of the development of the repair decision support technology for the battle-damaged marine both here and abroad and the characteristic of the repairing of the battle-damaged marine. And the database technology, the knowledgebase technology, the geometry information technology, the intelligent decision support technology and other related key technology were studied. Furthermore, the prototype of the battle-damaged marine repair decision support system was developed which could support the repair decision of the battle-damaged marine.%针对开展舰船战损抢修理论和技术研究的紧迫性和重要性,文中在研究国内外战损抢修决策技术发展现状的基础上,根据舰船战损抢修的特点,研究建立了舰船战损抢修决策支持系统总体构架,并分析了系统所涉及的数据库技术、知识库技术、地理信息技术及智能决策技术等关键技术,在此基础上开发了舰船战损抢修决策支持原型系统.
DISCOVERY OF MAIN-BELT COMET P/2006 VW{sub 139} BY Pan-STARRS1
Energy Technology Data Exchange (ETDEWEB)
Hsieh, Henry H.; Yang Bin; Haghighipour, Nader; Kaluna, Heather M.; Denneau, Larry; Jedicke, Robert; Wainscoat, Richard J.; Armstrong, James D.; Micheli, Marco; Keane, Jacqueline V.; Urban, Laurie; Riesen, Timm; Meech, Karen J. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Fitzsimmons, Alan [Astrophysics Research Centre, Queens University Belfast, Belfast BT7 1NN (United Kingdom); Novakovic, Bojan [Department of Astronomy, Faculty of Mathematics, University of Belgrade, Studentski trg 16, 11000 Belgrade (Serbia); Duddy, Samuel R.; Lowry, Stephen C. [Centre for Astrophysics and Planetary Science, The University of Kent, Canterbury CT2 7NH (United Kingdom); Trujillo, Chadwick A. [Gemini Observatory, Northern Operations Center, 670 N. Aohoku Place, Hilo, HI 96720 (United States); Abe, Shinsuke; Cheng, Yu-Chi, E-mail: hsieh@ifa.hawaii.edu [Institute of Astronomy, National Central University, 300 Jhongda Rd, Jhongli 32001, Taiwan (China); and others
2012-03-20
The main-belt asteroid (300163) 2006 VW{sub 139} (later designated P/2006 VW{sub 139}) was discovered to exhibit comet-like activity by the Pan-STARRS1 (PS1) survey telescope using automated point-spread-function analyses performed by PS1's Moving Object Processing System. Deep follow-up observations show both a short ({approx}10'') antisolar dust tail and a longer ({approx}60'') dust trail aligned with the object's orbit plane, similar to the morphology observed for another main-belt comet (MBC), P/2010 R2 (La Sagra), and other well-established comets, implying the action of a long-lived, sublimation-driven emission event. Photometry showing the brightness of the near-nucleus coma remaining constant over {approx}30 days provides further evidence for this object's cometary nature, suggesting it is in fact an MBC, and not a disrupted asteroid. A spectroscopic search for CN emission was unsuccessful, though we find an upper limit CN production rate of Q{sub CN} < 1.3 Multiplication-Sign 10{sup 24} mol s{sup -1}, from which we infer a water production rate of Q{sub H{sub 2O}}<10{sup 26} mol s{sup -1}. We also find an approximately linear optical spectral slope of 7.2%/1000 A, similar to other cometary dust comae. Numerical simulations indicate that P/2006 VW{sub 139} is dynamically stable for >100 Myr, while a search for a potential asteroid family around the object reveals a cluster of 24 asteroids within a cutoff distance of 68 m s{sup -1}. At 70 m s{sup -1}, this cluster merges with the Themis family, suggesting that it could be similar to the Beagle family to which another MBC, 133P/Elst-Pizarro, belongs.
Aiming Airsea Battle: An Operational Concept To Counter China’s Maritime Area Denial Capabilities
2011-06-18
unnamed great power: “To protect Germany’s sea trade and colonies in the existing circumstances there is only one means – Germany must have a battle...with friends and allies, but by ourselves if we must.24 As multiple analysts have noted, the unnamed adversary alluded to here is unmistakably...21 Rory Medcalf, “Chinese Ghost Story,” The Diplomat, February 14, 2008. 22 Ibid. 23 Donn A. Starry, “US and Federal
Arapović, Jurica; Lenac Rovis, Tihana; Reddy, Anil Butchi; Krmpotić, Astrid; Jonjić, Stipan
2009-11-01
Both human and mouse cytomegalovirus (CMV) encode proteins that inhibit the activation of NK cells by down-regulating the cellular ligands for activating NK cell receptor, NKG2D. MCMV proteins m145, m152 and m155 interfere with the expression of all known NKG2D ligands, MULT-1, RAE-1 family members and H60, respectively, whereas m138 affects the expression of MULT-1 and H60. Here we show that m152 affects the maturation of newly synthesized RAE-1 molecules, but is not sufficient to prevent surface expression of RAE-1varepsilon. We have identified m138 as a main inhibitor of the surface expression of RAE-1varepsilon. In contrast to m152, m138 affects the surface-resident protein leading to its endocytosis, which can be prevented by a dynamin inhibitor. Moreover, we demonstrated that m138 does not need other viral proteins to down-modulate the expression of RAE-1varepsilon.
Kassaee, Mohamad Zaman; Ashenagar, Samaneh
2018-02-06
In a quest to identify new ground-state triplet germylenes, the stabilities (singlet-triplet energy differences, ΔE S-T ) of 96 singlet (s) and triplet (t) M 1 -Ge-M 2 -M 3 species were compared and contrasted at the B3LYP/6-311++G**, QCISD(T)/6-311++G**, and CCSD(T)/6-311++G** levels of theory (M 1 = H, Li, Na, K; M 2 = Be, Mg, Ca; M 3 = H, F, Cl, Br). Interestingly, F-substituent triplet germylenes (M 3 = F) appear to be more stable and linear than the corresponding Cl- or Br-substituent triplet germylenes (M 3 = Cl or Br). Triplets with M 1 = K (i.e., the K-Ge-M 2 -M 3 series) seem to be more stable than the corresponding triplets with M 1 = H, Li, or Na. This can be attributed to the higher electropositivity of potassium. Triplet species with M 3 = Cl behave similarly to those with M 3 = Br. Conversely, triplets with M 3 = H show similar stabilities and linearities to those with M 3 = F. Singlet species of formulae K-Ge-Ca-Cl and K-Ge-Ca-Br form unexpected cyclic structures. Finally, the triplet germylenes M 1 -Ge-M 2 -M 3 become more stable as the electropositivities of the α-substituents (M 1 and M 2 ) and the electronegativity of the β-substituent (M 3 ) increase.
The copyright wars three centuries of trans-atlantic battle
Baldwin, Peter
2014-01-01
Today’s copyright wars can seem unprecedented. Sparked by the digital revolution that has made copyright—and its violation—a part of everyday life, fights over intellectual property have pitted creators, Hollywood, and governments against consumers, pirates, Silicon Valley, and open-access advocates. But while the digital generation can be forgiven for thinking the dispute between, for example, the publishing industry and Google is completely new, the copyright wars in fact stretch back three centuries—and their history is essential to understanding today’s battles. The Copyright Wars—the first major trans-Atlantic history of copyright from its origins to today—tells this important story. Peter Baldwin explains why the copyright wars have always been driven by a fundamental tension. Should copyright assure authors and rights holders lasting claims, much like conventional property rights, as in Continental Europe? Or should copyright be primarily concerned with giving consumers cheap and easy ac...
International Nuclear Information System (INIS)
Tacconi, L. J.; Genzel, R.; Wuyts, S.; Förster Schreiber, N. M.; Gracia-Carpio, J.; Lutz, D.; Saintonge, A.; Neri, R.; Cox, P.; Combes, F.; Bolatto, A.; Cooper, M. C.; Bournaud, F.; Burkert, A.; Comerford, J.; Davis, M.; Newman, S.; García-Burillo, S.; Naab, T.; Omont, A.
2013-01-01
We present PHIBSS, the IRAM Plateau de Bure high-z blue sequence CO 3-2 survey of the molecular gas properties in massive, main-sequence star-forming galaxies (SFGs) near the cosmic star formation peak. PHIBSS provides 52 CO detections in two redshift slices at z ∼ 1.2 and 2.2, with log(M * (M ☉ )) ≥ 10.4 and log(SFR(M ☉ /yr)) ≥ 1.5. Including a correction for the incomplete coverage of the M * -SFR plane, and adopting a ''Galactic'' value for the CO-H 2 conversion factor, we infer average gas fractions of ∼0.33 at z ∼ 1.2 and ∼0.47 at z ∼ 2.2. Gas fractions drop with stellar mass, in agreement with cosmological simulations including strong star formation feedback. Most of the z ∼ 1-3 SFGs are rotationally supported turbulent disks. The sizes of CO and UV/optical emission are comparable. The molecular-gas-star-formation relation for the z = 1-3 SFGs is near-linear, with a ∼0.7 Gyr gas depletion timescale; changes in depletion time are only a secondary effect. Since this timescale is much less than the Hubble time in all SFGs between z ∼ 0 and 2, fresh gas must be supplied with a fairly high duty cycle over several billion years. At given z and M * , gas fractions correlate strongly with the specific star formation rate (sSFR). The variation of sSFR between z ∼ 0 and 3 is mainly controlled by the fraction of baryonic mass that resides in cold gas.
Evaluation of Modern Navies’ Damage Control and Firefighting Training using Simulator Platforms
2011-09-01
RESPONSES The inspiration for the following analysis is Zaharee’s, (2003) Training Program Review: Theater Battle Management Core Systems ( TBMCS ...rep1&ty pe=pdf. Zaharee, M. E. (2003). Training Program Review: Theater Battle Management Core Systems ( TBMCS ) Training Program Evaluation. Andover
The MCNP Simulation of a PGNAA System at TRR-1/M1
Sangaroon, S.; Ratanatongchai, W.; Picha, R.; Khaweerat, S.; Channuie, J.
2017-06-01
The prompt-gamma neutron activation analysis system (PGNAA) has been installed at Thai Research Reactor-1/Modified 1 (TRR-1/M1) since 1999. The purpose of the system is for elemental and isotopic analyses. The system mainly consists of a series of the moderator and collimator, neutron and gamma-ray shielding and the HPGe detector. In this work, the condition of the system is carried out based on the Monte Carlo method using Monte Carlo N-Particle transport code and the experiment. The flux ratios (Φthermal/Φepithermal and Φthermal/Φfast) and thermal neutron flux have been obtained. The simulated prompt gamma rays of the Portland cement sample have been carried out. The simulation provides significant contribution in upgrading the PGNAA station to be available in various applications.
Lee, Bomee; Giavalisco, Mauro; Whitaker, Katherine; Williams, Christina C.; Ferguson, Henry C.; Acquaviva, Viviana; Koekemoer, Anton M.; Straughn, Amber N.; Guo, Yicheng; Kartaltepe, Jeyhan S.; Lotz, Jennifer; Pacifici, Camilla; Croton, Darren J.; Somerville, Rachel S.; Lu, Yu
2018-02-01
We use the deep CANDELS observations in the GOODS North and South fields to revisit the correlations between stellar mass (M *), star formation rate (SFR) and morphology, and to introduce a fourth dimension, the mass-weighted stellar age, in galaxies at 1.2history for each galaxy. Like others, we find that the slope of the main sequence (MS) of star formation in the ({M}* ;{SFR}) plane bends at high mass. We observe clear morphological differences among galaxies across the MS, which also correlate with stellar age. At all redshifts, galaxies that are quenching or quenched, and thus old, have high {{{Σ }}}1 (the projected density within the central 1 kpc), while younger, star-forming galaxies span a much broader range of {{{Σ }}}1, which includes the high values observed for quenched galaxies, but also extends to much lower values. As galaxies age and quench, the stellar age and the dispersion of {{{Σ }}}1 for fixed values of M * shows two different regimes: one at the low-mass end, where quenching might be driven by causes external to the galaxies; the other at the high-mass end, where quenching is driven by internal causes, very likely the mass given the low scatter of {{{Σ }}}1 (mass quenching). We suggest that the monotonic increase of central density as galaxies grow is one manifestation of a more general phenomenon of structural transformation that galaxies undergo as they evolve.
Rac1 Regulates the Activity of mTORC1 and mTORC2 and Controls Cellular Size
Saci, Abdelhafid; Cantley, Lewis C.; Carpenter, Christopher L.
2013-01-01
SUMMARY Mammalian target of rapamycin (mTOR) is a serine/threonine kinase that exists in two separate complexes, mTORC1 and mTORC2, that function to control cell size and growth in response to growth factors, nutrients, and cellular energy levels. Low molecular weight GTP-binding proteins of the Rheb and Rag families are key regulators of the mTORC1 complex, but regulation of mTORC2 is poorly understood. Here, we report that Rac1, a member of the Rho family of GTPases, is a critical regulator of both mTORC1 and mTORC2 in response to growth-factor stimulation. Deletion of Rac1 in primary cells using an inducible-Cre/Lox approach inhibits basal and growth-factor activation of both mTORC1 and mTORC2. Rac1 appears to bind directly to mTOR and to mediate mTORC1 and mTORC2 localization at specific membranes. Binding of Rac1 to mTOR does not depend on the GTP-bound state of Rac1, but on the integrity of its C-terminal domain. This function of Rac1 provides a means to regulate mTORC1 and mTORC2 simultaneously. PMID:21474067
The Battle for Iron between Humans and Microbes.
Carver, Peggy L
2018-01-01
Iron is an essential micronutrient for bacteria, fungi, and humans; as such, each has evolved specialized iron uptake systems to acquire iron from the extracellular environment. To describe complex 'tug of war' for iron that has evolved between human hosts and pathogenic microorganisms in the battle for this vital nutrient. A review of current literature was performed, to assess current approaches and controversies in iron therapy and chelation in humans. In humans, sequestration (hiding) of iron from invading pathogens is often successful; however, many pathogens have evolved mechanisms to circumvent this approach. Clinically, controversy continues whether iron overload or administration of iron results in an increased risk of infection. The administration of iron chelating agents and siderophore- conjugate drugs to infected hosts seems a biologically plausible approach as adjunctive therapy in the treatment of infections caused by pathogens dependent on host iron supply (e.g. tuberculosis, malaria, and many bacterial and fungal pathogens); however, thus far, studies in humans have proved unsuccessful. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
International Nuclear Information System (INIS)
Maeder, A.
1975-01-01
For a star of 1.5 M(S) with an initial composition given by X=0.70 and Z=0.03, three sets of evolutionary models are computed with different assumptions on the non-local effects characterizing the turbulent motions in the convective core. Some overshooting from the convective core may occur during Main-sequence evolution. The changes in the stellar structure, lifetimes and evolutionary tracks brought about by this process are studied. Some characteristics of the evolutionary tracks in the theoretical HR diagram have a very high sensitivity to the exact extent of the convective core, and this may provide powerful tests of events occurring in the deep stellar interior. (orig./BJ) [de
Kumar, Santosh; Bose, Debojit; Suryawanshi, Hemant; Sabharwal, Harshana; Mapa, Koyeli; Maiti, Souvik
2011-01-01
Rev is an essential HIV-1 regulatory protein which binds to the Rev responsive element (RRE) present within the env gene of HIV-1 RNA genome. This binding facilitates the transport of the RNA to the cytoplasm, which in turn triggers the switch between viral latency and active viral replication. Essential components of this complex have been localized to a minimal arginine rich Rev peptide and stem IIB region of RRE. A synthetic peptide known as RSG-1.2 binds with high binding affinity and specificity to the RRE-IIB than the Rev peptide, however the thermodynamic basis of this specificity has not yet been addressed. The present study aims to probe the thermodynamic origin of this specificity of RSG-1.2 over Rev Peptide for RRE-IIB. The temperature dependent melting studies show that RSG-1.2 binding stabilizes the RRE structure significantly (ΔT(m) = 4.3°C), in contrast to Rev binding. Interestingly the thermodynamic signatures of the binding have also been found to be different for both the peptides. At pH 7.5, RSG-1.2 binds RRE-IIB with a K(a) = 16.2±0.6×10(7) M(-1) where enthalpic change ΔH = -13.9±0.1 kcal/mol is the main driving force with limited unfavorable contribution from entropic change TΔS = -2.8±0.1 kcal/mol. A large part of ΔH may be due to specific stacking between U72 and Arg15. In contrast binding of Rev (K(a) = 3.1±0.4×10(7) M(-1)) is driven mainly by entropy (ΔH = 0 kcal/mol and TΔS = 10.2±0.2 kcal/mol) which arises from major conformational changes in the RNA upon binding.
Galectin-1 Is an Interactive Protein of Selenoprotein M in the Brain
Directory of Open Access Journals (Sweden)
Qiong Liu
2013-11-01
Full Text Available Selenium, an essential trace element for human health, mainly exerts its biological function through selenoproteins. Selenoprotein M (SelM is one of the highly expressed selenoproteins in the brain, but its biological effect and molecular mechanism remain unclear. Thus, the interactive protein of SelM was investigated in this paper to guide further study. In order to avoid protein translational stop, the selenocysteine-encoding UGA inside the open reading frame of SelM was site-directly changed to the cysteine-encoding UGC to generate the SelM' mutant. Meanwhile, its N terminal transmembrane signal peptide was also cut off. This truncated SelM' was used to screen a human fetal brain cDNA library by the yeast two-hybrid system. A new interactive protein of SelM' was found to be galectin-1 (Gal-1. This protein-protein interaction was further verified by the results of fluorescence resonance energy transfer techniques, glutathione S-transferase pull-down and co-immunoprecipitation assays. As Gal-1 plays important roles in preventing neurodegeneration and promoting neuroprotection in the brain, the interaction between SelM' and Gal-1 displays a new direction for studying the biological function of SelM in the human brain.
Chinese education in the novel by A. Chua Battle hymn of the tiger mother
Directory of Open Access Journals (Sweden)
Magda Wieteska
2017-07-01
Full Text Available Chinese culture and tradition stand in direct opposition to American and European cultures. Chinese children must live according to the principles of metaconfucianism from an early age. Failure to do so threatens social ostracism. Amy Chua in her autobiographical novel Battle Hymn of the Tiger Mother describes the education of her two daughters living in America according to the principles present in China. The educational methods used by Chua are considered controversial by western parents. The author made an attempt to explain the motives of Asian mothers.
Plowes, Nicola J.R; Adams, Eldridge S
2005-01-01
Lanchester's models of attrition describe casualty rates during battles between groups as functions of the numbers of individuals and their fighting abilities. Originally developed to describe human warfare, Lanchester's square law has been hypothesized to apply broadly to social animals as well, with important consequences for their aggressive behaviour and social structure. According to the square law, the fighting ability of a group is proportional to the square of the number of individual...
Lifescience Database Archive (English)
Full Text Available 85c Name=Dl3285c; Synonyms=At4g14490, At4g14490; Arabidopsis Thaliana Molecule: Expressed Protein; Chain: A;... Fragment: Forkhead Associated Domain, Fha Domain; Synonym: Hypothetical Protein; Engineered: Yes Structural..., T.Terada, T.Yabuki, M.Aoki, T.Matsuda, E.Seki, H.Hirota, M.Yoshida, A.Tanaka, T.Osanai, K.Shinozaki, M.Sek....Matsuda, E.Seki, H.Hirota, M.Yoshida, A.Tanaka, T.Osanai, K.Shinozaki, M.Seki, T....Kigawa, S.Yokoyama Solution Structure Of The Fha Domain Of Arabidopsis Thaliana Hypothetical Protein To Be Published Fha Domai
MNK Controls mTORC1:Substrate Association through Regulation of TELO2 Binding with mTORC1
Directory of Open Access Journals (Sweden)
Michael C. Brown
2017-02-01
Full Text Available The mechanistic target of rapamycin (mTOR integrates numerous stimuli and coordinates the adaptive response of many cellular processes. To accomplish this, mTOR associates with distinct co-factors that determine its signaling output. While many of these co-factors are known, in many cases their function and regulation remain opaque. The MAPK-interacting kinase (MNK contributes to rapamycin resistance in cancer cells. Here, we demonstrate that MNK sustains mTORC1 activity following rapamycin treatment and contributes to mTORC1 signaling following T cell activation and growth stimuli in cancer cells. We determine that MNK engages with mTORC1, promotes mTORC1 association with the phosphatidyl inositol 3′ kinase-related kinase (PIKK stabilizer, TELO2, and facilitates mTORC1:substrate binding. Moreover, our data suggest that DEPTOR, the endogenous inhibitor of mTOR, opposes mTORC1:substrate association by preventing TELO2:mTORC1 binding. Thus, MNK orchestrates counterbalancing forces that regulate mTORC1 enzymatic activity.
2010-01-01
... the greatest American battle of the war and will, I believe, be regarded as an ever-famous American... represent the best of our Nation and we are eternally grateful for their service and sacrifice. NOW... set my hand this fifteenth day of December, in the year of our Lord two thousand nine, and of the...
Enhanced M1/M2 macrophage ratio promotes orthodontic root resorption.
He, D; Kou, X; Luo, Q; Yang, R; Liu, D; Wang, X; Song, Y; Cao, H; Zeng, M; Gan, Y; Zhou, Y
2015-01-01
Mechanical force-induced orthodontic root resorption is a major clinical challenge in orthodontic treatment. Macrophages play an important role in orthodontic root resorption, but the underlying mechanism remains unclear. In this study, we examined the mechanism by which the ratio of M1 to M2 macrophage polarization affects root resorption during orthodontic tooth movement. Root resorption occurred when nickel-titanium coil springs were applied on the upper first molars of rats for 3 to 14 d. Positively stained odontoclasts or osteoclasts with tartrate-resistant acid phosphatase were found in resorption areas. Meanwhile, M1-like macrophages positive for CD68 and inducible nitric oxide synthase (iNOS) persistently accumulated on the compression side of periodontal tissues. In addition, the expressions of the M1 activator interferon-γ and the M1-associated pro-inflammatory cytokine tumor necrosis factor (TNF)-α were upregulated on the compression side of periodontal tissues. When the coil springs were removed at the 14th day after orthodontic force application, root resorption was partially rescued. The number of CD68(+)CD163(+) M2-like macrophages gradually increased on the compression side of periodontal tissues. The levels of M2 activator interleukin (IL)-4 and the M2-associated anti-inflammatory cytokine IL-10 also increased. Systemic injection of the TNF-α inhibitor etanercept or IL-4 attenuated the severity of root resorption and decreased the ratio of M1 to M2 macrophages. These data imply that the balance between M1 and M2 macrophages affects orthodontic root resorption. Root resorption was aggravated by an enhanced M1/M2 ratio but was partially rescued by a reduced M1/M2 ratio. © International & American Associations for Dental Research 2014.
Birinci Dünya Savaşı’nda Gazze Muharebeleri / The Battles of Gaza in World War I
Directory of Open Access Journals (Sweden)
Sami Ağaoğlu
2017-04-01
Full Text Available Abstract According to Germany’s demand, Ottoman Empire opened Canal Front which is one of the most important front lines of WWI to pass the Suez Canal and attack Egypt. There were two massive attacks between Ottoman and British. The first clash occured in 1915 and second took place in 1916. Result of Ottoman forces struggle with the British troops, Ottoman Empire were defeated but then Ottoman Empire counter attacked. They tried to prevent British attacks in the campaigns of Sinai and Palestine. The paper deals with the First and the Second Battle of Gaza that repelled English forces, the third Gaza Battle and its result, Yildirim Army Group (or Thunderbolt Army Group of the Ottoman Empire that was formed in order to prevent advance of attackers and siege and fall of Jerusalem. Therefore, subsequent failures of the campaign and retreating to the Anatolia started. The research paper was based on archival documents, primary&secondary sources and memoirs. Öz Osmanlı Devleti, Birinci Dünya Savaşı’nın önemli cephelerinden olan Kanal cephesini Almanların isteği doğrultusunda Süveyş kanalının geçmek ve Mısır’a taarruz etmek amacıyla açmıştı. Osmanlı Ordusunun I. Kanal Seferi ve II. Kanal Seferi başarısız olunca, karşı saldırıya geçen İngiliz birlikleri Sina ve Filistin cephesinde, Gazze muharebeleri ile durdurulmaya çalışılmıştır. Araştırmamızda, İngiliz birliklerinin püskürtüldüğü I. ve II. Gazze muharebeleri, Birüssebi ve Gazze’nin elden çıktığı III. Gazze muharebesi, Osmanlı Devleti’nin bu yenilgiyi durdurabilmek için kurduğu Yıldırım Orduları Gurup Komutanlığı ve Kudüs’ün elden çıkışı ele alınmıştır. Böylelikle birbiri ardına gelen yenilgiler zinciri ile Osmanlı Ordularının Anadolu’ya çekilişi arşiv belgeleri, birinci elden kaynaklar ve hatıratlardan yararlanılarak işlenmiştir.
CYP1A1 m1 and m2 polymorphisms: genetic susceptibility to lung cancer
Directory of Open Access Journals (Sweden)
Paula Mota
2010-01-01
Full Text Available Lung cancer is considered an environment-related disease that develops as a consequence of exposure to mutagenic agents, namely those present in tobacco. The CYP1A1 gene codifies the phase I enzyme aryl hydrocarbon hydroxilase (AHH belonging to the cytochrome P450 system that plays a major role in the bio-activation of tobacco procarcinogenes. Two CYP1A1 polymorphisms, m1 (T6235C transition and m2 (A4889G transition, are associated with greater enzymatic activity and have been described as genetic susceptibility factors for lung cancer.The aim of this study was to verify if this association holds true in blood samples of 175 lung cancer patients and 217 non-cancer patients from Portugal's midlands region. The samples were studied by restriction fragment length polymorphism (RFLP assay.The allelic frequencies of the mutant alleles were 0.12 for allele C and 1.14 for allele G in the control population. The results were not statistically different from those alleles in the patient population. There was also no statistically significant difference in genotype distribution in lung cancer patients and controls even when combining high risk genotypes. In our control sample, as in other populations of different ethnic origin, both polymorphisms also seem to be in linkage disequilibrium. We conclude that in this sample of the Portuguese population, CYP1A1 m1 and m2 polymorphisms are too rare to be of clinical relevance, and do not seem to be associated with susceptibility to lung cancer. Resumo: O cancro do pulmão é considerado uma doença relacionada com o meio ambiente, consequência da exposição a agentes mutagénicos, nomeadamente os presentes no fumo do tabaco. O gene CYP1A1 codifica a enzima aril hidrocarboneto hidroxilase (AHH, da fase I, do sistema multienzimático do citocromo P450, que desempenha uma função preponderante na bioactivação dos procarcinogénios do tabaco. Dois polimorfismos do CYP1A1, m1 (transi
Influenza A Virus NS1 Protein Promotes Efficient Nuclear Export of Unspliced Viral M1 mRNA.
Pereira, Carina F; Read, Eliot K C; Wise, Helen M; Amorim, Maria J; Digard, Paul
2017-08-01
Influenza A virus mRNAs are transcribed by the viral RNA-dependent RNA polymerase in the cell nucleus before being exported to the cytoplasm for translation. Segment 7 produces two major transcripts: an unspliced mRNA that encodes the M1 matrix protein and a spliced transcript that encodes the M2 ion channel. Export of both mRNAs is dependent on the cellular NXF1/TAP pathway, but it is unclear how they are recruited to the export machinery or how the intron-containing but unspliced M1 mRNA bypasses the normal quality-control checkpoints. Using fluorescent in situ hybridization to monitor segment 7 mRNA localization, we found that cytoplasmic accumulation of unspliced M1 mRNA was inefficient in the absence of NS1, both in the context of segment 7 RNPs reconstituted by plasmid transfection and in mutant virus-infected cells. This effect was independent of any major effect on steady-state levels of segment 7 mRNA or splicing but corresponded to a ∼5-fold reduction in the accumulation of M1. A similar defect in intronless hemagglutinin (HA) mRNA nuclear export was seen with an NS1 mutant virus. Efficient export of M1 mRNA required both an intact NS1 RNA-binding domain and effector domain. Furthermore, while wild-type NS1 interacted with cellular NXF1 and also increased the interaction of segment 7 mRNA with NXF1, mutant NS1 polypeptides unable to promote mRNA export did neither. Thus, we propose that NS1 facilitates late viral gene expression by acting as an adaptor between viral mRNAs and the cellular nuclear export machinery to promote their nuclear export. IMPORTANCE Influenza A virus is a major pathogen of a wide variety of mammalian and avian species that threatens public health and food security. A fuller understanding of the virus life cycle is important to aid control strategies. The virus has a small genome that encodes relatively few proteins that are often multifunctional. Here, we characterize a new function for the NS1 protein, showing that, as well as
Will the Communist Party of China Be Able to Win the Anticorruption Battle?
Directory of Open Access Journals (Sweden)
Jinghao Zhou
2016-12-01
Full Text Available Since the Eighteenth National Congress of the Communist Party of China (CPC in 2012, the CPC has made great efforts to implement Xi Jinping's blueprint for achieving the “China Dream”. The on-going anticorruption campaign is part of the road map towards the “China Dream”. There has been impressive progress in fighting corruption, but the CPC recognizes that the anticorruption campaign faces a huge challenge and is at a crucial stage. The anticorruption campaign is a life-and-death battle that the CPC cannot afford to lose. The critical question is: How can the CPC win the battle in the current Chinese political system? The intention of this paper is not to offer specific measures, but to discuss policy implications by elucidating why some existing anticorruption measures do not work through examining the relationship between corruption and Chinese market economy and the political system. The basic assumption of this paper is that corruption is universal, but the characteristics of China’s corruption are different from other nations due to the nature of the Chinese economic, political and cultural systems. The key to anticorruption is to find and deal with the real causes of China’s corruption in order to make effective anticorruption measures. There are two opposite perspectives concerning the causes of corruption: While one suggests that the primary source of corruption is the political system, the other contends that corruption has nothing to do with the socialist political system. This paper attempts to argue that either denying or overemphasizing the roles of the current political system in spreading corruption is one-sided.
Occurrence of B1 Aflatoxin in diet and M1 Aflatoxin in bovine milk
Directory of Open Access Journals (Sweden)
Adriana Frizzarin
2012-12-01
Full Text Available Ensuring food quality is one of the principles of food safety. Food for dairy cattle may be contaminated by fungi of the genus Aspergillus, which produce aflatoxins. The B1 aflatoxin, when ingested by animals, is biotransformed in liver in several other toxic metabolites, including M1 aflatoxin which is excreted in milk. M1 aflatoxin has a carcinogenic effect, which the presence in milk poses a serious risk to public health because milk and dairy products are consumed mainly by children, pregnant women and elderly. The objective of this study was to detect the presence of B1 aflatoxin in feed supplied to dairy cows and the presence of M1 aflatoxin in milk. Samples were collected from complete diet (corn silage and concentrate from a batch of 15 lactating cows from a dairy farm in the Campinas region. Two samples of diets were collected directly into the troughs in intervals of 24 hours at every 15 days, totalizing a period of 45 days. Milk samples of those cows were collected 24 hours after diet collection, directly from sample valves in the glass jars.. B1 and M1 aflatoxins were detected by the technique of High Performance Liquid Chromatography after extraction and purification on immunoaffinity columns. From the 40 samples of diets evaluated, 40% were contaminated with B1 aflatoxin, and the levels found ranged from 1.93 to 43.78μg/Kg. One sample showed result higher than the maximum recommended for grain and animal feed in Brazil (20μg/Kg. From the 75 milk samples analyzed, the presence of M1 aflatoxin was detected in 13.3% with levels ranging from 0.03 to 0.16μg/L, not exceeding the maximum permitted for marketing in the country of 0.5μg/L, however 80% of contaminated samples had values above the maximum permissible levels of 0.05μg/L, value found among countries with abundant milk production... The presence of aflatoxins highlights the importance of monitoring the production, the storage and the importance of handling food and
Dale, Matthew A; Xiong, Wanfen; Carson, Jeffrey S; Suh, Melissa K; Karpisek, Andrew D.; Meisinger, Trevor M.; Casale, George P.; Baxter, B. Timothy
2016-01-01
Abdominal aortic aneurysm (AAA) is a dynamic vascular disease characterized by inflammatory cell invasion and extracellular matrix (ECM) degradation. Damage to elastin in the ECM results in release of elastin-derived peptides (EDPs), which are chemotactic for inflammatory cells such as monocytes. Their effect on macrophage polarization is less well known. Pro-inflammatory M1 macrophages initially are recruited to sites of injury but, if their effects are prolonged, they can lead to chronic inflammation that prevents normal tissue repair. Conversely, anti-inflammatory M2 macrophages reduce inflammation and aid in wound healing. Thus, a proper M1/M2 ratio is vital for tissue homeostasis. AAA tissue reveals a high M1/M2 ratio where pro-inflammatory cells and their associated markers dominate. In the present study, in vitro treatment of bone marrow-derived macrophages with EDPs induced M1 macrophage polarization. By using C57Bl/6 mice, antibody-mediated neutralization of EDPs reduced aortic dilation, matrix metalloproteinase activity, and pro-inflammatory cytokine expression at early and late time points after aneurysm induction. Furthermore, direct manipulation of the M1/M2 balance altered aortic dilation. Injection of M2 polarized macrophages reduced aortic dilation after aneurysm induction. EDPs promoted a pro-inflammatory environment in aortic tissue by inducing M1 polarization and neutralization of EDPs attenuated aortic dilation. The M1/M2 imbalance is vital to aneurysm formation. PMID:27183603
The Texas A&M Radioisotope Production and Radiochemistry Program
International Nuclear Information System (INIS)
Akabani, Gamal
2016-01-01
The main motivation of the project at Texas A&M University was to carry out the production of critically needed radioisotopes used in medicine for diagnostics and therapy, and to establish an academic program in radionuclide production and separation methods. After a lengthy battle with the Texas A&M University Radiation Safety Office, the Texas Department of State Health Services granted us a license for the production of radionuclides in July 2015, allowing us to work in earnest in our project objectives. Experiments began immediately after licensing, and we started the assembly and testing of our target systems. There were four analytical/theoretical projects and two experimental target systems. These were for At-211 production and for Zn-62/Cu-62 production. The theoretical projects were related to the production of Mo-99/Tc-99m using a) a subcritical aqueous target system and b) production of Tc-99m from accelerator-generated Mo-99 utilizing a photon-neutron interaction with enriched Mo-100 targets. The two experimental projects were the development of targetry systems and production of At-211 and Zn-62/Cu-62 generator. The targetry system for At-211 has been tested and production of At-211 is chronic depending of availability of beam time at the cyclotron. The installation and testing of the targetry system for the production of Zn-62/Cu-62 has not been finalized. A description of the systems is described. The academic program in radionuclide production and separation methods was initiated in the fall of 2011 and, due to the lack of a radiochemistry laboratory, it was suspended. We expect to re-start the academic program at the Texas A&M Institute for Preclinical Studies under the Molecular Imaging Program.
The Texas A&M Radioisotope Production and Radiochemistry Program
Energy Technology Data Exchange (ETDEWEB)
Akabani, Gamal [Texas A & M Univ., College Station, TX (United States)
2016-08-31
The main motivation of the project at Texas A&M University was to carry out the production of critically needed radioisotopes used in medicine for diagnostic and therapy, and to establish an academic program in radionuclide production and separation methods. After a lengthy battle with the Texas A&M University Radiation Safety Office, the Texas Department of State Health Services granted us a license for the production of radionuclides in July 2015, allowing us to work in earnest in our project objectives. Experiments began immediately after licensing, and we started the assembly and testing of our target systems. There were four analytical/theoretical projects and two experimental target systems. These were for At-211 production and for Zn- 62/Cu-62 production. The theoretical projects were related to the production of Mo-99/Tc-99m using (a) a subcritical aqueous target system and (b) production of Tc-99m from accelerator-generated Mo-99 utilizing a photon-neutron interaction with enriched Mo-100 targets. The two experimental projects were the development of targetry systems and production of At-211 and Zn-62/Cu-62 generator. The targetry system for At-211 has been tested and production of At-211 is chronic depending of availability of beam time at the cyclotron. The installation and testing of the targetry system for the production of Zn-62/Cu-62 has not been finalized. A description of the systems is described. The academic program in radionuclide production and separation methods was initiated in the fall of 2011; due to the lack of a radiochemistry laboratory, it was suspended. We expect to re-start the academic program at the Texas A&M Institute for Preclinical Studies under the Molecular Imaging Program.
The Texas A&M Radioisotope Production and Radiochemistry Program
International Nuclear Information System (INIS)
Akabani, Gamal
2016-01-01
The main motivation of the project at Texas A&M University was to carry out the production of critically needed radioisotopes used in medicine for diagnostic and therapy, and to establish an academic program in radionuclide production and separation methods. After a lengthy battle with the Texas A&M University Radiation Safety Office, the Texas Department of State Health Services granted us a license for the production of radionuclides in July 2015, allowing us to work in earnest in our project objectives. Experiments began immediately after licensing, and we started the assembly and testing of our target systems. There were four analytical/theoretical projects and two experimental target systems. These were for At-211 production and for Zn- 62/Cu-62 production. The theoretical projects were related to the production of Mo-99/Tc-99m using (a) a subcritical aqueous target system and (b) production of Tc-99m from accelerator-generated Mo-99 utilizing a photon-neutron interaction with enriched Mo-100 targets. The two experimental projects were the development of targetry systems and production of At-211 and Zn-62/Cu-62 generator. The targetry system for At-211 has been tested and production of At-211 is chronic depending of availability of beam time at the cyclotron. The installation and testing of the targetry system for the production of Zn-62/Cu-62 has not been finalized. A description of the systems is described. The academic program in radionuclide production and separation methods was initiated in the fall of 2011; due to the lack of a radiochemistry laboratory, it was suspended. We expect to re-start the academic program at the Texas A&M Institute for Preclinical Studies under the Molecular Imaging Program.
The Texas A&M Radioisotope Production and Radiochemistry Program
Energy Technology Data Exchange (ETDEWEB)
Akabani, Gamal [Texas A & M Univ., College Station, TX (United States). Dept. of Nuclear Engineering. Dept. of Veterinary Integrative Biosciences
2016-10-28
The main motivation of the project at Texas A&M University was to carry out the production of critically needed radioisotopes used in medicine for diagnostics and therapy, and to establish an academic program in radionuclide production and separation methods. After a lengthy battle with the Texas A&M University Radiation Safety Office, the Texas Department of State Health Services granted us a license for the production of radionuclides in July 2015, allowing us to work in earnest in our project objectives. Experiments began immediately after licensing, and we started the assembly and testing of our target systems. There were four analytical/theoretical projects and two experimental target systems. These were for At-211 production and for Zn-62/Cu-62 production. The theoretical projects were related to the production of Mo-99/Tc-99m using a) a subcritical aqueous target system and b) production of Tc-99m from accelerator-generated Mo-99 utilizing a photon-neutron interaction with enriched Mo-100 targets. The two experimental projects were the development of targetry systems and production of At-211 and Zn-62/Cu-62 generator. The targetry system for At-211 has been tested and production of At-211 is chronic depending of availability of beam time at the cyclotron. The installation and testing of the targetry system for the production of Zn-62/Cu-62 has not been finalized. A description of the systems is described. The academic program in radionuclide production and separation methods was initiated in the fall of 2011 and, due to the lack of a radiochemistry laboratory, it was suspended. We expect to re-start the academic program at the Texas A&M Institute for Preclinical Studies under the Molecular Imaging Program.
Yang, Xiaodong; Xu, Shaoqing; Qian, Yiwei; Xiao, Qin
2017-08-01
Microglia are the primary cells that exert immune function in the central nervous system (CNS), and accumulating evidence suggests that microglia act as key players in the initiation of neurodegenerative diseases. It is now well recognized that microglia have functional plasticity and dual phenotypes, proinflammatory M1 and anti-inflammatory M2 phenotypes. Inhibiting the M1 phenotype while stimulating the M2 phenotype has been suggested as a potential therapeutic approach for the treatment of neuroinflammation-related diseases. Resveratrol has been demonstrated to exert anti-inflammatory effects by suppressing M1 microglia activation. However, the role of resveratrol in regulating microglia polarization and the molecular mechanisms involved have not been fully clarified. In this study, we tested whether resveratrol could suppress microglia activation by promoting microglia polarization toward the M2 phenotype via PGC-1α by measuring M1 and M2 markers in vitro and in vivo. Our study demonstrated that resveratrol reduced inflammatory damage and promoted microglia polarization to the M2 phenotype in LPS-induced neuroinflammation. In addition, resveratrol ameliorated LPS-induced sickness behavior in mice. The promoting effects of resveratrol on M2 polarization were attenuated by knocking down PGC-1α. PGC-1α not only suppressed LPS-evoked M1 marker expression by inhibition of NF-κB activity but also increased M2 marker expression by coactivation of the STAT6 and STAT3 pathways. We propose that overexpression PGC-1α by resveratrol could be a potential therapeutic approach to suppress neuroinflammation by regulating microglia polarization. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Bussac, M.N.; Pellat, R.; Edery, D.; Soule, J.L.
1976-01-01
A linear analysis is presented of the toroidal coupling between the internal resistive modes (m=1, n=1) and (m=2, n=1) in the Tokomak with circular cross sections. One includes the resistive and diamagnetic effects in the singular layers where the safety factor q takes respectively the values one and two. By expanding the MHD equations in powers of epsilon, the local inverse of the aspect ratio, one obtains a system of two coupled equations for the harmonic amplitudes. When the shear is finite on q=1, the toroidal coupling is negligible. In the opposite limit, one can explain: the experimental behaviour of the (m=1, n=1) mode before the internal disruption; the simultaneous observation of the modes (m=1, n=1) and [de
George Guthrie's clinical trial at the Napoleonic War Battle of Toulouse in 1814.
Malhan, Neeraj K; Greenslade, Tessa; Mitchell, Piers D
2009-08-01
George James Guthrie (1785-1856) was a British military surgeon who came to prominence during the Napoleonic Wars (1803-15). He wrote several books on military surgery and was President of the Royal College of Surgeons of England three times. However, his most innovative and important achievement has largely gone unrecognised by modern historians. In 1814, at the battle of Toulouse in the Peninsular Campaign, he performed a landmark early trial of the treatment of musket wounds to the thigh. Here we not only discuss this clinical trial and place it in its social context, but also present the pathological skeletal specimens of two wounded British soldiers who took part in it.
Directory of Open Access Journals (Sweden)
Paola V Castro
Full Text Available The nematode Caenorhabditis elegans arrests development at the first larval stage if food is not present upon hatching. Larvae in this stage provide an excellent model for studying stress responses during development. We found that supplementing starved larvae with ethanol markedly extends their lifespan within this L1 diapause. The effects of ethanol-induced lifespan extension can be observed when the ethanol is added to the medium at any time between 0 and 10 days after hatching. The lowest ethanol concentration that extended lifespan was 1 mM (0.005%; higher concentrations to 68 mM (0.4% did not result in increased survival. In spite of their extended survival, larvae did not progress to the L2 stage. Supplementing starved cultures with n-propanol and n-butanol also extended lifespan, but methanol and isopropanol had no measurable effect. Mass spectrometry analysis of nematode fatty acids and amino acids revealed that L1 larvae can incorporate atoms from ethanol into both types of molecules. Based on these data, we suggest that ethanol supplementation may extend the lifespan of L1 larvae by either serving as a carbon and energy source and/or by inducing a stress response.
International Nuclear Information System (INIS)
Sandage, A.
1983-01-01
Comparison of VandenBerg's isochrones for globular clusters with the photometry of many main-sequence stars in M92 and M15 gives an age of T = 18 +- 2 x 10 9 years for both clusters, using a vertical fit to the turn-off luminosity, together with distance modulii found from the period-color-luminosity relation of their RR Lyrae stars. Comparison of the systematics of the composite CM diagram for clusters of different metallicity with that predicted from VandenBerg's isochrones, all for T = 18 x 10 9 years, shows good agreement. Justification of the adopted zero-point value of M/sub v/ (RR,M92) = +0.63 is made by comparing the main sequences of M92, M3, and M5 with that defined by 11 field subdwarfs whose metallicities lie between [Fe/H] of -2.2 and -1.2 for which adequate astrometric distances exist
The Star-forming Main Sequence of Dwarf Low Surface Brightness Galaxies
McGaugh, Stacy S.; Schombert, James M.; Lelli, Federico
2017-12-01
We explore the star-forming properties of late-type, low surface brightness (LSB) galaxies. The star-forming main sequence ({SFR}-{M}* ) of LSB dwarfs has a steep slope, indistinguishable from unity (1.04 ± 0.06). They form a distinct sequence from more massive spirals, which exhibit a shallower slope. The break occurs around {M}* ≈ {10}10 {M}⊙ , and can also be seen in the gas mass—stellar mass plane. The global Kennicutt-Schmidt law ({SFR}-{M}g) has a slope of 1.47 ± 0.11 without the break seen in the main sequence. There is an ample supply of gas in LSB galaxies, which have gas depletion times well in excess of a Hubble time, and often tens of Hubble times. Only ˜ 3 % of this cold gas needs be in the form of molecular gas to sustain the observed star formation. In analogy with the faint, long-lived stars of the lower stellar main sequence, it may be appropriate to consider the main sequence of star-forming galaxies to be defined by thriving dwarfs (with {M}* {10}10 {M}⊙ ) are weary giants that constitute more of a turn-off population.
Woo, Ho-Hyung; Baker, Terri; Laszlo, Csaba; Chambers, Setsuko K.
