WorldWideScience

Sample records for lysine desoxycholate agar

  1. Mild heating of amphotericin B-desoxycholate: effects on ultrastructure, in vitro activity and toxicity, and therapeutic efficacy in severe candidiasis in leukopenic mice

    NARCIS (Netherlands)

    E.W.M. van Etten (Els); W. van Vianen (Wim); P. Roovers; P.M. Frederik

    2000-01-01

    textabstractHeated (20 min at 70 degrees C) amphotericin B-desoxycholate (hAMB-DOC) was further characterized, as was another formulation obtained after centrifugation (60 min, 3000 x g), hcAMB-DOC. Conventional AMB-DOC consisted of individual micelles (approximately 4

  2. Synergism and rules from combination of Baicalin, Jasminoidin and Desoxycholic acid in refined Qing Kai Ling for treat ischemic stroke mice model.

    Directory of Open Access Journals (Sweden)

    Jian Li

    Full Text Available Refined Qing-Kai-Ling (QKL, a modified Chinese medicine, consists of three main ingredients (Baicalin, Jasminoidin and Desoxycholic acid, plays a synergistic effect on the treatment of the acute stage of ischemic stroke. However, the rules of the combination and synergism are still unknown. Based on the ischemic stroke mice model, all different kinds of combination of Baicalin, Jasminoidin, and Desoxycholic acid were investigated by the methods of neurological examination, microarray, and genomics analysis. As a result, it confirmed that the combination of three drugs offered a better therapeutical effect on ischemic stroke than monotherapy of each drug. Additionally, we used Ingenuity pathway Analysis (IPA and principal component analysis (PCA to extract the dominant information of expression changes in 373 ischemia-related genes. The results suggested that 5 principal components (PC1-5 could account for more than 95% energy in the gene data. Moreover, 3 clusters (PC1, PC2+PC5, and PC3+PC4 were addressed with cluster analysis. Furthermore, we matched PCs on the drug-target networks, the findings demonstrated that Baicalin related with PC1 that played the leading role in the combination; Jasminoidin related with PC2+PC5 that played a compensatory role; while Desoxycholic acid had the least performance alone which could relate with PC3+PC4 that played a compatible role. These manifestations were accorded with the principle of herbal formulae of Traditional Chinese Medicine (TCM, emperor-minister-adjuvant-courier. In conclusion, we firstly provided scientific evidence to the classic theory of TCM formulae, an initiating holistic viewpoint of combination therapy of TCM. This study also illustrated that PCA might be an applicable method to analyze the complicated data of drug combination.

  3. Inoculation Expedition of Agar wood

    International Nuclear Information System (INIS)

    Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

    2015-01-01

    Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

  4. Ascidian Sperm Lysin System

    OpenAIRE

    Hitoshi, Sawada; Department of Biochemistry, Graduate School of Pharmaceutical Sciences, Hokkaido University

    2002-01-01

    Fertilization is a precisely controlled process involving many gamete molecules in sperm binding to and penetration through the extracellular matrix of the egg. After sperm bind to the extracellular matrix (vitelline coat), they undergo the acrosome reaction which exposes and partially releases a lytic agent called "lysin" to digest the vitelline coat for the sperm penetration. The vitelline coat sperm lysin is generally a protease in deuterostomes. The molecular mechanism of the actual degra...

  5. Lysine analoga; bereiding en enzymatische hydrolyse van peptide derivaten van lysine en lysine analoga

    NARCIS (Netherlands)

    Tesser, Godefridus Ignatius

    1961-01-01

    De synthese van enkele structuuranaloga van lysine wordt beschreven. Aangetoond wordt dat zij lysine in substraten voor trypsine, cathepsine B en papaine kan vervangen. Daar de structuur van de analoga O-(Beta-aminoaethyl)serine en S-(Beta-aminoaethyl) cysteine die van lysine dicht nadert, wordt

  6. Expanding lysine industry: industrial biomanufacturing of lysine and its derivatives.

    Science.gov (United States)

    Cheng, Jie; Chen, Peng; Song, Andong; Wang, Dan; Wang, Qinhong

    2018-04-13

    L-Lysine is widely used as a nutrition supplement in feed, food, and beverage industries as well as a chemical intermediate. At present, great efforts are made to further decrease the cost of lysine to make it more competitive in the markets. Furthermore, lysine also shows potential as a feedstock to produce other high-value chemicals for active pharmaceutical ingredients, drugs, or materials. In this review, the current biomanufacturing of lysine is first presented. Second, the production of novel derivatives from lysine is discussed. Some chemicals like L-pipecolic acid, cadaverine, and 5-aminovalerate already have been obtained at a lab scale. Others like 6-aminocaproic acid, valerolactam, and caprolactam could be produced through a biological and chemical coupling pathway or be synthesized by a hypothetical pathway. This review demonstrates an active and expansive lysine industry, and these green biomanufacturing strategies could also be applied to enhance the competitiveness of other amino acid industry.

  7. Morphological identification of Candida species on glucose agar, rice extract agar and corn meal agar with and without Tween-80.

    Science.gov (United States)

    Joshi, K R; Solanki, A; Prakash, P

    1993-01-01

    A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.

  8. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    Energy Technology Data Exchange (ETDEWEB)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at

    2016-09-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  9. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    International Nuclear Information System (INIS)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo

    2016-01-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  10. Menu Proposal to Use Powdered Agar

    OpenAIRE

    土屋, ひろ子; 嶋村, 桃子; 小松, 沙霧

    2015-01-01

    The author was involved in the development of the menu items that might be sold at “Taisho Village”, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...

  11. Catabolism of lysine by mixed rumen bacteria

    International Nuclear Information System (INIS)

    Onodera, Ryoji; Kandatsu, Makoto.

    1975-01-01

    Metabolites arising from the catabolism of lysine by the mixed rumen bacteria were chromatographically examined by using radioactive lysine. After 6 hr incubation, 241 nmole/ml of lysine was decomposed to give ether-soluble substances and CO 2 by the bacteria and 90 nmole/ml of lysine was incorporated unchanged into the bacteria. delta-Aminovalerate, cadaverine or pipecolate did not seem to be produced from lysine even after incubation of the bacteria with addition of those three amino compounds to trap besides lysine and radioactive lysine. Most of the ether-soluble substances produced from radioactive lysine was volatile fatty acids (VFAs). Fractionation of VFAs revealed that the peaks of butyric and acetic acids coincided with the strong radioactive peaks. Small amounts of radioactivities were detected in propionic acid peak and a peak assumed to be caproic acid. The rumen bacteria appeared to decompose much larger amounts of lysine than the rumen ciliate protozoa did. (auth.)

  12. Agar from some Hawaiian red algae

    Energy Technology Data Exchange (ETDEWEB)

    Santos, G.A.; Doty, M.S.

    1983-08-01

    From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).

  13. Morphological development of Morchella conica mycelium on different agar media.

    Science.gov (United States)

    Guler, P; Ozkaya, E G

    2009-07-01

    The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.

  14. Identification of Cryptococcus neoformans isolates using Staib agar without creatinine

    OpenAIRE

    Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia

    2005-01-01

    In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...

  15. Lysine: Participation in life, production and biosynthesis

    International Nuclear Information System (INIS)

    Shah, A.H.; Hameed, A.

    2002-01-01

    Lysine plays a vital role in life. Its demands increase worldwide. It is in the interest of students to advertise the supreme importance of its productions. In this report, the mechanism and the biosynthetic pathway of lysine in corynebacterium glutamicum is illustrated, in a simple and ready understandable way. These will pave the way of lysine production. (author)

  16. STABILITAS ANTOSIANIN JANTUNG PISANG KEPOK (Musa paradisiaca L TERHADAP CAHAYA SEBAGAI PEWARNA AGAR-AGAR

    Directory of Open Access Journals (Sweden)

    Lydia Ninan Lestario

    2015-02-01

    jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna

  17. Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent

    International Nuclear Information System (INIS)

    Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.

    2006-01-01

    Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants ΔH d egree, ΔS d egree and ΔG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)

  18. Extraction of agar from Gelidium sesquipedale (Rhodopyta) and surface characterization of agar based films.

    Science.gov (United States)

    Guerrero, P; Etxabide, A; Leceta, I; Peñalba, M; de la Caba, K

    2014-01-01

    The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Lysine purification with cation exchange resin

    International Nuclear Information System (INIS)

    Khayati, GH.; Mottaghi Talab, M.; Hamooni Hagheeghat, M.; Fatemi, M.

    2003-01-01

    L-lysine is an essential amino acid for the growth most of animal species and the number one limiting amino acid for poultry. After production and biomass removal by filtration and centrifugation, the essential next step is the lysine purification and recovery. There are different methods for lysine purification. The ion exchange process is one of the most commonly used purification methods. Lysine recovery was done from broth by ion exchange resin in three different ways: repeated passing, resin soaking and the usual method. Impurities were isolated from the column by repeated wash with distilled water. Recovery and purification was done with NH 4 OH and different alcohol volumes respectively. The results showed that repeated passing is the best method for lysine absorption (maximum range 86.21 %). Washing with alkali solution revealed that most of lysine is obtained in the first step of washing. The highest degree of lysine purification was achieved with the use of 4 volumes of alcohol

  20. Micropipette Deflection Measurements of Agar-Glass Adhesion

    Science.gov (United States)

    Parg, Richard; Shelton, Erin; Dutcher, John

    Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.

  1. Hemoglobin Labeled by Radioactive Lysine

    Science.gov (United States)

    Bale, W. F.; Yuile, C. L.; DeLaVergne, L.; Miller, L. L.; Whipple, G. H.

    1949-12-08

    This paper reports on the utilization of tagged epsilon carbon of DL-lysine by a dog both anemic and hypoproteinemic due to repeated bleeding plus a diet low in protein. The experiment extended over period of 234 days, a time sufficient to indicate an erythrocyte life span of at least 115 days based upon the rate of replacement of labeled red cell proteins. The proteins of broken down red cells seem not to be used with any great preference for the synthesis of new hemoglobin.

  2. 21 CFR 866.4600 - Ouchterlony agar plate.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...

  3. Agar alternatives for micropropagation of African violet ( Saintpaulia ...

    African Journals Online (AJOL)

    Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...

  4. Gari agar as culture media for mycological studies | Okorondu ...

    African Journals Online (AJOL)

    Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...

  5. Microbial production of lysine from sustainable feedstock

    DEFF Research Database (Denmark)

    Wang, Zhihao; Grishkova, Maria; Solem, Christian

    2014-01-01

    Lysine is produced in a fermentation process using Corynebacterium glutamicum. And even though production strains have been improved for decades, there is still room for further optimization.......Lysine is produced in a fermentation process using Corynebacterium glutamicum. And even though production strains have been improved for decades, there is still room for further optimization....

  6. PENILAIAN PENGARUH PENAMBAHAN LYSINE PADA NASI

    Directory of Open Access Journals (Sweden)

    Ignatius Tarwotjo

    2012-11-01

    Full Text Available Pengaruh penambahan lysine pada mutu protein nasi dilakukan pada tikus putih dengan mengukur Protein Efficiency Ratio. Nasi dan Nasi dengan sayur beserta laukpauk, seperti dikonsumsi oleh kebanyakan keluarga di Indonesia, yang berasnya lebih dulu ditambahi butiran premix berisi lysine, thiamine dan riboflavin ternaya menghasilkan Protein Efficiency Ratio lebih tinggi dari pada yang tidak ditambahi.

  7. Optimization of lysine metabolism in Corynebacterium glutamicum

    DEFF Research Database (Denmark)

    Rytter, Jakob Vang

    ,000,000 tons. The aim of this project is to optimize the yield of lysine in C. glutamicum using metabolic engineering strategies. According to a genome scale model of C. glutamicum, theoretically there is much room for increasing the lysine yield (Kjeldsen and Nielsen 2009). Lysine synthesis requires NADPH......Commercial pig and poultry production use the essential amino acid lysine as a feed additive with the purpose of optimizing the feed utilization. Lysine is produced by a fermentation process involving either Corynebacterium glutamicum or Escherichia coli. The global annual production is around 1...... the project intends to eliminate. PGI catalyzes the conversion of alpha-D-glucose-6-phosphate to fructose-6-phosphate just downstream of the branch in the glycolysis, but it also catalyzes the reverse reaction. It is unknown whether up- or down-regulation of the pgi is required to increase the flux through...

  8. Radiation sterilization of triple sugar iron agar

    International Nuclear Information System (INIS)

    Altmann, G.; Eisenberg, E.; Bogokowsky, B.

    1979-01-01

    Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)

  9. Lysine and glutamate transport in the erythrocytes of common brushtail possum, Tammar Wallaby and eastern grey, kangaroo.

    Science.gov (United States)

    Ogawa, E; Kuchel, P W; Agar, N S

    1998-04-01

    It was recently coincidentally discovered, using 1H NMR spectroscopy, that the erythrocytes of two species of Australian marsupials, Tammar Wallaby (Macropus eugenii) and Bettong (Bettongia penicillata), contain relatively high concentrations of the essential amino acid lysine (Agar NS, Rae CD, Chapman BE, Kuchel PW. Comp Biochem Physiol 1991;99B:575-97). Hence, in the present work the rates of transport of lysine into the erythrocytes from the Common Brushtail Possum (Dactylopsilia trivirgata) and Eastern Grey Kangaroo (Macropus giganteus) (which both have low lysine concentrations), and Tammar Wallaby were studied, to explore the mechanistic basis of this finding. The concentration-dependence of the uptake was studied with lysine alone and in the presence of arginine, which may be a competitor of the transport in some species. In relation to GSH metabolism, glutamate uptake was determined in the presence and absence of Na+. The data was analysed to yield estimates of the maximal velocity (Vmax) and the Km in each of the species. Erythrocytes from Tammar Wallaby lacked saturable lysine transport in contrast to the other two species. The glutamate uptake was normal in all three animals for adequate GSH biosynthesis.

  10. Deregulation of histone lysine methyltransferases contributes to oncogenic transformation of human bronchoepithelial cells

    Directory of Open Access Journals (Sweden)

    Yoda Satoshi

    2008-11-01

    Full Text Available Abstract Background Alterations in the processing of the genetic information in carcinogenesis result from stable genetic mutations or epigenetic modifications. It is becoming clear that nucleosomal histones are central to proper gene expression and that aberrant DNA methylation of genes and histone methylation plays important roles in tumor progression. To date, several histone lysine methyltransferases (HKMTs have been identified and histone lysine methylation is now considered to be a critical regulator of transcription. However, still relatively little is known about the role of HKMTs in tumorigenesis. Results We observed differential HKMT expression in a lung cancer model in which normal human bronchial epithelial (NHBE cells expressing telomerase, SV40 large T antigen, and Ras were immortal, formed colonies in soft agar, and expressed specific HKMTs for H3 lysine 9 and 27 residues but not for H3 lysine 4 residue. Modifications in the H3 tails affect the binding of proteins to the histone tails and regulate protein function and the position of lysine methylation marks a gene to be either activated or repressed. In the present study, suppression by siRNA of HKMTs (EZH2, G9A, SETDB1 and SUV39H1 that are over-expressed in immortalized and transformed cells lead to reduced cell proliferation and much less anchorage-independent colony growth. We also found that the suppression of H3-K9, G9A and SUV39H1 induced apoptosis and the suppression of H3-K27, EZH2 caused G1 arrest. Conclusion Our results indicate the potential of these HKMTs in addition to the other targets for epigenetics such as DNMTs and HDACs to be interesting therapeutic targets.

  11. Reactive lysine content in commercially available pet foods

    NARCIS (Netherlands)

    Rooijen, van C.; Bosch, G.; Poel, van der A.F.B.; Wierenga, P.A.; Alexander, L.; Hendriks, W.H.

    2014-01-01

    The Maillard reaction can occur during processing of pet foods. During this reaction, the e-amino group of lysine reacts with reducing sugars to become unavailable for metabolism. The aim of the present study was to determine the reactive lysine (RL; the remaining available lysine) to total lysine

  12. Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton

    Directory of Open Access Journals (Sweden)

    Margaret Ordoñez Smith de Danies

    1993-12-01

    Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.

  13. Lysine-Rich Proteins in High-Lysine Hordeum Vulgare Grain

    DEFF Research Database (Denmark)

    Ingversen, J.; Køie, B.

    1973-01-01

    The salt-soluble proteins in barley grain selected for high-lysine content (Hiproly, CI 7115 and the mutants 29 and 86) and of a control (Carlsberg II) with normal lysine content, contain identical major proteins as determined by MW and electrophoretic mobility. The concentration of a protein gro...

  14. Seasonal variations of agar extracted from different life stages of ...

    African Journals Online (AJOL)

    Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008–winter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between ...

  15. Methods for identifying lipoxygenase producing microorganisms on agar plates

    NARCIS (Netherlands)

    Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.

    2012-01-01

    Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching

  16. Assessment of Native Agar Gels Extracted from Gracilaria debilis ...

    African Journals Online (AJOL)

    Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...

  17. Efficient Production of Enantiopure d-Lysine from l-Lysine by a Two-Enzyme Cascade System

    Directory of Open Access Journals (Sweden)

    Xin Wang

    2016-10-01

    Full Text Available The microbial production of d-lysine has been of great interest as a medicinal raw material. Here, a two-step process for d-lysine production from l-lysine by the successive microbial racemization and asymmetric degradation with lysine racemase and decarboxylase was developed. The whole-cell activities of engineered Escherichia coli expressing racemases from the strains Proteus mirabilis (LYR and Lactobacillus paracasei (AAR were first investigated comparatively. When the strain BL21-LYR with higher racemization activity was employed, l-lysine was rapidly racemized to give dl-lysine, and the d-lysine yield was approximately 48% after 0.5 h. Next, l-lysine was selectively catabolized to generate cadaverine by lysine decarboxylase. The comparative analysis of the decarboxylation activities of resting whole cells, permeabilized cells, and crude enzyme revealed that the crude enzyme was the best biocatalyst for enantiopure d-lysine production. The reaction temperature, pH, metal ion additive, and pyridoxal 5′-phosphate content of this two-step production process were subsequently optimized. Under optimal conditions, 750.7 mmol/L d-lysine was finally obtained from 1710 mmol/L l-lysine after 1 h of racemization reaction and 0.5 h of decarboxylation reaction. d-lysine yield could reach 48.8% with enantiomeric excess (ee ≥ 99%.

  18. AGAR PENULISAN RESEP TETAP UP TO DATE

    Directory of Open Access Journals (Sweden)

    Rahmatini Rahmatini

    2009-09-01

    Full Text Available AbstrakResep adalah suatu permintaan tertulis dari dokter, dokter gigi atau dokter hewan kepada apoteker untuk membuatkan obat dalam bentuk sediaan tertentu dan menyerahkannya kepada pasien. Resep merupakan perwujudan akhir dari kompetensi, pengetahuan dan keahlian dokter dalam menerapkan pengetahuannya dalam bidang farmakologi dan terapi.Penulisan resep harus ditulis dengan jelas sehingga dapat dibaca oleh petugas di apotek. Resep yang ditulis dengan tidak jelas akan menimbulkan terjadinya kesalahan saat peracikan / penyiapan obat dan penggunaan obat yang diresepkan.Ilmu pengetahuan tentang obat selalu berubah, obat – obat baru selalu muncul di pasaran.Secara umum, seorang dokter harus mengikuti perkembangan dalam terapi obat. Bila muncul efek samping akibat obat yang seharusnya diketahui dan dapat dicegah oleh dokter, maka dokter akan berhadapan dengan hukum.Agar penulisan resep tetap up to date, seorang dokter harus mengumpulkan berbagai informasi yang tersedia. Sumber informasi yang dapat digunakan adalah : Buku acuan, Kompendium obat, Daftar Obat Esensial Nasional (DOEN dan Pedoman terapi, Buletin obat, Jurnal Kedokteran, Pusat informasi obat,Informasi melalui komputer, Sumber informasi dari industri farmasi, dan informasi lisan.Bandingkan kelebihan dan kekurangan berbagai sumber informasi. Tugas seorang dokter adalah melakukan cara terbaik untuk tetap up to date dengan mendaftar sumber informasi yang dapat dimanfaatkan. Carilah sedikitnya satu dari yang berikut ini : (1 jurnal kedokteran: (2 buletin obat; (3 buku acuan farmakologi atau acuan klinis; (4 komisi terapi maupun konsultan, atau lulusan pasca sarjana farmakologi. Dengan bekal pengetahuan dan kemampuan untuk melakukan penilaian secara kritis setiap bentuk informasi, diharapkan dokter tetap up to date dalam menulis resepKata kunci : Resep – up to- date.Abstract Prescription is a written request from a doctor, dentist or veterinarian to the pharmacist to make a particular drug

  19. Radioactive Lysine in Protein Metabolism Studies

    Science.gov (United States)

    Miller, L. L.; Bale, W. F.; Yuile, C. L.; Masters, R. E.; Tishkoff, G. H.; Whipple,, G. H.

    1950-01-09

    Studies of incorporation of DL-lysine in various body proteins of the dog; the time course of labeled blood proteins; and apparent rate of disappearance of labeled plasma proteins for comparison of behavior of the plasma albumin and globulin fractions; shows more rapid turn over of globulin fraction.

  20. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  1. Rheological properties of agar and carrageenan from Ghanaian red seaweeds

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2017-01-01

    spectroscopy (FTIR) analysis on the hydrocolloids extracted from H. musciformis (and K. alvarezii) indicated κ-carrageenan, C. crenulata hydrocolloids were mainly ι-carrageenan, and the H. dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36 °C for the κ-carrageenan hydrocolloid samples...... comparable with κ-carrageenan from K. alvarezii, whereas the H. dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21–26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...

  2. Hichrom candida agar for identification of candida species

    OpenAIRE

    Baradkar V; Mathur M; Kumar S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...

  3. Detection of extracellular proteases from microorganisms on agar plates

    Directory of Open Access Journals (Sweden)

    Alane Beatriz Vermelho

    1996-12-01

    Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.

  4. Thermal characterization of magnetically aligned carbonyl iron/agar composites.

    Science.gov (United States)

    Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J

    2014-01-01

    Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Differentiating Agar wood Oil Quality Using Artificial Neural Network

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)

  6. A comparison of EF-18 agar and modified brilliant green agar with lutensit for isolation of Salmonella from poultry samples

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård

    1997-01-01

    -Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...

  7. Agar/collagen membrane as skin dressing for wounds

    Energy Technology Data Exchange (ETDEWEB)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn

    2008-12-15

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  8. Agar/collagen membrane as skin dressing for wounds

    International Nuclear Information System (INIS)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing

    2008-01-01

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  9. Lysine Deacetylases and Regulated Glycolysis in Macrophages.

    Science.gov (United States)

    Shakespear, Melanie R; Iyer, Abishek; Cheng, Catherine Youting; Das Gupta, Kaustav; Singhal, Amit; Fairlie, David P; Sweet, Matthew J

    2018-06-01

    Regulated cellular metabolism has emerged as a fundamental process controlling macrophage functions, but there is still much to uncover about the precise signaling mechanisms involved. Lysine acetylation regulates the activity, stability, and/or localization of metabolic enzymes, as well as inflammatory responses, in macrophages. Two protein families, the classical zinc-dependent histone deacetylases (HDACs) and the NAD-dependent HDACs (sirtuins, SIRTs), mediate lysine deacetylation. We describe here mechanisms by which classical HDACs and SIRTs directly regulate specific glycolytic enzymes, as well as evidence that links these protein deacetylases to the regulation of glycolysis-related genes. In these contexts, we discuss HDACs and SIRTs as key control points for regulating immunometabolism and inflammatory outputs from macrophages. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Histone Lysine Methylation and Neurodevelopmental Disorders

    Directory of Open Access Journals (Sweden)

    Jeong-Hoon Kim

    2017-06-01

    Full Text Available Methylation of several lysine residues of histones is a crucial mechanism for relatively long-term regulation of genomic activity. Recent molecular biological studies have demonstrated that the function of histone methylation is more diverse and complex than previously thought. Moreover, studies using newly available genomics techniques, such as exome sequencing, have identified an increasing number of histone lysine methylation-related genes as intellectual disability-associated genes, which highlights the importance of accurate control of histone methylation during neurogenesis. However, given the functional diversity and complexity of histone methylation within the cell, the study of the molecular basis of histone methylation-related neurodevelopmental disorders is currently still in its infancy. Here, we review the latest studies that revealed the pathological implications of alterations in histone methylation status in the context of various neurodevelopmental disorders and propose possible therapeutic application of epigenetic compounds regulating histone methylation status for the treatment of these diseases.

  11. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  12. Photothermal characterization of the gelation process in Gelidium robustum Agar

    Science.gov (United States)

    Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.

    2005-06-01

    Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37°C. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.

  13. Hichrom candida agar for identification of Candida species.

    Science.gov (United States)

    Baradkar, V P; Mathur, M; Kumar, S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  14. Hichrom candida agar for identification of candida species

    Directory of Open Access Journals (Sweden)

    Baradkar V

    2010-01-01

    Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  15. Assay for adhesion and agar invasion in S. cerevisiae.

    Science.gov (United States)

    Guldal, Cemile G; Broach, James

    2006-11-08

    Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, biofilms can reduce industrial productivity, destroy structures, and threaten human life. 1-3 On the other hand, harnessing the power of biofilms can help clean the environment and generate sustainable energy. 4-8 The ability of S. cerevisiae to colonize surfaces and participate in complex biofilms was mostly ignored until the rediscovery of the differentiation programs triggered by various signaling pathways and environmental cues in this organism. 9, 10 The continuing interest in using S. cerevisiae as a model organism to understand the interaction and convergence of signaling pathways, such as the Ras-PKA, Kss1 MAPK, and Hog1 osmolarity pathways, quickly placed S. cerevisiae in the junction of biofilm biology and signal transduction research. 11-20 To this end, differentiation of yeast cells into long, adhesive, pseudohyphal filaments became a convenient readout for the activation of signal transduction pathways upon various environmental changes. However, filamentation is a complex collection of phenotypes, which makes assaying for it as if it were a simple phenotype misleading. In the past decade, several assays were successfully adopted from bacterial biofilm studies to yeast research, such as MAT formation assays to measure colony spread on soft agar and crystal violet staining to quantitatively measure cell-surface adherence. 12, 21 However, there has been some confusion in assays developed to qualitatively assess the adhesive and invasive phenotypes of yeast in agar. Here, we present a simple and reliable method for assessing the adhesive and invasive quality of yeast strains with easy-to-understand steps to isolate the adhesion assessment from invasion assessment. Our method, adopted from previous studies, 10, 16 involves growing cells in liquid media and plating on differential nutrient conditions for growth

  16. Preparation of Agar-Agar from the Red Seaweed Pterocladia capillacea off the Coast of Alexandria, Egypt.

    Science.gov (United States)

    Rao, A V; Bekheet, I A

    1976-10-01

    The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.

  17. Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar

    DEFF Research Database (Denmark)

    Høi, L.; Dalsgaard, Inger; Dalsgaard, A.

    1998-01-01

    An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....

  18. Characterization of Gluten-free Bread Prepared From Maize, Rice and Tapioca Flours using the Hydrocolloid Seaweed Agar-Agar

    OpenAIRE

    Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João

    2011-01-01

    Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...

  19. Corn and potato starch as an agar alternative for Solanum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).

  20. How selective are agar cultures for malignant transformation?

    NARCIS (Netherlands)

    Klein, J.C.

    1981-01-01

    In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized

  1. Growth of strontium oxalate crystals in agar–agar gel

    Indian Academy of Sciences (India)

    Growth of strontium oxalate crystals in agar–agar gel. P V DALAL. ∗ and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.

  2. Molecular and structural insight into lysine selection on substrate and ubiquitin lysine 48 by the ubiquitin-conjugating enzyme Cdc34

    DEFF Research Database (Denmark)

    Suryadinata, Randy; Holien, Jessica K; Yang, George

    2013-01-01

    , the mechanisms of lysine selection are not clearly understood. The positioning of lysine(s) toward the E2/E3 active site and residues proximal to lysines are critical in their selection. We investigated determinants of lysine specificity of the ubiquitin-conjugating enzyme Cdc34, toward substrate and Ub lysines....... Evaluation of the relative importance of different residues positioned -2, -1, +1 and +2 toward ubiquitination of its substrate, Sic1, on lysine 50 showed that charged residues in the -1 and -2 positions negatively impact on ubiquitination. Modeling suggests that charged residues at these positions alter...... the native salt-bridge interactions in Ub and Cdc34, resulting in misplacement of Sic1 lysine 50 in the Cdc34 catalytic cleft. During polyubiquitination, Cdc34 showed a strong preference for Ub lysine 48 (K48), with lower activity towards lysine 11 (K11) and lysine 63 (K63). Mutating the -2, -1, +1 and +2...

  3. Molecular evolution of the lysine biosynthetic pathways.

    Science.gov (United States)

    Velasco, A M; Leguina, J I; Lazcano, A

    2002-10-01

    Among the different biosynthetic pathways found in extant organisms, lysine biosynthesis is peculiar because it has two different anabolic routes. One is the diaminopimelic acid pathway (DAP), and the other over the a-aminoadipic acid route (AAA). A variant of the AAA route that includes some enzymes involved in arginine and leucine biosyntheses has been recently reported in Thermus thermophilus (Nishida et al. 1999). Here we describe the results of a detailed genomic analysis of each of the sequences involved in the two lysine anabolic routes, as well as of genes from other routes related to them. No evidence was found of an evolutionary relationship between the DAP and AAA enzymes. Our results suggest that the DAP pathway is related to arginine metabolism, since the lysC, asd, dapC, dapE, and lysA genes from lysine biosynthesis are related to the argB, argC, argD, argE, and speAC genes, respectively, whose products catalyze different steps in arginine metabolism. This work supports previous reports on the relationship between AAA gene products and some enzymes involved in leucine biosynthesis and the tricarboxylic acid cycle (Irvin and Bhattacharjee 1998; Miyazaki et al. 2001). Here we discuss the significance of the recent finding that several genes involved in the arginine (Arg) and leucine (Leu) biosynthesis participate in a new alternative route of the AAA pathway (Miyazaki et al. 2001). Our results demonstrate a clear relationship between the DAP and Arg routes, and between the AAA and Leu pathways.

  4. [Effect of the lysine guanidination on proteomic analysis].

    Science.gov (United States)

    Zheng, Hao; Mao, Jiawei; Pan, Yanbo; Liu, Zhongshan; Liu, Zheyi; Ye, Mingliang; Zou, Hanfa

    2014-04-01

    The guanidination of lysine side chain was paid great attention in recent years. It plays an important role in qualitative and quantitative proteomics. In this study, based on the results of separated peptides extracted from HeLa cells before and after the guanidination by liquid chromatography-tandem mass spectrometry (LC-MS/MS), the effect of the guanidination of three different kinds of peptides was systematically analyzed. It was found that the selectivity of the guanidination of the lysine side chain was as high as 96.8%. The ratio of identified peptides with lysine at C-term to all peptides increased from 51.7% to 57.3% and more new peptides were identified, while the ratio of peptides with lysine in the middle or without lysine changed little. Further study on the ratio of b and y ions indicated that there were more y ions of peptides with lysine at C-term after the guanidination. The results proved that the selective conversion of lysine to homoarginine by the guanidination could increase the sensitivity and selectivity of mass spectrum. The increased basicity and ability to sequester proton of lysine produced more y ions fragmentation information, which contributed to more identified peptides. It concluded that the lysine guanidination can improve the coverage of proteomic analysis.

  5. Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.

    Science.gov (United States)

    Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young

    2014-10-17

    This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright

  6. Role of L-lysine-alpha-ketoglutarate aminotransferase in catabolism of lysine as a nitrogen source for Rhodotorula glutinis.

    Science.gov (United States)

    Kinzel, J J; Winston, M K; Bhattacharjee, J K

    1983-01-01

    Wild-type and saccharopine dehydrogenaseless mutant strains of Rhodotorula glutinis grew in minimal medium containing lysine as the sole nitrogen source and simultaneously accumulated, in the culture supernatant, large amounts of a product identified as alpha-aminoadipic-delta-semialdehyde. The saccharopine dehydrogenase and pipecolic acid oxidase levels remained unchanged in wild-type cells grown in the presence of ammonium or lysine as the nitrogen source. Lysine-alpha-ketoglutarate aminotransferase activity was demonstrated in ammonium-grown cells. This activity was depressed in cells grown in the presence of lysine as the sole source of nitrogen. PMID:6408065

  7. The growing landscape of lysine acetylation links metabolism and cell signalling

    DEFF Research Database (Denmark)

    Choudhary, Chuna Ram; Weinert, Brian Tate; Nishida, Yuya

    2014-01-01

    Lysine acetylation is a conserved protein post-translational modification that links acetyl-coenzyme A metabolism and cellular signalling. Recent advances in the identification and quantification of lysine acetylation by mass spectrometry have increased our understanding of lysine acetylation...

  8. Digestible lysine levels in diets supplemented with ractopamine

    Directory of Open Access Journals (Sweden)

    Evelar de Oliveira Souza

    2011-10-01

    Full Text Available In order evaluate digestible lysine levels in diets supplemented with 20 ppm of ractopamine on the performance and carcass traits, 64 barrows with high genetic potential at finishing phase were allotted in a completely randomized block design with four digestible lysine levels (0.80, 0.90, 1.00, and 1.10%, eight replicates and two pigs per experimental unit. Initial body weight and pigs' kinship were used as criteria in the blocks formation. Diets were mainly composed of corn and soybean meal supplemented with minerals, vitamins and amino acids to meet pigs' nutritional requirements at the finishing phase, except for digestible lysine. No effect of digestible lysine levels was observed in animal performance. The digestible lysine intake increased linearly by increasing the levels of digestible lysine in the diets. Carcass traits were not influenced by the dietary levels of digestible lysine. The level of 0.80% of digestible lysine in diets supplemented with 20 ppm ractopamine meets the nutritional requirements of castrated male pigs during the finishing phase.

  9. Chemical mechanisms of histone lysine and arginine modifications

    OpenAIRE

    Smith, Brian C.; Denu, John M.

    2008-01-01

    Histone lysine and arginine residues are subject to a wide array of post-translational modifications including methylation, citrullination, acetylation, ubiquitination, and sumoylation. The combinatorial action of these modifications regulates critical DNA processes including replication, repair, and transcription. In addition, enzymes that modify histone lysine and arginine residues have been correlated with a variety of human diseases including arthritis, cancer, heart disease, diabetes, an...

  10. Bioavailability of lysine in heat-treated foods and feedstuffs

    NARCIS (Netherlands)

    McArtney Rutherfurd, S.

    2010-01-01

    During the processing of foodstuffs, lysine can react with other compounds present to form nutritionally unavailable derivatives, the most common example of which are Maillard products. Maillard products can cause serious problems when determining the available lysine content of processed foods or

  11. Quantification of Nε-(2-Furoylmethyl)-L-lysine (furosine), Nε-(Carboxymethyl)-L-lysine (CML), Nε-(Carboxyethyl)-L-lysine (CEL) and total lysine through stable isotope dilution assay and tandem mass spectrometry

    NARCIS (Netherlands)

    Troise, A.D.; Fiore, A.; Wiltafsky, M.; Fogliano, V.

    2015-01-01

    The control of Maillard reaction (MR) is a key point to ensure processed foods quality. Due to the presence of a primary amino group on its side chain, lysine is particularly prone to chemical modifications with the formation of Amadori products (AP), Nε-(Carboxymethyl)-L-lysine (CML),

  12. Threonine and lysine requirements for maintenance in chickens ...

    African Journals Online (AJOL)

    The maintenance requirement for threonine and lysine were estimated in two different experiments by measuring the nitrogen balance of adult male cockerels. Measured amounts of a diet first-limiting in threonine or lysine were fed by intubation each day for 4 d to give a range of intakes (unbalanced series) of from 0 to 239 ...

  13. Antibiotic and surfactant effects on lysine accumulation by Bacillus ...

    African Journals Online (AJOL)

    The effects of antibiotics and surfactants on lysine accumulation in the culture broth of three strains of Bacillus megaterium (B. megaterium SP 86, B. megaterium SP 76 and B. megaterium SP 14) were investigated. Lincomycin, neomycin and tetracycline stimulated lysine increase in B. megaterium SP 76 and B. megaterium ...

  14. Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Fu, Xiaoting

    2016-12-01

    Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Use of electron beam on aflatoxins degradation in coconut agar

    International Nuclear Information System (INIS)

    Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito

    2009-01-01

    The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1μg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)

  16. Histone H4 Lysine 20 methylation

    DEFF Research Database (Denmark)

    Jørgensen, Stine; Schotta, Gunnar; Sørensen, Claus Storgaard

    2013-01-01

    of histones have emerged as key regulators of genomic integrity. Intense research during the past few years has revealed histone H4 lysine 20 methylation (H4K20me) as critically important for the biological processes that ensure genome integrity, such as DNA damage repair, DNA replication and chromatin...... compaction. The distinct H4K20 methylation states are mediated by SET8/PR-Set7 that catalyses monomethylation of H4K20, whereas SUV4-20H1 and SUV4-20H2 enzymes mediate further H4K20 methylation to H4K20me2 and H4K20me3. Disruption of these H4K20-specific histone methyltransferases leads to genomic...

  17. Recovery of Lactobacillus bulgaricus and Streptococcus thermophilus on Nine Commonly Used Agar Media1

    Science.gov (United States)

    Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.

    1974-01-01

    Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006

  18. Myeloperoxidase-mediated protein lysine oxidation generates 2-aminoadipic acid and lysine nitrile in vivo.

    Science.gov (United States)

    Lin, Hongqiao; Levison, Bruce S; Buffa, Jennifer A; Huang, Ying; Fu, Xiaoming; Wang, Zeneng; Gogonea, Valentin; DiDonato, Joseph A; Hazen, Stanley L

    2017-03-01

    Recent studies reveal 2-aminoadipic acid (2-AAA) is both elevated in subjects at risk for diabetes and mechanistically linked to glucose homeostasis. Prior studies also suggest enrichment of protein-bound 2-AAA as an oxidative post-translational modification of lysyl residues in tissues associated with degenerative diseases of aging. While in vitro studies suggest redox active transition metals or myeloperoxidase (MPO) generated hypochlorous acid (HOCl) may produce protein-bound 2-AAA, the mechanism(s) responsible for generation of 2-AAA during inflammatory diseases are unknown. In initial studies we observed that traditional acid- or base-catalyzed protein hydrolysis methods previously employed to measure tissue 2-AAA can artificially generate protein-bound 2-AAA from an alternative potential lysine oxidative product, lysine nitrile (LysCN). Using a validated protease-based digestion method coupled with stable isotope dilution LC/MS/MS, we now report protein bound 2-AAA and LysCN are both formed by hypochlorous acid (HOCl) and the MPO/H 2 O 2 /Cl - system of leukocytes. At low molar ratio of oxidant to target protein N ε -lysine moiety, 2-AAA is formed via an initial N ε -monochloramine intermediate, which ultimately produces the more stable 2-AAA end-product via sequential generation of transient imine and semialdehyde intermediates. At higher oxidant to target protein N ε -lysine amine ratios, protein-bound LysCN is formed via initial generation of a lysine N ε -dichloramine intermediate. In studies employing MPO knockout mice and an acute inflammation model, we show that both free and protein-bound 2-AAA, and in lower yield, protein-bound LysCN, are formed by MPO in vivo during inflammation. Finally, both 2-AAA and to lesser extent LysCN are shown to be enriched in human aortic atherosclerotic plaque, a tissue known to harbor multiple MPO-catalyzed protein oxidation products. Collectively, these results show that MPO-mediated oxidation of protein lysyl

  19. Speciation of Candida using chromogenic and cornmeal agar with determination of fluconazole sensitivity

    OpenAIRE

    Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli

    2013-01-01

    Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...

  20. NMR spectroscopy study of agar-based polymers electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica

    2012-07-01

    Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)

  1. Quantitative SIMS Imaging of Agar-Based Microbial Communities.

    Science.gov (United States)

    Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2018-05-01

    After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

  2. Biotinylation of lysine method identifies acetylated histone H3 lysine 79 in Saccharomyces cerevisiae as a substrate for Sir2.

    Science.gov (United States)

    Bheda, Poonam; Swatkoski, Stephen; Fiedler, Katherine L; Boeke, Jef D; Cotter, Robert J; Wolberger, Cynthia

    2012-04-17

    Although the biological roles of many members of the sirtuin family of lysine deacetylases have been well characterized, a broader understanding of their role in biology is limited by the challenges in identifying new substrates. We present here an in vitro method that combines biotinylation and mass spectrometry (MS) to identify substrates deacetylated by sirtuins. The method permits labeling of deacetylated residues with amine-reactive biotin on the ε-nitrogen of lysine. The biotin can be utilized to purify the substrate and identify the deacetylated lysine by MS. The biotinyl-lysine method was used to compare deacetylation of chemically acetylated histones by the yeast sirtuins, Sir2 and Hst2. Intriguingly, Sir2 preferentially deacetylates histone H3 lysine 79 as compared to Hst2. Although acetylation of K79 was not previously reported in Saccharomyces cerevisiae, we demonstrate that a minor population of this residue is indeed acetylated in vivo and show that Sir2, and not Hst2, regulates the acetylation state of H3 lysine 79. The in vitro biotinyl-lysine method combined with chemical acetylation made it possible to identify this previously unknown, low-abundance histone acetyl modification in vivo. This method has further potential to identify novel sirtuin deacetylation substrates in whole cell extracts, enabling large-scale screens for new deacetylase substrates.

  3. Effect of vitamins and bivalent metals on lysine yield in Bacillus ...

    African Journals Online (AJOL)

    The effects of vitamins and bivalent metals on lysine accumulation in Bacillus strains were investigated. Biotin enhanced lysine production in all the Bacillus strains, while folic acid and riboflavin stimulated lysine yields in Bacillus megaterium SP 86 only. All bivalent metals stimulated lysine accumulation in B. megaterium ...

  4. The routine use of modified Borelli's lactritmel agar (MBLA).

    Science.gov (United States)

    Kaminski, G W

    1985-07-01

    The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.

  5. Effect of low protein diets and lysine supplementation on growth ...

    African Journals Online (AJOL)

    Dr. Ajit

    2012-07-17

    Jul 17, 2012 ... 3Division of Livestock Product Technology, Indian Veterinary Research Institute, Izatnagar – 243 ... Key words: Carcass trait, low protein, lysine, meat quality, pigs. ... functional activities, reproduction and disease resistance.

  6. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  7. Element distribution of the barley plant grown in an agar slice suspended culture

    International Nuclear Information System (INIS)

    Makino-Nakanishi, Tomoko; Matsumoto, Satoshi

    1991-01-01

    An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)

  8. ß-Lysine discrimination by lysyl-tRNA synthetase

    DEFF Research Database (Denmark)

    Gilreath, Marla S; Roy, Hervé; Bullwinkle, Tammy J

    2011-01-01

    guided by the PoxA structure. A233S LysRS behaved as wild type with a-lysine, while the G469A and A233S/G469A variants decreased stable a-lysyl-adenylate formation. A233S LysRS recognized ß-lysine better than wildtype, suggesting a role for this residue in discriminating a- and ß-amino acids. Both...

  9. Comparative study of bio-ethanol production from mahula (Madhuca latifolia L.) flowers by Saccharomyces cerevisiae cells immobilized in agar agar and Ca-alginate matrices

    Energy Technology Data Exchange (ETDEWEB)

    Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)

    2010-01-15

    Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)

  10. Systematic analysis of the lysine acetylome in Vibrio parahemolyticus.

    Science.gov (United States)

    Pan, Jianyi; Ye, Zhicang; Cheng, Zhongyi; Peng, Xiaojun; Wen, Liangyou; Zhao, Fukun

    2014-07-03

    Lysine acetylation of proteins is a major post-translational modification that plays an important regulatory role in almost every aspect of cells, both eukaryotes and prokaryotes. Vibrio parahemolyticus, a model marine bacterium, is a worldwide cause of bacterial seafood-borne illness. Here, we conducted the first lysine acetylome in this bacterium through a combination of highly sensitive immune-affinity purification and high-resolution LC-MS/MS. Overall, we identified 1413 lysine acetylation sites in 656 proteins, which account for 13.6% of the total proteins in the cells; this is the highest ratio of acetyl proteins that has so far been identified in bacteria. The bioinformatics analysis of the acetylome showed that the acetylated proteins are involved in a wide range of cellular functions and exhibit diverse subcellular localizations. More specifically, proteins related to protein biosynthesis and carbon metabolism are the preferential targets of lysine acetylation. Moreover, two types of acetylation motifs, a lysine or arginine at the +4/+5 positions and a tyrosine, histidine, or phenylalanine at the +1/+2 positions, were revealed from the analysis of the acetylome. Additionally, protein interaction network analysis demonstrates that a wide range of interactions are modulated by protein acetylation. This study provides a significant beginning for the in-depth exploration of the physiological role of lysine acetylation in V. parahemolyticus.

  11. Maintenance requirement and deposition efficiency of lysine in pigs

    Directory of Open Access Journals (Sweden)

    Marcos Speroni Ceron

    2013-09-01

    Full Text Available The objective of this work was to determine the maintenance requirement and the deposition efficiency of lysine in growing pigs. It was used the incomplete changeover experimental design, with replicates over time. Twelve castrated pigs with average body weight (BW of 52±2 kg were kept in metabolism crates with a controlled temperature of 22ºC. The diets were formulated to supply 30, 50, 60, and 70% of the expected requirements of standardized lysine, and provided at 2.6 times the energy requirements for maintenance. The trial lasted 24 days and was divided into two periods of 12 days: seven days for animal adaptation to the diet and five days for sample collection. The increasing content of lysine in the diet did not affect dry matter intake of the pigs. The amount of nitrogen excreted was 47% of the nitrogen intake, of which 35% was excreted through feces and 65% through urine. The estimated endogenous losses of lysine were 36.4 mg kg-1 BW0.75. The maintenance requirement of lysine for pigs weighing around 50 kg is 40.4 mg kg-1 BW0.75, and the deposition efficiency of lysine is 90%.

  12. Topological dispositions of lysine α380 and lysine γ486 in the acetylcholine receptor from Torpedo californica

    International Nuclear Information System (INIS)

    Dwyer, B.P.