2013-01-01
CSF-1 mRNA 3′UTR contains multiple unique motifs, including a common microRNA (miRNA) target in close proximity to a noncanonical G-quadruplex and AU-rich elements (AREs). Using a luciferase reporter system fused to CSF-1 mRNA 3′UTR, disruption of the miRNA target region, G-quadruplex, and AREs together dramatically increased reporter RNA levels, suggesting important roles for these cis-acting regulatory elements in the down-regulation of CSF-1 mRNA. We find that nucleolin, which binds both G-quadruplex and AREs, enhances deadenylation of CSF-1 mRNA, promoting CSF-1 mRNA decay, while having the capacity to increase translation of CSF-1 mRNA. Through interaction with the CSF-1 3′UTR miRNA common target, we find that miR-130a and miR-301a inhibit CSF-1 expression by enhancing mRNA decay. Silencing of nucleolin prevents the miRNA-directed mRNA decay, indicating a requirement for nucleolin in miRNA activity on CSF-1 mRNA. Downstream effects followed by miR-130a and miR-301a inhibition of directed cellular motility of ovarian cancer cells were found to be dependent on nucleolin. The paradoxical effects of nucleolin on miRNA-directed CSF-1 mRNA deadenylation and on translational activation were explored further. The nucleolin protein contains four acidic stretches, four RNA recognition motifs (RRMs), and nine RGG repeats. All three domains in nucleolin regulate CSF-1 mRNA and protein levels. RRMs increase CSF-1 mRNA, whereas the acidic and RGG domains decrease CSF-1 protein levels. This suggests that nucleolin has the capacity to differentially regulate both CSF-1 RNA and protein levels. Our finding that nucleolin interacts with Ago2 indirectly via RNA and with poly(A)-binding protein C (PABPC) directly suggests a nucleolin-Ago2-PABPC complex formation on mRNA. This complex is in keeping with our suggestion that nucleolin may work with PABPC as a double-edged sword on both mRNA deadenylation and translational activation. Our findings underscore the complexity of
McKinnon, Duncan Paul
This research is a synthesis of archaeogeophysical and archaeohistorical data collected from the Battle Mound site (3LA1). Using these data, this research seeks to understand how the site is organized in terms of architectural variability and how differential use areas, such as domestic or community space, can be compared to ethnographic and archaeological data concerning Caddo community structure and landscape use. The research is formulated around three research questions related to spatial organization and settlement patterning, intrasite behavioral practices, and Caddo culture history. Results show that an examination at multiple scales of resolution can inform about the spatial organization and settlement patterning of Caddo communities and how these underlying principles that define space have endured or been modified over time. It also proposes a new intrasite model that can be productively tested with geophysical methods and the mapping of the distribution of features within large village areas.
Directory of Open Access Journals (Sweden)
Senthilkumar Pitchalu Kasthurinaidu
Full Text Available Genetic diversity in drug metabolism and disposition is mainly considered as the outcome of the inter-individual genetic variation in polymorphism of drug-xenobiotic metabolizing enzyme (XME. Among the XMEs, glutathione-S-transferases (GST gene loci are an important candidate for the investigation of diversity in allele frequency, as the deletion mutations in GST M1 and T1 genotypes are associated with various cancers and genetic disorders of all major Population Affiliations (PAs. Therefore, the present population based phylogenetic study was focused to uncover the frequency distribution pattern in GST M1 and T1 null genotypes among 45 Geographically Assorted Human Populations (GAHPs. The frequency distribution pattern for GST M1 and T1 null alleles have been detected in this study using the data derived from literatures representing 44 populations affiliated to Africa, Asia, Europe, South America and the genome of PA from Gujarat, a region in western India. Allele frequency counting for Gujarat PA and scattered plot analysis for geographical distribution among the PAs were performed in SPSS-21. The GST M1 and GST T1 null allele frequencies patterns of the PAs were computed in Seqboot, Gendist program of Phylip software package (3.69 versions and Unweighted Pair Group method with Arithmetic Mean in Mega-6 software. Allele frequencies from South African Xhosa tribe, East African Zimbabwe, East African Ethiopia, North African Egypt, Caucasian, South Asian Afghanistan and South Indian Andhra Pradesh have been identified as the probable seven patterns among the 45 GAHPs investigated in this study for GST M1-T1 null genotypes. The patternized null allele frequencies demonstrated in this study for the first time addresses the missing link in GST M1-T1 null allele frequencies among GAHPs.
Hong, Sungki; Freeberg, Mallory A; Han, Ting; Kamath, Avani; Yao, Yao; Fukuda, Tomoko; Suzuki, Tsukasa; Kim, John K; Inoki, Ken
2017-06-26
The RNA binding protein, LARP1, has been proposed to function downstream of mTORC1 to regulate the translation of 5'TOP mRNAs such as those encoding ribosome proteins (RP). However, the roles of LARP1 in the translation of 5'TOP mRNAs are controversial and its regulatory roles in mTORC1-mediated translation remain unclear. Here we show that LARP1 is a direct substrate of mTORC1 and Akt/S6K1. Deep sequencing of LARP1-bound mRNAs reveal that non-phosphorylated LARP1 interacts with both 5' and 3'UTRs of RP mRNAs and inhibits their translation. Importantly, phosphorylation of LARP1 by mTORC1 and Akt/S6K1 dissociates it from 5'UTRs and relieves its inhibitory activity on RP mRNA translation. Concomitantly, phosphorylated LARP1 scaffolds mTORC1 on the 3'UTRs of translationally-competent RP mRNAs to facilitate mTORC1-dependent induction of translation initiation. Thus, in response to cellular mTOR activity, LARP1 serves as a phosphorylation-sensitive molecular switch for turning off or on RP mRNA translation and subsequent ribosome biogenesis.
The improvement of M1 polarization in macrophages by glycopeptide derived from Ganoderma lucidum.
Sun, Li-Xin; Lin, Zhi-Bin; Lu, Jie; Li, Wei-Dong; Niu, Yan-Dong; Sun, Yu; Hu, Chen-Yang; Zhang, Guo-Qiang; Duan, Xin-Suo
2017-06-01
Ganoderma lucidum (Fr.) Karst (Ganodermataceae) is a medicinal mushroom that has been extensively used in China for centuries to promote longevity and improve vigor without significant adverse effects. There is continuous interest in the bioactive properties of G. lucidum in view of its newly developed popularity in other regions besides Asia, such as Europe. Glycopeptide derived from G. lucidum (Gl-PS) is one of the main effective components isolated from this mushroom. The Gl-PS has been demonstrated pleiotropic with many bioactivities including immunomodulatory and antitumor effects. Macrophages are important cells involved in innate and adaptive immunity. Classically activated macrophages (M1) and alternatively activated macrophages (M2), with their different roles, display distinct cytokine profiles: M1 preferentially produces TNF-α, IL-6, and IL-12; conversely, M2 generates more IL-10 and arginase. Gl-PS might have the potential to promote macrophage M1 polarization by lipopolysaccharide (LPS). In this study, LPS was used to induce the M1 polarization. It was shown that the level of the TNF-α, IL-6, and IL-12 were increased and the IL-10 and arginase I were decreased in the polarized M1 macrophages after application of Gl-PS compared to the control. The results indicated the potential of Gl-PS to promote M1 polarization vs M2, with the health beneficial understanding of the bioactivities of Gl-PS.
Directory of Open Access Journals (Sweden)
Wanyi Li
2014-03-01
Full Text Available Influenza (flu pandemics have exhibited a great threat to human health throughout history. With the emergence of drug-resistant strains of influenza A virus (IAV, it is necessary to look for new agents for treatment and transmission prevention of the flu. Defensins are small (2–6 kDa cationic peptides known for their broad-spectrum antimicrobial activity. Beta-defensins (β-defensins are mainly produced by barrier epithelial cells and play an important role in attacking microbe invasion by epithelium. In this study, we focused on the anti-influenza A virus activity of mouse β-defensin 1 (mBD1 and β defensin-3 (mBD3 by synthesizing their fusion peptide with standard recombinant methods. The eukaryotic expression vectors pcDNA3.1(+/mBD1-mBD3 were constructed successfully by overlap-PCR and transfected into Madin-Darby canine kidney (MDCK cells. The MDCK cells transfected by pcDNA3.1(+/mBD1-mBD3 were obtained by G418 screening, and the mBD1-mBD3 stable expression pattern was confirmed in MDCK cells by RT-PCR and immunofluorescence assay. The acquired stable transfected MDCK cells were infected with IAV (A/PR/8/34, H1N1, 0.1 MOI subsequently and the virus titers in cell culture supernatants were analyzed by TCID50 72 h later. The TCID50 titer of the experimental group was clearly lower than that of the control group (p < 0.001. Furthermore, BALB/C mice were injected with liposome-encapsulated pcDNA3.1(+/mBD1-mBD3 through muscle and then challenged with the A/PR/8/34 virus. Results showed the survival rate of 100% and lung index inhibitory rate of 32.6% in pcDNA3.1(+/mBD1-mBD3group; the TCID50 titer of lung homogenates was clearly lower than that of the control group (p < 0.001. This study demonstrates that mBD1-mBD3 expressed by the recombinant plasmid pcDNA3.1(+/mBD1-mBD3 could inhibit influenza A virus replication both in vitro and in vivo. These observations suggested that the recombinant mBD1-mBD3 might be developed into an agent for
Gamma-line intensity difference method for sup 1 sup 1 sup 7 sup m Sn at high resolution
Remeikis, V; Mazeika, K
1998-01-01
The method for detection of small differences in the gamma-spectrum line intensity for the radionuclide in different environments has been developed for measurements at high resolution. The experiments were realized with the pure germanium planar detector. Solution of the methodical problems allowed to measure the relative difference DELTA IOTA subgamma/IOTA subgamma=(3.4+-1.5)*10 sup - sup 4 of the sup 1 sup 1 sup 7 sup m Sn 156.02 keV gamma-line intensity for the radionuclide in SnO sub 2 with respect to SnS from the difference in the gamma-spectra. The error of the result is caused mainly by the statistical accuracy. It is limited by the highest counting rate at sufficiently high energy resolution and relatively short half-life of sup 1 sup 1 sup 7 sup m Sn. (author)
Energy Technology Data Exchange (ETDEWEB)
Clements, Tiffany D.; Jao, Wei-Chun; Silverstein, Michele L. [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30303 (United States); Henry, Todd J.; Hosey, Altonio D. [RECONS Institute, Chambersburg, PA 17201 (United States); Winters, Jennifer G. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Dieterich, Sergio B. [Carnegie Institution for Science, Washington, DC 20015 (United States); Riedel, Adric R., E-mail: pewett@astro.gsu.edu, E-mail: jao@astro.gsu.edu, E-mail: silverstein@astro.gsu.edu, E-mail: toddhenry28@gmail.com, E-mail: altoniohosey@gmail.com, E-mail: jennifer.winters@cfa.harvard.edu, E-mail: sdieterich@carnegiescience.edu, E-mail: adric.riedel@gmail.com [Space Telescope Science Institute, Baltimore, MD 21218 (United States)
2017-09-01
We report findings from a long-term photometric variability study of M dwarfs carried out at the SMARTS 0.9 m telescope at the Cerro Tololo Inter-American Observatory. As part of a multi-faceted effort to investigate the range of luminosities of M dwarfs of a given color on the Hertzsprung–Russell Diagram, 76 M dwarfs have been observed for 3–17 years in the Johnson–Kron–Cousins V band. We find that stars elevated above the center of the main sequence distribution tend to have higher levels of variability, likely caused by magnetic activity, than their fainter counterparts below the center. This study provides insight into how the long-term magnetic activity of these stars may be affecting their sizes, luminosities, and thus positions on the H-R Diagram.
Erkisi, A.; Surucu, G.; Deligoz, E.
2018-03-01
In this study, the structural, electronic, magnetic, and mechanical properties of perovskite oxides PbM1/2Nb1/2O3 (M = Fe, Co and Ni) are investigated. The systems are treated in ferromagnetic order. The calculations are carried out in the framework of density functional theory (DFT) within the plane-wave pseudopotential method. The exchange-correlation potential is approximated by generalized-gradient spin approach (GGA). The intra-atomic Coulomb repulsion is also taken into account in calculations (GGA + U). We have considered two generalized-gradient spin approximation functionals, which are Perdew-Burke-Ernzerhof (PBE) and PBE for solids (PBEsol) for structural parameter calculations when it included Hubbard potential. Although the spin-polarized electronic band structures of PbCo1/2Nb1/2O3 and PbNi1/2Nb1/2O3 systems exhibit metallic property in ferromagnetic phase, a bandgap is observed in spin-down states of PbFe1/2Nb1/2O3 resulting in half-metallic behavior. The main reason for this behavior is attributed to the hybridization between d-states of transition metal atoms and p-states of oxygen atoms. The stability mechanically and the calculated mechanical properties by using elastic constants show that these compounds are mechanically stable in tetragonal phase and have anisotropic character mechanically.
Müller, Jan; von Bernstorff, Wolfram; Heidecke, Claus-Dieter; Schulze, Tobias
2017-01-01
Introduction . Macrophages are key players in complex biological processes. In response to environmental signals, macrophages undergo polarization towards a proinflammatory (M1) or anti-inflammatory (M2) phenotype. Sphingosine 1-phosphate (S1P) is a bioactive lysophospholipid that acts via 5 G-protein coupled receptors (S1P 1-5 ) in order to influence a broad spectrum of biological processes. This study assesses S1P receptor expression on macrophages before and after M1 and M2 polarization and performs a comparative analysis of S1P signalling in the two activational states of macrophages. Methods . Bone marrow derived macrophages (BMDM) from C57 BL/6 mice were cultured under either M1- or M2-polarizing conditions. S1P-receptor expression was determined by quantitative RT-PCR. Influence of S1P on macrophage activation, migration, phagocytosis, and cytokine secretion was assessed in vitro. Results . All 5 S1P receptor subclasses were expressed in macrophages. Culture under both M1- and M2-polarizing conditions led to significant downregulation of S1P 1 . In contrast, M1-polarized macrophages significantly downregulated S1P 4 . The expression of the remaining three S1P receptors did not change. S1P increased expression of iNOS under M2-polarizing conditions. Furthermore, S1P induced chemotaxis in M1 macrophages and changed cytokine production in M2 macrophages. Phagocytosis was not affected by S1P-signalling. Discussion . The expression of different specific S1P receptor profiles may provide a possibility to selectively influence M1- or M2-polarized macrophages.
Lifescience Database Archive (English)
Full Text Available 60420. Name=At5g60420; Arabidopsis Thaliana Molecule: Dna-Binding Family Protein; Chain: A; Fragment: Phd Domai...F.He, Y.Muto, M.Inoue, T.Kigawa, M.Shirouzu, T.Terada, S.Yokoyama Solution Structure Of Phd Domai...n In Dna-Binding Family Protein Aam98074 To Be Published Nmr, Structural Genomics, Phd Domai
Hamann, Melanie; Plank, Jagoda; Richter, Franziska; Bode, Christoph; Smiljanic, Sinisa; Creed, Meaghan; Nobrega, José N; Richter, Angelika
2017-08-15
Striatal cholinergic dysfunction has been suggested to play a critical role in the pathophysiology of dystonia. In the dt sz hamster, a phenotypic model of paroxysmal dystonia, M1 antagonists exerted moderate antidystonic efficacy after acute systemic administration. In the present study, we examined the effects of the M4 preferring antagonist tropicamid and whether long-term systemic or acute intrastriatal injections of the M1 preferring antagonist trihexyphenidyl are more effective in mutant hamsters. Furthermore, M1 and M4 receptors were analyzed by autoradiography and immunohistochemistry. Tropicamide retarded the onset of dystonic attacks, as previously observed after acute systemic administration of trihexyphenidyl. Combined systemic administration of trihexyphenidyl (30mg/kg) and tropicamide (15mg/kg) reduced the severity in acute trials and delayed the onset of dystonia during long-term treatment. In contrast, acute striatal microinjections of trihexyphenidyl, tropicamid or the positive allosteric M4 receptor modulator VU0152100 did not exert significant effects. Receptor analyses revealed changes of M1 receptors in the dorsomedial striatum, suggesting that the cholinergic system is involved in abnormal striatal plasticity in dt sz hamsters, but the pharmacological data argue against a crucial role on the phenotype in this animal model. However, antidystonic effects of tropicamide after systemic administration point to a novel therapeutic potential of M4 preferring anticholinergics for the treatment of dystonia. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.
Operation of TRR-1/M1 for 25 years and lessons learned in management of safety and safety culture
International Nuclear Information System (INIS)
Keinmeesuke, Sirichai
2002-01-01
The first Thai Research Reactor, TRR-1, was installed and put into operation in 1962. In 1975 the reactor was converted to a 2 MW TRIGA Mark III by replacing of the reactor core and the control system. The renamed TRR-1/M1 research reactor went critical again in November 1977. TRR-1/M1 has been operated safely for 25 years with its main utilization in research, isotope production and training. Safety management and safety culture have been implemented for 25 years both in the legislation level and the operation level. There was no nuclear incident and there were a few radiological incidents during the 25 years of operation of TRR-1/M1. The lessons learned from the incident events such as the release of N-16 and Ar-41, the release of radioactive Bromine gave valued opportunities to improve our operation procedure, safety procedure and safety culture. All type of activities with respect to safety culture such as individual awareness, commitment, motivation, supervision and responsibility have been seriously reviewed and being set as normal practices. (author)
Schobersberger, Wolfgang; Leichtfried, Veronika; Mueck-Weymann, Michael; Humpeler, Egon
2010-09-01
A considerable part of the millions of Alpine tourists suffer from pre-existing diseases (e.g., metabolic syndrome) and high daily stress levels. The main goal of the Austrian Moderate Altitude Study (AMAS) was to investigate (a) the consequences of an active vacation at moderate altitude on the key parameters of the metabolic syndrome (AMAS I) and (b) the effects of a short active vacation on adult progenitor cells, bio-psychological parameters, and heart rate variability (HRV). During the AMAS I pilot study (n = 22; 1,700 m a.s.l.) and AMAS I main study (n = 71; 1,700 m a.s.l. and 200 m a.s.l.), the volunteers simulated 3-week coached hiking vacations. For AMAS II, healthy volunteers (n = 13) participated in a 1-week active holiday at 1,700 m. There were significant improvements of obesity, hypertension, dyslipidemia, and insulin resistance of AMAS I patients after the vacation. In AMAS II participants, we found an increase in circulating endothelial progenitor cells as well as improvements in bio-psychological and HRV parameters. Active vacations at moderate altitude are associated with a variety of positive health effects in persons with metabolic syndrome and in healthy subjects.
Directory of Open Access Journals (Sweden)
Finger Thomas E
2008-12-01
Full Text Available Abstract Background In the past, ciliated receptor neurons, basal cells, and supporting cells were considered the principal components of the main olfactory epithelium. Several studies reported the presence of microvillous cells but their function is unknown. A recent report showed cells in the main olfactory epithelium that express the transient receptor potential channel TrpM5 claiming that these cells are chemosensory and that TrpM5 is an intrinsic signaling component of mammalian chemosensory organs. We asked whether the TrpM5-positive cells in the olfactory epithelium are microvillous and whether they belong to a chemosensory system, i.e. are olfactory neurons or trigeminally-innervated solitary chemosensory cells. Results We investigated the main olfactory epithelium of mice at the light and electron microscopic level and describe several subpopulations of microvillous cells. The ultrastructure of the microvillous cells reveals at least three morphologically different types two of which express the TrpM5 channel. None of these cells have an axon that projects to the olfactory bulb. Tests with a large panel of cell markers indicate that the TrpM5-positive cells are not sensory since they express neither neuronal markers nor are contacted by trigeminal nerve fibers. Conclusion We conclude that TrpM5 is not a reliable marker for chemosensory cells. The TrpM5-positive cells of the olfactory epithelium are microvillous and may be chemoresponsive albeit not part of the sensory apparatus. Activity of these microvillous cells may however influence functionality of local elements of the olfactory system.
International Nuclear Information System (INIS)
Kingston, A.E.; Norrington, P.H.; Boone, A.W.
2002-01-01
The spontaneous decay rates for the electric dipole (E1), electric quadrupole (E2), magnetic dipole (M1) and magnetic quadrupole (M2) transitions between all of the 1s 2 , 1s2 l and 1s3 l states have been obtained for helium-like calcium and sulfur ions. To assess the accuracy of the calculations, the transition probabilities were calculated using two sets of configuration interaction wavefunctions. One set of wavefunctions was generated using the fully relativistic GRASP code and the other was obtained using CIV3, in which relativistic effects are introduced using the Breit-Pauli approximation. The transition rates, A values, oscillator strengths and line strengths from our two calculations are found to be similar and to compare very well with other recent results for Δn=1 or 2 transitions. For Δn=0 transitions the agreement is much less good; this is mainly due to differences in the calculated excitation energies. (author)
Target-specific M1 inputs to infragranular S1 pyramidal neurons
Fanselow, Erika E.; Simons, Daniel J.
2016-01-01
The functional role of input from the primary motor cortex (M1) to primary somatosensory cortex (S1) is unclear; one key to understanding this pathway may lie in elucidating the cell-type specific microcircuits that connect S1 and M1. Recently, we discovered that a subset of pyramidal neurons in the infragranular layers of S1 receive especially strong input from M1 (Kinnischtzke AK, Simons DJ, Fanselow EE. Cereb Cortex 24: 2237–2248, 2014), suggesting that M1 may affect specific classes of pyramidal neurons differently. Here, using combined optogenetic and retrograde labeling approaches in the mouse, we examined the strengths of M1 inputs to five classes of infragranular S1 neurons categorized by their projections to particular cortical and subcortical targets. We found that the magnitude of M1 synaptic input to S1 pyramidal neurons varies greatly depending on the projection target of the postsynaptic neuron. Of the populations examined, M1-projecting corticocortical neurons in L6 received the strongest M1 inputs, whereas ventral posterior medial nucleus-projecting corticothalamic neurons, also located in L6, received the weakest. Each population also possessed distinct intrinsic properties. The results suggest that M1 differentially engages specific classes of S1 projection neurons, thereby regulating the motor-related influence S1 exerts over subcortical structures. PMID:27334960
Toda, S.; Stein, R. S.
2017-12-01
The M=8.1 and M=7.1 events struck 12 days and 600 km apart, both with an independent probability of occurrence of 0.5% per year, based on the GEAR model [Bird et al., 2015]. Are they related? First, we calculated the static stress imparted by the M=8.1 shock to the fault that ruptured in the M=7.1, and find a tiny push that would favor rupture. But the stress increase (0.2 kPa) is less than the fault would experience from the tidal stresses, and so it should be inconsequential. We next used the México Servicio Sismológico Nacional (UNAM) online catalog to look at the quakes in the month before the M=8.1 and in the 13 days since. We calculate the completeness to be M≥4.0. There are virtually no remote aftershocks from the Chiapas rupture that extend within 250 km of the M=7.1 shock during the first week after the M=8.1. So, if anything, the M=8.1 turned off for a week or more the region that ruptured in the M=7.1. Events started turning on about 2-3 days before the M=7.1, but none of those struck within 40 km of the future M=7.1 mainshock. The seismic surface waves unleashed by great earthquakes envelop the globe in just 160 minutes, and yet triggering of remote large aftershocks during these 2-3 hours is either very rare [Pollitz et al., Nature 2012] or in dispute [Fan & Shearer, 2016 vs. Yue et al., 2017]. So, the waves must trigger tiny shocks that cascade into larger shocks after some delay. Or, perhaps the stresses conveyed by the waves pump pockets of fluids that slowly diffuse into nearby fault zones, lubricating them to the point of failure [Parsons at al., 2017]. In the cases where great earthquakes are indisputably seen to trigger aftershocks at great distances or even globally, they to do so within several days, or a week at most. Since Puebla struck 12 days later, this seems to us too long a period to be explained by dynamic triggering. Even though neither quake on their own is rare, what's the chance of independent M=8.1 and M=7.1 events just 12
Farias, L H S; Rodrigues, A P D; Coêlho, E C; Santos, M F; Sampaio, S C; Silva, E O
2017-09-01
American tegumentary leishmaniasis is caused by different species of Leishmania. This protozoan employs several mechanisms to subvert the microbicidal activity of macrophages and, given the limited efficacy of current therapies, the development of alternative treatments is essential. Animal venoms are known to exhibit a variety of pharmacological activities, including antiparasitic effects. Crotoxin (CTX) is the main component of Crotalus durissus terrificus venom, and it has several biological effects. Nevertheless, there is no report of CTX activity during macrophage - Leishmania interactions. Thus, the main objective of this study was to evaluate whether CTX has a role in macrophage M1 polarization during Leishmania infection murine macrophages, Leishmania amazonensis promastigotes and L. amazonensis-infected macrophages were challenged with CTX. MTT [3-(4,5dimethylthiazol-2-yl)-2,5-diphenyl tetrasodium bromide] toxicity assays were performed on murine macrophages, and no damage was observed in these cells. Promastigotes, however, were affected by treatment with CTX (IC50 = 22·86 µg mL-1) as were intracellular amastigotes. Macrophages treated with CTX also demonstrated increased reactive oxygen species production. After they were infected with Leishmania, macrophages exhibited an increase in nitric oxide production that converged into an M1 activation profile, as suggested by their elevated production of the cytokines interleukin-6 and tumour necrosis factor-α and changes in their morphology. CTX was able to reverse the L. amazonensis-mediated inhibition of macrophage immune responses and is capable of polarizing macrophages to the M1 profile, which is associated with a better prognosis for cutaneous leishmaniasis treatment.
Experience with S-1 in older Caucasian patients with metastatic colorectal cancer (mCRC)
DEFF Research Database (Denmark)
Winther, Stine Braendegaard; Zubcevic, Kanita; Qvortrup, Camilla
2016-01-01
BACKGROUND: An aging population will increase the number of older patients with metastatic colorectal cancer (mCRC). However, there is limited knowledge about treatment in older patients as they are under-represented in clinical trials. The oral fluoropyrimidine S-1 is associated with a lower rate...... of adverse events than capecitabine and may therefore be a suitable drug for elderly. However, data on the use of S-1 in Caucasian mCRC patients are lacking/scarce. MATERIAL AND METHODS: In the present study we evaluated safety and the efficacy of S-1 alone or in combination with oxaliplatin (SOx......) or irinotecan (IRIS) in older mCRC patients. Patients who received at least one cycle of S-1 (first-line therapy), SOx (mainly first-line therapy) or IRIS (second-line therapy) were included. RESULTS: From June 2012 to December 2014, 71 older patients received ≥1 cycle of either S-1 (n = 9), SOx (n = 44...
Development of high field superconducting Tokamak 'TRIAM-1M'
International Nuclear Information System (INIS)
Ito, Satoshi; Suzuki, Takao; Suzuki, Shohei; Nishi, Masatsugu; Kawasaki, Takahide.
1984-01-01
The tokamak nuclear fusion apparatus ''TRIAM-1M'' which is constructed in the Research Institute for Applied Mechanics, Kyushu University, has a number of distinctive features as compared with other tokamak projects, that is, the toroidal field coils are made of superconductors for the first time in Japan, and the apparatus is small and has strong magnetic field. Hitachi Ltd. designed and has forwarded the manufacture of the TRIAM-1M. In this paper, the total constitution of the apparatus and the design and manufacture of the plasma vacuum vessel, superconducting toroidal coils and others are reported. The objectives of research are the containment of strong field tokamak plasma and the establishment of the law of proportion, the development of turbulent flow heating method, the adoption of mixed wave current driving method and the practical use of Nb 3 Sn superconducting coils. The apparatus is composed of the vacuum vessel containing plasma, toroidal field coils, poloidal field coils, current transformer coils and turbulent flow heating coils for plasma heating, heat insulating vacuum vessel and supporting structures. The evacuating facility, helium liquefying refrigerator and cooling water facility are installed around the main body. (Kako, I.)
Probing the central engine and environment of AGN using ARIES 1.3-m and 3.6-m telescopes
Chand, Hum; Rakshit, Suvendu; Jalan, Priyanka; Ojha, Vineet; Srianand, Raghunathan; Vivek, Mariappan; Mishra, Sapna; Omar, Amitesh; Kumar, Parveen; Joshi, Ravi; Gopal-Krishna; Kumar, Rathna
2018-04-01
We discuss three long term observational programmes to probe the central engine and environment of active galactic nuclei (AGN) using the recently installed ARIES 1.3-m and 3.6-m telescopes. The first programme is on the photometric reverberation mapping of low luminosity AGN by mainly using the ARIES 1.3-m telescope. The major impact of this programme other than to estimate the black hole mass will be to extend the broad line region (BLR) radius-luminosity (RBLR-LAGN) relation to the unexplored low luminosity regime, and to constrain the AGN broad line region geometry. The second programme is to use long slit spectroscopy on the ARIES 3.6-m telescope to discover new high redshift quasar pairs with angular separation less than 1-arcmin. Here, the background QSOs sight-line will be used to probe the environment of the foreground QSOs at kpc-Mpc scales. The major impact of this programme will be on the discovery of new pairs which have been missed in the SDSS survey due to fiber collision below 1-arcmin separation, and use them to understand about any excess overdensity around the QSO, any anisotropic emission of QSOs, and/or any episodic activity of QSOs. The third programme is related to spectral variability studies of the C IV broad absorption line (BAL) QSOs, based on low resolution spectroscopy using the ARIES 3.6-m telescope. Here, those most interesting cases will be monitored, where the BAL flow emerges afresh or disappears completely in the C IV trough of BAL QSOs sample as seen in SDSS multi-epoch observations. Continuous monitoring of such a sample will be important for our understanding of the nature and origin of the flow, along with their stability and dynamical evolution.
Radial Color Gradient in a Globular Cluster 1. M68
Directory of Open Access Journals (Sweden)
Sukyoung Yi
1990-12-01
Full Text Available Stars in M68 from the observed color-magnitude diagrams with CCD were integrated to find any radial gradient. The result shows that M68 has a slightly bluer core. The main cause of these calculated radial color variations seems to come from the random distribution of giants.
International Nuclear Information System (INIS)
Sittichai, Chaiyut
2000-01-01
In 1961, the first Thai Research Reactor, TRR-1, having power of 1 MW was established. It was located at Office of Atomic Energy for Peace (OAEP) in Bangkok. TRR-1 was completely commissioned in June 1962. Plate typed high-enriched uranium (HEU) and U 3 O 8 -Al were used as fuel. Light water used as moderator and coolant. During 1975-1977, TRR-1 was shut down for modification. The reactor core and control system were disassembled and replaced by TRIGA Mark III. It is a circular hexagonal core typed reactor designed by General Atomics Company (GA). Afterwards, TRR-1 was officially renamed to Thai Research Reactor 1/Modification 1 (TRR-1/M1). TRR-1/M1 is a multipurpose reactor with nominal power of 2 MW. This swimming pool typed reactor uses low-enriched uranium (LEU) as fuel and light water as coolant and moderator. To date, the reactor has been operated with core No.12 that released power 1135 MWD to serve the user. The reactor has been serving for various kinds of utilization, for example, to produce radioisotope, neutron beam experiments and reactor physics experiments. This report explains in detail regarding operational experience and current status of this reactor, for example, reactor operation and reactor utilization. (author)
International Nuclear Information System (INIS)
Genin, Marie; Clement, Francois; Fattaccioli, Antoine; Raes, Martine; Michiels, Carine
2015-01-01
Tumor associated macrophages (TAMs) are present in high density in solid tumors. TAMs share many characteristics with alternatively activated macrophages, also called M2. They have been shown to favor tumor development and a role in chemoresistance has also been suggested. Here, we investigated the effects of M2 in comparison to M1 macrophages on cancer cell sensitivity to etoposide. We set up a model of macrophage polarization, starting from THP-1 monocytes differentiated into macrophages using PMA (Phorbol 12-myristate 13-acetate). Once differentiated (M0 macrophages), they were incubated with IL-4 and IL-13 in order to obtain M2 polarized macrophages or with IFN-gamma and LPS for classical macrophage activation (M1). To mimic the communication between cancer cells and TAMs, M0, M1 or M2 macrophages and HepG2 or A549 cancer cells were co-cultured during respectively 16 (HepG2) or 24 (A549) hours, before etoposide exposure for 24 (HepG2) or 16 (A549) hours. After the incubation, the impact of etoposide on macrophage polarization was studied and cancer cell apoptosis was assessed by western-blot for cleaved caspase-3 and cleaved PARP-1 protein, caspase activity assay and FACS analysis of Annexin V and PI staining. mRNA and protein expression of M1 and M2 markers confirmed the polarization of THP-1-derived macrophages, which provide a new, easy and well-characterized model of polarized human macrophages. Etoposide-induced cancer cell apoptosis was markedly reduced in the presence of THP-1 M2 macrophages, while apoptosis was increased in cells co-cultured with M1 macrophages. On the other hand, etoposide did not influence M1 or M2 polarization. These results evidence for the first time a clear protective effect of M2 on the contrary to M1 macrophages on etoposide-induced cancer cell apoptosis
Macrophage polarisation: an immunohistochemical approach for identifying M1 and M2 macrophages.
Directory of Open Access Journals (Sweden)
Mário Henrique M Barros
Full Text Available Macrophage polarization is increasingly recognised as an important pathogenetic factor in inflammatory and neoplastic diseases. Proinflammatory M1 macrophages promote T helper (Th 1 responses and show tumoricidal activity. M2 macrophages contribute to tissue repair and promote Th2 responses. CD68 and CD163 are used to identify macrophages in tissue sections. However, characterisation of polarised macrophages in situ has remained difficult. Macrophage polarisation is regulated by transcription factors, pSTAT1 and RBP-J for M1, and CMAF for M2. We reasoned that double-labelling immunohistochemistry for the detection of macrophage markers together with transcription factors may be suitable to characterise macrophage polarisation in situ. To test this hypothesis, we have studied conditions associated with Th1- and Th2-predominant immune responses: infectious mononucleosis and Crohn's disease for Th1 and allergic nasal polyps, oxyuriasis, wound healing and foreign body granulomas for predominant Th2 response. In all situations, CD163+ cells usually outnumbered CD68+ cells. Moreover, CD163+ cells, usually considered as M2 macrophages, co-expressing pSTAT1 and RBP-J were found in all conditions examined. The numbers of putative M1 macrophages were higher in Th1- than in Th2-associated diseases, while more M2 macrophages were seen in Th2- than in Th1 related disorders. In most Th1-related diseases, the balance of M1 over M2 cells was shifted towards M1 cells, while the reverse was observed for Th2-related conditions. Hierarchical cluster analysis revealed two distinct clusters: cluster I included Th1 diseases together with cases with high numbers of CD163+pSTAT1+, CD68+pSTAT1+, CD163+RBP-J+ and CD68+RBP-J+ macrophages; cluster II comprised Th2 conditions together with cases displaying high numbers of CD163+CMAF+ and CD68+CMAF+ macrophages. These results suggest that the detection of pSTAT1, RBP-J, and CMAF in the context of CD68 or CD163 expression is a
Macrophage polarisation: an immunohistochemical approach for identifying M1 and M2 macrophages.
Barros, Mário Henrique M; Hauck, Franziska; Dreyer, Johannes H; Kempkes, Bettina; Niedobitek, Gerald
2013-01-01
Macrophage polarization is increasingly recognised as an important pathogenetic factor in inflammatory and neoplastic diseases. Proinflammatory M1 macrophages promote T helper (Th) 1 responses and show tumoricidal activity. M2 macrophages contribute to tissue repair and promote Th2 responses. CD68 and CD163 are used to identify macrophages in tissue sections. However, characterisation of polarised macrophages in situ has remained difficult. Macrophage polarisation is regulated by transcription factors, pSTAT1 and RBP-J for M1, and CMAF for M2. We reasoned that double-labelling immunohistochemistry for the detection of macrophage markers together with transcription factors may be suitable to characterise macrophage polarisation in situ. To test this hypothesis, we have studied conditions associated with Th1- and Th2-predominant immune responses: infectious mononucleosis and Crohn's disease for Th1 and allergic nasal polyps, oxyuriasis, wound healing and foreign body granulomas for predominant Th2 response. In all situations, CD163+ cells usually outnumbered CD68+ cells. Moreover, CD163+ cells, usually considered as M2 macrophages, co-expressing pSTAT1 and RBP-J were found in all conditions examined. The numbers of putative M1 macrophages were higher in Th1- than in Th2-associated diseases, while more M2 macrophages were seen in Th2- than in Th1 related disorders. In most Th1-related diseases, the balance of M1 over M2 cells was shifted towards M1 cells, while the reverse was observed for Th2-related conditions. Hierarchical cluster analysis revealed two distinct clusters: cluster I included Th1 diseases together with cases with high numbers of CD163+pSTAT1+, CD68+pSTAT1+, CD163+RBP-J+ and CD68+RBP-J+ macrophages; cluster II comprised Th2 conditions together with cases displaying high numbers of CD163+CMAF+ and CD68+CMAF+ macrophages. These results suggest that the detection of pSTAT1, RBP-J, and CMAF in the context of CD68 or CD163 expression is a suitable tool for
Improved E-ELT subsystem and component specifications, thanks to M1 test facility
Dimmler, M.; Marrero, J.; Leveque, S.; Barriga, Pablo; Sedghi, B.; Kornweibel, N.
2014-07-01
During the last 2 years ESO has operated the "M1 Test Facility", a test stand consisting of a representative section of the E-ELT primary mirror equipped with 4 complete prototype segment subunits including sensors, actuators and control system. The purpose of the test facility is twofold: it serves to study and get familiar with component and system aspects like calibration, alignment and handling procedures and suitable control strategies on real hardware long before the primary mirror (hereafter M1) components are commissioned. Secondly, and of major benefit to the project, it offered the possibility to evaluate component and subsystem performance and interface issues in a system context in such detail, that issues could be identified early enough to feed back into the subsystem and component specifications. This considerably reduces risk and cost of the production units and allows refocusing the project team on important issues for the follow-up of the production contracts. Experiences are presented in which areas the results of the M1 Test Facility particularly helped to improve subsystem specifications and areas, where additional tests were adopted independent of the main test facility. Presented are the key experiences of the M1 Test Facility which lead to improved specifications or identified the need for additional testing outside of the M1 Test Facility.
Ethics control of vertebrate animals experiments in biosatellite BION-M1 project
Ilyin, Eugene
During April 19-May 19, 2013 it was realized 30-days flight of Russian biosatellite Bion-M1. The main goal of this flight was to study effects of microgravity upon behavior and structural-functional state of different physiological systems of vertebrates. The folloving species were accommodated aboard of biosatellite: 45 mice C57bl/6, 8 Mongolian gerbils Meriones unguiculatus, 15 lizards, i.e. geckos Chondrodctylus turneri Gray, and fish Oreochromis mossambicus. The selection and traing of mice for the flight and ground-based control experiments was carried out at the Research Institute of Mitoengineering by Moscow State University. The protocols for animals care and reserch were revised and adopted by Bioethics Commission of above mentioned institute (decision on November 01, 2013, N35). The final version of Bion-M1 Scientific Reseach Program and protocols for separate experiments were discussed and adopted by Biomedical Ethics Commission of Institute of Biomedical Problems (decision on April 4, 2014, N317). The IMBP Commission has a status of Physiological Section of Russian Bioethics Committee by Russian Commision for UNESCO affairs and follows the Russian Bioethical Guidelines for Experiments in Aerospace and Naval Medicine and other national and international rules including COSPAR International Policy and Guidelines for Animal Care and Use in Space-born Research. Because US-scientists were the main partners in mice investigations the decision of IMBP Biomedical Commission related to Bion-M1 project was sended for information to Institutional Animal Care and Use Committee of NASA Ames Research Center. Postflight estimation of mice was done by Russian veterinary with the participation of NASA Chief veterinary.
β-adrenergic-stimulated macrophages: Comprehensive localization in the M1–M2 spectrum
Lamkin, Donald M.; Ho, Hsin-Yun; Ong, Tiffany H.; Kawanishi, Carly K.; Stoffers, Victoria L.; Ahlawat, Nivedita; Ma, Jeffrey C.Y.; Arevalo, Jesusa M. G.; Cole, Steve W.; Sloan, Erica K.
2016-01-01
β-adrenergic signaling can regulate macrophage involvement in several diseases and often produces anti-inflammatory properties in macrophages, which are similar to M2 properties in a dichotomous M1 vs. M2 macrophage taxonomy. However, it is not clear that β-adrenergic-stimulated macrophages may be classified strictly as M2. In this in vitro study, we utilized recently published criteria and transcriptome-wide bioinformatics methods to map the relative polarity of murine β-adrenergic-stimulated macrophages within a wider M1–M2 spectrum. Results show that β-adrenergic-stimulated macrophages did not fit entirely into any one predefined category of the M1–M2 spectrum but did express genes that are representative of some M2 side categories. Moreover, transcript origin analysis of genome-wide transcriptional profiles located β-adrenergic-stimulated macrophages firmly on the M2 side of the M1–M2 spectrum and found active suppression of M1 side gene transcripts. The signal transduction pathways involved were mapped through blocking experiments and bioinformatics analysis of transcription factor binding motifs. M2-promoting effects were mediated specifically through β2-adrenergic receptors and were associated with CREB, C/EBPβ, and ATF transcription factor pathways but not with established M1–M2 STAT pathways. Thus, β-adrenergic-signaling induces a macrophage transcriptome that locates on the M2 side of the M1–M2 spectrum but likely accomplishes this effect through a signaling pathway that is atypical for M2-spectrum macrophages. PMID:27485040
Radar Observations of Main-Belt M-class Asteroids
Shepard, Michael K.; Clark, B. E.; Ockert-Bell, M.; Nolan, M. C.; Howell, E. S.; Magri, C.; Giorgini, J. D.; Benner, L. A. M.; Ostro, S. J.; Harris, A. W.; Warner, B. D.; Stephens, R. D.; Mueller, M.
2009-01-01
Using the S-band radar at Arecibo Observatory, we have observed 19 Tholen M-class asteroids. The mean radar albedo for all our targets is 0.28 ± 0.13, considerably higher than the mean radar albedo of every other class (Magri et al. 2007, Icarus 186, 126-151). We find approximately one-third (six)
Interactions between the HIV-1 Unspliced mRNA and Host mRNA Decay Machineries
Directory of Open Access Journals (Sweden)
Daniela Toro-Ascuy
2016-11-01
Full Text Available The human immunodeficiency virus type-1 (HIV-1 unspliced transcript is used both as mRNA for the synthesis of structural proteins and as the packaged genome. Given the presence of retained introns and instability AU-rich sequences, this viral transcript is normally retained and degraded in the nucleus of host cells unless the viral protein REV is present. As such, the stability of the HIV-1 unspliced mRNA must be particularly controlled in the nucleus and the cytoplasm in order to ensure proper levels of this viral mRNA for translation and viral particle formation. During its journey, the HIV-1 unspliced mRNA assembles into highly specific messenger ribonucleoproteins (mRNPs containing many different host proteins, amongst which are well-known regulators of cytoplasmic mRNA decay pathways such as up-frameshift suppressor 1 homolog (UPF1, Staufen double-stranded RNA binding protein 1/2 (STAU1/2, or components of miRNA-induced silencing complex (miRISC and processing bodies (PBs. More recently, the HIV-1 unspliced mRNA was shown to contain N6-methyladenosine (m6A, allowing the recruitment of YTH N6-methyladenosine RNA binding protein 2 (YTHDF2, an m6A reader host protein involved in mRNA decay. Interestingly, these host proteins involved in mRNA decay were shown to play positive roles in viral gene expression and viral particle assembly, suggesting that HIV-1 interacts with mRNA decay components to successfully accomplish viral replication. This review summarizes the state of the art in terms of the interactions between HIV-1 unspliced mRNA and components of different host mRNA decay machineries.
The KEK 1 m hydrogen bubble chamber
International Nuclear Information System (INIS)
Doi, Yoshikuni; Araoka, Osamu; Hayashi, Kohei; Hayashi, Yoshio; Hirabayashi, Hiromi.
1978-03-01
A medium size hydrogen bubble chamber has been constructed at the National Laboratory for High Energy Physics, KEK. The bubble chamber has been designed to be operated with a maximum rate of three times per half a second in every two second repetition time of the accelerator, by utilizing a hydraulic expansion system. The bubble chamber has a one meter diameter and a visible volume of about 280 l. A three-view stereo camera system is used for taking photographic pictures of the chamber. A 2 MW bubble chamber magnet is constructed. The main part of the bubble chamber vessel is supported by the magnet yoke. The magnet gives a maximum field of 18.4 kG at the centre of the fiducial volume of the chamber. The overall system of the KEK 1 m hydrogen bubble chamber facility is described in some detail. Some operational characteristics of the facility are also reported. (auth.)
DEFF Research Database (Denmark)
Cooper-Jensen, C.; Klinkby, Esben Bryndt; Beaucour, J.
For neutrons the critical angle of Ni is defined as m=1. If one needs a coating with reflectivity above m=1, people have traditionally used Ni58 or Ni-based multilayers. The reason to use Ni is the high neutron scattering density and the fact that it is easy to coat Ni using magnetron sputtering....... For a neutron guide the cost of shielding around the guide is a substantial part of the total cost of the guide. We are therefore looking at other materials than Ni for m=1 coatings. Both Be and diamond have the same or higher neutron scattering density than Ni, and have a much smaller absorption cross section....... Because of the lower absorption cross section, and because of fewer emitted gamma ray photons when a neutron is absorbed, these coatings are producing much less gamma radiation and therefore reduce the shielding costs. Be is frequently used in a wide range of science and technology applications. The only...
Directory of Open Access Journals (Sweden)
Svetlana Olegovna Zakharchenko
2013-11-01
Full Text Available The Battle of Kulikovo is one of the most significant events in Russian history. This article studies five poems by Alexander Blok and Sergey Orlov devoted to this battle. Alexander Blok's cycle of poems On the Field of Kulikovo prophetically predicts future changes in Russia. Sergey Orlov's poems devoted to this historical event can be seen as a certain indicator of his creative evolution. The image of the homeland, as well as the image of his wife (widow, both in Blok's and Orlov's poems originates from the image of the Mother of God. Images of a celestial body used by both poets are associated with military paraphernalia and arise from the evangelical images, while the warrior image is based on the evangelical image of brotherhood. Poetic experience of Alexander Blok and Sergey Orlov reveals Orthodox roots that nourish the entire Russian culture.