    1991-01-01

    The locations have been determined, with respect to the plasma membrane, of lysine α380 and lysine γ486 in the α subunit and the γ subunit, respectively, of the nicotinic acetylcholine receptor from Torpedo californica. Immunoadsorbents were constructed that recognize the carboxy terminus of the peptide GVKYIAE released by proteolytic digestion from positions 378-384 in the amino acid sequence of the α subunit of the acetylcholine receptor and the carboxy terminus of the peptide KYVP released by proteolytic digestion from positions 486-489 in the amino acid sequence of the γ subunit. They were used to isolate these peptides from proteolytic digests of polypeptides from the acetylcholine receptor. Sealed vesicles containing the native acetylcholine receptor were labeled with pyridoxal phosphate and sodium [ 3 H]-borohydride. The effect of saponin on the incorporation of pyridoxamine phosphate into lysine α380 and lysine γ486 from the acetylcholine receptor in these vesicles was assessed with the immunoadsorbents. The conclusions that follow from these results are that lysine α380 is on the inside surface of a vesicle and lysine γ486 is on the outside surface. Because a majority (85%) of the total binding sites for α-bungarotoxin bind the toxin in the absence of saponin, the majority of the vesicles are right side out with the inside of the vesicle corresponding to the cytoplasmic surface and the outside of the vesicle corresponding to the extracytoplasmic, synaptic surface. Because lysine α380 and lysine γ486 lie on opposite sides of the membrane, a membrane-spanning segment must be located between the two positions occupied by these two amino acids in the common sequence of a polypeptide of the acetylcholine receptor

  13. Global Analysis of Protein Lysine Succinylation Profiles and Their Overlap with Lysine Acetylation in the Marine Bacterium Vibrio parahemolyticus.

    Science.gov (United States)

    Pan, Jianyi; Chen, Ran; Li, Chuchu; Li, Weiyan; Ye, Zhicang

    2015-10-02

    Protein lysine acylation, including acetylation and succinylation, has been found to be a major post-translational modification (PTM) and is associated with the regulation of cellular processes that are widespread in bacteria. Vibrio parahemolyticus is a model marine bacterium that causes seafood-borne illness in humans worldwide. The lysine acetylation of V. parahemolyticus has been extensively characterized in our previous work, and here, we report the first global analysis of lysine succinylation and the overlap between the two types of acylation in this bacterium. Using high-accuracy nano liquid chromatography-tandem mass spectrometry combined with affinity purification, we identified 1931 lysine succinylated peptides matched on 642 proteins, with the quantity of the succinyl-proteins accounting for 13.3% of the total proteins in cells. Bioinformatics analysis results showed that these succinylated proteins are involved in almost every cellular process, particularly in protein biosynthesis and metabolism, and are distributed in diverse subcellular compartments. Moreover, several sequence motifs were identified, including succinyl-lysine flanked by a lysine or arginine residue at the -8, -7, or +7 position and without these residues at the -1 or +2 position, and these motifs differ from those found in other bacteria and eukaryotic cells. Furthermore, a total of 517 succinyl-lysine sites (26.7%) on 288 proteins (44.9%) were also found to be acetylated, suggesting extensive overlap between succinylation and acetylation in this bacterium. This systematic analysis provides a promising starting point for further investigations of the physiologic and pathogenic roles of lysine succinylation and acetylation in V. parahemolyticus.

  14. Calibration of the BASS acoustic current meter with carrageenan agar

    Science.gov (United States)

    Morrison, A.T.; Williams, A.J.; Martini, M.

    1993-01-01

    The BASS current meter can measure currents down to the millimeter per second range. Due to the dependence of zero offset on pressure, determining a sensor referenced velocity requires accurate in situ zeroing of the meter. Previously, flow was restricted during calibration by placing plastic bags around the acoustic volume. In this paper, bacterial grade and carrageenan agars are used in the laboratory to create a zero flow condition during calibration and are shown to be acoustically transparent. Additionally, the results of open ocean and dockside carrageenan and plastic bag comparisons are presented. Carrageenan is shown to reliably provide a low noise, zero mean flow environment that is largely independent of ambient conditions. The improved zeros make millimeter per second accuracy possible under field conditions.

  15. Localized hydroxylamine mutagenesis, and cotransduction of threonine and lysine genes, in Streptomyces venezuelae.

    Science.gov (United States)

    Stuttard, C

    1983-01-01

    A lysate of the generalized transducing phage SV1, grown on the prototrophic type strain 10712 of Streptomyces venezuelae, was mutagenized with hydroxylamine and used to transduce a lysineless auxotroph to lysine independence on supplemented minimal agar. A complex threonine mutant, strain VS95, was isolated from among the transductants and was shown to be carrying at least two different thr mutations. These were about 50% cotransducible with alleles of four independently isolated lysA mutations, as were two other independently isolated threonine mutations, thr-1 and hom-5. The location of thr genes close to lysA occurs in at least three other streptomycetes, but apparently not in Streptomyces coelicolor A3(2), in which the lysA and thr loci are at diametrically opposite locations on the linkage map. This first observation of cotransduction between loci governing the biosynthesis of different amino acids in the genus Streptomyces demonstrates the feasibility of fine-structure genetic analysis by transduction in these antibiotic-producing bacteria. PMID:6411685

  16. Quantification of Nε-(2-Furoylmethyl)-L-lysine (furosine), Nε-(Carboxymethyl)-L-lysine (CML), Nε-(Carboxyethyl)-L-lysine (CEL) and total lysine through stable isotope dilution assay and tandem mass spectrometry.

    Science.gov (United States)

    Troise, Antonio Dario; Fiore, Alberto; Wiltafsky, Markus; Fogliano, Vincenzo

    2015-12-01

    The control of Maillard reaction (MR) is a key point to ensure processed foods quality. Due to the presence of a primary amino group on its side chain, lysine is particularly prone to chemical modifications with the formation of Amadori products (AP), Nε-(Carboxymethyl)-L-lysine (CML), Nε-(Carboxyethyl)-L-lysine (CEL). A new analytical strategy was proposed which allowed to simultaneously quantify lysine, CML, CEL and the Nε-(2-Furoylmethyl)-L-lysine (furosine), the indirect marker of AP. The procedure is based on stable isotope dilution assay followed by liquid chromatography tandem mass spectrometry. It showed high sensitivity and good reproducibility and repeatability in different foods. The limit of detection and the RSD% were lower than 5 ppb and below 8%, respectively. Results obtained with the new procedure not only improved the knowledge about the reliability of thermal treatment markers, but also defined new insights in the relationship between Maillard reaction products and their precursors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Comparison of different fungal agar for the environmental monitoring of pharmaceutical-grade cleanrooms.

    Science.gov (United States)

    Gebala, Barbara; Sandle, Tim

    2013-01-01

    In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.

  18. EVALUACIÓN POR MÉTODO ECOMÉTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS

    Directory of Open Access Journals (Sweden)

    A. Villalobos

    2007-12-01

    Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.

  19. Effect of sulfur analogue of lysine on bacterial protein biosynthesis

    International Nuclear Information System (INIS)

    Tanaka, Hidehiko; Soda, Kenji.

    1976-01-01

    S-(beta-Aminoethyl)-L-cysteine, a sulfur analogue of lysine inhibited strongly growth of Escherichia coli A-19, and weakly that of Corynebacterium sp. isolated from soil, but did not inhibit growth of Aerobacter aerogenes. In Corynebacterium sp. the inhibitory effect was markedly enhanced in the presence of L-threonine. The inhibition of growth by S-(beta-aminoethyl)-L-cysteine was rapidly reversed by the addition of L-lysine. S-(beta-Aminoethyl)-L-cysteine inhibited protein synthesis and the activity of lysyl-tRNA synthetase from E. coli and A. aerogenes. All the other lysine analogues tested inhibited the activity of enzyme, but S-(beta-aminoethyl)-L-cysteine derivatives, S-(beta-N-acetyl-aminoethyl)-L-cysteine and S-(beta-aminoethyl)-alpha-N-acetyl-L-cysteine were not effective. (auth.)

  20. Small molecule inhibitors of bromodomain-acetyl-lysine interactions.

    Science.gov (United States)

    Brand, Michael; Measures, Angelina R; Measures, Angelina M; Wilson, Brian G; Cortopassi, Wilian A; Alexander, Rikki; Höss, Matthias; Hewings, David S; Rooney, Timothy P C; Paton, Robert S; Conway, Stuart J

    2015-01-16

    Bromodomains are protein modules that bind to acetylated lysine residues. Their interaction with histone proteins suggests that they function as "readers" of histone lysine acetylation, a component of the proposed "histone code". Bromodomain-containing proteins are often found as components of larger protein complexes with roles in fundamental cellular process including transcription. The publication of two potent ligands for the BET bromodomains in 2010 demonstrated that small molecules can inhibit the bromodomain-acetyl-lysine protein-protein interaction. These molecules display strong phenotypic effects in a number of cell lines and affect a range of cancers in vivo. This work stimulated intense interest in developing further ligands for the BET bromodomains and the design of ligands for non-BET bromodomains. Here we review the recent progress in the field with particular attention paid to ligand design, the assays employed in early ligand discovery, and the use of computational approaches to inform ligand design.

  1. Screening agars for MRSA: evaluation of a stepwise diagnostic approach with two different selective agars for the screening for methicillin-resistant Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen

    2015-01-01

    Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low

  2. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ²-lactamase. A total of 96.5% of ²-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 µgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 µgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 µgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 µgml-1 for cefoxitin, < 0.06 µgml-1 for cefotaxime, < 0.25 µgml-1 for norfloxacin, < 10 µgml-1 for cephaloridine, < 10 µgml-1 for cephalexin, and < 50 µgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucumán, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucumán since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  3. Heavy metal accumulation by carrageenan and agar producing algae

    Energy Technology Data Exchange (ETDEWEB)

    Burdin, K.S. [Moscow State Univ. (Russian Federation). Faculty of Biology; Bird, K.T. [North Carolina Univ., Wilmington, NC (United States). Center for Marine Science Research

    1994-09-01

    The accumulation of six heavy metals Cu, Cd, Ni, Zn, Mn and Pb was measured in living and lzophilized algal thalli. The agar producing algae were Gracilaria tikvahiae and Gelidium pusillum. The carrageenan producing macroalgae were Agardhiella subulata and the gametophyte and tetrasporophyte phases of Chondrus crispus. These produce primarily iota, kappa and lambda carrageenans, respectively. At heavy metal concentrations of 0.5 mg L{sup -1}, living thalli of Gracilaria tikvahiae generally showed the greatest amount of accumulation of the 6 heavy metals tested. The accumulation of Pb was greater in the living thalli of all four species than in the lyophilized thalli. Except for Agardhiella subulata, lyophilized thalli showed greater accumulation of Ni, Cu and Zn. There was no difference in heavy metal accumulation between living and lyophilized thalli in the accumulation of Cd. Manganese showed no accumulation at the tested concentration. There did not appear to be a relationship between algal hydrocolloid characteristics and the amounts of heavy metals accumulated. (orig.)

  4. Structural aspects of the solvation shell of lysine and acetylated lysine: A Car-Parrinello and classical molecular dynamics investigation

    International Nuclear Information System (INIS)

    Carnevale, V.; Raugei, S.

    2009-01-01

    Lysine acetylation is a post-translational modification, which modulates the affinity of protein-protein and/or protein-DNA complexes. Its crucial role as a switch in signaling pathways highlights the relevance of charged chemical groups in determining the interactions between water and biomolecules. A great effort has been recently devoted to assess the reliability of classical molecular dynamics simulations in describing the solvation properties of charged moieties. In the spirit of these investigations, we performed classical and Car-Parrinello molecular dynamics simulations on lysine and acetylated-lysine in aqueous solution. A comparative analysis between the two computational schemes is presented with a focus on the first solvation shell of the charged groups. An accurate structural analysis unveils subtle, yet statistically significant, differences which are discussed in connection to the significant electronic density charge transfer occurring between the solute and the surrounding water molecules.

  5. Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.

    Science.gov (United States)

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F

    2012-12-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  6. Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7

    OpenAIRE

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.

    2012-01-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  7. Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme

    Directory of Open Access Journals (Sweden)

    Murdinah murdinah

    2008-06-01

    Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121°C dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.

  8. Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.

    Science.gov (United States)

    Chang, S S; Park, S H; Kang, D H

    2013-06-03

    The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms

    NARCIS (Netherlands)

    Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart

    2016-01-01

    Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.

  10. Therapeutic use of chimeric bacteriophage (phage) lysins in staphylococcal endophthalmitis

    Science.gov (United States)

    Purpose: Phage endolysins are peptidoglycan hydrolases that are produced at the end of the phage lytic cycle to digest the host bacterial cell wall, facilitating the release of mature phage progeny. The aim of this study is to determine the antimicrobial activity of chimeric phage lysins against cli...

  11. protein, tryptophan and lysine contents in quality protien maize

    African Journals Online (AJOL)

    owner

    From the human nutrition view point, lysine is the ... latitude and 79.3°E longitude and at an altitude of ... transferred to boiling tubes. ... mixtures were heated until the color changes to ... water was added into the digestion tube carefully.

  12. Lysine metabolism in antisense C-hordein barley grains

    DEFF Research Database (Denmark)

    Schmidt, Daiana; Rizzi, Vanessa; Gaziola, Salete A

    2015-01-01

    The grain proteins of barley are deficient in lysine and threonine due to their low concentrations in the major storage protein class, the hordeins, especially in the C-hordein subgroup. Previously produced antisense C-hordein transgenic barley lines have an improved amino acid composition, with ...

  13. Predicting post-translational lysine acetylation using support vector machines

    DEFF Research Database (Denmark)

    Gnad, Florian; Ren, Shubin; Choudhary, Chunaram

    2010-01-01

    spectrometry to identify 3600 lysine acetylation sites on 1750 human proteins covering most of the previously annotated sites and providing the most comprehensive acetylome so far. This dataset should provide an excellent source to train support vector machines (SVMs) allowing the high accuracy in silico...

  14. Effect of Low Protein-Methionine-and-Lysine-Supplemented Diets ...

    African Journals Online (AJOL)

    Two experiments were conducted to investigate the effect of supplementing low CP diets with methionine and lysine on broiler performance, carcass measure and their immune response against Infectious Bursa Disease (IBD) virus. In Experiment 1, ten diets were formulated. Diet 1 (control diet) contained 23.0% CP and ...

  15. Uptake of tritiated lysine by fresh water alga, Scenedesmus obliquus

    International Nuclear Information System (INIS)

    Gogate, S.S.; Krishnamoorthy, T.M.

    1983-01-01

    Tritium uptake by fresh water alga. S.obliquus was studied using tritium labelled lysine, and a sequential solvent extraction procedure was used to study the distribution of tritium in different organic constituents of the algal cells. The accumulation of tritium in the algal cells was found to be 3-4 orders of magnitude more than that obtained for tritiated water. (author)

  16. Detection of salt bridges to lysines in solution in barnase

    DEFF Research Database (Denmark)

    Hansen, Poul Erik; Williamson, Michael P.; Hounslow, Andrea M.

    2013-01-01

    We show that salt bridges involving lysines can be detected by deuterium isotope effects on NMR chemical shifts of the sidechain amine. Lys27 in the ribonuclease barnase is salt bridged, and mutation of Arg69 to Lys retains a partially buried salt bridge. The salt bridges are functionally important....

  17. Effect of low protein diets and lysine supplementation on growth ...

    African Journals Online (AJOL)

    The present study was to assess the effect of feeding low protein diet with or without supplemental lysine to meet NRC (1998) requirement on growth performance, carcass trait, meat composition, and meat quality of pigs. An experiment of 126 days was conducted on 21 crossbred Landrace pigs (average weight 11.72 ...

  18. Lysine-Grafted MCM-41 Silica as an Antibacterial Biomaterial.

    Science.gov (United States)

    Villegas, María F; Garcia-Uriostegui, Lorena; Rodríguez, Ofelia; Izquierdo-Barba, Isabel; Salinas, Antonio J; Toriz, Guillermo; Vallet-Regí, María; Delgado, Ezequiel

    2017-09-26

    This paper proposes a facile strategy for the zwitterionization of bioceramics that is based on the direct incorporation of l-lysine amino acid via the ε-amino group onto mesoporous MCM-41 materials. Fourier transform infrared (FTIR) studies of lysine-grafted MCM-41 (MCM-LYS) simultaneously showed bands at 3080 and 1540 cm -1 and bands at 1625 and 1415 cm -1 corresponding to -NH 3+ /COO - pairs, which demonstrate the incorporation of the amino acid on the material surface keeping its zwitterionic character. Both elemental and thermogravimetric analyses showed that the amount of grafted lysine was 8 wt. % based on the bioceramic total weight. Moreover, MCM-LYS exhibited a reduction of adhesion of S. aureus and E. coli bacteria in 33% and 50%, respectively at physiological pH, as compared with pristine MCM-41. Biofilm studies onto surfaces showed that lysine functionalization elicited a reduction of the area covered by S. aureus biofilm from 42% to only 5% (88%). This research shows a simple and effective approach to chemically modify bioceramics using single amino acids that provides zwitterionic functionality, which is useful to develop new biomaterials that are able to resist bacterial adhesion.

  19. Amino acid nutrition beyond methionine and lysine for milk protein

    Science.gov (United States)

    Amino acids are involved in many important physiological processes affecting the production, health, and reproduction of high-producing dairy cows. Most research and recommendations for lactating dairy cows has focused on methionine and lysine for increasing milk protein yield. This is because these...

  20. Lysine-Grafted MCM-41 Silica as an Antibacterial Biomaterial

    Directory of Open Access Journals (Sweden)

    María F. Villegas

    2017-09-01

    Full Text Available This paper proposes a facile strategy for the zwitterionization of bioceramics that is based on the direct incorporation of l-lysine amino acid via the ε-amino group onto mesoporous MCM-41 materials. Fourier transform infrared (FTIR studies of lysine-grafted MCM-41 (MCM-LYS simultaneously showed bands at 3080 and 1540 cm−1 and bands at 1625 and 1415 cm−1 corresponding to -NH3+/COO− pairs, which demonstrate the incorporation of the amino acid on the material surface keeping its zwitterionic character. Both elemental and thermogravimetric analyses showed that the amount of grafted lysine was 8 wt. % based on the bioceramic total weight. Moreover, MCM-LYS exhibited a reduction of adhesion of S. aureus and E. coli bacteria in 33% and 50%, respectively at physiological pH, as compared with pristine MCM-41. Biofilm studies onto surfaces showed that lysine functionalization elicited a reduction of the area covered by S. aureus biofilm from 42% to only 5% (88%. This research shows a simple and effective approach to chemically modify bioceramics using single amino acids that provides zwitterionic functionality, which is useful to develop new biomaterials that are able to resist bacterial adhesion.

  1. Effect Of Sprouting On Available Lysine Content Of Cowpea ( Vigna ...

    African Journals Online (AJOL)

    This study was conducted to determine the effect of sprouting on available Lysine content of cowpea (Vigna unguiculata) flour and the performance of the flour used for producing “moi – moi” (steamed bean cake). Cowpea seed was subjected to sprouting for different periods of 1 day, 2 days and 3 days for samples B, C and ...

  2. Lysine-vasopressin analogues with glycoconjugates in position 8

    Czech Academy of Sciences Publication Activity Database

    Marcinkowska, A.; Borovičková, Lenka; Slaninová, Jiřina; Grzonka, Z.

    2006-01-01

    Roč. 80, č. 5 (2006), s. 759-766 ISSN 0137- 5083 Institutional research plan: CEZ:AV0Z40550506 Keywords : glycoconjugates * glycopeptides * lysine-vasopressin analogues Subject RIV: CC - Organic Chemistry Impact factor: 0.491, year: 2006

  3. Optimization of lysine production in Corynebacteriumglutamicum ATCC15032 by Response surface methodology

    Directory of Open Access Journals (Sweden)

    Mehrnaz Haghi

    2017-03-01

    Discussion and conclusion: According to the results, the proposed culture media by response surface methodology causes 1400 times increase in the lysine production compared with M9 culture media and methionine had an important role in the production of lysine, probably by inhibiting the other metabolic pathway which has common metabolic precursor with lysine production metabolic pathway.

  4. Antimicrobial activity of bovine NK-lysin-derived peptides on bovine respiratory pathogen Histophilus somni

    Science.gov (United States)

    Bovine NK-lysins, which are functionally and structurally similar to human granulysin and porcine NK-lysin, are predominantly found in the granules of cytotoxic T-lymphocytes and NK-cells. Although antimicrobial activity of bovine NK-lysin has been assessed for several bacterial pathogens, not all t...

  5. The biology of lysine acetylation integrates transcriptional programming and metabolism

    Directory of Open Access Journals (Sweden)

    Mujtaba Shiraz

    2011-03-01

    Full Text Available Abstract The biochemical landscape of lysine acetylation has expanded from a small number of proteins in the nucleus to a multitude of proteins in the cytoplasm. Since the first report confirming acetylation of the tumor suppressor protein p53 by a lysine acetyltransferase (KAT, there has been a surge in the identification of new, non-histone targets of KATs. Added to the known substrates of KATs are metabolic enzymes, cytoskeletal proteins, molecular chaperones, ribosomal proteins and nuclear import factors. Emerging studies demonstrate that no fewer than 2000 proteins in any particular cell type may undergo lysine acetylation. As described in this review, our analyses of cellular acetylated proteins using DAVID 6.7 bioinformatics resources have facilitated organization of acetylated proteins into functional clusters integral to cell signaling, the stress response, proteolysis, apoptosis, metabolism, and neuronal development. In addition, these clusters also depict association of acetylated proteins with human diseases. These findings not only support lysine acetylation as a widespread cellular phenomenon, but also impel questions to clarify the underlying molecular and cellular mechanisms governing target selectivity by KATs. Present challenges are to understand the molecular basis for the overlapping roles of KAT-containing co-activators, to differentiate between global versus dynamic acetylation marks, and to elucidate the physiological roles of acetylated proteins in biochemical pathways. In addition to discussing the cellular 'acetylome', a focus of this work is to present the widespread and dynamic nature of lysine acetylation and highlight the nexus that exists between epigenetic-directed transcriptional regulation and metabolism.

  6. Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.

    Science.gov (United States)

    Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon

    2017-07-01

    Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.

  7. AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM

    Directory of Open Access Journals (Sweden)

    SIEW-LING HII

    2016-07-01

    Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.

  8. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.

    Science.gov (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong

    2015-01-01

    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  9. utilization of ensiled metabolizable mixture of cassava peel and caged

    African Journals Online (AJOL)

    Toluwande

    2011-09-05

    Sep 5, 2011 ... treatment ad libitum for 56 days, divided into starter phase (0 to 28 days) and .... Enterobacterium was determined using desoxycholate citrate agar lactose (DCL) ... C. Clostridium was determined after its heat activation at.

  10. PLMD: An updated data resource of protein lysine modifications.

    Science.gov (United States)

    Xu, Haodong; Zhou, Jiaqi; Lin, Shaofeng; Deng, Wankun; Zhang, Ying; Xue, Yu

    2017-05-20

    Post-translational modifications (PTMs) occurring at protein lysine residues, or protein lysine modifications (PLMs), play critical roles in regulating biological processes. Due to the explosive expansion of the amount of PLM substrates and the discovery of novel PLM types, here we greatly updated our previous studies, and presented a much more integrative resource of protein lysine modification database (PLMD). In PLMD, we totally collected and integrated 284,780 modification events in 53,501 proteins across 176 eukaryotes and prokaryotes for up to 20 types of PLMs, including ubiquitination, acetylation, sumoylation, methylation, succinylation, malonylation, glutarylation, glycation, formylation, hydroxylation, butyrylation, propionylation, crotonylation, pupylation, neddylation, 2-hydroxyisobutyrylation, phosphoglycerylation, carboxylation, lipoylation and biotinylation. Using the data set, a motif-based analysis was performed for each PLM type, and the results demonstrated that different PLM types preferentially recognize distinct sequence motifs for the modifications. Moreover, various PLMs synergistically orchestrate specific cellular biological processes by mutual crosstalks with each other, and we totally found 65,297 PLM events involved in 90 types of PLM co-occurrences on the same lysine residues. Finally, various options were provided for accessing the data, while original references and other annotations were also present for each PLM substrate. Taken together, we anticipated the PLMD database can serve as a useful resource for further researches of PLMs. PLMD 3.0 was implemented in PHP + MySQL and freely available at http://plmd.biocuckoo.org. Copyright © 2017 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  11. Acetylation site specificities of lysine deacetylase inhibitors in human cells

    DEFF Research Database (Denmark)

    Schölz, Christian; Weinert, Brian Tate; Wagner, Sebastian A

    2015-01-01

    Lysine deacetylases inhibitors (KDACIs) are used in basic research, and many are being investigated in clinical trials for treatment of cancer and other diseases. However, their specificities in cells are incompletely characterized. Here we used quantitative mass spectrometry (MS) to obtain acety......1-α, providing a possible mechanistic explanation of its adverse, pro-inflammatory effects. Our results offer a systems view of KDACI specificities, providing a framework for studying function of acetylation and deacetylases....

  12. Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)

    2010-11-05

    Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.

  13. Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)

    1997-04-01

    Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.

  14. A radiobiological comparison of human tumor soft-agar clonogenic assays.

    Science.gov (United States)

    West, C M; Sutherland, R M

    1986-06-15

    Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.

  15. Effect of Red Seaweed Polysaccharides Agar (Gracilaria changii) on Thermal Properties and Microstructure of Wheat Starch

    International Nuclear Information System (INIS)

    Faizal, P.K.

    2009-01-01

    This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (ΔH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (ΔH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)

  16. Methodical investigations on the determination of metabolic lysine requirements in broiler chickens. 1

    International Nuclear Information System (INIS)

    Bergner, H.; Nguyen Thi Nhan; Wilke, A.

    1987-01-01

    For the estimation of lysine requirement 128 male broiler chickens were used at an age of 7 to 21 days posthatching. They received a lysine-deficient diet composed of wheat and wheat gluten. To this basal diet L-lysine-HCL was supplemented successively resulting in 8 lysine levels ranging from 5.8 to 23.3 g lysine per kg dry matter (DM) (2.2 to 8.7 g lysine per 16 g N). At the end of the two-week feeding period of the experimental diets 14 C-lysine was injected intravenously 1.5 and 5.5 hours after feed withdrawal. During the following 4 hours the exretion of CO 2 and 14 CO 2 was measured. The highest daily gain of 21.5 g was observed in animals fed 13.3 g lysine-kg DM. Lysine concentrations exceeding 18.3 g/kg DM depressed body weight gain. The CO 2 excretion was not influenced by lysine intake. 14 CO 2 excretion was low with diets low in lysine content and increased 3 to 4 times with diets meeting the lysine requirement. Based on measurements 1.5 to 5.5 hours after feed withdrawal the saturation value for lysine was reached at 13.3 g/kg DM. This value was lowered (10.8 g/kg DM), however, if the estimation was carried out 5.5 to 9.5 hours after feed withdrawal. These results suggest a higher metabolic lysine requirement during the earlier period after feed intake. Both, reduced weight gain and non linearity in 14 CO 2 excretion in diets exceeding a lysine content of 18.3 g/kg DM indicate a limited capacity of the organism to degrade excessive lysine. According to the results a lysine requirement betwen 10.8 and 13.3 g/kg DM (27% CP and 660 EFU/sub hen//kg DM) was estimated for broiler chickens 3 weeks posthatching. (author)

  17. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    Directory of Open Access Journals (Sweden)

    Marol Serhat

    2003-10-01

    Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  18. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.

    Science.gov (United States)

    Yücesoy, Mine; Marol, Serhat

    2003-10-29

    The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  19. Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development

    Directory of Open Access Journals (Sweden)

    Wahyu Ramadhan

    2017-04-01

    Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that  the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g – 35.76 g/100 g, color intensity L*, a*, b* with ΔE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.

  20. Glycated Lysine Residues: A Marker for Non-Enzymatic Protein Glycation in Age-Related Diseases

    Directory of Open Access Journals (Sweden)

    Nadeem A. Ansari

    2011-01-01

    Full Text Available Nonenzymatic glycosylation or glycation of macromolecules, especially proteins leading to their oxidation, play an important role in diseases. Glycation of proteins primarily results in the formation of an early stage and stable Amadori-lysine product which undergo further irreversible chemical reactions to form advanced glycation endproducts (AGEs. This review focuses these products in lysine rich proteins such as collagen and human serum albumin for their role in aging and age-related diseases. Antigenic characteristics of glycated lysine residues in proteins together with the presence of serum autoantibodies to the glycated lysine products and lysine-rich proteins in diabetes and arthritis patients indicates that these modified lysine residues may be a novel biomarker for protein glycation in aging and age-related diseases.

  1. Conformational Studies of ε- CBz- L- Lysine and L- Valine Block Copolypeptides

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    2010-01-01

    Full Text Available Conformational studies of ε-CBz-L-lysine and L-valine block copoylpeptides using x- ray diffraction and CD spectra are described. The block copolypeptides contain valine block in the center and on both side of the valine are ε-CBz-L-lysine blocks. The conformation of the copolypeptides changes with increases in the chain length of ε- CBz-L- lysine blocks. When length of ε- CBZ- L- lysine blocks is 9, the block copolypeptide has exclusive beta sheet structure. With the increase in chain length of ε-CBz-L-lysine blocks from 9 to 14, the block copolypeptide shows presence of both alpha helix and beta sheet components. With further increase in chain length of ε- CBz- L- lysine blocks, the beta sheet component disappears and block copolypeptides exhibits exclusive α -helix conformation.

  2. Comparison of selective agars recommended by method ISO 11290-1 and chromogenic agars for the isolation of Listeria sp. in refrigerated sausages

    Directory of Open Access Journals (Sweden)

    Thalyta Marina Benetti

    2012-12-01

    Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at

  3. Novel α-Oxoamide Advanced-Glycation Endproducts within the N6-Carboxymethyl Lysine and N6-Carboxyethyl Lysine Reaction Cascades.

    Science.gov (United States)

    Baldensperger, Tim; Jost, Tobias; Zipprich, Alexander; Glomb, Marcus A

    2018-02-28

    The highly reactive α-dicarbonyl compounds glyoxal and methylglyoxal are major precursors of posttranslational protein modifications in vivo. Model incubations of N 2 -t-Boc-lysine and either glyoxal or methylglyoxal were used to further elucidate the underlying mechanisms of the N 6 -carboxymethyl lysine and N 6 -carboxyethyl lysine reaction cascades. After independent synthesis of the authentic reference standards, we were able to detect N 6 -glyoxylyl lysine and N 6 -pyruvoyl lysine for the first time by HPLC-MS 2 analyses. These two novel amide advanced-glycation endproducts were exclusively formed under aerated conditions, suggesting that they were potent markers for oxidative stress. Analogous to the well-known Strecker degradation pathway, leading from amino acids to Strecker acids, the oxidation of an enaminol intermediate is suggested to be the key mechanistic step. A highly sensitive workup for the determination of AGEs in tissues was developed. In support of our hypothesis, the levels of N 6 -glyoxylyl lysine and N 6 -pyruvoyl lysine in rat livers indeed correlated with liver cirrhosis and aging.

  4. Histidine-lysine peptides as carriers of nucleic acids.

    Science.gov (United States)

    Leng, Qixin; Goldgeier, Lisa; Zhu, Jingsong; Cambell, Patricia; Ambulos, Nicholas; Mixson, A James

    2007-03-01

    With their biodegradability and diversity of permutations, peptides have significant potential as carriers of nucleic acids. This review will focus on the sequence and branching patterns of peptide carriers composed primarily of histidines and lysines. While lysines within peptides are important for binding to the negatively charged phosphates, histidines are critical for endosomal lysis enabling nucleic acids to reach the cytosol. Histidine-lysine (HK) polymers by either covalent or ionic bonds with liposomes augment transfection compared to liposome carriers alone. More recently, we have examined peptides as sole carriers of nucleic acids because of their intrinsic advantages compared to the bipartite HK/liposome carriers. With a protocol change and addition of a histidine-rich tail, HK peptides as sole carriers were more effective than liposomes alone in several cell lines. While four-branched polymers with a primary repeating sequence pattern of -HHK- were more effective as carriers of plasmids, eight-branched polymers with a sequence pattern of -HHHK- were more effective as carriers of siRNA. Compared to polyethylenimine, HK carriers of siRNA and plasmids had reduced toxicity. When injected intravenously, HK polymers in complex with plasmids encoding antiangiogenic proteins significantly decreased tumor growth. Furthermore, modification of HK polymers with polyethylene glycol and vascular-specific ligands increased specificity of the polyplex to the tumor by more than 40-fold. Together with further development and insight on the structure of HK polyplexes, HK peptides may prove to be useful as carriers of different forms of nucleic acids both in vitro and in vivo.

  5. Beyond Histones: New Substrate Proteins of Lysine Deacetylases in Arabidopsis Nuclei

    Directory of Open Access Journals (Sweden)

    Magdalena Füßl

    2018-04-01

    Full Text Available The reversible acetylation of lysine residues is catalyzed by the antagonistic action of lysine acetyltransferases and deacetylases, which can be considered as master regulators of their substrate proteins. Lysine deacetylases, historically referred to as histone deacetylases, have profound functions in regulating stress defenses and development in plants. Lysine acetylation of the N-terminal histone tails promotes gene transcription and decondensation of chromatin, rendering the DNA more accessible to the transcription machinery. In plants, the classical lysine deacetylases from the RPD3/HDA1-family have thus far mainly been studied in the context of their deacetylating activities on histones, and their versatility in molecular activities is still largely unexplored. Here we discuss the potential impact of lysine acetylation on the recently identified nuclear substrate proteins of lysine deacetylases from the Arabidopsis RPD3/HDA1-family. Among the deacetylase substrate proteins, many interesting candidates involved in nuclear protein import, transcriptional regulation, and chromatin remodeling have been identified. These candidate proteins represent key starting points for unraveling new molecular functions of the Arabidopsis lysine deacetylases. Site-directed engineering of lysine acetylation sites on these target proteins might even represent a new approach for optimizing plant growth under climate change conditions.

  6. Minoxidil specifically decreases the expression of lysine hydroxylase in cultured human skin fibroblasts.

    Science.gov (United States)

    Hautala, T; Heikkinen, J; Kivirikko, K I; Myllylä, R

    1992-01-01

    The levels of lysine hydroxylase protein and the levels of the mRNAs for lysine hydroxylase and the alpha- and beta-subunits of proline 4-hydroxylase were measured in cultured human skin fibroblasts treated with 1 mM-minoxidil. The data demonstrate that minoxidil decreases the amount of lysine hydroxylase protein, this being due to a decrease in the level of lysine hydroxylase mRNA. The effect of minoxidil appears to be highly specific, as no changes were observed in the amounts of mRNAs for the alpha- and beta-subunits of proline 4-hydroxylase. Images Fig. 1. Fig. 2. Fig. 3. PMID:1314568

  7. Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.

    Science.gov (United States)

    Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena

    2015-05-01

    Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (ε'), loss factor (ε"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 °C. The ε' and ε" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m °C, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 °C in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. © 2015 Institute of Food Technologists®

  8. Antimicrobial and physical-mechanical properties of agar-based films incorporated with grapefruit seed extract.

    Science.gov (United States)

    Kanmani, Paulraj; Rhim, Jong-Whan

    2014-02-15

    The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 μg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Strategies to improve the mechanical strength and water resistance of agar films for food packaging applications.

    Science.gov (United States)

    Sousa, Ana M M; Gonçalves, Maria P

    2015-11-05

    Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Time domain NMR study of Agar-gelatin blends; Estudo por RMN no dominio do tempo de blendas de Agar- gelatina

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica

    2015-07-01

    This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)

  11. Solution Thermodynamics of Lysine Clonixinate in Some Ethanol + Water Mixtures

    OpenAIRE

    Delgado, Daniel R.; Martínez, Fleming; Gutiérrez, Rahumir A.

    2012-01-01

    The solubility of lysine clonixinate (LysClon) in several ethanol + water mixtures was determined at 293.15 to 313.15 K. The thermodynamic functions, Gibbs energy, enthalpy, and entropy of solution and of mixing were obtained from these solubility data by using the van’t Hoff and Gibbs equations. In general this drug exhibit good solubility and the greatest value was obtained in the mixture 0.60 in mass fraction of ethanol. A non-linear enthalpy–entropy relationship was observed from ...

  12. High-throughput screening to identify inhibitors of lysine demethylases.

    Science.gov (United States)

    Gale, Molly; Yan, Qin

    2015-01-01

    Lysine demethylases (KDMs) are epigenetic regulators whose dysfunction is implicated in the pathology of many human diseases including various types of cancer, inflammation and X-linked intellectual disability. Particular demethylases have been identified as promising therapeutic targets, and tremendous efforts are being devoted toward developing suitable small-molecule inhibitors for clinical and research use. Several High-throughput screening strategies have been developed to screen for small-molecule inhibitors of KDMs, each with advantages and disadvantages in terms of time, cost, effort, reliability and sensitivity. In this Special Report, we review and evaluate the High-throughput screening methods utilized for discovery of novel small-molecule KDM inhibitors.

  13. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  14. Effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of stone casts.

    Science.gov (United States)

    Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru

    2007-05-01

    This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.

  15. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    2015-01-01

    Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  16. Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo J. Licea Moreno

    2001-04-01

    Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture

  17. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  18. Selection and Characterization of a Lysine Yielding Mutant of Corynebacterium glutamicum - a Soil Isolate from Pakistan

    Directory of Open Access Journals (Sweden)

    Habib-ur-Rehman§٭, Abdul Hameed and Safia Ahmed

    2012-01-01

    Full Text Available L-lysine is the second limiting amino acid for poultry and supplemented in broiler feed for optimal performance. Lysine can be produced by inducing mutation in glutamate producing bacteria. The study was conducted to enhance lysine production from a local strain of Corynebacterium glutamicum. The bacterium was mutated by exposure to UV. Mutants resistant to s-2-aminoethyle L-cystein (AEC and showing auxotrophy for L-homoserine were screened for lysine production qualitatively and quantitatively. A mutant showing highest production of lysine (8.2 mg/mL was selected for optimization of physical and nutritional parameters for maximum production of lysine in shake flask. An initial pH 7.6, 30˚C temperature, 300 rpm and 60 h incubation time were the optimized values of physical requirements. Cane molasses and corn starch hydrolysate were required at 15% (w/v in the fermentation media which provided around 9% total sugars to produce maximum lysine (17 to 18 mg/mL. When amonium sulphate was used at 3.5% (w/v level in molasses or corn starch hydrolysate based fermentation media, production of lysine slightly increased above 18 mg/mL. It is concluded that industrial by products like cane molasses, corn steep liquor, and corn starch hydrolysate can be used as carbon and organic nitrogen sources in fermentation medium for scale up process of lysine production and this lysine enriched broth may be used in broiler feed later. However, more potent lysine producing mutant and additional in vivo trials would be required to commercialize this product.

  19. Radiation effects on agar, alginates and carrageenan to be used as food additives

    International Nuclear Information System (INIS)

    Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del

    2000-01-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  20. Radiation effects on agar, alginates and carrageenan to be used as food additives

    Energy Technology Data Exchange (ETDEWEB)

    Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del

    2000-03-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  1. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    Science.gov (United States)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  2. Comparison of Sabouraud dextrose and Pagano-Levin agar media for detection and isolation of yeasts from oral samples.

    OpenAIRE

    Samaranayake, L P; MacFarlane, T W; Williamson, M I

    1987-01-01

    The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...

  3. Effect of irradiation on Nε-carboxymethyl-lysine and Nε-carboxyethyl-lysine formation in cooked meat products during storage

    International Nuclear Information System (INIS)

    Yu, Ligang; He, Zhiyong; Zeng, Maomao; Zheng, Zongping; Chen, Jie

    2016-01-01

    This study investigated the effects of irradiation on N ε -carboxymethyl-lysine (CML) and N ε -carboxyethyl-lysine (CEL) formation in cooked red and white meats during storage. The results showed that irradiation did not affect CML/CEL formation (0 weeks). After 6 weeks, CML/CEL contents in the irradiated samples exhibited a higher growth rate than the non-irradiated samples, especially the red meat. The results of electron spin resonance spectrometry and 2-Thiobarbituric acid-reactive substances suggested irradiation had induced free-radical reactions and accelerated lipid oxidation during storage. A linear correlation (r=0.810–0.906, p<0.01) was found between the loss of polyunsaturated fatty acids content and increase of CML/CEL content in the irradiated samples after 0 and 6 weeks of storage. The results indicate that irradiation-induced lipid oxidation promotes CML/CEL formation, and CML/CEL formation by the lipid oxidation pathways may be an important pathway for CML/CEL accumulation in irradiated meat products during storage. - Highlights: • The effect of irradiation on CML and CEL formation in meat products is investigated. • CML and CEL contents in irradiated meat products exhibit a higher growth rate than non-irradiated samples. • PUFAs oxidation induced by irradiation promotes CML and CEL formation. • Lipid oxidation pathways are an important pathway for CML and CEL accumulation in irradiated samples during storage.

  4. Nε-(carboxymethyl)lysine and Nε-(carboxyethyl)lysine in tea and the factors affecting their formation.

    Science.gov (United States)

    Jiao, Ye; He, Jialiang; Li, Fengli; Tao, Guanjun; Zhang, Shuang; Zhang, Shikang; Qin, Fang; Zeng, Maomao; Chen, Jie

    2017-10-01

    The levels of N ε -(carboxymethyl)lysine (CML) and N ε -(carboxyethyl)lysine (CEL) in 99 tea samples from 14 geographic regions, including 44 green, 7 oolong, 41 black, and 7 dark teas were determined by liquid chromatography-tandem mass spectrometry (LC-MS/MS). The CML and CEL contents varied from 11.0 to 1701μg/g tea and 4.6 to 133μg/g tea, respectively. Dark tea presented the highest levels of CML and CEL, whereas green and oolong teas presented the lowest levels. Five kinds of catechins in the tea were also analyzed, and spearman's correlation coefficients showed that all the catechins negatively correlated with CML and CEL. The results suggested that withering, fermentation and pile fermentation may facilitate the formation of CML and CEL. Catechins might inhibit the formation of CML and CEL, but their inhibitory effects may be affected by tea processing. The results of this study are useful for the production of healthier tea. Copyright © 2017. Published by Elsevier Ltd.

  5. Fortification of lysine for improving protein quality in multiple-fortified quick cooking rice : Review

    NARCIS (Netherlands)

    Wongmetinee, T.; Boonstra, A.; Zimmermann, M.B.; Chavasit, V.

    2009-01-01

    Previous studies in Thailand indicated that rice-based complementary foods of breast-fed infants normally provided inadequate iron and calcium. Quick-cooking rice fortified with different nutrients was therefore developed. The idea of lysine fortification was based on the fact that lysine is a

  6. Widespread occurrence of lysine methylation in Plasmodium falciparum proteins at asexual blood stages.

    Science.gov (United States)

    Kaur, Inderjeet; Zeeshan, Mohammad; Saini, Ekta; Kaushik, Abhinav; Mohmmed, Asif; Gupta, Dinesh; Malhotra, Pawan

    2016-10-20

    Post-transcriptional and post-translational modifications play a major role in Plasmodium life cycle regulation. Lysine methylation of histone proteins is well documented in several organisms, however in recent years lysine methylation of proteins outside histone code is emerging out as an important post-translational modification (PTM). In the present study we have performed global analysis of lysine methylation of proteins in asexual blood stages of Plasmodium falciparum development. We immunoprecipitated stage specific Plasmodium lysates using anti-methyl lysine specific antibodies that immunostained the asexual blood stage parasites. Using liquid chromatography and tandem mass spectrometry analysis, 570 lysine methylated proteins at three different blood stages were identified. Analysis of the peptide sequences identified 605 methylated sites within 422 proteins. Functional classification of the methylated proteins revealed that the proteins are mainly involved in nucleotide metabolic processes, chromatin organization, transport, homeostatic processes and protein folding. The motif analysis of the methylated lysine peptides reveals novel motifs. Many of the identified lysine methylated proteins are also interacting partners/substrates of PfSET domain proteins as revealed by STRING database analysis. Our findings suggest that the protein methylation at lysine residues is widespread in Plasmodium and plays an important regulatory role in diverse set of the parasite pathways.

  7. Comprehensive Proteomic Analysis of Lysine Acetylation in the Foodborne Pathogen Trichinella spiralis

    Directory of Open Access Journals (Sweden)

    Yong Yang

    2018-01-01

    Full Text Available Lysine acetylation is a dynamic and highly conserved post-translational modification that plays a critical role in regulating diverse cellular processes. Trichinella spiralis is a foodborne parasite with a considerable socio-economic impact. However, to date, little is known regarding the role of lysine acetylation in this parasitic nematode. In this study, we utilized a proteomic approach involving anti-acetyl lysine-based enrichment and highly sensitive mass spectrometry to identify the global acetylated proteome and investigate lysine acetylation in T. spiralis. In total, 3872 lysine modification sites were identified in 1592 proteins that are involved in a wide variety of biological processes. Consistent with the results of previous studies, a large number of the acetylated proteins appear to be involved in metabolic and biosynthetic processes. Interestingly, according to the functional enrichment analysis, 29 acetylated proteins were associated with phagocytosis, suggesting an important role of lysine acetylation in this process. Among the identified proteins, 15 putative acetylation motifs were detected. The presence of serine downstream of the lysine acetylation site was commonly observed in the regions surrounding the sites. Moreover, protein interaction network analysis revealed that various interactions are regulated by protein acetylation. These data represent the first report of the acetylome of T. spiralis and provide an important resource for further explorations of the role of lysine acetylation in this foodborne pathogen.

  8. Antimicrobial activity of bovine NK-lysin-derived peptides on Mycoplasma bovis

    Science.gov (United States)

    Antimicrobial peptides (AMPs) are a diverse group of molecules which play an important role in the innate immune response. Bovine NK-lysins, a type of AMP, have been predominantly found in the granules of cytotoxic T-lymphocytes and NK-cells. Bovine NK-lysin-derived peptides demonstrate antimicrobia...

  9. Effect of Selected Plant Extracts and D- and L-Lysine on the Cyanobacterium Microcystis aeruginosa

    NARCIS (Netherlands)

    Lurling, M.F.L.L.W.; Oosterhout, J.F.X.