Liu, Mingxia; Allegood, Jeremy; Zhu, Xuewei; Seo, Jeongmin; Gebre, Abraham K; Boudyguina, Elena; Cheng, Dongmei; Chuang, Chia-Chi; Shelness, Gregory S; Spiegel, Sarah; Parks, John S
2015-03-20
Apolipoprotein M (apoM), a plasma sphingosine 1-phosphate (S1P) carrier, associates with plasma HDL via its uncleaved signal peptide. Hepatocyte-specific apoM overexpression in mice stimulates formation of both larger nascent HDL in hepatocytes and larger mature apoM/S1P-enriched HDL particles in plasma by enhancing hepatic S1P synthesis and secretion. Mutagenesis of apoM glutamine 22 to alanine (apoM(Q22A)) introduces a functional signal peptidase cleavage site. Expression of apoM(Q22A) in ABCA1-expressing HEK293 cells resulted in the formation of smaller nascent HDL particles compared with wild type apoM (apoM(WT)). When apoM(Q22A) was expressed in vivo, using recombinant adenoviruses, smaller plasma HDL particles and decreased plasma S1P and apoM were observed relative to expression of apoM(WT). Hepatocytes isolated from both apoM(WT)- and apoM(Q22A)-expressing mice displayed an equivalent increase in cellular levels of S1P, relative to LacZ controls; however, relative to apoM(WT), apoM(Q22A) hepatocytes displayed more rapid apoM and S1P secretion but minimal apoM(Q22A) bound to nascent lipoproteins. Pharmacologic inhibition of ceramide synthesis increased cellular sphingosine and S1P but not medium S1P in both apoM(WT) and apoM(Q22A) hepatocytes. We conclude that apoM secretion is rate-limiting for hepatocyte S1P secretion and that its uncleaved signal peptide delays apoM trafficking out of the cell, promoting formation of larger nascent apoM- and S1P-enriched HDL particles that are probably precursors of larger apoM/S1P-enriched plasma HDL. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Yigit, O.; Hofstra, A.H.
2003-01-01
The Gold Bar district contains five Carlin-type gold deposits and four resources for a combined gold endowment of 1.6 M oz [50 t]. The gold deposits are hosted in Devonian carbonate rocks below parautochthonous and allochthonous Paleozoic siliciclastic rocks emplaced during the Early Mississippian Antler orogeny. The district is in the Battle Mountain-Eureka trend, a long-lived structural feature that localized intrusions and ore deposits of different types and ages. The whole-rock geochemistry of four different mineralized and unmineralized Devonian carbonate rock units (two favorable and two unfavorable) were determined and interpreted in the context of the regional geology. A combination of basic statistics, R-mode factor analysis, isocon plots, and alteration diagrams were utilized to (1) identify favorable geochemical attributes of the host rocks, (2) characterize alteration and associated element enrichments and depletions, and (3) identify the mechanism of gold precipitation. This approach also led to the recognition of other types of alteration and mineralization in host rocks previously thought to be solely affected by Carlin-type mineralization. Unit 2 of the Upper Member of the Denay Formation, with the highest Al2O3, Fe2O3 and SiO2 contents and the lowest CaO content, is the most favorable host rock. Based on the high regression coefficients of data arrays on X-Y plots that project toward the origin, Al2O3 and TiO2 were immobile and K2O and Fe2O3 were relatively immobile during alteration and mineralization. Specific element associations identified by factor analysis are also prominent on isocon diagrams that compare the composition of fresh and altered equivalents of the same rock units. The most prominent associations are: Au, As, Sb, SiO2, TI, -CaO and -LOI, the main gold mineralizing event and related silicification and decalcification; Cd, Zn, Ag, P, Ni and Tl, an early base metal event; and MgO, early dolomitization. Alteration diagrams
The mutual dependence of M1 fertility and M2 mutations in rice
International Nuclear Information System (INIS)
Gopinathan Nair, V.
1982-01-01
The mutual dependence of M 1 fertility and M 2 mutations in rice was studied after treatment with gamma rays and EMS. The frequency of chlorophyll mutations increased with decrease in seed fertility when M 1 ears were selected at random. However, at the lowest fertility class the mutation frequency was low. This reduction is attributed to the elimination of mutants in the high sterility class. The mutation yield can therefore be significantly enhanced by selecting M 1 ears of low fertility. The segregation ratio of mutants increased as fertility decreased. Mutation spectrum was however not influenced by M 1 fertility. This makes selection for fertility quite ineffective in altering the mutation spectrum. (author)
Introduction to the main experimental findings of the LENR field
International Nuclear Information System (INIS)
Storms, Edmund
2015-01-01
Twenty-five years ago in March 1989, Martin Fleischmann and Stanley Pons announced their success in initiating fusion between deuterons in palladium used as the cathode in an electrolytic cell. Since then, a battle has waged between skeptics who reject the claim and people who observe behaviour that is consistent with the claim. This article briefly summarizes the major experimental observations. A companion article in this special section provides insight into how the observations might be explained. (author)
The Battle of Vukovar: The Battle That Saved Croatia
2002-07-01
1991, 4. 53 M. Marjanovic and D. Glišic, “Visoka cena slobode” [The High Price of Freedom], Narodna armija (Belgrade), 21 September 1991, 10. 39...The Bull Has No More Hay”] Ilustrovana politika, (Belgrade) 9 October 1991. o) Marjanovic M. and Glišic D., “Visoka cena slobode” [The High Price of
Air launch wireless sensor nodes (ALSN) for battle damage assessment (BDA)
Back, Jason M.; Beck, Steven D.; Frank, Mark A.; Hoenes, Eric
2006-05-01
This paper summarizes the Defense Threat Reduction Agency (DTRA) sponsored development and demonstration of an Air Launched Sensor Node (ALSN) system designed to fill DTRA's immediate need to support the Global Strike requirement of weapon-borne deliverable sensors for Battle Damage Assessment (BDA). Unattended ground sensors were integrated into a CBU-103 Tactical Munitions Dispenser (TMD), and flight test demonstrated with the 46 th Test Wing at Eglin AFB, FL. The objectives of the ALSN program were to repackage an existing multi-sensor node system to conform to the payload envelope and deployment configuration design; to integrate this payload into the CBU-103 TMD; and to conduct a combined payload flight test demonstration. The final sensor node included multiple sensors a microphone, a geophone, and multiple directional Passive Infrared (PIR) detectors with processing electronics, a low power wireless communications 802.15.4 mesh network, GPS (Global Positioning System), and power integrated into a form-fit BLU-97 munitions deployable package. This paper will present and discuss the flight test, results, and ALSN performance.
Which role for nuclear power in the battle against global warming?
International Nuclear Information System (INIS)
Jean-Baptiste, Ph.; Ducroux, R.
2000-01-01
The climatic impact of massive releases of carbon dioxide from the burning of fossil fuels has become a major international issue. Atmospheric CO 2 concentration continually increases. At the present rate, it is predicted that by 2040 it will have doubled with respect to its pre-industrial level. In a growing world economy, now dependent on fossil fuels for 90% of its energy, only a drastic change in energy policy involving extensive use of CO 2 -free energies can make it possible to stabilize atmospheric CO 2 levels. With 35 % of its primary energy from nuclear reactors, France sets a good example for the greenhouse gas reduction. Using this energy has resulted in a 20% reduction in releases since 1973. During the same period, world emissions have increased by 45%. In view of the French experience in 25 years of managing a large number of nuclear reactors in respecting safety requirements and environmental impact, it appears that nuclear energy has an important role to play in the battle against greenhouse gases. (authors)
Apolipoprotein M can discriminate HNF1A-MODY from Type 1 diabetes.
Mughal, S A; Park, R; Nowak, N; Gloyn, A L; Karpe, F; Matile, H; Malecki, M T; McCarthy, M I; Stoffel, M; Owen, K R
2013-02-01
Missed diagnosis of maturity-onset diabetes of the young (MODY) has led to an interest in biomarkers that enable efficient prioritization of patients for definitive molecular testing. Apolipoprotein M (apoM) was suggested as a biomarker for hepatocyte nuclear factor 1 alpha (HNF1A)-MODY because of its reduced expression in Hnf1a(-/-) mice. However, subsequent human studies examining apoM as a biomarker have yielded conflicting results. We aimed to evaluate apoM as a biomarker for HNF1A-MODY using a highly specific and sensitive ELISA. ApoM concentration was measured in subjects with HNF1A-MODY (n = 69), Type 1 diabetes (n = 50), Type 2 diabetes (n = 120) and healthy control subjects (n = 100). The discriminative accuracy of apoM and of the apoM/HDL ratio for diabetes aetiology was evaluated. Mean (standard deviation) serum apoM concentration (μmol/l) was significantly lower for subjects with HNF1A-MODY [0.86 (0.29)], than for those with Type 1 diabetes [1.37 (0.26), P = 3.1 × 10(-18) ) and control subjects [1.34 (0.22), P = 7.2 × 10(-19) ). There was no significant difference in apoM concentration between subjects with HNF1A-MODY and Type 2 diabetes [0.89 (0.28), P = 0.13]. The C-statistic measure of discriminative accuracy for apoM was 0.91 for HNF1A-MODY vs. Type 1 diabetes, indicating high discriminative accuracy. The apoM/HDL ratio was significantly lower in HNF1A-MODY than other study groups. However, this ratio did not perform well in discriminating HNF1A-MODY from either Type 1 diabetes (C-statistic = 0.79) or Type 2 diabetes (C-statistic = 0.68). We confirm an earlier report that serum apoM levels are lower in HNF1A-MODY than in controls. Serum apoM provides good discrimination between HNF1A-MODY and Type 1 diabetes and warrants further investigation for clinical utility in diabetes diagnostics. © 2012 The Authors. Diabetic Medicine © 2012 Diabetes UK.
Diversification of the vacAs1m1 and vacAs2m2 strains of Helicobacter pylori in Meriones unguiculatus
Directory of Open Access Journals (Sweden)
Sandra Mendoza Elizalde
2016-11-01
Full Text Available The bacterium Helicobacter pylori exhibits great genetic diversity, and the pathogenic roles of its virulence factors have been widely studied. However, the evolutionary dynamics of H. pylori strains during stomach colonization are not well characterized. Here, we analyzed the microevolutionary dynamics of the toxigenic strain vacAs1m1, the non-toxigenic strain vacAs2m2, and a combination of both strains in an animal model over time. Meriones unguiculatus were inoculated with the following bacteria: group 1–toxigenic strain vacAs1m1/cagA+/cagE+/babA2+; ST181, group 2–non-toxigenic strain vacAs2m2/ cagA+/ cagE+/ babA2+; ST2901, and group 3–both strains. The gerbils were euthanized at different time points (3, 6, 12 and 18 months. In group 1, genetic alterations were observed at 6 and 12 months. With the combination of both strains, group 3 also exhibited genetic alterations at 3 and 18 months; moreover, a chimera, vacA m1-m2, was detected. Additionally, four new sequence types (STs were reported in the PubMLST database for H. pylori. Synonymous and non-synonymous mutations were analyzed and associated with alterations in amino acids. Microevolutionary analysis of the STs (PHYLOViZ identified in each group revealed many mutational changes in the toxigenic (vacAs1m1 and non-toxigenic (vacAs2m2 strains. Phylogenetic assessments (eBURST did not reveal clonal complexes. Our findings indicate that the toxigenic strain, vacAs1m1, and a combination of toxigenic and non-toxigenic strains acquired genetic material by recombination. The allelic combination, vacAs2m1, displayed the best adaptation in the animal model over time, and a chimera, m1-m2, was also identified, which confirmed previous reports.
Natural radioactivity level of main building materials in Baotou, China
International Nuclear Information System (INIS)
Zhao Caifeng; Lu Xinwei; Li Nan; Yang Guang
2012-01-01
A survey was done on natural radioactivity level and annual effective dose rate of main building materials in Baotou, China. The natural radionuclides of 40 K, 232 Th and 226 Ra in main building materials collected from Baotou were measured using NaI γ-ray spectrometry and the measured data were analyzed according to the national standards and radiological protection principles of the European Commission. The specific activities of 40 K, 232 Th and 226 Ra in the building materials samples were 218.82-1145.92, 19.75-1.32.50 and 11.46-82.66 Bq/kg, respectively. The internal and external exposure indexes of building materials were 0.06-0.41 and 0.28-0.70, respectively. The annual effective dose equivalent was 0.41-0.97 mSv/y. This justifies the production and sale of the main building materials, as both the internal and external exposure indexes of building materials are less than 1. The effective dose rate of ash brick is 0.97 mSv/y, while the maximum acceptable value is 1 mSv/y. Therefore, it is necessary to control the amount of industrial waste residue in building materials to avoid unnecessary radioactive exposure to residents. (authors)
International Nuclear Information System (INIS)
Capron, J.M.
2008-01-01
The 100-F-26:12 waste site was an approximately 308-m-long, 1.8-m-diameter east-west-trending reinforced concrete pipe that joined the North Process Sewer Pipelines (100-F-26:1) and the South Process Pipelines (100-F-26:4) with the 1.8-m reactor cooling water effluent pipeline (100-F-19). In accordance with this evaluation, the verification sampling results support a reclassification of this site to Interim Closed Out. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River
Directory of Open Access Journals (Sweden)
Hiroyuki Takeya, Mohammed ElMassalami, Luis A Terrazos, Raul E Rapp, Rodrigo B Capaz, Hiroki Fujii, Yoshihiko Takano, Mathias Doerr and Sergey A Granovsky
2013-01-01
Full Text Available We follow the evolution of the electronic properties of the titled homologous series when n as well as the atomic type of A and M are varied where for n = 1, A = Ca, Sr and M = Rh, Ir while for n = 3, A = Ca, Sr and M = Rh. The crystal structure of n = 1 members is known to be CaRh2B2-type (Fddd, while that of n = 3 is Ca3Rh8B6-type (Fmmm; the latter can be visualized as a stacking of structural fragments from AM3B2 (P6/mmm and AM2B2. The metallic properties of the n = 1 and 3 members are distinctly different: on the one hand, the n = 1 members are characterized by a linear coefficient of the electronic specific heat γ ≈ 3 mJ mol−1 K−2, a Debye temperature θD ≈ 300 K, a normal conductivity down to 2 K and a relatively strong linear magnetoresistivity for fields up to 150 kOe. The n = 3 family, on the other hand, exhibits γ ≈ 18 mJ mol−1 K−2, θD ≈ 330 K, a weak linear magnetoresistivity and an onset of superconductivity (for Ca3Rh8B6, Tc = 4.0 K and Hc2 = 14.5 kOe, while for Sr3Rh8 B6, Tc = 3.4 K and Hc2 ≈ 4.0 kOe. These remarkable differences are consistent with the findings of the electronic band structures and density of state (DOS calculations. In particular, satisfactory agreement between the measured and calculated γ was obtained. Furthermore, the Fermi level, EF, of Ca3Rh8B6 lies at almost the top of a pronounced local DOS peak, while that of CaRh2B2 lies at a local valley: this is the main reason behind the differences between the, e.g., superconducting properties. Finally, although all atoms contribute to the DOS at EF, the contribution of the Rh atoms is the strongest.
Takeya, Hiroyuki; ElMassalami, Mohammed; Terrazos, Luis A; Rapp, Raul E; Capaz, Rodrigo B; Fujii, Hiroki; Takano, Yoshihiko; Doerr, Mathias; Granovsky, Sergey A
2013-01-01
We follow the evolution of the electronic properties of the titled homologous series when n as well as the atomic type of A and M are varied where for n = 1, A = Ca, Sr and M = Rh, Ir while for n = 3, A = Ca, Sr and M = Rh. The crystal structure of n = 1 members is known to be CaRh2B2-type (Fddd), while that of n = 3 is Ca3Rh8B6-type (Fmmm); the latter can be visualized as a stacking of structural fragments from AM3B2 (P6/mmm) and AM2B2. The metallic properties of the n = 1 and 3 members are distinctly different: on the one hand, the n = 1 members are characterized by a linear coefficient of the electronic specific heat γ ≈ 3 mJ mol−1 K−2, a Debye temperature θD ≈ 300 K, a normal conductivity down to 2 K and a relatively strong linear magnetoresistivity for fields up to 150 kOe. The n = 3 family, on the other hand, exhibits γ ≈ 18 mJ mol−1 K−2, θD ≈ 330 K, a weak linear magnetoresistivity and an onset of superconductivity (for Ca3Rh8B6, Tc = 4.0 K and Hc2 = 14.5 kOe, while for Sr3Rh8 B6, Tc = 3.4 K and Hc2 ≈ 4.0 kOe). These remarkable differences are consistent with the findings of the electronic band structures and density of state (DOS) calculations. In particular, satisfactory agreement between the measured and calculated γ was obtained. Furthermore, the Fermi level, EF, of Ca3Rh8B6 lies at almost the top of a pronounced local DOS peak, while that of CaRh2B2 lies at a local valley: this is the main reason behind the differences between the, e.g., superconducting properties. Finally, although all atoms contribute to the DOS at EF, the contribution of the Rh atoms is the strongest. PMID:27877576
The Hawaii trails project: comet-hunting in the main asteroid belt
Hsieh, H. H.
2009-10-01
Context: The mysterious solar system object 133P/(7968) Elst-Pizarro is dynamically asteroidal, yet displays recurrent comet-like dust emission. Two scenarios were hypothesized to explain this unusual behavior: 1) 133P is a classical comet from the outer solar system that has evolved onto a main-belt orbit or 2) 133P is a dynamically ordinary main-belt asteroid on which subsurface ice has recently been exposed. If 1) is correct, the expected rarity of a dynamical transition onto an asteroidal orbit implies that 133P could be alone in the main belt. In contrast, if 2) is correct, other icy main-belt objects should exist and could also exhibit cometary activity. Aims: Believing 133P to be a dynamically ordinary, yet icy main-belt asteroid, I set out to test the primary prediction of the hypothesis: that 133P-like objects should be common and could be found by an appropriately designed observational survey. Methods: I conducted just such a survey - the Hawaii Trails Project - of selected main-belt asteroids in a search for objects displaying cometary activity. Optical observations were made of targets selected from among the Themis, Koronis, and Veritas asteroid families, the Karin asteroid cluster, and low-inclination, kilometer-scale outer-belt asteroids, using the Lulin 1.0 m, small and moderate aperture research telescope system (SMARTS) 1.0 m, University of Hawaii 2.2 m, southern astrophysical research (SOAR) 4.1 m, Gemini North 8.1 m, Subaru 8.2 m, and Keck I 10 m telescopes. Results: I made 657 observations of 599 asteroids, discovering one active object now known as 176P/LINEAR, leading to the identification of the new cometary class of main-belt comets (MBCs). These results suggest that there could be ~100 currently active MBCs among low-inclination, kilometer-scale outer-belt asteroids. Physically and statistically, MBC activity is consistent with initiation by meter-sized impactors. The estimated rate of impacts and sizes of resulting active sites, however
BVI CCD photometry of the broad main-sequence globular cluster NGC 1851
International Nuclear Information System (INIS)
Alcaino, G.; Liller, W.; Alvarado, F.; Wenderoth, E.
1990-01-01
Three-color CCD C-M diagrams are presented for the globular cluster NGC 1851, showing an extreme breadth of the main-sequence, similar to that of Omega Centauri. It is found that the main-sequence turnoff points are located at V(TO) = 19.44 + or - 0.10, with colors at B-V = 0.54 + or - 0.02, V-I = 0.61 + or - 0.02, and B-I = 1.15 + or - 0.03. The best fit to the VandenBerg and Bell (1985) isochrones is shown to be all C-M diagrams with Y = 0.20, Fe/H abundance ratio = -1.27, and (m-M)v = 15.45. It is concluded that NGC 1851 has a Delta V(TO - HB) = 3.34 + or - 0.10 and an age of 16 + or - 2 Gyr. 29 refs
Hyperglycemia induces mixed M1/M2 cytokine profile in primary human monocyte-derived macrophages.
Moganti, Kondaiah; Li, Feng; Schmuttermaier, Christina; Riemann, Sarah; Klüter, Harald; Gratchev, Alexei; Harmsen, Martin C; Kzhyshkowska, Julia
2017-10-01
Hyperglycaemia is a key factor in diabetic pathology. Macrophages are essential regulators of inflammation which can be classified into two major vectors of polarisation: classically activated macrophages (M1) and alternatively activated macrophages (M2). Both types of macrophages play a role in diabetes, where M1 and M2-produced cytokines can have detrimental effects in development of diabetes-associated inflammation and diabetic vascular complications. However, the effect of hyperglycaemia on differentiation and programming of primary human macrophages was not systematically studied. We established a unique model to assess the influence of hyperglycaemia on M1 and M2 differentiation based on primary human monocyte-derived macrophages. The effects of hyperglycaemia on the gene expression and secretion of prototype M1 cytokines TNF-alpha and IL-1beta, and prototype M2 cytokines IL-1Ra and CCL18 were quantified by RT-PCR and ELISA. Hyperglycaemia stimulated production of TNF-alpha, IL-1beta and IL-1Ra during macrophage differentiation. The effect of hyperglycaemia on TNF-alpha was acute, while the stimulating effect on IL-1beta and IL-1Ra was constitutive. Expression of CCL18 was supressed in M2 macrophages by hyperglycaemia. However the secreted levels remained to be biologically significant. Our data indicate that hyperglycaemia itself, without additional metabolic factors induces mixed M1/M2 cytokine profile that can support of diabetes-associated inflammation and development of vascular complications. Copyright © 2016 Elsevier GmbH. All rights reserved.
TASKA-M exhaust system and its main components
International Nuclear Information System (INIS)
Kleefeldt, K.W.; Mueller, R.A.; Schramm, K.
1985-01-01
TASKA-M is a study for a mirror based D-T plasma device for fusion technology tests. Mature technology was applied whereever possible. The axial confinement time is relatively short, resulting in a large gas throughput compared to the fusion power level of 6.8 MW. The technological requirements of the exhaust system will not cause undue development problems in either of the two major areas: highly loaded dumps for the conversion of the escaping particle and plasma streams to thermal gas; vacuum pumping facilities. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Takayama-Muromachi, E.; Kawashima, T.; Matsui, Y. [National Institute for Research in Inorganic Materials, Ibaraki (Japan)
1994-12-31
We found a new series of oxycarbonate superconductors in the Ba-Ca-Cu-C-O system under high pressure of 5 GPa. Their ideal formula is (Cu{sub 0.5}C{sub 0.5}){sub m}Ba{sub m+1}Ca{sub n-1}Cu{sub n}O{sub 2}({sub m+n})+1 ((Cu,C)-m(m+1)(n-1)n). Thus far, n=3, 4 members of the m=1 series, (Cu,C)-1223 and (Cu,C)-1234, have been prepared in bulk while n=4, 5 members, (Cu,C)-2334 and (Cu,C)-2345, have been prepared for the m=2 series. (Cu,C)-1223 shows superconductivity below 67 K while T{sub c}`s of other compounds are above 110 K. In particular, (Cu,C)=1234 has the highest T{sub c} of 117 K.
Causal Analysis of The Uncontrolled Moderator In The HFEF Main Cell
Energy Technology Data Exchange (ETDEWEB)
Posegate, Charles R. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Crofts, Bryan P. [Idaho National Lab. (INL), Idaho Falls, ID (United States)
2012-12-01
On 11/07/2012 while investigating the cause of defects in neutron radiography film at HFEF, oil was discovered near the elevator shaft located at the 4M location within the Main Cell. Subsequent investigation identified oil (untracked moderator) in several locations ofthe HFEF Main Cell. Initial analysis determined that oil leaking from a 1M shielding window had leaked past a compensatory containment system resulting in a thin layer of oil found in several locations on the main cell floor. The result of this condition is uncontrolled moderator in moderator controlled zones, which is a violation of Criticality Hazard Control Statements (CHCS) for HFEF.
Directory of Open Access Journals (Sweden)
Wei-Ju Chung
Full Text Available Radiation therapy for cancer patients works by ionizing damage to nuclear DNA, primarily by creating double-strand breaks (DSB. A major shortcoming of traditional radiation therapy is the set of side effect associated with its long-range interaction with nearby tissues. Low-energy Auger electrons have the advantage of an extremely short effective range, minimizing damage to healthy tissue. Consequently, the isotope ⁹⁹mTc, an Auger electron source, is currently being studied for its beneficial potential in cancer treatment. We examined the dose effect of a pyrene derivative ⁹⁹mTc complex on plasmid DNA by using gel electrophoresis in both aqueous and methanol solutions. In aqueous solutions, the average yield per decay for double-strand breaks is 0.011±0.005 at low dose range, decreasing to 0.0005±0.0003 in the presence of 1 M dimethyl sulfoxide (DMSO. The apparent yield per decay for single-strand breaks (SSB is 0.04±0.02, decreasing to approximately a fifth with 1 M DMSO. In methanol, the average yield per decay of DSB is 0.54±0.06 and drops to undetectable levels in 2 M DMSO. The SSB yield per decay is 7.2±0.2, changing to 0.4±0.2 in the presence of 2 M DMSO. The 95% decrease in the yield of DSB in DMSO indicates that the main mechanism for DSB formation is through indirect effect, possibly by cooperative binding or clustering of intercalators. In the presence of non-radioactive ligands at a near saturation concentration, where radioactive Tc compounds do not form large clusters, the yield of SSB stays the same while the yield of DSB decreases to the value in DMSO. DSBs generated by ⁹⁹mTc conjugated to intercalators are primarily caused by indirect effects through clustering.
Chung, Wei-Ju; Cui, Yujia; Huang, Feng-Yun J; Tu, Tzu-Hui; Yang, Tzu-Sen; Lo, Jem-Mau; Chiang, Chi-Shiun; Hsu, Ian C
2014-01-01
Radiation therapy for cancer patients works by ionizing damage to nuclear DNA, primarily by creating double-strand breaks (DSB). A major shortcoming of traditional radiation therapy is the set of side effect associated with its long-range interaction with nearby tissues. Low-energy Auger electrons have the advantage of an extremely short effective range, minimizing damage to healthy tissue. Consequently, the isotope ⁹⁹mTc, an Auger electron source, is currently being studied for its beneficial potential in cancer treatment. We examined the dose effect of a pyrene derivative ⁹⁹mTc complex on plasmid DNA by using gel electrophoresis in both aqueous and methanol solutions. In aqueous solutions, the average yield per decay for double-strand breaks is 0.011±0.005 at low dose range, decreasing to 0.0005±0.0003 in the presence of 1 M dimethyl sulfoxide (DMSO). The apparent yield per decay for single-strand breaks (SSB) is 0.04±0.02, decreasing to approximately a fifth with 1 M DMSO. In methanol, the average yield per decay of DSB is 0.54±0.06 and drops to undetectable levels in 2 M DMSO. The SSB yield per decay is 7.2±0.2, changing to 0.4±0.2 in the presence of 2 M DMSO. The 95% decrease in the yield of DSB in DMSO indicates that the main mechanism for DSB formation is through indirect effect, possibly by cooperative binding or clustering of intercalators. In the presence of non-radioactive ligands at a near saturation concentration, where radioactive Tc compounds do not form large clusters, the yield of SSB stays the same while the yield of DSB decreases to the value in DMSO. DSBs generated by ⁹⁹mTc conjugated to intercalators are primarily caused by indirect effects through clustering.
Binary pulsar PSR 1718-19 contains a stripped main-sequence turn-off star
International Nuclear Information System (INIS)
Zwitter, T.
1993-05-01
Lyne et al. (1993) have recently announced the discovery of a 1-second globular cluster pulsar, 1718-19, in a 6.2-hour binary system which is embedded in a cloud of material originating from the companion star. However the incident flux of the pulsar's radiation on the companion is too low to ablate it and a main sequence companion is too small to fill its Roche lobe. Here I argue that the companion is a stripped turn-off star of 0.2-0.4 solar masses (M sun ) and with approx. 0.1M sun helium core. It has approx. 1.8-times larger radius than a main sequence star of equal mass. Its position in the Hertzsprung-Russell diagram overlaps that of a ∼ 0.65M sun main-sequence star. The evolutionary state of the companion and the highly magnetized slowly rotating neutron star place the system on the verge of the low mass X-ray binary phase. (author). 19 refs, 2 figs
Lifescience Database Archive (English)
Full Text Available ineered: Yes Metal Binding Protein M.Nagae, A.Nozawa, N.Koizumi, H.Sano, H.Hashimot...n 2 Name=Cbl2; Arabidopsis Thaliana Molecule: Calcineurin B-Like Protein 2; Chain: A; Fragment: Residues 32-220; Synonym: Atcbl2; Eng
Reamey, Becky Avery
2009-01-01
The battle of the Little Big Horn in 1876 was one of the last great wars fought by Native Americans on a grassy battlefield. The battle was fought over territory and the right to live in the Dakota and Montana territories. The Native Americans won the battle of Little Big Horn but eventually lost the war and were forced to live on a reservation…
Takeya, Hiroyuki; ElMassalami, Mohammed; Terrazos, Luis A; Rapp, Raul E; Capaz, Rodrigo B; Fujii, Hiroki; Takano, Yoshihiko; Doerr, Mathias; Granovsky, Sergey A
2013-06-01
We follow the evolution of the electronic properties of the titled homologous series when n as well as the atomic type of A and M are varied where for n = 1, A = Ca, Sr and M = Rh, Ir while for n = 3, A = Ca, Sr and M = Rh. The crystal structure of n = 1 members is known to be CaRh 2 B 2 -type ( Fddd ), while that of n = 3 is Ca 3 Rh 8 B 6 -type ( Fmmm ); the latter can be visualized as a stacking of structural fragments from AM 3 B 2 ( P 6/ mmm ) and AM 2 B 2 . The metallic properties of the n = 1 and 3 members are distinctly different: on the one hand, the n = 1 members are characterized by a linear coefficient of the electronic specific heat γ ≈ 3 mJ mol -1 K -2 , a Debye temperature θ D ≈ 300 K, a normal conductivity down to 2 K and a relatively strong linear magnetoresistivity for fields up to 150 kOe. The n = 3 family, on the other hand, exhibits γ ≈ 18 mJ mol -1 K -2 , θ D ≈ 330 K, a weak linear magnetoresistivity and an onset of superconductivity (for Ca 3 Rh 8 B 6 , T c = 4.0 K and H c2 = 14.5 kOe, while for Sr 3 Rh 8 B 6 , T c = 3.4 K and H c2 ≈ 4.0 kOe). These remarkable differences are consistent with the findings of the electronic band structures and density of state (DOS) calculations. In particular, satisfactory agreement between the measured and calculated γ was obtained. Furthermore, the Fermi level, E F , of Ca 3 Rh 8 B 6 lies at almost the top of a pronounced local DOS peak, while that of CaRh 2 B 2 lies at a local valley: this is the main reason behind the differences between the, e.g., superconducting properties. Finally, although all atoms contribute to the DOS at E F , the contribution of the Rh atoms is the strongest.
M1 transitions in the (sdg) boson model
Energy Technology Data Exchange (ETDEWEB)
Kuyucak, S.; Morrison, I.
1988-03-03
Using the 1/N expansion technique we derive expressions for ..beta.. -> g, ..gamma.. -> g and ..gamma.. -> ..gamma.. M1 transitions in a general boson model. The M1 matrix elements in the sdg-boson model are similar in form to those in the neutron-proton IBM. Comparisons are made to some selected M1 data exhibiting collective character.
Lifescience Database Archive (English)
Full Text Available Nucleic acids (DNA and RNA) are found to induce the innate immunity - We will elucidate detailed molecular m...Rapid advances in our understanding of innate immune systems, which provide immediate defense agai...sistance effects in mice. We would like to elucidate detailed molecular mechanism
Energy Technology Data Exchange (ETDEWEB)
Fukasawa, Y.; Sugiyama, T. [Yamaguchi University, Yamaguchi (Japan). Faculty of Engineering; Kaneko, S.; Mukoyama, T.; Iwaki, T. [Pacific Consultants K.K., Tokyo (Japan)
1995-12-15
In order to investigate the feasibility of construction of cable-supported bridge at the site where ground condition is poor and/or air route restriction shoed be considered the static and dynamic characteristics of both self-anchored cable-stayed bridge with relatively low tower and self-anchored suspension bridge have been discussed. The main span length of bridge considered here is about 500 m because of the fact that stress resultant of main girder caused by design loads is considerably lower than its design strength in the existing cable-supported bridges of this scale. The result shows that the application of both types of cable-supported bridges to the above described site may be possible as enough static safety and economy are ensured. It has been also revealed that no problem may occur from both wind and earthquake resistant viewpoints. 10 refs., 24 figs., 8 tabs.
Architecture of human mTOR complex 1.
Aylett, Christopher H S; Sauer, Evelyn; Imseng, Stefan; Boehringer, Daniel; Hall, Michael N; Ban, Nenad; Maier, Timm
2016-01-01
Target of rapamycin (TOR), a conserved protein kinase and central controller of cell growth, functions in two structurally and functionally distinct complexes: TORC1 and TORC2. Dysregulation of mammalian TOR (mTOR) signaling is implicated in pathologies that include diabetes, cancer, and neurodegeneration. We resolved the architecture of human mTORC1 (mTOR with subunits Raptor and mLST8) bound to FK506 binding protein (FKBP)-rapamycin, by combining cryo-electron microscopy at 5.9 angstrom resolution with crystallographic studies of Chaetomium thermophilum Raptor at 4.3 angstrom resolution. The structure explains how FKBP-rapamycin and architectural elements of mTORC1 limit access to the recessed active site. Consistent with a role in substrate recognition and delivery, the conserved amino-terminal domain of Raptor is juxtaposed to the kinase active site. Copyright © 2016, American Association for the Advancement of Science.
Soldano, Stefano; Pizzorni, Carmen; Paolino, Sabrina; Trombetta, Amelia Chiara; Montagna, Paola; Brizzolara, Renata; Ruaro, Barbara; Sulli, Alberto; Cutolo, Maurizio
2016-01-01
Alternatively activated (M2) macrophages are phenotypically characterized by the expression of specific markers, mainly macrophage scavenger receptors (CD204 and CD163) and mannose receptor-1 (CD206), and participate in the fibrotic process by over-producing pro-fibrotic molecules, such as transforming growth factor-beta1 (TGFbeta1) and metalloproteinase (MMP)-9. Endothelin-1 (ET-1) is implicated in the fibrotic process, exerting its pro-fibrotic effects through the interaction with its receptors (ETA and ETB). The study investigated the possible role of ET-1 in inducing the transition from cultured human macrophages into M2 cells. Cultured human monocytes (THP-1 cell line) were activated into macrophages (M0 macrophages) with phorbol myristate acetate and subsequently maintained in growth medium (M0-controls) or treated with either ET-1 (100nM) or interleukin-4 (IL-4, 10ng/mL, M2 inducer) for 72 hours. Similarly, primary cultures of human peripheral blood monocyte (PBM)-derived macrophages obtained from healthy subjects, were maintained in growth medium (untreated cells) or treated with ET-1 or IL-4 for 6 days. Both M0 and PBM-derived macrophages were pre-treated with ET receptor antagonist (ETA/BRA, bosentan 10-5M) for 1 hour before ET-1 stimulation. Protein and gene expression of CD204, CD206, CD163, TGFbeta1 were analysed by immunocytochemistry, Western blotting and quantitative real time polymerase chain reaction (qRT-PCR). Gene expression of interleukin(IL)-10 and macrophage derived chemokine (CCL-22) was evaluated by qRT-PCR. MMP-9 production was investigated by gel zymography. ET-1 significantly increased the expression of M2 phenotype markers CD204, CD206, CD163, IL-10 and CCL-22, and the production of MMP-9 in both cultures of M0 and PBM-derived macrophages compared to M0-controls and untreated cells. In cultured PBM-derived macrophages, ET-1 increased TGFbeta1 protein and gene expression compared to untreated cells. The ET-1-mediated effects were
M1 transitions in the (sdg) boson model
Kuyucak, S.; Morrison, I.
1988-03-01
Using the {1}/{N} expansion technique we derive expressions for β→g, γ→g and γ→γ M1 transitions in a general boson model. The M1 matrix elements in the sdg-boson model are similar in form to those in the neutron-proton IBM. Comparisons are made to some selected M1 data exhibiting collective character.
2010-04-01
... 26 Internal Revenue 5 2010-04-01 2010-04-01 false ACP test. 1.401(m)-2 Section 1.401(m)-2 Internal... TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.401(m)-2 ACP test. (a) Actual contribution percentage (ACP) test—(1) In general—(i) ACP test formula. A plan satisfies the ACP test for a plan year only...
M1 transitions in the (sdg) boson model
International Nuclear Information System (INIS)
Kuyucak, S.; Tuebingen Univ.; Morrison, I.
1988-01-01
Using the 1/N expansion technique we derive expressions for β → g, γ → g and γ → γ M1 transitions in a general boson model. The M1 matrix elements in the sdg-boson model are similar in form to those in the neutron-proton IBM. Comparisons are made to some selected M1 data exhibiting collective character. (orig.)
Hydrogen retention properties of co-deposition under high-density plasmas in TRIAM-1M
International Nuclear Information System (INIS)
Tokitani, M.; Miyamoto, M.; Tokunaga, K.; Fujiwara, T.; Yoshida, N.; Sakamoto, M.; Zushi, H.; Hanada, K.; TRIAM Group,; Nagata, S.; Tsuchiya, B.
2007-01-01
Retention of hydrogen in co-deposits formed under high-density plasma discharge in TRIAM-1M was studied. In order to quantify the retained hydrogen, material probe experiments were performed under the high-density (n at e ∼10 19 m -3 ) discharges. After the exposure to the plasma, the quantitative analysis of deposition, hydrogen retention, and microscopic modification of specimens were performed by means of ion beam analysis and transmission electron microscopy. The co-deposits mainly consisted of Mo. The deposition rate of Mo was about ten times higher than that of the low-density discharge case. The hydrogen concentrations (H/Mo) retained in the co-deposits were 0.06-0.17, which was much higher than that in bulk-Mo and almost equal to the low-density case. These results indicate that as long as the co-deposition layers are continuously formed, strong wall pumping in TRIAM-1M is maintained during the discharges
M1-transitions in the MIT bag model
International Nuclear Information System (INIS)
Hackman, R.H.; Deshpande, N.G.; Dicus, D.A.; Teplitz, V.L.
1977-03-01
In the MIT bag model, the M1-transitions of low lying hadrons are investigated. The following calculations are performed: 32 hadron masses are recomputed with a choice of bag parameters designed to give the correct values for the proton magnetic moment, μ/sub p/, and several masses, M/sub rho/ M/sub ω/ M/sub Δ/ M/sub Ω/, and M/sub D/; (2) eta, eta', eta/sub c/ mixing is computed in an untrustworthy approximation; and the widths for 38 M1-transitions are computed
Study of gamma-ray induced variability on F1M1-F3M3 distant tomato hybrids
International Nuclear Information System (INIS)
Siromeatnicov, Iulia; Cotenco, Eugenia; Ciobanu, Renata
2013-01-01
The outcome of the evaluation of the gamma radiation's action, the growth and development tomato plant has shown that the coefficient of variation of plant height character is on the rise with increasing doses of gamma radiation. The hybrid combination F 1 M 1 (L.hpriz.1998) irradiated with dose 150 Gy variant presented superior value a towards scrutiny for plant height of the characters, number of flowers and fruits per bunch, number of fruits per plant and fruit mass of. The character F 2 M 2 generation plant height registered diminished value compared to F 1 M 1 generation. The highest value was recorded at the hybrid combination F 2 M 2 L.hpriz.1998 200 Gy treated dose. The evaluation research has highlighted that at the doses 100 Gy, 150 Gy, 200 Gy, have confirmed an increase in characters of reproductive system: the number of flowers and fruits per bunch, number of fruits per plant, fruit mass and reduction of the characters waist and height of placing of the first inflorescences plant. Similar aspects with some differences as low as hybrid combination Lhpi1998 in relation to the radiation doses used under study were confirmed in the case F 3 M 3 . (authors)
ONKALO - Main drawings in 2007
International Nuclear Information System (INIS)
2008-05-01
characterisation drifts and niches accessed by the personnel shaft 1 and an access tunnel. The main characterisation level is located at a depth of -420 metres. Demonstrations related to the repository technology will be mainly carried out on the main level. The lower characterisation level at a depth of -520 metres could mainly be used to assess the feasibility of the two-storey layout. The total underground volume of ONKALO is approximately 410 000 m 3 , the combined length of tunnels and shafts being 10.8 km. The access tunnel from the surface to the lower level consists approximately of 5.6 km of tunnelling with an inclination of 1:10. The inlet air shaft 1, exhaust air shaft 1 and personnel shaft 1 will be raise bored to lower level. The personnel shaft 1 will be equipped with technical systems and a man cage for personnel transport. Connecting tunnels from the access tunnel to the shafts at every 1 to 1.5 km will make it easier to ventilate and evacuate the ONKALO facility. (orig.)
Quench Heater Experiments on the LHC Main Superconducting Magnets
Rodríguez-Mateos, F; Pugnat, P; Sanfilippo, S; Schmidt, R; Siemko, A; Sonnemann, F
2000-01-01
In case of a quench in one of the main dipoles and quadrupoles of CERN's Large Hadron Collider (LHC), the magnet has to be protected against excessive temperatures and high voltages. In order to uniformly distribute the stored magnetic energy in the coils, heater strips installed in the magnet are fired after quench detection. Tests of different quench heater configurations were performed on various 1 m long model and 15 m long prototype dipole magnets, as well as on a 3 m long prototype quad...
Transient analysis of an M/M/1 queue with multiple vacations
Directory of Open Access Journals (Sweden)
Kaliappan Kalidass
2014-05-01
Full Text Available In this paper, we have obtained explicit expressions for the time dependent probabilities of the M/M/1 queue with server vacations under a multiple vacation scheme. The corresponding steady state probabilities have been obtained. We also obtain the time dependent performance measures of the systems
RuO4-mediated oxidation of secondary amines: Part 1. Are hydroxylamines main intermediates?
Directory of Open Access Journals (Sweden)
Florea Cristina A.
2016-01-01
Full Text Available The RuO4-catalyzed oxidation of secondary amines Bn-NH-CH2R (1a-b; R=H, Me gave mainly amides, but minute amounts of nitrones PhCH=N(O-CH2R (9a-b and traces of Bn-N(OH-CH2R (R=H, 4a were also detected. In the presence of cyanide, up to 22 reaction products were identified, but mainly α-aminonitriles. Comparison of the oxidation products of 1a-b with those of 4a-b, 9a-b, and Bn-N(O=CHR (10a-b showed that 4a-b cannot be main reaction intermediates formed from 1a-b.
Stochasticity and the m = 1 mode in tokamaks
International Nuclear Information System (INIS)
Izzo, R.; Monticello, D.A.; Stodiek, W.; Park, W.
1986-05-01
It has recently been proposed that stochasticity resulting from toroidal coupling could lead to a saturation of the m = 1 internal mode in tokamaks. We present results from the nonlinear evolution of the m = 1 mode with toroidal coupling that show that stochasticity is not enough to cause saturation of the m = 1 mode
Spatial variability of anaerobic processes and wastewater pH in force mains
DEFF Research Database (Denmark)
Rudelle, Elise Alice; Nielsen, Asbjørn Haaning; Hvitved-Jacobsen, Thorkild
2016-01-01
The present study focuses on anaerobic organic matter transformation processes in force mains for the purpose of improving existing sewer process models. Wastewater samples were obtained at 100 m intervals from a 1 km long pilot scale force main and measured for several wastewater parameters. Tra...
Molybdenum emission from impurity-induced m= 1 snake-modes on the Alcator C-Mod tokamak
Energy Technology Data Exchange (ETDEWEB)
Delgado-Aparicio, L. [Princeton Plasma Physics Laboratory, Princeton, New Jersey 08540 (United States); MIT - Plasma Science and Fusion Center, Cambridge, Massachusetts 02139 (United States); Bitter, M.; Gates, D.; Hill, K.; Pablant, N. [Princeton Plasma Physics Laboratory, Princeton, New Jersey 08540 (United States); Granetz, R.; Reinke, M.; Podpaly, Y.; Rice, J. [MIT - Plasma Science and Fusion Center, Cambridge, Massachusetts 02139 (United States); Beiersdorfer, P. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Sugiyama, L. [MIT - Laboratory for Nuclear Science, Cambridge, Massachusetts 02139 (United States)
2012-10-15
A suite of novel high-resolution spectroscopic imaging diagnostics has facilitated the identification and localization of molybdenum impurities as the main species during the formation and lifetime of m= 1 impurity-induced snake-modes on Alcator C-Mod. Such measurements made it possible to infer, for the first time, the perturbed radiated power density profiles from which the impurity density can be deduced.
Directory of Open Access Journals (Sweden)
Karina Sánchez-Reyes
2014-01-01
Full Text Available Cervical cancer (CC is the second most common cancer among women worldwide. Infection with human papillomavirus (HPV is the main risk factor for developing CC. Macrophages are important immune effector cells; they can be differentiated into two phenotypes, identified as M1 (classically activated and M2 (alternatively activated. Macrophage polarization exerts profound effects on the Toll-like receptor (TLR profile. In this study, we evaluated whether the supernatant of human CC cells HeLa, SiHa, and C-33A induces a shift of M1 macrophage toward M2 macrophage in U937-derived macrophages. Results. The results showed that soluble factors secreted by CC cells induce a change in the immunophenotype of macrophages from macrophage M1 into macrophage M2. U937-derived macrophages M1 released proinflammatory cytokines and nitric oxide; however, when these cells were treated with the supernatant of CC cell lines, we observed a turnover of M1 toward M2. These cells increased CD163 and IL-10 expression. The expression of TLR-3, -7, and -9 is increased when the macrophages were treated with the supernatant of CC cells. Conclusions. Our result strongly suggests that CC cells may, through the secretion of soluble factors, induce a change of immunophenotype M1 into M2 macrophages.