    2014-01-01

    We tested extracts from Fructus mume, Salvia miltiorrhiza and Moringa oleifera as well as L-lysine and D-Lysine as curative measures to rapidly suppress the cyanobacterium Microcystis aeruginosa NIVA-CYA 43. We tested these compounds under similar conditions to facilitate comparisons. We

  10. Structural Basis of Histone Demethylase KDM6B Histone 3 Lysine 27 Specificity

    DEFF Research Database (Denmark)

    Jones, Sarah E; Olsen, Lars; Gajhede, Michael

    2018-01-01

    KDM subfamily 6 enzymes KDM6A and KDM6B specifically catalyze demethylation of di- and trimethylated lysine on histone 3 lysine 27 (H3K27me3/2) and play an important role in repression of developmental genes. Despite identical amino acid sequence in the immediate surroundings of H3K9me3/2 (ARKS...

  11. An Update on Lysine Deacylases Targeting the Expanding “Acylome”

    DEFF Research Database (Denmark)

    Olsen, Christian Adam

    2013-01-01

    Lysine e-amino acetylation has long been recognized as an epigenetically relevant post-translational modification of multiple residues in histone proteins. However, it has become clear that lysine acetylation is not restricted to histones, and therefore, it may be involved in the regulation of a ...

  12. Lysine Rich Proteins in the Salt-Soluble Protein Fraction of Barley

    DEFF Research Database (Denmark)

    Ingversen, J.; Køie, B.

    1973-01-01

    Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2.......Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2....

  13. Enterobacterial colonization in captive red-eared sliders (Trachemys scripta elegans).

    Science.gov (United States)

    Gioia-Di Chiacchio, Rosely; Penido Júnior, Gilberto Nogueira; De Souza, Claudia Almeida Igayara; Prioste, Fabiola Eloisa Setim; Prado, Miriam Siqueira; Knöbl, Terezinha; Menão, Marcia Cristina; Matushima, Eliana Reiko

    2014-12-01

    The handling of turtles and other reptiles can be associated with risk of pathogenic enterobacteria transmission, mainly Salmonella spp. The aim of this study was to identify the enterobacteria in cloacal swabs of 39 red-eared sliders (Trachemys scripta elegans). Cloacal swabs from 39 captive individuals were analyzed. After sample enrichment in brain-heart infusion broth and 1% peptone water, bacterial isolation was performed through cultivation in blood, MacConkey and xylose lysine desoxycholate agar. Bacterial identification was achieved through conventional tests and automated turbidity analysis. The results indicated the growth of Kluyvera ascorbata (38/39), Leclercia adecarboxylata (37/39), Raoultella planticola (30/39), Citrobacter freundii (20/39), Proteus spp. (15/39), and Escherichia coli (5/39). Salmonella spp. were not detected. The intestinal enterobacteria identified inthis study differed from that reported in the literature for other reptiles.

  14. Extensive Lysine Methylation in Hyperthermophilic Crenarchaea: Potential Implications for Protein Stability and Recombinant Enzymes

    Directory of Open Access Journals (Sweden)

    Catherine H. Botting

    2010-01-01

    Full Text Available In eukarya and bacteria, lysine methylation is relatively rare and is catalysed by sequence-specific lysine methyltransferases that typically have only a single-protein target. Using RNA polymerase purified from the thermophilic crenarchaeum Sulfolobus solfataricus, we identified 21 methyllysines distributed across 9 subunits of the enzyme. The modified lysines were predominantly in α-helices and showed no conserved sequence context. A limited survey of the Thermoproteus tenax proteome revealed widespread modification with 52 methyllysines in 30 different proteins. These observations suggest the presence of an unusual lysine methyltransferase with relaxed specificity in the crenarchaea. Since lysine methylation is known to enhance protein thermostability, this may be an adaptation to a thermophilic lifestyle. The implications of this modification for studies and applications of recombinant crenarchaeal enzymes are discussed.

  15. Comparison of the Cellient(™) automated cell block system and agar cell block method.

    Science.gov (United States)

    Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

    2014-12-01

    To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

  16. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  17. Investigation of dental alginate and agar impression materials as a brain simulant for ballistic testing.

    Science.gov (United States)

    Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil

    2016-06-01

    Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films

    Directory of Open Access Journals (Sweden)

    Esam A. El-Hefian

    2011-01-01

    Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.

  19. Medium dependant production of corymbiferone a novel product from Penicillium hordei cultured on plant tissue agar

    DEFF Research Database (Denmark)

    Overy, David Patrick; Zidorn, C.; Petersen, B.O.

    2005-01-01

    Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...

  20. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  1. Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Mogensen, Jesper Mølgaard; Thrane, Ulf

    2009-01-01

    A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...

  2. Cell cytotoxicity and mycotoxin and secondary metabolite production by common penicillia on cheese agar

    DEFF Research Database (Denmark)

    Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    2002-01-01

    Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...

  3. Phenotypic differentiation of species from Aspergillus section Flavi on neutral red desiccated coconut agar

    DEFF Research Database (Denmark)

    Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.

    2014-01-01

    In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...

  4. Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.

    Science.gov (United States)

    Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W

    2012-01-01

    A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 µg/g in samples taken on day 19, 16.4 µg/g in samples taken 3 months after exposure, 13.4 µg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 µg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.

  5. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    Science.gov (United States)

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  6. Immediate differentiation of salmonella-resembling colonies on brilliant green agar

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2000-01-01

    A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...

  7. Effects of season on the yield and quality of agar from Gelidium ...

    African Journals Online (AJOL)

    The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...

  8. Can serums be replaced by Mueller‑Hinton agar in germ tube test?

    African Journals Online (AJOL)

    2016-03-03

    Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‑Hinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the ...

  9. Colony formation in agar: in vitro assay for haemopoietic stem cells

    NARCIS (Netherlands)

    Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

    1971-01-01

    Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

  10. Growth and study of barium oxalate single crystals in agar gel

    Indian Academy of Sciences (India)

    Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...

  11. Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.

    Science.gov (United States)

    Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max

    2016-07-01

    Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  12. Identification of catechols as histone-lysine demethylase inhibitors

    DEFF Research Database (Denmark)

    Nielsen, Anders L; Kristensen, Line H; Stephansen, Karen B

    2012-01-01

    Identification of inhibitors of histone-lysine demethylase (HDM) enzymes is important because of their involvement in the development of cancer. An ELISA-based assay was developed for identification of inhibitors of the HDM KDM4C in a natural products library. Based on one of the hits with affinity...... in the low µM range (1, a catechol), a subset of structurally related compounds was selected and tested against a panel of HDMs. In this subset, two inhibitors (2 and 10) had comparable affinities towards KDM4C and KDM6A but no effect on PHF8. One inhibitor restored H3K9me3 levels in KDM4C transfected U2-OS...

  13. Histone lysine demethylases as targets for anticancer therapy

    DEFF Research Database (Denmark)

    Højfeldt, Jonas W; Agger, Karl; Helin, Kristian

    2013-01-01

    It has recently been demonstrated that the genes controlling the epigenetic programmes that are required for maintaining chromatin structure and cell identity include genes that drive human cancer. This observation has led to an increased awareness of chromatin-associated proteins as potentially...... interesting drug targets. The successful introduction of DNA methylation and histone deacetylase (HDAC) inhibitors for the treatment of specific subtypes of cancer has paved the way for the use of epigenetic therapy. Here, we highlight key biological findings demonstrating the roles of members of the histone...... lysine demethylase class of enzymes in the development of cancers, discuss the potential and challenges of therapeutically targeting them, and highlight emerging small-molecule inhibitors of these enzymes....

  14. Nutritional plans of digestible lysine for growing-finishing gilts

    Directory of Open Access Journals (Sweden)

    Gabriel Cipriano Rocha

    2014-09-01

    Full Text Available This experiment was conducted to evaluate nutritional plans of digestible lysine (DLys for growing-finishing gilts. Eighty gilts with 63 days of age and an initial weight of 24.2±1.52 kg were distributed in a completely randomized block design, with five nutritional plans of DLys (9-8-7, 10-9-8, 11-10-9, 12-11-10, and 13-12-11 g/kg, from 63 to 103, 104 to 133, and 134 to 153 days of age, respectively and eight replicates. Pigs were housed in pairs and fed their respective diets ad libitum throughout the experimental period (90 days. To monitor the animal development along the experiment at 103 and 133 days, gilts were weighed and subjected to analysis of ultrasound for evaluation of loin depth (longissimus dorsi and backfat thickness. At the end of the experiment (153 days of age the animals were weighed, and after slaughter carcasses were evaluated individually using a typifying pistol to evaluate the percentage and the content of carcass meat, loin depth and backfat thickness. From 63 to 133 days, there was no effect of the nutritional plans on daily feed intake, performance, or backfat thickness; however the loin depth was greater in the gilts that received plans with high levels of DLys (12-11; 13-12 g/kg compared with the plan with the lowest level (8-7 g/kg. For the entire period (63 to 153 days, no influence of the nutritional plans was observed on the daily feed intake, performance variables, or carcass characteristics. A nutritional plan containing 9-8-7 g/kg of digestible lysine fed from 63 to 103, 104 to 133 and 134 to 153 days, respectively, meets the requirements for performance and carcass characteristics of growing-finishing gilts.

  15. Effect of feeding three lysine to energy diets on growth, body composition and age at puberty in replacement gilts

    Science.gov (United States)

    This study evaluated the effect of diets differing in standard ileal digestible (SID) lysine on lysine intake, growth rate, body composition and age at puberty on maternal line gilts. Crossbred Large White×Landrace gilts (n =641) were fed corn-soybean diets differing in SID lysine concentration (%, ...

  16. Differentiating non-0157:H7 STEC serogroups from ground beef plated on agar media by hyperspetral imaging

    Science.gov (United States)

    Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...

  17. Discolored Red Seaweed Pyropia yezoensis with Low Commercial Value Is a Novel Resource for Production of Agar Polysaccharides.

    Science.gov (United States)

    Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji

    2018-04-26

    The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.

  18. Effect of lignin on water vapor barrier, mechanical, and structural properties of agar/lignin composite films.

    Science.gov (United States)

    Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan

    2015-11-01

    Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus

    NARCIS (Netherlands)

    Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.

    2016-01-01

    An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water

  20. On the quantitative Amido Black B staining of protein spots in agar gel at low local protein concentrations

    NARCIS (Netherlands)

    Jansen, M.T.

    1962-01-01

    Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected

  1. Voluntary wheel running is beneficial to the amino acid profile of lysine-deficient rats.

    Science.gov (United States)

    Nagao, Kenji; Bannai, Makoto; Seki, Shinobu; Kawai, Nobuhiro; Mori, Masato; Takahashi, Michio

    2010-06-01

    Rats voluntarily run up to a dozen kilometers per night when their cages are equipped with a running wheel. Daily voluntary running is generally thought to enhance protein turnover. Thus, we sought to determine whether running worsens or improves protein degradation caused by a lysine-deficient diet and whether it changes the utilization of free amino acids released by proteolysis. Rats were fed a lysine-deficient diet and were given free access to a running wheel or remained sedentary (control) for 4 wk. Amino acid levels in plasma, muscle, and liver were measured together with plasma insulin levels and tissue weight. The lysine-deficient diet induced anorexia, skeletal muscle loss, and serine and threonine aminoacidemia, and it depleted plasma insulin and essential amino acids in skeletal muscle. Allowing rats to run voluntarily improved these symptoms; thus, voluntary wheel running made the rats less susceptible to dietary lysine deficiency. Amelioration of the declines in muscular leucine and plasma insulin observed in running rats could contribute to protein synthesis together with the enhanced availability of lysine and other essential amino acids in skeletal muscle. These results indicate that voluntary wheel running under lysine-deficient conditions does not enhance protein catabolism; on the contrary, it accelerates protein synthesis and contributes to the maintenance of muscle mass. The intense nocturnal voluntary running that characterizes rodents might be an adaptation of lysine-deficient grain eaters that allows them to maximize opportunities for food acquisition.

  2. Aflatoxin B1-lysine adduct in dried blood spot samples of animals and humans.

    Science.gov (United States)

    Xue, Kathy S; Cai, Wenjie; Tang, Lili; Wang, Jia-Sheng

    2016-12-01

    Dried blood spots (DBS) were proposed as potentially viable method for exposure assessment of environmental toxicants in infant and young children. For this study, we validated an experimental protocol to quantify AFB 1 -lysine adduct in DBS samples of AFB 1 -treated F344 rats, as well as samples from human field study. Significant dose-response relationships in AFB 1 -lysine adduct formation were found in DBS samples of rats treated with single- and repeated-dose AFB 1 . AFB 1 -lysine levels in DBS samples were highly correlated with corresponding serum sample levels. The Person coefficients were 0.997 for the single-dose exposure, and 0.996 for the repeated-dose exposure. Levels of AFB 1 -lysine adduct had also good agreement between DBS and serum samples as shown by Bland-Altman plot analysis. For human field study samples (n = 36), a Pearson correlation coefficient of 0.784 was found between AFB 1 -lysine adduct levels of DBS and corresponding serum samples. Bland-Altman plots showed the distribution of the log differences between DBS and serum AFB 1 -lysine levels are within 95% confidence intervals. These results showed AFB 1 -lysine adduct levels in DBS cards and serum samples from animals and human samples are comparable, and the DBS technique and analytical protocol is a good means to assess AFB 1 exposure in infant and children populations. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Copper nanoclusters as probes for turn-on fluorescence sensing of L-lysine.

    Science.gov (United States)

    Zhang, Mingming; Qiao, Juan; Zhang, Shufeng; Qi, Li

    2018-05-15

    Herein, a unique protocol based on copper nanoclusters (CuNCs) probe for turn-on fluorescence sensing of L-lysine was developed. The fluorescent CuNCs with ovalbumin as the stabilizer was prepared by a simple, one-step and green method. When 370 nm was used as the excitation wavelength, the resultant CuNCs exhibited a pale blue fluorescence with the maximum emission at 440 nm. Interestingly, existence of L-lysine evoked the obvious fluorescence intensity increase of CuNCs. The detection limit of the proposed method for L-lysine was 5.5 μM, with a good linear range from 10.0 μM to 1.0 mM (r 2 = 0.999). Moreover, the possible mechanism for enhanced fluorescence intensity of CuNCs by addition of L-lysine was explored and discussed briefly. Further, the as-prepared fluorescent CuNCs was successfully applied in detection of L-lysine in urine. Our results demonstrated that L-lysine could be monitored by the probe, providing new path for construction of CuNCs as fluorescent probes and showing great potential in quantification of L-lysine in real samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    International Nuclear Information System (INIS)

    Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio

    2010-01-01

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  5. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus.

    Directory of Open Access Journals (Sweden)

    Bob Laarhoven

    Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.

  6. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)

    2010-10-15

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  7. The tRNA synthetase paralog PoxA modifies elongation factor-P with (R)-ß-lysine

    DEFF Research Database (Denmark)

    Roy, Hervé; Zou, S Betty; Bullwinkle, Tammy J

    2011-01-01

    The lysyl-tRNA synthetase paralog PoxA modifies elongation factor P (EF-P) with a-lysine at low efficiency. Cell-free extracts containing non-a-lysine substrates of PoxA modified EF-P with a change in mass consistent with addition of ß-lysine, a substrate also predicted by genomic analyses. EF......-P was efficiently functionally modified with (R)-ß-lysine but not (S)-ß-lysine or genetically encoded a-amino acids, indicating that PoxA has evolved an activity orthogonal to that of the canonical aminoacyl-tRNA synthetases....

  8. Lysine acetylation targets protein complexes and co-regulates major cellular functions

    DEFF Research Database (Denmark)

    Choudhary, Chuna Ram; Kumar, Chanchal; Gnad, Florian

    2009-01-01

    Lysine acetylation is a reversible posttranslational modification of proteins and plays a key role in regulating gene expression. Technological limitations have so far prevented a global analysis of lysine acetylation's cellular roles. We used high-resolution mass spectrometry to identify 3600......, cell cycle, splicing, nuclear transport, and actin nucleation. Acetylation impaired phosphorylation-dependent interactions of 14-3-3 and regulated the yeast cyclin-dependent kinase Cdc28. Our data demonstrate that the regulatory scope of lysine acetylation is broad and comparable with that of other...

  9. Proteomic investigations of lysine acetylation identify diverse substrates of mitochondrial deacetylase sirt3

    DEFF Research Database (Denmark)

    Sol, E-ri Maria; Wagner, Sebastian A; Weinert, Brian T

    2012-01-01

    Lysine acetylation is a posttranslational modification that is dynamically regulated by the activity of acetyltransferases and deacetylases. The human and mouse genomes encode 18 different lysine deacetylases (KDACs) which are key regulators of many cellular processes. Identifying substrates...... of KDACs and pinpointing the regulated acetylation sites on target proteins may provide important information about the molecular basis of their functions. Here we apply quantitative proteomics to identify endogenous substrates of the mitochondrial deacetylase Sirtuin 3 (Sirt3) by comparing site...... by modulating acetylation on diverse substrates. The experimental strategy described here is generic and can be applied to identify endogenous substrates of other lysine deacetylases....

  10. Regulation of eukaryotic elongation factor 1 alpha (eEF1A) by dynamic lysine methylation

    DEFF Research Database (Denmark)

    Jakobsson, Magnus E; Małecki, Jędrzej; Falnes, Pål Ø

    2018-01-01

    Lysine methylation is a frequent post-translational protein modification, which has been intensively studied in the case of histone proteins. Lysine methylations are also found on many non-histone proteins, and one prominent example is eukaryotic elongation factor 1 alpha (eEF1A). Besides its...... essential role in the protein synthesis machinery, a number of non-canonical functions have also been described for eEF1A, such as regulation of the actin cytoskeleton and the promotion of viral replication. The functional significance of the extensive lysine methylations on eEF1A, as well as the identity...

  11. (R)-β-lysine-modified elongation factor P functions in translation elongation

    DEFF Research Database (Denmark)

    Bullwinkle, Tammy J; Zou, S Betty; Rajkovic, Andrei

    2013-01-01

    Post-translational modification of bacterial elongation factor P (EF-P) with (R)-β-lysine at a conserved lysine residue activates the protein in vivo and increases puromycin reactivity of the ribosome in vitro. The additional hydroxylation of EF-P at the same lysine residue by the YfcM protein has......-(β)-lysyl-EF-P showed 30% increased puromycin reactivity but no differences in dipeptide synthesis rates when compared with the β-lysylated form. Unlike disruption of the other genes required for EF-P modification, deletion of yfcM had no phenotypic consequences in Salmonella. Taken together, our findings indicate...

  12. Impact of Variety and Agronomic Factors on Crude Protein and Total Lysine in Chicory; N(ε)-Carboxymethyl-lysine-Forming Potential during Drying and Roasting.

    Science.gov (United States)

    Loaëc, Grégory; Niquet-Léridon, Céline; Henry, Nicolas; Jacolot, Philippe; Jouquand, Céline; Janssens, Myriam; Hance, Philippe; Cadalen, Thierry; Hilbert, Jean-Louis; Desprez, Bruno; Tessier, Frédéric J

    2015-12-02

    During the heat treatment of coffee and its substitutes some compounds potentially deleterious to health are synthesized by the Maillard reaction. Among these, N(ε)-carboxymethyl-lysine (CML) was detected at high levels in coffee substitutes. The objective of this study was to evaluate the impact of changes in agricultural practice on the lysine content present in chicory roots and try to limit CML formation during roasting. Of the 24 varieties analyzed, small variations in lysine content were observed, 213 ± 8 mg/100 g dry matter (DM). The formation of lysine tested in five commercial varieties was affected by the nitrogen treatment with mean levels of 176 ± 2 mg/100 g DM when no fertilizer was added and 217 ± 7 mg/100 g DM with a nitrogen supply of 120 kg/ha. The lysine content of fresh roots was significantly correlated to the concentration of CML formed in roasted roots (r = 0.51; p < 0.0001; n = 76).

  13. Control of the pattern of perithecium development in Sordaria fimicola on agar medium.

    Science.gov (United States)

    Pollock, R T

    1975-06-01

    In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.

  14. Substances used as gelling agent alternative to the agar in culture media for in vitro propagation

    Directory of Open Access Journals (Sweden)

    Darío Alonso Martin Gordo

    2012-10-01

    Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.

  15. Sterilization of MacConkey agar and CLED medium by gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Eisenberg, E; Altmann, G

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.

  16. Sterilization of MacConkey agar and CLED medium by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.

  17. The Global Acetylome of the Human Pathogen Vibrio cholerae V52 Reveals Lysine Acetylation of Major Transcriptional Regulators

    DEFF Research Database (Denmark)

    Jers, Carsten; Ravikumar, Vaishnavi; Lezyk, Mateusz Jakub

    2018-01-01

    Protein lysine acetylation is recognized as an important reversible post translational modification in all domains of life. While its primary roles appear to reside in metabolic processes, lysine acetylation has also been implicated in regulating pathogenesis in bacteria. Several global lysine...... acetylome analyses have been carried out in various bacteria, but thus far there have been no reports of lysine acetylation taking place in the important human pathogen Vibrio cholerae. In this study, we analyzed the lysine acetylproteome of the human pathogen V. cholerae V52. By applying a combination...... in direct regulation of virulence in V. cholerae were acetylated. In conclusion, this is the first global protein lysine acetylome analysis of V. cholerae and should constitute a valuable resource for in-depth studies of the impact of lysine acetylation in pathogenesis and other cellular processes....

  18. Ophthalmic ester removal in the agar state giant molecule; Kantenjo kobunshi de futarusan esuteru jokyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    Matsubara professors of Tokyo College of Pharmacy developed the technique which simply removed phthalic ester from the solution. The property in which the giant molecule called the poly N isopropyl acrylamide cohered like the agar, when 32 degrees C is exceeded, was utilized, and the phthalic ester of poor solubility is taken in the flocculation stage. It is expected with that it can be utilized for wastewater treatment and solicitation quantity thing analysis in the environment. (translated by NEDO)

  19. Comparison of the Etest and the routine multi-disc agar diffusion ...

    African Journals Online (AJOL)

    Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.

  20. Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.

    2013-01-01

    Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30°C in 5% CO2 for 2 days prior to continuous culture in air at 30°C. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 μg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772

  1. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    OpenAIRE

    Marol Serhat; Yücesoy Mine

    2003-01-01

    Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...

  2. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    International Nuclear Information System (INIS)

    Losse, G.; Mueller, F.; Fischer, S.

    1989-01-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)

  3. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    International Nuclear Information System (INIS)

    Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun

    2005-01-01

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic

  4. Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.

    OpenAIRE

    Moskowitz, L B; Chester, B

    1982-01-01

    A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.

  5. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    Energy Technology Data Exchange (ETDEWEB)

    Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E

    1989-05-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).

  6. Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ▿

    OpenAIRE

    Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael

    2010-01-01

    BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.

  7. Comparing the disk-diffusion and agar dilution tests for Neisseria gonorrhoeae antimicrobial susceptibility testing

    Directory of Open Access Journals (Sweden)

    Hsi Liu

    2016-11-01

    Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest® (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer’s standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest® were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest®, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC’s were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest® were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.

  8. Preparation of amine-impregnated silica foams using agar as the gelling agent

    Energy Technology Data Exchange (ETDEWEB)

    Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5° andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)

    2016-10-15

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  9. Preparation of amine-impregnated silica foams using agar as the gelling agent

    International Nuclear Information System (INIS)

    Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.

    2016-01-01

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  10. An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.

    Directory of Open Access Journals (Sweden)

    Emma R Cold

    Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.

  11. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar

    Directory of Open Access Journals (Sweden)

    Fabíola Silveira-Gomes

    2011-08-01

    Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  12. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar.

    Science.gov (United States)

    Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena

    2011-01-01

    Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  13. Calibration of Ge(Li) semiconductor detector by method using agar volume source

    International Nuclear Information System (INIS)

    Yanase, Nobuyuki; Kasai, Atsushi

    1979-12-01

    The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 μCi and 0.2 μCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)

  14. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  15. Synthesis and Phase Behavior of Poly(N-isopropylacrylamide-b- Poly(L-Lysine Hydrochloride and Poly(N-Isopropylacrylamide- co-Acrylamide-b-Poly(L-Lysine Hydrochloride

    Directory of Open Access Journals (Sweden)

    Milica Spasojević

    2014-07-01

    Full Text Available The synthesis of poly(N-isopropylacrylamide-b-poly(L-lysine and poly(N- isopropylacrylamide-co-acrylamide-b-poly(L-lysine copolymers was accomplished by combining atom transfer radical polymerization (ATRP and ring opening polymerization (ROP. For this purpose, a di-functional initiator with protected amino group was successfully synthetized. The ATRP of N-isopropylacrylamide yielded narrowly dispersed polymers with consistent high yields (~80%. Lower yields (~50% were observed when narrowly dispersed random copolymers of N-isopropylacrylamide and acrylamide where synthesized. Amino-terminated poly(N-isopropylacrylamide and poly(N-isopropylacrylamide- co-acrylamide were successfully used as macroinitiators for ROP of N6-carbobenzoxy-L- lysine N-carboxyanhydride. The thermal behavior of the homopolymers and copolymers in aqueous solutions was studied by turbidimetry, dynamic light scattering (DLS and proton nuclear magnetic resonance spectroscopy (1H-NMR.

  16. Energy and lysine requirements and balances of sows during transition and lactation: A factorial approach

    DEFF Research Database (Denmark)

    Feyera, Takele; Theil, Peter Kappel

    2017-01-01

    components (including uterus wall, placenta and membrane fluids) and maintenance were estimated. It was estimated that maintenance, additional heat loss, colostrum production, fetal growth, mammary growth and uterine components accounted for 66.8%, 19.3%, 7.2%, 5.0%, 1.3% and 0.5% of total ME requirements......, respectively, in the last 12 days of gestation. Oxidation/transamination, fetal growth, mammary growth, colostrum production, maintenance and uterine components were estimated to account for 29.5%, 22.7%, 16.8%, 16.1%, 10.4% and 4.5% of total SID lysine requirements, respectively, in the last 12 days...... of gestation. After parturition, ME and SID lysine requirements increased daily until peak lactation (day 17). At peak lactation, 95% and 72% of total required SID lysine and ME, respectively, were associated with milk production (including oxidation). Relative to day 104 of gestation, ME and SID lysine...

  17. Global profiling of lysine reactivity and ligandability in the human proteome

    Science.gov (United States)

    Hacker, Stephan M.; Backus, Keriann M.; Lazear, Michael R.; Forli, Stefano; Correia, Bruno E.; Cravatt, Benjamin F.

    2017-12-01

    Nucleophilic amino acids make important contributions to protein function, including performing key roles in catalysis and serving as sites for post-translational modification. Electrophilic groups that target amino-acid nucleophiles have been used to create covalent ligands and drugs, but have, so far, been mainly limited to cysteine and serine. Here, we report a chemical proteomic platform for the global and quantitative analysis of lysine residues in native biological systems. We have quantified, in total, more than 9,000 lysines in human cell proteomes and have identified several hundred residues with heightened reactivity that are enriched at protein functional sites and can frequently be targeted by electrophilic small molecules. We have also discovered lysine-reactive fragment electrophiles that inhibit enzymes by active site and allosteric mechanisms, as well as disrupt protein-protein interactions in transcriptional regulatory complexes, emphasizing the broad potential and diverse functional consequences of liganding lysine residues throughout the human proteome.

  18. Global profiling of lysine reactivity and ligandability in the human proteome.

    Science.gov (United States)

    Hacker, Stephan M; Backus, Keriann M; Lazear, Michael R; Forli, Stefano; Correia, Bruno E; Cravatt, Benjamin F

    2017-12-01

    Nucleophilic amino acids make important contributions to protein function, including performing key roles in catalysis and serving as sites for post-translational modification. Electrophilic groups that target amino-acid nucleophiles have been used to create covalent ligands and drugs, but have, so far, been mainly limited to cysteine and serine. Here, we report a chemical proteomic platform for the global and quantitative analysis of lysine residues in native biological systems. We have quantified, in total, more than 9,000 lysines in human cell proteomes and have identified several hundred residues with heightened reactivity that are enriched at protein functional sites and can frequently be targeted by electrophilic small molecules. We have also discovered lysine-reactive fragment electrophiles that inhibit enzymes by active site and allosteric mechanisms, as well as disrupt protein-protein interactions in transcriptional regulatory complexes, emphasizing the broad potential and diverse functional consequences of liganding lysine residues throughout the human proteome.

  19. Pharmacokinetics of lysine clonixinate in children in postoperative care.

    Science.gov (United States)

    González-Martin, G; Cattan, C; Zuñiga, S

    1996-09-01

    The pharmacokinetics of 2 doses of intravenous lysine clonixinate (4 and 6 mg x kg-1) were studied in 10 children (age 4-10 years) under postoperative care. A single dose of the drug was injected in a forearm vein. Blood samples were collected at regular intervals for 3 hours. Serum clonixin concentrations (expressed as clonixin) were analyzed using a high pressure liquid chromatography method. Pharmacokinetic values were estimated by a nonlinear computer program. The distribution volume was similar in both groups of children (1.288 +/- 0.829 1 and 1. 139 +/- 0.667 1, respectively). There were no differences between the values of total plasma clearance and the administered doses (0.026 +/- 0.017 ml x min-1 and 0.017 +/- 0.008 ml x min-1, t = 1.07, p = 0.76). The elimination half-life was longer in children who received 6 mg x kg-1 (44.26 +/- 6.34 min vs 38.63 +/- 10.93 min) but this difference was not statistically significant (t = 0.99, p < 0.34). The pharmacokinetic parameters calculated in these children were different from those found by other authors in adults and experimental animals.

  20. Glycated Lysine Residues: A Marker for Non-Enzymatic Protein Glycation in Age-Related Diseases

    OpenAIRE

    Ansari, Nadeem A.; Moinuddin,; Ali, Rashid

    2011-01-01

    Nonenzymatic glycosylation or glycation of macromolecules, especially proteins leading to their oxidation, play an important role in diseases. Glycation of proteins primarily results in the formation of an early stage and stable Amadori-lysine product which undergo further irreversible chemical reactions to form advanced glycation endproducts (AGEs). This review focuses these products in lysine rich proteins such as collagen and human serum albumin for their role in aging and age-related dise...

  1. DNA Damage-Induced Acetylation of Lysine 3016 of ATM Activates ATM Kinase Activity▿ †

    OpenAIRE

    Sun, Yingli; Xu, Ye; Roy, Kanaklata; Price, Brendan D.

    2007-01-01

    The ATM protein kinase is essential for cells to repair and survive genotoxic events. The activation of ATM's kinase activity involves acetylation of ATM by the Tip60 histone acetyltransferase. In this study, systematic mutagenesis of lysine residues was used to identify regulatory ATM acetylation sites. The results identify a single acetylation site at lysine 3016, which is located in the highly conserved C-terminal FATC domain adjacent to the kinase domain. Antibodies specific for acetyl-ly...

  2. Effects of single oral doses of lysine clonixinate and acetylsalicylic acid on platelet functions in man.

    Science.gov (United States)

    Pallapies, D; Muhs, A; Bertram, L; Rohleder, G; Nagyiványi, P; Peskar, B A

    1996-01-01

    Lysine clonixinate is an analgesic drug with a so far unknown mechanism of action. We have determined its effect on platelet cyclooxygenase in man. Biosynthesis of thromboxane (TX)B2 and prostaglandin (PG)F2 alpha in clotting whole blood ex vivo as well as collagen-induced platelet aggregation measured before and at various time points after oral administration of 125 mg lysine clonixinate were compared to results obtained with 500 mg acetylsalicylic acid (ASA). While biosynthesis of both TXB2 and PGF2 alpha measured radioimmunologically was inhibited significantly 2.5 h, but not 6 h, after administration of lysine clonixinate, inhibition by ASA was much greater and still highly significant after 48 h. Similarly, collagen-induced aggregation of platelet-rich plasma was inhibited for a longer period and to a greater extent after administration of ASA than after lysine clonixinate. Our results indicate that lysine clonixinate is a cyclooxygenase inhibitor of moderate potency. It remains to be investigated whether mechanisms other than inhibition of cyclooxygenase contribute to the analgesic activity of lysine clonixinate.

  3. Flux through the tetrahydrodipicolinate succinylase pathway is dispensable for L-lysine production in Corynebacterium glutamicum.

    Science.gov (United States)

    Shaw-Reid, C A; McCormick, M M; Sinskey, A J; Stephanopoulos, G

    1999-03-01

    The N-succinyl-LL-diaminopimelate desuccinylase gene (dapE) in the four-step succinylase branch of the L-lysine biosynthetic pathway of Corynebacterium glutamicum was disrupted via marker-exchange mutagenesis to create a mutant strain that uses only the one-step meso-diaminopimelate dehydrogenase branch to overproduce lysine. This mutant strain grew and utilized glucose from minimal medium at the same rate as the parental strain. In addition, the dapE- strain produced lysine at the same rate as its parent strain. Transformation of the parental and dapE- strains with the amplified meso-diaminopimelate dehydrogenase gene (ddh) on a plasmid did not affect lysine production in either strain, despite an eightfold amplification of the activity of the enzyme. These results indicate that the four-step succinylase pathway is dispensable for lysine overproduction in shake-flask culture. In addition, the one-step meso-diaminopimelate dehydrogenase pathway does not limit lysine flux in Corynebacterium under these conditions.

  4. CPLA 1.0: an integrated database of protein lysine acetylation.

    Science.gov (United States)

    Liu, Zexian; Cao, Jun; Gao, Xinjiao; Zhou, Yanhong; Wen, Longping; Yang, Xiangjiao; Yao, Xuebiao; Ren, Jian; Xue, Yu

    2011-01-01

    As a reversible post-translational modification (PTM) discovered decades ago, protein lysine acetylation was known for its regulation of transcription through the modification of histones. Recent studies discovered that lysine acetylation targets broad substrates and especially plays an essential role in cellular metabolic regulation. Although acetylation is comparable with other major PTMs such as phosphorylation, an integrated resource still remains to be developed. In this work, we presented the compendium of protein lysine acetylation (CPLA) database for lysine acetylated substrates with their sites. From the scientific literature, we manually collected 7151 experimentally identified acetylation sites in 3311 targets. We statistically studied the regulatory roles of lysine acetylation by analyzing the Gene Ontology (GO) and InterPro annotations. Combined with protein-protein interaction information, we systematically discovered a potential human lysine acetylation network (HLAN) among histone acetyltransferases (HATs), substrates and histone deacetylases (HDACs). In particular, there are 1862 triplet relationships of HAT-substrate-HDAC retrieved from the HLAN, at least 13 of which were previously experimentally verified. The online services of CPLA database was implemented in PHP + MySQL + JavaScript, while the local packages were developed in JAVA 1.5 (J2SE 5.0). The CPLA database is freely available for all users at: http://cpla.biocuckoo.org.

  5. Modulation of benzodiazepine by lysine and pipecolic acid on pentylenetetrazol-induced seizures

    International Nuclear Information System (INIS)

    Chang, Y.F.; Hargest, V.; Chen, J.S.

    1988-01-01

    L-lysine and its metabolite pipecolic acid (PA) have been studied for their effects on pentylenetetrazol (PTZ)-induced seizures in mice. L-Lysine of L-Pa i.p. significantly increased clonic and tonic latencies in a dose-dependent manner against 90 mg/kg PTZ-induced seizures. L-Lysine but not L-Pa enhanced the anticonvulsant effect of diazepam (DZ). L-Pa i.c.v. showed a slight decrease in clonic latency; it did not enhance the antiseizure activity of DZ; it caused seizures at 0.6 mmol/kg. D-PA i.c.v. displayed an opposite effect compared to its L-isomer. The anticonvulsant effect of L-lysine in terms of increase in seizure latency and survival was even more amplified when tested with a submaximal PTZ concentration. L-Lysine showed an enhancement of specific 3 H-flunitrazepam(FZ) binding to mouse brain membranes both in vitro an din vivo. The possibility of L-lysine acting as a modulator for the GABA/benzodiazepine receptors was demonstrated. Since L-PA showed enhancement of 3 H-FZ binding only in vitro but not in vivo, the anticonvulsant effect of L-PA may not be linked to the GABA/benzodiazepine receptor

  6. Systematic Analysis of the Functions of Lysine Acetylation in the Regulation of Tat Activity.

    Directory of Open Access Journals (Sweden)

    Minghao He

    Full Text Available The Tat protein of HIV-1 has several well-known properties, such as nucleocytoplasmic trafficking, transactivation of transcription, interaction with tubulin, regulation of mitotic progression, and induction of apoptosis. Previous studies have identified a couple of lysine residues in Tat that are essential for its functions. In order to analyze the functions of all the lysine residues in Tat, we mutated them individually to alanine, glutamine, and arginine. Through systematic analysis of the lysine mutants, we discovered several previously unidentified characteristics of Tat. We found that lysine acetylation could modulate the subcellular localization of Tat, in addition to the regulation of its transactivation activity. Our data also revealed that lysine mutations had distinct effects on microtubule assembly and Tat binding to bromodomain proteins. By correlation analysis, we further found that the effects of Tat on apoptosis and mitotic progression were not entirely attributed to its effect on microtubule assembly. Our findings suggest that Tat may regulate diverse cellular activities through binding to different proteins and that the acetylation of distinct lysine residues in Tat may modulate its interaction with various partners.

  7. Use of acetimidation in the NMR identification of neurophysin lysine protons

    International Nuclear Information System (INIS)

    Sardana, V.; Breslow, E.

    1986-01-01

    Acetimidation of the two lysine residues of neurophysin (NP) results in localized changes in the proton magnetic resonance spectrum, allowing identification of lysine side-chain resonances. Neither peptide-binding nor protein self-association appeared to be significantly altered by acetimidation. Additionally, no significant effect of either peptide-binding or self-association on lysine epsilon-CH 2 protons was seen. However, dimerization-induced NMR changes in the 1.6-1.8 ppm region, associated with lysine β,γ,σ protons, were altered in the acetimidated protein. In particular, while the spectrum of the acetimidated NP monomer was almost identical to that of the native protein, a shoulder at 1.72 ppm in the native protein dimer was shifted upfield in the modified dimer. Additionally the direction of NMR shifts in the 1.6-1.8 ppm region normally associated with peptide binding to the NP dimer appeared to be reversed in the acetimidated protein. Binding-induced and dimerization-induced changes in all other regions of the spectrum were identical in the native and modified proteins. These results suggest that one or both NP lysine residues may be near the dimer subunit interface and indicate an effect of peptide-binding on lysine side-chain environment

  8. Self-degradation of tissue adhesive based on oxidized dextran and poly-L-lysine.

    Science.gov (United States)

    Matsumura, Kazuaki; Nakajima, Naoki; Sugai, Hajime; Hyon, Suong-Hyu

    2014-11-26

    We have developed a low-toxicity bioadhesive based on oxidized dextran and poly-L-lysine. Here, we report that the mechanical properties and degradation of this novel hydrogel bioadhesive can be controlled by changing the extent of oxidation of the dextran and the type or concentration of the anhydride species in the acylated poly-L-lysine. The dynamic moduli of the hydrogels can be controlled from 120 Pa to 20 kPa, suggesting that they would have mechanical compatibility with various tissues, and could have applications as tissue adhesives. Development of the hydrogel color from clear to brown indicates that the reaction between the dextran aldehyde groups and the poly-L-lysine amino groups may be induced by a Maillard reaction via Schiff base formation. Degradation of the aldehyde dextran may begin by reaction of the amino groups in the poly-L-lysine. The gel degradation can be ascribed to degradation of the aldehyde dextran in the hydrogel, although the aldehyde dextran itself is relatively stable in water. The oxidized dextran and poly-L-lysine, and the degraded hydrogel showed low cytotoxicities. These findings indicate that a hydrogel consisting of oxidized dextran and poly-L-lysine has low toxicity and a well-controlled degradation rate, and has potential clinical applications as a bioadhesive. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. METHODS FOR DETERMINATION REACTIVE LYSINE IN HEAT-TREATED FOODS AND FEEDS

    Directory of Open Access Journals (Sweden)

    Matej Brestenský

    2014-08-01

    Full Text Available Lysine is an essential amino acid, which is limited in foods of plant origin, especially in cereals. The heat-treatment of products containing proteins and reducing sugars results in formation of Maillard reactions during which the cross-linkages among epsilon amino groups (ε-NH2 and reducing sugars are created. Thus the protein-carbohydrate complex is formed. This complex contains an unreactive (unavailable lysine, which is bound to reducing sugars and is not available in body. Hereby, the nutritive value of feeds and foods decreases. When a standard analytical method for analyses of amino acids is used, in products containing protein-carbohydrate complexes, it is not possible to analyze the content of reactive (available and unreactive (unavailable lysine, but only the content of total lysine. Therefore, when the standard amino acid analysis is used, the content of lysine in heat-treated feeds and foods is overestimated. In order to avoid this, some methods for determination of reactive lysine were developed. Among the best known, the homoarginine and furosine methods are included. Using these methods, in evaluation of nutritive value of feeds and foods, is of great importance because they allow to determine the extent of proteins, which were damaged during the heat treatment and thus we obtain information on objective nutritional protein quality of the product.

  10. Effects of fortified lysine on the amino acid profile and sensory qualities of deep-fried and dried noodles.

    Science.gov (United States)

    Polpuech, C; Chavasit, V; Srichakwal, P; Paniangvait, P

    2011-08-01

    Lysine fortification of wheat flour has been used toward reducing protein energy malnutrition in developing countries. The feasibility of fortifying instant noodles with lysine was evaluated based on sensory qualities and the residual lysine content. Fifty grams of deep-fried and dried instant noodles were fortified with 0.23 and 0.21 g lysine, respectively. The production temperatures used for deep-frying were 165-175 degrees C and for drying, 80-105 degrees C; these are the temperatures used in the industrial production of both kinds of noodles. Lysine fortification was then performed at the local factories using the commercial production lines and packaging for both types of instant noodles. Both fortified and unfortified deep-fried and dried instant noodles were stored at 50 degrees C under fluorescent light for 2 and 4 months, respectively. The fortified products were tested for residual lysine content and sensory qualities as compared with unfortified noodles. The results show fortified products from the tested processing temperatures were all accepted. After storage, significant losses of lysine were not found in both types of noodles analysed. The lysine-fortified noodles had amino acid scores of 102% and 122%, respectively. After 2 months, the sensory quality of fortified deep-fried noodles was still acceptable; however, the dried noodles turned to an unacceptable dark colour. This study shows that it is feasible to fortify deep-fried instant noodles with lysine, though lysine fortification exhibited an undesirable colour in the dried instant noodles after storage.

  11. O-Methylisourea Can React with the α-Amino Group of Lysine: Implications for the Analysis of Reactive Lysine.

    Science.gov (United States)

    Hulshof, Tetske G; Rutherfurd, Shane M; Sforza, Stefano; Bikker, Paul; van der Poel, Antonius F B; Hendriks, Wouter H

    2017-02-01

    The specificity of O-methylisourea (OMIU) to bind to the ε-amino group of Lys, an important supposition for the OMIU-reactive Lys analysis of foods, feeds, ingredients, and digesta, was investigated. Crystalline l-Lys incubated under standard conditions with OMIU resulted in low homoarginine recoveries. The reaction of OMIU with the α-amino group of Lys was confirmed by MS analysis, with double derivatized Lys being identified. None of the changes in reaction conditions (OMIU pH, OMIU to Lys ratio, and reaction time) with crystalline l-Lys resulted in 100% recovery of homoarginine. The average free Lys content in ileal digesta of growing pigs and broilers was found to be 13% of total Lys, which could result in a significant underestimation of the reactive Lys content. The reaction of OMIU with α-amino groups may necessitate analysis of free Lys to accurately quantify reactive lysine in samples containing a large proportion of Lys with a free α-amino group.

  12. Lysine residue 185 of Rad1 is a topological but not a functional counterpart of lysine residue 164 of PCNA.

    Directory of Open Access Journals (Sweden)

    Niek Wit

    Full Text Available Monoubiquitylation of the homotrimeric DNA sliding clamp PCNA at lysine residue 164 (PCNA(K164 is a highly conserved, DNA damage-inducible process that is mediated by the E2/E3 complex Rad6/Rad18. This ubiquitylation event recruits translesion synthesis (TLS polymerases capable of replicating across damaged DNA templates. Besides PCNA, the Rad6/Rad18 complex was recently shown in yeast to ubiquitylate also 9-1-1, a heterotrimeric DNA sliding clamp composed of Rad9, Rad1, and Hus1 in a DNA damage-inducible manner. Based on the highly similar crystal structures of PCNA and 9-1-1, K185 of Rad1 (Rad1(K185 was identified as the only topological equivalent of PCNA(K164. To investigate a potential role of posttranslational modifications of Rad1(K185 in DNA damage management, we here generated a mouse model with a conditional deletable Rad1(K185R allele. The Rad1(K185 residue was found to be dispensable for Chk1 activation, DNA damage survival, and class switch recombination of immunoglobulin genes as well as recruitment of TLS polymerases during somatic hypermutation of immunoglobulin genes. Our data indicate that Rad1(K185 is not a functional counterpart of PCNA(K164.

  13. Lysine supplementation is not effective for the prevention or treatment of feline herpesvirus 1 infection in cats: a systematic review.

    Science.gov (United States)

    Bol, Sebastiaan; Bunnik, Evelien M

    2015-11-16

    Feline herpesvirus 1 is a highly contagious virus that affects many cats. Virus infection presents with flu-like signs and irritation of ocular and nasal regions. While cats can recover from active infections without medical treatment, examination by a veterinarian is recommended. Lysine supplementation appears to be a popular intervention (recommended by > 90 % of veterinarians in cat hospitals). We investigated the scientific merit of lysine supplementation by systematically reviewing all relevant literature. NCBI's PubMed database was used to search for published work on lysine and feline herpesvirus 1, as well as lysine and human herpesvirus 1. Seven studies on lysine and feline herpesvirus 1 (two in vitro studies and 5 studies with cats), and 10 publications on lysine and human herpesvirus 1 (three in vitro studies and 7 clinical trials) were included for qualitative analysis. There is evidence at multiple levels that lysine supplementation is not effective for the prevention or treatment of feline herpesvirus 1 infection in cats. Lysine does not have any antiviral properties, but is believed to act by lowering arginine levels. However, lysine does not antagonize arginine in cats, and evidence that low intracellular arginine concentrations would inhibit viral replication is lacking. Furthermore, lowering arginine levels is highly undesirable since cats cannot synthesize this amino acid themselves. Arginine deficiency will result in hyperammonemia, which may be fatal. In vitro studies with feline herpesvirus 1 showed that lysine has no effect on the replication kinetics of the virus. Finally, and most importantly, several clinical studies with cats have shown that lysine is not effective for the prevention or the treatment of feline herpesvirus 1 infection, and some even reported increased infection frequency and disease severity in cats receiving lysine supplementation. We recommend an immediate stop of lysine supplementation because of the complete lack of

  14. AgarTrap: a simplified Agrobacterium-mediated transformation method for sporelings of the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Tsuboyama, Shoko; Kodama, Yutaka

    2014-01-01

    The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.

  15. Androgen receptor and histone lysine demethylases in ovine placenta.

    Directory of Open Access Journals (Sweden)

    Ellane R Cleys

    Full Text Available Sex steroid hormones regulate developmental programming in many tissues, including programming gene expression during prenatal development. While estradiol is known to regulate placentation, little is known about the role of testosterone and androgen signaling in placental development despite the fact that testosterone rises in maternal circulation during pregnancy and in placenta-induced pregnancy disorders. We investigated the role of testosterone in placental gene expression, and focused on androgen receptor (AR. Prenatal androgenization decreased global DNA methylation in gestational day 90 placentomes, and increased placental expression of AR as well as genes involved in epigenetic regulation, angiogenesis, and growth. As AR complexes with histone lysine demethylases (KDMs to regulate AR target genes in human cancers, we also investigated if the same mechanism is present in the ovine placenta. AR co-immunoprecipitated with KDM1A and KDM4D in sheep placentomes, and AR-KDM1A complexes were recruited to a half-site for androgen response element (ARE in the promoter region of VEGFA. Androgenized ewes also had increased cotyledonary VEGFA. Finally, in human first trimester placental samples KDM1A and KDM4D immunolocalized to the syncytiotrophoblast, with nuclear KDM1A and KDM4D immunostaining also present in the villous stroma. In conclusion, placental androgen signaling, possibly through AR-KDM complex recruitment to AREs, regulates placental VEGFA expression. AR and KDMs are also present in first trimester human placenta. Androgens appear to be an important regulator of trophoblast differentiation and placental development, and aberrant androgen signaling may contribute to the development of placental disorders.

  16. Lysine clonixinate in the treatment of primary dysmenorrhea.

    Science.gov (United States)

    Di Girolamo, G; Zmijanovich, R; de los Santos, A R; Martí, M L; Terragno, A

    1996-01-01

    The efficacy and tolerance of Lysine Clonixinate (LC), a NSAID with prostaglandin synthesis inhibiting mechanism was studied in 24 patients with primary dysmenorrhea according to a double-blind randomized crossover Placebo (P) controlled design with patients serving as their own controls. Treatment consisted in administering 1 tablet of LC or P q6h as from onset of menstrual pain during 5 days and 6 menstrual cycles. Patients were controlled monthly as from the 5th day of the cycle, rating changes in pain intensity according to a 4-point scale, presence of pain during pre-, post- and menstrual periods; possible intracycle changes, amount of bleeding, tolerance and related total and general signs and symptoms. Intensity of baseline menstrual pain amounted to 2.9. Menstrual, intramenstrual and postmenstrual pains were observed in 19 out of 24, 24/24 and only 2 out of the 24 patients, respectively. Concomitant symptoms consisted in headache (12), mastalgia (14) and discomfort (12). Results were obtained by averaging the data from the treatment periods with each drug. Menstrual pain was reduced from 2.9 +/- 0.7 to 1.9 +/- 0.7 with P administration and to 0.66 +/- 0.4 with the administration of LC, a highly significant difference between treatments (p < 0.0001). Premenstrual pain was reduced nonsignificantly from 0.79% to 0.58% with P administration and significantly to 0.29% with administration of LC (p < 0.001). Intramenstrual pain affecting all patients at baseline was reduced significantly by 9% with P and also significantly by 50% with LC (p < 0.001). No differences were encountered in concomitant symptoms during P treatment periods while the incidence was significantly reduced with LC (p < 0.0001). No changes in cycle duration or amount of bleeding were observed between treatments. No adverse events were reported.

  17. Lysine clonixinate vs. paracetamol/codeine in postepisiotomy pain.

    Science.gov (United States)

    De los Santos, A R; Martí, M I; Espinosa, D; Di Girolamo, G; Vinacur, J C; Casadei, A

    1998-01-01

    This study was conducted to compare the analgesic action of Lysine Clonixinate (LC) vs Paracetamol/Codeine association (PC) in the treatment of postepisiotomy pain in primiparae women: 131 primiparous patients with moderate-to-severe postepisiotomy pain were enrolled in a double blind dummy design study and randomly allocated to either treatment with fixed doses of LC 125 mg or Paracetamol 500 mg+Codeine 30 mg 6 qh during 24 hours. Intensity of spontaneous pain and pain on walking was assessed according to a visual analog scale (VAS) and patient's assessment before receiving treatment and after 1, 2, 6 and 24 hours. Intensity of spontaneous pain was reduced in 24 hours from 4.28 +/- 2.11 to 1.73 +/- 1.46 (P < 0.0001) in the LC group and from 4.78 +/- 2.08 to 1.90 +/- 1.72 in the PC-treated group (p < 0.0001); with no significant differences between treatments. 54% of the patients treated with LC and 55% of those receiving PC showed onset of analgesic action 30 minutes following dose administration. Patient's final global assessment revealed that 95% of LC-treated patients and 96% of the PC group showed total or partial pain relief during the first treatment day. No sleep disturbances were seen during the night in 75% of patients. Only one patient receiving LC showed nausea not requiring treatment discontinuation. It is concluded that both treatments are equally effective to relieve moderate-to-severe postepisiotomy pain.

  18. Bacteriophage Lysin CF-301, a Potent Antistaphylococcal Biofilm Agent.

    Science.gov (United States)

    Schuch, Raymond; Khan, Babar K; Raz, Assaf; Rotolo, Jimmy A; Wittekind, Michael

    2017-07-01

    Biofilms pose a unique therapeutic challenge because of the antibiotic tolerance of constituent bacteria. Treatments for biofilm-based infections represent a major unmet medical need, requiring novel agents to eradicate mature biofilms. Our objective was to evaluate bacteriophage lysin CF-301 as a new agent to target Staphylococcus aureus biofilms. We used minimum biofilm-eradicating concentration (MBEC) assays on 95 S. aureus strains to obtain a 90% MBEC (MBEC 90 ) value of ≤0.25 μg/ml for CF-301. Mature biofilms of coagulase-negative staphylococci, Streptococcus pyogenes , and Streptococcus agalactiae were also sensitive to disruption, with MBEC 90 values ranging from 0.25 to 8 μg/ml. The potency of CF-301 was demonstrated against S. aureus biofilms formed on polystyrene, glass, surgical mesh, and catheters. In catheters, CF-301 removed all biofilm within 1 h and killed all released bacteria by 6 h. Mixed-species biofilms, formed by S. aureus and Staphylococcus epidermidis on several surfaces, were removed by CF-301, as were S. aureus biofilms either enriched for small-colony variants (SCVs) or grown in human synovial fluid. The antibacterial activity of CF-301 was further demonstrated against S. aureus persister cells in exponential-phase and stationary-phase populations. Finally, the antibiofilm activity of CF-301 was greatly improved in combinations with the cell wall hydrolase lysostaphin when tested against a range of S. aureus strains. In all, the data show that CF-301 is highly effective at disrupting biofilms and killing biofilm bacteria, and, as such, it may be an efficient new agent for treating staphylococcal infections with a biofilm component. Copyright © 2017 American Society for Microbiology.

  19. Lysine methyltransferase SMYD2 promotes triple negative breast cancer progression.

    Science.gov (United States)

    Li, Linda Xiaoyan; Zhou, Julie Xia; Calvet, James P; Godwin, Andrew K; Jensen, Roy A; Li, Xiaogang

    2018-02-27

    We identified SMYD2, a SMYD (SET and MYND domain) family protein with lysine methyltransferase activity, as a novel breast cancer oncogene. SMYD2 was expressed at significantly higher levels in breast cancer cell lines and in breast tumor tissues. Silencing of SMYD2 by RNAi in triple-negative breast cancer (TNBC) cell lines or inhibition of SMYD2 with its specific inhibitor, AZ505, significantly reduced tumor growth in vivo. SMYD2 executes this activity via methylation and activation of its novel non-histone substrates, including STAT3 and the p65 subunit of NF-κB, leading to increased TNBC cell proliferation and survival. There are cross-talk and synergistic effects among SMYD2, STAT3, and NF-κB in TNBC cells, in that STAT3 can contribute to the modification of NF-κB p65 subunit post-translationally by recruitment of SMYD2, whereas the p65 subunit of NF-κB can also contribute to the modification of STAT3 post-translationally by recruitment of SMYD2, leading to methylation and activation of STAT3 and p65 in these cells. The expression of SMYD2 can be upregulated by IL-6-STAT3 and TNFα-NF-κB signaling, which integrates epigenetic regulation to inflammation in TNBC development. In addition, we have identified a novel SMYD2 transcriptional target gene, PTPN13, which links SMYD2 to other known breast cancer associated signaling pathways, including ERK, mTOR, and Akt signaling via PTPN13 mediated phosphorylation.

  20. The emerging role of histone lysine demethylases in prostate cancer

    Directory of Open Access Journals (Sweden)

    Crea Francesco

    2012-08-01

    Full Text Available Abstract Early prostate cancer (PCa is generally treatable and associated with good prognosis. After a variable time, PCa evolves into a highly metastatic and treatment-refractory disease: castration-resistant PCa (CRPC. Currently, few prognostic factors are available to predict the emergence of CRPC, and no curative option is available. Epigenetic gene regulation has been shown to trigger PCa metastasis and androgen-independence. Most epigenetic studies have focused on DNA and histone methyltransferases. While DNA methylation leads to gene silencing, histone methylation can trigger gene activation or inactivation, depending on the target amino acid residues and the extent of methylation (me1, me2, or me3. Interestingly, some histone modifiers are essential for PCa tumor-initiating cell (TIC self-renewal. TICs are considered the seeds responsible for metastatic spreading and androgen-independence. Histone Lysine Demethylases (KDMs are a novel class of epigenetic enzymes which can remove both repressive and activating histone marks. KDMs are currently grouped into 7 major classes, each one targeting a specific methylation site. Since their discovery, KDM expression has been found to be deregulated in several neoplasms. In PCa, KDMs may act as either tumor suppressors or oncogenes, depending on their gene regulatory function. For example, KDM1A and KDM4C are essential for PCa androgen-dependent proliferation, while PHF8 is involved in PCa migration and invasion. Interestingly, the possibility of pharmacologically targeting KDMs has been demonstrated. In the present paper, we summarize the emerging role of KDMs in regulating the metastatic potential and androgen-dependence of PCa. In addition, we speculate on the possible interaction between KDMs and other epigenetic effectors relevant for PCa TICs. Finally, we explore the role of KDMs as novel prognostic factors and therapeutic targets. We believe that studies on histone demethylation may add a

  1. Bacteriophage Lysin CF-301, a Potent Antistaphylococcal Biofilm Agent

    KAUST Repository

    Schuch, Raymond

    2017-05-02

    Biofilms pose a unique therapeutic challenge because of the antibiotic tolerance of constituent bacteria. Treatments for biofilm-based infections represent a major unmet medical need, requiring novel agents to eradicate mature biofilms. Our objective was to evaluate bacteriophage lysin CF-301 as a new agent to target Staphylococcus aureus biofilms. We used minimum biofilm-eradicating concentration (MBEC) assays on 95 S. aureus strains to obtain a 90% MBEC (MBEC90) value of <= 0.25 mu g/ml for CF-301. Mature biofilms of coagulase-negative staphylococci, Streptococcus pyogenes, and Streptococcus agalactiae were also sensitive to disruption, with MBEC90 values ranging from 0.25 to 8 mu g/ml. The potency of CF-301 was demonstrated against S. aureus biofilms formed on polystyrene, glass, surgical mesh, and catheters. In catheters, CF-301 removed all biofilm within 1 h and killed all released bacteria by 6 h. Mixed-species biofilms, formed by S. aureus and Staphylococcus epidermidis on several surfaces, were removed by CF-301, as were S. aureus biofilms either enriched for small-colony variants (SCVs) or grown in human synovial fluid. The antibacterial activity of CF-301 was further demonstrated against S. aureus persister cells in exponential-phase and stationary-phase populations. Finally, the antibiofilm activity of CF-301 was greatly improved in combinations with the cell wall hydrolase lysostaphin when tested against a range of S. aureus strains. In all, the data show that CF-301 is highly effective at disrupting biofilms and killing biofilm bacteria, and, as such, it may be an efficient new agent for treating staphylococcal infections with a biofilm component.

  2. Bacteriophage Lysin CF-301, a Potent Antistaphylococcal Biofilm Agent

    KAUST Repository

    Schuch, Raymond; Khan, Babar Khalid; Raz, Assaf; Rotolo, Jimmy A.; Wittekind, Michael

    2017-01-01

    Biofilms pose a unique therapeutic challenge because of the antibiotic tolerance of constituent bacteria. Treatments for biofilm-based infections represent a major unmet medical need, requiring novel agents to eradicate mature biofilms. Our objective was to evaluate bacteriophage lysin CF-301 as a new agent to target Staphylococcus aureus biofilms. We used minimum biofilm-eradicating concentration (MBEC) assays on 95 S. aureus strains to obtain a 90% MBEC (MBEC90) value of <= 0.25 mu g/ml for CF-301. Mature biofilms of coagulase-negative staphylococci, Streptococcus pyogenes, and Streptococcus agalactiae were also sensitive to disruption, with MBEC90 values ranging from 0.25 to 8 mu g/ml. The potency of CF-301 was demonstrated against S. aureus biofilms formed on polystyrene, glass, surgical mesh, and catheters. In catheters, CF-301 removed all biofilm within 1 h and killed all released bacteria by 6 h. Mixed-species biofilms, formed by S. aureus and Staphylococcus epidermidis on several surfaces, were removed by CF-301, as were S. aureus biofilms either enriched for small-colony variants (SCVs) or grown in human synovial fluid. The antibacterial activity of CF-301 was further demonstrated against S. aureus persister cells in exponential-phase and stationary-phase populations. Finally, the antibiofilm activity of CF-301 was greatly improved in combinations with the cell wall hydrolase lysostaphin when tested against a range of S. aureus strains. In all, the data show that CF-301 is highly effective at disrupting biofilms and killing biofilm bacteria, and, as such, it may be an efficient new agent for treating staphylococcal infections with a biofilm component.

  3. Amorphous Silica-Promoted Lysine Dimerization: a Thermodynamic Prediction

    Science.gov (United States)

    Kitadai, Norio; Nishiuchi, Kumiko; Nishii, Akari; Fukushi, Keisuke

    2018-03-01

    It has long been suggested that mineral surfaces played a crucial role in the abiotic polymerization of amino acids that preceded the origin of life. Nevertheless, it remains unclear where the prebiotic process took place on the primitive Earth, because the amino acid-mineral interaction and its dependence on environmental conditions have yet to be understood adequately. Here we examined experimentally the adsorption of L-lysine (Lys) and its dimer (LysLys) on amorphous silica over a wide range of pH, ionic strength, adsorbate concentration, and the solid/water ratio, and determined the reaction stoichiometries and the equilibrium constants based on the extended triple-layer model (ETLM). The retrieved ETLM parameters were then used, in combination with the equilibrium constant for the peptide bond formation in bulk water, to calculate the Lys-LysLys equilibrium in the presence of amorphous silica under various aqueous conditions. Results showed that the silica surface favors Lys dimerization, and the influence varies greatly with changing environmental parameters. At slightly alkaline pH (pH 9) in the presence of a dilute NaCl (1 mM), the thermodynamically attainable LysLys from 0.1 mM Lys reached a concentration around 50 times larger than that calculated without silica. Because of the versatility of the ETLM, which has been applied to describe a wide variety of biomolecule-mineral interactions, future experiments with the reported methodology are expected to provide a significant constraint on the plausible geological settings for the condensation of monomers to polymers, and the subsequent chemical evolution of life.

  4. Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.

    Directory of Open Access Journals (Sweden)

    V. O. Antonyuk

    2014-08-01

    Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3β-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid сhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric

  5. Characterization of Agronomy, Grain Physicochemical Quality, and Nutritional Property of High-Lysine 35R Transgenic Rice with Simultaneous Modification of Lysine Biosynthesis and Catabolism.

    Science.gov (United States)

    Yang, Qingqing; Wu, Hongyu; Li, Qianfeng; Duan, Ruxu; Zhang, Changquan; Sun, Samuel Saiming; Liu, Qiaoquan

    2017-05-31

    Lysine is the first limiting essential amino acid in rice. We previously constructed a series of transgenic rice lines to enhance lysine biosynthesis (35S), down-regulate its catabolism (Ri), or simultaneously achieve both metabolic effects (35R). In this study, nine transgenic lines, three from each group, were selected for both field and animal feeding trials. The results showed that the transgene(s) caused no obvious effects on field performance and main agronomic traits. Mature seeds of transgenic line 35R-17 contained 48-60-fold more free lysine than in wild type and had slightly lower apparent amylose content and softer gel consistency. Moreover, a 35-day feeding experiment showed that the body weight gain, food efficiency, and protein efficiency ratio of rats fed the 35R-17 transgenic rice diet were improved when compared with those fed wild-type rice diet. These data will be useful for further evaluation and potential commercialization of 35R high-lysine transgenic rice.

  6. Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

    International Nuclear Information System (INIS)

    Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

    2012-01-01

    Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

  7. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr

    2005-05-15

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.

  8. Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.

    Science.gov (United States)

    Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia

    2015-02-01

    For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from

  9. Effect of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel

    International Nuclear Information System (INIS)

    Palaniandavar, N.; Gnanam, F.D.; Ramasamy, P.

    1986-01-01

    The interrelated effects of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel medium have been investigated. The main parameters are concentration of electrolytes, pH of the medium, density of the gel, the concentration of parasitic electrolyte and the concentration of additives. The pattern formation is explained on the basis of electrical double layer theory coupled with diffusion. Using Shinohara's revised coagulation concept, the flocculation value is calculated. With suitable combinations of parameter values, dendritic growth and spherulitic growth of cadmium hydroxide crystals have been observed. (author)

  10. Biofilm Removal and Antimicrobial Activities of Agar Hydrogel Containing Colloid Nano-Silver against Staphylococcus aureus and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Leyla Sadat Bouryabaf

    2017-10-01

    Full Text Available Background:    Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods:      The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results:    The MIC value was 125 µg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion:     We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.

  11. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  12. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  13. The Preventive Effect of L-Lysine on Lysozyme Glycation in Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Hossein Mirmiranpour

    2016-01-01

    Full Text Available Lysozyme is a bactericidal enzyme whose structure and functions change in diabetes. Chemical chaperones are small molecules including polyamines (e.g. spermine, amino acids (e.g. L-lysine and polyols (e.g. glycerol. They can improve protein conformation in several stressful conditions such as glycation. In this study, the authors aimed to observe the effect of L-lysine as a chemical chaperone on structure and function of glycated lysozyme. In this study, in vitro and in vivo effects of L-lysine on lysozyme glycation were investigated. Lysozyme was incubated with glucose and/or L-lysine, followed by an investigation of its structure by electrophoresis, fluorescence spectroscopy, and circular dichroism spectroscopy and also assessment of its bactericidal activity against M. lysodeikticus. In the clinical trial, patients with type 2 diabetes mellitus (T2DM were randomly divided into two groups of 25 (test and control. All patients received metformin and glibenclamide for a three months period. The test group was supplemented with 3 g/day of L-lysine. The quantity and activity of lysozyme and other parameters were then measured. Among the test group, L-lysine was found to reduce the advanced glycation end products (AGEs in the sera of patients with T2DM and in vitro condition. This chemical chaperone reversed the alteration in lysozyme structure and function due to glycation and resulted in increased lysozyme activity. Structure and function of glycated lysozyme are significantly improved by l-lysine; therefore it can be considered an effective therapeutic supplementation in T2DM, decreasing the risk of infection in these patients.

  14. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen

    2012-01-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

    Science.gov (United States)

    Kim, Kyunghoon; Kim, Jung Kyung

    2015-08-26

    Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

  16. Mechanical and water barrier properties of agar/κ-carrageenan/konjac glucomannan ternary blend biohydrogel films.

    Science.gov (United States)

    Rhim, Jong-Whan; Wang, Long-Feng

    2013-07-01

    Multicomponent hydrogel films composed of agar, κ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(®) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and κ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Gamma radiation effect on agar viscosity for use in food industry

    International Nuclear Information System (INIS)

    Aliste, Antonio J.; Del Mastro, Nelida L.

    1999-01-01

    The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)

  18. Mechanical response of agar gel irradiated with Nd:YAG nanosecond laser pulses

    Science.gov (United States)

    Pérez-Gutiérrez, Francisco G.; Evans, Rodger; Camacho-López, Santiago; Aguilar, Guillermo

    2010-02-01

    Nanosecond long laser pulses are used in medical applications where precise tissue ablation with minimal thermal and mechanical collateral damage is required. When a laser pulse is incident on a material, optical energy will be absorbed by a combination of linear and nonlinear absorption according to both: laser light intensity and material properties. In the case of water or gels, the first results in heat generation and thermoelastic expansion; while the second results in an expanding plasma formation that launches a shock wave and a cavitation/boiling bubble. Plasma formation due to nonlinear absorption of nanosecond laser pulses is originated by a combination of multiphoton ionization and thermionic emission of free electrons, which is enhanced when the material has high linear absorption coefficient. In this work, we present measurements of pressure transients originated when 6 ns laser pulses are incident on agar gels with varying linear absorption coefficient, mechanical properties and irradiation geometry using laser radiant exposures above threshold for bubble formation. The underlying hypothesis is that pressure transients are composed of the superposition of both: shock wave originated by hot expanding plasma resulting from nonlinear absorption of optical energy and, thermoelastic expansion originated by heat generation due to linear absorption of optical energy. The objective of this work is to evaluate the relative contribution of each absorption mechanism to mechanical effects in agar gel. Real time pressure transients are recorded with PVDF piezoelectric sensors and time-resilved imaging from 50 μm to 10 mm away from focal point.

  19. An agar gel membrane-PDMS hybrid microfluidic device for long term single cell dynamic study.

    Science.gov (United States)

    Wong, Ieong; Atsumi, Shota; Huang, Wei-Chih; Wu, Tung-Yun; Hanai, Taizo; Lam, Miu-Ling; Tang, Ping; Yang, Jian; Liao, James C; Ho, Chih-Ming

    2010-10-21

    Significance of single cell measurements stems from the substantial temporal fluctuations and cell-cell variability possessed by individual cells. A major difficulty in monitoring surface non-adherent cells such as bacteria and yeast is that these cells tend to aggregate into clumps during growth, obstructing the tracking or identification of single-cells over long time periods. Here, we developed a microfluidic platform for long term single-cell tracking and cultivation with continuous media refreshing and dynamic chemical perturbation capability. The design highlights a simple device-assembly process between PDMS microchannel and agar membrane through conformal contact, and can be easily adapted by microbiologists for their routine laboratory use. The device confines cell growth in monolayer between an agar membrane and a glass surface. Efficient nutrient diffusion through the membrane and reliable temperature maintenance provide optimal growth condition for the cells, which exhibited fast exponential growth and constant distribution of cell sizes. More than 24 h of single-cell tracking was demonstrated on a transcription-metabolism integrated synthetic biological model, the gene-metabolic oscillator. Single cell morphology study under alcohol toxicity allowed us to discover and characterize cell filamentation exhibited by different E. coli isobutanol tolerant strains. We believe this novel device will bring new capabilities to quantitative microbiology, providing a versatile platform for single cell dynamic studies.

  20. Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.

    Directory of Open Access Journals (Sweden)

    Lai Kuan Tan

    Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.

  1. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane

    2012-12-26

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.

    Science.gov (United States)

    Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen

    2013-02-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. An electrochemical approach to monitor pH change in agar media during plant tissue culture.

    Science.gov (United States)

    Wang, Min; Ha, Yang

    2007-05-15

    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  4. Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp

    Science.gov (United States)

    Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin

    2014-01-01

    Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941

  5. Effect of different levels of lysine in the diet of broilers on the metabolism of /sup 35/S-methionine

    Energy Technology Data Exchange (ETDEWEB)

    Stanchev, Kh; Venkov, T; Dzharova, M [Akademiya na Selskostopanskite Nauki, Sofia-Kostinbrod (Bulgaria). Inst. po Zhivotnovydstvo

    1974-01-01

    The lack of balance of the ration with respect to lysine leads to a decrease in the rate of incorporation of /sup 35/S-methionine in the liver, pancreas, kidney and femoral muscle. Most intensive protein synthesis in the liver of chickens is observed in the group receiving ration balanced with respect to lysine while in the case of a deficiency or excess of lysine the protein biosynthesis drops. The deficiency or excess of lysine leads to an increase in the excretion rate and decreases the assimilability of radioactive methionine in the chickens organisms. (INIS)

  6. Enhanced Amelioration of High-Fat Diet-Induced Fatty Liver by Docosahexaenoic Acid and Lysine Supplementations

    Directory of Open Access Journals (Sweden)

    Hsin-Yu Lin

    2014-01-01

    Full Text Available Fatty liver disease is the most common pathological condition in the liver. Here, we generated high-fat diet-(HFD- induced nonalcoholic fatty liver disease (NAFLD in mice and tested the effects of docosahexaenoic acid (DHA and lysine during a four-week regular chow (RCfeeding. Our results showed that 1% lysine and the combination of 1% lysine + 1% DHA reduced body weight. Moreover, serum triglyceride levels were reduced by 1% DHA and 1% lysine, whereas serum alanine transaminase activity was reduced by 1% DHA and 1% DHA + 0.5% lysine. Switching to RC reduced hepatic lipid droplet accumulation, which was further reduced by the addition of DHA or lysine. Furthermore, the mRNA expressions of hepatic proinflammatory cytokines were suppressed by DHA and combinations of DHA + lysine, whereas the mRNA for the lipogenic gene, acetyl-CoA carboxylase 1 (ACC1, was suppressed by DHA. In the gonadal adipose tissues, combinations of DHA and lysine inhibited mRNA expression of lipid metabolism-associated genes, including ACC1, fatty acid synthase, lipoprotein lipase, and perilipin. In conclusion, the present study demonstrated that, in conjunction with RC-induced benefits, supplementation with DHA or lysine further ameliorated the high-fat diet-induced NAFLD and provided an alternative strategy to treat, and potentially prevent, NAFLD.

  7. Effect of varying dietary concentrations of lysine on growth performance of the Pearl Grey guinea fowl.

    Science.gov (United States)

    Bhogoju, S; Nahashon, S N; Donkor, J; Kimathi, B; Johnson, D; Khwatenge, C; Bowden-Taylor, T

    2017-05-01

    Lysine is the second limiting essential amino acid in poultry nutrition after methionine. Understanding the lysine requirement of poultry is necessary in guiding formulation of least cost diets that effectively meet the nutritional needs of individual birds. The lysine requirement of the Pearl Grey guinea fowl (PGGF) is not known. Therefore, the objective of this study was to assess the appropriate lysine levels required for optimal growth attributes of the PGGF. In a 12-week study, 512 one-day-old Pearl Grey guinea keets were weighed individually and randomly assigned to electrically heated battery brooders. Each battery contained 12 compartments housing 15 birds each. Eight diets fed to the experimental birds consisted of corn-soybean meal and contained 0.80 to 1.22 digestible lysine in 0.06% increments. Feed and water were provided at free choice and the diets were replicated twice. Experimental diets contained 3,100 Kcal metabolizable energy (ME)/kg diet and 23% crude protein (CP), 3,150 ME Kcal ME/kg diet and 21% CP, and 3,100 ME/kg and 17% CP, at zero to 4, 5 to 10, and 11 to 12 weeks of age (WOA), respectively. Birds were provided water ad libitum and a 23:1 and 8:16-hr (light:dark) regimen at zero to 8 and 9 to 12 WOA, respectively. Birds were weighed weekly, and body weight gain, feed consumption, and feed conversions were determined. Data were analyzed using the General Linear Model (GLM) procedures of SAS (2002) with dietary lysine as treatment effect. Females responded better to diets containing 1.04 and 0.8% lysine from hatch to 4 and 5 to 12 WOA, respectively. Males responded better to diets containing 1.10 and 0.8% lysine at hatch to 4 WOA and 5 to 12 WOA, respectively. Therefore, we recommend that PGGF females and males be fed diets containing 1.04 and 1.10%, respectively, at hatch to 4 WOA and 0.80% lysine at 5 to 12 WOA. The diets should be supplied in phases. © 2016 Poultry Science Association Inc.

  8. Effect of exogenous CNT on kinetics of 3H-lysine in haerbin white rabbits

    International Nuclear Information System (INIS)

    Liu Dengke; Zan Linsen; Liu Yongfeng

    2007-01-01

    Haerbin White rabbits was used as testimonial and trace kinetics and radioimmunoassay and other techniques were used to study the distribution, transportation and metabolism of 3 H-Lysine in the animal. The metabolic kinetics of 3 H-Lysine could be described by the follows equation: (Y-circumflex) (t) =983.6281e -0.021935t + 1773.9999e -0.083932t - 983.6281e -0.432590t - 0773.9999e -0.050399t + 300.2820. Experimental results showed that 3 H-Lysine was accumulated mainly in kidney, heart, liver, spleen and muscle in check group; accumulated mainly in muscle, stomach, liver, heart and genitalia in cAMP treated group; accumulated in bladder, muscle, lung and intestine in cGMP treated group; and accumulated mainly in muscle, bladder, genitalia an fat in cAMP + cGMP treated group, respectively. The distribution of 3 H-Lysine was of evidently variations being treated with exogenous CNT. The results indicated that the distribution, transportation and metabolism of 3 H-Lysine were significantly affected by exogenous CNT in the Haerbin White rabbit. (authors)

  9. Detection of DNA and poly-l-lysine using CVD graphene-channel FET biosensors

    International Nuclear Information System (INIS)

    Kakatkar, Aniket; Craighead, H G; Abhilash, T S; Alba, R De; Parpia, J M

    2015-01-01

    A graphene channel field-effect biosensor is demonstrated for detecting the binding of double-stranded DNA and poly-l-lysine. Sensors consist of chemical vapor deposition graphene transferred using a clean, etchant-free transfer method. The presence of DNA and poly-l-lysine are detected by the conductance change of the graphene transistor. A readily measured shift in the Dirac voltage (the voltage at which the graphene’s resistance peaks) is observed after the graphene channel is exposed to solutions containing DNA or poly-l-lysine. The ‘Dirac voltage shift’ is attributed to the binding/unbinding of charged molecules on the graphene surface. The polarity of the response changes to positive direction with poly-l-lysine and negative direction with DNA. This response results in detection limits of 8 pM for 48.5 kbp DNA and 11 pM for poly-l-lysine. The biosensors are easy to fabricate, reusable and are promising as sensors of a wide variety of charged biomolecules. (paper)

  10. Critical lysine residues of Klf4 required for protein stabilization and degradation

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Key-Hwan; Kim, So-Ra; Ramakrishna, Suresh; Baek, Kwang-Hyun, E-mail: baek@cha.ac.kr

    2014-01-24

    Highlights: • Klf4 undergoes the 26S proteasomal degradation by ubiquitination on its multiple lysine residues. • Essential Klf4 ubiquitination sites are accumulated between 190–263 amino acids. • A mutation of lysine at 232 on Klf4 elongates protein turnover. • Klf4 mutants dramatically suppress p53 expression both under normal and UV irradiated conditions. - Abstract: The transcription factor, Krüppel-like factor 4 (Klf4) plays a crucial role in generating induced pluripotent stem cells (iPSCs). As the ubiquitination and degradation of the Klf4 protein have been suggested to play an important role in its function, the identification of specific lysine sites that are responsible for protein degradation is of prime interest to improve protein stability and function. However, the molecular mechanism regulating proteasomal degradation of the Klf4 is poorly understood. In this study, both the analysis of Klf4 ubiquitination sites using several Klf4 deletion fragments and bioinformatics predictions showed that the lysine sites which are signaling for Klf4 protein degradation lie in its N-terminal domain (aa 1–296). The results also showed that Lys32, 52, 232, and 252 of Klf4 are responsible for the proteolysis of the Klf4 protein. These results suggest that Klf4 undergoes proteasomal degradation and that these lysine residues are critical for Klf4 ubiquitination.

  11. Studies of lysine cyclodeaminase from Streptomyces pristinaespiralis: Insights into the complex transition NAD+ state.

    Science.gov (United States)

    Ying, Hanxiao; Wang, Jing; Shi, Ting; Zhao, Yilei; Wang, Xin; Ouyang, Pingkai; Chen, Kequan

    2018-01-01

    Lysine cyclodeaminase (LCD) catalyzes the piperidine ring formation in macrolide-pipecolate natural products metabolic pathways from a lysine substrate through a combination of cyclization and deamination. This enzyme belongs to a unique enzyme class, which uses NAD + as the catalytic prosthetic group instead of as the co-substrate. To understand the molecular details of NAD + functions in lysine cyclodeaminase, we have determined four ternary crystal structure complexes of LCD-NAD + with pipecolic acid (LCD-PA), lysine (LCD-LYS), and an intermediate (LCD-INT) as ligands at 2.26-, 2.00-, 2.17- and 1.80 Å resolutions, respectively. By combining computational studies, a NAD + -mediated "gate keeper" function involving NAD + /NADH and Arg49 that control the binding and entry of the ligand lysine was revealed, confirming the critical roles of NAD + in the substrate access process. Further, in the gate opening form, a substrate delivery tunnel between ε-carboxyl moiety of Glu264 and the α-carboxyl moiety of Asp236 was observed through a comparison of four structure complexes. The LCD structure details including NAD + -mediated "gate keeper" and substrate tunnel may assist in the exploration the NAD + function in this unique enzyme class, and in regulation of macrolide-pipecolate natural product synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Antibacterial activity of a newly developed peptide-modified lysin against Acinetobacter baumannii and Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Hang eYang

    2015-12-01

    Full Text Available The global emergence of multidrug-resistant (MDR bacteria is a growing threat to public health worldwide. Natural bacteriophage lysins are promising alternatives in the treatment of infections caused by Gram-positive pathogens, but not Gram-negative ones, like Acinetobacter baumannii and Pseudomonas aeruginosa, due to the barriers posed by their outer membranes. Recently, modifying a natural lysin with an antimicrobial peptide was found able to break the barriers, and to kill Gram-negative pathogens. Herein, a new peptide-modified lysin (PlyA was constructed by fusing the cecropin A peptide residues 1–8 (KWKLFKKI with the OBPgp279 lysin and its antibacterial activity was studied. PlyA showed good and broad antibacterial activities against logarithmic phase A. baumannii and P. aeruginosa, but much reduced activities against the cells in stationary phase. Addition of outer membrane permeabilizers (EDTA and citric acid could enhance the antibacterial activity of PlyA against stationary phase cells. Finally, no antibacterial activity of PlyA could be observed in some bio-matrices, such as culture media, milk, and sera. In conclusion, we reported here a novel peptide-modified lysin with significant antibacterial activity against both logarithmic (without OMPs and stationary phase (with OMPs A. baumannii and P. aeruginosa cells in buffer, but further optimization is needed to achieve broad activity in diverse bio-matrices.

  13. SucStruct: Prediction of succinylated lysine residues by using structural properties of amino acids.

    Science.gov (United States)

    López, Yosvany; Dehzangi, Abdollah; Lal, Sunil Pranit; Taherzadeh, Ghazaleh; Michaelson, Jacob; Sattar, Abdul; Tsunoda, Tatsuhiko; Sharma, Alok

    2017-06-15

    Post-Translational Modification (PTM) is a biological reaction which contributes to diversify the proteome. Despite many modifications with important roles in cellular activity, lysine succinylation has recently emerged as an important PTM mark. It alters the chemical structure of lysines, leading to remarkable changes in the structure and function of proteins. In contrast to the huge amount of proteins being sequenced in the post-genome era, the experimental detection of succinylated residues remains expensive, inefficient and time-consuming. Therefore, the development of computational tools for accurately predicting succinylated lysines is an urgent necessity. To date, several approaches have been proposed but their sensitivity has been reportedly poor. In this paper, we propose an approach that utilizes structural features of amino acids to improve lysine succinylation prediction. Succinylated and non-succinylated lysines were first retrieved from 670 proteins and characteristics such as accessible surface area, backbone torsion angles and local structure conformations were incorporated. We used the k-nearest neighbors cleaning treatment for dealing with class imbalance and designed a pruned decision tree for classification. Our predictor, referred to as SucStruct (Succinylation using Structural features), proved to significantly improve performance when compared to previous predictors, with sensitivity, accuracy and Mathew's correlation coefficient equal to 0.7334-0.7946, 0.7444-0.7608 and 0.4884-0.5240, respectively. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Estimation of Digestible Lysine Requirements of Japanese Quail during the Starter Period

    Directory of Open Access Journals (Sweden)

    M Ashoori

    2013-11-01

    Full Text Available The aim of this study was the estimation of digestible lysine requirements of Japanese quail during the 7-21d period. Graduation level of L-lysine.HCL were added to the basal diet at the expense of corn starch to create different levels of digestible lysine ranged from 0.75 to 1.35% of diet. Growth performance and carcass composition were evaluated during the experiment. The results showed that incremental levels of digestible lysine significantly affected the body weight gain (BWG, feed conversion ratio (FCR, feed intake (FI, breast meat yield (BMY and thigh meat yield (TMY. Either linear broken- line or quadratic broken line model were used to get break points of digestible lysine as a requirement. Based on linear broken line analysis, the break points for FCR and BMY were 0.99 and 1.04 % of diet, respectively. Using the quadratic broken-line model, the estimated Lys requirements for BWG, FCR, and BMY were 1.11, 1.04, and 1.15% of diet, respectively. The results showed that the Lys needs for optimum BMY was higher than BWG and FCR.

  15. Effect of Selected Plant Extracts and D- and L-Lysine on the Cyanobacterium Microcystis aeruginosa

    Directory of Open Access Journals (Sweden)

    Miquel Lürling

    2014-06-01

    Full Text Available We tested extracts from Fructus mume, Salvia miltiorrhiza and Moringa oleifera as well as L-lysine and D-Lysine as curative measures to rapidly suppress the cyanobacterium Microcystis aeruginosa NIVA-CYA 43. We tested these compounds under similar conditions to facilitate comparisons. We hypothesized that for each compound, relatively low concentrations—i.e., 5–50 mg L−1, would reduce M. aeruginosa biomass. At these low concentrations, only L-lysine caused a decline in M. aeruginosa biomass at ≥4.3 mg L−1. F. mume extract was effective to do so at high concentrations, i.e., at ≥240 mg L−1, but the others were virtually non-effective. Low pH caused by organic acids is a probable explanation for the effect of F. mume extract. No complete wipe-outs of the experimental population were achieved as Photosystem II efficiency showed a recovery after six days. L-lysine may be effective at low concentrations—meaning low material costs. However, the effect of L-lysine seems relatively short-lived. Overall, the results of our study did not support the use of the tested plant extracts and amino-acid as promising candidates for curative application in M. aeruginosa bloom control.

  16. Purification and properties of fructosyl lysine oxidase from Fusarium oxysporum S-1F4.

    Science.gov (United States)

    Sakai, Y; Yoshida, N; Isogai, A; Tani, Y; Kato, N

    1995-03-01

    Fructosyl lysine oxidase (FLOD) was examined for its use in the enzymatic measurement of the level of glycated albumin in blood serum. To isolate microorganisms having such an enzyme activity, we used N epsilon-fructosyl N alpha-Z-lysine (epsilon-FL) as a sole nitrogen source in the enrichment culture medium. The isolated fungus, strain S-1F4, showed a high FLOD activity in the cell-free extract and was identified as Fusarium oxysporum. FLOD was purified to an apparent homogeneity on SDS-PAGE. The molecular mass of the subunit was 50 kDa on SDS-PAGE and seemed to exist in a monomeric form. The enzyme had an absorption spectrum characteristic of a flavoprotein and the flavin was found to be covalently bound to the enzyme. The enzyme acted against N epsilon-fructosyl N alpha-Z-lysine and N alpha-fructosyl N epsilon-Z-lysine and showed specificity for fructosyl lysine residues.

  17. Extraction and LC determination of lysine clonixinate salt in water/oil microemulsions.

    Science.gov (United States)

    Pineros, I; Ballesteros, P; Lastres, J L

    2002-02-01

    A new reversed-phase high performance liquid chromatography method has been developed and validated for the quantitative determination of lysine clonixinate salt in water/oil microemulsions. The mobile phase was acetonitrile-buffer phosphate pH 3.3. Detection was UV absorbance at 252 nm. The precision and accurately of the method were excellent. The established linearity range was 5-60 microg ml(-1) (r(2)=0.999). Microemulsions samples were dispersed with chloroform and extracted lysine clonixinate salt with water. This easy method employing chloroformic extraction has been done three times. The recovery of lysine clonixinate salt from spiked placebo and microemulsion were >90% over the linear range.

  18. The course of protein synthesis during grain filling in normal and high lysine barley

    International Nuclear Information System (INIS)

    Giese, H.; Andersen, B.

    1984-01-01

    A study of the course of protein synthesis during grain filling in Bomi and the high lysine barleys Hily 82/3 and Risoe 56 showed that the four salt-soluble proteins, protein Z, β-amylase and the chymotrypsin inhibitors CI-1 and CI-2, are synthesized in greater amounts earlier in the high lysine lines than in Bomi. On the other hand, the hordeins are synthesized in greater amounts earlier during grain filling in Bomi than in Hily 82/3 and Risoe 56. There is no indication of a significant reduction of total protein synthesis in the high lysine lines compared with the standard lines Bomi and Pirrka. Hily 82/3 and Risoe 56 are very similar in protein composition in that they have a lower hordein content and higher levels, particularly of β-amylase and the chymotrypsin inhibitors, than Bomi. (author)

  19. [Expression of the genes for lysine biosynthesis of Bacillus subtilis in Escherichia coli cells].

    Science.gov (United States)

    Shevchenko, T N; Okunev, O V; Aleksieva, Z M; Maliuta, S S

    1984-01-01

    Hybrid plasmids pLRS33 and pLRB4 containing Bac. subtilis genes coding lysin biosynthesis were subjected to genetical analysis. It is shown that after pLRS33- and pLRB4- transformation of E. coli strains, auxotrophic relative to lysin and diaminopimelic acid, there occurs complementation of dapA, dapB, dapC, dapD, dapE, lysA mutations by plasmid pLRS33 and of dapC, dapB, lysA mutations by plasmid pLRB4. The plasmids are studied for their influence on the level of lysin and its precurror synthesis in E. coli strains.

  20. Genetic Analysis of Diaminopimelic Acid- and Lysine-Requiring Mutants of Escherichia coli1

    Science.gov (United States)

    Bukhari, Ahmad I.; Taylor, Austin L.

    1971-01-01

    Several diaminopimelic acid (DAP)- and lysine-requiring mutants of Escherichia coli were isolated and studied by genetic, physiological, and biochemical means. The genes concerned with DAP-lysine synthesis map at several different sites on the E. coli chromosome and, therefore, do not constitute a single operon. Three separate loci affecting DAP synthesis are located in the 0 to 2.5 min region of the genetic map. The order of the loci in this region is thr-dapB-pyrA-ara-leu-pan-dapC-tonA-dapD. Two additional DAP genes map in the region between min 47 and 48, with the gene order being gua-dapA-dapE-ctr. The lys locus at min 55 determines the synthesis of the enzyme DAP decarboxylase, which catalyzes the conversion of DAP into lysine. The order of the genes in this region is serA-lysA-thyA. PMID:4926684

  1. Genetic analysis of diaminopimelic acid- and lysine-requiring mutants of Escherichia coli.

    Science.gov (United States)

    Bukhari, A I; Taylor, A L

    1971-03-01

    Several diaminopimelic acid (DAP)- and lysine-requiring mutants of Escherichia coli were isolated and studied by genetic, physiological, and biochemical means. The genes concerned with DAP-lysine synthesis map at several different sites on the E. coli chromosome and, therefore, do not constitute a single operon. Three separate loci affecting DAP synthesis are located in the 0 to 2.5 min region of the genetic map. The order of the loci in this region is thr-dapB-pyrA-ara-leu-pan-dapC-tonA-dapD. Two additional DAP genes map in the region between min 47 and 48, with the gene order being gua-dapA-dapE-ctr. The lys locus at min 55 determines the synthesis of the enzyme DAP decarboxylase, which catalyzes the conversion of DAP into lysine. The order of the genes in this region is serA-lysA-thyA.

  2. Insight into the collagen assembly in the presence of lysine and glutamic acid: An in vitro study

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xinhua; Dan, Nianhua [Key Laboratory for Leather Chemistry and Engineering of the Education Ministry, Sichuan University, Chengdu, Sichuan 610065 (China); Research Center of Biomedical Engineering, Sichuan University, Chengdu, Sichuan 610065 (China); Dan, Weihua, E-mail: danweihua_scu@126.com [Key Laboratory for Leather Chemistry and Engineering of the Education Ministry, Sichuan University, Chengdu, Sichuan 610065 (China); Research Center of Biomedical Engineering, Sichuan University, Chengdu, Sichuan 610065 (China)

    2017-01-01

    The aim of this study is to evaluate the effects of two different charged amino acids in collagen chains, lysine and glutamic acid, on the fibrillogenesis process of collagen molecules. The turbidity, zeta potential, and fiber diameter analysis suggest that introducing the positively charged lysine into collagen might improve the sizes or amounts of the self-assembled collagen fibrils significantly. Conversely, the negatively charged glutamic acid might restrict the self-assembly of collagen building blocks into a higher order structure. Meanwhile, the optimal fibrillogenesis condition is achieved when the concentration of lysine reaches to 1 mM. Both scanning electron microscopy (SEM) and atomic force microscope (AFM) analysis indicates that compared to pure collagen fibrils, the reconstructed collagen-lysine co-fibrils exhibit a higher degree of inter-fiber entanglements with more straight and longer fibrils. Noted that the specific D-period patterns of the reconstructed collagen fibrils could be clearly discernible and the width of D-banding increases steadily after introducing lysine. Besides, the kinetic and thermodynamic collagen self-assembly analysis confirms that the rate constants of both the first and second assembly phase decrease after introducing lysine, and lysine could promote the process of collagen fibrillogenesis obeying the laws of thermodynamics. - Highlights: • The effects of two different charged amino acids in collagen chains on the collagen fibrillogenesis were evaluated. • The positively charged lysine could improve the sizes or amounts of self-assembled collagen fibrils. • The width of D-banding of the collagen-lysine co-fibrils increased steadily after introducing lysine. • The optimal fibrillogenesis was achieved when the concentration of lysine reached to 1 mM. • The kinetic and thermodynamic collagen self-assembly were both analyzed.