Energy Technology Data Exchange (ETDEWEB)
Dias, Carla Roberta de Barros Rodrigues
2005-07-01
Nuclear Medicine is a speciality that uses radioisotopes for the diagnosis or treatment of diseases and it is considered one of the best tools among the diagnostic modalities for detection of cancer. {sup 99m}Tc is one of the main isotopes for labelling antibodies and in Nuclear Medicine in general, due to its adequate physical properties, availability and low cost. Labelled monoclonal antibodies have shown promising results for diagnosis and therapy of cancer and their use has brought great experimental and clinical advances in the field of oncology. The main clinical applications of immunoscintigraphy with monoclonal antibodies are staging and evaluation of tumoral reappearance. The antibodies employed in this work were: OIR-CEA-1, a murine monoclonal antibody that acts directly against CEA expressed in several neoplasia in particular those from the gastrointestinal tract (colorectal cancer) and IOR-EGF/R3, a murine monoclonal antibody that binds to the external domain of EGF-R and it has been used in the diagnosis of tumors of epithelial origin. The objectives of this work were the development and optimization of the reduction and purification processes, the radiolabelling techniques and quality control procedures (radiochemical, immunoreactivity and cystein challenge) and imaging studies of monoclonal antibodies OIR-CEA-1 and IOR-EGF/R3, using the simple, fast and efficient method of direct labelling of the antibody with {sup 99m}Tc. The final results was the definition of the best conditions for the preparation of lyophilized reactive kits of OIR-CEA-1 and IOR- EGF/R3 for an efficient diagnostic application in Nuclear Medicine. The most adequate conditions for the labelling of the antibodies were: 1.0 mg Ab, 29 {mu}L MDP, 3.0 {mu}g Sn{sup 2+}, 1 mL of {sup 99m}Tc and 30 min. reaction time. With these conditions the labelling yield was always higher than 95% and the maximum activity of {sup 99m}Tc was about 2220 MBq (60 mCi). The evidences of the efficiency and
Leakage detection in underground gas mains with radioaktive argon
International Nuclear Information System (INIS)
Schmitz, J.
1975-01-01
In the field of gas supply, radionuclide techniques are suitable for the routine monitoring of transport mains by means of highly active tracer clouds and a measuring scraper as well as for exact leakage detection in local gas distribution systems. Very good results are obtained in the case of mains lying lower than 1.5 m if the length and alignment of the pipe section allow a towing probe to be pulled through. This was investigated systematically on a model stretch under practical conditions. The attempts to detect leakages were made with the aid of the radioactive isotope 41 Ar. Under conditions close to practice concerning pipe bedding, branching, pre-pressure, and leakage diameter, a leak with leakage rates as small as approx. 1 l/min could be measured with the aid of a towing probe with a precision of +-0.5 m. This accuracy is another advantage of this method. Branching and fittings with a big dead volume do not interfere with the evaluation. The investment for this method can be compared to other physical/technical investigations on mains, e.g. weld seam tests. (orig./LN) [de
Super Phenix 1: in Service inspection of main and safety tanks weldments
International Nuclear Information System (INIS)
Asty, Michel; Vertut, Jean; Argous, J.P.
1980-05-01
In service inspection of the main tank of the Super Phenix 1 reactor is a new demand as compared to Phenix: the authorities have asked that surface and internal defects could be detected and their evolution monitored in the future. The presence of thermal baffles inside the main tank precludes the access on that side: the distance between the main and safety tanks takes into account the room needed for an In Service Inspection module. An inspection vehicle is presently under development, which includes ultrasonic examination (focussed probes) and visual examination (TV cameras) capabilities. We briefly describe the techniques that have been selected for ultrasonic testing and also for the vehicle and its guidance between the tanks
Super Phenix 1: In-service inspection of main and safety tanks weldments
Energy Technology Data Exchange (ETDEWEB)
Asty, M [DTech/STA, Centre d' Etudes Nucleaires de Saclay (France); Vertut, J [DPR/STEP, Centre d' Etudes Nucleaires de Saclay (France); Argous, J P [DRNR/STRS, Centre d' Etudes Nucleaires de Cadarache (France)
1980-11-01
In Service Inspection of the main tank of the Super Phenix 1 reactor is a new demand compared to Phenix: the authorities have asked that surface and internal defects be detected and their evolution monitored in the future. The presence of thermal baffles inside the main tank precludes the access on that side: the distance between the main and safety tanks takes into account the room needed for an In Service Inspection module. An inspection vehicle is presently under development, which includes ultrasonic examination (focussed probes) and visual examination (TV cameras) capabilities. We briefly describe the techniques that have been selected for ultrasonic testing and also for the vehicle and its guidance between the tanks. (author)
Super Phenix 1: In-service inspection of main and safety tanks weldments
International Nuclear Information System (INIS)
Asty, M.; Vertut, J.; Argous, J.P.
1980-01-01
In Service Inspection of the main tank of the Super Phenix 1 reactor is a new demand compared to Phenix: the authorities have asked that surface and internal defects be detected and their evolution monitored in the future. The presence of thermal baffles inside the main tank precludes the access on that side: the distance between the main and safety tanks takes into account the room needed for an In Service Inspection module. An inspection vehicle is presently under development, which includes ultrasonic examination (focussed probes) and visual examination (TV cameras) capabilities. We briefly describe the techniques that have been selected for ultrasonic testing and also for the vehicle and its guidance between the tanks. (author)
Main Battle Tank Flexible Gun Tube Disturbance Model: Three-Segment Model
National Research Council Canada - National Science Library
Sneck, Henry
2002-01-01
... them. It was found that, contrary to the previously analyzed two degree-of-freedom segment model, the muzzle-end segment could be stabilized by the proper choice of transfer functions and elevation driveline response...
International Nuclear Information System (INIS)
Vasquez A, M.; Murillo C, V.; Arbayza F, J.; Sanchez S, P.; Cabrera S, C.
2016-10-01
The radiation absorbed dose in the fetus of a pregnant woman during thyroid studies is estimated through the analysis of the bio-kinetics of radiopharmaceuticals containing I"1"3"1 (iodide) or Tc"9"9"m (pertechnetate). MIRD formalism and its representation Cristy-Eckerman are used. The results indicate that the absorbed dose by the fetus of a woman of 3, 6 and 9 months of gestation due to Tc"9"9"m emissions is lower than that obtained by I"1"3"1; represent 34.7%, 6% and 3.5% of the dose generate by the iodide. The auto-dose in the fetus of a pregnant woman is mainly due to the local energy deposition of the beta and gamma emissions of I"1"3"1, being greater than the one reported by the gamma emissions and conversion electrons of the Tc"9"9"m, for fetuses of 6 and 9 months. The dose incorporated to the fetus due to the organs of the maternal tissues, which are part of the bio-kinetics, are basically due to the emission of its gamma photons and correspond to 38.50% /60.52% in fetuses of 3 months, 64.71% /12.43% in fetuses of 6 months and 69.79% /10.97% in fetuses of 9 months for the radiopharmaceuticals Tc"9"9"m (pertechnetate) / I"1"3"1 (iodide). The organs of bio-kinetics that contribute to the fetus dose are mainly due to the bladder, followed by the rest, and small intestine (fetuses of 3 months); of the rest, followed by the small intestine and bladder (fetuses of 6 months); of the bladder, followed by the small intestine and stomach (fetuses of 9 months) when using I"1"3"1; while for the Tc"9"9"m the bladder and rest contribute (fetuses of 3 months); of the placenta, followed by the rest and bladder (fetuses of 6 and 9 months). (Author)
Investigation of aflatoxin M1 degradation in milk
Directory of Open Access Journals (Sweden)
Smajlović Ahmed
2012-01-01
Full Text Available Aflatoxin M1 is a highly toxic 4-hydroxylated metabolite of aflatoxins B1 and B2. It is one of the most potent hepatocarcinogens, mutagens, teratogens and immunosuppressors. Feed is often contaminated with aflatoxigenic moulds and aflatoxins with a high possibility of contaminating milk and dairy products with aflatoxin M1. Samples of artificially contaminated milk were exposed to the effects of physical conditions (temperature of -18oC and for microwaves in a microwave oven, time (during the period from 1 to 12 months and a combination of the above mentioned conditions. Following this, levels of aflatoxin M1 degradation were established by using the ELISA method. An insignificant decrease in concentration of toxin was observed which indicates that a temperature of -18°C does not significantly influence the concentration of aflatoxin M1 in the artificially contaminated milk. At the same time, treatment of milk with microwaves in a microwave oven showed an insignificant influence on the percentage of aflatoxin M1 absorbance.
The Armys M-1 Abrams, M-2/M-3 Bradley, and M-1126 Stryker: Background and Issues for Congress
2016-04-05
the Army John McHugh , urging instead the limited production of 70 M-1A2SEPv2 tanks per year from FY2013 to FY2017. 32 Congress subsequently decided...House Members sent a letter to Secretary of the Army McHugh expressing concern over the Army’s failure to fund production of the M-1A2. Congress...John McHugh by Rep. Sander Levin and Rep. Mike Rogers, May 6, 2011. 33 See CRS Reports: CRS Report R43323, Defense: FY2014 Authorization and
Rac2 controls tumor growth, metastasis and M1-M2 macrophage differentiation in vivo.
Directory of Open Access Journals (Sweden)
Shweta Joshi
Full Text Available Although it is well-established that the macrophage M1 to M2 transition plays a role in tumor progression, the molecular basis for this process remains incompletely understood. Herein, we demonstrate that the small GTPase, Rac2 controls macrophage M1 to M2 differentiation and the metastatic phenotype in vivo. Using a genetic approach, combined with syngeneic and orthotopic tumor models we demonstrate that Rac2-/- mice display a marked defect in tumor growth, angiogenesis and metastasis. Microarray, RT-PCR and metabolomic analysis on bone marrow derived macrophages isolated from the Rac2-/- mice identify an important role for Rac2 in M2 macrophage differentiation. Furthermore, we define a novel molecular mechanism by which signals transmitted from the extracellular matrix via the α4β1 integrin and MCSF receptor lead to the activation of Rac2 and potentially regulate macrophage M2 differentiation. Collectively, our findings demonstrate a macrophage autonomous process by which the Rac2 GTPase is activated downstream of the α4β1 integrin and the MCSF receptor to control tumor growth, metastasis and macrophage differentiation into the M2 phenotype. Finally, using gene expression and metabolomic data from our Rac2-/- model, and information related to M1-M2 macrophage differentiation curated from the literature we executed a systems biologic analysis of hierarchical protein-protein interaction networks in an effort to develop an iterative interactome map which will predict additional mechanisms by which Rac2 may coordinately control macrophage M1 to M2 differentiation and metastasis.
Quadrupole decay strength of the M1 scissors mode of {sup 156}Gd
Energy Technology Data Exchange (ETDEWEB)
Beck, T.; Beller, J.; Gayer, U.; Mertes, L.; Pai, H.; Pietralla, N.; Ries, P.; Romig, C.; Werner, V.; Zweidinger, M. [IKP, TU Darmstadt (Germany); Derya, V. [IKP, Universitaet zu Koeln (Germany); Isaak, J.; Loeher, B.; Savran, D. [EMMI, GSI, Darmstadt (Germany); FIAS, Frankfurt (Germany); Scheck, M. [IKP, TU Darmstadt (Germany); School of Engineering, UWS, Paisley (United Kingdom); SUPA, Glasgow (United Kingdom); Tornow, W.; Weller, H.R. [Duke University, Durham (United States)
2015-07-01
The isovector low-lying J{sup π}{sub K}=1{sup +}{sub 1} scissors mode of deformed nuclei has been studied extensively in (e,e{sup '}) and (γ,γ{sup '}) experiments over the last 30 years with the main focus on strong M1 transitions to the ground state band. In the framework of the semiclassical two-rotor-model it has its origin in quadrupole deformation. A considerable E2 matrix element between the rotational band of the scissors mode and the ground band is predicted which has not been addressed experimentally. A photon-scattering experiment with linearly-polarized quasi monoenergetic vector (γ)-rays has been performed at the High Intensity vector (γ)-ray Source (HIvector (γ)S) at Duke University, Durham, NC, exploiting the γ{sup 3} setup. We have measured an E2/M1-multipole mixing ratio for the 1{sup +}{sub sc}→2{sup +}{sub 1} transition for the first time. The Alaga rule is applicable and delivers a first estimate of the transition strength B(E2:2{sup +}{sub sc}→0{sup +}{sub 1}). A candidate for a 2{sup +}{sub sc}→2{sup +}{sub 1} transition is discussed.
Analysis of main artifacts in scanning probe microscopy (1)
International Nuclear Information System (INIS)
Alekperov, S.D.; Alekperov, S.D.
2012-01-01
The analysis of experiment carrying methodology in the scanning probe microscopy (SPM) region is carried out, the main parameters influencing on image quality are revealed. In order to reveal the artifact reason the main components of SPM signal which are divided on 5 groups : the useful signal; noises connected with external influences and temperature drift; distortions connected with piezoceramics and piezo-scanner non-ideality; probe geometry influence; apparatus noises are considered. The main methods of removal and minimization of the given artifacts are considered. The second and third groups of main components of SPM signal are considered in the articles first part
A M2FS Spectroscopic Study of Low-mass Young Stars in Orion OB1
Kaleida, Catherine C.; Briceno, Cesar; Calvet, Nuria; Mateo, Mario L.; Hernandez, Jesus
2015-01-01
Surveys of pre-main sequence stars in the ~4-10 Myr range provide a window into the decline of the accretion phase of stars and the formation of planets. Nearby star clusters and stellar associations allow for the study of these young stellar populations all the way down to the lowest mass members. One of the best examples of nearby 4-10 Myr old stellar populations is the Orion OB1 association. The CIDA Variability Survey of Orion OB1 (CVSO - Briceño et al. 2001) has used the variability properties of low-mass pre-main-sequence (PMS) stars to identify hundreds of K and M-type stellar members of the Orion OB1 association, a number of them displaying IR-excess emission and thought to be representative of more evolved disk-bearing young stars. Characterizing these young, low-mass objects using spectroscopy is integral to understanding the accretion phase in young stars. We present preliminary results of a spectroscopic survey of candidate and confirmed Orion OB1 low-mass members taken during November 2014 and February 2014 using the Michigan/Magellan Fiber Spectrograph (M2FS), a PI instrument on the Magellan Clay Telescope (PI: M. Matteo). Target fields located in the off-cloud regions of Orion were identified in the CVSO, and observed using the low and high-resolution modes of M2FS. Both low and high-resolution spectra are needed in order to confirm membership and derive masses, ages, kinematics and accretion properties. Initial analysis of these spectra reveal many new K and M-type members of the Orion OB1 association in these low extinction, off-cloud areas. These are the more evolved siblings of the youngest stars still embedded in the molecular clouds, like those in the Orion Nebula Cluster. With membership and spectroscopic indicators of accretion we are building the most comprehensive stellar census of this association, enabling us to derive a robust estimate of the fraction of young stars still accreting at a various ages, a key constraint for the end of
Experimental Conditions: SE24_S1_M1_D1 [Metabolonote[Archive
Lifescience Database Archive (English)
Full Text Available rometry with 13C‑Labeling for Chemical Assignment of Sulfur-Containing Metabolites ...SE24_S1_M1_D1 SE24 Combination of Liquid Chromatography-Fourier Transform Ion Cyclotron Resonance-Mass Spect
E2F1 regulates cellular growth by mTORC1 signaling.
Directory of Open Access Journals (Sweden)
Sebastian Real
2011-01-01
Full Text Available During cell proliferation, growth must occur to maintain homeostatic cell size. Here we show that E2F1 is capable of inducing growth by regulating mTORC1 activity. The activation of cell growth and mTORC1 by E2F1 is dependent on both E2F1's ability to bind DNA and to regulate gene transcription, demonstrating that a gene induction expression program is required in this process. Unlike E2F1, E2F3 is unable to activate mTORC1, suggesting that growth activity could be restricted to individual E2F members. The effect of E2F1 on the activation of mTORC1 does not depend on Akt. Furthermore, over-expression of TSC2 does not interfere with the effect of E2F1, indicating that the E2F1-induced signal pathway can compensate for the inhibitory effect of TSC2 on Rheb. Immunolocalization studies demonstrate that E2F1 induces the translocation of mTORC1 to the late endosome vesicles, in a mechanism dependent of leucine. E2F1 and leucine, or insulin, together affect the activation of S6K stronger than alone suggesting that they are complementary in activating the signal pathway. From these studies, E2F1 emerges as a key protein that integrates cell division and growth, both of which are essential for cell proliferation.
DEFF Research Database (Denmark)
Marzec, Michal Tomasz; Liu, Xiaobin; Wysocka, Maria
2011-01-01
mTOR kinase forms the mTORC1 complex by associating with raptor and other proteins and affects a number of key cell functions. mTORC1 activates p70S6kinase 1 (p70S6K1) and inhibits 4E-binding protein 1 (4E-BP1). In turn, p70S6K1 phosphorylates a S6 protein of the 40S ribosomal subunit (S6rp) and 4E...
Effects of main-sequence mass loss on stellar and galactic chemical evolution
International Nuclear Information System (INIS)
Guzik, J.A.
1988-01-01
L.A. Willson, G.H. Bowen and C. Struck-Marcell have proposed that 1 to 3 solar mass stars may experience evolutionarily significant mass loss during the early part of their main-sequence phase. The suggested mass-loss mechanism is pulsation, facilitated by rapid rotation. Initial mass-loss rates may be as large as several times 10 -9 M mass of sun/yr, diminishing over several times 10 8 years. The author attempts to test this hypothesis by comparing some theoretical implications with observations. Three areas are addressed: Solar models, cluster HR diagrams, and galactic chemical evolution. Mass-losing solar models were evolved that match the Sun's luminosity and radius at its present age. The most extreme viable models have initial mass 2.0 M 0 , and mass-loss rates decreasing exponentially over 2-3 x 10 8 years. Evolution calculations incorporating main-sequence mass loss were completed for a grid of models with initial masses 1.25 to 2.0 M mass of sun and mass loss timescales 0.2 to 2.0 Gry. Cluster HR diagrams synthesized with these models confirm the potential for the hypothesis to explain observed spreads or bifurcations in the upper main sequence, blue stragglers, anomalous giants, and poor fits of main-sequence turnoffs by standard isochrones. Simple closed galactic chemical evolution models were used to test the effects of main-sequence mass loss on the F and G dwarf distribution. Stars between 3.0 M mass of sun and a metallicity-dependent lower mass are assumed to lose mass. The models produce a 30 to 60% increase in the stars to stars-plus-remnants ratio, with fewer early-F dwarfs and many more late-F dwarfs remaining on the main sequence to the present
The search for main-belt comets: The Pan-STARRS1 perspective
Hsieh, H.; Denneau, L.; Wainscoat, R.; Jedicke, R.; Schorghofer, N.; Micheli, M.; Veres, P.; Kleyna, J.; Bolin, B.
2014-07-01
In recent years, an increasing number of objects have been discovered in the main asteroid belt that exhibit comet-like activity. Some instances of activity are believed to result from sublimation of volatile sub-surface ice, and the objects exhibiting this type of activity have come to be known as main-belt comets (MBCs; Hsieh & Jewitt 2006). For most MBCs, the presence of gas is only inferred from visible dust emission, although water vapor outgassing has recently been directly detected from (1) Ceres (Kuppers et al. 2014), indicating that water sublimation on MBCs could also be possible. In other instances, comet-like dust emission has been found to result from impacts onto otherwise inert objects, rotational disruption, or a combination of effects (cf., Jewitt 2012). In these cases, the objects can be referred to as disrupted asteroids. Collectively, MBCs and disrupted asteroids are known as active asteroids. MBCs have attracted interest in astrobiology due to theoretical studies indicating that material from the asteroid belt region could have been a significant primordial source of the water and other volatiles on the Earth. Icy asteroids also contain some of the least altered material from the inner protosolar disk still in existence today, presenting us with opportunities to learn about the earliest stages of our solar system's formation. The added bonus of the MBCs' relatively close proximity in the asteroid belt means that in situ spacecraft studies are entirely feasible using present-day technology. Pan-STARRS1 (PS1) is a wide-field synoptic survey telescope located on Halekala in Hawaii. It employs a 3.2×3.2 deg 1.4 gigapixel camera and uses an SDSS-like filter system. As of 2014 March 31, the Pan-STARRS1 survey has discovered three MBCs --- P/2006 VW139, P/2012 T1 (PANSTARRS), and P/2013 R3 (Catalina-PANSTARRS) --- as well as one disrupted asteroid (P/2013 P5 (PANSTARRS)), two active Centaurs, 33 Jupiter-family comets, and 17 long-period comets. For
75 FR 1754 - Gulf of Mexico Fishery Management Council; Public Meetings
2010-01-13
... meetings will be held February 1 - 4, 2010. ADDRESSES: The meetings will be held at the Battle House, 26 N....m. - The Council will review and discuss reports from the Sustainable Fisheries/Ecosystem Committee... Access Privilege Program Advisory Panel. 10 a.m. - 12 p.m. - The Sustainable Fisheries/Ecosystem...
Wu, Xin; Dou, Yannong; Yang, Yan; Bian, Difei; Luo, Jinque; Tong, Bei; Xia, Yufeng; Dai, Yue
2015-08-15
Arctigenin, the main effective constituent of Arctium lappa L. fruit, has previously been proven to dramatically attenuate dextran sulfate sodium (DSS)-induced colitis in mice, a frequently used animal model of inflammatory bowel disease (IBD). As Th1 and Th17 cells play a crucial role in the pathogenesis of IBD, the present study addressed whether and how arctigenin exerted anti-colitis efficacy by interfering with the differentiation and activation of Th1/Th17 cells. In vitro, arctigenin was shown to markedly inhibit the differentiation of Th17 cells from naïve T cells, and moderately inhibit the differentiation of Th1 cells, which was accompanied by lowered phosphorylation of STAT3 and STAT4, respectively. In contrast, arctigenin was lack of marked effect on the differentiation of either Th2 or regulatory T cells. Furthermore, arctigenin was shown to suppress the mammalian target of rapamycin complex 1 (mTORC1) pathway in T cells as demonstrated by down-regulated phosphorylation of the downstream target genes p70S6K and RPS6, and it functioned independent of two well-known upstream kinases PI3K/AKT and ERK. Arctigenin was also able to inhibit the activity of mTORC1 by dissociating raptor from mTOR. Interestingly, the inhibitory effect of arctigenin on T cell differentiation disappeared under a status of mTORC1 overactivation via knockdown of tuberous sclerosis complex 2 (TSC2, a negative regulator of mTORC1) or pretreatment of leucine (an agonist of mTOR). In DSS-induced mice, the inhibition of Th1/Th17 responses and anti-colitis effect of arctigenin were abrogated by leucine treatment. In conclusion, arctigenin ameliorates colitis through down-regulating the differentiation of Th1 and Th17 cells via mTORC1 pathway. Copyright © 2015 Elsevier Inc. All rights reserved.
[The operation on and death of Lieutenant M.J. Nix].
de Jong, C D
1978-06-10
One of the four Dutch military attaches who sided with the Republican forces in the Second Anglo-Boer War, Lieutenant M.J. Nix, was severely wounded during the battle at Sannaspost on 31 March 1900. A British shrapnel bullet injured his spine, which left him almost completely paralysed. He was transported in a British ambulance to the military hospital in Bloemfontein, where he was operated on on 10 April. He died during the operation. Conan Doyle, who was a medical officer and War correspondent in the South African War, attended the operation and published a brief report of it in his well-known book The Great Boer War. This report is quoted in full in this article. It is clear that the failure of the operation was due to the surgeon's lack of medical knowledge.
Role of mTORC1 Controlling Proteostasis after Brain Ischemia
Directory of Open Access Journals (Sweden)
Maria J. Perez-Alvarez
2018-02-01
Full Text Available Intense efforts are being undertaken to understand the pathophysiological mechanisms triggered after brain ischemia and to develop effective pharmacological treatments. However, the underlying molecular mechanisms are complex and not completely understood. One of the main problems is the fact that the ischemic damage is time-dependent and ranges from negligible to massive, involving different cell types such as neurons, astrocytes, microglia, endothelial cells, and some blood-derived cells (neutrophils, lymphocytes, etc.. Thus, approaching such a complicated cellular response generates a more complex combination of molecular mechanisms, in which cell death, cellular damage, stress and repair are intermixed. For this reason, animal and cellular model systems are needed in order to dissect and clarify which molecular mechanisms have to be promoted and/or blocked. Brain ischemia may be analyzed from two different perspectives: that of oxygen deprivation (hypoxic damage per se and that of deprivation of glucose/serum factors. For investigations of ischemic stroke, middle cerebral artery occlusion (MCAO is the preferred in vivo model, and uses two different approaches: transient (tMCAO, where reperfusion is permitted; or permanent (pMCAO. As a complement to this model, many laboratories expose different primary cortical neuron or neuronal cell lines to oxygen-glucose deprivation (OGD. This ex vivo model permits the analysis of the impact of hypoxic damage and the specific response of different cell types implicated in vivo, such as neurons, glia or endothelial cells. Using in vivo and neuronal OGD models, it was recently established that mTORC1 (mammalian Target of Rapamycin Complex-1, a protein complex downstream of PI3K-Akt pathway, is one of the players deregulated after ischemia and OGD. In addition, neuroprotective intervention either by estradiol or by specific AT2R agonists shows an important regulatory role for the mTORC1 activity, for
Studies of monoclonal antibodies IOR-CEA-1 and IOR-EGF/R3 labelled with 99mTc
International Nuclear Information System (INIS)
Dias, Carla Roberta de Barros Rodrigues
2005-01-01
Nuclear Medicine is a speciality that uses radioisotopes for the diagnosis or treatment of diseases and it is considered one of the best tools among the diagnostic modalities for detection of cancer. 99m Tc is one of the main isotopes for labelling antibodies and in Nuclear Medicine in general, due to its adequate physical properties, availability and low cost. Labelled monoclonal antibodies have shown promising results for diagnosis and therapy of cancer and their use has brought great experimental and clinical advances in the field of oncology. The main clinical applications of immunoscintigraphy with monoclonal antibodies are staging and evaluation of tumoral reappearance. The antibodies employed in this work were: OIR-CEA-1, a murine monoclonal antibody that acts directly against CEA expressed in several neoplasia in particular those from the gastrointestinal tract (colorectal cancer) and IOR-EGF/R3, a murine monoclonal antibody that binds to the external domain of EGF-R and it has been used in the diagnosis of tumors of epithelial origin. The objectives of this work were the development and optimization of the reduction and purification processes, the radiolabelling techniques and quality control procedures (radiochemical, immunoreactivity and cystein challenge) and imaging studies of monoclonal antibodies OIR-CEA-1 and IOR-EGF/R3, using the simple, fast and efficient method of direct labelling of the antibody with 99m Tc. The final results was the definition of the best conditions for the preparation of lyophilized reactive kits of OIR-CEA-1 and IOR- EGF/R3 for an efficient diagnostic application in Nuclear Medicine. The most adequate conditions for the labelling of the antibodies were: 1.0 mg Ab, 29 μL MDP, 3.0 μg Sn 2+ , 1 mL of 99m Tc and 30 min. reaction time. With these conditions the labelling yield was always higher than 95% and the maximum activity of 99m Tc was about 2220 MBq (60 mCi). The evidences of the efficiency and quality of the methods here
Anderson, Jonathan; Peace, David; Okun, Michael S
2008-12-01
To determine whether General Albert Sidney Johnston's dueling wound and nerve injury (1837) contributed to his death at the Battle of Shiloh (1862). General A.S. Johnston was commander of the Confederate Army at Shiloh and was killed by a bullet that severed his right popliteal artery. The location of this wound in the popliteal fossa region was largely unnoticed and, consequently, was not treated expeditiously. It has been widely assumed that the sciatic nerve was injured in a duel 3 decades before and that this injury resulted in a loss of sensation in the right posterior thigh and knee. This loss of sensation was assumed to be the reason why Johnston failed to notice that he was bleeding and consequently died. A complete review of all accounts of the battle was performed, as well as a complete review of the previous dueling injury. Primary source documents were examined, including Johnston's collected papers and original letters from eyewitness accounts and from family member observations. The wounds were traced using modern anatomic textbooks, and relevant published literature was reviewed regarding expected symptoms. Numerous secondary literature resources on the battle were also reviewed and compared with the original accounts. All sources agree that Johnston was severely injured during his 1837 duel. Sciatic nerve injury was clearly documented by his physicians. His recovery was punctuated by many of the classical symptoms of sciatic nerve injury, including foot pain, muscle wasting, and numbness. Johnston's recovery from the dueling wound was nearly complete, and he returned to full active military life. No serious signs or symptoms were noted by biographers during the next 25 years. He was, however, noted to have a mild limp when overly exerting himself and to have occasional intermittent foot pain and numbness. He was never known to use a cane. Comparison to modern literature on sciatic nerve injury suggests that the constellation of symptoms was closer
Directory of Open Access Journals (Sweden)
Ana-Maria Gurban
2017-12-01
Full Text Available Aflatoxins, which are mainly produced by Aspergillus flavus and parasiticus growing on plants and products stored under inappropriate conditions, represent the most studied group of mycotoxins. Contamination of human and animal milk with aflatoxin M1, the hydroxylated metabolite of aflatoxin B1, is an important health risk factor due to its carcinogenicity and mutagenicity. Due to the low concentration of this aflatoxin in milk and milk products, the analytical methods used for its quantification have to be highly sensitive, specific and simple. This paper presents an overview of the analytical methods, especially of the electrochemical immunosensors and aptasensors, used for determination of aflatoxin M1.
Radiative rates for E1, E2, M1 and M2 transitions in Fe X
International Nuclear Information System (INIS)
Aggarwal, K.M.; Keenan, F.P.
2004-01-01
Energies of the 54 levels belonging to the (1s 2 2s 2 2p 6 ) 3s 2 3p 5 , 3s3p 6 , 3s 2 3p 4 3d and 3s3p 5 3d configurations of Fe X have been calculated using the GRASP code of Dyall and colleagues (1989). Additionally, radiative rates, oscillator strengths, and line strengths are calculated for all electric dipole (E1), magnetic dipole (M1), electric quadrupole (E2), and magnetic quadrupole (M2) transitions among these levels. Comparisons are made with results available in the literature, and the accuracy of the data is assessed. Our energy levels are estimated to be accurate to better than 3%, whereas results for other parameters are probably accurate to better than 20% . Additionally, the agreement between measured and calculated lifetimes is better than 10%. (authors)
Stringfellow, Guy
2004-01-01
This program intended to test whether the lowest mass stars at the bottom end of the main sequence and the lower mass brown dwarfs have coronae. If they have coronae, what are the coronal characteristics and what drives them? In the classical dynamo picture, the closed magnetic loop structure is generated near the boundary of the convective envelope and the radiative core. Stars with mass below 0.30 Msun however are fully convective, and the nature of the dynamo responsible for the generation of the coronae in this regime is poorly understood. Previous results from the ROSAT mission (e.g., Fleming et al. 1993, 1995; Schmitt et al. 1995) had confirmed three very important characteristics of M-star coronae: (1) a very high percentage of all M dwarfs have coronae (of order 85% in the local 7 pc sample), (2) those M dwarfs showing high chromospheric activity, such as having the Balmer series in emission or large/numerous optical flaring, indeed exhibit the highest coronal activity, and (3) that the maximum saturation boundary in X-ray luminosity, which amounts to 0.0001-0.001 for Lx/Lbol for the dMe stars, extends down to the current detection limit, through spectral types M7. It was likely that the incompleteness noted for result (1) above was simply a detection limit problem; for more distant sources, the X-ray fainter dM stars will drop below detection thresholds before the more X-ray luminous dMe stars. The latest stars for which direct detection of the corona had been successful were of spectral type dM7 (e.g., VB8, LHS 3003). This program proposed to obtain ROSAT HRI observations for a large number of the coolest known (at that time) stars at the bottom of the main-sequence, which had spectral types of M9 or later. Three stars were approved for observations with ROSAT-HRI totaling 180 ksec. The goal was to obtain X-ray detections or low upper limits for the three approved stars.
Directory of Open Access Journals (Sweden)
Alessandro Paiardini
Full Text Available Malaria is a parasitic disease that remains a global health burden. The ability of the parasite to rapidly develop resistance to therapeutics drives an urgent need for the delivery of new drugs. The Medicines for Malaria Venture have compounds known for their antimalarial activity, but not necessarily the molecular targets. In this study, we assess the ability of the "MMV 400" compounds to inhibit the activity of three metalloaminopeptidases from Plasmodium falciparum, PfA-M1, PfA-M17 and PfM18 AAP. We have developed a multiplex assay system to allow rapid primary screening of compounds against all three metalloaminopeptidases, followed by detailed analysis of promising compounds. Our results show that there were no PfM18AAP inhibitors, whereas two moderate inhibitors of the neutral aminopeptidases PfA-M1 and PfA-M17 were identified. Further investigation through structure-activity relationship studies and molecular docking suggest that these compounds are competitive inhibitors with novel binding mechanisms, acting through either non-classical zinc coordination or independently of zinc binding altogether. Although it is unlikely that inhibition of PfA-M1 and/or PfA-M17 is the primary mechanism responsible for the antiplasmodial activity reported for these compounds, their detailed characterization, as presented in this work, pave the way for their further optimization as a novel class of dual PfA-M1/PfA-M17 inhibitors utilising non-classical zinc binding groups.
International Nuclear Information System (INIS)
Hu, J.; Wang, S.Z.; el-Fakahany, E.E.
1991-01-01
Muscarinic receptor agonist-induced desensitization of phosphoinositide (PI) hydrolysis and loss of receptors were studied in Chinese hamster ovary (CHO) cells transfected with the m1 and m3 muscarinic receptor genes. Long-term exposure to the full agonist carbamylcholine (CBC) resulted in a time-dependent attenuation of the maximal PI response and a decrease in agonist potency. This desensitization was accompanied by a parallel loss of maximal ligand binding without an alteration of the binding affinity. The time course of both receptor desensitization and down-regulation was similar in m1 and m3 CHO cells. The PI response to the partial agonist McN-A-343 (McN) in m1 cells was more sensitive to desensitization by CBC than the response to the latter agonist, and this desensitization was faster than receptor down-regulation. Desensitization of the PI response to McN was reflected as a decrease in the maximal response without a marked change in potency. McN induced slow desensitization of the PI response to CBC but a much faster desensitization of its own response. Our data provide evidence that although muscarinic agonist-induced desensitization of PI hydrolysis in CHO cells is due mainly to loss of receptors, there are other important factors which play a role in this process, e.g., receptor-effector uncoupling. The relative contribution of these different mechanisms depends on the efficacy of the agonists used for the receptor desensitization and activation steps
Energy Technology Data Exchange (ETDEWEB)
Hu, Guo-rong, E-mail: hgrhsj@263.net; Liu, Ji-jun; Du, Ke; Peng, Zhong-dong; Cao, Yan-bing; Wang, Wei-gang; Duan, Jian-guo
2014-08-01
To separate ferrum from chromium in the leaching sulfate solution of ferrochrome alloy, the oxalic acid was employed to precipitate the ferrum as the form of FeC{sub 2}O{sub 4} and Cr was left in the solution. In this route, small amount of nickel, cobalt and manganese exited in ferrochrome alloy were also precipitated simultaneously together with ferrous oxalate. Analysis from ICP shows that the molar percent of Fe in oxalic precipitate is 97.9% and the main doped elements are Ni (1.1%) and Mn (0.4%).The mixed metal oxalate Fe{sub (1−x)}M{sub x}C{sub 2}O{sub 4} was used as a raw material to prepare doped LiFePO{sub 4} cathode material of lithium ion batteries. The obtained LiFe{sub (1−x)}M{sub x}PO{sub 4}/C was a single olivine-type phase with higher crystallinity and presents the well-distributed fine particles. It shows an outstanding electrochemical performance with a discharge capacity of 162 mAh/g at the rate of 0.1 C, 136 mAh/g at 1 C and 103 mAh/g at 5 C. When cycled at 1 C for 50 times, the capacity retention is 98.2%.
M1 muscarinic receptor facilitates cognitive function by interplay with AMPA receptor GluA1 subunit.
Zhao, Lan-Xue; Ge, Yan-Hui; Xiong, Cai-Hong; Tang, Ling; Yan, Ying-Hui; Law, Ping-Yee; Qiu, Yu; Chen, Hong-Zhuan
2018-03-06
M1 muscarinic acetylcholine receptors (M1 mAChRs) are the most abundant muscarinic receptors in the hippocampus and have been shown to have procognitive effects. AMPA receptors (AMPARs), an important subtype of ionotropic glutamate receptors, are key components in neurocognitive networks. However, the role of AMPARs in procognitive effects of M1 mAChRs and how M1 mAChRs affect the function of AMPARs remain poorly understood. Here, we found that basal expression of GluA1, a subunit of AMPARs, and its phosphorylation at Ser845 were maintained by M1 mAChR activity. Activation of M1 mAChRs promoted membrane insertion of GluA1, especially to postsynaptic densities. Impairment of hippocampus-dependent learning and memory by antagonism of M1 mAChRs paralleled the reduction of GluA1 expression, and improvement of learning and memory by activation of M1 mAChRs was accompanied by the synaptic insertion of GluA1 and its increased phosphorylation at Ser845. Furthermore, abrogation of phosphorylation of Ser845 residue of GluA1 ablated M1 mAChR-mediated improvement of learning and memory. Taken together, these results show a functional correlation of M1 mAChRs and GluA1 and the essential role of GluA1 in M1 mAChR-mediated cognitive improvement.-Zhao, L.-X., Ge, Y.-H., Xiong, C.-H., Tang, L., Yan, Y.-H., Law, P.-Y., Qiu, Y., Chen, H.-Z. M1 muscarinic receptor facilitates cognitive function by interplay with AMPA receptor GluA1 subunit.
González-Bacerio, Jorge; Maluf, Sarah El Chamy; Méndez, Yanira; Pascual, Isel; Florent, Isabelle; Melo, Pollyana M S; Budu, Alexandre; Ferreira, Juliana C; Moreno, Ernesto; Carmona, Adriana K; Rivera, Daniel G; Alonso Del Rivero, Maday; Gazarini, Marcos L
2017-09-01
Malaria is a global human parasitic disease mainly caused by the protozoon Plasmodium falciparum. Increased parasite resistance to current drugs determines the relevance of finding new treatments against new targets. A novel target is the M1 alanyl-aminopeptidase from P. falciparum (PfA-M1), which is essential for parasite development in human erythrocytes and is inhibited by the pseudo-peptide bestatin. In this work, we used a combinatorial multicomponent approach to produce a library of peptidomimetics and screened it for the inhibition of recombinant PfA-M1 (rPfA-M1) and the in vitro growth of P. falciparum erythrocytic stages (3D7 and FcB1 strains). Dose-response studies with selected compounds allowed identifying the bestatin-based peptidomimetic KBE009 as a submicromolar rPfA-M1 inhibitor (K i =0.4μM) and an in vitro antimalarial compound as potent as bestatin (IC 50 =18μM; without promoting erythrocyte lysis). At therapeutic-relevant concentrations, KBE009 is selective for rPfA-M1 over porcine APN (a model of these enzymes from mammals), and is not cytotoxic against HUVEC cells. Docking simulations indicate that this compound binds PfA-M1 without Zn 2+ coordination, establishing mainly hydrophobic interactions and showing a remarkable shape complementarity with the active site of the enzyme. Moreover, KBE009 inhibits the M1-type aminopeptidase activity (Ala-7-amido-4-methylcoumarin substrate) in isolated live parasites with a potency similar to that of the antimalarial activity (IC 50 =82μM), strongly suggesting that the antimalarial effect is directly related to the inhibition of the endogenous PfA-M1. These results support the value of this multicomponent strategy to identify PfA-M1 inhibitors, and make KBE009 a promising hit for drug development against malaria. Copyright © 2017 Elsevier Ltd. All rights reserved.
Optimisation of 1.3 μm strained-layer semiconductor lasers
International Nuclear Information System (INIS)
Pacey, C.
1999-03-01
-wells to the device length. The experimental study confirms the conclusions drawn in the theoretical investigation that the optimum structure for a 1.3 μm InGaAsP laser for low threshold current, high efficiency and high characteristic temperature operation consists of six 1% compressively strained 50 A quantum-wells in a device of medium length (approx. 450 μm). The inclusion of a high reflection coating on one facet provides further improvement in the device performance, but increases the production cost dramatically. Also investigated in the experimental section is the effect of changing the device material from InGaAsP to InGaAlAs. The results discussed do not offer firm evidence of any improvement in the device characteristics in switching from a P-based to an Al-based structure. This is mainly due to the added complication of switching to a RWG structure from a BH structure. Another explanation for the relatively poor performance of InGaAsP 1.3 μm lasers has been examined. That is leakage of the carriers out of the well region. Evidence of a leakage current has been seen primarily in devices with a low number of quantum-wells. A novel measurement technique has been demonstrated, which should prove useful for obtaining a numerical value for the leakage current in semiconductor lasers. The results presented suggest that leakage current is not significant for a 9 well device until operating at temperatures above around 373 K. This is supported by evidence supplied by the spontaneous emission spectra. (author)
Musante, Veronica; Neri, Elisa; Feligioni, Marco; Puliti, Aldamaria; Pedrazzi, Marco; Conti, Valerio; Usai, Cesare; Diaspro, Alberto; Ravazzolo, Roberto; Henley, Jeremy M; Battaglia, Giuseppe; Pittaluga, Anna
2008-09-01
The effects of mGlu1 and mGlu5 receptor activation on the depolarization-evoked release of [3H]d-aspartate ([3H]D-ASP) from mouse cortical synaptosomes were investigated. The mGlu1/5 receptor agonist 3,5-DHPG (0.1-100microM) potentiated the K+(12mM)-evoked [3H]D-ASP overflow. The potentiation occurred in a concentration-dependent manner showing a biphasic pattern. The agonist potentiated [3H]D-ASP exocytosis when applied at 0.3microM; the efficacy of 3,5-DHPG then rapidly declined and reappeared at 30-100microM. The fall of efficacy of agonist at intermediate concentration may be consistent with 3,5-DHPG-induced receptor desensitization. Facilitation of [3H]D-ASP exocytosis caused by 0.3microM 3,5-DHPG was prevented by the selective mGlu5 receptor antagonist MPEP, but was insensitive to the selective mGlu1 receptor antagonist CPCCOEt. In contrast, CPCCOEt prevented the potentiation by 50microM 3,5-DHPG, while MPEP had minimal effect. Unexpectedly, LY 367385 antagonized both the 3,5-DHPG-induced effects. A total of 0.3microM 3,5-DHPG failed to facilitate the K+-evoked [3H]D-ASP overflow from mGlu5 receptor knockout (mGlu5-/-) cortical synaptosomes, but not from nerve terminals prepared from the cortex of animals lacking the mGlu1 receptors, the crv4/crv4 mice. On the contrary, 50microM 3,5-DHPG failed to affect the [3H]D-ASP exocytosis from cortical synaptosomes obtained from crv4/crv4 and mGlu5-/-mice. Western blot analyses in subsynaptic fractions support the existence of both mGlu1 and mGlu5 autoreceptors located presynaptically, while immunocytochemistry revealed their presence at glutamatergic terminals. We propose that mGlu1 and mGlu5 autoreceptors exist on mouse glutamatergic cortical terminals; mGlu5 receptors may represent the "high affinity" binding sites for 3,5-DHPG, while mGlu1 autoreceptors represent the "low affinity" binding sites.
The Physical Driver of the Optical Eigenvector 1 in Quasar Main Sequence
Energy Technology Data Exchange (ETDEWEB)
Panda, Swayamtrupta; Czerny, Bożena [Center for Theoretical Physics, Polish Academy of Sciences, Warsaw (Poland); Nicolaus Copernicus Astronomical Center, Polish Academy of Sciences, Warsaw (Poland); Wildy, Conor, E-mail: panda@cft.edu.pl [Center for Theoretical Physics, Polish Academy of Sciences, Warsaw (Poland)
2017-11-07
Quasars are complex sources, characterized by broad band spectra from radio through optical to X-ray band, with numerous emission and absorption features. This complexity leads to rich diagnostics. However, Boroson and Green (1992) used Principal Component Analysis (PCA), and with this analysis they were able to show significant correlations between the measured parameters. The leading component, related to Eigenvector 1 (EV1) was dominated by the anticorrelation between the FeII optical emission and [OIII] line and EV1 alone contained 30% of the total variance. It opened a way in defining a quasar main sequence, in close analogy to the stellar main sequence on the Hertzsprung-Russel (HR) diagram (Sulentic et al., 2001). The question still remains which of the basic theoretically motivated parameters of an active nucleus (Eddington ratio, black hole mass, accretion rate, spin, and viewing angle) is the main driver behind the EV1. Here we limit ourselves to the optical waveband, and concentrate on theoretical modeling the FeII to Hβ ratio, and we test the hypothesis that the physical driver of EV1 is the maximum of the accretion disk temperature, reflected in the shape of the spectral energy distribution (SED). We performed computations of the Hβ and optical FeII for a broad range of SED peak position using CLOUDY photoionisation code. We assumed that both Hβ and FeII emission come from the Broad Line Region represented as a constant density cloud in a plane-parallel geometry. We expected that a hotter disk continuum will lead to more efficient production of FeII but our computations show that the FeII to Hβ ratio actually drops with the rise of the disk temperature. Thus either hypothesis is incorrect, or approximations used in our paper for the description of the line emissivity is inadequate.
The Physical Driver of the Optical Eigenvector 1 in Quasar Main Sequence
Directory of Open Access Journals (Sweden)
Swayamtrupta Panda
2017-11-01
Full Text Available Quasars are complex sources, characterized by broad band spectra from radio through optical to X-ray band, with numerous emission and absorption features. This complexity leads to rich diagnostics. However, Boroson and Green (1992 used Principal Component Analysis (PCA, and with this analysis they were able to show significant correlations between the measured parameters. The leading component, related to Eigenvector 1 (EV1 was dominated by the anticorrelation between the FeII optical emission and [OIII] line and EV1 alone contained 30% of the total variance. It opened a way in defining a quasar main sequence, in close analogy to the stellar main sequence on the Hertzsprung-Russel (HR diagram (Sulentic et al., 2001. The question still remains which of the basic theoretically motivated parameters of an active nucleus (Eddington ratio, black hole mass, accretion rate, spin, and viewing angle is the main driver behind the EV1. Here we limit ourselves to the optical waveband, and concentrate on theoretical modeling the FeII to Hβ ratio, and we test the hypothesis that the physical driver of EV1 is the maximum of the accretion disk temperature, reflected in the shape of the spectral energy distribution (SED. We performed computations of the Hβ and optical FeII for a broad range of SED peak position using CLOUDY photoionisation code. We assumed that both Hβ and FeII emission come from the Broad Line Region represented as a constant density cloud in a plane-parallel geometry. We expected that a hotter disk continuum will lead to more efficient production of FeII but our computations show that the FeII to Hβ ratio actually drops with the rise of the disk temperature. Thus either hypothesis is incorrect, or approximations used in our paper for the description of the line emissivity is inadequate.
Hydrogeologic Setting of A/M Area: Framework for Groundwater Transport. Book 1
Energy Technology Data Exchange (ETDEWEB)
Van Pelt, R.; Lewis, S.E.; Aadland, R.K.
1994-03-11
This document includes a brief summary of the regional geology within a 200--mile radius of the A/M Area, a summary of stratigraphy and hydrostratigraphic nomenclature as it applies to the A/M Area, and a summary of stratigraphy and hydrostratigraphy specific to the A/M Area. Five different stratigraphic cross sections show site-specific geology of the Tertiary section of the Upper Atlantic Coastal Plain geologic province within the A/M Area. The Cretaceous section lacks detail because the deepest wells penetrate only the uppermost part of the Upper Cretaceous sediments. Most of the wells are confined to the Tertiary section. The A/M Area is located in the northwestern corner of the Savannah River Site (SRS). The area serves as a main administrative hub for the site. Between 1958 and 1985, approximately 2,000,000 pounds of volatile organic solvents (metal degreasers, primarily trichloroethylene and tetrachloroethylene) were routed to the M Area Settling Basin. Between 1954 and 1958, effluent also was discharged to Tim`s Branch via the A014 Outfall. In the main M Area Solvent Handling/Storage Area, a significant amount of leakage occurred from drums stored during this time period. Extensive quantities of solvents were transported, via the Process Sewer Line, to the M Area Settling Basin, and leaks occurred along this line as well. A smaller source area has been identified and is centered around the Savannah River Laboratory (SRL) (now called the Savannah River Technology Center [SRTC]) Complex. All of these source areas are represented by solvent contamination in the groundwater system. (Abstract Truncated)
Harusato, Akihito; Naito, Yuji; Takagi, Tomohisa; Uchiyama, Kazuhiko; Mizushima, Katsura; Hirai, Yasuko; Higashimura, Yasuki; Katada, Kazuhiro; Handa, Osamu; Ishikawa, Takeshi; Yagi, Nobuaki; Kokura, Satoshi; Ichikawa, Hiroshi; Muto, Akihiko; Igarashi, Kazuhiko; Yoshikawa, Toshikazu
2013-01-01
BTB and CNC homolog 1 (Bach1) is a transcriptional repressor of heme oxygenase-1 (HO-1), which plays an important role in the protection of cells and tissues against acute and chronic inflammation. However, the role of Bach1 in the gastrointestinal mucosal defense system remains little understood. HO-1 supports the suppression of experimental colitis and localizes mainly in macrophages in colonic mucosa. This study was undertaken to elucidate the Bach1/HO-1 system's effects on the pathogenesis of experimental colitis. This study used C57BL/6 (wild-type) and homozygous Bach1-deficient C57BL/6 mice in which colonic damage was induced by the administration of an enema of 2,4,6-trinitrobenzene sulfonic acid (TNBS). Subsequently, they were evaluated macroscopically, histologically, and biochemically. Peritoneal macrophages from the respective mice were isolated and analyzed. Then, wild-type mice were injected with peritoneal macrophages from the respective mice. Acute colitis was induced similarly. TNBS-induced colitis was inhibited in Bach1-deficient mice. TNBS administration increased the expression of HO-1 messenger RNA and protein in colonic mucosa in Bach1-deficient mice. The expression of HO-1 mainly localized in F4/80-immunopositive and CD11b-immunopositive macrophages. Isolated peritoneal macrophages from Bach1-deficient mice highly expressed HO-1 and also manifested M2 macrophage markers, such as Arginase-1, Fizz-1, Ym1, and MRC1. Furthermore, TNBS-induced colitis was inhibited by the transfer of Bach1-deficient macrophages into wild-type mice. Deficiency of Bach1 ameliorated TNBS-induced colitis. Bach1-deficient macrophages played a key role in protection against colitis. Targeting of this mechanism is applicable to cell therapy for human inflammatory bowel disease.
A comparative study, of 1 M and 8 M KOH electrolyte concentrations, used in Ni-MH batteries
International Nuclear Information System (INIS)
Khaldi, C.; Mathlouthi, H.; Lamloumi, J.
2009-01-01
One may wonder if we really should use a very high concentration of KOH electrolyte in Ni-MH batteries, to keep the thermodynamic and kinetic properties of the alloy, while this solution is very aggressive to the used alloys. In this work we present a comparative study, using different techniques of two concentrations, 1 M and 8 M KOH electrolytes. The maximum capacity values are 295 mAh g -1 and 237 mAh g -1 , the loss in capacity, after 23 cycles, are of 10% and 58%, the polarization after the activation are 110 mV and 360 mV and the thickness of the corrosion layer, on the electrode surface, are 7 nm and 42 nm, for the 1 M and 8 M KOH electrolytes, respectively. These results showed that replacing the solution 8 M with 1 M improves the performance of Ni-MH batteries and leads to better results
Effects of mass loss on the evolution of massive stars. I. Main-sequence evolution
International Nuclear Information System (INIS)
Dearborn, D.S.P.; Blake, J.B.; Hainebach, K.L.; Schramm, D.N.
1978-01-01
The effect of mass loss on the evolution and surface composition of massive stars during main-sequence evolution are examined. While some details of the evolutionary track depend on the formula used for the mass loss, the results appear most sensitive to the total mass removed during the main-sequence lifetime. It was found that low mass-loss rates have very little effect on the evolution of a star; the track is slightly subluminous, but the lifetime is almost unaffected. High rates of mass loss lead to a hot, high-luminosity stellar model with a helium core surrounded by a hydrogen-deficient (Xapprox.0.1) envelope. The main-sequence lifetime is extended by a factor of 2--3. These models may be identified with Wolf-Rayet stars. Between these mass-loss extremes are intermediate models which appear as OBN stars on the main sequence. The mass-loss rates required for significant observable effects range from 8 x 10 -7 to 10 -5 M/sub sun/ yr -1 , depending on the initial stellar mass. It is found that observationally consistent mass-loss rates for stars with M> or =30 M/sub sun/ may be sufficiently high that these stars lose mass on a time scale more rapidly than their main-sequence core evolution time. This result implies that the helium cores resulting from the main-sequence evolution of these massive stars may all be very similar to that of a star of Mapprox.30 M/sub sun/ regardless of the zero-age mass
ARGUS laser plasma experiments at 1.06 μm, 0.53 μm and 0.35 μm
International Nuclear Information System (INIS)
Turner, R.E.; Campbell, E.M.; Mead, W.C.; Ze, F.; Max, C.; Phillion, D.W.; Lee, P.; Pruett, B.; Tirsell, G.; Lasinski, B.F.
1982-01-01
ARGUS wavelength scaling experiments have been performed on low (Be) and high (Au) Z disk targets, with laser wavelengths of 1.06 μm, 0.53 μm and 0.35 μm. The laser provided a 700 psec pulse, with up to 100J and 1.06 μm; 200J at 0.53 μm; and 40J at 0.35 μm. Laser intensities on target ranged from 3 x 10 13 to over 3 x 10 15 W/cm 2 , using an f/2.2 focusing system. Box calorimeter measurements show the expected increasing fractional absorption at shorter laser wavelengths; absolutely calibrated hard x-ray detectors show the number of suprathermal electrons to be greatly decreased. Scattered light measurements concentrated on stimulated Raman scattering, and the 3/2 harmonic. The SRS was spectrally and temporally resolved during 0.53 μm irradiations; our measurements showed the scattering to be principally from the convective instability, near tenth critical density. Near ω/2, a double peaked spectral feature is observed. The time resolved data show a number of interesting features, which are discussed
International Nuclear Information System (INIS)
Murin, I.V.; Andreev, A.M.; Amelin, Yu.V.
1982-01-01
The temperature dependence of electric conductivity of some double fluorides formed in the systems M 1 F-Th(U)F 4 (M 1 =K, Tl) and M 2 F 2 -ThF 4 (M 2 =Ca, Sr, Ba) as well as UF 3 in a wide temperature range is studied. It is shown that the values of electric conductivity and activation energy of these fluorides depend on the compound structure and cation nature. The temperature electric conductivity dependence for double fluorides with the tysonite structure is close to the lanthanum fluoride dependence. Taking into account low electron electric conductivity component the conclusion is drawn that the investigated compounds can be used as solid electrolytes
Current status of the Thai Research Reactor (TRR-1/M1)
International Nuclear Information System (INIS)
Chueinta, Siripone; Julanan, Mongkol; Charncanchee, Decharchai
2006-01-01
The first Thai Research Reactor, TRR-1 went critical on 27 October 1962 at the maximum power of 1 MW. It was located at Office of Atoms for Peace (OAP) in Bangkok. Since then, TRR-1 was continuously operated and eventually shut down in 1975. Plate type, high-enriched uranium (HEU) and U 3 O 8 A1 cladding were used as the reactor fuel. Light water was used as moderator and coolant as well. In 1975, because of the problem from fuel supplier and also to supporting the Treaty of Non Proliferation of Nuclear Weapon or NPT, TRR-1 was shut down for modification. The reactor core and control system were disassembled and replaced by TRIGA Mark III. A new core was a hexagonal core shape designed by General Atomics (GA). Afterwards, TRR-1 was officially renamed to the Thai Research Reactor-1/Modification 1 (TRR-1/M1). TRR-1/M1 is a multipurpose swimming pool type reactor with nominal power of 2 MW. The TRR-1/M1 uses uranium enriched at 20% in U-235 (LEU) and ZrH alloy as fuel. Light water is also used as coolant and moderator. At present, the reactor is operating with core No.14. The reactor has been serving for various kinds of utilization namely, radioisotope production, neutron activation analysis, beam experiments and reactor physics experiments. (author)
Directory of Open Access Journals (Sweden)
Nilsson-Ehle Peter
2004-10-01
Full Text Available Abstract Apolipoprotein M (apoM is a 26-kDa protein that is mainly associated with high-density lipoprotein (HDL in human plasma, with a small proportion present in triglyceride-rich lipoproteins (TGRLP and low-density lipoproteins (LDL. Human apoM gene is located in p21.31 on chromosome 6 (chromosome 17, in mouse. Human apoM cDNA (734 base pairs encodes 188-amino acid residue-long protein. It belongs to lipocalin protein superfamily. Human tissue expression array study indicates that apoM is only expressed in liver and in kidney and small amounts are found in fetal liver and kidney. In situ apoM mRNA hybridization demonstrates that apoM is exclusively expressed in the hepatocytes and in the tubule epithelial cells in kidney. Expression of apoM could be regulated by platelet activating factor (PAF, transforming growth factors (TGF, insulin-like growth factor (IGF and leptin in vivo and/or in vitro. It has been demonstrated that apoM expression is dramatically decreased in apoA-I deficient mouse. Hepatocyte nuclear factor-1α (HNF-1α is an activator of apoM gene promoter. Deficiency of HNF-1α mouse shows lack of apoM expression. Mutations in HNF-1α (MODY3 have reduced serum apoM levels. Expression of apoM is significantly decreased in leptin deficient (ob/ob mouse or leptin receptor deficient (db/db mouse. ApoM concentration in plasma is positively correlated to leptin level in obese subjects. These may suggest that apoM is related to the initiation and progression of MODY3 and/or obesity.
Directory of Open Access Journals (Sweden)
Maria Elvira Mendez Pinedo
2014-11-01
Full Text Available Six years after the financial crisis that led to the collapse of the banking system in 2008, the over-indebtedness of households is one of the most important problems in Iceland. This study aims to cast light on a specific feature of the Icelandic credit system in connection with the problem of over-indebtedness. The main research question is whether the end of indexation of credit is close or not. The author argues, in the first place, that indexation of credit ex-post to the consumer price index (CPI in negative amortization schemes is responsible for over-indebtedness. In the second place, the author describes the challenges ahead in the field of consumer and mortgage credit in Iceland in the light of European law (European Union EU and European Economic Area EEA. The incorporation of Directive 2008/48 on credit agreement for consumers to the Icelandic domestic order through the EEA Agreement allowed a preliminary legal review of the practice in light of EU/EEA consumer credit law, both at national and European level without a final conclusion. It has nevertheless led to the judicial review on the legality of some indexation alleged malpractices before national courts and to the EFTA Court for interpretation (mostly on Directives 93/13/EEC on unfair terms 87/102/EEC on consumer credit. A ruling from the Supreme Court is expected on several cases. A critical battle between the legality, the fairness and the legitimacy of indexation of credit is taking place in Iceland under the influence of European law.
Component biomass equations for black spruce in Maine
M. M. Czapowskyj; D. J. Robison; R. D. Briggs; E. H. White; E. H. White
1985-01-01
Component biomass prediction equations are presented for young black spruce (Picea mariana B.S.P. (Mill,:)) in northern Maine. A weighted least squares model was used to construct the eq~iationsfo r small trees from 1 to 15 cm d.b.h., and an ordinary least squares model for trees less than 2 m in height. A linearized allometric model was also tested but was not used....
Energy Technology Data Exchange (ETDEWEB)
Yanagita, Manabu; Kobayashi, Ryohei [Department of Periodontology, Division of Oral Biology and Disease Control, Osaka University Graduate School of Dentistry, Osaka 565-0871 (Japan); Murakami, Shinya, E-mail: ipshinya@dent.osaka-u.ac.jp [Department of Periodontology, Division of Oral Biology and Disease Control, Osaka University Graduate School of Dentistry, Osaka 565-0871 (Japan)
2009-10-09
Macrophages (M{Phi}s) exhibit functional heterogeneity and plasticity in the local microenvironment. Recently, it was reported that M{Phi}s can be divided into proinflammatory M{Phi}s (M{Phi}1) and anti-inflammatory M{Phi}s (M{Phi}2) based on their polarized functional properties. Here, we report that nicotine, the major ingredient of cigarette smoke, can modulate the characteristics of M{Phi}1. Granulocyte-macrophage colony-stimulating factor-driven M{Phi}1 with nicotine (Ni-M{Phi}1) showed the phenotypic characteristics of M{Phi}2. Like M{Phi}2, Ni-M{Phi}1 exhibited antigen-uptake activities. Ni-M{Phi}1 suppressed IL-12, but maintained IL-10 and produced high amounts of MCP-1 upon lipopolysaccharide stimulation compared with M{Phi}1. Moreover, we observed strong proliferative responses of T cells to lipopolysaccharide-stimulated M{Phi}1, whereas Ni-M{Phi}1 reduced T cell proliferation and inhibited IFN-{gamma} production by T cells. These results suggest that nicotine can change the functional characteristics of M{Phi} and skew the M{Phi}1 phenotype to M{Phi}2. We propose that nicotine is a potent regulator that modulates immune responses in microenvironments.
Intrinsic width and luminosity function of the M92 main sequence
International Nuclear Information System (INIS)
Sandage, A.; Katem, B.
1983-01-01
Measurements of B and V magnitudes of approx.475 identified stars in the magnitude interval 18.0 - 4 is too low. The luminosity function, obtained from the present data, is compared with that determined earlier by Tayler, by Hartwick, by van den Bergh, and with Fukuoka and Simoda, with good agreement. The evidence favors that phi(M/sub v/) flattens fainter than M/sub v/approx. =+6 as predicted in some dynamical models, due to loss of low mass stars
FoxM1 promotes epithelial-mesenchymal transition of hepatocellular carcinoma by targeting Snai1
Yu, Chun-Peng; Yu, Shui; Shi, Lei; Wang, Song; Li, Zi-Xiang; Wang, Yan-Hua; Sun, Cheng-Jian; Liang, Jun
2017-01-01
Forkhead box protein M1 (FoxM1) is aberrantly expressed in several types of human malignancy, and serves an important role in tumor metastasis. Epithelial-mesenchymal transition (EMT) of cancer cells has been associated cancer metastasis; however, the implication of FoxM1 in EMT and its putative roles in the regulation of cancer metastasis remain to be elucidated. In the present study, the expression of FoxM1, Snai1 and E-cadherin in hepatocellular carcinoma (HCC) cell lines with various meta...
Directory of Open Access Journals (Sweden)
N. Umino
1999-06-01
Full Text Available The first main shock of the off-Sanriku earthquake sequence (02/11/89, M 7.1; 18/07/92, M 6.9; 28/12/94, M 7.5 was preceded by a precursory seismic quiescence lasting 2.5 ± 1 year and up to this main shock. The detailed properties of this quiescence were mapped as a function of time and space by a gridding technique using the ZMAP computer code, and the statistical significance was estimated by generating a synthetic catalog based on the microearthquake catalog of Tohoku University, which was the data set used. The statistically most significant expression of this precursory quiescence has a probability of 0.1% to have occurred at random and was located in the eastern part of the 1989 aftershock area, at a point to which the 1994 aftershocks extended also. If we define the dimensions of the quiescence anomaly by a vertical cylinder with the depth of the entire seismogenic layer, centered at the point of most significant quiescence and showing a rate decrease of 75%, then we find its radius is 25 ± 9 km. If we allow other shapes, such as the simplified aftershock volume of 1989, or other simple geometric figures, to define the rate decrease we find dimensions of 80 by 80 km. The characteristics of the quiescence anomaly do not depend strongly on the choice of free parameters within the following ranges: 100 ? number of events ? 400, 2.0 ? Mmin £ 3.0, 1 ? time window ? 3 years. With our method, a thorough analysis of the period before the 1994 main shock is not possible because of the interference of the extended aftershock sequence of 1989. Nevertheless, we identified a quiescence of nearly zero earthquakes located near the center of the 1994 aftershock area that lasted for one year up to that main shock. However, this quiescence period ranked only 46th in significance, behind other quiescences of equal duration and similar dimensions distributed in time and space through the data set. Because of the ubiquitous existence of periods of near
2009 U.S. Geological Survey (USGS) Topographic LiDAR: Androscoggin County, Maine
National Oceanic and Atmospheric Administration, Department of Commerce — USGS Contract Number: G10PC00026 USGS Task Order: G10PD01737 LiDAR was collected at a 1.0 points per square meter (1.0m GSD) for the county of Androscoggin, Maine...
Symbiotic nature of the object M1-77
International Nuclear Information System (INIS)
Kondrt'eva, L.N.
2004-01-01
Many year spectral observations show, that the object M1-77 is the symbiotic system, which consists of a M-giant and a B-star. An emission spectra arises from an envelope, which was formed from a giant's extended atmosphere, and now is ionized by the hotter component. Some spectral changes were registered in M1-77: the forbidden lines intensities increase relatively to that of Hα. It is connected with the decrease of hydrogen emission. (author)
2011-04-04
...) RWY 24, Amdt 2 Battle Creek, MI, W K Kellogg, ILS OR LOC RWY 23R, Amdt 18 Battle Creek, MI, W K Kellogg, NDB RWY 23R, Amdt 18 Battle Creek, MI, W K Kellogg, RNAV (GPS) RWY 5L, Amdt 1 Battle Creek, MI, W K Kellogg, RNAV (GPS) RWY 23R, Amdt 1 Cheboygan, MI, Cheboygan County, RNAV (GPS) RWY 28, Amdt 1...
Directory of Open Access Journals (Sweden)
Federica Raggi
2017-09-01
Full Text Available Macrophages (Mf are a heterogeneous population of tissue-resident professional phagocytes and a major component of the leukocyte infiltrate at sites of inflammation, infection, and tumor growth. They can undergo diverse forms of activation in response to environmental factors, polarizing into specialized functional subsets. A common hallmark of the pathologic environment is represented by hypoxia. The impact of hypoxia on human Mf polarization has not been fully established. The objective of this study was to elucidate the effects of a hypoxic environment reflecting that occurring in vivo in diseased tissues on the ability of human Mf to polarize into classically activated (proinflammatory M1 and alternatively activated (anti-inflammatory M2 subsets. We present data showing that hypoxia hinders Mf polarization toward the M1 phenotype by decreasing the expression of T cell costimulatory molecules and chemokine homing receptors and the production of proinflammatory, Th1-priming cytokines typical of classical activation, while promoting their acquisition of phenotypic and secretory features of alternative activation. Furthermore, we identify the triggering receptor expressed on myeloid cells (TREM-1, a member of the Ig-like immunoregulatory receptor family, as a hypoxia-inducible gene in Mf and demonstrate that its engagement by an agonist Ab reverses the M2-polarizing effect of hypoxia imparting a M1-skewed phenotype to Mf. Finally, we provide evidence that Mf infiltrating the inflamed hypoxic joints of children affected by oligoarticular juvenile idiopatic arthritis express high surface levels of TREM-1 associated with predominant M1 polarization and suggest the potential of this molecule in driving M1 proinflammatory reprogramming in the hypoxic synovial environment.
Raggi, Federica; Pelassa, Simone; Pierobon, Daniele; Penco, Federica; Gattorno, Marco; Novelli, Francesco; Eva, Alessandra; Varesio, Luigi; Giovarelli, Mirella; Bosco, Maria Carla
2017-01-01
Macrophages (Mf) are a heterogeneous population of tissue-resident professional phagocytes and a major component of the leukocyte infiltrate at sites of inflammation, infection, and tumor growth. They can undergo diverse forms of activation in response to environmental factors, polarizing into specialized functional subsets. A common hallmark of the pathologic environment is represented by hypoxia. The impact of hypoxia on human Mf polarization has not been fully established. The objective of this study was to elucidate the effects of a hypoxic environment reflecting that occurring in vivo in diseased tissues on the ability of human Mf to polarize into classically activated (proinflammatory M1) and alternatively activated (anti-inflammatory M2) subsets. We present data showing that hypoxia hinders Mf polarization toward the M1 phenotype by decreasing the expression of T cell costimulatory molecules and chemokine homing receptors and the production of proinflammatory, Th1-priming cytokines typical of classical activation, while promoting their acquisition of phenotypic and secretory features of alternative activation. Furthermore, we identify the triggering receptor expressed on myeloid cells (TREM)-1, a member of the Ig-like immunoregulatory receptor family, as a hypoxia-inducible gene in Mf and demonstrate that its engagement by an agonist Ab reverses the M2-polarizing effect of hypoxia imparting a M1-skewed phenotype to Mf. Finally, we provide evidence that Mf infiltrating the inflamed hypoxic joints of children affected by oligoarticular juvenile idiopatic arthritis express high surface levels of TREM-1 associated with predominant M1 polarization and suggest the potential of this molecule in driving M1 proinflammatory reprogramming in the hypoxic synovial environment. PMID:28936211
Influence of extracellular zinc on M1 microglial activation.
Higashi, Youichirou; Aratake, Takaaki; Shimizu, Shogo; Shimizu, Takahiro; Nakamura, Kumiko; Tsuda, Masayuki; Yawata, Toshio; Ueba, Tetuya; Saito, Motoaki
2017-02-27
Extracellular zinc, which is released from hippocampal neurons in response to brain ischaemia, triggers morphological changes in microglia. Under ischaemic conditions, microglia exhibit two opposite activation states (M1 and M2 activation), which may be further regulated by the microenvironment. We examined the role of extracellular zinc on M1 activation of microglia. Pre-treatment of microglia with 30-60 μM ZnCl 2 resulted in dose-dependent increases in interleukin-1 beta (IL-1β), interleukin-6 (IL-6), and tumour necrosis factor-alpha (TNFα) secretion when M1 activation was induced by lipopolysaccharide administration. In contrast, the cell-permeable zinc chelator TPEN, the radical scavenger Trolox, and the P2X7 receptor antagonist A438079 suppressed the effects of zinc pre-treatment on microglia. Furthermore, endogenous zinc release was induced by cerebral ischaemia-reperfusion, resulting in increased expression of IL-1β, IL-6, TNFα, and the microglial M1 surface marker CD16/32, without hippocampal neuronal cell loss, in addition to impairments in object recognition memory. However, these effects were suppressed by the zinc chelator CaEDTA. These findings suggest that extracellular zinc may prime microglia to enhance production of pro-inflammatory cytokines via P2X7 receptor activation followed by reactive oxygen species generation in response to stimuli that trigger M1 activation, and that these inflammatory processes may result in deficits in object recognition memory.
Deficiency in mTORC1-controlled C/EBP beta-mRNA translation improves metabolic health in mice
Zidek, Laura M.; Ackermann, Tobias; Hartleben, Goetz; Eichwald, Sabrina; Kortman, Gertrud; Kiehntopf, Michael; Leutz, Achim; Sonenberg, Nahum; Wang, Zhao-Qi; von Maltzahn, Julia; Mueller, Christine; Calkhoven, Cornelis F.
The mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of physiological adaptations in response to changes in nutrient supply. Major downstream targets of mTORC1 signalling are the mRNA translation regulators p70 ribosomal protein S6 kinase 1 (S6K1p70) and the 4E-binding
Active remote observing system for the 1-m telescope at Tonantzintla Observatory
Bernal, Abel; Martínez, Luis A.; Hernández, Héctor; Garfias, Fernando; Ángeles, Fernando
2006-06-01
We have designed and installed a new active remote observing system for the 1-m, f/15 telescope at the Tonantzintla Observatory. This remote system is operated in real-time through the Internet, allowing an observer to control the building, the telescope (pointing, guiding and focusing) and the CCD image acquisition at the main and finder telescopes from the Instituto de Astronomia headquarters in Mexico City (150 KM away). The whole system was modeled within the Unified Modeling Language (UML) and the design has proved to be versatile enough for a variety of astronomical instruments. We describe the system architecture and how different subsystems (telescope control, main telescope and finder image acquisition, weather station, videoconference, etc.) that are based on different operative system platforms (Linux, Windows, uIP) have been integrated. We present the first results of an IPv6 over IPv4 tunnel. Recent remote direct imaging and spectroscopic observations have been used to test the astronomical site. We conclude that this remote system is an excellent tool for supporting research and graduated observational astronomy programs.
The WA105-3x1x1 m3 dual phase LAr-TPC demonstrator
Murphy, Sebastien
2016-11-15
The dual phase Liquid Argon Time Projection Chamber (LAr TPC) is the state-of-art technology for neutrino detection thanks to its superb 3D tracking and calorimetry performance. Its main feature is the charge amplification in gas argon which provides excellent signal-to-noise ratio. Electrons produced in the liquid argon are extracted in the gas phase. Here, a readout plane based on Large Electron Multiplier detectors provides amplification of the charges before its collection onto an anode with strip readout. The charge amplification enables constructing fully homoge- nous giant LAr-TPCs with tuneable gain, excellent charge imaging performance and increased sensitivity to low energy events. Following a staged approach the WA105 collaboration is con- structing a dual phase LAr-TPC with an active volume of 3x1x1m3 that will soon be tested with cosmic rays. Its construction and operation aims to test scalable solutions for the crucial aspects of this technology: ultra high argon purity in non-evacuable tank, la...
Fabrication and testing of main sodium pumps of Superphenix 1
International Nuclear Information System (INIS)
Noel, H.; Pasqualini, G.
1985-01-01
The complexity of the loads involved and the extremely fine analysis required necessitates extensive design calculations for the Superphenix 1 primary and secondary pumps and associated expansion tanks, aiming toward detailed design validation, after slight adjustments, mainly to the secondary pumps and expansion tanks. The component parts to be built were far larger than those for the previous pumps (Rapsodie, Phenix), with very low manufacturing tolerances, which led to precision machining and welding operations, together with numerous dimensional inspections and materials characterization tests to achieve the required quality standards
Swiss Première of the film "Deep Web" | 11 March 7 p.m. | CERN Main Auditorium
2016-01-01
On Friday 11 March, the CineGlobe Film Festival at CERN will host the FIFDH (International Film Festival and Forum on Human Rights) in the CERN Main Auditorium for the Swiss Première of the film Deep Web. Starting from the online black market Silk Road, this investigation immerses us in the universe of the Tor network and the Dark Web, the cryptic and anonymous side of the Internet. In this modern version of the Far West, inhabited by bounty hunters, libertarians and political dissidents, everything is paid in bitcoins. After the screening, filmmaker Miruna Coca-Cozma will moderate a discussion on security and the evolution of the web, with the participation of the director of the DiploFoundation, Jovan Kubalija, and CERN Computer Security Officer Stefan Lueders. Doors open at 7:00 p.m., film begins at 7:30 p.m.. Entry is free with reservation by email to deepweb.cern@fifdh.org. Anyone interested in volunteering for the s...
International Nuclear Information System (INIS)
Kumar, A.; Pandey, A.; Sogarwal, Hariom; Marimuthu, N.; Singh, V.; Subrahmanyam, V.S.
2016-01-01
India based Neutrino Observatory (INO) is going to use ∼ 30,000 Resistive Plate Chamber (RPC) as an active detector. Resistive Plate chambers are parallel plate fast gaseous detector made up of high resistivity (10"1"2 ohm) of glass or bakelite. Glass plates work as electrodes of positive and negative potential. When a charged particle passes through chamber it ionizes the gas and charge move towards opposite electrodes. The pick-up panels pick these signals. Signals are sent to front end electronics. The characteristic impedance of the strips of the panels should be matched with front end electronics which helps in minimizing the reflected signal. Since INO is an underground laboratory, all material used in it must be fireproof. Since ∼ 60,000 pick-up panels are going to be used in INO hence it should be cheaper also. We recently received a new set of Silicon Fiber Sheets - a dielectric material, of 25 pieces of 1m x 0.5m having thickness 05 mm. We fabricated a set of readout strips panel of dimension 1m x 1m. We will present this work in detail
Analytic theory of the nonlinear M = 1 tearing mode
International Nuclear Information System (INIS)
Hazeltine, R.D.; Meiss, J.D.; Morrison, P.J.
1985-09-01
Numerical studies show that the m = 1 tearing mode continues to grow exponentially well into the nonlinear regime, in contrast with the slow, ''Rutherford,'' growth of m > 1 modes. We present a single helicity calculation which generalizes that of Rutherford to the case when the constant-psi approximation is invalid. As in that theory, the parallel current becomes an approximate flux function when the island size, W, exceeds the linear tearing layer width. However for the m = 1 mode, W becomes proportional to deltaB, rather than (deltaB)/sup 1/2/ above this critical amplitude. This implies that the convective nonlinearity in Ohm's law, which couples the m = 0 component to the m = 1 component, dominates the resistive diffusion term. The balance between the inductive electric field and this convective nonlinearity results in exponential growth. Assuming the form of the perturbed fields to be like that of the linear mode, we find that the growth occurs at 71% of the linear rate
Endothelium-protective sphingosine-1-phosphate provided by HDL-associated apolipoprotein M
DEFF Research Database (Denmark)
Christoffersen, Christina; Obinata, Hideru; Kumaraswamy, Sunil B
2011-01-01
Protection of the endothelium is provided by circulating sphingosine-1-phosphate (S1P), which maintains vascular integrity. We show that HDL-associated S1P is bound specifically to both human and murine apolipoprotein M (apoM). Thus, isolated human ApoM(+) HDL contained S1P, whereas ApoM(-) HDL did...... not. Moreover, HDL in Apom(-/-) mice contains no S1P, whereas HDL in transgenic mice overexpressing human apoM has an increased S1P content. The 1.7-Å structure of the S1P-human apoM complex reveals that S1P interacts specifically with an amphiphilic pocket in the lipocalin fold of apoM. Human ApoM......(+) HDL induced S1P(1) receptor internalization, downstream MAPK and Akt activation, endothelial cell migration, and formation of endothelial adherens junctions, whereas apoM(-) HDL did not. Importantly, lack of S1P in the HDL fraction of Apom(-/-) mice decreased basal endothelial barrier function in lung...
Evaluation of 2.1μm DFB lasers for space applications
Barbero, J.; López, D.; Esquivias, I.; Tijero, J. M. G.; Fischer, M.; Roessner, K.; Koeth, J.; Zahir, M.
2017-11-01
This paper presents the results obtained in the frame of an ESA-funded project called "Screening and Preevaluation of Shortwave Infrared Laser Diode for Space Application" with the objective of verifying the maturity of state of the art SWIR DFB lasers at 2.1μm to be used for space applications (mainly based on the occultation measurement principle and spectroscopy). The paper focus on the functional and environmental evaluation test plan. It includes high precision characterization, mechanical test (vibration and SRS shocks), thermal cycling, gamma and proton radiation tests, life test and some details of the Destructive Physical Analysis performed. The electro-optical characterization includes measurements of the tuning capabilities of the laser both by current and by temperature, the wavelength stability and the optical power versus laser current.
Inflammation induced mTORC2-Akt-mTORC1 signaling promotes macrophage foam cell formation.
Banerjee, Dipanjan; Sinha, Archana; Saikia, Sudeshna; Gogoi, Bhaskarjyoti; Rathore, Arvind K; Das, Anindhya Sundar; Pal, Durba; Buragohain, Alak K; Dasgupta, Suman
2018-06-05
The transformation of macrophages into lipid loaded foam cells is a critical and early event in the pathogenesis of atherosclerosis. Several recent reports highlighted that induction of TLR4 signaling promotes macrophage foam cell formation; however, the underlying molecular mechanisms have not been clearly elucidated. Here, we found that the TLR4 mediated inflammatory signaling communicated with mTORC2-Akt-mTORC1 metabolic cascade in macrophage and thereby promoting lipid uptake and foam cell formation. Mechanistically, LPS treatment markedly upregulates TLR4 mediated inflammatory pathway which by activating mTORC2 induces Akt phosphorylation at serine 473 and that aggravate mTORC1 dependent scavenger receptors expression and consequent lipid accumulation in THP-1 macrophages. Inhibition of mTORC2 either by silencing Rictor expression or inhibiting its association with mTOR notably prevents LPS induced Akt activation, scavenger receptors expression and macrophage lipid accumulation. Although suppression of mTORC1 expression by genetic knockdown of Raptor did not produce any significant change in Akt S473 phosphorylation, however, incubation with Akt activator in Rictor silenced cells failed to promote scavenger receptors expression and macrophage foam cell formation. Thus, present research explored the signaling pathway involved in inflammation induced macrophage foam cells formation and therefore, targeting this pathway might be useful for preventing macrophage foam cell formation. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
1989-12-15
ORDER NO. 1 BOOK 2 OF 5 DATABASE DOCUMENTATION BOOK 00-ALC MANPRA *(C5 MAIN LANDING GEAR- WCD’S) CONTRACT SUMMARY REPORT , 15 DECEMBER 1989 ’.1 - CONTRACT...ORIQ 1 . T A 1~4 M E* X C I" El 1 -:11 E:XCE:EI:IIE:U RE:CORI’ RFiS CvAUiS FOREXE IN REWORK LI[MITS Ill FINAL DESTINATION 22. COOROINATION/INITIATING MCC
Lifescience Database Archive (English)
Full Text Available Mays Molecule: Beta-Glucosidase; Chain: A, B; Engineered: Yes Glycoside Hydrolase 3.2.1.21 (Beta-Glucosidas..., B.Henrissat, A.Esen Crystal Structure Of A Monocotyledon (Maize Zmglu1) Beta-Gl...55-566.|PDB; 1E55; X-ray; A/B=55-566.|PDB; 1E56; X-ray; A/B=55-566.|PDB; 1H49; X-ray; A/B=55-566.|PDB; 1HXJ; X-ray; A/B=60-566.|Mai...ze-2DPAGE; P49235; COLEOPTILE.|MaizeDB; 13870; -.|InterPro
A new and efficient culture method for porcine bone marrow-derived M1- and M2-polarized macrophages.
Gao, Jiye; Scheenstra, Maaike R; van Dijk, Albert; Veldhuizen, Edwin J A; Haagsman, Henk P
2018-06-01
Macrophages play an important role in the innate immune system as part of the mononuclear phagocyte system (MPS). They have a pro-inflammatory signature (M1-polarized macrophages) or anti-inflammatory signature (M2-polarized macrophages) based on expression of surface receptors and secretion of cytokines. However, very little is known about the culture of macrophages from pigs and more specific about the M1 and M2 polarization in vitro. Porcine monocytes or mononuclear bone marrow cells were used to culture M1- and M2-polarized macrophages in the presence of GM-CSF and M-CSF, respectively. Surface receptor expression was measured with flow cytometry and ELISA was used to quantify cytokine secretion in response to LPS and PAM 3 CSK 4 stimulation. Human monocyte-derived macrophages were used as control. Porcine M1- and M2-polarized macrophages were cultured best using porcine GM-CSF and murine M-CSF, respectively. Cultures from bone marrow cells resulted in a higher yield M1- and M2-polarized macrophages which were better comparable to human monocyte-derived macrophages than cultures from porcine monocytes. Porcine M1-polarized macrophages displayed the characteristic fried egg shape morphology, lower CD163 expression and low IL-10 production. Porcine M2-polarized macrophages contained the spindle-like morphology, higher CD163 expression and high IL-10 production. Porcine M1- and M2-polarized macrophages can be most efficiently cultured from mononuclear bone marrow cells using porcine GM-CSF and murine M-CSF. The new culture method facilitates more refined studies of porcine macrophages in vitro, important for both porcine and human health since pigs are increasingly used as model for translational research. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Ostrowski, Michael; Błocki, J.; Bogacz, L.; Bulik, T.; Cadoux, F.; Christov, A.; Curyło, M.; della Volpe, D.; Dyrda, M.; Favre, Y.; Frankowski, A.; Grudnik, Ł.; Grudzińska, M.; Heller, M.; Idźkowski, B.; Jamrozy, M.; Janiak, M.; Kasperek, J.; Lalik, K.; Lyard, E.; Mach, E.; Mandat, D.; Marszałek, A.; Michałowski, J.; Moderski, R.; Montaruli, T.; Neronov, A.; Niemiec, J.; Paśko, P.; Pech, M.; Porcelli, A.; Prandini, E.; Pueschel, E.; Rajda, P.; Rameez, M.; Schioppa, E. jr; Schovanek, P.; Skowron, K.; Sliusar, V.; Sowiński, M.; Stawarz, Ł.; Stodulska, M.; Stodulski, M.; Toscano, S.; Troyano Pujadas, I.; Walter, R.; Wiȩcek, M.; Zagdański, A.; Ziȩtara, K.; Żychowski, P.; Barciński, T.; Karczewski, M.; Kukliński, J. Nicolau; Płatos, Ł.; Rataj, M.; Wawer, P.; Wawrzaszek, R.
2016-01-01
The prototype of a Davies-Cotton small size telescope (SST-1M) has been designed and developed by a consortium of Polish and Swiss institutions and proposed for the Cherenkov Telescope Array (CTA) observatory. The main purpose of the optical system is to focus the Cherenkov light emitted by extensive air showers in the atmosphere onto the focal plane detectors. The main component of the system is a dish consisting of 18 hexagonal mirrors with a total effective collection area of 6.47 m2 (including the shadowing and estimated mirror reflectivity). Such a solution was chosen taking into account the analysis of the Cherenkov light propagation and based on optical simulations. The proper curvature and stability of the dish is ensured by the mirror alignment system and the isostatic interface to the telescope structure. Here we present the design of the optical subsystem together with the performance measurements of its components.
Study of 1 MW neutron source synchrotron dual frequency power circuit for the main ring magnets
International Nuclear Information System (INIS)
McGhee, D.G.
1993-01-01
This paper describes the proposed design of the resonant power circuits for the 1-MW neutron source synchrotron's main ring magnets. The synchrotron is to have a duty cycle of 30 Hz with a maximum upper limit of operation corresponding to 2.0 GeV and a maximum design value of 2.2 GeV. A stability of 30 ppM is the design goal for the main bending and focusing magnets (dipoles and quadruples), in order to achieve an overall stabffity of 100 ppm when random field and position errors of the magnets are included. The power circuits of this design are similar to those used in Argonne's Intense Pulsed Neutron Source (IPNS) where the energy losses during each cycle are supplied by continuous excitation from modulated multiphase DC power supplies. Since only 50% of the 30-Hz sinewave is used for acceleration, a dual-frequency resonant magnet circuit is used in this design. The 30-Hz repetition rate is maintained with a 20-Hz magnet guide field during acceleration and a 60-Hz reset field when no beam is present. This lengthens the guide-field rise time and shortens the fall time, improving the duty factor for acceleration. The maximum B dot is reduced by 33% during acceleration and hence, the maximum rf voltage/turn is reduced by 56%
Interaction between NBS1 and the mTOR/Rictor/SIN1 complex through specific domains.
Directory of Open Access Journals (Sweden)
Jian-Qiu Wang
Full Text Available Nijmegen breakage syndrome (NBS is a chromosomal-instability syndrome. The NBS gene product, NBS1 (p95 or nibrin, is a part of the Mre11-Rad50-NBS1 complex. SIN1 is a component of the mTOR/Rictor/SIN1 complex mediating the activation of Akt. Here we show that NBS1 interacted with mTOR, Rictor, and SIN1. The specific domains of mTOR, Rictor, or SIN1 interacted with the internal domain (a.a. 221-402 of NBS1. Sucrose density gradient showed that NBS1 was located in the same fractions as the mTOR/Rictor/SIN1 complex. Knockdown of NBS1 decreased the levels of phosphorylated Akt and its downstream targets. Ionizing radiation (IR increased the NBS1 levels and activated Akt activity. These results demonstrate that NBS1 interacts with the mTOR/Rictor/SIN1 complex through the a.a. 221-402 domain and contributes to the activation of Akt activity.
Analysis of glutathione S-transferase (M1, T1 and P1) gene ...
African Journals Online (AJOL)
Glutathione S-transferase enzymes are active in detoxifying a wide number of endogenous and exogenous chemical carcinogens and subsequently, are crucial in protecting the DNA. Several studies show some differences in association of glutathione S-transferase M1, T1 and P1 genetic polymorphisms with the risk of ...
Reconstruction of the pre-compactional thickness of the Zechstein Main Dolomite in northwest Poland
Directory of Open Access Journals (Sweden)
Semyrka Grażyna
2015-12-01
Full Text Available Our reconstruction of the pre-compactional thickness of the Main Dolomite strata from the so-called Grotów Peninsula (northwest Poland was based on macroscopic observations of drill cores from three wells: Mokrzec-1, Sieraków-4 and Międzychód-5. These wells are located in various palaeogeographical zones of the Main Dolomite and cored rocks represent a range of microfacies. The amount of compactional reduction in thickness of the Main Dolomite was estimated by summing the total heights (Wst of all stylolites encountered in logs of these wells. For calculations, a generalised model of a drill core was developed, which embraced all types of stylolite seams present in the Main Dolomite succession studied. Also the method of stylolite dimensioning was demonstrated. The number of stylolites in the drill cores studied varied from 511 in the Sieraków-4 well to 1,534 in the Międzychód-5 well. In all cores studied low-amplitude macrostylolites predominated, but the reduction of thickness was controlled mostly by the low- and medium-amplitude macrostylolites. The largest number of stylolites was found in the grainstone/packstone microfacies. The turnout of stylolites depends of microfacies. The highest density of stylolites was documented in mudstones/wackestones (24 stylolites per metre of rock thickness and the lowest in boundstones (14 stylolites per metre of rock thickness. The low-amplitude stylolites appear most frequently in the mudstone/wackestone microfacies (15 stylolites per metre of rock thickness; in grainstones/packstones, rudstones/floatstones and boundstones middle-amplitude stylolites are rare (3 stylolites per metre of rock thickness. The degree of compaction of the Main Dolomite succession studied varied from 6 to 10%; hence, its calculated initial thickness also varied in the wells studied: from 41.3 m in the Sieraków-4 well to 56.9 m in the Mokrzec-1 well and to 97.1 m in the Międzychód-5 well. The volumes of reservoir
A Busy period analysis for the state dependent M/M/1/K queue
Al Hanbali, Ahmad; Boxma, Onno
2010-01-01
In this paper, we study the transient behavior of a state dependent M/M/1/K queue during the busy period. We derive in closed-form the joint transform of the length of the busy period, the number of customers served during the busy period, and the number of losses during the busy period. For two
Overexpression of the polycystin-1 (PC-1) C-tail enhances sensitivity of M-1 cells to ouabain
Jansson, Kyle; Magenheimer, Brenda S.; Maser, Robin L.; Calvet, James P.; Blanco, Gustavo
2014-01-01
Cells derived from renal cysts of patients with autosomal dominant polycystic kidney disease (ADPKD) are abnormally sensitive to ouabain, responding to physiological ouabain concentrations with enhanced proliferation and increased forskolin-induced transepithelial fluid secretion. This requires activation of the epidermal growth factor receptor (EGFR), Src kinase, and the extracellular regulated kinases MEK and ERK. Here, we have determined if the ADPKD phenotype obtained in mouse cortical collecting duct cells by stable overexpression of the C-terminal domain of polycystin-1 (PC-1 C-tail) also elicits the ADPKD-like response to ouabain in the cells. M-1 C20 cells expressing the PC-1 C-tail, and M-1 C17 cells, lacking expression of this construct, were treated with physiological concentrations of ouabain, and cell proliferation, activation of the EGFR-Src-MEK-ERK pathway, forskolin-induced transepithelial Cl− secretion, and the sensitivity of the Na,K-ATPase to ouabain were explored. M-1 C20 cells responded to ouabain with increased cell proliferation and ERK phosphorylation. Ouabain also augmented forskolin-induced and cystic fibrosis transmembrane conductance regulator (CFTR)-mediated apical secretion of Cl− in M-1 C20 cells. These effects required activation of EGFR, Src and MEK. In contrast, ouabain had no significant effects on M-1 C17 cells. Interestingly, approximately 20 % of the Na,K-ATPase from M-1 C20 cells presented an abnormally increased sensitivity to ouabain. Overexpression of PC-1 C-tail in M-1 C20 cells is associated with a ouabain sensitive phenotype and an increased ability of the cells to proliferate and secrete anions upon ouabain stimulation. This phenotype mimics the ouabain sensitivity of ADPKD cells and may help promote their cystogenic potential. PMID:23784065
Joseph, Lauren; Thomsen, Morgane
2017-06-30
Muscarinic M 1 /M 4 receptor stimulation can reduce abuse-related effects of cocaine and may represent avenues for treating cocaine addiction. Muscarinic antagonists can mimic and enhance effects of cocaine, including discriminative stimulus (S D ) effects, but the receptor subtypes mediating those effects are not known. A better understanding of the complex cocaine/muscarinic interactions is needed to evaluate and develop potential muscarinic-based medications. Here, knockout mice lacking M 1 , M 2 , or M 4 receptors (M 1 -/- , M 2 -/- , M 4 -/- ), as well as control wild-type mice and outbred Swiss-Webster mice, were trained to discriminate 10mg/kg cocaine from saline. Muscarinic receptor antagonists with no subtype selectivity (scopolamine), or preferential affinity at the M 1 , M 2 , or M 4 subtype (telenzepine, trihexyphenidyl; methoctramine, AQ-RA 741; tropicamide) were tested alone and in combination with cocaine. In intact animals, antagonists with high affinity at M 1 /M 4 receptors partially substituted for cocaine and increased the S D effect of cocaine, while M 2 -preferring antagonists did not substitute, and reduced the S D effect of cocaine. The cocaine-like effects of scopolamine were absent in M 1 -/- mice. The cocaine S D attenuating effects of methoctramine were absent in M 2 -/- mice and almost absent in M 1 -/- mice. The findings indicate that the cocaine-like S D effects of muscarinic antagonists are primarily mediated through M 1 receptors, with a minor contribution of M 4 receptors. The data also support our previous findings that stimulation of M 1 receptors and M 4 receptors can each attenuate the S D effect of cocaine, and show that this can also be achieved by blocking M 2 autoreceptors, likely via increased acetylcholine release. Copyright © 2017 Elsevier B.V. All rights reserved.