  3. Colonyzer: automated quantification of micro-organism growth characteristics on solid agar

    Directory of Open Access Journals (Sweden)

    Young Alexander

    2010-05-01

    Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by

  4. Effect of lysine clonixinate on the pharmacokinetics and anticoagulant activity of phenprocoumon.

    Science.gov (United States)

    Russmann, S; Dilger, K; Trenk, D; Nagyivanyi, P; Jähnchen, E

    2001-11-01

    The effect of the non-steroidal anti-inflammatory drug lysine clonixinate ([2-(3-chloro-o-toluidino)nicotinic acid]-L-lysinate, CAS 55837-30-4) on the pharmacokinetics and anticoagulant activity of phenprocoumon (4-hydroxy-3-(1-phenylpropyl)-coumarin, CAS 435-97-2) was investigated in an open, randomised, two-fold, cross-over study in 12 healthy male volunteers. These subjects received a single dose of 18 mg phenprocoumon without or with concomitant treatment with lysine clonixinate (125 mg five times a day for 3 days before and 13 days after ingestion of a single dose of phenprocoumon). Pharmacokinetic parameters of phenprocoumon following oral administration were: CL/f: 0.779 +/- 0.157 ml/min, half-life of elimination: 147.2 +/- 19.9 h; free fraction in serum: 0.51 +/- 0.20%. These parameters were not significantly altered by concomitant treatment with lysine clonixinate. Prothrombin time increased from 13.3 +/- 1.3 s (at time 0) to 17.7 +/- 2.7 s following phenprocoumon and from 13.3 +/- 1.2 s to 18.0 +/- 2.2 s following combined administration. Prothrombin time returned to the pretreatment values 240 h after administration of phenprocoumon. The integrated effect (AUEC0-288 h) was identical following both treatments (4.303 +/- 461 and 4.303 +/- 312 s x h for phenprocoumon alone and phenprocoumon with lysine clonixinate, respectively). Thus, lysine clonixinate administered in therapeutic doses does not affect the pharmacokinetics and anticoagulant activity of phenproxoumon.

  5. The effect of gamma irradiation on the lysine content of plants

    International Nuclear Information System (INIS)

    Benedekne-Lazar, M.

    1979-01-01

    It has been proved by studies on the physiological effect of ionizing irradiation that in plant metabolism important changes take place. From the endosperm of seven-day-old seedlings 14 C-L-Lysine is transported faster to organs, especially to shoots and its incorporation into protein is also more intensive. The animation of the growth of roots and shoots can be observed on 14-day-old plants grown in water culture. In sand culture a surplus in dry weight can be experienced after 56 days for maize, under the influence of 100 rad. Two soybean varieties (Merit, Clay) responded different to irradiation. The dry weight of the Merit variety was increased significantly by 500 and 1000 rad, whereas that of the Clay variety decreased or did not change significantly. The lysine content of plants changes in the function of growth. In the case of the two maize varieties (Szegedi sarga, KSC 360) treatments with 1000 and 5000 rad resulted in an essential surplus of the total lysine content (46.25 and 31.21%, respectively). The total lysine content of the Merit variety has been increased by about 23.9% and 20.92%, respectively. 5000 rad treatment resulted in a negative correlation (-0.77) in the shoots. The total lysine content of the Clay plants was lower than that of the control. Under the influence of 500 and 1000 rad treatments the total lysine content of the shoots of the Merit variety grown in fields increased to a lesser extent (16.82 and 3.19 respectively) than that of plants grown in a climate room. (author)

  6. Comprehensive assessment of the L-lysine production process from fermentation of sugarcane molasses.

    Science.gov (United States)

    Anaya-Reza, Omar; Lopez-Arenas, Teresa

    2017-07-01

    L-Lysine is an essential amino acid that can be produced by chemical processes from fossil raw materials, as well as by microbial fermentation, the latter being a more efficient and environmentally friendly procedure. In this work, the production process of L-lysine-HCl is studied using a systematic approach based on modeling and simulation, which supports decision making in the early stage of process design. The study considers two analysis stages: first, the dynamic analysis of the fermentation reactor, where the conversion of sugars from sugarcane molasses to L-lysine with a strain of Corynebacterium glutamicum is carried out. In this stage, the operation mode (either batch or fed batch) and operating conditions of the fermentation reactor are defined to reach the maximum technical criteria. Afterwards, the second analysis stage relates to the industrial production process of L-lysine-HCl, where the fermentation reactor, upstream processing, and downstream processing are included. In this stage, the influence of key parameters on the overall process performance is scrutinized through the evaluation of several technical, economic, and environmental criteria, to determine a profitable and sustainable design of the L-lysine production process. The main results show how the operating conditions, process design, and selection of evaluation criteria can influence in the conceptual design. The best plant design shows maximum product yield (0.31 g L-lysine/g glucose) and productivity (1.99 g/L/h), achieving 26.5% return on investment (ROI) with a payback period (PBP) of 3.8 years, decreasing water and energy consumption, and with a low potential environmental impact (PEI) index.

  7. Lysine and Leucine Deficiencies Affect Myocytes Development and IGF Signaling in Gilthead Sea Bream (Sparus aurata.

    Directory of Open Access Journals (Sweden)

    Sheida Azizi

    Full Text Available Optimizing aquaculture production requires better knowledge of growth regulation and improvement in diet formulation. A great effort has been made to replace fish meal for plant protein sources in aquafeeds, making necessary the supplementation of such diets with crystalline amino acids (AA to cover the nutritional requirements of each species. Lysine and Leucine are limiting essential AA in fish, and it has been demonstrated that supplementation with them improves growth in different species. However, the specific effects of AA deficiencies in myogenesis are completely unknown and have only been studied at the level of hepatic metabolism. It is well-known that the TOR pathway integrates the nutritional and hormonal signals to regulate protein synthesis and cell proliferation, to finally control muscle growth, a process also coordinated by the expression of myogenic regulatory factors (MRFs. This study aimed to provide new information on the impact of Lysine and Leucine deficiencies in gilthead sea bream cultured myocytes examining their development and the response of insulin-like growth factors (IGFs, MRFs, as well as key molecules involved in muscle growth regulation like TOR. Leucine deficiency did not cause significant differences in most of the molecules analyzed, whereas Lysine deficiency appeared crucial in IGFs regulation, decreasing significantly IGF-I, IGF-II and IGF-IRb mRNA levels. This treatment also down-regulated the gene expression of different MRFs, including Myf5, Myogenin and MyoD2. These changes were also corroborated by a significant decrease in proliferation and differentiation markers in the Lysine-deficient treatment. Moreover, both Lysine and Leucine limitation induced a significant down-regulation in FOXO3 gene expression, which deserves further investigation. We believe that these results will be relevant for the production of a species as appreciated for human consumption as it is gilthead sea bream and demonstrates

  8. Characterisation of the first enzymes committed to lysine biosynthesis in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Michael D W Griffin

    Full Text Available In plants, the lysine biosynthetic pathway is an attractive target for both the development of herbicides and increasing the nutritional value of crops given that lysine is a limiting amino acid in cereals. Dihydrodipicolinate synthase (DHDPS and dihydrodipicolinate reductase (DHDPR catalyse the first two committed steps of lysine biosynthesis. Here, we carry out for the first time a comprehensive characterisation of the structure and activity of both DHDPS and DHDPR from Arabidopsis thaliana. The A. thaliana DHDPS enzyme (At-DHDPS2 has similar activity to the bacterial form of the enzyme, but is more strongly allosterically inhibited by (S-lysine. Structural studies of At-DHDPS2 show (S-lysine bound at a cleft between two monomers, highlighting the allosteric site; however, unlike previous studies, binding is not accompanied by conformational changes, suggesting that binding may cause changes in protein dynamics rather than large conformation changes. DHDPR from A. thaliana (At-DHDPR2 has similar specificity for both NADH and NADPH during catalysis, and has tighter binding of substrate than has previously been reported. While all known bacterial DHDPR enzymes have a tetrameric structure, analytical ultracentrifugation, and scattering data unequivocally show that At-DHDPR2 exists as a dimer in solution. The exact arrangement of the dimeric protein is as yet unknown, but ab initio modelling of x-ray scattering data is consistent with an elongated structure in solution, which does not correspond to any of the possible dimeric pairings observed in the X-ray crystal structure of DHDPR from other organisms. This increased knowledge of the structure and function of plant lysine biosynthetic enzymes will aid future work aimed at improving primary production.

  9. Desensitization to inhaled aztreonam lysine in an allergic patient with cystic fibrosis using a novel approach.

    Science.gov (United States)

    Guglani, Lokesh; Abdulhamid, Ibrahim; Ditouras, Joanna; Montejo, Jenny

    2012-10-01

    To report the successful desensitization of a highly allergic patient with cystic fibrosis (CF) to inhaled aztreonam lysine using the novel approach of intravenous desensitization followed by full-dose inhaled therapy without any adverse reactions. A 19-year-old woman with CF had persistent Pseudomonas aeruginosa-positive cultures and a history of type I hypersensitivity reactions to multiple medications, including aztreonam and tobramycin (intravenous and inhaled). To start therapy with an inhaled antipseudomonal antibiotic on a chronic basis, she underwent rapid desensitization to intravenous aztreonam followed by initiation of inhaled aztreonam lysine. Following intravenous desensitization with aztreonam, there was no adverse reaction or decline in lung function noted with inhaled aztreonam lysine and the chronic therapy was continued at home, with a modified regimen to maintain desensitization. Aztreonam lysine has been used for treatment of patients with CF with chronic P. aeruginosa colonization. Previous allergic reaction to intravenous aztreonam is considered a contraindication for use of aztreonam lysine. Our patient had a history of hives and facial swelling following administration of intravenous aztreonam (type I hypersensitivity reaction) as well as hypersensitivity to tobramycin. Rapid desensitization can be done for drugs that mediate a type I hypersensitivity reaction, with mast cells and basophils being the cellular targets. There are a few case reports of desensitization to inhaled antibiotics such as tobramycin and colistin, but desensitization to aztreonam lysine has not previously been reported. Desensitization of a patient with CF who is allergic to intravenous aztreonam was successfully accomplished with the novel approach of rapid intravenous desensitization followed by inhaled therapy. As inhaled antibiotics are being increasingly used for patients with CF, this novel strategy can be used for desensitizing allergic patients with CF to

  10. The effect of magnetic nanoparticles on the acoustic properties of tissue-mimicking agar-gel phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Józefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kubovčíková, M. [Institute of Experimental Physics, Slovak Academy of Sciences, Košice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland)

    2017-06-01

    In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: • Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. • The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. • Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.

  11. Lysine demethylase inhibition protects pancreatic β cells from apoptosis and improves β-cell function

    DEFF Research Database (Denmark)

    Backe, Marie Balslev; Andersson, Jan Legaard; Bacos, Karl

    2018-01-01

    ) protects β cells from cytokine-induced apoptosis and reduces type 1 diabetes incidence in animals. We hypothesized that also lysine demethylases (KDMs) regulate β-cell fate in response to inflammatory stress. Expression of the demethylase Kdm6B was upregulated by proinflammatory cytokines suggesting......Transcriptional changes control β-cell survival in response to inflammatory stress. Posttranslational modifications of histone and non-histone transcriptional regulators activate or repress gene transcription, but the link to cell-fate signaling is unclear. Inhibition of lysine deacetylases (KDACs...

  12. Aspects of the selection, design and use of high lysine cereals

    International Nuclear Information System (INIS)

    Munck, L.

    1976-01-01

    A discussion of the need for and the considerations involved in the breeding of high lysine cereals is presented. Progress in the discovery and exploitation of genotypes with high lysine characters in maize and barley are briefly reviewed. The role and some of the characteristics of the dye-binding capacity (DBC) methods are evaluated along with the ways in which DBC results should be used in combination with other information. Lastly, the changes in attitudes and procedures associated with the acceptance of a product of a new technology such as nutritionally improved cereals is discussed. (author)

  13. Biological significance of lysine mono-, di- and trimethylation on histone and non-histone proteins

    International Nuclear Information System (INIS)

    Perez-Burgos, L.

    2006-01-01

    Histones are the proteins that compact DNA into the repeating unit of chromatin known as the nucleosome. The N-termini of histones are subject to a series of post-translational modifications, one of which is methylation. This modification is termed 'epigenetic' because it extends the information encoded in the genome. Lysines can be mono-, di- or tri-methylated at different positions on histones H1, H3 and H4. In order to study the biological role of histone lysine methylation, antibodies were generated against mono-, di- and trimethylated H3-K9 and H3-27. Indeed, different chromatin domains in the mouse nucleus are enriched in distinct forms of histone lysine methylation, such as pericentric heterochromatin and the inactive X chromosome. Interestingly, heterochromatin in Arabidopsis thaliana is enriched in the mono- and di-, but not the trimethylated form of H3-K9. Furthermore, there exists a hierarchy of epigenetic modifications in which H3-K9 trimethylation is found to be upstream of DNA methylation on mouse major satellites. Histone lysine methylation is also involved in gene regulation upon development. One example is the chicken 61538;-globin locus, a region of facultative chromatin that undergoes a loss of di- and trimethylated H3-K27 in mature red blood cells, concomitant with expression of the 61538;-globin genes. SET-domain proteins are enzymes that methylate histones, but some of them are also able to methylate non-histone substrates. In particular, p53 is methylated by Set9 on lysine 372, G9a and Glp-1 on lysine 373 and by Smyd2 on lysine 370. Smyd2 transcript levels are greatly increased upon irradiation and dimethylated p53-370 specifically binds to 53BP1, a protein involved in recognizing DNA double-stranded breaks upon ionizing radiation. These results argue for a novel role of p53-K370 methylation in the biology of DNA damage. In summary, lysine methylation is a post-translational modification that can occur both on histone and non-histone proteins

  14. Preliminary studies of the toxic effects of non-ionic surfactants derived from lysine.

    Science.gov (United States)

    Macián, M; Seguer, J; Infante, M R; Selve, C; Vinardell, M P

    1996-01-08

    The toxic effects of new synthetic monodisperse non-ionic long-chain N alpha, N epsilon-diacyl lysine polyoxyethylene glycol amide compounds with a structural resemblance to natural lecithin phospholipids were studied by the haemolytic method and the test of the chorioallantoic membrane of the hen's egg (HET-CAM). The following compounds were tested: symmetrical N alpha,N epsilon-diacyl lysine homologues (N alpha,N epsilon-dihexanoyl, N alpha,N epsilon-dioctanoyl and N alpha,N epsilon-didecanoyl lysine) with one methyl ether polyoxyethylene glycol chain of different oxyethylene units (dioxyethylene glycol, tetraoxyethylene glycol and hexaoxyethylene glycol) as headgroup; symmetrical N alpha,N epsilon-diacyl lysine homologues with two methyl ether dioxyethylene glycol chains and the asymmetrical N alpha-butanoyl, N epsilon-dodecyl lysine with two hydrophilic methyl ether dioxyethylene glycol chains as headgroup. A commercial (polydisperse) oleoyl polyoxyethylene glycol diethanolamide with an average of eight units of ethylene oxide was used as control. All the synthesized tested compounds appeared to be less haemolytic and less irritant than the control. The synthesized products were studied with regard to their hydrophobic and hydrophilic chains in order to evaluate the influence of their structure on their haemolytic and irritative action. The results of this study show that the acyl chain distribution of these compounds greatly influence toxic effects: the asymmetrical compound N alpha-butanoyl,N epsilon-dodecyl lysine-bis[methyl ether diethylene glycol]amide was found to be the most haemolytic and irritating compound. Among the symmetrical homologues, the shortest-chain compounds N alpha,N epsilon-dihexanoyl lysine methyl ether polyoxyethylene glycol amides present the least haemolytic and irritating activity, independently of the number and length of the hydrophilic methyl ether polyoxyethylene glycol chains. Taking into account their surface activity

  15. Acetyl-Phosphate Is a Critical Determinant of Lysine Acetylation in E. coli

    DEFF Research Database (Denmark)

    Weinert, Brian T; Iesmantavicius, Vytautas; Wagner, Sebastian A

    2013-01-01

    Lysine acetylation is a frequently occurring posttranslational modification in bacteria; however, little is known about its origin and regulation. Using the model bacterium Escherichia coli (E. coli), we found that most acetylation occurred at a low level and accumulated in growth-arrested cells...... acetylate lysine residues in vitro and that AcP levels are correlated with acetylation levels in vivo, suggesting that AcP may acetylate proteins nonenzymatically in cells. These results uncover a critical role for AcP in bacterial acetylation and indicate that most acetylation in E. coli occurs at a low...

  16. Structural Basis for Recognition of L-lysine, L-ornithine, and L-2,4-diamino Butyric Acid by Lysine Cyclodeaminase.

    Science.gov (United States)

    Min, Kyungjin; Yoon, Hye-Jin; Matsuura, Atsushi; Kim, Yong Hwan; Lee, Hyung Ho

    2018-04-30

    L-pipecolic acid is a non-protein amino acid commonly found in plants, animals, and microorganisms. It is a well-known precursor to numerous microbial secondary metabolites and pharmaceuticals, including anticancer agents, immunosuppressants, and several antibiotics. Lysine cyclodeaminase (LCD) catalyzes β-deamination of L-lysine into L-pipecolic acid using β-nicotinamide adenine dinucleotide as a cofactor. Expression of a human homolog of LCD, μ-crystallin, is elevated in prostate cancer patients. To understand the structural features and catalytic mechanisms of LCD, we determined the crystal structures of Streptomyces pristinaespiralis LCD (SpLCD) in (i) a binary complex with NAD + , (ii) a ternary complex with NAD + and L-pipecolic acid, (iii) a ternary complex with NAD + and L-proline, and (iv) a ternary complex with NAD + and L-2,4-diamino butyric acid. The overall structure of SpLCD was similar to that of ornithine cyclodeaminase from Pseudomonas putida . In addition, SpLCD recognized L-lysine, L-ornithine, and L-2,4-diamino butyric acid despite differences in the active site, including differences in hydrogen bonding by Asp236, which corresponds with Asp228 from Pseudomonas putida ornithine cyclodeaminase. The substrate binding pocket of SpLCD allowed substrates smaller than lysine to bind, thus enabling binding to ornithine and L-2,4-diamino butyric acid. Our structural and biochemical data facilitate a detailed understanding of substrate and product recognition, thus providing evidence for a reaction mechanism for SpLCD. The proposed mechanism is unusual in that NAD + is initially converted into NADH and then reverted back into NAD + at a late stage of the reaction.

  17. Diffusion of manganese ions in agar gel containing alkali metal chlorides

    International Nuclear Information System (INIS)

    Borhade, A.V.

    2000-01-01

    The obstruction effect for tracer-diffusion of Mn 2+ ions in the presence of different supporting electrolytes (LiCl, NaCl, KCl, CsCl) at various concentrations has been studied at 25 deg C using the zone diffusion technique. It has been observed that the obstruction effect determined in terms of α increases with concentration of the electrolyte. Further, for a given concentration it is found to decrease with increasing charge density of the cation. We also report here on the effect of temperature on obstruction and found that is constant over the temperature range studied (25-45 deg C). These observations are explained on the basis of competitive hydration between ions and agar macromolecules. (author)

  18. Antimicrobial Disk Susceptibility Testing of Leptospira spp. Using Leptospira Vanaporn Wuthiekanun (LVW) Agar.

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Langla, Sayan; White, Nicholas J; Day, Nicholas P J; Limmathurotsakul, Direk; Peacock, Sharon J

    2015-08-01

    Leptospira Vanaporn Wuthiekanun (LVW) agar was used to develop a disk diffusion assay for Leptospira spp. Ten pathogenic Leptospira isolates were tested, all of which were susceptible to 17 antimicrobial agents (amoxicillin/clavulanic acid, amoxicillin, azithromycin, cefoxitin, ceftazidime, ceftriaxone, chloramphenicol, ciprofloxacin, clindamycin, doripenem, doxycycline, gentamicin, linezolid, nitrofurantoin, penicillin, piperacillin/tazobactam, and tetracycline). All 10 isolates had no zone of growth inhibition for four antimicrobials (fosfomycin, nalidixic acid, rifampicin, and trimethoprim/sulfamethoxazole). Of the ten Leptospira, seven had a growth inhibition zone of ≤ 21 mm for aztreonam, the zone diameter susceptibility break point for Enterobacteriaceae. This assay could find utility as a simple screening method during the epidemiological surveillance of antimicrobial resistance in Leptospira spp. © The American Society of Tropical Medicine and Hygiene.

  19. Perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on pigeon manure filtrate agar

    Energy Technology Data Exchange (ETDEWEB)

    Staib, F.

    1981-02-01

    To enable studies of the dependence of Cryptococcus neoformans and its perfect and imperfect states upon bird manure as a habitat of this pathogen, a nutrient medium closely resembling natural conditions was prepared. As sole nutrient, the water soluble ingredients of manure from pigeons (Columbia livia) were used. There was no heat sterilization of the manure filtrate. Using a standard pair of C. neoformans strains for mating, it could be demonstrated that the perfect state of the fungus developed on this so called pigeon manure filtrate agar within 48 h at 26 degrees C. This medium is supposed to help in the elucidation of the epidemiological significance of the perfect and imperfect states of this pathogen.

  20. Agar hydrogel with silver nanoparticles to prolong the shelf life of Fior di Latte cheese.

    Science.gov (United States)

    Incoronato, A L; Conte, A; Buonocore, G G; Del Nobile, M A

    2011-04-01

    The objective of this work was to evaluate the effectiveness of an antimicrobial packaging system containing active nanoparticles on the quality deterioration of Fior di Latte cheese. To this aim, 3 concentrations of silver montmorillonite embedded in agar were used. The cell loads of spoilage and useful microorganisms were monitored during a refrigerated storage period. Moreover, cheese sensory quality (i.e., odor, color, consistency, and overall quality) was evaluated by means of a panel test. Results showed that the active packaging system markedly increased the shelf life of Fior di Latte cheese, due to the ability of silver cations to control microbial proliferation, without affecting the functional dairy microbiota and the sensory characteristics of the product. The active packaging system developed in this work could be used to prolong the shelf life of Fior di Latte and boost its distribution beyond local market borders. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Diagnostic Value of Processing Cytologic Aspirates of Renal Tumors in Agar Cell (Tissue) Blocks

    DEFF Research Database (Denmark)

    Smedts, F.; Schrik, M.; Horn, T.

    2010-01-01

    smears were prepared after each aspiration for conventional cytology and the remaining aspirate was processed for the improved agar microbiopsy (AM) method. Conventional cytology slides, AM slides and surgical specimens were diagnosed separately, after which the diagnoses were compared....... Immunohistochemistry was performed as required on the AM sections. Surgical specimens served as the gold standard. Results In 53% of conventional cytologic smears, the cellular yield was sufficient to render a correct diagnosis. In 12% the diagnosis was incorrect, in 21% only a differential diagnosis could be fin......-initiated, and in 14% too few diagnostic cells were present in the conventional smears for cytologic diagnosis. It was, however, possible to correctly diagnose histologic sections from 97% of AM tissue blocks. In 11 cases this was facilitated with immunochemistry. In only 1 case did the AM tissue block contain too few...

  2. Optimasi Waktu Proses Hidrolisis dan Fermentasi dalam Produksi Bioetanol dari Limbah Pengolahan Agar (Gracilaria sp. Industri

    Directory of Open Access Journals (Sweden)

    Rodiah Nurbaya Sari

    2013-12-01

    menggunakan kapang Trichoderma viride dan khamir Saccharomyces cerevisiae. Penelitian yang dilakukan terdiri dari beberapa tahap yaitu karakterisasi limbah agar industri, hidrolisis enzimatis menggunakan kapang Trichoderma viride penghasil selulase, dan fermentasi dengan khamir Saccharomyces cerevisiae. Hasilnya menunjukkan bahwa waktu optimal untuk hidrolisis enzimatis adalah 4 hari pada suhu 28 oC dan pH 3,91; aktivitas CMCase 210,48 IU/ml dan menghasilkan total gula pereduksi 6,74 mg/ml. Sedangkan untuk waktu fermentasi yang optimal adalah 2 hari pada suhu 32 oC dan pH 4,66 dengan nilai OD 600 nm 0,0181 menghasilkan etanol kasar dengan kadar 0,47% (b/b.

  3. The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

    DEFF Research Database (Denmark)

    Burmølle, Mette; Johnsen, Kaare; Abu Al-Soud, Waleed Mohamad Abdel F

    2009-01-01

    Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial...... cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect...... of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain...

  4. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  5. Effects of Antifungal Soaked Silicone Hydrogel Contact Lenses on Candida albicans in an Agar Eye Model.

    Science.gov (United States)

    Phan, Chau-Minh; Bajgrowicz, Magdalena; McCanna, David J; Subbaraman, Lakshman N; Jones, Lyndon

    2016-09-01

    To evaluate the effects of two commercial silicone hydrogel contact lenses (CLs) soaked with natamycin (NA) or fluconazole (FL) on the growth of Candida albicans in an in vitro eye model. Three-D printed molds were used as a cast for making eye-shaped models comprising potato dextrose agar. Senofilcon A (SA) and lotrafilcon B (LB) CLs were incubated with either 2 mL of NA or FL at a concentration of 1 mg/mL for 24 hr. To simulate a fungal infection, the eye models were coated with C. albicans. The drug-soaked lenses were placed on top of the eye models. Seven experimental conditions were examined: (1) NA-SA, (2) NA-LB, (3) FL-SA, (4) FL-LB, (5) SA, (6) LB, and (7) control-no lens. At specified time points (t=1, 8, 16, 24, 48 hr), the agar eyes from each experimental condition were removed from the incubator and photographed. The yeast cells from the 24 and 48 hr time point were also analyzed using light microscopy. At 24 and 48 hr, there was considerable growth observed for all conditions except for the NA-SA and NA-LB conditions. When observed under the microscope at 24 and 48 hr, the morphology of the yeast cells in the FL-SA and SA condition were similar to that of the control (oval shaped). There was limited hyphae growth observed for LB and significant visible hyphae growth for the NA-LB group. For NA-SA, NA-LB, and FL-LB groups, the cells were significantly smaller compared with the control. For NA-SA and NA-LB, there was limited growth of C. albicans observed on the eye models even after 48 hr. Under the microscope, the cell morphology differ noticeably between each testing condition, and is dependent on drug-lens combinations.

  6. Copper removal by algae Gelidium, agar extraction algal waste and granulated algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2008-03-01

    Biosorption of copper ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). The effects of contact time, pH, ionic strength (IS) and temperature on the biosorption process have been studied. Equilibrium data follow both Langmuir and Langmuir-Freundlich models. The parameters of Langmuir equilibrium model were: q(max)=33.0mgg(-1), K(L)=0.015mgl(-1); q(max)=16.7mgg(-1), K(L)=0.028mgl(-1) and q(max)=10.3mgg(-1), K(L)=0.160mgl(-1) respectively for Gelidium, algal waste and composite material at pH=5.3, T=20 degrees C and IS=0.001M. Increasing the pH, the number of deprotonated active sites increases and so the uptake capacity of copper ions. In the case of high ionic strengths, the contribution of the electrostatic component to the overall binding decreases, and so the uptake capacity. The temperature has little influence on the uptake capacity principally for low equilibrium copper concentrations. Changes in standard enthalpy, Gibbs energy and entropy during biosorption were determined. Kinetic data at different solution pH (3, 4 and 5.3) were fitted to pseudo-first-order and pseudo-second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model, which successfully predicts Cu(II) concentration profiles.

  7. Adsorption of Lysine on Na-Montmorillonite and Competition with Ca(2+): A Combined XRD and ATR-FTIR Study.

    Science.gov (United States)

    Yang, Yanli; Wang, Shengrui; Liu, Jingyang; Xu, Yisheng; Zhou, Xiaoyun

    2016-05-17

    Lysine adsorption at clay/aqueous interfaces plays an important role in the mobility, bioavailability, and degradation of amino acids in the environment. Knowledge of these interfacial interactions facilitates our full understanding of the fate and transport of amino acids. Here, X-ray diffraction (XRD) and attenuated total reflectance Fourier-transform infrared spectroscopy (ATR-FTIR) measurements were used to explore the dynamic process of lysine adsorption on montmorillonite and the competition with Ca(2+) at the molecular level. Density functional theory (DFT) calculations were employed to determine the peak assignments of dissolved lysine in the solution phase. Three surface complexes, including dicationic, cationic, and zwitterionic structures, were observed to attach to the clay edge sites and penetrate the interlayer space. The increased surface coverage and Ca(2+) competition did not affect the interfacial lysine structures at a certain pH, whereas an elevated lysine concentration contributed to zwitterionic-type coordination at pH 10. Moreover, clay dissolution at pH 4 could be inhibited at a higher surface coverage with 5 and 10 mM lysine, whereas the inhibition effect was inconspicuous or undetected at pH 7 and 10. The presence of Ca(2+) not only could remove a part of the adsorbed lysine but also could facilitate the readsorption of dissolved Si(4+) and Al(3+) and surface protonation. Our results provide new insights into the process of lysine adsorption and its effects on montmorillonite surface sites.

  8. The relationship between DNA synthesis and incorporation of (14C) lysine into different histone fractions in Ehrlich ascites tumour cells

    International Nuclear Information System (INIS)

    Malec, J.; Kornacka, L.; Wojnarowska, M.; Moscicka, M.

    1974-01-01

    The effect of inhibition of DNA synthesis by hydroxyurea on ( 14 C) lysine incorporation into the main four histone fractions in Ehrlich ascites tumor cells, was examined in vitro. The radioactivity of lysine-rich histones, especially of histone f1, was preferentially decreased. The smallest decrease was observed for histone f3. The incorporation into other cellular proteins was but slightly affected. (author)

  9. Zinc-air cell with KOH-treated agar layer between electrode and electrolyte containing hydroponics gel

    Energy Technology Data Exchange (ETDEWEB)

    Otham, R. [International Islamic University, Kuala Lumpur (Malaysia); Yahaya, A. H. [University of Malaya, Dept. of Chemistry, Kuala Lumpur (Malaysia); Arof, A. K. [University of Malaya, Dept. of Physics, Kuala Lumpur (Malaysia)

    2002-07-01

    Zinc-air electrochemical power sources possess the highest density compared to other zinc anode batteries, due their free and unlimited supply from the ambient air. In this experiment zinc-air cells have been fabricated employing hydroponics gel as an alternative alkaline electrolyte gelling agent. Thin KOH-treated agar layer was applied between the electrode-electrolyte interfaces which produced significant enhancement of the cells' capacities, indicating that the application of thin agar layer will improve the electrode-gelled electrolyte interfaces. Promising results have been achieved with porous zinc anode prepared from dried zinc-graphite-gelatinized agar paste; e g. a zinc-air cell employing a porous zinc anode has demonstrated a capacity of 1470 mAh rated at 0.1 A continuous discharge. 32 refs., 9 figs.

  10. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Science.gov (United States)

    Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo

    2009-07-03

    Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to

  11. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Directory of Open Access Journals (Sweden)

    Ellen Yeh

    Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost

  12. Enhanced chlorine resistance of tap water-adapted Legionella pneumophila as compared with agar medium-passaged strains.

    Science.gov (United States)

    Kuchta, J M; States, S J; McGlaughlin, J E; Overmeyer, J H; Wadowsky, R M; McNamara, A M; Wolford, R S; Yee, R B

    1985-07-01

    Previous studies have shown that bacteria maintained in a low-nutrient "natural" environment such as swimming pool water are much more resistant to disinfection by various chemical agents than strains maintained on rich media. In the present study a comparison was made of the chlorine (Cl2) susceptibility of hot-water tank isolates of Legionella pneumophila maintained in tap water and strains passaged on either nonselective buffered charcoal-yeast extract or selective differential glycine-vancomycin-polymyxin agar medium. Our earlier work has shown that environmental and clinical isolates of L. pneumophila maintained on agar medium are much more resistant to Cl2 than coliforms are. Under the present experimental conditions (21 degrees C, pH 7.6 to 8.0, and 0.25 mg of free residual Cl2 per liter, we found the tap water-maintained L. pneumophila strains to be even more resistant than the agar-passaged isolates. Under these conditions, 99% kill of tap water-maintained strains of L. pneumophila was usually achieved within 60 to 90 min compared with 10 min for agar-passaged strains. Samples from plumbing fixtures in a hospital yielded legionellae which were "super"-chlorine resistant when assayed under natural conditions. After one agar passage their resistance dropped to levels of comparable strains which had not been previously exposed to additional chlorination. These studies more closely approximate natural conditions than our previous work and show that tap water-maintained L. pneumophila is even more resistant to Cl2 than its already resistant agar medium-passaged counterpart.

  13. Variation in the excitability of developed D. discoideum cells as a function of agar concentration in the substrate

    Science.gov (United States)

    Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard

    2010-03-01

    In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.

  14. Lysine supplementation in late gestation of gilts: effects on piglet birth weight, and gestational and lactational performance

    Directory of Open Access Journals (Sweden)

    Diogo Magnabosco

    2013-08-01

    Full Text Available Lysine requirements for gain in maternal body reserves and piglet birth weight, during pregnancy, in contemporary prolific genotypes, are not well established. This study aimed to evaluate the effect of dietary lysine in late pregnancy on piglet birth weight, and on the gestational and lactational performance of gilts. Pregnant gilts were uniformly distributed into two groups and received, from 85 to 110 days of gestation, either of two lysine levels in their diet: Control group - 28g lysine/day (n=136, and Lysine group - 35g lysine/day (n=141. There were no effects (P>0.10 of supplemental lysine on body weight and backfat (BF gain of females or on piglet birth weight. Gilts supplemented with lysine tended to have a lower percentage of stillbirths (P=0.077, reduced within-litter birth weight variation (P=0.094 and a lower percentage of piglets weighing less than 1100g (P=0.082 than in the Control group. During lactation, the performance of sows and litters was also evaluated in a subgroup of sows (n=26/group. There were no differences between the Control and Lysine groups (P>0.10 in voluntary feed intake, body reserve losses (weight and BF, weaning-to-estrus interval of the sows, and litter weaning weight. In conclusion, an increase in lysine (from 28 to 35g/day in late gestation of gilts (85 to 110 days tends to reduce the rate of stillbirths and to improve the uniformity of litter weight at birth, but does not affect the performance of females until farrowing or during subsequent lactation.

  15. Differential lysine acetylation profiles of Erwinia amylovora strains revealed by proteomics

    Science.gov (United States)

    Wu, Xia; Vellaichamy, Adaikkalam; Wang, Dongping; Zamdborg, Leonid; Kelleher, Neil L.; Huber, Steven C.; Zhao, Youfu

    2015-01-01

    Protein lysine acetylation (LysAc) has recently been demonstrated to be widespread in E. coli and Salmonella, and to broadly regulate bacterial physiology and metabolism. However, LysAc in plant pathogenic bacteria is largely unknown. Here we first report the lysine acetylome of Erwinia amylovora, an enterobacterium causing serious fire blight disease of apples and pears. Immunoblots using generic anti-lysine acetylation antibodies demonstrated that growth conditions strongly affected the LysAc profiles in E. amylovora. Differential LysAc profiles were also observed for two E. amylovora strains, known to have differential virulence in plants, indicating translational modification of proteins may be important in determining virulence of bacterial strains. Proteomic analysis of LysAc in two E. amylovora strains identified 141 LysAc sites in 96 proteins that function in a wide range of biological pathways. Consistent with previous reports, 44% of the proteins are involved in metabolic processes, including central metabolism, lipopolysaccharide, nucleotide and amino acid metabolism. Interestingly, for the first time, several proteins involved in E. amylovora virulence, including exopolysaccharide amylovoran biosynthesis- and type III secretion-associated proteins, were found to be lysine acetylated, suggesting that LysAc may play a major role in bacterial virulence. Comparative analysis of LysAc sites in E. amylovora and E. coli further revealed the sequence and structural commonality for LysAc in the two organisms. Collectively, these results reinforce the notion that LysAc of proteins is widespread in bacterial metabolism and virulence. PMID:23234799

  16. Lysine deacetylase inhibition prevents diabetes by chromatin-independent immunoregulation and beta-cell protection

    NARCIS (Netherlands)

    Christensen, D.P.; Gysemans, C.; Lundh, M.; Dahllof, M.S.; Noesgaard, D.; Schmidt, S.F.; Mandrup, S; Birkbak, N.; Workman, C.T.; Piemonti, L.; Blaabjerg, L.; Monzani, V.; Fossati, G.; Mascagni, P.; Paraskevas, S.; Aikin, R.A.; Billestrup, N.; Grunnet, L.G.; Dinarello, C.A.; Mathieu, C.; Mandrup-Poulsen, T.

    2014-01-01

    Type 1 diabetes is due to destruction of pancreatic beta-cells. Lysine deacetylase inhibitors (KDACi) protect beta-cells from inflammatory destruction in vitro and are promising immunomodulators. Here we demonstrate that the clinically well-tolerated KDACi vorinostat and givinostat revert diabetes

  17. Lysine requirement of the enterally fed term infant in the first month of life

    NARCIS (Netherlands)

    Huang, L.; Hogewind-Schoonenboom, J.E.; de Groof, F.; Twisk, J.W.R.; Voortman, G.J.; Dorst, K.; Schierbeek, H.; Boehm, G.; Huang, Y.; Chen, C.; van Goudoever, J.B.

    2011-01-01

    Background: Infant nutrition has a major impact on child growth and functional development. Low and high intakes of protein or amino acids could have a detrimental effect. Objective: The objective of the study was to determine the lysine requirement of enterally fed term neonates by using the

  18. Proteomic analysis of lysine acetylation sites in rat tissues reveals organ specificity and subcellular patterns

    DEFF Research Database (Denmark)

    Lundby, Alicia; Hansen, Kasper Lage; Weinert, Brian Tate

    2012-01-01

    ,541 proteins and provide the data set as a web-based database. We demonstrate that lysine acetylation displays site-specific sequence motifs that diverge between cellular compartments, with a significant fraction of nuclear sites conforming to the consensus motifs G-AcK and AcK-P. Our data set reveals...

  19. Ab Initio Calculations of Deuterium Isotope Effects on Chemical Shifts of Salt-Bridged Lysines

    DEFF Research Database (Denmark)

    Ullah, Saif; Ishimoto, Takayoshi; Williamson, Mike P.

    2011-01-01

    (D), in ammonium and amines decrease as a counterion or water molecule moves closer to the nitrogen. 1Δ15N(D) and 2Δ1H(D) of the NH3+ groups of lysine residues in the B1 domain of protein G have been calculated using truncated side chains and also determined experimentally by NMR. Comparisons show...

  20. Differential Modulation of Cellular Bioenergetics by Poly(L-lysine)s of Different Molecular Weights

    DEFF Research Database (Denmark)

    Hall, Arnaldur; Wu, Lin-Ping; Parhamifar, Ladan

    2015-01-01

    Poly(L-lysine)s (PLLs), and related derivatives, have received considerable attention as nonviral vectors. High molecular weight PLLs (H-PLLs) are superior transfectants compared with low Mw PLLs (L-PLLs), but suggested to be more cytotoxic. Through a pan-integrated metabolomic approach using Sea...

  1. Tuning a Protein-Labeling Reaction to Achieve Highly Site Selective Lysine Conjugation.

    Science.gov (United States)

    Pham, Grace H; Ou, Weijia; Bursulaya, Badry; DiDonato, Michael; Herath, Ananda; Jin, Yunho; Hao, Xueshi; Loren, Jon; Spraggon, Glen; Brock, Ansgar; Uno, Tetsuo; Geierstanger, Bernhard H; Cellitti, Susan E

    2018-04-16

    Activated esters are widely used to label proteins at lysine side chains and N termini. These reagents are useful for labeling virtually any protein, but robust reactivity toward primary amines generally precludes site-selective modification. In a unique case, fluorophenyl esters are shown to preferentially label human kappa antibodies at a single lysine (Lys188) within the light-chain constant domain. Neighboring residues His189 and Asp151 contribute to the accelerated rate of labeling at Lys188 relative to the ≈40 other lysine sites. Enriched Lys188 labeling can be enhanced from 50-70 % to >95 % by any of these approaches: lowering reaction temperature, applying flow chemistry, or mutagenesis of specific residues in the surrounding protein environment. Our results demonstrated that activated esters with fluoro-substituted aromatic leaving groups, including a fluoronaphthyl ester, can be generally useful reagents for site-selective lysine labeling of antibodies and other immunoglobulin-type proteins. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Digestible threonine to lysine ratio in diets for laying hens aged 24-40 weeks

    Directory of Open Access Journals (Sweden)

    Tatiana Cristina da Rocha

    2013-12-01

    Full Text Available Two-hundred sixteen white laying hens were used to assess the ideal ratio of digestible threonine:lysine in diets for laying hens at 24 to 40 weeks of age. Birds were assigned to a randomized block design, with six treatments, six replicates per treatment and six birds per experimental unit. The cage was used as the blocking criterion. Experimental diets contained different digestible threonine:digestible lysine ratios (65, 70, 75, 80, 85 and 90% with 142 g/kg of crude protein. Experimental diets were formulated to be isonitrogenous and isocaloric with different contents of L-glutamic acid. Feed intake (g/hen/d, egg production (%, egg weight (g, egg mass (g/hen/d, feed conversion ratio (kg/dozen and kg/kg egg, eggshell weight (g, albumen weight (g, yolk weight (g and body weight gain (g were assessed. The maximum egg production was observed at 78% digestible threonine:digestible lysine ratio, while the best values of feed conversion ratio (kg/dozen egg and feed conversion ratio (kg/kg of egg were observed at 77.6% and 75%, respectively. Feed intake, egg mass and egg contents (yolk, albumen and eggshell were not affected by treatments. The estimated digestible threonine:digestible lysine ratio of Hy-Line W36 laying hens at 24 to 40 weeks of age is 78%, corresponding to 5.70 g/kg of dietary digestible threonine.

  3. Lysine deacetylases are produced in pancreatic beta cells and are differentially regulated by proinflammatory cytokines

    DEFF Research Database (Denmark)

    Lundh, M; Christensen, D P; Rasmussen, D N

    2010-01-01

    Cytokine-induced beta cell toxicity is abrogated by non-selective inhibitors of lysine deacetylases (KDACs). The KDAC family consists of 11 members, namely histone deacetylases HDAC1 to HDAC11, but it is not known which KDAC members play a role in cytokine-mediated beta cell death. The aim...

  4. Lysine Acetylation of CREBH Regulates Fasting-Induced Hepatic Lipid Metabolism

    Science.gov (United States)

    Kim, Hyunbae; Mendez, Roberto; Chen, Xuequn; Fang, Deyu

    2015-01-01

    Cyclic AMP-responsive element-binding protein 3-like 3, hepatocyte specific (CREBH), is a hepatic transcription factor that functions as a key regulator of energy homeostasis. Here, we defined a regulatory CREBH posttranslational modification process, namely, lysine-specific acetylation, and its functional involvement in fasting-induced hepatic lipid metabolism. Fasting induces CREBH acetylation in mouse livers in a time-dependent manner, and this event is critical for CREBH transcriptional activity in regulating hepatic lipid homeostasis. The histone acetyltransferase PCAF-mediated acetylation and the deacetylase sirtuin-1-mediated deacetylation coexist to maintain CREBH acetylation states under fasting conditions. Site-directed mutagenesis and functional analyses revealed that the lysine (K) residue at position 294 (K294) within the bZIP domain of the CREBH protein is the site where fasting-induced acetylation/deacetylation occurs. Introduction of the acetylation-deficient (K294R) or acetylation-mimicking (K294Q) mutation inhibited or enhanced CREBH transcriptional activity, respectively. Importantly, CREBH acetylation at lysine 294 was required for the interaction and synergy between CREBH and peroxisome proliferator-activated receptor α (PPARα) in activating their target genes upon fasting or glucagon stimulation. Introduction of the CREBH lysine 294 mutation in the liver leads to hepatic steatosis and hyperlipidemia in animals under prolonged fasting. In summary, our study reveals a molecular mechanism by which fasting or glucagon stimulation modulates lipid homeostasis through acetylation of CREBH. PMID:26438600

  5. Lysine sulfonamides as novel HIV-protease inhibitors: Nepsilon-acyl aromatic alpha-amino acids.

    Science.gov (United States)

    Stranix, Brent R; Lavallée, Jean-François; Sévigny, Guy; Yelle, Jocelyn; Perron, Valérie; LeBerre, Nicholas; Herbart, Dominik; Wu, Jinzi J

    2006-07-01

    A series of lysine sulfonamide analogues bearing Nepsilon-acyl aromatic amino acids were synthesized using an efficient synthetic route. Evaluation of these novel protease inhibitors revealed compounds with high potency against wild-type and multiple-protease inhibitor-resistant HIV viruses.

  6. Substrates for Efficient Fluorometric Screening Employing the NAD-Dependent Sirtuin 5 Lysine Deacylase (KDAC) Enzyme

    DEFF Research Database (Denmark)

    Madsen, Andreas Stahl; Olsen, Christian Adam

    2012-01-01

    The class III lysine deacylases (KDACs), also known as the sirtuins, have emerged as interesting drug targets for therapeutic intervention in a variety of diseases. To gain a deeper understanding of the processes affected by sirtuins, the development of selective small molecule modulators of indi...

  7. Enantioselective adsorption of ibuprofen and lysine in metal-organic frameworks

    NARCIS (Netherlands)

    Bueno-Perez, R.; Martin-Calvo, A.; Gómez-Álvarez, P.; Gutiérrez-Sevillano, J.J.; Merkling, P.J.; Vlugt, T.J.H.; van Erp, T.S.; Dubbeldam, D.; Calero, S.