Lithium abundances and metallicities in stars near the main-sequence turnoff and a giant in M67
International Nuclear Information System (INIS)
Garcia Lopez, R.J.; Rebolo, R.; Beckman, J.E.
1988-01-01
The iron abundance of seven stars near the main-sequence (MS) turnoff and a giant in M67 are spectroscopically derived, and the results are discussed. The resulting mean iron abundance of the turnoff stars is (Fe/H) = 0.04 + or - 0.04. Taken together with previous determinations for younger clusters, this shows that there has been relatively little change of the iron abundance in the solar neighborhood during the last 5 Gyr. Lithium was detected in one unevolved star and marginally in the giant, while in the other MS stars only upper limits were found. The considerable differences in Li abundances for stars with similar surface temperature imply that there is at least one parameter affecting Li depletion apart from stellar mass and metallicity. Nonsimultaneous star formation in the cluster cloud explain the scatter in lithium abundances. 50 references
mPGES-1-derived PGE2 mediates dehydration natriuresis
Jia, Zhanjun; Liu, Gang; Sun, Ying; Kakizoe, Yutaka; Guan, Guangju; Zhang, Aihua; Zhou, Shu-Feng
2013-01-01
PGE2 is a natriuretic factor whose production is elevated after water deprivation (WD) but its role in dehydration natriuresis is not well-defined. The goal of the present study was to investigate the role of microsomal prostaglandin E synthase-1 (mPGES-1) in dehydration natriuresis. After 24-h WD, wild-type (WT) mice exhibited a significant increase in 24-h urinary Na+ excretion accompanied with normal plasma Na+ concentration and osmolality. In contrast, WD-induced elevation of urinary Na+ excretion was completely abolished in mPGES-1 knockout (KO) mice in parallel with increased plasma Na+ concentration and a trend increase in plasma osmolality. WD induced a 1.8-fold increase in urinary PGE2 output and a 1.6-fold increase in PGE2 content in the renal medulla of WT mice, both of which were completely abolished by mPGES-1 deletion. Similar patterns of changes were observed for urinary nitrate/nitrite and cGMP. The natriuresis in dehydrated WT mice was associated with a significant downregulation of renal medullary epithelial Na channel-α mRNA and protein, contrasting to unaltered expressions in dehydrated KO mice. By quantitative RT-PCR, WD increased the endothelial nitric oxide synthase (eNOS), inducible NOS, and neuronal NOS expressions in the renal medulla of WT mice by 3.9-, 1.48-, and 2.6-fold, respectively, all of which were significantly blocked in mPGES-1 KO mice. The regulation of eNOS expression was further confirmed by immunoblotting. Taken together, our results suggest that mPGES-1-derived PGE2 contributes to dehydration natriuresis likely via NO/cGMP. PMID:23171554
DEFF Research Database (Denmark)
Bachmann, E; Krogh, T N; Højrup, P
1996-01-01
The mouse homologue to human fetal antigen 1 (hFA1) was purified from mouse amniotic fluid by cation exchange chromatography and immunospecific affinity chromatography. Mouse FA1 (mFA1) is a single chain glycoprotein with an M(r) of 42-50 kDa (SDS-PAGE). The N-terminal amino acid sequence (39...... residues) revealed 74% identity to hFA1 and 100% identity to the translated cDNAs referred to as mouse dlk, pref-1 and SCP-1. mFA1 is the secreted processed molecule encoded by the mRNA defined by these identical mouse cDNAs. Monospecific rabbit anti-mFA1 antibodies, purified by ammonium sulfate...... precipitation and immunospecific affinity chromatography, were used for immunohistochemical and quantitative ELISA techniques. The indirect immunoperoxidase technique demonstrated mFA1 within the endocrine structures of adult mouse pancreas, whereas the exocrine tissue remained unstained. FA1-positive staining...
[99mTc[TRODAT-1: a novel technetium-99m complex as a dopamine transporter imaging agent
International Nuclear Information System (INIS)
Kung Meiping; Stevenson, D.A.; Ploessl, K.; Meegalla, S.K.; Beckwith, A.; Essman, W.D.; Mu, M.; Lucki, I.; Kung, H.F.
1997-01-01
Technetium-99m is the most commonly used radionuclide in routine nuclear medicine imaging procedures. Development of 99m Tc-labeled receptor-specific imaging agents for studying the central nervous system is potentially useful for evaluation of brain function in normal and disease states. A novel 99m Tc-labeled tropane derivative, [ 99m Tc[TRODAT-1, which is useful as a potential CNS dopamine transporter imaging agent, was evaluated and characterized. After i.v. injection into rats, [ 99m Tc[TRODAT-1 displayed specific brain uptake in the rat striatal region (striatum-cerebellum/cerebellum ratio 1.8 at 60 min), where dopamine neurons are concentrated. The specific striatal uptake could be blocked by pretreating rats with a dose of competing dopamine transporter ligand, β-CIT (or RTI-55, i.v., 1 mg/kg). However, the specific striatal uptake of [ 99m Tc[TRODAT-1 was not affected by co-injection of excess free ligand (TRODAT-1, up to 200 μg per rat) or by pretreating the rats with haloperidol (i.v., 1 mg/kg). The specific uptake in striatal regions of rats that had prior 6-hydroxydopamine lesion in the substantia nigra area showed a dramatic reduction. The radioactive material recovered from the rat striatal homogenates at 60 min after i.v. injection of [ 99m Tc[TRODAT-1 showed primarily the original compound (>95%), a good indication of in vivo stability in brain tissue. Similar and comparable organ distribution patterns and brain regional uptakes of [ 99m Tc[TRODAT-1 were obtained for male and female rats. (orig./AJ). With 4 figs., 6 tabs
Preliminary crystallographic analysis of avian infectious bronchitis virus main protease
Energy Technology Data Exchange (ETDEWEB)
Li, Jun; Shen, Wei [Laboratory of Structural Biology, Tsinghua University, Beijing 100084 (China); Liao, Ming, E-mail: mliao@scau.edu.cn [Laboratory of Avian Medicine, College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642 (China); Bartlam, Mark, E-mail: mliao@scau.edu.cn [Laboratory of Structural Biology, Tsinghua University, Beijing 100084 (China); National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)
2007-01-01
The avian infectious bronchitis virus main protease has been crystallized; crystals diffract to 2.7 Å resolution. Infectious bronchitis virus (IBV) is the prototype of the genus Coronavirus. It causes a highly contagious disease which affects the respiratory, reproductive, neurological and renal systems of chickens, resulting great economic losses in the poultry industry worldwide. The coronavirus (CoV) main protease (M{sup pro}), which plays a pivotal role in viral gene expression and replication through a highly complex cascade involving the proteolytic processing of replicase polyproteins, is an attractive target for antiviral drug design. In this study, IBV M{sup pro} was overexpressed in Escherichia coli. Crystals suitable for X-ray crystallography have been obtained using microseeding techniques and belong to space group P6{sub 1}22. X-ray diffraction data were collected in-house to 2.7 Å resolution from a single crystal. The unit-cell parameters were a = b = 119.1, c = 270.7 Å, α = β = 90, γ = 120°. Three molecules were predicted to be present in the asymmetric unit from a calculated self-rotation function.
HAT-P-49b: a 1.7 M {sub J} planet transiting a bright 1.5 M {sub ☉} F-star
Energy Technology Data Exchange (ETDEWEB)
Bieryla, A.; Latham, D. W.; Buchhave, L. A.; Béky, B.; Falco, E.; Torres, G.; Noyes, R. W.; Berlind, P.; Calkins, M. C.; Esquerdo, G. A. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Hartman, J. D.; Bakos, G. Á.; Bhatti, W.; Csubry, Z.; Penev, K.; De Val-Borro, M. [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States); Kovács, G. [Konkoly Observatory, Budapest 1121 (Hungary); Boisse, I. [Centro de Astrofísica, Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal); Lázár, J.; Papp, I., E-mail: abieryla@cfa.harvard.edu, E-mail: gbakos@astro.princeton.edu [Hungarian Astronomical Association (HAA), Budapest 1461 (Hungary); and others
2014-04-01
We report the discovery of the transiting extrasolar planet HAT-P-49b. The planet transits the bright (V = 10.3) slightly evolved F-star HD 340099 with a mass of 1.54 M {sub ☉} and a radius of 1.83 R {sub ☉}. HAT-P-49b is orbiting one of the 25 brightest stars to host a transiting planet which makes this a favorable candidate for detailed follow-up. This system is an especially strong target for Rossiter-McLaughlin follow-up due to the host star's fast rotation, 16 km s{sup –1}. The planetary companion has a period of 2.6915 days, mass of 1.73 M {sub J}, and radius of 1.41 R {sub J}. The planetary characteristics are consistent with that of a classical hot Jupiter but we note that this is the fourth most massive star to host a transiting planet with both M{sub p} and R{sub p} well determined.
Analysis of the Main Nucleosides in Cordyceps Sinensis by LC/ESI-MS
Directory of Open Access Journals (Sweden)
Yun-Biao He
2010-01-01
Full Text Available A sensitive, selective and reliable liquid chromatography-mass spectrometry coupled with electrospray ionization interface method for simultaneous separation and determination of thymine, adenine, adenosine and cordycepin in Cordyceps sinensis has been established. The optimum separation for these analytes was achieved using a gradient elution system and a 2.0 × 150 mm Shimadzu VP-ODS column. 2-Chloroadenosine was used as internal standard for this assay. [M+H]+ions at m/z 127, 136, 268, 252 and 302 were chosen and selective ion monitoring (SIM mode was used for quantitative analysis of the four main nucleosides. The regression equations were linear in the range of 1.0–117.5 μg·mL-1 for thymine, 1.8-127.0 μg·mL-1 for adenine, 0.6-114.0 μg·mL-1 for adenosine and 0.5-107.5 μg·mL-1 for cordycepin. The limits of quantitation (LOQ and detection (LOD were 1.0 and 0.2 μg·mL-1 for thymine, 1.8 and 0.6 μg·mL-1 for adenine, 0.6 and 0.1 μg·mL-1 for adenosine and 0.5 and 0.1 μg·mL-1 for cordycepin, respectively. The recoveries of the four nucleosides ranged from 98.47 to 99.32%. The developed method was successfully used to determine nucleosides in Cordyceps sinensis from different sources.
Selective mGAT2 (BGT-1) GABA Uptake Inhibitor
DEFF Research Database (Denmark)
Vogensen, Stine Byskov; Jørgensen, Lars; Madsen, Karsten Kirkegaard
2013-01-01
β-Amino acids sharing a lipophilic diaromatic side chain were synthesized and characterized pharmacologically on mouse GABA transporter subtypes mGAT1−4. The parent amino acids were also characterized. Compounds 13a, 13b, and 17b displayed more than 6-fold selectivity for mGAT2 over mGAT1. Compou...... 17b displayed anticonvulsive properties inferring a role of mGAT2 in epileptic disorders. These results provide new neuropharmacological tools and a strategy for designing subtype selective GABA transport inhibitors....
Beisser, K.; Cruikshank, D. P.; McFadden, T.
2013-12-01
Is Pluto a planet? Some creative low income Bay-area middle-schoolers put a musical spin on this hot science debate with a video rap ';battle' over tiny Pluto's embattled planetary standing. The students' timing was perfect, with NASA's New Horizons mission set to conduct the first reconnaissance of Pluto and its moons in July 2015. Pluto - the last of the nine original planets to be explored by spacecraft - has been the subject of scientific study and speculation since Clyde Tombaugh discovered it in 1930, orbiting the Sun far beyond Neptune. Produced by the students and a very creative educator, the video features students 'battling' back and forth over the idea of Pluto being a planet. The group collaborated with actual space scientists to gather information and shot their video before a 'green screen' that was eventually filled with animations and visuals supplied by the New Horizons mission team. The video debuted at the Pluto Science Conference in Maryland in July 2013 - to a rousing response from researchers in attendance. The video marks a nontraditional approach to the ongoing 'great planet debate' while educating viewers on a recently discovered region of the solar system. By the 1990s, researchers had learned that Pluto possessed multiple exotic ices on its surface, a complex atmosphere and seasonal cycles, and a large moon (Charon) that likely resulted from a giant impact on Pluto itself. It also became clear that Pluto was no misfit among the planets - as had long been thought - but the largest and brightest body in a newly discovered 'third zone' of our planetary system called the Kuiper Belt. More recent observations have revealed that Pluto has a rich system of satellites - five known moons - and a surface that changes over time. Scientists even speculate that Pluto may possess an internal ocean. For these and other reasons, the 2003 Planetary Decadal Survey ranked a Pluto/Kuiper Belt mission as the highest priority mission for NASA's newly created
Stress relaxation damage in K9 glass plate irradiated by 1.06μm CW laser
International Nuclear Information System (INIS)
Luo Fu; Sun Chengwei
2001-01-01
Based on the stress relaxation model in 1D planar geometry and the visco-elastic constitutive equation, the temperature and stress histories in the K9 glass samples irradiated by CW laser beams (λ = 1.06 μm) have been calculated. The results indicate that the residual tensile stress due to the stress relaxation effect during cooling after the laser radiation may be greater than the tensile fracture strength of samples, while the maximum compression stress during the laser heating is less than the requirement for compression damage. For a K9 glass window of 3 mm thickness, its damage due to the stress relaxation may be induced by a laser radiation of 0.946 MW/cm 2 for 0.2s . Therefore, the stress relaxation should be regarded as the main mechanism of damage in K9 glass windows while a CW laser beam (λ = 1.06 μm) irradiates it with large spot
Efficacy of magnetoacustoradiation treatment of experimental M-1, PC-1 tumors
International Nuclear Information System (INIS)
Chizh, D.V.; Krutilina, N.I.
2011-01-01
The urgency of the struggle against malignant tumors is determined by a stable growth of cancer incidence, high level of disability and morbidity, the cost and difficulty of treatment. The influence of low-frequency ultrasound and alternating magnetic field on transplanted tumors of sarcoma M-1 and alveolar liver cancer PC-1 together with radiation therapy at a SFD of 5 Gy and 20 Gy was investigated in the experiments on animals. It was established that the influence of the above physical factors inhibited sarcoma M-1 and alveolar liver cancer PC-1 growth, prolonged the life and survival of the animals of the investigated groups when compared to the intact controls, which definitely expanded the ideas about the capabilities of ultrasound and magnetic fields in cancer treatment.
FoxM1 is a general target for proteasome inhibitors.
Directory of Open Access Journals (Sweden)
Uppoor G Bhat
2009-08-01
Full Text Available Proteasome inhibitors are currently in the clinic or in clinical trials, but the mechanism of their anticancer activity is not completely understood. The oncogenic transcription factor FoxM1 is one of the most overexpressed genes in human tumors, while its expression is usually halted in normal non-proliferating cells. Previously, we established that thiazole antibiotics Siomycin A and thiostrepton inhibit FoxM1 and induce apoptosis in human cancer cells. Here, we report that Siomycin A and thiostrepton stabilize the expression of a variety of proteins, such as p21, Mcl-1, p53 and hdm-2 and also act as proteasome inhibitors in vitro. More importantly, we also found that well-known proteasome inhibitors such as MG115, MG132 and bortezomib inhibit FoxM1 transcriptional activity and FoxM1 expression. In addition, overexpression of FoxM1 specifically protects against bortezomib-, but not doxorubicin-induced apoptosis. These data suggest that negative regulation of FoxM1 by proteasome inhibitors is a general feature of these drugs and it may contribute to their anticancer properties.
Energy Technology Data Exchange (ETDEWEB)
Philpott, Michael R., E-mail: philpott@imr.edu [Center for Computational Materials Science, Institute of Materials Science, Tohoku University, 2-1-1 Katahira, Aoba-ku, 980-8577 Sendai (Japan); Kawazoe, Yoshiyuki [Center for Computational Materials Science, Institute of Materials Science, Tohoku University, 2-1-1 Katahira, Aoba-ku, 980-8577 Sendai (Japan)
2009-03-30
Ab initio plane wave all valence electron based DFT calculations were used to explore the dichotomy of perimeter vs. interior in the electronic and geometric structure of the D{sub 6h} singlet ground state and D{sub 2h} lowest triplet state of planar graphene hydrocarbon molecules with crenellated (arm chair) edges and the general formula C{sub 6[3m(m-1)+1]} H{sub 6(2m-1)} where m = 2,...,6. The largest molecule C{sub 546}H{sub 66} was 4.78 nm across and contained 2250 valence electrons. These molecules are nominally 'fully benzenoid hydrocarbons'. However with increasing size, the core of central atoms abandoned any fully benzenoid geometry they had in small systems and organized into single layer graphite (graphene) structure. The perimeter atoms of the crenellation adopted a conjugated geometry with unequal bonds and between core and perimeter there were some C{sub 6} rings retaining remnants of aromatic sextet-type properties. Compared to a zigzag edge the crenellated edge conferred stability in all the systems studied as measured by the singlet homo-lumo level gap BG{sub 0} and the singlet-lowest triplet energy gap {Delta}E{sub ST}. For the largest crenellated system (m = 6) BG{sub 0} and {Delta}E{sub ST} were approximately 0.7 eV, larger in value than for similarly sized hexagonal graphenes with zigzag edges. Triplet states were identified for all the molecules in the series and in the case of the m = 2 molecule hexabenzocoronene C{sub 42}H{sub 18}, two conformations with D{sub 2h} symmetry were identified and compared to features on the triplet state potential energy surface of benzene.
Divorcing the Late Upper Palaeolithic demographic histories of mtDNA haplogroups M1 and U6 in Africa
Directory of Open Access Journals (Sweden)
Pennarun Erwan
2012-12-01
Full Text Available Abstract Background A Southwest Asian origin and dispersal to North Africa in the Early Upper Palaeolithic era has been inferred in previous studies for mtDNA haplogroups M1 and U6. Both haplogroups have been proposed to show similar geographic patterns and shared demographic histories. Results We report here 24 M1 and 33 U6 new complete mtDNA sequences that allow us to refine the existing phylogeny of these haplogroups. The resulting phylogenetic information was used to genotype a further 131 M1 and 91 U6 samples to determine the geographic spread of their sub-clades. No southwest Asian specific clades for M1 or U6 were discovered. U6 and M1 frequencies in North Africa, the Middle East and Europe do not follow similar patterns, and their sub-clade divisions do not appear to be compatible with their shared history reaching back to the Early Upper Palaeolithic. The Bayesian Skyline Plots testify to non-overlapping phases of expansion, and the haplogroups’ phylogenies suggest that there are U6 sub-clades that expanded earlier than those in M1. Some M1 and U6 sub-clades could be linked with certain events. For example, U6a1 and M1b, with their coalescent ages of ~20,000–22,000 years ago and earliest inferred expansion in northwest Africa, could coincide with the flourishing of the Iberomaurusian industry, whilst U6b and M1b1 appeared at the time of the Capsian culture. Conclusions Our high-resolution phylogenetic dissection of both haplogroups and coalescent time assessments suggest that the extant main branching pattern of both haplogroups arose and diversified in the mid-later Upper Palaeolithic, with some sub-clades concomitantly with the expansion of the Iberomaurusian industry. Carriers of these maternal lineages have been later absorbed into and diversified further during the spread of Afro-Asiatic languages in North and East Africa.
The development of 99mTc-d, 1-HM-PAO
International Nuclear Information System (INIS)
Bai Lanqin; Huang Jinjie; Fan Li; Bai Suzhen; Li Guoli; Jing Hui; Xiao Lun
1991-12-01
The 99m Tc-d,1-HM-PAO is an ideal radiopharmaceutical for regional cerebral blood perfusion imaging. The improvement of synthesis and separation of diastereoisomers leads to obtain high purity (>99%) of d, 1-HM-PAO and meso-HM-PAO. During separation H NMR spectroscopy was used to monitor the relative composition of these two diastereoisomers that can ensure the purity of pligand of d,1-HM-PAO. The intravenous injection of 99m Tc-d,1-HM-PAO was formed by adding fresh 99m Tc washing liquor into a sterile. Pyrogen-free and freeze-dried vial. The radiochemical purity (RCP) of 99m Tc-d,1-HM-PAO was greater than 80%. From the experiments of 99m Tc-d,1-HM-PAO in mice, after two minutes of intravenously (I>V>) administration about 2.24% of injected dose (I.D.)appeared in the brain, and after 24 hours about 72% of radioactivity of injected dose still left in the brain. But for the 99m Tc-meso-HM-PAO after two minutes of i.v. administration, about 1.93% of I.D. appeared in the brain, and 24 hours later, 25% of radioactivity of I.D. was in the brain. This result shows that in the brain the radioactivity of 99m Tc-meso-HM-PAO declines faster than that of 99m Td-d,1-HM-PAO
REDDY MAIN BELT ASTEROID SPECTRA V1.0
National Aeronautics and Space Administration — This data set contains low-resolution (R~150) near-infrared (0.7-2.5 microns) spectra of 90 main belt asteroids observed with the SpeX instrument on the NASA...
Occupational Toluene Exposure Induces Cytochrome P450 2E1 mRNA Expression in Peripheral Lymphocytes
Mendoza-Cantú, Ania; Castorena-Torres, Fabiola; de León, Mario Bermúdez; Cisneros, Bulmaro; López-Carrillo, Lizbeth; Rojas-García, Aurora E.; Aguilar-Salinas, Alberto; Manno, Maurizio; Albores, Arnulfo
2006-01-01
Print workers are exposed to organic solvents, of which the systemic toxicant toluene is a main component. Toluene induces expression of cytochrome P450 2E1 (CYP2E1), an enzyme involved in its own metabolism and that of other protoxicants, including some procarcinogens. Therefore, we investigated the association between toluene exposure and the CYP2E1 response, as assessed by mRNA content in peripheral lymphocytes or the 6-hydroxychlorzoxazone (6OH-CHZ)/chlorzoxazone (CHZ) quotient (known as CHZ metabolic ratio) in plasma, and the role of genotype (5′-flanking region RsaI/PstI polymorphic sites) in 97 male print workers. The geometric mean (GM) of toluene concentration in the air was 52.80 ppm (10–760 ppm); 54% of the study participants were exposed to toluene concentrations that exceeded the maximum permissible exposure level (MPEL). The GM of urinary hippuric acid at the end of a work shift (0.041 g/g creatinine) was elevated relative to that before the shift (0.027 g/g creatinine; p < 0.05). The GM of the CHZ metabolic ratio was 0.33 (0–9.3), with 40% of the subjects having ratios below the GM. However, the average CYP2E1 mRNA level in peripheral lymphocytes was 1.07 (0.30–3.08), and CYP2E1 mRNA levels within subjects correlated with the toluene exposure ratio (environmental toluene concentration:urinary hippuric acid concentration) (p = 0.014). Genotype did not alter the association between the toluene exposure ratio and mRNA content. In summary, with further validation, CYP2E1 mRNA content in peripheral lymphocytes could be a sensitive and noninvasive biomarker for the continuous monitoring of toluene effects in exposed persons. PMID:16581535
EXTraS discovery of a 1.2-s X-ray pulsar in M31
Esposito, P.; Israel, G.; Belfiore, A.; Novara, G.; Sidoli, L.; Rodriguez Castillo, G.; De Luca, A.; Tiengo, A.; Haberl, F.; Salvaterra, R.
2017-10-01
A systematic search for periodic signals in the XMM-Newton's EPIC archive carried out within the EXTraS project resulted in the discovery of a 1.2-s flux modulation in 3XMM J004301.4+413017. It is the first accreting neutron star in M31 for which the spin period has been detected. Besides this distinction, 3XMM J0043 proved to be an interesting system. Doppler shifts of the spin modulation revealed an orbital motion with period of 1.27 d and the analysis of optical data shows that, while the source is likely associated to a globular cluster, a counterpart with V ˜ 22 outside the cluster cannot be excluded. The emission of the pulsar appears rather hard (most data are described by a power law with photon index <1) and, assuming the distance to M31, the 0.3-10 keV luminosity was variable, from ˜3×10^{37} to 2×10^{38} erg/s. Based on this, we discuss two main possible scenarios for 3X J0043: a peculiar low-mass X-ray binary, perhaps similar to 4U 1822-37 or 4U 1626-67, or an intermediate-mass X-ray binary akin Her X-1.
Mitochondrial lineage M1 traces an early human backflow to Africa.
González, Ana M; Larruga, José M; Abu-Amero, Khaled K; Shi, Yufei; Pestano, José; Cabrera, Vicente M
2007-07-09
The out of Africa hypothesis has gained generalized consensus. However, many specific questions remain unsettled. To know whether the two M and N macrohaplogroups that colonized Eurasia were already present in Africa before the exit is puzzling. It has been proposed that the east African clade M1 supports a single origin of haplogroup M in Africa. To test the validity of that hypothesis, the phylogeographic analysis of 13 complete mitochondrial DNA (mtDNA) sequences and 261 partial sequences belonging to haplogroup M1 was carried out. The coalescence age of the African haplogroup M1 is younger than those for other M Asiatic clades. In contradiction to the hypothesis of an eastern Africa origin for modern human expansions out of Africa, the most ancestral M1 lineages have been found in Northwest Africa and in the Near East, instead of in East Africa. The M1 geographic distribution and the relative ages of its different subclades clearly correlate with those of haplogroup U6, for which an Eurasian ancestor has been demonstrated. This study provides evidence that M1, or its ancestor, had an Asiatic origin. The earliest M1 expansion into Africa occurred in northwestern instead of eastern areas; this early spread reached the Iberian Peninsula even affecting the Basques. The majority of the M1a lineages found outside and inside Africa had a more recent eastern Africa origin. Both western and eastern M1 lineages participated in the Neolithic colonization of the Sahara. The striking parallelism between subclade ages and geographic distribution of M1 and its North African U6 counterpart strongly reinforces this scenario. Finally, a relevant fraction of M1a lineages present today in the European Continent and nearby islands possibly had a Jewish instead of the commonly proposed Arab/Berber maternal ascendance.
Mitochondrial lineage M1 traces an early human backflow to Africa
Directory of Open Access Journals (Sweden)
Pestano José
2007-07-01
Full Text Available Abstract Background The out of Africa hypothesis has gained generalized consensus. However, many specific questions remain unsettled. To know whether the two M and N macrohaplogroups that colonized Eurasia were already present in Africa before the exit is puzzling. It has been proposed that the east African clade M1 supports a single origin of haplogroup M in Africa. To test the validity of that hypothesis, the phylogeographic analysis of 13 complete mitochondrial DNA (mtDNA sequences and 261 partial sequences belonging to haplogroup M1 was carried out. Results The coalescence age of the African haplogroup M1 is younger than those for other M Asiatic clades. In contradiction to the hypothesis of an eastern Africa origin for modern human expansions out of Africa, the most ancestral M1 lineages have been found in Northwest Africa and in the Near East, instead of in East Africa. The M1 geographic distribution and the relative ages of its different subclades clearly correlate with those of haplogroup U6, for which an Eurasian ancestor has been demonstrated. Conclusion This study provides evidence that M1, or its ancestor, had an Asiatic origin. The earliest M1 expansion into Africa occurred in northwestern instead of eastern areas; this early spread reached the Iberian Peninsula even affecting the Basques. The majority of the M1a lineages found outside and inside Africa had a more recent eastern Africa origin. Both western and eastern M1 lineages participated in the Neolithic colonization of the Sahara. The striking parallelism between subclade ages and geographic distribution of M1 and its North African U6 counterpart strongly reinforces this scenario. Finally, a relevant fraction of M1a lineages present today in the European Continent and nearby islands possibly had a Jewish instead of the commonly proposed Arab/Berber maternal ascendance.
Genetic analysis of rice semidwarf mutant Tad-M-1
International Nuclear Information System (INIS)
Wang Naiyuan; Yang Rencui
1995-01-01
This paper dealed with the inheritance of the rice semidwarf of Tad-M-,a mutant line bred from traditional indica rice Variety Tadukan by radiation. The results indicated that semidwarf of Tad-M-1 was controlled by one pair of recessive gene, which was nonallelic to sd-1 gene of variety Aijiaonante and sd-g gene of variety Xinguiai and allelic to the semidwarf gene of Yunnan japonica variety Xueheaizao and Sichuan indica variety Yizila.The possible uses of Tad-M-1 in rice breeding was also discussed
N=1 field theory duality from M theory
International Nuclear Information System (INIS)
Schmaltz, M.; Sundrum, R.
1998-01-01
We investigate Seiberg close-quote s N=1 field theory duality for four-dimensional supersymmetric QCD with the M-theory 5-brane. We find that the M-theory configuration for the magnetic dual theory arises via a smooth deformation of the M-theory configuration for the electric theory. The creation of Dirichlet 4-branes as Neveu-Schwarz 5-branes are passed through each other in type IIA string theory is given an elegant derivation from M theory. copyright 1998 The American Physical Society
Tsuji-Tamura, Kiyomi; Ogawa, Minetaro
2018-02-26
Elongation of endothelial cells is an important process in vascular formation and is expected to be a therapeutic target for inhibiting tumor angiogenesis. We have previously demonstrated that inhibition of mTORC1 and mTORC2 impaired endothelial cell elongation, although the mechanism has not been well defined. In this study, we analyzed the effects of the mTORC1-specific inhibitor everolimus and the mTORC1/mTORC2 dual inhibitor KU0063794 on the cytoskeletal organization and morphology of endothelial cell lines. While both inhibitors equally inhibited cell proliferation, KU0063794 specifically caused abnormal accumulation of F-actin and disordered distribution of microtubules, thereby markedly impairing endothelial cell elongation and tube formation. The effects of KU0063794 were phenocopied by paclitaxel treatment, suggesting that KU0063794 might impair endothelial cell morphology through over-stabilization of microtubules. Although mTORC1 is a key signaling molecule in cell proliferation and has been considered a target for preventing angiogenesis, mTORC1 inhibitors have not been sufficient to suppress angiogenesis. Our results suggest that mTORC1/mTORC2 dual inhibition is more effective for anti-angiogenic therapy, as it impairs not only endothelial cell proliferation, but also endothelial cell elongation. Copyright © 2018 Elsevier Inc. All rights reserved.
Mautjana, R. T.; Molefe, P. T.; Mayindu, N. F.; Armah, M. N.; Ramasawmy, V.; Albasini, G. L.; Matali, S.; Richmond, H.; Rusimbi, V.; Kiwanuka, J.; Mutale, D. M.; Mutsimba, F.
2018-01-01
This report summarizes the results of AFRIMETS.M.M-S6 mass standards comparison conducted between eleven participating laboratories/countries. Two sets of five weights with nominal values 100 mg, 100 g, 500 g, 1 kg and 5 kg were used as the traveling standards. These nominal values were decided from the needs of participating laboratories submitted to the pilot laboratory through a questionnaire and agreed upon by all participants. The traveling standards were hand carried between laboratories starting from February 2014 and were received from the last participants in October 2014. The programme was coordinated by National Metrology Institute of South Africa (NMISA), who provided the travelling standards and reference values for the comparison. The corrections to the BIPM as-maintained mass unit [5] have insignificant influence on the results of this comparison. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).
ApolipoproteinA1-75 G/A (M1- polymorphism and Lipoprotein(a; Anti- vs. Pro-Atherogenic properties
Directory of Open Access Journals (Sweden)
Ranganath L
2007-08-01
Full Text Available Abstract Background ApolipoproteinA1(apoA1 is the major apoprotein constituent of high-density-lipoprotein(HDL. The relationship of apoA1 -75 bp(M1- allele polymorphism with lipoprotein phenotype and cardiovascular diseae (CVD remain unclear. Overnight fasting blood samples were collected from a cohort of high-risk Omani population, 90 non-diabetic subjects and 149 type 2 diabetes mellitus (T2DM subjects for genotype and phenotype studies. Results The M1+ and M1- alleles frequencies were 0.808 and 0.192 for M1+ and M1-, respectively, comparable to the frequency of apoA1 (M1+ and M1- amongst a healthy Omani population, 0.788 and 0.212, respectively. The frequencies of the hetero- and homozygous subjects for the MspI polymorphism at -75 (M1- of the apoA1 gene were in Hardy-Weinberg equilibrium. The mean Lp(a concentration was significantly higher(P = 0.02 in subjects carrying M1- allele compared to M1+ allele of the APOA1 gene with an odd ratio of 2.3(95% CI, 1.13–14.3, irrespective of gender and the diabetic status. Conclusion ApolipoproteinA1-75 G/A (M1- polymorphism is relatively common and is positively associated with Lp(a and therefore, may confer a potential risk for cardiovascular disease (CVD.
Energy Technology Data Exchange (ETDEWEB)
1986-10-30
This study involves a concept developed by the Fairchild Space Company which is directly applicable to the Strategic Defense Initiative (SDI) Program as well as other national security programs requiring reliable, secure and survivable telecommunications systems. The overall objective of this study program was to determine the feasibility of combining and integrating long-lived, compact, autonomous isotope power sources with fiber optic and other types of ground segments of the SDI communications, command, control and intelligence/battle management (C/sup 3/I/BM) system in order to significantly enhance the survivability of those critical systems, especially against the potential threats of electromagnetic pulse(s) (EMP) resulting from high altitude nuclear weapon explosion(s). 28 figs., 2 tabs.
Waiting time distribution in M/D/1 queueing systems
DEFF Research Database (Denmark)
Iversen, Villy Bæk; Staalhagen, Lars
1999-01-01
The well-known formula for the waiting time distribution of M/D/1 queueing systems is numerically unsuitable when the load is close to 1.0 and/or the results for a large waiting time are required. An algorithm for any load and waiting time is presented, based on the state probabilities of M/D/1...
Directory of Open Access Journals (Sweden)
Yvana Cristina Jorge
2013-01-01
Full Text Available Objective. The anti-inflammatory proteins annexin-A1 and galectin-1 have been associated with tumor progression. This scenario prompted us to investigate the relationship between the gene and protein expression of annexin-A1 (ANXA1/AnxA1 and galectin-1 (LGALS1/Gal-1 in an inflammatory gastric lesion as chronic gastritis (CG and gastric adenocarcinoma (GA and its association with H. pylori infection. Methods. We analyzed 40 samples of CG, 20 of GA, and 10 of normal mucosa (C by the quantitative real-time PCR (qPCR technique and the immunohistochemistry assay. Results. High ANXA1 mRNA expression levels were observed in 90% (36/40 of CG cases (mean relative quantification RQ = 4.26 ± 2.03 and in 80% (16/20 of GA cases (mean RQ = 4.38 ± 4.77. However, LGALS1 mRNA levels were high (mean RQ = 2.44 ± 3.26 in 60% (12/20 of the GA cases, while low expression was found in CG (mean RQ = 0.43±3.13; P<0.01. Normal mucosa showed modest immunoreactivity in stroma but not in epithelium, while stroma and epithelium displayed an intense immunostaining in CG and GA for both proteins. Conclusion. These results have provided evidence that galectin-1 and mainly annexin-A1 are overexpressed in both gastritis and gastric cancer, suggesting a strong association of these proteins with chronic gastric inflammation and carcinogenesis.
Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism.
Backlund, Michael; Paukku, Kirsi; Kontula, Kimmo K; Lehtonen, Jukka Y A
2016-04-20
As the formation of ribonucleoprotein complexes is a major mechanism of angiotensin II type 1 receptor (AT1R) regulation, we sought to identify novel AT1R mRNA binding proteins. By affinity purification and mass spectroscopy, we identified TIA-1. This interaction was confirmed by colocalization of AT1R mRNA and TIA-1 by FISH and immunofluorescence microscopy. In immunoprecipitates of endogenous TIA- 1, reverse transcription-PCR amplified AT1R mRNA. TIA-1 has two binding sites within AT1R 3'-UTR. The binding site proximal to the coding region is glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-dependent whereas the distal binding site is not. TIA-1 functions as a part of endoplasmic reticulum (ER) stress response leading to stress granule (SG) formation and translational silencing. We and others have shown that AT1R expression is increased by ER stress-inducing factors. In unstressed cells, TIA-1 binds to AT1R mRNA and decreases AT1R protein expression. Fluorescence microscopy shows that ER stress induced by thapsigargin leads to the transfer of TIA-1 to SGs. In FISH analysis AT1R mRNA remains in the cytoplasm and no longer colocalizes with TIA-1. Thus, release of TIA-1-mediated suppression by ER stress increases AT1R protein expression. In conclusion, AT1R mRNA is regulated by TIA-1 in a ER stress-dependent manner. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
MK-III function tests in JOYO. Primary main cooling pump
International Nuclear Information System (INIS)
Isozaki, Kazunori; Saito, Takakazu; Sumino, Kouzo; Karube, Kouji; Terano, Toshihiro; Sakaba, Hideo; Nakai, Satoru
2004-06-01
MK-III function test (SKS-1) that was carried out from October 17, 2001 through October 23, 2001 using MK-III transition core configuration and MK-III function tests (SKS-2) was carried out from January 27, 2003 through February 13, 2003 using MK-III core configuration. The major function tests results of primary cooling system were shown as follows; (1) The stability of the primary main pump flow control system was confirmed on both CAS (cascade) mode and Man (manual) mode. Also no divergence of flow and revolution of the pump were observed at step flow change disturbance. (2) The main motor was shifted to run-back flow control operation in about 54 seconds after scram. The flow rate and pump revolution at run-back operation of A and B cooling system were 167 m 3 /h and 117 rpm, 185m 3 /h and 118 rpm respectively. The pump revolution was within the design target revolution 122 rpm ± 8 rpm and the flow was over the 10% of the rated flow. (3) The pony motor was engaged in operation in about 39 seconds after the primary main pump trip. The flow rate and pump revolution at the pony motor operation of A and B cooling system were 180 m 3 /h and 124 rpm, 190 m 3 /h and 123 rpm respectively. These values were satisfied the design low limit of 93 rpm and 10% of the rated flow. (4) Free flow coast down time constant was longer than 10 seconds that was design shortest time at both the primary pump trip and run-back operation. (5) Pump over flow column sodium levels of both A and B cooling system at rated operating condition were NL-1550 mm and, NL-1468 mm respectively and were lower than NL-1581 mm of the design value. This result shows the new IHX pressure loss estimation was conservative. (6) It was confirmed that the primary main pump could operate with out scram for up to 0.6 seconds of external power supply loss. (author)
Behavior of 14C aflatoxin M1 during camembert cheese making.
Fremy, J M; Roiland, J C; Gaymard, A
1990-01-01
Camembert cheeses are made from raw milk spiked with aflatoxin M1. Three aflatoxin M1 levels (7.5 micrograms/L, 3 micrograms/L, and 0.3 micrograms/L) are used. In curds 35.6, 47.1, and 57.7% of aflatoxin M1, respectively, are recovered, and in wheys 64.4, 52.9, and 42.3%, respectively, are recovered. During the first 15 days of storage, the aflatoxin M1 content of different cheeses decreases 25, 55, and 75%, respectively. A similar experiment is made with milk contaminated with 14C labeled aflatoxin M1. The same results are obtained, except for the behavior of aflatoxin M1 in cheese; the same 14C activity is recovered during storage for 30 days.
Three aspects of stellar evolution near the main sequence
International Nuclear Information System (INIS)
Morgan, J.C.
1979-05-01
Three problems of stellar evolution are considered: the gap in the HR diagram of M67, the evolutionary status of RS CVn binaries and the solar neutrino problem. The physical basis of the Eggleton stellar evolution computer program is described. The program was used to calculate a grid of evolutionary tracks for models with masses between 0.7 and 1.29 solar masses. The more massive stars considered here have expanding convective cores during their main sequence evolution. The isochrone of the old galactic cluster M67 has a gap at the top of its main sequence because of the rapid evolution of stars at hydrogen exhaustion. RS CVn binaries present a complex collection of observational phenomena although they appear to be detached binaries. Their evolutionary status has remained controversial because of their high space density. Here it is shown that a post main sequence interpretation is satisfactory. Models of the Sun with metal poor interiors have been proposed in an attempt to resolve the solar neutrino problem. Here the evolution of two such models is calculated in detail, including a gradual contamination of the surface convection zone to produce the observed metal abundance, giving fully consistent models of the Sun as it is observed. (author)
DEFF Research Database (Denmark)
Bisgaard, Line S; Mogensen, Christina K; Rosendahl, Alexander
2016-01-01
Macrophages are heterogeneous and can polarize into specific subsets, e.g. pro-inflammatory M1-like and re-modelling M2-like macrophages. To determine if peritoneal macrophages (PEMs) or bone marrow derived macrophages (BMDMs) resembled aortic macrophages from ApoE-/- mice, their M1/M2 phenotype,......, ACSL1, SRB1, DGAT1, and cpt1a) was decreased in advanced versus early lesions. In conclusion, PEMs and BMDMs are phenotypically distinct and differ from macrophages in lesions with respect to expression of M1/M2 markers and lipid metabolism genes....
Yoshida, E; Kojima, Y; Shizuma, K
2000-01-01
Photoactivation by gamma-rays from sup 6 sup 0 Co of 10 kCi has been performed for isomers of sup 1 sup 0 sup 7 sup m Ag, sup 1 sup 0 sup 9 sup m Ag and sup 1 sup 0 sup 3 sup m Rh and half-lives of these isomers were determined. Gamma-rays emitted from sup 1 sup 0 sup 7 sup m Ag and sup 1 sup 0 sup 9 sup m Ag were measured with a low-background Ge detector and internal conversion electrons from sup 1 sup 0 sup 3 sup m Rh were measured with a 2 pi gas flow counter. The half-lives obtained are: sup 1 sup 0 sup 7 sup m Ag: 44.5+-0.8 s, sup 1 sup 0 sup 9 sup m Ag: 38.0+-1.2 s and sup 1 sup 0 sup 3 sup m Rh: 54.8+-3.8 min. The results are in agreement with previous values obtained by different excitation methods.
Frej, Cecilia; Mendez, Armando J; Ruiz, Mario; Castillo, Melanie; Hughes, Thomas A; Dahlbäck, Björn; Goldberg, Ronald B
2017-06-01
Type 1 diabetes mellitus (T1D) patients have an increased risk of cardiovascular disease despite high levels of high-density lipoproteins (HDL). Apolipoprotein M (apoM) and its ligand sphingosine 1-phospate (S1P) exert many of the anti-inflammatory effects of HDL. We investigated whether apoM and S1P are altered in T1D and whether apoM and S1P are important for HDL functionality in T1D. ApoM and S1P were quantified in plasma from 42 healthy controls and 89 T1D patients. HDL was isolated from plasma and separated into dense, medium-dense, and light HDL by ultracentrifugation. Primary human aortic endothelial cells were challenged with tumor necrosis factor-α in the presence or absence of isolated HDL. Proinflammatory adhesion molecules E-selectin and vascular cellular adhesion molecule-1 were quantified by flow cytometry. Activation of the S1P 1 - receptor was evaluated by analyzing downstream signaling targets and receptor internalization. There were no differences in plasma levels of apoM and S1P between controls and T1D patients, but the apoM/S1P complexes were shifted from dense to light HDL particles in T1D. ApoM/S1P in light HDL particles from women were less efficient in inhibiting expression of vascular cellular adhesion molecule-1 than apoM/S1P in denser particles. The light HDL particles were unable to activate Akt, whereas all HDL subfractions were equally efficient in activating Erk and receptor internalization. ApoM/S1P in light HDL particles were inefficient in inhibiting tumor necrosis factor-α-induced vascular cellular adhesion molecule-1 expression in contrast to apoM/S1P in denser HDL particles. T1D patients have a higher proportion of light particles and hence more dysfunctional HDL, which could contribute to the increased cardiovascular disease risk associated with T1D. © 2017 American Heart Association, Inc.