    2014-01-01

    This study reveals the efficient enantiomeric separation of bioactive molecules in the liquid phase. Chiral structure HMOF-1 separates racemic mixtures whereas heteroselectivity is observed for scalemic mixtures of ibuprofen using non-chiral MIL-47 and MIL-53. Lysine enantiomers are only separated

  8. [Studies with 15N-labeled lysine in colostomized hens. 2. 15N excretion in feces].

    Science.gov (United States)

    Gruhn, K; Wiefel, P

    1983-05-01

    Over a period of four days colostomised hens were given 15N-lysine, and the development of 15N-excretion both in the TCA-soluble and the TCA-precipitable fraction of the faeces was measured over eight days. In both fractions the total, lysine, histidine and arginine N and 15N-excess (15N') was determined. The average apparent digestibility of 14N was 81.2% +/- 1.1% and of 15N' 93.2% +/- 0.7%. Labelled N is already excreted in faeces 3 hours after its application. The TCA-precipitable N is less strongly labelled than the TCA-soluble N. During the application of 15N' the labelling in faecal lysine is nearly one power of ten higher than in total N. The atom-% 15N' of the lysine could also be distinctly detected in arginine and histidine. The quotas of the total 15N' in faeces were 3.5% for arginine-15N' and 0.8% for histidine 15N'; 15N' can mainly be detected in the soluble fraction.

  9. Monitoring lysin motif-ligand interactions via tryptophan analog fluorescence spectroscopy

    NARCIS (Netherlands)

    Petrovic, Dejan M.; Leenhouts, Kees; van Roosmalen, Maarten L.; KleinJan, Fenneke; Broos, Jaap

    2012-01-01

    The lysin motif (LysM) is a peptidoglycan binding protein domain found in a wide range of prokaryotes and eukaryotes. Various techniques have been used to study the LysM-ligand interaction, but a sensitive spectroscopic method to directly monitor this interaction has not been reported. Here a

  10. Controllable synthesis of functional nanocomposites: Covalently functionalize graphene sheets with biocompatible L-lysine

    International Nuclear Information System (INIS)

    Mo, Zunli; Gou, Hao; He, Jingxian; Yang, Peipei; Feng, Chao; Guo, Ruibin

    2012-01-01

    Highlights: ► The biocompatible L-lysine functionalized graphene sheets (Gs/Lys) were synthesized controllably using a novel method. ► The Gs/Lys nanocomposites are water-soluble, biocompatible and chiral. ► A chiral graphene derivative was proposed. - Abstract: In this paper a novel method to synthesize functionalize graphene sheets (Gs) by biocompatible L-lysine (Gs/Lys) is reported. The method was composed of two steps: (1) we controllably synthesized self-assembly Gs/Lys-Cu-Lys through the terminal amino of copper L-lysine (Lys-Cu-Lys) attaching to graphite oxide (GO) and then reducing. (2) Obtained the Gs/Lys by eliminating the copper ion. This method could also be used to functionalize other nanomaterials by L-lysine. The Gs/Lys nanocomposites are water-soluble, biocompatible, and above all, it is a chiral material of graphene, which is proposed by us. This novel material will be promising for more applications of graphene. The formation of Gs/Lys nanocomposites were confirmed by scanning electron microscopy (SEM), Fourier-transform infrared spectra (FT-IR), X-ray photoelectron spectroscopy (XPS), X-ray diffraction (XRD), and thermal gravimetric (TG) analysis.

  11. Mechanistic study of ruthenium (III) catalysed oxidation of L-lysine by ...

    Indian Academy of Sciences (India)

    Administrator

    MS received 15 April 2008; revised 2 July 2008. Abstract. The kinetics of Ru(III) catalysed oxidation of L-lysine by diperiodatoargentate (III) (DPA) in alkaline medium at 298 K and a constant ionic strength of 0⋅50 mol dm. –3 was studied spectrophotometri- cally. The oxidation products are aldehyde (5-aminopentanal) and ...

  12. A Proteomic Approach to Analyze the Aspirin-mediated Lysine Acetylome.

    Science.gov (United States)

    Tatham, Michael H; Cole, Christian; Scullion, Paul; Wilkie, Ross; Westwood, Nicholas J; Stark, Lesley A; Hay, Ronald T

    2017-02-01

    Aspirin, or acetylsalicylic acid is widely used to control pain, inflammation and fever. Important to this function is its ability to irreversibly acetylate cyclooxygenases at active site serines. Aspirin has the potential to acetylate other amino acid side-chains, leading to the possibility that aspirin-mediated lysine acetylation could explain some of its as-yet unexplained drug actions or side-effects. Using isotopically labeled aspirin-d 3 , in combination with acetylated lysine purification and LC-MS/MS, we identified over 12000 sites of lysine acetylation from cultured human cells. Although aspirin amplifies endogenous acetylation signals at the majority of detectable endogenous sites, cells tolerate aspirin mediated acetylation very well unless cellular deacetylases are inhibited. Although most endogenous acetylations are amplified by orders of magnitude, lysine acetylation site occupancies remain very low even after high doses of aspirin. This work shows that while aspirin has enormous potential to alter protein function, in the majority of cases aspirin-mediated acetylations do not accumulate to levels likely to elicit biological effects. These findings are consistent with an emerging model for cellular acetylation whereby stoichiometry correlates with biological relevance, and deacetylases act to minimize the biological consequences of nonspecific chemical acetylations. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. A Proteomic Approach to Analyze the Aspirin-mediated Lysine Acetylome*

    Science.gov (United States)

    Tatham, Michael H.; Cole, Christian; Scullion, Paul; Wilkie, Ross; Westwood, Nicholas J.; Stark, Lesley A.; Hay, Ronald T.

    2017-01-01

    Aspirin, or acetylsalicylic acid is widely used to control pain, inflammation and fever. Important to this function is its ability to irreversibly acetylate cyclooxygenases at active site serines. Aspirin has the potential to acetylate other amino acid side-chains, leading to the possibility that aspirin-mediated lysine acetylation could explain some of its as-yet unexplained drug actions or side-effects. Using isotopically labeled aspirin-d3, in combination with acetylated lysine purification and LC-MS/MS, we identified over 12000 sites of lysine acetylation from cultured human cells. Although aspirin amplifies endogenous acetylation signals at the majority of detectable endogenous sites, cells tolerate aspirin mediated acetylation very well unless cellular deacetylases are inhibited. Although most endogenous acetylations are amplified by orders of magnitude, lysine acetylation site occupancies remain very low even after high doses of aspirin. This work shows that while aspirin has enormous potential to alter protein function, in the majority of cases aspirin-mediated acetylations do not accumulate to levels likely to elicit biological effects. These findings are consistent with an emerging model for cellular acetylation whereby stoichiometry correlates with biological relevance, and deacetylases act to minimize the biological consequences of nonspecific chemical acetylations. PMID:27913581

  14. Lysine succinylation is a frequently occurring modification in prokaryotes and eukaryotes and extensively overlaps with acetylation

    DEFF Research Database (Denmark)

    Weinert, Brian T; Schölz, Christian; Wagner, Sebastian A

    2013-01-01

    Recent studies have shown that lysines can be posttranslationally modified by various types of acylations. However, except for acetylation, very little is known about their scope and cellular distribution. We mapped thousands of succinylation sites in bacteria (E. coli), yeast (S. cerevisiae), hu...

  15. Proteomic Analysis of Lysine Acetylation Sites in Rat Tissues Reveals Organ Specificity and Subcellular Patterns

    Directory of Open Access Journals (Sweden)

    Alicia Lundby

    2012-08-01

    Full Text Available Lysine acetylation is a major posttranslational modification involved in a broad array of physiological functions. Here, we provide an organ-wide map of lysine acetylation sites from 16 rat tissues analyzed by high-resolution tandem mass spectrometry. We quantify 15,474 modification sites on 4,541 proteins and provide the data set as a web-based database. We demonstrate that lysine acetylation displays site-specific sequence motifs that diverge between cellular compartments, with a significant fraction of nuclear sites conforming to the consensus motifs G-AcK and AcK-P. Our data set reveals that the subcellular acetylation distribution is tissue-type dependent and that acetylation targets tissue-specific pathways involved in fundamental physiological processes. We compare lysine acetylation patterns for rat as well as human skeletal muscle biopsies and demonstrate its general involvement in muscle contraction. Furthermore, we illustrate that acetylation of fructose-bisphosphate aldolase and glycerol-3-phosphate dehydrogenase serves as a cellular mechanism to switch off enzymatic activity.

  16. High lysine and high yielding mutants in wheat (Triticum aestivum) L

    International Nuclear Information System (INIS)

    Mohammad, T.; Mahmood, F.; Ahmad, A.; Sattar, A.; Khan, I.

    1988-01-01

    The dry seeds of the variety Lu-26 were irradiated with 20 krad of gamma rays. In M 2 about 300 mutant plants were selected for short stature, rust resistance and other desirable traits. As a result of further selection, in M 6 , eight superior lines were finally identified. The agronomic characteristics of these mutants, the parent variety (Lu-26) and a standard check variety (Pak-81) are shown. The selected mutants and commercially grown cultivars (Lu-26 and Pak-81) were studied for total protein content and amino acid pattern. The mutants WM-89-1, WM-6-17 and WM-81-2 showing high yield also contained comparatively high amounts of methionine and lysine. The lysine contents were 565, 410, and 370 mg/100g in the mutants WM-89-1, WM-6-17 and WM-81-2, respectively against a range value of 210-370 mg/100g in other mutants and 250-320 in the commercial cultivars. The mutant WM-81-2 was comparable to WM-56-1-5 in lysine content. The results of these experiments show a possibility of developing varieties having high yield and high amounts of essential amino acids such as lysine and methionine

  17. A Toolbox of Genetically Encoded FRET-Based Biosensors for Rapid l-Lysine Analysis

    Directory of Open Access Journals (Sweden)

    Victoria Steffen

    2016-09-01

    Full Text Available Background: The fast development of microbial production strains for basic and fine chemicals is increasingly carried out in small scale cultivation systems to allow for higher throughput. Such parallelized systems create a need for new rapid online detection systems to quantify the respective target compound. In this regard, biosensors, especially genetically encoded Förster resonance energy transfer (FRET-based biosensors, offer tremendous opportunities. As a proof-of-concept, we have created a toolbox of FRET-based biosensors for the ratiometric determination of l-lysine in fermentation broth. Methods: The sensor toolbox was constructed based on a sensor that consists of an optimized central lysine-/arginine-/ornithine-binding protein (LAO-BP flanked by two fluorescent proteins (enhanced cyan fluorescent protein (ECFP, Citrine. Further sensor variants with altered affinity and sensitivity were obtained by circular permutation of the binding protein as well as the introduction of flexible and rigid linkers between the fluorescent proteins and the LAO-BP, respectively. Results: The sensor prototype was applied to monitor the extracellular l-lysine concentration of the l-lysine producing Corynebacterium glutamicum (C. glutamicum strain DM1933 in a BioLector® microscale cultivation device. The results matched well with data obtained by HPLC analysis and the Ninhydrin assay, demonstrating the high potential of FRET-based biosensors for high-throughput microbial bioprocess optimization.

  18. The use of crude protein content to predict concentrations of lysine ...

    African Journals Online (AJOL)

    Correlations were determined between the crude protein (CP) and lysine or methionine concentrations of grain from wheat (cultivar: palmiet), barley (cultivar: clipper) and triticale (cultivar: usgen 19) grown in the Western Cape region of South Africa. Twenty samples of varying CP content were collected for each grain type ...

  19. Histone H3 Lysine Methylation in Cognition and Intellectual Disability Disorders

    Science.gov (United States)

    Parkel, Sven; Lopez-Atalaya, Jose P.; Barco, Angel

    2013-01-01

    Recent research indicates that epigenetic mechanisms and, in particular, the post-translational modification (PTM) of histones may contribute to memory encoding and storage. Among the dozens of possible histone PTMs, the methylation/demethylation of lysines in the N-terminal tail of histone H3 exhibits particularly strong links with cognitive…

  20. Extracción, identificación y prueba microbiológica del agar extraído de Gracilaria fortissima dawson (rhodophyta, gigartinales, gracilariaceae (ING

    Directory of Open Access Journals (Sweden)

    M.V. Sánchez

    2016-03-01

    Full Text Available The red seaweed Gracilaria fortissima colected in the caribean coast of Costa Rica, was studied for the extraction, identification and microbiological performance of the agar contend of this plant, as well as the mineral contend. The research was done focused on the agar quality included pH, % extraction, geling point, fusion point and gel strength, as well as infrared analysis and the performance as a microbiological culture of bacteria and fungus and compared with commercial agar from BDH chemicals.

  1. Lysine-functionalized nanodiamonds: synthesis, physiochemical characterization, and nucleic acid binding studies

    Science.gov (United States)

    Kaur, Randeep; Chitanda, Jackson M; Michel, Deborah; Maley, Jason; Borondics, Ferenc; Yang, Peng; Verrall, Ronald E; Badea, Ildiko

    2012-01-01

    Purpose: Detonation nanodiamonds (NDs) are carbon-based nanomaterials that, because of their size (4–5 nm), stable inert core, alterable surface chemistry, fluorescence, and biocompatibility, are emerging as bioimaging agents and promising tools for the delivery of biochemical molecules into cellular systems. However, diamond particles possess a strong propensity to aggregate in liquid formulation media, restricting their applicability in biomedical sciences. Here, the authors describe the covalent functionalization of NDs with lysine in an attempt to develop nanoparticles able to act as suitable nonviral vectors for transferring genetic materials across cellular membranes. Methods: NDs were oxidized and functionalized by binding lysine moieties attached to a three-carbon-length linker (1,3-diaminopropane) to their surfaces through amide bonds. Raman and Fourier transform infrared spectroscopy, zeta potential measurement, dynamic light scattering, atomic force microscopic imaging, and thermogravimetric analysis were used to characterize the lysine-functionalized NDs. Finally, the ability of the functionalized diamonds to bind plasmid DNA and small interfering RNA was investigated by gel electrophoresis assay and through size and zeta potential measurements. Results: NDs were successfully functionalized with the lysine linker, producing surface loading of 1.7 mmol g−1 of ND. These modified NDs formed highly stable aqueous dispersions with a zeta potential of 49 mV and particle size of approximately 20 nm. The functionalized NDs were found to be able to bind plasmid DNA and small interfering RNA by forming nanosized “diamoplexes”. Conclusion: The lysine-substituted ND particles generated in this study exhibit stable aqueous formulations and show potential for use as carriers for genetic materials. PMID:22904623

  2. Comparative Analysis of Proteome-Wide Lysine Acetylation in Juvenile and Adult Schistosoma japonicum

    Directory of Open Access Journals (Sweden)

    Qing Li

    2017-11-01

    Full Text Available Schistosomiasis is a devastating parasitic disease caused by tremotodes of the genus Schistosoma. Eggs produced by sexually mature schistosomes are the causative agents of for pathogenesis and transmission. Elucidating the molecular mechanism of schistosome development and sexual maturation would facilitate the prevention and control of schistosomiasis. Acetylation of lysine is a dynamic and reversible post-translational modification playing keys role in many biological processes including development in both eukaryotes and prokaryotes. To investigate the impacts of lysine acetylation on Schistosoma japonicum (S. japonicum development and sexual maturation, we used immunoaffinity-based acetyllysine peptide enrichment combined with mass spectrometry (MS, to perform the first comparative analysis of proteome-wide lysine acetylation in both female and male, juvenile (18 days post infection, 18 dpi and adult (28 dpi schistosome samples. In total, we identified 874 unique acetylated sites in 494 acetylated proteins. The four samples shared 47 acetylated sites and 46 proteins. More acetylated sites and proteins shared by both females and males were identified in 28 dpi adults (189 and 143, respectively than in 18 dpi schistosomula (76 and 59, respectively. More stage-unique acetylated sites and proteins were also identified in 28 dpi adults (494 and 210, respectively than in 18 dpi schistosomula (73 and 44, respectively. Functional annotation showed that in different developmental stages and genders, a number of proteins involving in muscle movement, glycometabolism, lipid metabolism, energy metabolism, environmental stress resistance, antioxidation, etc., displayed distinct acetylation profiles, which was in accordance with the changes of their biological functions during schistosome development, suggesting that lysine acetylation modification exerted important regulatory roles in schistosome development. Taken together, our data provided the first

  3. Comparison of Neisseria gonorrhoeae MICs Obtained by Etest and Agar Dilution for Ceftriaxone, Cefpodoxime, Cefixime and Azithromycin.

    Science.gov (United States)

    Gose, Severin; Kong, Carol J; Lee, Yer; Samuel, Michael C; Bauer, Heidi M; Dixon, Paula; Soge, Olusegun O; Lei, John; Pandori, Mark

    2013-10-24

    We evaluated Neisseria gonorrhoeae Etest minimum inhibitory concentrations (MICs) relative to agar dilution MICs for 664 urethral isolates for ceftriaxone (CRO) and azithromycin (AZM), 351 isolates for cefpodoxime (CPD) and 315 isolates for cefixime (CFM). Etest accurately determined CPD, CFM and AZM MICs, but resulted in higher CRO MICs. © 2013. Published by Elsevier B.V. All rights reserved.

  4. Agar Plates Made from Common Supermarket Substances and Bacillus subtilis Natto as an Inexpensive Approach to Microbiology Education

    Directory of Open Access Journals (Sweden)

    Franz-Josef Scharfenberg

    2015-08-01

    Full Text Available To address the possible limitations that financial restrictions may have on students’ independent experimentation at school, we developed and implemented an inexpensive approach for basic microbiology education. We describe four nutrient agars consisting only of everyday substances available from the supermarket or online that we developed to replace standard agars and specific agars. Additionally, we selected Bacillus subtilis natto as an example of a pure-culture species. Our tip first reports the four supermarket-substance agar variants; second, it suggests utilizing them to introduce basic microbiological techniques; and third, it introduces B. subtilis natto in the context of the antibacterial effects of antibiotics as well as of supermarket products which students can bring to class from home. We implemented our approach in microbiology education at school as well as in pre-service teacher education and in in-service teacher professional development courses at our university. Finally, our paper provides worksheets for all the experiments. Editor's Note:The ASM advocates that students must successfully demonstrate the ability to explain and practice safe laboratory techniques. For more information, read the laboratory safety section of the ASM Curriculum Recommendations: Introductory Course in Microbiology and the Guidelines for Biosafety in Teaching Laboratories, available at www.asm.org. The Editors of JMBE recommend that adopters of the protocols included in this article follow a minimum of Biosafety Level 1 practices. If the soil plates described in the activity are opened, a minimum of Biosafety Level 2 is required.

  5. Choline chloride based ionic liquid analogues as tool for the fabrication of agar films with improved mechanical properties

    Science.gov (United States)

    In the present paper, we test the suitability of Choline-Cl/urea (DES-U) and Choline-Cl/glycerol (DES-G) eutectic mixtures at 1:2 molar ratios for the production of agar biodegradable films. A three-step process is proposed: pre-solubilization of polymer in DES followed by compression-molding and s...

  6. Detection of Fusobacterium nucleatum in two cases of empyema and lung abscess using paromomycin-vancomycin supplemented Brucella HK agar.

    Science.gov (United States)

    Nagaoka, Kentaro; Yanagihara, Katsunori; Morinaga, Yoshitomo; Kohno, Shigeru

    2017-02-01

    Fusobacterium nucleatum was found in patients with empyema or pulmonary abscess, using paromomycin-vancomycin Brucella HK agar. In vitro examination revealed that growth of the strains differed significantly in different media. Clinicians should be aware that suboptimal F. nucleatum cultivation methods may result in an underestimation of its frequency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Effects of immersion disinfection of agar-alginate combined impressions on the surface properties of stone casts.

    Science.gov (United States)

    Iwasaki, Yukiko; Hiraguchi, Hisako; Iwasaki, Eriko; Yoneyama, Takayuki

    2016-01-01

    This study investigated the effects of disinfection of agar-alginate combined impressions on the surface properties of the resulting stone casts. Two brands of cartridge-form agar impression material and one alginate impression material were used. Agar-alginate combined impressions of smooth glass plates were prepared. The impressions were immersed in 0.55% ortho-phthalaldehyde solution or 0.5% sodium hypochlorite solution for 1, 3, 5 and 10 min. A stone cast made with an impression that had not been immersed was prepared as a control. The surface roughness (Ra) of the stone casts was measured, and the cast surfaces were observed by SEM. Immersion of agar-alginate combined impressions in 0.5% sodium hypochlorite solution for up to 10 min had no serious adverse effects on the surface properties of the stone casts. In contrast, even 1 min of immersion in 0.55% ortho-phthalaldehyde solution caused deterioration of the cast surface properties.

  8. Agar/gelatin bilayer gel matrix fabricated by simple thermo-responsive sol-gel transition method.

    Science.gov (United States)

    Wang, Yifeng; Dong, Meng; Guo, Mengmeng; Wang, Xia; Zhou, Jing; Lei, Jian; Guo, Chuanhang; Qin, Chaoran

    2017-08-01

    We present a simple and environmentally-friendly method to generate an agar/gelatin bilayer gel matrix for further biomedical applications. In this method, the thermally responsive sol-gel transitions of agar and gelatin combined with the different transition temperatures are exquisitely employed to fabricate the agar/gelatin bilayer gel matrix and achieve separate loading for various materials (e.g., drugs, fluorescent materials, and nanoparticles). Importantly, the resulting bilayer gel matrix provides two different biopolymer environments (a polysaccharide environment vs a protein environment) with a well-defined border, which allows the loaded materials in different layers to retain their original properties (e.g., magnetism and fluorescence) and reduce mutual interference. In addition, the loaded materials in the bilayer gel matrix exhibit an interesting release behavior under the control of thermal stimuli. Consequently, the resulting agar/gelatin bilayer gel matrix is a promising candidate for biomedical applications in drug delivery, controlled release, fluorescence labeling, and bio-imaging. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. [Thin layer agar represents a cost-effective alternative for the rapid diagnosis of multi-drug resistant tuberculosis].

    Science.gov (United States)

    Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A

    2014-01-01

    Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.

  10. Evaluatie van de membraanfiltratiemethode op mCP-agar voor bepaling van sporen van Clostridium perfringens in water

    NARCIS (Netherlands)

    Schets FM; Medema GJ; LWL

    1995-01-01

    Current Dutch and European drinking water standards include criteria for spores of sulphite reducing clostridia. This has some inherent disadvantages. The reproducibility of the enumeration method for spores of sulphite reducing clostridia (SSRC) in Sulphite Cycloserine Agar (SCA) is poor. Some

  11. A simple agar plate preparation for effective transfer of Ureaplasma colonies onto nitrocellulose membranes for colony immunoblotting.

    Science.gov (United States)

    Zimmerman, Carl-Ulrich R; Stiedl, Thomas; Spergser, Joachim; Rosengarten, Renate

    2014-09-01

    A simple method for preparing agar plates is presented, which allows an efficient transfer of Ureaplasma colonies to nitrocellulose membranes for subsequent immunological detection. This simple and reproducible procedure was used to demonstrate antigenic variation in the phase-variable mba-locus of Ureaplasma parvum serovar 3. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. CYLD, a deubiquitinase specific for lysine63-linked polyubiquitins, accumulates at the postsynaptic density in an activity-dependent manner

    International Nuclear Information System (INIS)

    Dosemeci, Ayse; Thein, Soe; Yang, Yijung; Reese, Thomas S.; Tao-Cheng, Jung-Hwa

    2013-01-01

    Highlights: ► CYLD is a deubiquitinase specific for lysine63-linked polyubiquitins. ► Presence of CYLD in PSDs is established by biochemistry and immunoEM. ► CYLD accumulates on PSDs upon depolarization of neurons. ► Accumulation of CYLD at PSDs may regulate trafficking/degradation of synaptic proteins. -- Abstract: Polyubiquitin chains on proteins flag them for distinct fates depending on the type of polyubiquitin linkage. While lysine48-linked polyubiquitination directs proteins to proteasomal degradation, lysine63-linked polyubiquitination promotes different protein trafficking and is involved in autophagy. Here we show that postsynaptic density (PSD) fractions from adult rat brain contain deubiquitinase activity that targets both lysine48 and lysine63-linked polyubiquitins. Comparison of PSD fractions with parent subcellular fractions by Western immunoblotting reveals that CYLD, a deubiquitinase specific for lysine63-linked polyubiquitins, is highly enriched in the PSD fraction. Electron microscopic examination of hippocampal neurons in culture under basal conditions shows immunogold label for CYLD at the PSD complex in approximately one in four synapses. Following depolarization by exposure to high K+, the proportion of CYLD-labeled PSDs as well as the labeling intensity of CYLD at the PSD increased by more than eighty percent, indicating that neuronal activity promotes accumulation of CYLD at the PSD. An increase in postsynaptic CYLD following activity would promote removal of lysine63-polyubiquitins from PSD proteins and thus could regulate their trafficking and prevent their autophagic degradation.

  13. Insight into the collagen assembly in the presence of lysine and glutamic acid: An in vitro study.

    Science.gov (United States)

    Liu, Xinhua; Dan, Nianhua; Dan, Weihua

    2017-01-01

    The aim of this study is to evaluate the effects of two different charged amino acids in collagen chains, lysine and glutamic acid, on the fibrillogenesis process of collagen molecules. The turbidity, zeta potential, and fiber diameter analysis suggest that introducing the positively charged lysine into collagen might improve the sizes or amounts of the self-assembled collagen fibrils significantly. Conversely, the negatively charged glutamic acid might restrict the self-assembly of collagen building blocks into a higher order structure. Meanwhile, the optimal fibrillogenesis condition is achieved when the concentration of lysine reaches to 1mM. Both scanning electron microscopy (SEM) and atomic force microscope (AFM) analysis indicates that compared to pure collagen fibrils, the reconstructed collagen-lysine co-fibrils exhibit a higher degree of inter-fiber entanglements with more straight and longer fibrils. Noted that the specific D-period patterns of the reconstructed collagen fibrils could be clearly discernible and the width of D-banding increases steadily after introducing lysine. Besides, the kinetic and thermodynamic collagen self-assembly analysis confirms that the rate constants of both the first and second assembly phase decrease after introducing lysine, and lysine could promote the process of collagen fibrillogenesis obeying the laws of thermodynamics. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. CYLD, a deubiquitinase specific for lysine63-linked polyubiquitins, accumulates at the postsynaptic density in an activity-dependent manner

    Energy Technology Data Exchange (ETDEWEB)

    Dosemeci, Ayse, E-mail: dosemeca@mail.nih.gov [Laboratory of Neurobiology, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 (United States); Thein, Soe; Yang, Yijung; Reese, Thomas S. [Laboratory of Neurobiology, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 (United States); Tao-Cheng, Jung-Hwa [EM Facility, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 (United States)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer CYLD is a deubiquitinase specific for lysine63-linked polyubiquitins. Black-Right-Pointing-Pointer Presence of CYLD in PSDs is established by biochemistry and immunoEM. Black-Right-Pointing-Pointer CYLD accumulates on PSDs upon depolarization of neurons. Black-Right-Pointing-Pointer Accumulation of CYLD at PSDs may regulate trafficking/degradation of synaptic proteins. -- Abstract: Polyubiquitin chains on proteins flag them for distinct fates depending on the type of polyubiquitin linkage. While lysine48-linked polyubiquitination directs proteins to proteasomal degradation, lysine63-linked polyubiquitination promotes different protein trafficking and is involved in autophagy. Here we show that postsynaptic density (PSD) fractions from adult rat brain contain deubiquitinase activity that targets both lysine48 and lysine63-linked polyubiquitins. Comparison of PSD fractions with parent subcellular fractions by Western immunoblotting reveals that CYLD, a deubiquitinase specific for lysine63-linked polyubiquitins, is highly enriched in the PSD fraction. Electron microscopic examination of hippocampal neurons in culture under basal conditions shows immunogold label for CYLD at the PSD complex in approximately one in four synapses. Following depolarization by exposure to high K+, the proportion of CYLD-labeled PSDs as well as the labeling intensity of CYLD at the PSD increased by more than eighty percent, indicating that neuronal activity promotes accumulation of CYLD at the PSD. An increase in postsynaptic CYLD following activity would promote removal of lysine63-polyubiquitins from PSD proteins and thus could regulate their trafficking and prevent their autophagic degradation.

  15. Development and Validation of a Microbiological Agar Assay for Determination of Orbifloxacin in Pharmaceutical Preparations

    Directory of Open Access Journals (Sweden)

    Hérida R. N. Salgado

    2011-08-01

    Full Text Available Orbifloxacin is a fluoroquinolone with broad-spectrum antimicrobial activity, and belongs to the third generation of quinolones. Regarding the quality control of medicines, a validated microbiological assay for determination of orbifloxacin in pharmaceutical formulations has not as yet been reported. For this purpose, this paper reports the development and validation of a simple, sensitive, accurate and reproducible agar diffusion method to quantify orbifloxacin in tablet formulations. The assay is based on the inhibitory effect of orbifloxacin upon the strain of Staphylococcus aureus ATCC 25923 used as test microorganism. The results were treated statistically by analysis of variance and were found to be linear (r = 0.9992 in the selected range of 16.0–64.0 μg/mL, precise with relative standard deviation (RSD of repeatability intraday = 2.88%, intermediate precision RSD = 3.33%, and accurate (100.31%. The results demonstrated the validity of the proposed bioassay, which allows reliable orbifloxacin quantitation in pharmaceutical samples and therefore can be used as a useful alternative methodology for the routine quality control of this medicine.

  16. Hypertonic sabouraud dextrose agar as a substrate for differentiation of Candida dubliniensis.

    Science.gov (United States)

    Akgül, Oncü; Cerikçioğlu, Nilgün

    2009-06-01

    In this study, we aimed to detect the proportion of Candida dubliniensis among yeast strains previously identified as C. albicans by using several phenotypic methods and PCR.For this purpose, we screened 300 strains by using phenotypic tests suggested for the identification of C. dubliniensis in the literature, but we detected high proportion of false-positive reactions. Only two strains (0.6%) were detected as true C. dubliniensis by PCR and API ID 32C methods. Moreover, these two strains gave the expected results with all the phenotypic tests, including modified salt tolerance test for C. dubliniensis.In conclusion, none of the phenotypic methods, except for the modified salt tolerance test, revealed 100% successful results in discrimination of C. albicans and C. dubliniensis species. However, in the tobacco agar test, the rate of false positivity was as low as 0.6%. We suggest that in the case of absence of PCR and other automatized identification systems, these two phenotypic tests can be used in routine laboratories to obtain a presumptive result.

  17. Internal properties assessment in agar wood trees using ultrasonic velocity measurement

    International Nuclear Information System (INIS)

    Mohd Noorul Ikhsan Mohamed; Mohamad Pauzi Ismail; Mat Rasol Awang; Mohd Fajri Osman; Fakhruzi, M.; Hashim, M.M.

    2010-01-01

    This paper presents the application of ultrasonic velocity in agar wood trees (Aquilaria crassna) with the purpose of evaluating the relationship of the ultrasonic velocity to the variations of internal properties of trees. In this study, three circular cross-sectional discs from the freshly cut tree were selected as samples. First sample with a big hole (decay) in the middle, second sample with internal resinous and the last one is the sample with no defects. The through transmission ultrasonic testing method was carried out using Tico ultrasonic pulse velocity tester which is from Switzerland. Two-dimensional image of internal properties evaluation by an ultrasonic investigation was obtained using Matlab. The results showed that the ultrasonic wave cannot pass through the internal decay or resinous so that the wave went round it and thus ultrasonic wave velocity significantly decreased by increasing the hole or resinous. The difference in color of the image generated by Matlab software based on variation of ultrasonic velocity between the internal decay area and its surrounding area was obvious. Therefore, the properties of internal properties of the three could be detected by ultrasonic line imaging technique. (author)

  18. Functional properties of edible agar-based and starch-based films for food quality preservation.

    Science.gov (United States)

    Phan, The D; Debeaufort, F; Luu, D; Voilley, A

    2005-02-23

    Edible films made of agar (AG), cassava starch (CAS), normal rice starch (NRS), and waxy (glutinous) rice starch (WRS) were elaborated and tested for a potential use as edible packaging or coating. Their water vapor permeabilities (WVP) were comparable with those of most of the polysaccharide-based films and with some protein-based films. Depending on the environmental moisture pressure, the WVP of the films varies and remains constant when the relative humidity (RH) is >84%. Equilibrium sorption isotherms of these films have been measured; the Guggenheim-Anderson-de Boer (GAB) model was used to describe the sorption isotherm and contributed to a better knowledge of hydration properties. Surface hydrophobicity and wettability of these films were also investigated using the sessile drop contact angle method. The results obtained suggested the migration of the lipid fraction toward evaporation surface during film drying. Among these polysaccharide-based films, AG-based film and CAS-based film displayed more interesting mechanical properties: they are transparent, clear, homogeneous, flexible, and easily handled. NRS- and WRS-based films were relatively brittle and have a low tension resistance. Microstructure of film cross section was observed by environmental scanning electron microscopy to better understand the effect of the structure on the functional properties. The results suggest that AG-based film and CAS-based films, which show better functional properties, are promising systems to be used as food packaging or coating instead of NRS- and WRS-based films.

  19. Estimating the Diffusion Coefficients of Sugars Using Diffusion Experiments in Agar-Gel and Computer Simulations.

    Science.gov (United States)

    Miyamoto, Shuichi; Atsuyama, Kenji; Ekino, Keisuke; Shin, Takashi

    2018-01-01

    The isolation of useful microbes is one of the traditional approaches for the lead generation in drug discovery. As an effective technique for microbe isolation, we recently developed a multidimensional diffusion-based gradient culture system of microbes. In order to enhance the utility of the system, it is favorable to have diffusion coefficients of nutrients such as sugars in the culture medium beforehand. We have, therefore, built a simple and convenient experimental system that uses agar-gel to observe diffusion. Next, we performed computer simulations-based on random-walk concepts-of the experimental diffusion system and derived correlation formulas that relate observable diffusion data to diffusion coefficients. Finally, we applied these correlation formulas to our experimentally-determined diffusion data to estimate the diffusion coefficients of sugars. Our values for these coefficients agree reasonably well with values published in the literature. The effectiveness of our simple technique, which has elucidated the diffusion coefficients of some molecules which are rarely reported (e.g., galactose, trehalose, and glycerol) is demonstrated by the strong correspondence between the literature values and those obtained in our experiments.

  20. Acidity Tunable Ionic Liquids as Catalysts for Conversion of Agar into Mixed Sugars

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Churl; Kim, Hoon Sik [Kyung Hee Univ., Seoul (Korea, Republic of); Ryu, Hyun Jin; Kim, Sang Hyoun; Yoon, Jeong Jun; Kim, Yong Jin [Korea Institute of Industrial Technology, Cheonan (Korea, Republic of)

    2010-02-15

    To summarize, various factors affecting yields of Gal, AG, and 5-HMF formation during saccharification were investigated using agar as a substrate in the presence of several bisulfate-based acidic ionic liquids as catalysts. The result was compared with employing sulfuric acid from the viewpoint of sugar yields and 5-HMF formation. [Bmim][HSO{sub 4}], [Hmim][HSO{sub 4}], [Morph] [HSO{sub 4}], [Bu{sub 4}N][HSO{sub 4}], [Bu{sub 4}P][HSO{sub 4}], [Chol][HSO{sub 4}] showed moderate to high yields of Gal and AG with a remarkable decrease in 5-HMF formation compared with sulfuric acid. Among them, [Chol][HSO{sub 4}] ionic liquid was found to exhibit the highest yield of sugars with an acceptable concentration of 5-HMF that does not inhibit the fermentation process. Generally, there are five major bottom lines for a bioethanol process to be economically viable: the feedstock must be plentiful, inexpensive, in high energy conversion rate, in low demand for food industry, and finally, has to be cultivated in sustainable systems.

  1. Unraveling the nuclear and chloroplast genomes of an agar producing red macroalga, Gracilaria changii (Rhodophyta, Gracilariales).

    Science.gov (United States)

    Ho, Chai-Ling; Lee, Wei-Kang; Lim, Ee-Leen

    2018-03-01

    Agar and agarose have wide applications in food and pharmaceutical industries. Knowledge on the genome of red seaweeds that produce them is still lacking. To fill the gap in genome analyses of these red algae, we have sequenced the nuclear and organellar genomes of an agarophyte, Gracilaria changii. The partial nuclear genome sequence of G. changii has a total length of 35.8Mb with 10,912 predicted protein coding sequences. Only 39.4% predicted proteins were found to have significant matches to protein sequences in SwissProt. The chloroplast genome of G. changii is 183,855bp with a total of 201 open reading frames (ORFs), 29 tRNAs and 3 rRNAs predicted. Five genes: ssrA, leuC and leuD CP76_p173 (orf139) and pbsA were absent in the chloroplast genome of G. changii. The genome information is valuable in accelerating functional studies of individual genes and resolving evolutionary relationship of red seaweeds. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Comparison of three techniques for production goat lentivirus antigen used in the agar gel immunodifusion test

    Directory of Open Access Journals (Sweden)

    Raymundo Rizaldo Pinheiro

    2005-12-01

    Full Text Available The Caprine Arthritis Encephalitis (CAE is a disease who cause considerable economic losses, including loss in the milk production and reduction of the useful life of the animal. In the diagnosis of this disease the agar gel immunodifusion test (AGID is used worldwide as the selection test. The objective of thid work was to test three different concentrations of bovine fetal serum (BFS in the production of the antigen (Ag for the diagnosis of the CAE virus (CAEV, to verify amongst the three methods the most efficient concentration and which the antigen concentration of the antigen produced is appropriate for the test. The method of the AMICON and the concentration of the Ag for dialysis was indicated, however the system AMICON, despite the implantation costs, promoted minor loss of antigen, little time expense in the processing and greater simplicity. With relation to the amount of BFS placed after the viral inoculation it was verified that 5% of BFS the amount that presented better resulted. The antigen concentration 100 times was more indicated, therefore it allowed the diagnosis of the CAEV for two proteins (gp 135 and p28. The concentration of the Ag for precipitation/ultracentrifugation, used for imunoenzimatic tests, did not present resulted satisfactory used in the AGID.

  3. Antimicrobial susceptibility of Brazilian Clostridium difficile strains determined by agar dilution and disk diffusion

    Directory of Open Access Journals (Sweden)

    Edmir Geraldo Fraga

    2016-09-01

    Full Text Available Clostridium difficile is a leading cause of diarrhea in hospitalized patients worldwide. While metronidazole and vancomycin are the most prescribed antibiotics for the treatment of this infection, teicoplanin, tigecycline and nitazoxanide are alternatives drugs. Knowledge on the antibiotic susceptibility profiles is a basic step to differentiate recurrence from treatment failure due to antimicrobial resistance. Because C. difficile antimicrobial susceptibility is largely unknown in Brazil, we aimed to determine the profile of C. difficile strains cultivated from stool samples of inpatients with diarrhea and a positive toxin A/B test using both agar dilution and disk diffusion methods. All 50 strains tested were sensitive to metronidazole according to CLSI and EUCAST breakpoints with an MIC90 value of 2 μg/mL. Nitazoxanide and tigecycline were highly active in vitro against these strains with an MIC90 value of 0.125 μg/mL for both antimicrobials. The MIC90 were 4 μg/mL and 2 μg/mL for vancomycin and teicoplanin, respectively. A resistance rate of 8% was observed for moxifloxacin. Disk diffusion can be used as an alternative to screen for moxifloxacin resistance, nitazoxanide, tigecycline and metronidazole susceptibility, but it cannot be used for testing glycopeptides. Our results suggest that C. difficile strains from São Paulo city, Brazil, are susceptible to metronidazole and have low MIC90 values for most of the current therapeutic options available in Brazil.

  4. Theoretical and experimental NMR studies on muscimol from fly agaric mushroom (Amanita muscaria)

    Science.gov (United States)

    Kupka, Teobald; Wieczorek, Piotr P.

    2016-01-01

    In this article we report results of combined theoretical and experimental NMR studies on muscimol, the bioactive alkaloid from fly agaric mushroom (Amanita muscaria). The assignment of 1H and 13C NMR spectra of muscimol in DMSO-d6 was supported by additional two-dimensional heteronuclear correlated spectra (2D NMR) and gauge independent atomic orbital (GIAO) NMR calculations using density functional theory (DFT). The effect of solvent in theoretical calculations was included via polarized continuum model (PCM) and the hybrid three-parameter B3LYP density functional in combination with 6-311++G(3df,2pd) basis set enabled calculation of reliable structures of non-ionized (neutral) molecule and its NH and zwitterionic forms in the gas phase, chloroform, DMSO and water. GIAO NMR calculations, using equilibrium and rovibrationally averaged geometry, at B3LYP/6-31G* and B3LYP/aug-cc-pVTZ-J levels of theory provided muscimol nuclear magnetic shieldings. The theoretical proton and carbon chemical shifts were critically compared with experimental NMR spectra measured in DMSO. Our results provide useful information on its structure in solution. We believe that such data could improve the understanding of basic features of muscimol at atomistic level and provide another tool in studies related to GABA analogs.

  5. Impact of lysine-fortified wheat flour on morbidity and immunologic variables among members of rural families in northwest Syria.

    Science.gov (United States)

    Ghosh, Shibani; Pellett, Peter L; Aw-Hassan, Aden; Mouneime, Youssef; Smriga, Miro; Scrimshaw, Nevin S

    2008-09-01

    Previous studies have shown an effect of lysine fortification on nutrition and immunity of poor men, women, and children consuming a predominantly wheat-based diet. To examine the lysine value of diets and the effect of lysine fortification on functional protein status, anthropometry, and morbidity of men, women, and children in rural Syria. At baseline of a two-phase study using 7-day household food intake inventories (n = 98), nutrient availabilities per adult male equivalent were estimated. In the intervention phase, a 16-week double-blind trial, households (n = 106) were randomly assigned to control and lysine groups. Hematologic and anthropometric data were collected from men (n = 69; 31 control, 38 lysine), women (n = 99; 51 control, 48 lysine), and children (n = 69; 37 control, 32 lysine) at baseline, 12 weeks, and 16 weeks. Total CD3 T lymphocytes as well as T lymphocytes bearing the receptors CD4, CD8, and CD56, IgM, IgG, IgA, complement C3, C-reactive protein, serum albumin, prealbumin, transferrin, retinol-binding protein, hemoglobin, and hepatitis B surface antigen were determined. Health status and flour usage were monitored. Paired- and independent-sample t-tests and chi-square tests were performed. Mean nutrient availability per adult equivalent was 2,650 +/- 806 kcal, 70.1 +/- 26.4 g protein, 65 +/- 14% cereal protein, and 41.9 +/- 0.8 mg lysine per gram of protein. Complement C3 was significantly higher in men receiving lysine than in controls (p children, who have much higher morbidity and mortality rates from this disease than school-age children or adults.

  6. [Variations in hyperbilirrubinemia in low birth weight newborns under phototherapy and continous or discontinous agar oral administration (author's transl)].

    Science.gov (United States)

    Colomer, J; Moya, M; Marco, V; De Paredes, C; Escrivá, F; Vila, R

    1975-06-01

    Therapeutic attitude in hyperbilirrubinemia is always worth because other infrequent complications but not for this, less important. Phototherapy innocuousness, largely demonstrated, fosters its profilactic use at beginning and not only for those babies with serum bilirrubin over 10 mg % in the first day of life. Previously we have reported positive results with agar oral administration without collateral effects. On this grounds we have planned the following experience in a homogenous group of L.B.W.: one group was fed with agar previously to each formula administration; other group received the same amount of agar but divided in only three administrations in 24 hours; the last group received continuous phototherapy for 96 hours with a white cold fluorescent light from a source of 8-Vita-lite lamp of 40 watts with a intensity of 500 foot candle and 30 lumens. All of these babies weighed less than 2.500 g. and were between 10 and 90 percentil of Lubschenko diagram. They were fed with the same formula and same time table with no infusions, rejecting all that presented any type of pathology. Obstetric conditions were basically identical. This population was randomly divided in four groups. 1) Control group with no profilaxis, but with identical bilirrubin andhematocrit determinations. 2) Group with continuous agar oral administration, 125 mg. before each of the seven formula feeding. 3) Group with discontinuous agar administration, 250 mg. before three of the seven formula feeding. 4) Group with continuous phototherapy for 96 hours. These is initial identification of the groups with statistic signification, and after that a quantitative and sequential evolution of bilirrubin is analized in each group.

  7. Induction of monooxygenases and incorporation of radioactivity from 2-14C-lysine into hepatic microsomes of phenobarbital-treated rats fed a diet deficient in lysine, methionine, threonine and vitamines A, C, E

    International Nuclear Information System (INIS)

    Nurmagambetov, T.Zh.; Amirov, B.B.; Kuanysheva, T.G.; Sharmanov, T.Sh.

    1992-01-01

    The effect of diet on induction of monooxygenases and distribution of radioactivity from 2- 14 C-lysine in fractions of liver homogenate, muscle homogenate and blood of male rats treated with phenobarbital was studied. 2- 14 C-lysin was injected intraperitoneally 24 h before the first injection of phenobarbital. It was demonstrated that monooxygenase induction, increase of relative liver weight and incorporation of radioactivity from 2- 14 C-lysine into fractions of liver homogenate in phenobarbital-treated rats fed diet deficient in lysine, methionine, threonine and vitamins A, C, E were more pronounced as compared with the similarly treated rats which were fed a balanced diet. The possibility of mobilization of deficient essencial components to liver from other organs and tissues for maintenance of monooxygenase induction iis discussed

  8. Analysis of High Quality Agar wood Oil Chemical Compounds By Means Of SPME/ GC-MS and Z-Score Technique

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Mohd Ali Nor Azah; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Currently, the grading of the agar wood oil to the high and low quality is done using manually such as human trained grader. It was performed based on the agar wood oil physical properties such as human experience and perception and the oil colour, odor and long lasting aroma. Several researchers found that chemical profiles of the oil should be utilized to overcome the problem facing by manual techniques for example human nose cannot tolerate with the many oils at the same time, so that accurate result can be obtained in grading the agar wood oil. The analysis involved of SPME/ GC-MS and Z-score techniques have been proposed in this study to analyze the chemical compounds especially from the high quality samples of agar wood oil (Aquilariamalaccensis) from Malaysia. Two SPME fibers were used such as divinylbenzene-carbogen-polydimethylsiloxane (DVB-CAR-PDMS) and polydimethylsiloxane (PDMS) in extracting the oils compound under three different sampling temperature conditions such as 40, 60 and 80 degree Celsius. The chemical compounds extracted by SPME/ GC-MS were analyzed. The chemical compounds as identified by Z-score as significant compounds were discussed before the conclusion is made. It was found that 10-epi-γ-eudesmol, aromadendrene, β-agar ofuran, α-agar ofuran and γ-eudesmol were highlighted as significant for high quality agar wood oil and can be used as a marker compounds in classifying the agar wood oil. (author)

  9. Equivalency testing of TTC Tergitol 7 agar (ISO 9308-1:2000) with five culture media for the detection of E. coli in water samples in Greece.

    Science.gov (United States)

    Mavridou, A; Smeti, E; Mandilara, G; Mandilara, G; Boufa, P; Vagiona-Arvanitidou, M; Vantarakis, A; Vassilandonopoulou, G; Pappa, O; Roussia, V; Tzouanopoulos, A; Livadara, M; Aisopou, I; Maraka, V; Nikolaou, E; Mandilara, G

    2010-01-01

    In this study ten laboratories in Greece compared the performance of reference method TTC Tergitol 7 Agar (with the additional test of beta-glucuronidase production) with five alternative methods, to detect E. coli in water, in line with European Water Directive recommendations. The samples were prepared by spiking drinking water with sewage effluent following a standard protocol. Chlorinated and non-chlorinated samples were used. The statistical analysis was based on the mean relative difference of confirmed counts and was performed in line with ISO 17994. The results showed that in total, three of the alternative methods (Chromocult Coliform agar, Membrane Lauryl Sulfate agar and Trypton Bilex-glucuronidase medium) were not different from TTC Tergitol 7 agar (TTC Tergitol 7 agar vs Chromocult Coliform agar, 294 samples, mean RD% 5.55; vs MLSA, 302 samples, mean RD% 1; vs TBX, 297 samples, mean RD% -2.78). The other two alternative methods (Membrane Faecal coliform medium and Colilert 18/ Quantitray) gave significantly higher counts than TTC Tergitol 7 agar (TTC Tergitol 7 agar vs MFc, 303 samples, mean RD% 8.81; vs Colilert-18/Quantitray, 76 samples, mean RD% 18.91). In other words, the alternative methods generated performance that was as reliable as, or even better than, the reference method. This study will help laboratories in Greece overcome culture and counting problems deriving from the EU reference method for E. coli counts in water samples.

  10. Comparison of Rosco Neo-Sensitabs with Oxoid paper disks in EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar

    DEFF Research Database (Denmark)

    Justesen, U S; Acar, Ziyap; Olsson, K

    2013-01-01

    This study compared Neo-Sensitabs with Oxoid paper disks using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) disk diffusion antimicrobial susceptibility test on Mueller-Hinton agar. The EUCAST-recommended quality control strains (Escherichia coli ATCC 25922, Pseudomonas...... paper disks for EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar....

  11. Chromium and zinc uptake by algae Gelidium and agar extraction algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-11-19

    Biosorption of chromium and zinc ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). Langmuir and Langmuir-Freundlich equilibrium models describe well the equilibrium data. The parameters of Langmuir equilibrium model at pH 5.3 and 20 degrees C were for the algae, q(L)=18 mg Cr(III)g(-1) and 13 mgZn(II)g(-1), K(L) = 0.021l mg(-1)Cr(III) and 0.026l mg(-1) Zn(II); for the algal waste, q(L)=12 mgCr(III)g(-1) and 7mgZn(II)g(-1), K(L)=0.033lmg(-1) Cr(III) and 0.042l mg(-1) Zn(II); for the composite material, q(L) = 9 mgCr(III)g(-1) and 6 mgZn(II)g(-1), K(L)=0.032l mg(-1)Cr(III) and 0.034l mg(-1)Zn(II). The biosorbents exhibited a higher preference for Cr(III) ions and algae Gelidium is the best one. The pseudo-first-order Lagergren and pseudo-second-order models fitted well the kinetic data for the two metal ions. Kinetic constants and equilibrium uptake concentrations given by the pseudo-second-order model for an initial Cr(III) and Zn(II) concentration of approximately 100 mgl(-1), at pH 5.3 and 20 degrees C were k(2,ads)=0.04 g mg(-1)Cr(III)min(-1) and 0.07 g mg(-1)Zn(II)min(-1), q(eq)=11.9 mgCr(III)g(-1) and 9.5 mgZn(II)g(-1) for algae; k(2,ads)=0.17 g mg(-1)Cr(III)min(-1) and 0.19 g mg(-1)Zn(II)min(-1), q(eq)=8.3 mgCr(III)g(-1) and 5.6 mgZn(II)g(-1) for algal waste; k(2,ads)=0.01 g mg(-1)Cr(III)min(-1) and 0.18 g mg(-1)Zn(II)min(-1), q(eq)=8.0 mgCr(III)g(-1) and 4.4 mgZn(II)g(-1) for composite material. Biosorption was modelled using a batch adsorber mass transfer kinetic model, which successfully predicts Cr(III) and Zn(II) concentration profiles. The calculated average homogeneous diffusivities, D(h), were 4.2 x 10(-8), 8.3 x 10(-8) and 1.4 x 10(-8)cm(2)s(-1) for Cr(III) and 4.8 x 10(-8), 9.7 x 10(-8) and 6.2 x 10(-8)cm(2)s(-1

  12. Direct impression on agar surface as a diagnostic sampling procedure for candida balanitis.

    Science.gov (United States)

    Lisboa, Carmen; Santos, António; Azevedo, Filomena; Pina-Vaz, Cidália; Rodrigues, Acácio Gonçalves

    2010-02-01

    The diagnosis of candida balanitis should be based upon both clinical and mycological data. The procedure of material collection is a critical issue to confirm or rule out the clinical diagnosis of candida balanitis. To compare direct impression of the glans on the agar surface of solid culture media with the collection of genital exudates with cotton swab for the diagnosis of candida balanitis. A prospective cross-sectional study was carried out during a 36-month period. Sexually transmitted disease clinic attendees with balanitis and asymptomatic men were included. Specimens for yeast culture were collected from the glans penis and inner preputial layer using the direct impression on CHROMagar candida medium and by swabbing with a sterile cotton swab. Among 478 men enrolled, 189 had balanitis. The prevalence of candida balanitis was 17.8% (85/478) confirmed after culture by direct impression; the swab method detected only 54/85 (63.5%) of these men. Of the 289 asymptomatic men, 36 (12.5%) yielded Candida spp; the swab method detected only 38.9% of these men. The risk of having candida balanitis is 8.9 (IC 95% 2.48 to 32.04) whenever the number of candida colonies recovered by direct impression was greater than 10. Direct impression on CHROMagar candida medium resulted in the highest Candida spp recovery rate. More than 10 colonies yielded by impression culture were statistically associated with candida balanitis. This method shows the ideal profile for sampling the male genital area for yeasts and should be included in the management of balanitis.

  13. In vitro antifungal susceptibility testing of Scopulariopsis brevicaulis strains using agar diffusion method.

    Science.gov (United States)

    Skóra, Magdalena; Macura, Anna B

    2011-01-01

    The genus Scopulariopsis is a common soil saprotroph and has been isolated from air, organic waste and also from plant, animal and human tissues. Scopulariopsis has mainly been associated in humans with superficial mycoses, but it has also been described as the cause of subcutaneous and invasive infections. The most common aetiological agent of infections in humans is Scopulariopsis brevicaulis. This species has been reported to be resistant in vitro to broad-spectrum antifungal agents available today. The aim of the study was to establish in vitro antifungal susceptibility of 35 S. brevicaulis strains against amphotericin B (AMB), flucytosine (FC), caspofungin (CAS), terbinafine (TER), ciclopirox (CIC), voriconazole (VOR), clotrimazole (CTR), miconazole (MCZ), econazole (ECO), ketoconazole (KET), itraconazole (ITR), and fluconazole (FLU). Antifungal susceptibility tests were evaluated by an agar diffusion method (Neo-Sensitabs, Rosco, Denmark). AMB, FC, CAS, ITR and FLU showed no antifungal activity against S. brevicaulis. TER, CIC, CTR, KET, VOR, ECO, and MCZ revealed inhibitory activity for S. brevicaulis, but it varied for each of the drugs. The best antifungal effect was observed for TER and CIC. All isolates had large inhibition zones for TER and CIC. CTR was also inhibitory for all tested S. brevicaulis isolates, but the diameters of inhibition zones were smaller than for TER and CIC. Nearly 89% isolates showed inhibition zones for KET and the mean diameter of the inhibition zone was comparable to CTR. The least antifungal activity exhibited VQR, ECO and MCZ. Because of the multiresistance of S. brevicaulis, infections due to this species may not respond to particular antifungal treatment and other therapeutic approaches should be considered, e.g., combined therapy and/or surgery.

  14. Preparation and application of agar/alginate/collagen ternary blend functional food packaging films.

    Science.gov (United States)

    Wang, Long-Feng; Rhim, Jong-Whan

    2015-09-01

    Ternary blend agar/alginate/collagen (A/A/C) hydrogel films with silver nanoparticles (AgNPs) and grapefruit seed extract (GSE) were prepared. Their performance properties, transparency, tensile strength (TS), water vapor permeability (WVP), water contact angle (CA), water swelling ratio (SR), water solubility (WS), and antimicrobial activity were determined. The A/A/C film was highly transparent, and both AgNPs and GSE incorporated blend films (A/A/C(AgNPs) and A/A/C(GSE)) exhibited UV-screening effect, especially, the A/A/C(GSE) film had high UV-screening effect without sacrificing the transmittance. In addition, the A/A/C blend films formed efficient hydrogel film with the water holding capacity of 23.6 times of their weight. Both A/A/C(AgNPs) and A/A/C(GSE) composite films exhibited strong antimicrobial activity against both Gram-positive (Listeria monocytogenes) and Gram-negative (Escherichia coli) food-borne pathogenic bacteria. The test results of fresh potatoes packaging revealed that all the A/A/C ternary blend films prevented forming of condensed water on the packaged film surface, both A/A/C(AgNPs) and A/A/C(GSE) composite films prevented greening of potatoes during storage. The results indicate that the ternary blend hydrogel films incorporated with AgNPs or GSE can be used not only as antifogging packaging films for highly respiring fresh agriculture produce, but also as an active food packaging system utilizing their strong antimicrobial activity. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Evaluation of semisolid agar method for antifungal susceptibility test of T. rubrum

    Directory of Open Access Journals (Sweden)

    Sultana Razia

    2016-08-01

    Full Text Available Background: With increasing fungal disease many newer antifungal drugs are available with different spectrum of activ­ity. Antifungal susceptibility test will help clinicians for selection of effective drug and thereby treatment of patient. Objective: The study was undertaken to perform a simple screening drug susceptibility test of T. rnbrum by Semi Solid Agar Antifungal Susceptibility (SAAS Method: Perfonnance of susceptibility method was assessed by comparing the MICs of three commonly prescribed antifungal agents namely- tluconazole (FCZ, itraconazole (ITZ and terbinafine (TER to the CLSI (Clinical and Laboratory Standard Institute recommended M-38, a broth microdilution method. Results: In SAAS method, among twenty nine T. rubrum, twenty five (86.2% were susceptible (MIC range 0.5-64 µg/ml to Fluconazole (FCZ and four (13.7% were resistant (MIC value >64 µg/ml. In broth microdilution method, among twenty nine T. rubrum, twenty six (89.6% were susceptible (MIC range 0.3-64 µg/ml to FCZ and three (10.3% were resistant (MIC value >64 µg/ml. In case of both ITZ and TER, all were susceptible (MIC range 0.3-64 µg/ml to both methods. The SAAS method demonstrated the susceptibility pattern of T. rubrum against FCZ, ITZ and TER usually within 72 to 96 hours after organism isolation and results were concordance with the results of CLSI broth microdilution method. Conclusion: Though it is a newer method with proper standardization of the test method, SAAS method is simple and easily applicable screening method for susceptibility testing of antifungal agents against dermatophytes in any microbiology laboratories.

  16. Perbedaan Cara Penyebaran Suspensi terhadap Jumlah Bakteri pada Media Eosin Methylene Blue Agar

    Directory of Open Access Journals (Sweden)

    Ahmad Nuzuludin Kadri

    2015-06-01

    Full Text Available Dalam rangka pengawasan mutu secara biologis dilakukan pengujian laboratorium untuk mengisolasi dan melakukan jumlah penghitungan jumlah bakteri patogen (enumerasi. Tujuan dari penelitian ini adalah untuk mengetahui perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok, mikropipet dan ose terhadap jumlah bakteri yang terhitung pada media Eosin Methylene Blue Agar. Sampel diambil dari air susu kambing yang kemudian dihitung jumlah bakteri-nya dengan tiga kelompok perlakuan yaitu menggunakan batang gelas bengkok, mikropipet dan ose. Data hasil penelitian dianalisis menggunakan sidik ragam, bila hasilnya berbeda nyata maka dilanjutkan dengan uji Duncan. Jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok, mikropipet dan ose per ml berturut-turut mengandung 9.722.222 cfu, 68.944.444 cfu dan 116.444.444 cfu. Dengan sidik ragam, perlakuan cara penyebaran dengan menggunakan mikropipet dan ose berbeda sangat nyata (P<0,01 terhadap jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok. Setelah di uji dengan uji Duncan, rata-rata jumlah bakteri yang terhitung dengan menggunakan mikropipet dan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan batang gelas bengkok, sedangkan rata-rata jumlah bakteri yang terhitung menggunakan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan mikropipet. Kesimpulan dari penelitian ini adalah terdapat perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok,mikropipet dan ose terhadap jumlah bakteri pada media EMBA. Penyebaran bakteri menggunakan ose lebih banyak (P<0,01 dibandingkan mikropipet dan batang gelas bengkok. Sedangkan penyebaran bakteri menggunakan mikropipet lebih banyak (P<0,01 dibandingkan dengan gelas bengkok.

  17. Halococcus agarilyticus sp. nov., an agar-degrading haloarchaeon isolated from commercial salt.

    Science.gov (United States)

    Minegishi, Hiroaki; Echigo, Akinobu; Shimane, Yasuhiro; Kamekura, Masahiro; Itoh, Takashi; Ohkuma, Moriya; Usami, Ron

    2015-05-01

    Two agar-degrading halophilic archaeal strains, 62 E(T) and 197 A, were isolated from commercial salt samples. Cells were non-motile cocci, approximately 1.2-2.0 µm in diameter and stained Gram-negative. Colonies were pink-pigmented. Strain 62 E(T) was able to grow with 24-30% (w/v) NaCl (optimum, 27%), at pH 6.5-8.5 (optimum, pH 7.5) and at 22-47 °C (optimum, 42 °C). The 16S rRNA gene sequences of strains 62 E(T) and 197 A were identical, and the level of DNA-DNA relatedness between them was 90 and 90% (reciprocally). The closest relative was Halococcus saccharolyticus JCM 8878(T) with 99.7% similarity in 16S rRNA orthologous gene sequences, followed by Halococcus salifodinae JCM 9578(T) (99.6%), while similarities with other species of the genus Halococcus were equal to or lower than 95.1%. The rpoB' gene tree strongly supported that the two strains were members of the genus Halococcus . Mean DNA-DNA relatedness between strain 62 E(T) and H. saccharolyticus JCM 8878(T) and H. salifodinae JCM 9578(T) was 46 and 44%, respectively. The major polar lipids were archaeol derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, derived from both C20C20 and C20C25 archaeol, and sulfated diglycosyl archaeol-1. Several unidentified glycolipids were present. Based on the phenotypic and phylogenetic analyses, the isolates are considered to represent a novel species of the genus Halococcus , for which the name Halococcus agarilyticus sp. nov. is proposed. The type strain is 62 E(T) ( = JCM 19592(T) =KCTC 4143(T)). © 2015 IUMS.

  18. Agar Technique for the Cultivation In Vitro of Bone-Marrow Colonies

    Energy Technology Data Exchange (ETDEWEB)

    Metcalf, D. [Walter and Eliza Hall Institute, Royal Melbourne Hospital, Melbourne, VIC (Australia)

    1969-07-15

    In solid-state agar cultures certain haemopoietic cells proliferate and form discrete colonies of 200 - 4000 cells. Colony formation is dependent on stimulation by the colony-stimulating factor, and this is achieved by (1) the use of a cell feeder layer, (2) the addition of conditioned medium, or (3) the addition of human or mouse serum or urine containing the factor. All colonies initially contain granulocytic cells which differentiate from myeloblasts to polymorphs as colony growth proceeds. Later colonies develop a second population of phagocytic mononuclear cells (macrophages). The colony-forming-system is simple, readily quantitated and highly reproducible. Linear dose responses occur between the dose of colony-stimulating factor and the number and size of colonies developing from a standard number of bone-marrow cells. In-vitro colony formation has been achieved with haemopoietic cells of the following species: mouse, rat, hamster, guinea pig, rabbit and human. In the adult mouse, colony-forming cells are located in the bone marrow, spleen and blood and in the embryo, in the yolk sac, liver and spleen. The colony-forming cell appears to be an early member of the granulocytic series. The colony-forming system has been used as a quantitative assay system: (1) to assay levels of colony-stimulating factor in serum and urine and in the chemical- characterization and purification of the factor; and (2) to enumerate the number of colony-forming cells in haemopoietic tissues in response to a variety of experimental procedures and disease states. Since the system is applicable to human bone-marrow cells, it should prove of value in the quantitative assay of (1) survival of human bone marrow on storage, and (2) bone-marrow content of granulocytic precursor cells in various disease states and following various types of therapy. The system is not suitable for the mass production in vitro of haemopoietic cells for therapeutic use. (author)

  19. Effect of lysine addition on growth of black iguana (Ctenosaura pectinata).

    Science.gov (United States)

    Guzmán, Juan José Ortiz; Luis, Arcos-García José; Martínez, Germán D Mendoza; Pérez, Fernando Xicoténcatl Plata; Mascorro, Gisela Fuentes; Inzunza, Gabriela Ruelas

    2013-01-01

    The effects of the addition of lysine to commercial feed given to captive black iguana (Ctenosaura pectinata) were evaluated in terms of growth and feed digestibility. Twenty-eight-day-old black iguana with an initial weight of 5.5 ± 0.3 g were housed individually in cages measuring 45 × 45 × 45 cm. The experiment lasted 150 days. The ambient temperature ranged from 28 to 35°C with a relative humidity of 60 to 95%. Treatments consisted of the addition of different percentages of lysine to the feed (0.0, 0.1, 0.2, and 0.3%, dry matter [DM] base). There was a linear response (P iguana diet in the first months of life is important to stimulate growth and intake. © 2012 Wiley Periodicals, Inc.

  20. Protection against inflammatory β-cell damage by lysine deacetylase inhibition and microRNA expression?

    DEFF Research Database (Denmark)

    Vestergaard, Anna Lindeløv; Pallesen, Emil Marek Heymans; Novotny, Guy Wayne

    Background and aims: Pro-inflammatory cytokines contribute to pancreatic β-cell apoptosis in type 1 and 2 diabetes mellitus. The detrimental effects resulting from cytokine-induced signaling in the β cell can be reduced by inhibition of class I classical lysine deacetylases (KDACi), especially HDAC...... of oxidative stress proteins responsible for β-cell death. The aim of the study is to identify novel and specific therapeutic targets for β-cell protection by mapping the miR profile of β cells rescued from inflammatory assault by inhibition of lysine deacetylation, thereby identifying miR that repress....... The perspective of this study is to develop novel anti-diabetic drugs targeting HDAC1 and/or associated miR....

  1. The Role of Nuclear Receptor-Binding SET Domain Family Histone Lysine Methyltransferases in Cancer.

    Science.gov (United States)

    Bennett, Richard L; Swaroop, Alok; Troche, Catalina; Licht, Jonathan D

    2017-06-01

    The nuclear receptor-binding SET Domain (NSD) family of histone H3 lysine 36 methyltransferases is comprised of NSD1, NSD2 (MMSET/WHSC1), and NSD3 (WHSC1L1). These enzymes recognize and catalyze methylation of histone lysine marks to regulate chromatin integrity and gene expression. The growing number of reports demonstrating that alterations or translocations of these genes fundamentally affect cell growth and differentiation leading to developmental defects illustrates the importance of this family. In addition, overexpression, gain of function somatic mutations, and translocations of NSDs are associated with human cancer and can trigger cellular transformation in model systems. Here we review the functions of NSD family members and the accumulating evidence that these proteins play key roles in tumorigenesis. Because epigenetic therapy is an important emerging anticancer strategy, understanding the function of NSD family members may lead to the development of novel therapies. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.

  2. Tumor accumulation of {epsilon}-poly-lysines-based polyamines conjugated with boron clusters

    Energy Technology Data Exchange (ETDEWEB)

    Umano, Masayuki; Uechi, Kazuhiro; Uriuda, Takatoshi; Murayama, Sayuri; Azuma, Hideki [Department of Applied Chemistry and Bioengineering, Graduate School of Engineering, Osaka City University, 3-3-138 Sugimoto, Sumiyoshi-ku, Osaka 5588585 (Japan); Shinohara, Atsuko [Department of Epidemiology and Environmental Health, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 1138421 (Japan); Liu, Young; Ono, Koji [Research Reactor Institute, Kyoto University, 2-1010 Asashiro-nishi, Kumatori 5900494 (Japan); Kirihata, Mitsunori [Department of Bioscience and Informatics, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Sakai 5998531 (Japan); Yanagie, Hironobu [Department of Nuclear Engineering and Management, Graduate School of Engineering, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 1138656 (Japan); Nagasaki, Takeshi, E-mail: nagasaki@bioa.eng.osaka-cu.ac.jp [Department of Applied Chemistry and Bioengineering, Graduate School of Engineering, Osaka City University, 3-3-138 Sugimoto, Sumiyoshi-ku, Osaka 5588585 (Japan)

    2011-12-15

    Boron Neutron Capture Therapy (BNCT) is one of the potent cancer radiotherapies using nuclear reaction between {sup 10}B atoms and the neutron. Whether BNCT will succeed or not depends on tumor selective delivery of {sup 10}B compounds. {epsilon}-Poly-L-lysine is a naturally occurring polyamine characterized by the peptide linkages between the carboxyl and {epsilon}-amino groups of L-lysine. Because of high safety {epsilon}-PLL is applied practically as a food additive due to its strong antimicrobial activity. In this study, we focus on a development of a novel polymeric delivery system for BNCT using biodegradable {epsilon}-PLL conjugated with {sup 10}B-containing clusters (BSH). This polymeric boron carrier will be expected to deliver safely and efficiently into tumor tissues based on Enhanced Permeability and Retention (EPR) effect.

  3. Formation and Inhibition of Nε-(Carboxymethyllysine in Saccharide-Lysine Model Systems during Microwave Heating

    Directory of Open Access Journals (Sweden)

    Bing Li

    2012-10-01

    Full Text Available  Nε-(carboxymethyl lysine (CML is the most abundant advanced glycation end product (AGE, and frequently selected as an AGEs marker in laboratory studies. In this paper, the formation and inhibition of Nε-(carboxymethyllysine in saccharide-lysine model systems during microwave heating have been studied. The microwave heating treatment significantly promoted the formation of CML during Maillard reactions, which was related to the reaction temperature, time and type of saccharide. The order of CML formation for different saccharides was lactose > glucose > sucrose. Then, the inhibition effect on CML by five inhibitors was further examined. According to the results, ascorbic acid and tocopherol did not affect inhibition of CML, in contrast, thiamin, rutin and quercetin inhibited CML formation, and the inhibitory effects were concentration dependent.

  4. Increased expression of pyruvate carboxylase and biotin protein ligase increases lysine production in a biotin prototrophic Corynebacterium glutamicum strain

    DEFF Research Database (Denmark)

    Wang, Zhihao; Moslehi-Jenabian, Soloomeh; Solem, Christian

    2015-01-01

    , and achieved biotin prototrophy. We found that AHP-3, containing pBIO, was able to produce lysine in a medium lacking biotin and that the lysine yield on glucose was similar to what is obtained when using a medium containing biotin. However, there was a decrease in specific growth rate of 20% when the strain...... pimeloyl-Acyl Carrier Protein [ACP]) formation. Pyruvate carboxylase (pycA), a biotin-dependent enzyme needed for lysine biosynthesis and biotin ligase (birA), which is responsible for attaching biotin to pyruvate carboxylase, were overexpressed by replacing the native promoters with the strong superoxide...... dismutase (sod) promoter, to see whether growth could be restored. Neither pycA nor birA overexpression, whether alone or in combination, had an effect on specific growth rate, but they did have a positive effect on lysine yield, which increased by 55% in the strain overexpressing both enzymes....

  5. Proteome-wide analysis of lysine acetylation suggests its broad regulatory scope in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Henriksen, Peter; Wagner, Sebastian Alexander; Weinert, Brian Tate

    2012-01-01

    Post-translational modification of proteins by lysine acetylation plays important regulatory roles in living cells. The budding yeast Saccharomyces cerevisiae is a widely used unicellular eukaryotic model organism in biomedical research. S. cerevisiae contains several evolutionary conserved lysine...... acetyltransferases and deacetylases. However, only a few dozen acetylation sites in S. cerevisiae are known, presenting a major obstacle for further understanding the regulatory roles of acetylation in this organism. Here we use high resolution mass spectrometry to identify about 4000 lysine acetylation sites in S....... cerevisiae. Acetylated proteins are implicated in the regulation of diverse cytoplasmic and nuclear processes including chromatin organization, mitochondrial metabolism, and protein synthesis. Bioinformatic analysis of yeast acetylation sites shows that acetylated lysines are significantly more conserved...

  6. Modelling of Fed-batch Fermentation Process with Droppings for L-lysine Production

    Directory of Open Access Journals (Sweden)

    Velitchka Ivanova

    2006-04-01

    Full Text Available The aim of the article is the development of dynamic unstructured model of L-lysine fed-batch fermentation process with droppings. This approach includes the following procedures: description of the process by generalized stoichiometric equations; preliminary data processing; identification of the specific rates (growth rate (mu , substrate utilization rate (nu, production rate (rho; establishment and optimization of the dynamic model of the process; simulation researches.

  7. Structural basis for the site-specific incorporation of lysine derivatives into proteins.

    Directory of Open Access Journals (Sweden)

    Veronika Flügel

    Full Text Available Posttranslational modifications (PTMs of proteins determine their structure-function relationships, interaction partners, as well as their fate in the cell and are crucial for many cellular key processes. For instance chromatin structure and hence gene expression is epigenetically regulated by acetylation or methylation of lysine residues in histones, a phenomenon known as the 'histone code'. Recently it was shown that these lysine residues can furthermore be malonylated, succinylated, butyrylated, propionylated and crotonylated, resulting in significant alteration of gene expression patterns. However the functional implications of these PTMs, which only differ marginally in their chemical structure, is not yet understood. Therefore generation of proteins containing these modified amino acids site specifically is an important tool. In the last decade methods for the translational incorporation of non-natural amino acids using orthogonal aminoacyl-tRNA synthetase (aaRS:tRNAaaCUA pairs were developed. A number of studies show that aaRS can be evolved to use non-natural amino acids and expand the genetic code. Nevertheless the wild type pyrrolysyl-tRNA synthetase (PylRS from Methanosarcina mazei readily accepts a number of lysine derivatives as substrates. This enzyme can further be engineered by mutagenesis to utilize a range of non-natural amino acids. Here we present structural data on the wild type enzyme in complex with adenylated ε-N-alkynyl-, ε-N-butyryl-, ε-N-crotonyl- and ε-N-propionyl-lysine providing insights into the plasticity of the PylRS active site. This shows that given certain key features in the non-natural amino acid to be incorporated, directed evolution of this enzyme is not necessary for substrate tolerance.

  8. Chemical modification of lysine residues in lysozyme may dramatically influence its amyloid fibrillation.

    Science.gov (United States)

    Morshedi, Dina; Ebrahim-Habibi, Azadeh; Moosavi-Movahedi, Ali Akbar; Nemat-Gorgani, Mohsen

    2010-04-01

    Studies on the aggregation of mutant proteins have provided new insights into the genetics of amyloid diseases and the role of the net charge of the protein on the rate, extent, and type of aggregate formation. In the present work, hen egg white lysozyme (HEWL) was employed as the model protein. Acetylation and (separately) citraconylation were employed to neutralize the charge on lysine residues. Acetylation of the lysine residues promoted amyloid formation, resulting in more pronounced fibrils and a dramatic decline in the nucleation time. In contrast, citraconylation produced the opposite effect. In both cases, native secondary and tertiary structures appeared to be retained. Studies on the effect of pH on aggregation suggested greater possibilities for amorphous aggregate formation rather than fibrillation at pH values closer to neutrality, in which the protein is known to take up a conformation more similar to its native form. This is in accord with reports in the literature suggesting that formation of amorphous aggregates is more favored under relatively more native conditions. pH 5 provided a critical environment in which a mixture of amorphous and fibrillar structures were observed. Use of Tango and Aggrescan software which describe aggregation tendencies of different parts of a protein structure suggested critical importance of some of the lysine residues in the aggregation process. Results are discussed in terms of the importance of the net charge in control of protein-protein interactions leading to aggregate formation and possible specific roles of lysine residues 96 and 97. Copyright 2009 Elsevier B.V. All rights reserved.

  9. Effects of lysine residues on structural characteristics and stability of tau proteins

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Myeongsang; Baek, Inchul; Choi, Hyunsung; Kim, Jae In; Na, Sungsoo, E-mail: nass@korea.ac.kr

    2015-10-23

    Pathological amyloid proteins have been implicated in neuro-degenerative diseases, specifically Alzheimer's, Parkinson's, Lewy-body diseases and prion related diseases. In prion related diseases, functional tau proteins can be transformed into pathological agents by environmental factors, including oxidative stress, inflammation, Aβ-mediated toxicity and covalent modification. These pathological agents are stable under physiological conditions and are not easily degraded. This un-degradable characteristic of tau proteins enables their utilization as functional materials to capturing the carbon dioxides. For the proper utilization of amyloid proteins as functional materials efficiently, a basic study regarding their structural characteristic is necessary. Here, we investigated the basic tau protein structure of wild-type (WT) and tau proteins with lysine residues mutation at glutamic residue (Q2K) on tau protein at atomistic scale. We also reported the size effect of both the WT and Q2K structures, which allowed us to identify the stability of those amyloid structures. - Highlights: • Lysine mutation effect alters the structure conformation and characteristic of tau. • Over the 15 layers both WT and Q2K models, both tau proteins undergo fractions. • Lysine mutation causes the increment of non-bonded energy and solvent accessible surface area. • Structural instability of Q2K model was proved by the number of hydrogen bonds analysis.

  10. Human borna disease virus infection impacts host proteome and histone lysine acetylation in human oligodendroglia cells

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xia [Department of Neurology, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Department of Neurology, The Fifth People' s Hospital of Shanghai, School of Medicine, Fudan University, Shanghai, 200240 (China); Zhao, Libo [Department of Neurology, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Department of Neurology, The Third People' s Hospital of Chongqing, 400014 (China); Yang, Yongtao [Department of Neurology, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Chongqing Key Laboratory of Neurobiology, Chongqing Medical University, Chongqing, 400016 (China); Institute of Neuroscience, Chongqing Medical University, Chongqing, 400016 (China); Bode, Liv [Bornavirus Research Group affiliated to the Free University of Berlin, Berlin (Germany); Huang, Hua [Department of Neurology, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Chongqing Key Laboratory of Neurobiology, Chongqing Medical University, Chongqing, 400016 (China); Institute of Neuroscience, Chongqing Medical University, Chongqing, 400016 (China); Liu, Chengyu [Chongqing Key Laboratory of Neurobiology, Chongqing Medical University, Chongqing, 400016 (China); Institute of Neuroscience, Chongqing Medical University, Chongqing, 400016 (China); Huang, Rongzhong [Department of Rehabilitative Medicine, The Second Affiliated Hospital of Chongqing Medical University, Chongqing, 400010 (China); Zhang, Liang [Department of Neurology, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Chongqing Key Laboratory of Neurobiology, Chongqing Medical University, Chongqing, 400016 (China); Institute of Neuroscience, Chongqing Medical University, Chongqing, 400016 (China); and others

    2014-09-15

    Background: Borna disease virus (BDV) replicates in the nucleus and establishes persistent infections in mammalian hosts. A human BDV strain was used to address the first time, how BDV infection impacts the proteome and histone lysine acetylation (Kac) of human oligodendroglial (OL) cells, thus allowing a better understanding of infection-driven pathophysiology in vitro. Methods: Proteome and histone lysine acetylation were profiled through stable isotope labeling for cell culture (SILAC)-based quantitative proteomics. The quantifiable proteome was annotated using bioinformatics. Histone acetylation changes were validated by biochemistry assays. Results: Post BDV infection, 4383 quantifiable differential proteins were identified and functionally annotated to metabolism pathways, immune response, DNA replication, DNA repair, and transcriptional regulation. Sixteen of the thirty identified Kac sites in core histones presented altered acetylation levels post infection. Conclusions: BDV infection using a human strain impacted the whole proteome and histone lysine acetylation in OL cells. - Highlights: • A human strain of BDV (BDV Hu-H1) was used to infect human oligodendroglial cells (OL cells). • This study is the first to reveal the host proteomic and histone Kac profiles in BDV-infected OL cells. • BDV infection affected the expression of many transcription factors and several HATs and HDACs.

  11. Effects of lysine residues on structural characteristics and stability of tau proteins

    International Nuclear Information System (INIS)

    Lee, Myeongsang; Baek, Inchul; Choi, Hyunsung; Kim, Jae In; Na, Sungsoo

    2015-01-01

    Pathological amyloid proteins have been implicated in neuro-degenerative diseases, specifically Alzheimer's, Parkinson's, Lewy-body diseases and prion related diseases. In prion related diseases, functional tau proteins can be transformed into pathological agents by environmental factors, including oxidative stress, inflammation, Aβ-mediated toxicity and covalent modification. These pathological agents are stable under physiological conditions and are not easily degraded. This un-degradable characteristic of tau proteins enables their utilization as functional materials to capturing the carbon dioxides. For the proper utilization of amyloid proteins as functional materials efficiently, a basic study regarding their structural characteristic is necessary. Here, we investigated the basic tau protein structure of wild-type (WT) and tau proteins with lysine residues mutation at glutamic residue (Q2K) on tau protein at atomistic scale. We also reported the size effect of both the WT and Q2K structures, which allowed us to identify the stability of those amyloid structures. - Highlights: • Lysine mutation effect alters the structure conformation and characteristic of tau. • Over the 15 layers both WT and Q2K models, both tau proteins undergo fractions. • Lysine mutation causes the increment of non-bonded energy and solvent accessible surface area. • Structural instability of Q2K model was proved by the number of hydrogen bonds analysis.

  12. Lysine-Directed Post-translational Modifications of Tau Protein in Alzheimer's Disease and Related Tauopathies

    Directory of Open Access Journals (Sweden)

    Christiana Kontaxi

    2017-08-01

    Full Text Available Tau is a microtubule-associated protein responsible mainly for stabilizing the neuronal microtubule network in the brain. Under normal conditions, tau is highly soluble and adopts an “unfolded” conformation. However, it undergoes conformational changes resulting in a less soluble form with weakened microtubule stabilizing properties. Altered tau forms characteristic pathogenic inclusions in Alzheimer's disease and related tauopathies. Although, tau hyperphosphorylation is widely considered to be the major trigger of tau malfunction, tau undergoes several post-translational modifications at lysine residues including acetylation, methylation, ubiquitylation, SUMOylation, and glycation. We are only beginning to define the site-specific impact of each type of lysine modification on tau biology as well as the possible interplay between them, but, like phosphorylation, these modifications are likely to play critical roles in tau's normal and pathobiology. This review summarizes the latest findings focusing on lysine post-translational modifications that occur at both endogenous tau protein and pathological tau forms in AD and other tauopathies. In addition, it highlights the significance of a site-dependent approach of studying tau post-translational modifications under normal and pathological conditions.

  13. Biodistribution and catabolism of 18F-labelled isopeptide N(epsilon)-(gamma-glutamyl)-L-lysine.

    Science.gov (United States)

    Hultsch, C; Bergmann, R; Pawelke, B; Pietzsch, J; Wuest, F; Johannsen, B; Henle, T

    2005-12-01

    Isopeptide bonds between the epsilon-amino group of lysine and the gamma-carboxamide group of glutamine are formed during strong heating of pure proteins or, more important, by enzymatic reaction mediated by transglutaminases. Despite the wide use of a microbial transglutaminase in food biotechnology, up to now little is known about the metabolic fate of the isopeptide N(epsilon)-(gamma-glutamyl)-L-lysine. In the present study, N-succinimidyl-4-[(18)F]fluorobenzoate was used to modify N(epsilon)-(gamma-glutamyl)-L-lysine at each of its two alpha-amino groups, resulting in the 4-[(18)F]fluorobenzoylated derivatives, for which biodistribution, catabolism, and elimination were investigated in male Wistar rats. A significant different biochemical behavior of the two labelled isopeptides was observed in terms of in vitro stability, in vivo metabolism as well as biodistribution. The results suggest that the metabolic fate of isopeptides is likely to be dependent on how they are reabsorbed - free or peptide bound.

  14. Dichotomy in the Epigenetic Mark Lysine Acetylation is Critical for the Proliferation of Prostate Cancer Cells

    Energy Technology Data Exchange (ETDEWEB)

    Pathak, Ravi [Department of Structural and Chemical Biology, Mount Sinai School of Medicine, 1425 Madison Ave, New York, NY 10029 (United States); Philizaire, Marc [Medgar Evers College, City University of New York, 1638 Bedford Ave, 403D, Brooklyn, NY 11225 (United States); Mujtaba, Shiraz, E-mail: smujtaba@mec.cuny.edu [Department of Structural and Chemical Biology, Mount Sinai School of Medicine, 1425 Madison Ave, New York, NY 10029 (United States); Medgar Evers College, City University of New York, 1638 Bedford Ave, 403D, Brooklyn, NY 11225 (United States)

    2015-08-19

    The dynamics of lysine acetylation serve as a major epigenetic mark, which regulates cellular response to inflammation, DNA damage and hormonal changes. Microarray assays reveal changes in gene expression, but cannot predict regulation of a protein function by epigenetic modifications. The present study employs computational tools to inclusively analyze microarray data to understand the potential role of acetylation during development of androgen-independent PCa. The data revealed that the androgen receptor interacts with 333 proteins, out of which at least 92 proteins were acetylated. Notably, the number of cellular proteins undergoing acetylation in the androgen-dependent PCa was more as compared to the androgen-independent PCa. Specifically, the 32 lysine-acetylated proteins in the cellular models of androgen-dependent PCa were mainly involved in regulating stability as well as pre- and post-processing of mRNA. Collectively, the data demonstrate that protein lysine acetylation plays a crucial role during the transition of androgen-dependent to -independent PCa, which importantly, could also serve as a functional axis to unravel new therapeutic targets.

  15. Increase of rutin antioxidant activity by generating Maillard reaction products with lysine.

    Science.gov (United States)

    Zhang, Ru; Zhang, Bian-Ling; He, Ting; Yi, Ting; Yang, Ji-Ping; He, Bin

    2016-06-01

    Rutin exists in medicinal herbs, fruits, vegetables, and a number of plant-derived sources. Dietary sources containing rutin are considered beneficial because of their potential protective roles in multiple diseases related to oxidative stresses. In the present study, the change and antioxidation activity of rutin in Maillard reaction with lysine through a heating process were investigated. There is release of glucose and rhamnose that interact with lysine to give Maillard reaction products (MRPs), while rutin is converted to less-polar quercetin and a small quantity of isoquercitrin. Because of their high cell-membrane permeability, the rutin-lysine MRPs increase the free radical-scavenging activity in HepG2 cells, showing cellular antioxidant activity against Cu(2+)-induced oxidative stress higher than that of rutin. Furthermore, the MRPs significantly increased the Cu/Zn SOD (superoxide dismutase) activity and Cu/Zn SOD gene expression of HepG2 cells, consequently enhancing antioxidation activity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Dichotomy in the Epigenetic Mark Lysine Acetylation is Critical for the Proliferation of Prostate Cancer Cells

    International Nuclear Information System (INIS)

    Pathak, Ravi; Philizaire, Marc; Mujtaba, Shiraz

    2015-01-01

    The dynamics of lysine acetylation serve as a major epigenetic mark, which regulates cellular response to inflammation, DNA damage and hormonal changes. Microarray assays reveal changes in gene expression, but cannot predict regulation of a protein function by epigenetic modifications. The present study employs computational tools to inclusively analyze microarray data to understand the potential role of acetylation during development of androgen-independent PCa. The data revealed that the androgen receptor interacts with 333 proteins, out of which at least 92 proteins were acetylated. Notably, the number of cellular proteins undergoing acetylation in the androgen-dependent PCa was more as compared to the androgen-independent PCa. Specifically, the 32 lysine-acetylated proteins in the cellular models of androgen-dependent PCa were mainly involved in regulating stability as well as pre- and post-processing of mRNA. Collectively, the data demonstrate that protein lysine acetylation plays a crucial role during the transition of androgen-dependent to -independent PCa, which importantly, could also serve as a functional axis to unravel new therapeutic targets

  17. Determination of digestible isoleucine: lysine ratio in diets for laying hens aged 42-58 weeks

    Directory of Open Access Journals (Sweden)

    Heloisa Helena de Carvalho Mello

    2012-05-01

    Full Text Available Two hundred and fifty-two Hy-Line W36 laying hens were allotted in a completely randomized design with 6 treatments, 7 replicates and 6 hens per experimental unit in order to determine the ideal ratio of isoleucine (Ile in relation to lysine (Lys to laying hens aged 42-58 weeks. Experimental diets contained digestible Ile at different levels, resulting in different Ile:Lys ratios (0.73:1; 0.78:1; 0.83:1; 0.88:1; 0.93:1 and 0.98:1. A basal diet was formulated to provide Isoleucine in levels below recommendations. This diet was supplemented with L-isoleucine to make up the 6 diets. Each diet was made isonitrogenous by varying the dietary contents of glutamic acid and isocaloric by adjusting the contents of cornstarch. All essential amino acids were provided proportionally to lysine. Egg production, egg weight, egg mass, feed conversion ratio, albumen, yolk and eggshell contents were recorded and compiled at every 28-day period. No differences were observed in the performance over a wide range of dietary isoleucine concentrations from 5.76 to 7.73 g/kg corresponding to 0.73:1 to 0.98:1 Ile:Lys ratios. The lowest Ile:Lys ratio (0.73:1 was sufficient to ensure satisfactory performance of birds, corresponding to the consumption of 534 mg of isoleucine and 731 mg of lysine/day.

  18. Lysine desuccinylase SIRT5 binds to cardiolipin and regulates the electron transport chain.

    Science.gov (United States)

    Zhang, Yuxun; Bharathi, Sivakama S; Rardin, Matthew J; Lu, Jie; Maringer, Katherine V; Sims-Lucas, Sunder; Prochownik, Edward V; Gibson, Bradford W; Goetzman, Eric S

    2017-06-16

    SIRT5 is a lysine desuccinylase known to regulate mitochondrial fatty acid oxidation and the urea cycle. Here, SIRT5 was observed to bind to cardiolipin via an amphipathic helix on its N terminus. In vitro , succinyl-CoA was used to succinylate liver mitochondrial membrane proteins. SIRT5 largely reversed the succinyl-CoA-driven lysine succinylation. Quantitative mass spectrometry of SIRT5-treated membrane proteins pointed to the electron transport chain, particularly Complex I, as being highly targeted for desuccinylation by SIRT5. Correspondingly, SIRT5 -/- HEK293 cells showed defects in both Complex I- and Complex II-driven respiration. In mouse liver, SIRT5 expression was observed to localize strictly to the periportal hepatocytes. However, homogenates prepared from whole SIRT5 -/- liver did show reduced Complex II-driven respiration. The enzymatic activities of Complex II and ATP synthase were also significantly reduced. Three-dimensional modeling of Complex II suggested that several SIRT5-targeted lysine residues lie at the protein-lipid interface of succinate dehydrogenase subunit B. We postulate that succinylation at these sites may disrupt Complex II subunit-subunit interactions and electron transfer. Lastly, SIRT5 -/- mice, like humans with Complex II deficiency, were found to have mild lactic acidosis. Our findings suggest that SIRT5 is targeted to protein complexes on the inner mitochondrial membrane via affinity for cardiolipin to promote respiratory chain function. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Use of a bacteriophage lysin to identify a novel target for antimicrobial development.

    Directory of Open Access Journals (Sweden)

    Raymond Schuch

    Full Text Available We identified an essential cell wall biosynthetic enzyme in Bacillus anthracis and an inhibitor thereof to which the organism did not spontaneously evolve measurable resistance. This work is based on the exquisite binding specificity of bacteriophage-encoded cell wall-hydrolytic lysins, which have evolved to recognize critical receptors within the bacterial cell wall. Focusing on the B. anthracis-specific PlyG lysin, we first identified its unique cell wall receptor and cognate biosynthetic pathway. Within this pathway, one biosynthetic enzyme, 2-epimerase, was required for both PlyG receptor expression and bacterial growth. The 2-epimerase was used to design a small-molecule inhibitor, epimerox. Epimerox prevented growth of several Gram-positive pathogens and rescued mice challenged with lethal doses of B. anthracis. Importantly, resistance to epimerox was not detected (<10(-11 frequency in B. anthracis and S. aureus. These results describe the use of phage lysins to identify promising lead molecules with reduced resistance potential for antimicrobial development.