Directory of Open Access Journals (Sweden)
Laura Dugo
2017-01-01
Full Text Available Polyphenols-rich cocoa has many beneficial effects on human health, such as anti-inflammatory effects. Macrophages function as control switches of the immune system, maintaining the balance between pro- and anti-inflammatory activities. We investigated the hypothesis that cocoa polyphenol extract may affect macrophage proinflammatory phenotype M1 by favoring an alternative M2 anti-inflammatory state on macrophages deriving from THP-1 cells. Chemical composition, total phenolic content, and antioxidant capacity of cocoa polyphenols extracted from roasted cocoa beans were determined. THP-1 cells were activated with both lipopolysaccharides and interferon-γ for M1 or with IL-4 for M2 switch, and specific cytokines were quantified. Cellular metabolism, through mitochondrial oxygen consumption, and ATP levels were evaluated. Here, we will show that cocoa polyphenolic extract attenuated in vitro inflammation decreasing M1 macrophage response as demonstrated by a significantly lowered secretion of proinflammatory cytokines. Moreover, treatment of M1 macrophages with cocoa polyphenols influences macrophage metabolism by promoting oxidative pathways, thus leading to a significant increase in O2 consumption by mitochondrial complexes as well as a higher production of ATP through oxidative phosphorylation. In conclusion, cocoa polyphenolic extract suppresses inflammation mediated by M1 phenotype and influences macrophage metabolism by promoting oxidative pathways and M2 polarization of active macrophages.
Geng, Song; Wu, Ding-Lu; Yang, Jing; Wei, Xi-Guang; Zhu, Jun; Zhang, Hai-Bo; Ren, Yi; Lau, Kai-Chung
2014-05-08
We have made an extensive theoretical exploration of gas-phase N-alkylamino cation affinities (NAAMCA), including amino cation affinities (AMCA) and N-dimethylamino cation affinities (NDMAMCA), of neutral main-group element hydrides of groups 15-17 and periods 2-4 in the periodic table by using the G2(+)M method. Some similarities and differences are found between NAAMCA and the corresponding alkyl cation affinities (ACA) of H(n)X. Our calculations show that the AMCA and NDMAMCA are systematically lower than the corresponding proton affinities (PA) for H(n)X. In general, there is no linear correlation between NAAMCA and PA of H(n)X. Instead, the correlations exist only within the central elements X in period 2, or periods 3-4, which is significantly different from the reasonable correlations between ACA and PA for all H(n)X. NAAMCA (H(n)X) are weaker than NAAMCA (H(n-1)X(-)) by more than 700 kJ/mol and generally stronger than ACA (H(n)X), with three exceptions: H2ONR2(+)(R = H, Me) and HFNH2(+). These new findings can be rationalized by the negative hyperconjugation and Pauli repulsion.
Lifescience Database Archive (English)
Full Text Available MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea ...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...
Galloway, Claire R; Lebois, Evan P; Shagarabi, Shezza L; Hernandez, Norma A; Manns, Joseph R
2014-01-01
Acetylcholine signaling through muscarinic receptors has been shown to benefit memory performance in some conditions, but pan-muscarinic activation also frequently leads to peripheral side effects. Drug therapies that selectively target M1 or M4 muscarinic receptors could potentially improve memory while minimizing side effects mediated by the other muscarinic receptor subtypes. The ability of three recently developed drugs that selectively activate M1 or M4 receptors to improve recognition memory was tested by giving Long-Evans rats subcutaneous injections of three different doses of the M1 agonist VU0364572, the M1 positive allosteric modulator BQCA or the M4 positive allosteric modulator VU0152100 before performing an object recognition memory task. VU0364572 at 0.1 mg/kg, BQCA at 1.0 mg/kg and VU0152100 at 3.0 and 30.0 mg/kg improved the memory performance of rats that performed poorly at baseline, yet the improvements in memory performance were the most statistically robust for VU0152100 at 3.0 mg/kg. The results suggested that selective M1 and M4 receptor activation each improved memory but that the likelihood of obtaining behavioral efficacy at a given dose might vary between subjects even in healthy groups depending on baseline performance. These results also highlighted the potential of drug therapies that selectively target M1 or M4 receptors to improve memory performance in individuals with impaired memory.
Dale Reed with model in front of M2-F1
1967-01-01
during the initial auto tows. Auto tows were done using a 1000 foot rope fastened to the NASA Pontiac. Rogers Dry Lake provided miles of unobstructed motoring. On April 5, 1963, Thompson lifted the M2-F1's nose off of the ground for the first time on tow. Speed was 86 miles per hour. The little craft seemed to bounce uncontrollably back and forth on the main landing gear, and stopped when he lowered the nose to the ground. He tried again, but each time with the same results. He felt it was a landing gear problem that could have caused the aircraft to roll on its back if he had lifting the main gear off of the ground. Looking at movies of the tests, engineers decided that the bouncing was probably caused by unwanted rudder movements. Flight control system number two was replaced in favor of number one, and it never bounced again. Speeds on tow inched up to 110 miles per hour, which allowed Thompson to climb to about 20 feet, then glide for about 20 seconds after releasing the line. That was the most that could be expected during an auto tow. In the spring of 1963 the M2-F1 was shipped to Ames Research Center, where it was mounted on twenty-foot poles inside the 40-foot by 80-foot wind tunnel. For two weeks, Thompson and engineers Ed Browne and Dick Eldredge took turns 'flying' it as air blasted by at a 135 miles per hour. They learned more about its flying qualities, and accumulated important data for the upcoming aero tows. A NASA C-47 was used for all of the aero tows. The first was on August 16, 1963. The M2-F1 had recently been equipped with an ejection seat, small rockets in the tail to extend the landing flare for about 5 seconds (if needed), and Thompson prepared for the flight with a few more tows behind the Pontiac. Forward visibility in the M2-F1 was very limited on tow, requiring Thompson to fly about 20 feet higher than the C-47 so he could see the plane through the nose window. Towing speed was about 100 miles per hour. Tow release was at 12,000 feet. The
International Nuclear Information System (INIS)
Scherer, N.M.; Nathanson, N.M.
1990-01-01
Cloned muscarinic acetylcholine m1 and m2 receptors were expressed in stably transfected mouse Y1 adrenal cells and in a variant Y1 line, Kin-8, which is deficient in cAMP-dependent protein kinase activity (PKA - ). m1 and m2 receptors were rapidly internalized following exposure of transfected PKA + or PKA - cells to the muscarinic agonist carbachol. Thus, agonist-dependent internalization of m1 and m2 did not require PKA activity. A differential effect of PKA on regulation by agonist of the m2 receptor, but not the m1 receptor, was unmasked in PKA - cells. These data indicate that the basal activity of PKA may modulate the agonist-dependent internalization of the m2 receptor, but not the m1 receptor. The internalization of the m1 and m2 receptors in both PKA + and PKA - cells was accompanied by desensitization of functional responses. Exposure of PKA + cells to 10 -7 M phorbol 12-myristate 13-acetate (PMA), an activator of protein kinase C, resulted in a 30 ± 9% decrease in the number of m1 receptors on the cell surface. The m2 receptor was not internalized following treatment of either PKA + or PKA - cells with PMA. Thus, the m1 and m2 receptors show differential sensitivity to internalization by PMA. Agonist-dependent internalization of the m1 receptor appeared to be independent of activation of PKC because (1) agonist-dependent internalization of m1 was not attenuated in PKA - cells, (2) the rate and extent of internalization of m1 in cells exposed to PMA were less than those in cells exposed to agonist, and (3) treatment of cells with concanavalin A selectivity blocked internalization of m1 in cells exposed to PMA, but not to agonist. The effects of agonist and PMA on receptor internalization were not additive. Exposure of PKA + or PKA - cells to PMA reduced the magnitude of pilocarpine-stimulated PI hydrolysis by about 25%
Sugiyanto; Zukhronah, Etik; Pratiwi, Esteti Sophia
2017-12-01
Indonesia has been hit by financial crisis in the middle of 1997. The financial crisis that has occurred gives a severe impact to the economy of Indonesia resulting the needs for a detection system of financial crisis. Crisis can be detected based on several indicators such as M1, M2 per foreign exchange reserves, and M2 multiplier. These three indicators can affect the exchange rate stability and may further affect the financial stability so that it can be one of the causes of the financial crisis. This research aims to determine the appropriate model that can detect the financial crisis in Indonesia. Markov switching is an alternative model that can be approach and used often for detecting financial crisis. We can determine the combination of volatility and Markov switching model with AR and volatility model are determined first. The results of this research are that M1 can be modelled by SWARCH (3, 1) while M2 per foreign research exchange reserves and M2 multiplier can be modelled by SWARCH(3,2).
Safety measures for the main control board replacement project at Ikata units 1 and 2
International Nuclear Information System (INIS)
Hashimoto, Nozomu; Tada, Kenji
2013-01-01
When Units 1 and 2 of the Ikata Power Station underwent replacement of their main control boards, control cabinets, and associated equipment, it was necessary to remove all the control boards, cabinets, and cables from the control building including from the main control room. This meant the loss of operation and monitoring functions in the main control room and functions of control cabinets. To maintain the operation and monitoring functions required under plant shutdown conditions, temporary operation and monitoring equipment (i.e., temporary main control board) was installed in the temporary main control room. The advance preparations included a trial switching from the permanent to the temporary main control board to identify and address potential problems in advance. When the replacement work was underway, a work schedule sheet posted in the temporary and the permanent control rooms was used to prevent human errors caused by operators’ recognition errors. Monitoring and control signals were switched from the old boards to the temporary boards and from the temporary boards to the new boards at appropriate timings to ensure plant safety during the replacement operation. (author)
Emergence and oscillation of cosmic space by joining M1-branes
Energy Technology Data Exchange (ETDEWEB)
Sepehri, Alireza [Shahid Bahonar University, Faculty of Physics, Kerman (Iran, Islamic Republic of); Research Institute for Astronomy and Astrophysics of Maragha (RIAAM), Maragha (Iran, Islamic Republic of); Rahaman, Farook [Jadavpur University, Department of Mathematics, Kolkata, West Bengal (India); Capozziello, Salvatore [Universita di Napoli Federico II, Dipartimento di Fisica ' ' E. Pancini' ' , Naples (Italy); Gran Sasso Science Institute (INFN), L' Aquila (Italy); Tomsk State Pedagogical University, Tomsk (Russian Federation); INFN Sezione di Napoli, Naples (Italy); Ali, Ahmed Farag [Benha University, Department of Physics, Faculty of Science, Benha (Egypt); Pradhan, Anirudh [G L A University, Department of Mathematics, Institute of Applied Sciences and Humanities, Mathura, Uttar Pradesh (India)
2016-05-15
Recently, it has been proposed by Padmanabhan that the difference between the number of degrees of freedom on the boundary surface and the number of degrees of freedom in a bulk region leads to the expansion of the universe. Now, a natural question arises; how could this model explain the oscillation of the universe between contraction and expansion branches? We try to address this issue in the framework of a BIonic system. In this model, M0-branes join to each other and give rise to a pair of M1-anti-M1-branes. The fields which live on these branes play the roles of massive gravitons that cause the emergence of a wormhole between them and formation of a BIon system. This wormhole dissolves into M1-branes and causes a divergence between the number of degrees of freedom on the boundary surface of M1 and the bulk leading to an expansion of M1-branes. When M1-branes become close to each other, the square energy of their system becomes negative and some tachyonic states emerge. To remove these states, M1-branes become compact, the sign of compacted gravity changes, causing anti-gravity to arise: in this case, branes get away from each other. By articulating M1-BIons, an M3-brane and an anti-M3-brane are created and connected by three wormholes forming an M3-BIon. This new system behaves like the initial system and by closing branes to each other, they become compact and, by getting away from each other, they open. Our universe is located on one of these M3-branes and, by compactifying the M3-brane, it contracts and, by opening it, it expands. (orig.)
Emergence and oscillation of cosmic space by joining M1-branes
International Nuclear Information System (INIS)
Sepehri, Alireza; Rahaman, Farook; Capozziello, Salvatore; Ali, Ahmed Farag; Pradhan, Anirudh
2016-01-01
Recently, it has been proposed by Padmanabhan that the difference between the number of degrees of freedom on the boundary surface and the number of degrees of freedom in a bulk region leads to the expansion of the universe. Now, a natural question arises; how could this model explain the oscillation of the universe between contraction and expansion branches? We try to address this issue in the framework of a BIonic system. In this model, M0-branes join to each other and give rise to a pair of M1-anti-M1-branes. The fields which live on these branes play the roles of massive gravitons that cause the emergence of a wormhole between them and formation of a BIon system. This wormhole dissolves into M1-branes and causes a divergence between the number of degrees of freedom on the boundary surface of M1 and the bulk leading to an expansion of M1-branes. When M1-branes become close to each other, the square energy of their system becomes negative and some tachyonic states emerge. To remove these states, M1-branes become compact, the sign of compacted gravity changes, causing anti-gravity to arise: in this case, branes get away from each other. By articulating M1-BIons, an M3-brane and an anti-M3-brane are created and connected by three wormholes forming an M3-BIon. This new system behaves like the initial system and by closing branes to each other, they become compact and, by getting away from each other, they open. Our universe is located on one of these M3-branes and, by compactifying the M3-brane, it contracts and, by opening it, it expands. (orig.)
Macroscopic quantum tunneling in 1 μm Nb junctions below 100mK
International Nuclear Information System (INIS)
Voss, R.F.; Webb, R.A.
1981-01-01
The transition probabilities out of the superconducting state of low current density 1 μm Nb Josephson junctions with capacitance < 0.15 pF have been measured as a function of temperature T down to 3 mK. Below 100 mK the distribution widths become independent of T. Junctions with critical currents that differ by an order of magnitude have the same dependence of relative width on T. The low T results are interpreted in terms of quantum tunneling of the (macroscopic) junction phase. The observed low temperature widths are smaller than expected indicating the necessity of corrections to the simple WKB tunneling rates. (orig.)
China Dimensions Data Collection: Fundamental GIS: Digital Chart of China, 1:1M, Version 1
National Aeronautics and Space Administration — Fundamental GIS: Digital Chart of China, 1:1M, Version 1 consists of vector maps of China and surrounding areas. The maps include roads, railroads, drainage systems,...
Yao, Q.; Shen, D. W.; Wen, C. H. P.; Hua, C. Q.; Zhang, L. Q.; Wang, N. Z.; Niu, X. H.; Chen, Q. Y.; Dudin, P.; Lu, Y. H.; Zheng, Y.; Chen, X. H.; Wan, X. G.; Feng, D. L.
2018-03-01
van der Waals heterostructures (VDWHs) exhibit rich properties and thus has potential for applications, and charge transfer between different layers in a heterostructure often dominates its properties and device performance. It is thus critical to reveal and understand the charge transfer effects in VDWHs, for which electronic structure measurements have proven to be effective. Using angle-resolved photoemission spectroscopy, we studied the electronic structures of (PbSe )1.16(TiSe2 )m (m =1 , 2), which are naturally occurring VDWHs, and discovered several striking charge transfer effects. When the thickness of the TiSe2 layers is halved from m =2 to m =1 , the amount of charge transferred increases unexpectedly by more than 250%. This is accompanied by a dramatic drop in the electron-phonon interaction strength far beyond the prediction by first-principles calculations and, consequently, superconductivity only exists in the m =2 compound with strong electron-phonon interaction, albeit with lower carrier density. Furthermore, we found that the amount of charge transferred in both compounds is nearly halved when warmed from below 10 K to room temperature, due to the different thermal expansion coefficients of the constituent layers of these misfit compounds. These unprecedentedly large charge transfer effects might widely exist in VDWHs composed of metal-semiconductor contacts; thus, our results provide important insights for further understanding and applications of VDWHs.
IgM repertoire biodiversity is reduced in HIV-1 infection and systemic lupus erythematosus
Directory of Open Access Journals (Sweden)
Li eYin
2013-11-01
Full Text Available Background: HIV-1 infection or systemic lupus erythematosus [SLE] disrupt B cell homeostasis, reduce memory B cells, and impair function of IgG and IgM antibodies. Objective: To determine how disturbances in B cell populations producing polyclonal antibodies relate to the IgM repertoire, the IgM transcriptome in health and disease was explored at the complementarity determining region 3 [CDRH3] sequence population level. Methods: 454-deep pyrosequencing in combination with a novel analysis pipeline was applied to define populations of IGHM CDRH3 sequences based on absence or presence of somatic hypermutations [SHM] in peripheral blood B cells. Results: HIV or SLE subjects have reduced biodiversity within their IGHM transcriptome compared to healthy subjects, mainly due to a significant decrease in the number of unique combinations of alleles, although recombination machinery was intact. While major differences between sequences without or with SHM occurred among all groups, IGHD and IGHJ allele use, CDRH3 length distribution, or generation of SHM were similar among study cohorts. Antiretroviral therapy failed to normalize IGHM biodiversity in HIV-infected individuals. All subjects had a low frequency of allelic combinations within the IGHM repertoire similar to known broadly-neutralizing HIV-1 antibodies. Conclusions: Polyclonal expansion would decrease overall IgM biodiversity independent of other mechanisms for development of the B cell repertoire. Applying deep sequencing as a strategy to follow development of the IgM repertoire in health and disease provides a novel molecular assessment of multiple points along the B cell differentiation pathway that is highly sensitive for detecting perturbations within the repertoire at the population level.
Hanus, Daniel
2016-08-01
The debate about whether or not one could/should ascribe reasoning abilities to animals has deep historical roots and seems very up-to-date in the light of the immense body of new empirical data originating from various species and research paradigms. Associative learning (AL) seems to be a ubiquitous low-level contender for any cognitive interpretation of animal behavior, mostly because of the assumed mechanistic simplicity and phylogenetic prevalence. However, the implicit assumption that AL is simple and therefore the most parsimonious mechanism to describe seemingly complex behavior can and must be questioned on various grounds. Using recent empirical findings with chimpanzees as an example, I argue that at times inferential reasoning might be the most likely candidate to account for performance differences between experimental and control conditions. Finally, a general conclusion drawn from the current debate(s) in the field of comparative psychology could be that a dichotomist battle of 2 conceptual camps-each of which is lacking a clear and homogeneous theoretical framework-is a scientific deadlock. (PsycINFO Database Record (c) 2016 APA, all rights reserved).
Directory of Open Access Journals (Sweden)
Maja Pori
2009-11-01
Full Text Available The aim of the study was to investigate the correlation between motor ability of coordination and personality traits of Slovenian soldiers. The subject sample consisted of 94 soldiers in a battle unit of Slovenian Armed Forces (SAF who were serving in the first brigade (age 26,5 ± 3,4 years. Motor ability of coordination was assessed with two motor tasks (polygon bac- kwards and figure 8 duck test. The structure of personality traits was measured with a FPI (Freiburg Personality Inventory included 114 items and measured 9 personality traits of order I (neuroticism, impulsivity, depression, irritability, sociability, calmness, dominance, suppression, sincerity and 3 personality traits of order II (extroversion, emotional istability, masculinity. The correlation between coordination and personality traits was estimated by the Pearson’s correlation coefficient. The results show that soldiers who did worse in motor test polygon backwards were more neurotic, suppressed, and impulsive. They also tend to be more sociable. The correlation between second test of coordination shows that better soldiers in this test are more extrovert or less introvert.
Hasan, Al Shaimaa; Luo, Lan; Yan, Chen; Zhang, Tian-Xia; Urata, Yoshishige; Goto, Shinji; Mangoura, Safwat A.; Abdel-Raheem, Mahmoud H.; Zhang, Shouhua; Li, Tao-Sheng
2016-01-01
Cardiosphere-derived cells (CDCs), one of the promising stem cell sources for myocardial repair, have been tested in clinical trials and resulted in beneficial effects; however, the relevant mechanisms are not fully understood. In this study, we examined the hypothesis that CDCs favor heart repair by switching the macrophages from a pro-inflammatory phenotype (M1) into a regulatory anti-inflammatory phenotype (M2). Macrophages from mice were cultured with CDCs-conditioned medium or with fibroblasts-conditioned medium as a control. Immunostaining showed that CDCs-conditioned medium significantly enhanced the expression of CD206 (a marker for M2 macrophages), but decreased the expression of CD86 (a marker for M1 macrophages) 3 days after culture. For animal studies, we used an acute myocardial infarction model of mice. We injected CDCs, fibroblasts, or saline only into the border zone of infarction. Then we collected the heart tissues for histological analysis 5 and 14 days after treatment. Compared with control animals, CDCs treatment significantly decreased M1 macrophages and neutrophils but increased M2 macrophages in the infarcted heart. Furthermore, CDCs-treated mice had reduced infarct size and fewer apoptotic cells compared to the controls. Our data suggest that CDCs facilitate heart repair by modulating M1/M2 macrophage polarization and neutrophil recruitment, which may provide a new insight into the mechanisms of stem cell-based myocardial repair. PMID:27764217
HLA-B27M1M2 and high immune responsiveness to Shigella flexneri in post-dysenteric arthritis
van Bohemen, C. G.; Nabbe, A. J.; Landheer, J. E.; Grumet, F. C.; Mazurkiewicz, E. S.; Dinant, H. J.; Lionarons, R. J.; van Bodegom, P. C.; Zanen, H. C.
1986-01-01
The heterogeneous HLA-B27 antigen is closely associated with post-infectious or reactive arthritis (ReA) and is comprised of two serologically defined variants: B27M1+M2+ and B27M1+M2-. An outbreak of dysentery (n = 120) caused by a Shigella flexneri 2a strain, which possessed cell envelope antigens
Directory of Open Access Journals (Sweden)
Huixi Li
2016-04-01
Full Text Available BloodSTOP iX Battle Matrix (BM and QuikClot Combat Gauze (CG have both been used to treat traumatic bleeding. The purpose of this study was to examine the efficacy and initial safety of both products in a swine extremity arterial hemorrhage model, which mimics combat injury. Swine (37.13 ± 0.56 kg, NBM = 11, NCG = 9 were anesthetized and splenectomized. We then isolated the femoral arteries and performed a 6 mm arteriotomy. After 45 s of free bleeding, either BM or CG was applied. Fluid resuscitation was provided to maintain a mean arterial pressure of 65 mmHg. Animals were observed for three hours or until death. Fluoroscopic angiography and wound stability challenge tests were performed on survivors. Tissue samples were collected for histologic examination. Stable hemostasis was achieved in 11/11 BM and 5/9 CG subjects, with recovery of mean arterial pressure and animal survival for three hours (p < 0.05, Odds Ratio (OR = 18.82 (0.85–415.3. Time to stable hemostasis was shorter for the BM-treated group (4.8 ± 2.5 min vs. 58 ± 20.1 min; Median = 2, Interquartile Range (IQR = 0 min vs. Median = 60, IQR = 120 min; p < 0.05 and experienced longer total stable hemostasis (175.2 ± 2.5 min vs. 92.4 ± 29.9 min; Median = 178, IQR = 0 min vs. Median = 120, IQR = 178 min; p < 0.05. Post-treatment blood loss was lower with BM (9.5 ± 2.4 mL/kg, Median = 10.52, IQR = 13.63 mL/kg compared to CG (29.9 ± 9.9 mL/kg, Median = 29.38, IQR = 62.44 mL/kg (p = 0.2875. Standard BM products weighed less compared to CG (6.9 ± 0.03 g vs. 20.2 ± 0.4 g (p < 0.05 and absorbed less blood (3.4 ± 0.8 g vs. 41.9 ± 12.3 g (p < 0.05. Fluoroscopic angiography showed recanalization in 5/11 (BM and 0/5 (CG surviving animals (p = 0.07, OR = 9.3 (0.41–208.8. The wound stability challenge test resulted in wound re-bleeding in 1/11 (BM and 5/5 (CG surviving animals (p < 0.05, OR = 0.013 (0.00045–0.375. Histologic evidence indicated no wound site, distal limb or major
Neuroprotective activity of selective mGlu1 and mGlu5 antagonists in vitro and in vivo.
Szydlowska, Kinga; Kaminska, Bozena; Baude, Andrea; Parsons, Chris G; Danysz, Wojciech
2007-01-05
The neuroprotective potential of allosteric mGlu5 and mGlu1 antagonists such as 6-methyl-2-(phenylethynyl)-pyridin (MPEP)/[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) and (3-ethyl-2-methyl-quinolin-6-yl)-(4-methoxy-cyclohexyl)-methanone methanesulfonate (EMQMCM), was tested in vitro in organotypic hippocampal cultures and in the middle cerebral artery occlusion model of stroke in vivo. Both classes of agent have high selectivity toward mGlu sub-types and are active in animal models of various diseases indicating satisfactory CNS penetration. In organotypic hippocampal cultures MPEP showed high neuroprotective potency against sub-chronic (12 days) insult produced by 3-NP with an IC50 of c.a. 70 nM. In contrast, although the mGlu1 antagonist EMQMCM was also protective, it seems to be weaker yielding an IC50 of c.a. 1 microM. Similarly, in the transient (90 min) middle cerebral artery occlusion model of ischaemia in rats, MTEP seems to be more effective than EMQMCM. MTEP, at 2.5 mg/kg and at 5 mg/kg provided 50 and 70% neuroprotection if injected 2 h after the onset of ischaemia. At a dose of 5 mg/kg, significant (50%) neuroprotection was also seen if the treatment was delayed by 4 h. EMQMCM was not protective at 5 mg/kg (given 2 h after occlusion) but at 10 mg/kg 50% of neuroprotection was observed. The present data support stronger neuroprotective potential of mGlu5 than mGlu1 antagonists.
Conductivity ageing studies on 1M10ScSZ (M4+=Ce, Hf)
DEFF Research Database (Denmark)
Omar, Shobit; Bin Najib, Waqas; Bonanos, Nikolaos
2011-01-01
The long-term conductivity stability is tested on zirconia based electrolyte materials for solid oxide fuel cell applications. The ageing studies have been performed on the samples of ZrO2 co-doped with 10mol% of Sc2O3 and 1mol% MO2, where M = Ce or Hf (denoted respectively 1Ce10ScSZ and 1Hf10Sc......SZ) in oxidising and reducing atmospheres, at 600°C for 3000h. At 600°C, these compositions show initial conductivity of around 9–12mS∙cm−1 in air. After 3000h of ageing, no phase transitions are observed in any of the samples. For the first 1000h, the degradation rate is higher than in the subsequent 2000h......; thereafter, conductivity degrades linearly with time for all samples. In air, the loss in the conductivity is lower than in reducing conditions. The 1Ce10ScSZ shows the highest degradation rate of 3.8%/1000h in wet H2/N2 after the first 1000h of ageing. A colour change of the 1Ce10ScSZ sample from white...
[{sup 99m}Tc]TRODAT-1: a novel technetium-99m complex as a dopamine transporter imaging agent
Energy Technology Data Exchange (ETDEWEB)
Meiping, Kung [Department of Radiology, University of Pennsylvania, Philadelphia (United States); Stevenson, D A [Department of Radiology, University of Pennsylvania, Philadelphia (United States); Ploessl, K [Department of Radiology, University of Pennsylvania, Philadelphia (United States); Meegalla, S K [Department of Radiology, University of Pennsylvania, Philadelphia (United States); Beckwith, A [Department of Radiology, University of Pennsylvania, Philadelphia (United States); Essman, W D [Department of Psychiatry, University of Pennsylvania, Philadelphia (United States); Mu, M [Department of Radiology, University of Pennsylvania, Philadelphia (United States); Lucki, I [Department of Psychiatry, University of Pennsylvania, Philadelphia (United States); [Department of Pharmacology, University of Pennsylvania, Philadelphia (United States); Kung, H F [Department of Radiology, University of Pennsylvania, Philadelphia (United States); [Department of Pharmacology, University of Pennsylvania, Philadelphia (United States)
1997-04-01
Technetium-99m is the most commonly used radionuclide in routine nuclear medicine imaging procedures. Development of {sup 99m}Tc-labeled receptor-specific imaging agents for studying the central nervous system is potentially useful for evaluation of brain function in normal and disease states. A novel {sup 99m}Tc-labeled tropane derivative, [{sup 99m}Tc]TRODAT-1, which is useful as a potential CNS dopamine transporter imaging agent, was evaluated and characterized. After i.v. injection into rats, [{sup 99m}Tc]TRODAT-1 displayed specific brain uptake in the rat striatal region (striatum-cerebellum/cerebellum ratio 1.8 at 60 min), where dopamine neurons are concentrated. The specific striatal uptake could be blocked by pretreating rats with a dose of competing dopamine transporter ligand, {beta}-CIT (or RTI-55, i.v., 1 mg/kg). However, the specific striatal uptake of [{sup 99m}Tc]TRODAT-1 was not affected by co-injection of excess free ligand (TRODAT-1, up to 200 {mu}g per rat) or by pretreating the rats with haloperidol (i.v., 1 mg/kg). The specific uptake in striatal regions of rats that had prior 6-hydroxydopamine lesion in the substantia nigra area showed a dramatic reduction. The radioactive material recovered from the rat striatal homogenates at 60 min after i.v. injection of [{sup 99m}Tc]TRODAT-1 showed primarily the original compound (>95%), a good indication of in vivo stability in brain tissue. Similar and comparable organ distribution patterns and brain regional uptakes of [{sup 99m}Tc]TRODAT-1 were obtained for male and female rats. (orig./AJ). With 4 figs., 6 tabs.
Lifescience Database Archive (English)
Full Text Available itiation Factor Tfiid-1; Chain: A, B; Synonym: Tata-Box Factor 1, Tata Sequence-Binding Protein 1, Tbp1; Eng...ineered: Yes; Molecule: Dna (5'-D(*Gp*Cp*Tp*Ap*Tp*Ap*Ap*Ap*Tp*Gp*Gp*Gp*Cp*A)-3'); Chai...n: C, E; Molecule: Dna (5'-D(*Tp*Gp*Cp*Cp*Cp*Ap*Tp*Tp*Tp*Ap*Tp*Ap*Gp*C)-3'); Chain: D, F Tata Box-Bindi
Lifescience Database Archive (English)
Full Text Available itiation Factor Tfiid-1; Chain: A, B; Synonym: Tata-Box Factor 1, Tata Sequence-Binding Protein 1, Tbp1; Eng...ineered: Yes; Molecule: Dna (5'-D(*Gp*Cp*Tp*Tp*Tp*Ap*Ap*Ap*Ap*Gp*Gp*Gp*Cp*A)-3'); Chai...n: C, E; Molecule: Dna (5'-D(*Tp*Gp*Cp*Cp*Cp*Tp*Tp*Tp*Tp*Ap*Ap*Ap*Gp*C)-3'); Chain: D, F Tata Box-Bindi
Lifescience Database Archive (English)
Full Text Available ativa Molecule: Nonspecific Lipid Transfer Protein; Synonym: Ltp 1, Pap 1; Chain: A; Other_details: Complexe...NMR; @=26-116.|PDB; 1RZL; X-ray; @=26-116.|Gramene; P23096; -.|InterPro; IPR003612; AAI....|InterPro; IPR000528; Plant_LTP.|Pfam; PF00234; Tryp_alpha_amyl; 1.|PRINTS; PR00382; LIPIDTRNSFER.|SMART; SM00499; AAI... 0.224, R-Free: 0.265 Length: 116 AA, Molecular weight: 11364 Da MARAQLVLVALVAALLLAAPHAAVAI
German battle casualties: the treatment of functional somatic disorders during World War I.
Linden, Stefanie Caroline; Jones, Edgar
2013-10-01
World War I witnessed the admission of large numbers of German soldiers with neurological symptoms for which there was no obvious organic cause. This posed a considerable challenge for the military and medical authorities and resulted in an active discussion on the etiology and treatment of these disorders. Current historiography is reliant on published physician accounts, and this represents the first study of treatment approaches based on original case notes. We analyzed patient records from two leading departments of academic psychiatry in Germany, those at Berlin and Jena, in conjunction with the contemporaneous medical literature. Treatment, which can be broadly classified into reward and punishment, suggestion, affective shock, cognitive learning, and physiological methods, was developed in the context of the emerging fields of animal learning and neurophysiology. A further innovative feature was the use of quantitative methods to assess outcomes. These measures showed good response rates, though most cured patients were not sent back to battle because of their presumed psychopathic constitution. While some treatments appear unnecessarily harsh from today's perspective and were also criticized by leading psychiatrists of the time, the concentration of effort and involvement of so many senior doctors led to the development of psychotherapeutic methods that were to influence the field of psychiatric therapy for decades to come.
[Appearance of aflatoxin M1 during the manufacture of Camembert cheese].
Frémy, J M; Roiland, J C
1979-01-01
Several classic cheese making of camembert are made from raw milk spiked with Aflatoxin M1. Three Aflatoxin levels 7.5 microgram/l, 3 microgram/l are used. In respective curds 35.6, 47.1 and 57.7% of Aflatoxin M1 are recovered and 64.4, 52.9 and 42.3% in respective whey. During the first 15 days of storage the Aflatoxin M1 content of different cheeses decrease respectively 25, 55, 75%. A similar experience is made with a milk contamined in Aflatoxin M1 C14 labelled. Same results are recovered, except about behaviour of Aflatoxin M1 in cheese: a same C14 activity is recovered during storage for 30 days.
DFT study on oxidation of HS(CH2) m SH ( m = 1-8) in oxidative desulfurization
Song, Y. Z.; Song, J. J.; Zhao, T. T.; Chen, C. Y.; He, M.; Du, J.
2016-06-01
Density functional theory was employed for calculation of HS(CH2) m SH ( m = 1-8) and its derivatives at B3LYP method at 6-31++g ( d, p) level. Using eigenvalues of LUMO and HOMO for HS(CH2) m SH, the standard electrode potentials were estimated by a stepwise multiple regression techniques (MLR), and obtained as E° = 1.500 + 7.167 × 10-3 HOMO-0.229 LUMO with high correlation coefficients of 0.973 and F values of 43.973.
Main modelling features of the ASTEC V2.1 major version
International Nuclear Information System (INIS)
Chatelard, P.; Belon, S.; Bosland, L.; Carénini, L.; Coindreau, O.; Cousin, F.; Marchetto, C.; Nowack, H.; Piar, L.; Chailan, L.
2016-01-01
Highlights: • Recent modelling improvements of the ASTEC European severe accident code are outlined. • Key new physical models now available in the ASTEC V2.1 major version are described. • ASTEC progress towards a multi-design reactor code is illustrated for BWR and PHWR. • ASTEC strong link with the on-going EC CESAM FP7 project is emphasized. • Main remaining modelling issues (on which IRSN efforts are now directing) are given. - Abstract: A new major version of the European severe accident integral code ASTEC, developed by IRSN with some GRS support, was delivered in November 2015 to the ASTEC worldwide community. Main modelling features of this V2.1 version are summarised in this paper. In particular, the in-vessel coupling technique between the reactor coolant system thermal-hydraulics module and the core degradation module has been strongly re-engineered to remove some well-known weaknesses of the former V2.0 series. The V2.1 version also includes new core degradation models specifically addressing BWR and PHWR reactor types, as well as several other physical modelling improvements, notably on reflooding of severely damaged cores, Zircaloy oxidation under air atmosphere, corium coolability during corium concrete interaction and source term evaluation. Moreover, this V2.1 version constitutes the back-bone of the CESAM FP7 project, which final objective is to further improve ASTEC for use in Severe Accident Management analysis of the Gen.II–III nuclear power plants presently under operation or foreseen in near future in Europe. As part of this European project, IRSN efforts to continuously improve both code numerical robustness and computing performances at plant scale as well as users’ tools are being intensified. Besides, ASTEC will continue capitalising the whole knowledge on severe accidents phenomenology by progressively keeping physical models at the state of the art through a regular feed-back from the interpretation of the current and
Sestrin2 inhibits mTORC1 through modulation of GATOR complexes
Energy Technology Data Exchange (ETDEWEB)
Kim, Jeong Sig; Ro, Seung-Hyun; Kim, Myungjin; Park, Hwan-Woo; Semple, Ian A.; Park, Haeli; Cho, Uhn-Soo; Wang, Wei; Guan, Kun-Liang; Karin, Michael; Lee, Jun Hee (Michigan); (UCSD)
2015-03-30
Sestrins are stress-inducible metabolic regulators that suppress a wide range of age- and obesity-associated pathologies, many of which are due to mTORC1 overactivation. Upon various stresses, the Sestrins inhibit mTORC1 activity through an indirect mechanism that is still unclear. GATORs are recently identified protein complexes that regulate the activity of RagB, a small GTPase essential for mTORC1 activation. GATOR1 is a GTPase activating protein (GAP) for RagB whereas GATOR2 functions as an inhibitor of GATOR1. However, how the GATORs are physiologically regulated is unknown. Here we show that Sestrin2 binds to GATOR2, and liberates GATOR1 from GATOR2-mediated inhibition. Released GATOR1 subsequently binds to and inactivates RagB, ultimately resulting in mTORC1 suppression. Consistent with this biochemical mechanism, genetic ablation of GATOR1 nullifies the mTORC1-inhibiting effect of Sestrin2 in both cell culture and Drosophila models. Collectively, we elucidate a new signaling cascade composed of Sestrin2-GATOR2-GATOR1-RagB that mediates stress-dependent suppression of mTORC1 activity.
Lifescience Database Archive (English)
Full Text Available Molecule: Non-Specific Lipid Transfer Protein; Chain: A Lipid Transport G.W.Han, J.Y.Lee, H.K.Song, D.H.Shin....Kim, J.Choe, D.Lim, H.J.Moon, S.W.Suh Structural Basis Of Non-Specific Lipid Binding In Mai...y; @=28-120.|PDB; 1MZM; X-ray; @=28-120.|MaizeDB; 25447; -.|InterPro; IPR003612;
A universal real-time PCR assay for the quantification of group-M HIV-1 proviral load.
Malnati, Mauro S; Scarlatti, Gabriella; Gatto, Francesca; Salvatori, Francesca; Cassina, Giulia; Rutigliano, Teresa; Volpi, Rosy; Lusso, Paolo
2008-01-01
Quantification of human immunodeficiency virus type-1 (HIV-1) proviral DNA is increasingly used to measure the HIV-1 cellular reservoirs, a helpful marker to evaluate the efficacy of antiretroviral therapeutic regimens in HIV-1-infected individuals. Furthermore, the proviral DNA load represents a specific marker for the early diagnosis of perinatal HIV-1 infection and might be predictive of HIV-1 disease progression independently of plasma HIV-1 RNA levels and CD4(+) T-cell counts. The high degree of genetic variability of HIV-1 poses a serious challenge for the design of a universal quantitative assay capable of detecting all the genetic subtypes within the main (M) HIV-1 group with similar efficiency. Here, we describe a highly sensitive real-time PCR protocol that allows for the correct quantification of virtually all group-M HIV-1 strains with a higher degree of accuracy compared with other methods. The protocol involves three stages, namely DNA extraction/lysis, cellular DNA quantification and HIV-1 proviral load assessment. Owing to the robustness of the PCR design, this assay can be performed on crude cellular extracts, and therefore it may be suitable for the routine analysis of clinical samples even in developing countries. An accurate quantification of the HIV-1 proviral load can be achieved within 1 d from blood withdrawal.
Final report on COOMET Vickers PTB/VNIIFTRI key comparison (COOMET.M.H-K1.b and COOMET.M.H-K1.c)
Aslanyan, E.; Herrmann, K.
2013-01-01
This report describes a COOMET key comparison on Vickers hardness scales of two National Metrology Institutes—PTB and VNIIFTRI. The pilot laboratory was PTB, which was the linking institute with the key comparison reference values of CCM.H-K1. In the key comparison two sets of hardness reference blocks for the Vickers hardness scales HV1 and HV30, each consisting of three hardness reference blocks with the hardness levels 240 HV, 540 HV and 840 HV, are used. The same hardness reference blocks were used previously in the key comparison CCM.H-K1. The measurement results and uncertainty assessments, announced by VNIIFTRI, are in good agreement with the key comparison reference values of CCM.H-K1. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).
99mTc complexes of 1,3-propanedithiol derivatives
International Nuclear Information System (INIS)
Alagui, A.; Apparu, M.; Vidal, M.; Mathieu, J.P.
1987-01-01
The labelling of 1,3-n alkylpropanedithiols and of 15-(1,3-dimercapto 2-propyl)pentadecanoic acid by 99m Tc was performed by an exchange reaction with the hexachlorotechnetate ion 99m TcCl 6 2- and by reduction of 99m TcO 4 - with Sn(II) in the presence of the ligand. The biological distribution of the exotechnetium complexes obtained by the latter method in mouse does not reveal a high tropism of these labelling compounds in relation to a particular tissue. (author) 14 refs.; 2 tabs
Directory of Open Access Journals (Sweden)
Al Shaimaa Hasan
Full Text Available Cardiosphere-derived cells (CDCs, one of the promising stem cell sources for myocardial repair, have been tested in clinical trials and resulted in beneficial effects; however, the relevant mechanisms are not fully understood. In this study, we examined the hypothesis that CDCs favor heart repair by switching the macrophages from a pro-inflammatory phenotype (M1 into a regulatory anti-inflammatory phenotype (M2. Macrophages from mice were cultured with CDCs-conditioned medium or with fibroblasts-conditioned medium as a control. Immunostaining showed that CDCs-conditioned medium significantly enhanced the expression of CD206 (a marker for M2 macrophages, but decreased the expression of CD86 (a marker for M1 macrophages 3 days after culture. For animal studies, we used an acute myocardial infarction model of mice. We injected CDCs, fibroblasts, or saline only into the border zone of infarction. Then we collected the heart tissues for histological analysis 5 and 14 days after treatment. Compared with control animals, CDCs treatment significantly decreased M1 macrophages and neutrophils but increased M2 macrophages in the infarcted heart. Furthermore, CDCs-treated mice had reduced infarct size and fewer apoptotic cells compared to the controls. Our data suggest that CDCs facilitate heart repair by modulating M1/M2 macrophage polarization and neutrophil recruitment, which may provide a new insight into the mechanisms of stem cell-based myocardial repair.
Main Propulsion Test Article (MPTA)
Snoddy, Cynthia
2010-01-01
Scope: The Main Propulsion Test Article integrated the main propulsion subsystem with the clustered Space Shuttle Main Engines, the External Tank and associated GSE. The test program consisted of cryogenic tanking tests and short- and long duration static firings including gimbaling and throttling. The test program was conducted on the S1-C test stand (Position B-2) at the National Space Technology Laboratories (NSTL)/Stennis Space Center. 3 tanking tests and 20 hot fire tests conducted between December 21 1 1977 and December 17, 1980 Configuration: The main propulsion test article consisted of the three space shuttle main engines, flightweight external tank, flightweight aft fuselage, interface section and a boilerplate mid/fwd fuselage truss structure.
Proto-planetary nebulae. I. The extreme bipolar nebulae M2-9 and M1-91
International Nuclear Information System (INIS)
Goodrich, R.W.
1991-01-01
Results are presented on a long-slit optical spectroscopy measurements of the prototype bipolar planetary nebula M2-9 and the M1-91 bipolar nebula, performed in order to determine the nature of the morphology of the wings of these two nebulae. It is concluded that the overall bipolar morphologies of these nebulae might be due to the orbital motions of binaries, with the orbital angular momentum vector defining the axis of the nebula. Secondary symmetries in the nebulae, such as the point-symmetric knots in M1-91, could be due to other symmetries, such as the rotation axis of one of the individual stars or the polar axis of the accretion disk. 39 refs
George L. McCaskill; Thomas Albright; Charles J. Barnett; Brett J. Butler; Susan J. Crocker; Cassandra M. Kurtz; William H. McWilliams; Patrick D. Miles; Randall S. Morin; Mark D. Nelson; Richard H. Widmann; Christopher W. Woodall
2016-01-01
The third 5-year annualized inventory of Maine's forests was completed in 2013 after more than 3170 forested plots were measured. Maine contains more than 17.6 million acres of forest land, an area that has been quite stable since 1960, covering more than 82 percent of the total land area. The number of live trees greater than 1 inch in diameter are approaching 24...
Directory of Open Access Journals (Sweden)
2010-03-01
Full Text Available An investigation was made of grafting trans-ethylene-1,2-dicarboxylic acid (TEDA onto metallocene-linear low-density polyethylene (mLLDPE and low-density polyethylene (LDPE in the course of reactive extrusion. The initiator was 1,3-bis-(tert-butyl-peroxyisopropylbenzene. The graft efficiency of TEDA has been shown to increase with increasing initiator concentration, irrespective of polyethylene type. The graft values for LDPE were higher than for mLLDPE over the initiator concentration range (0.05 to 0.4 wt%. The rheological properties of mLLDPE were found to undergo more tangible changes during functionalization than those of LDPE. These changes were caused by side reactions, mainly macromolecular crosslinking. It has been established that some carboxyl groups get transformed to anhydride groups in the grafted product. The concentration of end double bonds reduces, but intramolecular unsaturation in both polyethylenes increases. Data are presented on thermal and stress-strain (mechanical properties of virgin and functionalized polymers, as well as rheological and viscoelastic properties of their melts.
Eesti - väärikas vanur või mäslev noor? / Anari Koppel
Koppel, Anari
2008-01-01
Eesti Filmi Sihtasutuse, Eesti Rahvusringhäälingu ja Eesti Kultuurkapitali finantseeritava tõsielufilmide sarja "Eesti lood" uued filmid : Eva-Katariina Taimre "Jackpot", Kristel Leesmendi "Dr. Kloun", Mihkel Ulki "MC Battle - Sõnasõjad" ja Katri Rannastu "Lehelapse suvi"
Directory of Open Access Journals (Sweden)
V. M. Scussel
2003-12-01
Full Text Available Milk and egg matrixes were assayed for aflatoxin M1 (AFM1 and B1 (AFB1 respectively, by AOAC official and modified methods with detection and quantification by thin layer chromatography (TLC and high performance thin layer chromatography (HPTLC. The modified methods: Blanc followed by Romer, showed to be most appropriate for AFM1 analysis in milk. Both methods reduced emulsion formation, produced cleaner extracts, no streaking spots, precision and accuracy improved, especially when quantification was performed by HPTLC. The use of ternary mixture in the Blanc Method was advantageous as the solvent could extract AFM1 directly from the first stage (extraction, leaving other compounds in the binary mixture layer, avoiding emulsion formation, thus reducing toxin loss. The relative standard deviation (RSD% values were low, 16 and 7% when TLC and HPTLC were used, with a mean recovery of 94 and 97%, respectively. As far as egg matrix and final extract are concerned, both methods evaluated for AFB1 need further studies. Although that matrix leads to emulsion with consequent loss of toxin, the Romer modified presented a reasonable clean extract (mean recovery of 92 and 96% for TLC and HPTLC, respectively. Most of the methods studied did not performed as expected mainly due to the matrixes high content of triglicerides (rich on saturated fatty acids, cholesterol, carotene and proteins. Although nowadays most methodology for AFM1 is based on HPLC, TLC determination (Blanc and Romer modified for AFM1 and AFB1 is particularly recommended to those, inexperienced in food and feed mycotoxins analysis and especially who cannot afford to purchase sophisticated (HPLC,HPTLC instrumentation.Aflatoxinas M1 (AFM1 e B1 (AFB1 foram analisadas em leite e ovos respectivamente, por diferentes métodos oficiais da AOAC e modificações usando detecção por cromatografia em camada delgada (CCD e CCD de alta eficiência (CCDAE. Os métodos modificados: Blanc e Romer
B-1 Aircraft Main Hydraulic Pump Tests With MIL-H-87257 Hydraulic Fluid
National Research Council Canada - National Science Library
Sharma, Shashi
1998-01-01
In an effort to convert the B-1 aircraft from MIL-H-5606 to M1-H-87257, the Air Force sponsored a study conducted by Rockwell International from April 1991 through June 1992, under contract F34601-89-C-0401...
mTORC1 directly phosphorylates and regulates human MAF1.
Michels Annemieke A; Robitaille Aaron M; Buczynski-Ruchonnet Diane; Hodroj Wassim; Reina Jaime H; Hall Michael N; Hernandez Nouria
2010-01-01
mTORC1 is a central regulator of growth in response to nutrient availability, but few direct targets have been identified. RNA polymerase (pol) III produces a number of essential RNA molecules involved in protein synthesis, RNA maturation, and other processes. Its activity is highly regulated, and deregulation can lead to cell transformation. The human phosphoprotein MAF1 becomes dephosphorylated and represses pol III transcription after various stresses, but neither the significance of the p...
Main building fire drill safely concluded
CERN Bulletin
2015-01-01
Last week, a simulated fire in the stairwell of the Main Building put CERN’s emergency response procedures to the test. Firefighters descend the stairwell in the Main Building as the simulated fire rises. At 2 p.m. on 22 September, alarms sounded around CERN’s Main Building as an evacuation exercise got underway. A simulated fire in the stairwell, complete with very realistic smoke, led to the evacuation of one of the busiest places at CERN. The Main Building complex includes the Carlson Wagonlit travel agency, the post office, UBS, Uniqa, the Users Office, the Staff Association and the Novae restaurant as well as the Main Auditorium, the Council Chamber and the Charpak meeting room. It was impressive to see how quickly the smoke propagated in the staircase as well as into the corridors, and equally impressive to see how smoothly, quickly and efficiently the evacuation proceeded. The...
Manning Implications of Logistics Support for Airland Battle.
1985-10-01
0 1 0 4 -H.- 20 00 300 0 w = PO. w -a m W >0. 04 m~ E 0 Ia.0 -. ’-H>O4J 4-Or23 0. .- 41 -H4 0 * ./3’ CO. F5 -4 2 ) 0 ) F30. -40 -4 0 0 0 P Eo...34400 0 m. Ia .01 0-~44 0A0 V r.-( z A l.0. .Jw 0 0 0 W w- ACCA -’ 0. 0 CA0-4 4) ca 0 w 4CA0 A4 MC .. 03 a w 0 0)4 : 4 o: 0.00 CJ40 .0’ 0a > CA O.4-4x 4
Directory of Open Access Journals (Sweden)
JoAnn eTrial
2013-09-01
Full Text Available We have demonstrated that cardiac fibrosis arises from the differentiation of monocyte-derived fibroblasts. We present here evidence that this process requires sequential Th1 and Th2 induction promoting analogous M1 (classically activated and M2 (alternatively activated macrophage polarity. Our models are 1 mice subjected to daily repetitive ischemia reperfusion (I/R without infarction and 2 the in vitro transmigration of human mononuclear leukocytes through human cardiac microvascular endothelium. In the mouse heart, leukocytes entered after I/R in response to monocyte chemoattractant protein-1 (MCP-1 which is the major cytokine induced by this protocol. Monocytes within the heart then differentiated into fibroblasts making collagen while bearing the markers of M2 macrophages. T cells were seen in these hearts as well as in the human heart with cardiomyopathy. In the in vitro model, transmigration of the leukocytes was likewise induced by MCP-1 and some monocytes matured into fibroblasts bearing M2 markers. In this model, the MCP-1 stimulus induced a transient Th1 and M1 response that developed into a predominately Th2 and M2 response. An increase in the Th2 product IL-13 was present in both the human and the mouse models, consistent with its known role in fibrosis. In these simplified models, in which there is no cell death to stimulate an anti-inflammatory response, there is nonetheless a resolution of inflammation enabling a profibrotic environment. This induces the maturation of monocyte precursors into fibroblasts.
Deng, Changshun; Li, Min; Qian, Junning; Hu, Qun; Huang, Meina; Lin, Qingjin; Ruan, Yongshun; Dong, Lihui; Li, Bin; Fan, Minguang
2016-08-05
This work is mainly focused on investigating the effects of different doped metal cations on the formation of Ce20 M1 Ox (M=Zr, Cr, Mn, Fe, Co, Sn) composite oxides and their physicochemical and catalytic properties for NO reduction by CO as a model reaction. The obtained samples were characterized by using N2 physisorption, X-ray diffraction, laser Raman spectroscopy, UV/Vis diffuse reflectance spectroscopy, inductively coupled plasma atomic emission spectroscopy, X-ray photoelectron spectroscopy, temperature-programmed reduction by hydrogen and by oxygen (H2 -TPR and O2 -TPD), in situ diffuse reflectance infrared Fourier transform spectroscopy, and the NO+CO model reaction. The results imply that the introduction of M(x+) into the lattice of CeO2 increases the specific surface area and pore volume, especially for variable valence metal cations, and enhances the catalytic performance to a great extent. In this regard, increases in the oxygen vacancies, reduction properties, and chemisorbed O2 (-) (and/or O(-) ) species of these Ce20 M1 Ox composite oxides (M refers to variable valence metals) play significant roles in this reaction. Among the samples, Ce20 Cr1 Ox exhibited the best catalytic performance, mainly because it has the best reducibility and more chemisorbed oxygen, and significant reasons for these attributes may be closely related to favorable synergistic interactions of the vacancies and near-surface Ce(3+) and Cr(3+) . Finally, a possible reaction mechanism was tentatively proposed to understand the reactions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zini, Chiara; Venneri, Mary A; Miglietta, Selenia; Caruso, Damiano; Porta, Natale; Isidori, Andrea M; Fiore, Daniela; Gianfrilli, Daniele; Petrozza, Vincenzo; Laghi, Andrea
2018-08-01
Aim of the study was to evaluate USPIO labeling in different macrophage populations using a clinical 3.0T MR unit with optical and electron microscopy as the gold standard. Human monocytic cell line THP-1 cells were differentiated into macrophages. Afterwards, M0 macrophages were incubated with IL-4 and IL-13 in order to obtain M2 polarized macrophages or with IFN-gamma and LPS for classical macrophage activation (M1). These groups were incubated with USPIO-MR contrast agent (P904) for 36 hr; M0, M0 + P904, M1 + P904, and M2 + P904 were analyzed in gel phantoms with a 3.0T MR scanner. m-RNA of M1 and M2 markers confirmed the polarization of THP-1-derived macrophages. M2 + P904 showed a much higher T1 signal (p < 0.0001), a significantly lower (p < 0.0001) T2* signal, and significantly higher R* (p < 0.0001) compared to the other populations. Hystological analysis confirmed higher iron content in the M2-polarized population compared to both M1-polarized (p = 0.04) and M0-P904 (p = 0.003). Ultrastructure analysis demonstrated ubiquitous localization of P904 within the cellular compartments. Our results demonstrate that a selective USPIO-labeling of different macrophage populations can be detected in vitro using the 3.0T clinical scanner. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Harjoko Agus
2018-01-01
Full Text Available Acute Myeloid Leukemia (AML is a type of cancer which attacks white blood cells from myeloid. AML has eight subtypes, namely: M0, M1, M2, M3, M4, M5, M6, and M7. AML subtypes M1, M2 and M3 are affected by the same type of cells, myeloblast, making it needs more detailed analysis to distinguish. To overcome these obstacles, this research is applying digital image processing with Active Contour Without Edge (ACWE and Momentum Backpropagation artificial neural network for AML subtypes M1, M2 and M3 classification based on the type of the cell. Six features required as training parameters from every cell obtained by using feature extraction. The features are: cell area, perimeter, circularity, nucleus ratio, mean and standard deviation. The results show that ACWE can be used for segmenting white blood cells with 83.789% success percentage of 876 total cell objects. The whole AML slides had been identified according to the cell types predicted number through training with momentum backpropagation. Five times testing calibration with the best parameter generated averages value of 84.754% precision, 75.887% sensitivity, 95.090% specificity and 93.569% accuracy.
PGE2-induced colon cancer growth is mediated by mTORC1
International Nuclear Information System (INIS)
Dufour, Marc; Faes, Seraina; Dormond-Meuwly, Anne; Demartines, Nicolas; Dormond, Olivier
2014-01-01
Highlights: • PGE 2 activates mTORC1 in colon cancer cells. • Inhibition of mTORC1 blocks PGE 2 induced colon cancer cell growth. • mTORC1 is a signaling intermediary in PGE 2 induced colon cancer cell responses. - Abstract: The inflammatory prostaglandin E 2 (PGE 2 ) cytokine plays a key role in the development of colon cancer. Several studies have shown that PGE 2 directly induces the growth of colon cancer cells and furthermore promotes tumor angiogenesis by increasing the production of the vascular endothelial growth factor (VEGF). The signaling intermediaries implicated in these processes have however not been fully characterized. In this report, we show that the mechanistic target of rapamycin complex 1 (mTORC1) plays an important role in PGE 2 -induced colon cancer cell responses. Indeed, stimulation of LS174T cells with PGE 2 increased mTORC1 activity as observed by the augmentation of S6 ribosomal protein phosphorylation, a downstream effector of mTORC1. The PGE 2 EP 4 receptor was responsible for transducing the signal to mTORC1. Moreover, PGE 2 increased colon cancer cell proliferation as well as the growth of colon cancer cell colonies grown in matrigel and blocking mTORC1 by rapamycin or ATP-competitive inhibitors of mTOR abrogated these effects. Similarly, the inhibition of mTORC1 by downregulation of its component raptor using RNA interference blocked PGE 2 -induced LS174T cell growth. Finally, stimulation of LS174T cells with PGE 2 increased VEGF production which was also prevented by mTORC1 inhibition. Taken together, these results show that mTORC1 is an important signaling intermediary in PGE 2 mediated colon cancer cell growth and VEGF production. They further support a role for mTORC1 in inflammation induced tumor growth
Energy Technology Data Exchange (ETDEWEB)
Osivandi, K.; Racher, D. [RWE Dea AG, Hamburg (Germany)
2011-07-15
The Mittelplate Oil Field is situated in the German Wadden Sea in the West Holstein Trough in the concession Heide/Buesum, about 100 km northwest of Hamburg. Operator is RWE Dea AG (50%), and the partner is Wintershall Holding GmbH (50%). Besides the reservoir layers of the Dogger Gamma, Delta, Epsilon, and Zeta, the shallow-marine/deltaic sandstone-shale-succession of the Dogger Beta (with its five oil-bearing sandstones of 1-5 m thickness each) forms the laterally widespread reservoir which was the target for Germany's and RWE Dea AG's first pressure-tight multilateral well. So far the Dogger-Beta-Reservoir has been developed with wells from the artificial island Mittelplate A using a 5-spot pattern with a successive concentric concept. In order to reduce the costs and effectively make use of the limited amount of slots, the development concept should be improved by implementing the multilateral technology. By targeting three drainage areas in total, the multilateral well Mittelplate A23/A23M1 was planned to produce oil at an initial rate of ca. 400 m{sup 3}/d. In order to achieve a horizontal interval of ca. 2640 m length, several LWD measurements including Gamma Ray- and Density- Images and Deep-Directional-Resistivity logs were necessary. The long horizontal exposure of the oil-bearing sandstone layers as well as the tangent sections for placement of the electrical submersible pump (ESP) and junction above the reservoir represented the main challenges during geological planning and realtime geosteering. A total perforation length of 1360 m was achieved, taking into account the required distances to neighboring producer wells and the laterally varying pore pressures. According to the latest production history of the well, a cumulative production of about 10% more than initially planned are expected after an initial production rate of 735 m{sup 3}/d. Thanks to the successful application of the multilateral technology and geosteering within the thin
International Nuclear Information System (INIS)
Kuo, W.-H.; Chou, F.-P.; Young, S.-C.; Chang, Y.-C.; Wang, C.-J.
2005-01-01
Geniposide, an iridoid glycoside isolated from the fruit of Gardenia jasminoides Ellis, has biological capabilities of detoxication, antioxidation, and anticarcinogenesis. We have recently found that geniposide possesses a potential for detoxication by inducing GST activity and the expression of GST M1 and GST M2 subunits. In this study, the signaling pathway of geniposide leading to the activation of GSH S-transferase (GST) was investigated. Primary cultured rat hepatocytes were treated with geniposide in the presence or absence of mitogen-activated protein kinase (MAPK) inhibitors and examined for GST activity, expression of GST M1 and M2 subunits, and protein levels of MAPK signaling proteins. Western blotting data demonstrated that geniposide induced increased protein levels of GST M1 and GST M2 (∼1.76- and 1.50-fold of control, respectively). The effect of geniposide on the increased protein levels of GST M1 and GST M2 was inhibited by the MEK-1 inhibitor PD98059, but not by other MAPK inhibitors. The GST M1 and GST M2 transcripts as determined by RT-PCR and GST activity were also inhibited concurrently by the MEK-1 inhibitor PD98059. The protein levels of up- and down-stream effectors of the MEK-1, including Ras, Raf, and Erk1/2, and the phosphorylation state of Erk1/2 were found to be induced by geniposide, indicating a two-phase influence of geniposide. The results suggest that geniposide induced GST activity and the expression of GST M1 and GST M2 acting through MEK-1 pathway by activating and increasing expression of Ras/Raf/MEK-1 signaling mediators
Directory of Open Access Journals (Sweden)
Qian Gong
2018-03-01
Full Text Available In adulthood, chronic exposure to stressful experiences disrupts synaptic plasticity and cognitive function. Previous studies have shown that perirhinal cortex-dependent object recognition memory is impaired by chronic stress. However, the stress effects on molecular expression and structural plasticity in the perirhinal cortex remain unclear. In this study, we applied the chronic social defeat stress (CSDS paradigm and measured the mRNA levels of nectin-1, nectin-3 and neurexin-1, three synaptic cell adhesion molecules (CAMs implicated in the adverse stress effects, in the perirhinal cortex of wild-type (WT and conditional forebrain corticotropin-releasing hormone receptor 1 conditional knockout (CRHR1-CKO mice. Chronic stress reduced perirhinal nectin-1 mRNA levels in WT but not CRHR1-CKO mice. In conditional forebrain corticotropin-releasing hormone conditional overexpression (CRH-COE mice, perirhinal nectin-1 mRNA levels were also reduced, indicating that chronic stress modulates nectin-1 expression through the CRH-CRHR1 system. Moreover, chronic stress altered dendritic spine morphology in the main apical dendrites and reduced spine density in the oblique apical dendrites of perirhinal layer V pyramidal neurons. Our data suggest that chronic stress disrupts cell adhesion and dendritic spine plasticity in perirhinal neurons, which may contribute to stress-induced impairments of perirhinal cortex-dependent memory.
Directory of Open Access Journals (Sweden)
Eva Šantrůčková
Full Text Available Xanomeline is an agonist endowed with functional preference for M1/M4 muscarinic acetylcholine receptors. It also exhibits both reversible and wash-resistant binding to and activation of these receptors. So far the mechanisms of xanomeline selectivity remain unknown. To address this question we employed microfluorometric measurements of intracellular calcium levels and radioligand binding to investigate differences in the short- and long-term effects of xanomeline among muscarinic receptors expressed individually in Chinese hamster ovary cells. 1/One-min exposure of cells to xanomeline markedly increased intracellular calcium at hM1 and hM4, and to a lesser extent at hM2 and hM3 muscarinic receptors for more than 1 hour. 2/Unlike the classic agonists carbachol, oxotremorine, and pilocarpine 10-min exposure to xanomeline did not cause internalization of any receptor subtype. 3/Wash-resistant xanomeline selectively prevented further increase in intracellular calcium by carbachol at hM1 and hM4 receptors. 4/After transient activation xanomeline behaved as a long-term antagonist at hM5 receptors. 5/The antagonist N-methylscopolamine (NMS reversibly blocked activation of hM1 through hM4 receptors by xanomeline. 6/NMS prevented formation of xanomeline wash-resistant binding and activation at hM2 and hM4 receptors and slowed them at hM1, hM3 and hM5 receptors. Our results show commonalities of xanomeline reversible and wash-resistant binding and short-time activation among the five muscarinic receptor subtypes. However long-term receptor activation takes place in full only at hM1 and hM4 receptors. Moreover xanomeline displays higher efficacy at hM1 and hM4 receptors in primary phasic intracellular calcium release. These findings suggest the existence of particular activation mechanisms specific to these two receptors.
Mission hazard assessment for STARS Mission 1 (M1) in the Marshall Islands area
Energy Technology Data Exchange (ETDEWEB)
Outka, D.E.; LaFarge, R.A.
1993-07-01
A mission hazard assessment has been performed for the Strategic Target System Mission 1 (known as STARS M1) for hazards due to potential debris impact in the Marshall Islands area. The work was performed at Sandia National Laboratories as a result of discussion with Kwajalein Missile Range (KMR) safety officers. The STARS M1 rocket will be launched from the Kauai Test Facility (KTF), Hawaii, and deliver two payloads to within the viewing range of sensors located on the Kwajalein Atoll. The purpose of this work has been to estimate upper bounds for expected casualty rates and impact probability or the Marshall Islands areas which adjoin the STARS M1 instantaneous impact point (IIP) trace. This report documents the methodology and results of the analysis.
Hsp70 cochaperones HspBP1 and BAG-1M differentially regulate steroid hormone receptor function.
Directory of Open Access Journals (Sweden)
Regina T Knapp
Full Text Available Hsp70 binding protein 1 (HspBP1 and Bcl2-associated athanogene 1 (BAG-1, the functional orthologous nucleotide exchange factors of the heat shock protein 70 kilodalton (Hsc70/Hsp70 chaperones, catalyze the release of ADP from Hsp70 while inducing different conformational changes of the ATPase domain of Hsp70. An appropriate exchange rate of ADP/ATP is crucial for chaperone-dependent protein folding processes. Among Hsp70 client proteins are steroid receptors such as the glucocorticoid receptor (GR, the mineralocorticoid receptor (MR, and the androgen receptor (AR. BAG-1 diversely affects steroid receptor activity, while to date the influence of HspBP1 on steroid receptor function is mostly unknown. Here, we compared the influence of HspBP1 and BAG-1M on Hsp70-mediated steroid receptor folding complexes and steroid receptor activity. Coimmunoprecipitation studies indicated preferential binding of Hsp40 and the steroid receptors to BAG-1M as compared to HspBP1. Furthermore, Hsp70 binding to the ligand-binding domain of GR was reduced in the presence of HspBP1 but not in the presence of BAG-1M as shown by pull-down assays. Reporter gene experiments revealed an inhibitory effect on GR, MR, and AR at a wide range of HspBP1 protein levels and at hormone concentrations at or approaching saturation. BAG-1M exhibited a transition from stimulatory effects at low BAG-1M levels to inhibitory effects at higher BAG-1M levels. Overall, BAG-1M and HspBP1 had differential impacts on the dynamic composition of steroid receptor folding complexes and on receptor function with important implications for steroid receptor physiology.
Bakker, Astrid D; Gakes, Tom; Hogervorst, Jolanda M A; de Wit, Gerard M J; Klein-Nulend, Jenneke; Jaspers, Richard T
2016-06-01
Insulin-like growth factor-1 (IGF-1) is anabolic for muscle by enhancing the rate of mRNA translation via activation of AKT and subsequent activation of the mammalian target of rapamycin complex 1 (mTOR), thereby increasing cellular protein production. IGF-1 is also anabolic for bone, but whether the mTOR pathway plays a role in the rate of bone matrix protein production by osteoblasts is unknown. We hypothesized that anabolic stimuli such as mechanical loading and IGF-1 stimulate protein synthesis in osteoblasts via activation of the AKT-mTOR pathway. MC3T3-E1 osteoblasts were either or not subjected for 1 h to mechanical loading by pulsating fluid flow (PFF) or treated with or without human recombinant IGF-1 (1-100 ng/ml) for 0.5-6 h, to determine phosphorylation of AKT and p70S6K (downstream of mTOR) by Western blot. After 4 days of culture with or without the mTOR inhibitor rapamycin, total protein, DNA, and gene expression were quantified. IGF-1 (100 ng/ml) reduced IGF-1 gene expression, although PFF enhanced IGF-1 expression. IGF-1 did not affect collagen-I gene expression. IGF-1 dose-dependently enhanced AKT and p70S6K phosphorylation at 2 and 6 h. PFF enhanced phosphorylation of AKT and p70S6K already within 1 h. Both IGF-1 and PFF enhanced total protein per cell by ∼30%, but not in the presence of rapamycin. Our results show that IGF-1 and PFF activate mTOR, thereby stimulating the rate of mRNA translation in osteoblasts. The known anabolic effect of mechanical loading and IGF-1 on bone may thus be partly explained by mTOR-mediated enhanced protein synthesis in osteoblasts. © 2015 Wiley Periodicals, Inc.
Ciany, Charles M.; Zurawski, William; Kerfoot, Ian
2001-10-01
The performance of Computer Aided Detection/Computer Aided Classification (CAD/CAC) Fusion algorithms on side-scan sonar images was evaluated using data taken at the Navy's's Fleet Battle Exercise-Hotel held in Panama City, Florida, in August 2000. A 2-of-3 binary fusion algorithm is shown to provide robust performance. The algorithm accepts the classification decisions and associated contact locations form three different CAD/CAC algorithms, clusters the contacts based on Euclidian distance, and then declares a valid target when a clustered contact is declared by at least 2 of the 3 individual algorithms. This simple binary fusion provided a 96 percent probability of correct classification at a false alarm rate of 0.14 false alarms per image per side. The performance represented a 3.8:1 reduction in false alarms over the best performing single CAD/CAC algorithm, with no loss in probability of correct classification.
Macedo, Alexandre Casimiro de; Cunha, José Evandro; Yaochite, Juliana Navarro Ueda; Tavares, Clodis Maria; Nagao-Dias, Aparecida Tiemi
Considering that the main route of Mycobacterium leprae transmission is the upper respiratory tract, detection of salivary antibodies can be a useful tool for diagnosing early infection. The study aimed to analyze salivary anti-PGL-1 IgA and IgM antibodies in 169 children aged 4-16 years old, who lived nearby or inside the house of multibacillary or paucibacillary leprosy patients in two endemic cities in Alagoas State - Brazil. Salivary anti-PGL-1 antibodies were quantified by modified ELISA method. The frequency of contact and clinical form of the index case were significantly associated with salivary antibody levels. High frequency of IgM positivity strongly suggests active transmission of M. leprae in these communities. We suggest in the present work that salivary anti-PGL IgA and IgM are important biomarkers to be used for identifying communities with probable active transmission of M. leprae. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.
Yebra, Gonzalo; de Mulder, Miguel; Holguín, África
2013-01-01
Background The HIV epidemic is increasing in Equatorial Guinea (GQ), West Central Africa, but few studies have reported its HIV molecular epidemiology. We aimed to describe the HIV-1 group M (HIV-1M) variants and drug-resistance mutations in GQ using sequences sampled in this country and in Spain, a frequent destination of Equatoguinean migrants. Methods We collected 195 HIV-1M pol sequences from Equatoguinean subjects attending Spanish clinics during 1997-2011, and 83 additional sequences sampled in GQ in 1997 and 2008 from GenBank. All (n = 278) were re-classified using phylogeny and tested for drug-resistance mutations. To evaluate the origin of CRF02_AG in GQ, we analyzed 2,562 CRF02_AG sequences and applied Bayesian MCMC inference (BEAST program). Results Most Equatoguinean patients recruited in Spain were women (61.1%) or heterosexuals (87.7%). In the 278 sequences, the variants found were CRF02_AG (47.8%), A (13.7%), B (7.2%), C (5.8%), G (5.4%) and others (20.1%). We found 6 CRF02_AG clusters emerged from 1983.9 to 2002.5 with origin in GQ (5.5 sequences/cluster). Transmitted drug-resistance (TDR) rate among naïve patients attended in Spain (n = 144) was 4.7%: 3.4% for PI (all with M46IL), 1.8% for NRTI (all with M184V) and 0.9% for NNRTI (Y188L). Among pre-treated patients, 9/31 (29%) presented any resistance, mainly affecting NNRTI (27.8%). Conclusions We report a low (HIV-1M variant and entered GQ through independent introductions at least since the early 1980s. PMID:23717585
Infrared (1.4-4.1μm) spectra of Wolf-Rayet stars
International Nuclear Information System (INIS)
Williams, P.M.
1982-01-01
The spectra of a variety of Wolf-Rayet stars have been observed with approximately 1% spectral resolution in the 1.4-4.1μm region using UKIRT. Strong lines due to ions of helium and carbon are observed and their relative strengths discussed. The He I singlet at 2.058μm is anomalously strong relative to other He I lines in WC stars and is responsible for the difference in the (H-K) colours of WN and WC stars. Emission line corrections to H, K and L magnitudes of different types are discussed. The Sanduleak O VI star ST 3 shows very strong C IV lines like the WC5 stars but not the strong He I. (Auth.)
The M/M/1 queue with inventory, lost sale and general lead times
DEFF Research Database (Denmark)
Saffari, Mohammad; Asmussen, Søren; Haji, Rasoul
We consider an M/M/1 queueing system with inventory under the (r,Q) policy and with lost sales, in which demands occur according to a Poisson process and service times are exponentially distributed. All arriving customers during stockout are lost. We derive the stationary distributions of the joint...... queue length (number of customers in the system) and on-hand inventory when lead times are random variables and can take various distributions. The derived stationary distributions are used to formulate long-run average performance measures and cost functions in some numerical examples....
Energy Technology Data Exchange (ETDEWEB)
Jeon, Min Ku; Lee, Ki Rak; Kang, Kweon Ho; Park, Geun Il [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Jeon, Hyung Joon [Kyoto University, Kyoto (Japan); McGinn, Paul J. [University of Notre Dame, Indiana (United States)
2015-02-15
Quaternary Pt{sub 2}Ru{sub 1}Fe{sub 1}M{sub 1}/C (M=Ni, Mo, or W) catalysts were investigated for the methanol electro-oxidation reaction (MOR). Electrocatalytic activities of the quaternary catalysts for CO electro-oxidation were studied via CO stripping experiments, and the Pt{sub 2}Ru{sub 1}Fe{sub 1}Ni{sub 1}/C and Pt{sub 2}Ru{sub 1}Fe{sub 1}W{sub 1}/C catalysts exhibited lowered on-set potential compared to that of a commercial PtRu/C catalyst. MOR activities of the quaternary catalysts were determined by linear sweep voltammetry (LSV) experiments, and the Pt{sub 2}Ru{sub 1}Fe{sub 1}W{sub 1}/C catalyst outperformed the commercial PtRu/C catalyst by 170 and 150% for the mass and specific activities, respectively. X-ray photoelectron spectroscopy (XPS) was employed to analyze surface oxidation states of constituent atoms, and it was identified that the structure of the synthesized catalysts are close to a nano-composite of Pt and constituent metal hydroxides and oxides. In addition, the XPS results suggested that the bi-functional mechanism accounts for the improved performance of the Pt{sub 2}Ru{sub 1}Fe{sub 1}Ni{sub 1}/C and Pt{sub 2}Ru{sub 1} Fe{sub 1}W{sub 1}/C catalysts.
Gleddie, Douglas L; Hobin, Erin P
2011-03-01
The Battle River Project (BRP) is a school division-level intervention in rural Alberta, Canada, built upon the health-promoting schools approach to health promotion. Using self-reported school and student-level data from administrators and students, the central aim of the BRP is to examine: 'How can the school environment and health behaviours (healthy eating, physical activity and mental wellness) of children and youth be improved when a health-promoting schools model, the Ever Active Schools program, is implemented with school division support?' Evidence used to inform school level changes included students' demographic, behavioral, and psychosocial variables linked to school environment data, comprised of school demographics and administrator-assessed quality of policies, facilities, and programs related to physical activity. Each participating school and the division were provided with a tailored report of their schools' results to reflect, plan and implement for positive health behavior change. The main lesson learned was that sharing school-specific evidence can operate as a catalyst for embedding health promoting policy and practices within the school and division culture.
Dynamics of mTORC1 activation in response to amino acids
Manifava, Maria; Smith, Matthew; Rotondo, Sergio; Walker, Simon; Niewczas, Izabella; Zoncu, Roberto; Clark, Jonathan; Ktistakis, Nicholas T
2016-01-01
Amino acids are essential activators of mTORC1 via a complex containing RAG GTPases, RAGULATOR and the vacuolar ATPase. Sensing of amino acids causes translocation of mTORC1 to lysosomes, an obligate step for activation. To examine the spatial and temporal dynamics of this translocation, we used live imaging of the mTORC1 component RAPTOR and a cell permeant fluorescent analogue of di-leucine methyl ester. Translocation to lysosomes is a transient event, occurring within 2 min of aa addition and peaking within 5 min. It is temporally coupled with fluorescent leucine appearance in lysosomes and is sustained in comparison to aa stimulation. Sestrin2 and the vacuolar ATPase are negative and positive regulators of mTORC1 activity in our experimental system. Of note, phosphorylation of canonical mTORC1 targets is delayed compared to lysosomal translocation suggesting a dynamic and transient passage of mTORC1 from the lysosomal surface before targetting its substrates elsewhere. DOI: http://dx.doi.org/10.7554/eLife.19960.001 PMID:27725083
International Nuclear Information System (INIS)
Bessell, M.S.
1991-01-01
Far-red spectra and VRIJHK photometry have been obtained for a sample of late-M dwarfs selected on the basis of large reduced red magnitudes from the LHS Catalog. Half of the stars in the three faintest 1 mag bins are late-M stars, the other red stars are metallic-hydride subdwarfs. Relations between various colors for the late-M dwarfs are investigated. Of all the colors I - K most reliably correlates with spectral type. FeH bands near 9900 A are clearly seen in the spectra of all dwarf stars later than M5. Two stars cooler than VB10, and similar in temperature to LHS2924 have been identified; both have H-alpha in emission and appear variable in magnitude and R - I color; one is a flare star. The other stars are of earlier spectral type and resemble W359 and VB8. The observed MI, I - K main sequence is in good agreement with the IG theoretical main sequence of Stringfellow, and the faintest stars could be about 0.09 solar mass red dwarfs or lower mass brown dwarfs. 65 refs
Chemical and Biological Analyses of the Essential Oils and Main Constituents of Piper Species
Directory of Open Access Journals (Sweden)
Leonor Laura Leon
2012-02-01
Full Text Available The essential oils obtained from leaves of Piper duckei and Piper demeraranum by hydrodistillation were analyzed by gas chromatography-mass spectrometry. The main constituents found in P. demeraranum oil were limonene (19.3% and β-elemene (33.1% and in P. duckei oil the major components found were germacrene D (14.7% and trans-caryophyllene (27.1%. P. demeraranum and P. duckei oils exhibited biological activity, with IC50 values between 15 to 76 μg mL−1 against two Leishmania species, P. duckei oil being the most active. The cytotoxicity of the essential oils on mice peritoneal macrophage cells was insignificant, compared with the toxicity of pentamidine. The main mono- and sesquiterpene, limonene (IC50 = 278 μM and caryophyllene (IC50 = 96 μM, were tested against the strains of Leishmania amazonensis, and the IC50 values of these compounds were lower than those found for the essential oils of the Piper species. The HET-CAM test was used to evaluate the irritation potential of these oils as topical products, showing that these oils can be used as auxiliary medication in cases of cutaneous leishmaniasis, with less side effects and lower costs.
In Vivo Measurements in Mice in the Bion-M 1 Mission
Andreev-Andrievskiy, Alexander; Custaud, Marc-Antoine; Popova, Anfisa; Borovik, Anatoliy; Dolgov, Oleg; Anokhin, Konstantin; Tsvirkun, Daria; Vinogradova, Olga
The main aim of BION-M 1 mission was to reveal morphological, biochemical and molecular mechanisms of adaptation to prolonged exposure in microgravity. Besides that functional state and behavior were assessed in vivo using test battery, home cage observations and implantable telemetry in space-flown mice (SF), control mice from the ground replica of the flight experiment (GC) and in mice kept in vivarium (SFV and GCV). Blood pressure and heart rate were monitored continuously in a subgroup of mice using implantable telemetry throughout the flight as well as before and after it. After 30-days flight aboard BION-M 1 biosatellite SF mice have gained more weight than GC, SFV or GCV mice (11%). SF mice displayed pronounced motor impairment upon examination shortly after landing. 1 day after the flight mice were less active and more anxious in the open-field test, less coordinated in the Rotarod and aerial drop test and had less grip force compared to both control and pre-flight values. Exercise performance was greatly reduced after 30-days flight and recovered by day 7 post-flight. Before the flight mice were trained to perform a simple task using positively reinforced free operant conditioning approach. After the flight performance in the same task was preserved, however learning ability was impaired. Mice displayed drastic reduction of heart rate during launch and reentry acceleration periods. Heart rate (by 8-10%) and, to a lesser extent blood pressure (by 5%) were elevated during the 30-days flight. After return heart rate in SF mice remained elevated throughout the 7-days observation period with no apparent recovery. In summary, mice display pronounced disadaptation to 1g after 30-days exposure in microgravity with different physiological systems having different recovery dynamics. Of particular interest, hemodynamic reactions in mice closely resemble reactions in larger organisms, implying that factors that govern the cardiovascular system adaptation to
Effects of Main-Sequence Mass Loss on Stellar and Galactic Chemical Evolution.
Guzik, Joyce Ann
1988-06-01
L. A. Willson, G. H. Bowen and C. Struck -Marcell have proposed that 1 to 3 solar mass stars may experience evolutionarily significant mass loss during the early part of their main-sequence phase. The suggested mass-loss mechanism is pulsation, facilitated by rapid rotation. Initial mass-loss rates may be as large as several times 10^{-9}M o/yr, diminishing over several times 10^8 years. We attempted to test this hypothesis by comparing some theoretical implications with observations. Three areas are addressed: Solar models, cluster HR diagrams, and galactic chemical evolution. Mass-losing solar models were evolved that match the Sun's luminosity and radius at its present age. The most extreme viable models have initial mass 2.0 M o, and mass-loss rates decreasing exponentially over 2-3 times 10^8 years. Compared to a constant -mass model, these models require a reduced initial ^4He abundance, have deeper envelope convection zones and higher ^8B neutrino fluxes. Early processing of present surface layers at higher interior temperatures increases the surface ^3He abundance, destroys Li, Be and B, and decreases the surface C/N ratio following first dredge-up. Evolution calculations incorporating main-sequence mass loss were completed for a grid of models with initial masses 1.25 to 2.0 Mo and mass loss timescales 0.2 to 2.0 Gyr. Cluster HR diagrams synthesized with these models confirm the potential for the hypothesis to explain observed spreads or bifurcations in the upper main sequence, blue stragglers, anomalous giants, and poor fits of main-sequence turnoffs by standard isochrones. Simple closed galactic chemical evolution models were used to test the effects of main-sequence mass loss on the F and G dwarf distribution. Stars between 3.0 M o and a metallicity -dependent lower mass are assumed to lose mass. The models produce a 30 to 60% increase in the stars to stars-plus -remnants ratio, with fewer early-F dwarfs and many more late-F dwarfs remaining on the main
Zhang, Hansi; Pluhackova, Kristyna; Jiang, Zhenyan; Böckmann, Rainer A.
2016-08-01
Sphingosine-1-phosphate (S1P) is a lysophospholipid mediator carried by the HDL-associated apoM protein in blood, regulating many physiological processes by activating the G protein-coupled S1P receptor in mammals. Despite the solved crystal structure of the apoM-S1P complex, the mechanism of S1P release from apoM as a part of the S1P pathway is unknown. Here, the dynamics of the wild type apoM-S1P complex as well as of mutants were investigated by means of atomistic molecular dynamics simulations. The potential of mean force for S1P unbinding from apoM reflected a large binding strength of more than 60 kJ/mol. This high unbinding free energy for S1P underlines the observed specificity of the physiological effects of S1P as it suggests that the spontaneous release of S1P from apoM is unlikely. Instead, S1P release and thus the control of this bioactive lipid probably requires the tight interaction with other molecules, e.g. with the S1P receptor. Mutations of specific S1P anchoring residues of apoM decreased the energetic barrier by up to 20 kJ/mol. Moreover, the ligand-free apoM protein is shown to adopt a more open upper hydrophilic binding pocket and to result in complete closure of the lower hydrophobic cavity, suggesting a mechanism for adjusting the gate for ligand access.
Directory of Open Access Journals (Sweden)
João Yunes
1978-09-01
Full Text Available Estudou-se as principais características biológicas e sociais do recém-nascido de baixo peso (£ 2.500 g comparado com o de peso normal (> 2.500 através de uma amostra de recém-nascidos admitidos no berçário e nascidos na Clínica Obstétrica do Hospital das Clínicas da Faculdade de Medicina da USP durante o período de 1 ano. As características individuais do recém-nascido foram avaliadas através das variáveis sexo, cor, medidas antropométricas e condições clínicas. A assistência dispensada ao recém-nascido foi estudada quer sob o ponto de vista quantitativo como qualitativo. As condições sócio-econômicas foram analisadas através da caracterização ao tamanho da família, tipo de união, qualificação da mão de obra, escolaridade e renda. Também foram analisados o comportamento e a atitude das mães dos recém-nascidos quanto à utilização dos recursos de saúde, idade ideal para ter filhos e número ideal de filhos. As principais características médico-sociais identificadas e analisadas neste estudo fornecem elementos para subsidiar o estabelecimento de uma assistência global à gestante.A study was made on the main biological and social characteristics of low birth-weight (£ 2500 g as compared to normal weight (> 2500 g based on a sample of newborn admited to the nursery and born at the "Clínica Obstétrica do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo" during the period of one year. The individual characteristics of the new-born were evaluated according to the variables sex, color, anthropometric measures and clinical conditions. Medical care given to new-born was studied not only as to the aspect of quantity but also of quality. Social-economic conditions were analyzed based on the characterization of family size, legal conditions of marriage, man-power qualification, schooling and income. Behavior and attitudes of mothers of the newborn were also analyzed as regards the
Compact Nd:YAG laser operating at 1.06, 1.32, and 1.44 μm for dental caries effective disinfection
Dostálová, Tat'jana; Jelínková, Helena; Kadlecová, Martina; Němec, Michal; Å ulc, Jan; Fibrich, Martin; Nejezchleb, Karel; Kapitch, Nickalai; Å koda, Václav
2017-02-01
The analysis of the disinfection effect of Nd:YAG laser radiation was investigated for patients with high concentration of Streptococcus mutans in saliva (positive result in Saliva-check mutans test). For the interaction the Nd:YAG laser system generated separate switchable wavelengths with the maximum output energies 1.1, 0.6, and 0.3 J for wavelength 1.06 μm, 1.32, μm and 1.44 μm, respectively, was used. Our study proved that after the laser irradiation the Saliva-check test showed negative presence of Streptococcus mutans. The disinfection effect was confirmed for all used radiation wavelength. For 1.44 μm this effect was reached with a smallest energy density.
Design of the 1.8 Tesla wiggler for the DAΦNE Main Rings
International Nuclear Information System (INIS)
Sanelli, C.; Hsieh, H.
1992-01-01
The electromagnetic and mechanical design of the eight wiggler magnets for DAΦNE Main Rings is described. The wigglers have a large 1.8 Tesla flat top magnetic field, 64 cm period and 4 cm gap. The magnetic 3-D calculations, the electromagnetic design and the adopted mechanical solutions, with particular attention to the vacuum chamber problems are described. A full scale prototype (5 full poles and two half pole) will be constructed in order to verify the accuracy of magnetic calculations, the end pole design and the multipole content. (author) 4 figs.; 1 tab
Ire1 mediated mRNA splicing in a C-terminus deletion mutant of Drosophila Xbp1.
Directory of Open Access Journals (Sweden)
Dina S Coelho
Full Text Available The Unfolded Protein Response is a homeostatic mechanism that permits eukaryotic cells to cope with Endoplasmic Reticulum (ER stress caused by excessive accumulation of misfolded proteins in the ER lumen. The more conserved branch of the UPR relies on an ER transmembrane enzyme, Ire1, which, upon ER stress, promotes the unconventional splicing of a small intron from the mRNA encoding the transcription factor Xbp1. In mammals, two specific regions (the hydrophobic region 2--HR2--and the C-terminal translational pausing site present in the Xbp1unspliced protein mediate the recruitment of the Xbp1 mRNA-ribosome-nascent chain complex to the ER membrane, so that Xbp1 mRNA can be spliced by Ire1. Here, we generated a Drosophila Xbp1 deletion mutant (Excision101 lacking both HR2 and C-terminal region, but not the Ire1 splicing site. We show that Ire1-dependent splicing of Xbp1 mRNA is reduced, but not abolished in Excision101. Our results suggest the existence of additional mechanisms for ER membrane targeting of Xbp1 mRNA that are independent of the C-terminal domain of Drosophila Xbp1unspliced.
E1 and M1 strength functions at low energy
Schwengner, Ronald; Massarczyk, Ralph; Bemmerer, Daniel; Beyer, Roland; Junghans, Arnd R.; Kögler, Toni; Rusev, Gencho; Tonchev, Anton P.; Tornow, Werner; Wagner, Andreas
2017-09-01
We report photon-scattering experiments using bremsstrahlung at the γELBE facility of Helmholtz-Zentrum Dresden-Rossendorf and using quasi-monoenergetic, polarized γ beams at the HIγS facility of the Triangle Universities Nuclear Laboratory in Durham. To deduce the photoabsorption cross sections at high excitation energy and high level density, unresolved strength in the quasicontinuum of nuclear states has been taken into account. In the analysis of the spectra measured by using bremsstrahlung at γELBE, we perform simulations of statistical γ-ray cascades using the code γDEX to estimate intensities of inelastic transitions to low-lying excited states. Simulated average branching ratios are compared with model-independent branching ratios obtained from spectra measured by using monoenergetic γ beams at HIγS. E1 strength in the energy region of the pygmy dipole resonance is discussed in nuclei around mass 90 and in xenon isotopes. M1 strength in the region of the spin-flip resonance is also considered for xenon isotopes. The dipole strength function of 74Ge deduced from γELBE experiments is compared with the one obtained from experiments at the Oslo Cyclotron Laboratory. The low-energy upbend seen in the Oslo data is interpreted as M1 strength on the basis of shell-model calculations.
E1 and M1 strength functions at low energy
Directory of Open Access Journals (Sweden)
Schwengner Ronald
2017-01-01
Full Text Available We report photon-scattering experiments using bremsstrahlung at the γELBE facility of Helmholtz-Zentrum Dresden-Rossendorf and using quasi-monoenergetic, polarized γ beams at the HIγS facility of the Triangle Universities Nuclear Laboratory in Durham. To deduce the photoabsorption cross sections at high excitation energy and high level density, unresolved strength in the quasicontinuum of nuclear states has been taken into account. In the analysis of the spectra measured by using bremsstrahlung at γELBE, we perform simulations of statistical γ-ray cascades using the code γDEX to estimate intensities of inelastic transitions to low-lying excited states. Simulated average branching ratios are compared with model-independent branching ratios obtained from spectra measured by using monoenergetic γ beams at HIγS. E1 strength in the energy region of the pygmy dipole resonance is discussed in nuclei around mass 90 and in xenon isotopes. M1 strength in the region of the spin-flip resonance is also considered for xenon isotopes. The dipole strength function of 74Ge deduced from γELBE experiments is compared with the one obtained from experiments at the Oslo Cyclotron Laboratory. The low-energy upbend seen in the Oslo data is interpreted as M1 strength on the basis of shell-model calculations.
Collider baseline parameters: Milestone M1.5
Schulte, Daniel
2016-01-01
The deliverable D1.1 provided a preliminary specification of the layout and target operation parameters for the FCC-hh hadron collider concept. It serves as the basis for the studies in all work packages. Tis milestone summarises the outcome of the first studies of this design. The goal of the FCC hadron collider is to provide proton-proton collisions at a centre-of-mass energy of 100 TeV. The machine is compatible with ion beam operation. Assuming a nominal dipole field of 16 T, such a machine is based on a perimeter of 100 km. The machine is designed to accommodate two main proton experiments that are operated simultaneously. The machine delivers a peak luminosity of 5-30 x 1034 cm-2s-1. The layout allows for two additional special-purpose experiments.
Directory of Open Access Journals (Sweden)
Howard Ramos
2016-05-01
Full Text Available Literature on rural and small island tourism critically questions the commodification of culture and landscapes, showing that replacing rural resource based industries with tourism often leads to a mummification of culture and questionable economic payoffs. Using original survey and qualitative data from three communities in Labrador’s Battle Harbour Historic District, this paper explores how rural and island communities perceive the benefits of tourism and interactions with tourists. The paper finds that residents value the cultural showcasing of their communities and history, but are ambiguous about the economic rewards of tourism. We conclude by questioning whether the cultural rewards of tourism, around meaning making, outweigh other rewards around promoting economically and socially viable communities.