  20. Human borna disease virus infection impacts host proteome and histone lysine acetylation in human oligodendroglia cells

    International Nuclear Information System (INIS)

    Liu, Xia; Zhao, Libo; Yang, Yongtao; Bode, Liv; Huang, Hua; Liu, Chengyu; Huang, Rongzhong; Zhang, Liang

    2014-01-01

    Background: Borna disease virus (BDV) replicates in the nucleus and establishes persistent infections in mammalian hosts. A human BDV strain was used to address the first time, how BDV infection impacts the proteome and histone lysine acetylation (Kac) of human oligodendroglial (OL) cells, thus allowing a better understanding of infection-driven pathophysiology in vitro. Methods: Proteome and histone lysine acetylation were profiled through stable isotope labeling for cell culture (SILAC)-based quantitative proteomics. The quantifiable proteome was annotated using bioinformatics. Histone acetylation changes were validated by biochemistry assays. Results: Post BDV infection, 4383 quantifiable differential proteins were identified and functionally annotated to metabolism pathways, immune response, DNA replication, DNA repair, and transcriptional regulation. Sixteen of the thirty identified Kac sites in core histones presented altered acetylation levels post infection. Conclusions: BDV infection using a human strain impacted the whole proteome and histone lysine acetylation in OL cells. - Highlights: • A human strain of BDV (BDV Hu-H1) was used to infect human oligodendroglial cells (OL cells). • This study is the first to reveal the host proteomic and histone Kac profiles in BDV-infected OL cells. • BDV infection affected the expression of many transcription factors and several HATs and HDACs

  1. De Novo Assembly and Comparative Transcriptome Analysis Provide Insight into Lysine Biosynthesis in Toona sinensis Roem.

    Science.gov (United States)

    Zhang, Xia; Song, Zhenqiao; Liu, Tian; Guo, Linlin; Li, Xingfeng

    2016-01-01

    Toona sinensis Roem is a popular leafy vegetable in Chinese cuisine and is also used as a traditional Chinese medicine. In this study, leaf samples were collected from the same plant on two development stages and then used for high-throughput Illumina RNA-sequencing (RNA-Seq). 125,884 transcripts and 54,628 unigenes were obtained through de novo assembly. A total of 25,570 could be annotated with known biological functions, which indicated that the T. sinensis leaves and shoots were undergoing multiple developmental processes especially for active metabolic processes. Analysis of differentially expressed unigenes between the two libraries showed that the lysine biosynthesis was an enriched KEGG pathway, and candidate genes involved in the lysine biosynthesis pathway in T. sinensis leaves and shoots were identified. Our results provide a primary analysis of the gene expression files of T. sinensis leaf and shoot on different development stages and afford a valuable resource for genetic and genomic research on plant lysine biosynthesis.

  2. Genipin-cross-linked poly(L-lysine)-based hydrogels: synthesis, characterization, and drug encapsulation.

    Science.gov (United States)

    Wang, Steven S S; Hsieh, Ping-Lun; Chen, Pei-Shan; Chen, Yu-Tien; Jan, Jeng-Shiung

    2013-11-01

    Genipin-cross-linked hydrogels composed of biodegradable and pH-sensitive cationic poly(L-lysine) (PLL), poly(L-lysine)-block-poly(L-alanine) (PLL-b-PLAla), and poly(L-lysine)-block-polyglycine (PLL-b-PGly) polypeptides were synthesized, characterized, and used as carriers for drug delivery. These polypeptide hydrogels can respond to pH-stimulus and their gelling and mechanical properties, degradation rate, and drug release behavior can be tuned by varying polypeptide composition and cross-linking degree. Comparing with natural polymers, the synthetic polypeptides with well-defined chain length and composition can warrant the preparation of the hydrogels with tunable properties to meet the criteria for specific biomedical applications. These hydrogels composed of natural building blocks exhibited good cell compatibility and enzyme degradability and can support cell attachment/proliferation. The evaluation of these hydrogels for in vitro drug release revealed that the controlled release profile was a biphasic pattern with a mild burst release and a moderate release rate thereafter, suggesting the drug molecules were encapsulated inside the gel matrix. With the versatility of polymer chemistry and conjugation of functional moieties, it is expected these hydrogels can be useful for biomedical applications such as polymer therapeutics and tissue engineering. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Sequences of digestible lysine for gilts from 60 to 148 days of age

    Directory of Open Access Journals (Sweden)

    Veredino Louzada da Silva Júnior

    2015-01-01

    Full Text Available The experiment was conducted to evaluate five nutritional plans based on sequences of standardized ileal digestible lysine: 0.90-0.80-0.70, 1.00-0.90-0.80, 1.10-1.00-0.90, 1.20-1.10-1.00, and 1.30-1.20-1.10% fed to gilts from 60 to 99, 129 to 100, and 130 to 148 days of age, respectively. Eighty commercial hybrid gilts, selected for lean gain, with initial weight of 23.46±0.27kg were allotted in a randomized block design, with five treatments, eight replicates, and two pigs per experimental unit. No effect (P>0.05 of the nutritional plans was verified on daily feed intake, daily weight gain and feed conversion. The nutritional plans had no influence (P>0.05 on any of the carcass traits evaluated (carcass yield, meat amount, and meat yield. The nutritional plan of 0.90-0.80-0.70% standardized ileal digestible lysine fed to gilts from 60 to 99, 100 to 129, and 130 to 148 days of age, respectively, meets the standardized ileal digestible lysine requirements of gilts from 60 to 148 days of age.

  4. Bioconversion of Agricultural By-Products to Lysin by brevibacterium flavum and physico-chemical optimization for hyper-production

    International Nuclear Information System (INIS)

    Irshad, S.; Hashmi, A. S.; Babar, M. E.; Awan, A. R.; Anjum, A. A.; Javed, M. M.

    2015-01-01

    Poultry and agriculture industry has a great role in the development of food sector in Pakistan. Whole of the Lysine required for poultry feed is imported to fulfil the desired dietary needs. Present study was designed to utilize different agricultural by-products like molasses, wheat bran, rice polishing and corn steep liquor. Different Physico-Chemical parameters were optimized to have hyper-production of Lysine through fermentation by using Brevibacterium flavum as a fermentative agent. From wheat bran, rice polishing and molasses (as best carbon source), significantly high concentrations of lysine (10.4 g/L) after 72h of incubation was observed with molasses (4 percentage) with 3 percentage (v/v) inoculum size at 30 degree C and pH 7. Among different nitrogen sources, 0.25 percentage (NH/sub 4/)2SO/sub 4/ showed significantly (P< 0.05) high yield of Lysine (16.89 g/L). Addition of different optimum levels of ionic salts; 4 percentage CaCO/sub 3/, 0.4 percentage MgSO/sub 4/.7H/sub 2/O, 0.1 percentage NaCl and 0.2 percentage KH/sub 2/PO/sub 4/ gave significantly (P< 0.05) higher quantity of Lysine 19.01 g/L. Inclusion of 0.6 percentage corn steep liquor and 0.4 mg/100mL biotin significantly (P< 0.05) raised the Lysine from 19.4 g/L - 19.45 g/L. The presence of Lysine in fermented broth was detected by TLC. Thus a cheap and practical bioprocess of Lysine production was concluded, that can be exploited commercially to save foreign exchange. (author)

  5. Effect of EDTA on Pb(II) Uptake and Translocation by Tumbleweed (Salsola Kali): Agar and Hydroponics Studies

    Energy Technology Data Exchange (ETDEWEB)

    de la Rosa, Guadalupe; Gardea-Torresdey, Jorge L.; Peralta-Videa, Jose R.; Aldrich, Mary

    2004-03-31

    Environmental accumulation of Pb represents a worldwide health hazard. While conventional cleanup techniques are generally expensive and soil disturbing, phytoremediation represents an inexpensive friendly option for the removal of contaminants from soil and water. In this research, tumbleweed (Salsola kali) plants exposed for 15 days to Pb(NO3)2 at 80 and 125 ppm in hydroponics and agar media, demonstrated a high capacity to uptake lead. The results showed that the plants cultivated in agar accumulated 25563, 5534 and 2185 mg Pb kg-1 DW in roots, stems and leaves, respectively. Moreover, Pb concentrations found in hydroponically grown tumbleweed plants tissues were 30744, 1511 and 1421 mg kg-1 DW in roots, stems and leaves, respectively. It was observed that EDTA enhanced Pb translocation. No Pb phytotoxic effects were observed during the experimental time period. Cellular structural features were also observed using TEM.

  6. Systematic replacement of lysine with glutamine and alanine in Escherichia coli malate synthase G: effect on crystallization

    International Nuclear Information System (INIS)

    Anstrom, David M.; Colip, Leslie; Moshofsky, Brian; Hatcher, Eric; Remington, S. James

    2005-01-01

    Alanine and glutamine mutations were made to the same 15 lysine positions on the surface of E. coli malate synthase G and the impact on crystallization observed. The results support lysine replacement for improvement of crystallization and provide insight into site selection and type of amino-acid replacement. Two proposals recommend substitution of surface lysine residues as a means to improve the quality of protein crystals. In proposal I, substitution of lysine by alanine has been suggested to improve crystallization by reducing the entropic cost of ordering flexible side chains at crystal contacts. In proposal II, substitution of lysine by residues more commonly found in crystal contacts, such as glutamine, has been proposed to improve crystallization. 15 lysine residues on the surface of Escherichia coli malate synthase G, distributed over a variety of secondary structures, were individually mutated to both alanine and glutamine. For 28 variants, detailed studies of the effect on enzymatic activity and crystallization were conducted. This has permitted direct comparison of the relative effects of the two types of mutations. While none of the variants produced crystals suitable for X-ray structural determination, small crystals were obtained in a wide variety of conditions, in support of the general approach. Glutamine substitutions were found to be more effective than alanine in producing crystals, in support of proposal II. Secondary structure at the site of mutation does not appear to play a major role in determining the rate of success

  7. Strain differences in the response to morphine on incorporation of 3H-lysine into rat brain protein

    International Nuclear Information System (INIS)

    Ford, D.H.; Rhines, R.K.; Levi, M.A.

    1977-01-01

    The effect of morphine on the specific activity (SA) of lysine in the plasma free amino acid (FFA) fraction and in the cerebral cortical FAA and protein fractions, as well as on the specific accumulation and incorporation, was determined in male Sprague-Dawley and Wistar rats at various time intervals after intravenous injection of drug and amino acid into unanesthetized animals. The lysine SA was higher in Sprague-Dawley than in Wistar rats in the plasma and brain FAA fraction and in the protein fraction. In the SD strain, morphine decreased the SA of plasma FAA significantly, but had only slight effects in the Wistar strain. In the cortical gray matter, morphine elevated the SA of lysine significantly in both strains. SA of the lysine in cerebral cortical protein increased in both strains with time. When the data for the free amino acids were expressed in terms of specific accumulation, the observed rates were higher in the Sprague-Dawley animals and reached a point of maximal concentration, which was not observed in animals of the Wistar strain. Morphine elevated the levels of specific accumulation of lysine into the cortical free amino acid pool in both strains of rat. It is concluded that Sprague-Dawley and Wistar rats are not equivalent in relation to the accumulation of an amino acid in the brain FAA pool from the plasma and that the effect of morphine on specific incorporation of lysine into brain protein is greater in Wistar rats. (author)

  8. Tracking the behavior of Maillard browning in lysine/arginine-sugar model systems under high hydrostatic pressure.

    Science.gov (United States)

    Ma, Xiao-Juan; Gao, Jin-Yan; Tong, Ping; Li, Xin; Chen, Hong-Bing

    2017-12-01

    High-pressure processing is gaining popularity in the food industry. However, its effect on the Maillard reaction during high-pressure-assisted pasteurization and sterilization is not well documented. This study aimed to investigate the effects of high hydrostatic pressure on the Maillard reaction during these processes using amino acid (lysine or arginine)-sugar (glucose or fructose) solution models. High pressure retarded the intermediate and final stages of the Maillard reaction in the lysine-sugar model. For the lysine-glucose model, the degradation rate of Amadori compounds was decelerated, while acceleration was observed in the arginine-sugar model. Increased temperature not only accelerated the Maillard reaction over time but also formed fluorescent compounds with different emission wavelengths. Lysine reacted with the sugars more readily than arginine under the same conditions. In addition, it was easier for lysine to react with glucose, whereas arginine reacted more readily with fructose under high pressure. High pressure exerts different effects on lysine-sugar and arginine-sugar models. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  9. Variation in Microbial Identification System Accuracy for Yeast Identification Depending on Commercial Source of Sabouraud Dextrose Agar

    OpenAIRE

    Kellogg, James A.; Bankert, David A.; Chaturvedi, Vishnu

    1999-01-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc.) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system’s accuracy.

  10. Variation in Microbial Identification System accuracy for yeast identification depending on commercial source of Sabouraud dextrose agar.

    Science.gov (United States)

    Kellogg, J A; Bankert, D A; Chaturvedi, V

    1999-06-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc. ) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system's accuracy.

  11. Performance of Chromogenic Candida agar and CHROMagar Candida in recovery and presumptive identification of monofungal and polyfungal vaginal isolates.

    Science.gov (United States)

    Ozcan, Kadri; Ilkit, Macit; Ates, Aylin; Turac-Bicer, Aygul; Demirhindi, Hakan

    2010-02-01

    Chromogenic Candida agar (OCCA) is a novel medium facilitating isolation and identification of Candida albicans, C. tropicalis, and C. krusei, as well as indicating polyfungal population in clinical samples. We compare the performance of OCCA, to CHROMagar Candida (CAC) and Sabouraud chloramphenicol agar (SCA). Vaginal swab samples from 392 women were simultaneously inoculated onto three study media. A total of 161 (41.1%) were found to be positive for fungi of which 140 (87%) were monofungal, and 21 (13%) polyfungal. One-hundred and fifty-seven samples (97.5%) were positive on CAC, 156 (96.9%) on OCCA, 148 (91.9%) on SCA and 144 (89.4%) samples were positive on all three media. The yeasts were identified by conventional methods including germ tube test, microscopic morphology on cornmeal-Tween 80 agar, and the commercial API 20C AUX. The 182 isolates were C. albicans (n = 104), C. glabrata (n = 51), C. krusei (n = 7), C. tropicalis (n = 5), C. famata (n = 3), C. kefyr (n = 3), C. zeylanoides (n = 3), C. colliculosa (n = 2), and other species of Candida (n = 4). Among the 21 polyfungal populations, 20 (95.2%) were detected in OCCA, 14 (66.7%) in CAC, and 13 (61.9%) in CAC and OCCA (P or=92.9% at 72 h. OCCA is more efficient and reliable for rapidly identifying C. albicans and polyfungal populations than CAC. However, CAC is more efficient for identifying C. krusei and C. tropicalis. A chromogenic agar with a higher isolation rate of yeasts and better detection of polyfungal populations than SCA, is suggested as a medium of first choice when available.

  12. Comparison of antibacterial activities of root-end filling materials by an agar diffusion assay and Alamar blue assay

    Directory of Open Access Journals (Sweden)

    Tsui-Hsien Huang

    2012-12-01

    Conclusion: We concluded that both the agar diffusion test and Alamar blue assay gave comparable findings of assessing the antimicrobial activity present in root-end filling materials. No antimicrobial activity was detected for mineral trioxide aggregate, calcium silicate cement, or amalgam after coming into contact with S. mutans, S. sanguinis and E. coli. IRM showed high antimicrobial activity against both S. sanguinis and E. coli.

  13. Efficacy and tolerance of lysine clonixinate versus paracetamol/codeine following inguinal hernioplasty.

    Science.gov (United States)

    de los Santos, A R; Di Girolamo, G; Martí, M L

    1998-01-01

    In this study lysine clonixinate, a nonsteroidal antiinflammatory agent with selective inhibition of cyclooxygenase-2 and 5-lipooxygenase in in vitro and in vivo pharmacodynamic studies, was evaluated in a prospective, randomized, double-blind, double-dummy clinical study versus paracetamol/codeine, in 151 patients with pain following inguinal hernioplasty. Patients were treated with one 125 mg tablet of lysine clonixinate or paracetamol/codeine (500 mg + 30 mg) administered at fixed doses every 4 h during 2 days. Controls were carried out 1, 2 and 4 h after the first intake of day 1 and day 2. Each control included assessment of pain at rest, when coughing, sitting and upon moderate pressure. Both treatment groups (lysine clonixinate, 77 patients and paracetamol/codeine, 74 patients) were comparable in terms of demographic and baseline pain intensities. Spontaneous pain was reduced significantly in both treatment groups from the 1st-h control. The following values were recorded in the lysine clonixinate group during day 1: baseline: 6.86 +/- 1.24; 1st h: 4.49 +/- 1.77; 2nd h: 2.96 +/- 1.74; 4th h: 2.23 +/- 1.51. The following values for the same group during day 2 were: predose: 1.70 +/- 1.64; 1st h: 1.16 +/- 1.17; 2nd h: 0.78 +/- 1.06; 4th h: 0.63 +/- 1.05. The paracetamol/codeine group revealed the following values: day 1: baseline: 6.72 +/- 1.22; 1st h: 4.57 +/- 1.72; 2nd h: 2.97 +/- 1.68; 4th h: 2.47 +/- 1.68 and day 2: predose: 2.02 +/- 1.57; 1st h: 1.32 +/- 1.23; 2nd h: 0.82 +/- 0.99; 4th h: 0.66 +/- 0.89. Reduction of pain induced by coughing, sitting and pressure showed similar behavior patterns. No significant differences between both treatment groups were encountered in terms of analgesic efficacy. Incidence of adverse effects was significantly higher in the paracetamol/codeine group (X2: p lysine clonixinate group four out of 77 patients showed side effects but these did not require treatment discontinuation.

  14. Metabolic responses to pyruvate kinase deletion in lysine producing Corynebacterium glutamicum

    Directory of Open Access Journals (Sweden)

    Wittmann Christoph

    2008-03-01

    Full Text Available Abstract Background Pyruvate kinase is an important element in flux control of the intermediate metabolism. It catalyzes the irreversible conversion of phosphoenolpyruvate into pyruvate and is under allosteric control. In Corynebacterium glutamicum, this enzyme was regarded as promising target for improved production of lysine, one of the major amino acids in animal nutrition. In pyruvate kinase deficient strains the required equimolar ratio of the two lysine precursors oxaloacetate and pyruvate can be achieved through concerted action of the phosphotransferase system (PTS and phosphoenolpyruvate carboxylase (PEPC, whereby a reduced amount of carbon may be lost as CO2 due to reduced flux into the tricarboxylic acid (TCA cycle. In previous studies, deletion of pyruvate kinase in lysine-producing C. glutamicum, however, did not yield a clear picture and the exact metabolic consequences are not fully understood. Results In this work, deletion of the pyk gene, encoding pyruvate kinase, was carried out in the lysine-producing strain C. glutamicum lysCfbr, expressing a feedback resistant aspartokinase, to investigate the cellular response to deletion of this central glycolytic enzyme. Pyk deletion was achieved by allelic replacement, verified by PCR analysis and the lack of in vitro enzyme activity. The deletion mutant showed an overall growth behavior (specific growth rate, glucose uptake rate, biomass yield which was very similar to that of the parent strain, but differed in slightly reduced lysine formation, increased formation of the overflow metabolites dihydroxyacetone and glycerol and in metabolic fluxes around the pyruvate node. The latter involved a flux shift from pyruvate carboxylase (PC to PEPC, by which the cell maintained anaplerotic supply of the TCA cycle. This created a metabolic by-pass from PEP to pyruvate via malic enzyme demonstrating its contribution to metabolic flexibility of C. glutamicum on glucose. Conclusion The metabolic

  15. Comparative pharmacokinetics of cefuroxime lysine after single intravenous, intraperitoneal, and intramuscular administration to rats.

    Science.gov (United States)

    Zhao, Long-shan; Yin, Ran; Wei, Bin-bin; Li, Qing; Jiang, Zhen-yuan; Chen, Xiao-hui; Bi, Kai-shun

    2012-11-01

    To compare the pharmacokinetic parameters of cefuroxime lysine, a new second-generation of cephalosporin antibiotics, after intravenous (IV), intraperitoneal (IP), or intramuscular (IM) administration. Twelve male and 12 virgin female Sprague-Dawley rats, weighing from 200 to 250 g, were divided into three groups (n=4 for each gender in each group). The rats were administered a single dose (67.5 mg/kg) of cefuroxime lysine via IV bolus or IP or IM injection. Blood samples were collected and analyzed with a validated UFLC-MS/MS method. The concentration-time data were then calculated by compartmental and non-compartmental pharmacokinetic methods using DAS software. After IV, IP or IM administration, the plasma cefuroxime lysine disposition was best described by a tri-compartmental, bi-compartmental or mono-compartmental open model, respectively, with first-order elimination. The plasma concentration profiles were similar through the 3 administration routes. The distribution process was rapid after IV administration [t(1/2(d)), 0.10 ± 0.11 h vs 1.36 ± 0.65 and 1.25 ± 1.01 h]. The AUMC(0-∞) is markedly larger, and mean residence time (MRT) is greatly longer after IP administration than that in IV, or IM routes (AUMC(0-∞): 55.33 ± 20.34 vs 16.84 ± 4.85 and 36.17 ± 13.24 mg·h(2)/L; MRT: 0.93 ± 0.10 h vs 0.37 ± 0.07 h and 0.65 ± 0.05 h). The C(max) after IM injection was significantly higher than that in IP injection (73.51 ± 12.46 vs 49.09 ± 7.06 mg/L). The AUC(0-∞) in male rats were significantly higher than that in female rats after IM administration (66.38 ± 16.5 vs 44.23 ± 6.37 mg·h/L). There was no significantly sex-related difference in other pharmacokinetic parameters of cefuroxime lysine between male and female rats. Cefuroxime lysine shows quick absorption after IV injection, a long retension after IP injection, and a high C(max) after IM injection. After IM administration the AUC(0-∞) in male rats was significantly larger than that in

  16. Lysine-functionalized nanodiamonds: synthesis, physiochemical characterization, and nucleic acid binding studies

    Directory of Open Access Journals (Sweden)

    Kaur R

    2012-07-01

    Full Text Available Randeep Kaur,1 Jackson M Chitanda,2 Deborah Michel,1 Jason Maley,3 Ferenc Borondics,2,4 Peng Yang,5 Ronald E Verrall,2 Ildiko Badea11Drug Design and Discovery Research Group, College of Pharmacy and Nutrition, University of Saskatchewan, 2Department of Chemistry, University of Saskatchewan, 3Saskatchewan Structural Sciences Centre, University of Saskatchewan, 4Canadian Light Source, University of Saskatchewan, Saskatoon, SK, Canada; 5Department of Organic Chemistry, School of Pharmaceutical Engineering, Shenyang Pharmaceutical University, Shenyang, People's Republic of ChinaPurpose: Detonation nanodiamonds (NDs are carbon-based nanomaterials that, because of their size (4–5 nm, stable inert core, alterable surface chemistry, fluorescence, and biocompatibility, are emerging as bioimaging agents and promising tools for the delivery of biochemical molecules into cellular systems. However, diamond particles possess a strong propensity to aggregate in liquid formulation media, restricting their applicability in biomedical sciences. Here, the authors describe the covalent functionalization of NDs with lysine in an attempt to develop nanoparticles able to act as suitable nonviral vectors for transferring genetic materials across cellular membranes.Methods: NDs were oxidized and functionalized by binding lysine moieties attached to a three-carbon-length linker (1,3-diaminopropane to their surfaces through amide bonds. Raman and Fourier transform infrared spectroscopy, zeta potential measurement, dynamic light scattering, atomic force microscopic imaging, and thermogravimetric analysis were used to characterize the lysine-functionalized NDs. Finally, the ability of the functionalized diamonds to bind plasmid DNA and small interfering RNA was investigated by gel electrophoresis assay and through size and zeta potential measurements.Results: NDs were successfully functionalized with the lysine linker, producing surface loading of 1.7 mmol g-1 of ND

  17. Mechanical touch responses of Arabidopsis TCH1-3 mutant roots on inclined hard-agar surface

    Science.gov (United States)

    Zha, Guodong; Wang, Bochu; Liu, Junyu; Yan, Jie; Zhu, Liqing; Yang, Xingyan

    2016-01-01

    The gravity-induced mechanical touch stimulus can affect plant root architecture. Mechanical touch responses of plant roots are an important aspect of plant root growth and development. Previous studies have reported that Arabidopsis TCH1-3 genes are involved in mechano-related events, how-ever, the physiological functions of TCH1-3 genes in Arabidopsis root mechanoresponses remain unclear. In the present study, we applied an inclined hard agar plate method to produce mechanical touch stimulus, and provided evidence that altered mechanical environment could influence root growth. Furthermore, tch1-3 Arabidopsis mutants were investigated on inclined agar surfaces to explore the functions of TCH1-3 genes on Arabidopsis root mechanoresponses. The results showed that two tch2 mutants, cml24-2 and cml24-4, exhibited significantly reduced root length, biased skewing, and decreased density of lateral root. In addition, primary root length and density of lateral root of tch3 (cml12-2) was significantly decreased on inclined agar surfaces. This study indicates that the tch2 and tch3 mutants are hypersensitive to mechanical touch stimulus, and TCH2 (CML24-2 and CML24-4) and TCH3 (CML12-2) genes may participate in the mechanical touch response of Arabidopsis roots.

  18. Irradiation of silver and agar/silver nanoparticles with argon, oxygen glow discharge plasma, and mercury lamp.

    Science.gov (United States)

    Ahmad, Mahmoud M; Abdel-Wahab, Essam A; El-Maaref, A A; Rawway, Mohammed; Shaaban, Essam R

    2014-01-01

    The irradiation effect of argon, oxygen glow discharge plasma, and mercury lamp on silver and agar/silver nanoparticle samples is studied. The irradiation time dependence of the synthesized silver and agar/silver nanoparticle absorption spectra and their antibacterial effect are studied and compared. In the agar/silver nanoparticle sample, as the irradiation time of argon glow discharge plasma or mercury lamp increases, the peak intensity and the full width at half maximum, FWHM, of the surface plasmon resonance absorption band is increased, however a decrease of the peak intensity with oxygen glow plasma has been observed. In the silver nanoparticle sample, as the irradiation time of argon, oxygen glow discharge plasma or mercury lamp increases, the peak intensity of the surface plasmon resonance absorption band is increased, however, there is no significant change in the FWHM of the surface plasmon resonance absorption band. The SEM results for both samples showed nanoparticle formation with mean size about 50 nm and 40 nm respectively. Throughout the irradiation time with the argon, oxygen glow discharge plasma or mercury lamp, the antibacterial activity of several kinds of Gram-positive and Gram-negative bacteria has been examined.

  19. Isolation of nontuberculous mycobacteria from soil using Middlebrook 7H10 agar with increased malachite green concentration.

    Science.gov (United States)

    Hu, Yuli; Yu, Xinglong; Zhao, Dun; Li, Runcheng; Liu, Yang; Ge, Meng; Hu, Huican

    2017-12-01

    Environmental exposure is considered to be responsible for nontuberculous mycobacterial infections in humans. To facilitate the isolation of mycobacteria from soil, Middlebrook 7H10 agar was optimized as an enhanced selective medium by increasing the concentration of malachite green. A series of modified Middlebrook 7H10 agar media with malachite green concentrations ranging from 2.5 to 2500 mg/L was evaluated using 20 soil samples decontaminated with 3% sodium dodecyl sulfate plus 2% NaOH for 30 min. Among these modified Middlebrook 7H10 media, the medium with malachite green at a concentration of 250 mg/L, i.e., at the same concentration as in Löwenstein-Jensen medium, was the most effective in terms of the number of plates with mycobacterial growth. This medium was further evaluated with 116 soil samples. The results showed that 87.1% (101/116) of the samples produced mycobacterial growth, and 15 samples (12.9%) produced no mycobacterial growth. Of the plates inoculated with the soil samples, each in duplicate, 5.2% (12/232) showed late contamination. In total, 19 mycobacterial species were isolated, including seven (36.8%) rapidly growing mycobacteria and 12 (63.2%) slowly growing mycobacteria. Our results demonstrate that the modified Middlebrook 7H10 agar with 250 mg/L malachite green is useful for the primary isolation of nontuberculous mycobacteria from soil.

  20. Broth and agar hop-gradient plates used to evaluate the beer-spoilage potential of Lactobacillus and Pediococcus isolates.

    Science.gov (United States)

    Haakensen, M; Schubert, A; Ziola, B

    2009-03-15

    Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.

  1. Non-enzymatic N-acetylation of Lysine Residues by AcetylCoA Often Occurs via a Proximal S-acetylated Thiol Intermediate Sensitive to Glyoxalase II

    Directory of Open Access Journals (Sweden)

    Andrew M. James

    2017-02-01

    Full Text Available Summary: Acetyl coenzyme A (AcCoA, a key intermediate in mitochondrial metabolism, N-acetylates lysine residues, disrupting and, in some cases, regulating protein function. The mitochondrial lysine deacetylase Sirtuin 3 (Sirt3 reverses this modification with benefits reported in diabetes, obesity, and aging. We show that non-enzymatic lysine N-acetylation by AcCoA is greatly enhanced by initial acetylation of a cysteine residue, followed by SN-transfer of the acetyl moiety to a nearby lysine on mitochondrial proteins and synthetic peptides. The frequent occurrence of an S-acetyl intermediate before lysine N-acetylation suggests that proximity to a thioester is a key determinant of lysine susceptibility to acetylation. The thioesterase glyoxalase II (Glo2 can limit protein S-acetylation, thereby preventing subsequent lysine N-acetylation. This suggests that the hitherto obscure role of Glo2 in mitochondria is to act upstream of Sirt3 in minimizing protein N-acetylation, thus limiting protein dysfunction when AcCoA accumulates. : James et al. show that the non-enzymatic N-acetylation of lysine residues in mitochondrial proteins frequently occurs via a proximal S-acetylated thiol intermediate. Glutathione equilibrates with this intermediate, allowing the thioesterase glyoxalase II to limit protein lysine N-acetylation. These findings expand our understanding of how protein acetylation arises. Keywords: AcetylCoA, lysine acetylation, glyoxalase

  2. Effect of dietary nutrients on ileal endogenous losses of threonine, cysteine, methionine, lysine, leucine and protein in broiler chicks.

    Science.gov (United States)

    Cerrate, S; Vignale, S K; Ekmay, R; England, J; Coon, C

    2018-04-01

    An isotope dose technique was utilized (i) to determine endogenous amino acid (AA) and protein losses and (ii) to propose adjusted values for AA requirements. The endogenous flow rate was calculated from the pool of enrichment in plasma AA, assuming similitude to enrichment of endogenous AA. In experiment 1, chicks were orally administered D4-lysine at 2% of estimated lysine intake from 16 to 24 days to find the isotopic steady state of the atom percent excess (APE) of lysine for plasma and jejunal and ileal digesta. The APE of D4-lysine in plasma, jejunal digesta and ileal digesta reached the isotopic steady state at 5.5, 3.4 and 2.0 days, respectively, by using the broken-line model. It was assumed that the isotopic steady state at 5 days identified for D4-lysine is also representative for the 15N-labeled AA. In experiment 2, chicks were fed diets from 1 to 21 days with increasing levels of fat (6%, 8%, 12%, 13% extract ether), protein (26%, 28.5%, 31% CP) or fiber (14%, 16%, 18% NDF) by adding poultry fat, soybean meal, blended animal protein or barley. Chicks were orally administered 15N-threonine, 15N-cysteine, 15N-methionine, 15N-lysine and 15N-leucine at 2% of estimated daily intake for 5 days from 17 to 21 days of age. Dietary nutrients influenced endogenous losses (EL), where dietary fat stimulated EL of lysine (P=0.06), leucine and protein (P=0.07); dietary protein enhanced EL of leucine and protein; and finally the dietary fiber increased EL of leucine. Dietary nutrients also affected apparent ileal digestibility (AID). Dietary fat increased AID of cysteine but decreased AID of lysine. Dietary protein reduced AID of protein, threonine, lysine and leucine, and similarly dietary fiber decreased AID of protein, threonine, methionine, lysine and leucine. In contrast, dietary fat or protein did not affect real ileal digestibility (RID) of protein and AA except threonine and leucine. The dietary fiber reduced the RID of protein, threonine and leucine. This

  3. Research on Candida dubliniensis in a Brazilian yeast collection obtained from cardiac transplant, tuberculosis, and HIV-positive patients, and evaluation of phenotypic tests using agar screening methods.

    Science.gov (United States)

    Ribeiro, Patrícia Monteiro; Querido, Silvia Maria Rodrigues; Back-Brito, Graziela Nueremberg; Mota, Adolfo José; Koga-Ito, Cristiane Yumi; Jorge, Antonio Olavo Cardoso

    2011-09-01

    The aim of this study was to research Candida dubliniensis among isolates present in a Brazilian yeast collection and to evaluate the main phenotypic methods for discrimination between C. albicans and C. dubliniensis from oral cavity. A total of 200 isolates, presumptively identified as C. albicans or C. dubliniensis obtained from heart transplant patients under immunosuppressive therapy, tuberculosis patients under antibiotic therapy, HIV-positive patients under antiretroviral therapy, and healthy subjects, were analyzed using the following phenotypic tests: formation and structural arrangement of chlamydospores on corn meal agar, casein agar, tobacco agar, and sunflower seed agar; growth at 45 °C; and germ tube formation. All strains were analyzed by polymerase chain reaction (PCR). In a preliminary screen for C. dubliniensis, 48 of the 200 isolates on corn meal agar, 30 of the 200 on casein agar, 16 of the 200 on tobacco agar, and 15 of the 200 on sunflower seed agar produced chlamydoconidia; 27 of the 200 isolates showed no or poor growth at 45 °C. All isolates were positive for germ tube formation. These isolates were considered suggestive of C. dubliniensis. All of them were subjected to PCR analysis using C. dubliniensis-specific primers. C. dubliniensis isolates were not found. C. dubliniensis isolates were not recovered in this study done with immunocompromised patients. Sunflower seed agar was the medium with the smallest number of isolates of C. albicans suggestive of C. dubliniensis. None of the phenotypic methods was 100% effective for discrimination between C. albicans and C. dubliniensis. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Production of trichothecenes and other secondary metabolites by Fusarium culmorum and Fusarium equiseti on common laboratory media and a soil organic matter agar: An ecological interpretation

    DEFF Research Database (Denmark)

    Hestbjerg, H.; Nielsen, Kristian Fog; Thrane, Ulf

    2002-01-01

    trichothecene production was detected for 94 of 102 F culmorum isolates, only 8 of 57 F equiseti isolates were positive. Profiles of secondary metabolites were compared by following growth on yeast extract sucrose agar (YES), potato sucrose agar (PSA), and an agar medium, prepared from soil organic matter (SOM......), which was included to simulate growth, conditions in soil. SOM supported the production of chrysogine by F culmorum. The two species utilized the media differently. F culmorum produced zearalenone (ZEA) on YES, whereas some F. equiseti isolates produced ZEA on PSA. Other F. equiseti isolates produced...

  5. Optimization of the agar-gel method for isolation of migrating Ascaris suum larvae from the liver and lungs of pigs

    DEFF Research Database (Denmark)

    Saeed, I.; Roepstorff, A.; Rasmussen, T.

    2001-01-01

    Experiments on use of an agar-gel method for recovery of migrating Ascaris suum larvae from the liver and lungs of pigs were conducted to obtain fast standardized methods. Subsamples of blended tissues of pig liver and lungs were mixed with agar to a final concentration of 1% agar and the larvae...... clean suspension which reduced the sample counting time. Blending the liver for 60 sec in a commercial blender showed significantly higher larvae recovery than blending for 30 sec. Addition of gentamycin to reduce bacterial growth during incubation, glucose to increase larval motility during migration...

  6. Acid dissociation constant and apparent nucleophilicity of lysine-501 of the alpha-polypeptide of sodium and potassium ion activated adenosinetriphosphatase

    International Nuclear Information System (INIS)

    Xu, K.Y.

    1989-01-01

    A combination of competitive labeling with [ 3 H]acetic anhydride and immunoaffinity chromatography is described that permits the assignment of the acid dissociation constant and the absolute nucleophilicity of individual lysines in a native enzyme. The acid dissociation constant of lysine-501 of the alpha-polypeptide in native (Na+ + K+)-ATPase was determined. This lysine had a normal pKa of 10.4. The rate constant for the reaction of the free base of lysine-501 with acetic anhydride at 10 degrees C is 400 M-1 s-1. This value is only 30% that for a fully accessible lysine in a protein. The lower than normal apparent nucleophilicity suggests that lysine-501 is hindered from reacting with its intrinsic nucleophilicity by the tertiary structure of the enzyme and is consistent with its location within a pocket that forms the active site upon the surface of the native protein

  7. N-epsilon-(carboxyethyl)lysine, a product of the chemical modification of proteins by methylglyoxal, increases with age in human lens proteins.

    OpenAIRE

    Ahmed, M U; Brinkmann Frye, E; Degenhardt, T P; Thorpe, S R; Baynes, J W

    1997-01-01

    Advanced glycation end-products and glycoxidation products, such as Nepsilon-(carboxymethyl)lysine (CML) and pentosidine, accumulate in long-lived tissue proteins with age and are implicated in the aging of tissue proteins and in the development of pathology in diabetes, atherosclerosis and other diseases. In this paper we describe a new advanced glycation end-product, Nepsilon-(carboxyethyl)lysine (CEL), which is formed during the reaction of methylglyoxal with lysine residues in model compo...

  8. Lysine Restriction and Pyridoxal Phosphate Administration in a NADK2 Patient.

    Science.gov (United States)

    Tort, Frederic; Ugarteburu, Olatz; Torres, Maria Angeles; García-Villoria, Judit; Girós, Marisa; Ruiz, Angeles; Ribes, Antonia

    2016-11-01

    We report the case of a 10-year-old Spanish girl with mutations in NADK2 Prenatal central nervous system abnormalities showed ventriculomegaly, colpocephaly, and hypoplasia of the corpus callosum. At birth, axial hypotonia, uncoordinated movements, microcephaly, and generalized cerebellar atrophy were detected. Metabolic investigations revealed high lysine, lactate, and pipecolic acid levels in blood and cerebrospinal fluid. Pyruvate carboxylase and pyruvate dehydrogenase activity in fibroblasts were normal. Beginning at birth she received biotin, thiamine, and carnitine supplementation. A lysine-restricted diet was started when she was 1 month old. Because pipecolic acid was high, pyridoxine was added to treatment. At 3 years old, astatic myoclonic epilepsy appeared, with no response to levetiracetam. We switched pyridoxine to pyridoxal phosphate, with electroclinical improvement. Because the activity of mitochondrial respiratory chain complexes III and IV was slightly low in muscle, other cofactors such as ubidecarenone, idebenone, vitamin E, and creatine were added to the treatment. At 8 years old, plasma acylcarnitine testing was performed, and high levels of 2-trans, 4-cis-decadienoylcarnitine were found. Whole exome sequencing identified a homozygous splice site mutation in NADK2 (c.956+6T>C; p.Trp319Cysfs*21). This substitution generates exon skipping, leading to a truncated protein. In fact, NADK2 messenger RNA and the corresponding protein were almost absent. Now, at 10 years of age she presents with ataxia and incoordination. She has oromotor dysphasia but is able to understand fluid language and is a very friendly girl. We hypothesize that the patient's clinical improvement could be due to her lysine-restricted diet together with cofactors and pyridoxal phosphate administration. Copyright © 2016 by the American Academy of Pediatrics.

  9. Free Base Lysine Increases Survival and Reduces Metastasis in Prostate Cancer Model.

    Science.gov (United States)

    Ibrahim-Hashim, Arig; Wojtkowiak, Jonathan W; de Lourdes Coelho Ribeiro, Maria; Estrella, Veronica; Bailey, Kate M; Cornnell, Heather H; Gatenby, Robert A; Gillies, Robert J

    2011-11-19

    Malignant tumor cells typically metabolize glucose anaerobically to lactic acid even under normal oxygen tension, a phenomenon called aerobic glycolysis or the Warburg effect. This results in increased acid production and the acidification of the extracellular microenvironment in solid tumors. H + ions tend to flow along concentration gradients into peritumoral normal tissue causing extracellular matrix degradation and increased tumor cell motility thus promoting invasion and metastasis. We have shown that reducing this acidity with sodium bicarbonate buffer decreases the metastatic fitness of circulating tumor cells in prostate cancer and other cancer models. Mathematical models of the tumor-host dynamics predicted that buffers with a pka around 7 will be more effective in reducing intra- and peri-tumoral acidosis and, thus, and possibly more effective in inhibiting tumor metastasis than sodium bicarbonate which has a pKa around 6. Here we test this prediction the efficacy of free base lysine; a non-bicarbonate/non-volatile buffer with a higher pKa (~10), on prostate tumor metastases model. Oxygen consumption and acid production rate of PC3M prostate cancer cells and normal prostate cells were determined using the Seahorse Extracellular Flux (XF-96) analyzer. In vivo effect of 200 mM lysine started four days prior to inoculation on inhibition of metastasis was examined in PC3M-LUC-C6 prostate cancer model using SCID mice. Metastases were followed by bioluminescence imaging. PC3M prostate cancer cells are highly acidic in comparison to a normal prostate cell line indicating that reduction of intra- and perit-tumoral acidosis should inhibit metastases formation. In vivo administration of 200 mM free base lysine increased survival and reduced metastasis. PC3M prostate cancer cells are highly glycolytic and produce large amounts of acid when compared to normal prostate cells. Administration of non-volatile buffer decreased growth of metastases and improved survival

  10. Effect of different levels of L-carnitine and lysine-methionine on broiler blood parameters

    Directory of Open Access Journals (Sweden)

    Babak Hosseintabar

    2015-09-01

    Full Text Available Objetive. In the present study a completely randomized 3×3 factorial design was used to analyze the effects of different levels of L-Carnitine, lysine(Lys and methionine (Met on the blood concentrations of energy, protein and lipid metabolites of male broiler chickens. Materials and methods. A total of 270 newly hatched male broiler chickens (Ross 308 were randomly assigned to 9 groups (ten broilers per replicate and three replicates per treatment. The control group was fed a basal diet, whereas the treatment groups were fed basal diets supplemented with L-Carnitine (0 mg/kg, 75 mg/kg and 150 mg/kg and lysine-methionine (0, 15 and 30% for 42 days. On day 42, one bird was randomly chosen per replication, a blood sample was taken and the blood concentrations of glucose (GLU, uric acid (UAc, triglyceride (TG, VLDL, HDL, LDL, total protein (TP, albumin (Alb and total cholesterol (TC were analyzed. Results. Dietary L-carnitine supplementation had a significant effect (p<0.05 on uric acid (UAc, HDL, LDL, and total cholesterol (TC. The birds feed L-carnitine plus Lys and Met presented the highest plasmatic UAc level and the lowest plasmatic TC and LDL level. Moreover, L-carnitine significantly reduced total cholesterol (TC when compared with both the control group and the birds feed Lys and Met without L-carnitine. Conclusions. A diet with 150 mg/kg L-carnitine plus 15% Lys and Met seems to be enough to sustain low plasmatic TC, LDL and HDL concentrations on male broiler.

  11. Peripheral effects of FAAH deficiency on fuel and energy homeostasis: role of dysregulated lysine acetylation.

    Directory of Open Access Journals (Sweden)

    Bhavapriya Vaitheesvaran

    Full Text Available FAAH (fatty acid amide hydrolase, primarily expressed in the liver, hydrolyzes the endocannabinoids fatty acid ethanolamides (FAA. Human FAAH gene mutations are associated with increased body weight and obesity. In our present study, using targeted metabolite and lipid profiling, and new global acetylome profiling methodologies, we examined the role of the liver on fuel and energy homeostasis in whole body FAAH(-/- mice.FAAH(-/- mice exhibit altered energy homeostasis demonstrated by decreased oxygen consumption (Indirect calorimetry. FAAH(-/- mice are hyperinsulinemic and have adipose, skeletal and hepatic insulin resistance as indicated by stable isotope phenotyping (SIPHEN. Fed state skeletal muscle and liver triglyceride levels was increased 2-3 fold, while glycogen was decreased 42% and 57% respectively. Hepatic cholesterol synthesis was decreased 22% in FAAH(-/- mice. Dysregulated hepatic FAAH(-/- lysine acetylation was consistent with their metabolite profiling. Fasted to fed increases in hepatic FAAH(-/- acetyl-CoA (85%, p<0.01 corresponded to similar increases in citrate levels (45%. Altered FAAH(-/- mitochondrial malate dehydrogenase (MDH2 acetylation, which can affect the malate aspartate shuttle, was consistent with our observation of a 25% decrease in fed malate and aspartate levels. Decreased fasted but not fed dihydroxyacetone-P and glycerol-3-P levels in FAAH(-/- mice was consistent with a compensating contribution from decreased acetylation of fed FAAH(-/- aldolase B. Fed FAAH(-/- alcohol dehydrogenase (ADH acetylation was also decreased.Whole body FAAH deletion contributes to a pre-diabetic phenotype by mechanisms resulting in impairment of hepatic glucose and lipid metabolism. FAAH(-/- mice had altered hepatic lysine acetylation, the pattern sharing similarities with acetylation changes reported with chronic alcohol treatment. Dysregulated hepatic lysine acetylation seen with impaired FAA hydrolysis could support the liver

  12. Metabolic transit of N(ε)-carboxymethyl-lysine after consumption of AGEs from bread crust.

    Science.gov (United States)

    Roncero-Ramos, Irene; Delgado-Andrade, Cristina; Tessier, Frédéric J; Niquet-Léridon, Céline; Strauch, Christopher; Monnier, Vincent M; Navarro, María Pilar

    2013-07-01

    Our aim was to investigate carboxymethyl-lysine (CML) intake and excretion after feeding rats with diets containing advanced glycation end-products (AGEs) from bread crust (BC) or its soluble or insoluble fractions, and to identify the factors responsible for the effects observed. CML in serum and different tissues was measured to detect possible accumulations. For 88 days, weanling rats were fed with either a control diet or one containing BC, or its soluble low molecular weight (LMW), soluble high molecular weight (HMW) or insoluble fractions. In the last week of the assay, faeces and urine were collected daily and stored as a 1 week pool. After sacrifice, blood was drawn to obtain serum and some organs were removed. CML analysis was performed by HPLC/MS/MS in diets, faeces, urines, serum and tissues. Faecal excretion of CML was strongly influenced by dietary CML levels and represents the major route of excretion (i.e. 33.2%). However, the urinary elimination of CML was probably limited or saturated, especially when more complex compounds were present in the diet. BC consumption increased CML in the cardiac tissue (170 ± 18 vs. 97 ± 3 μmol per mol lysine for BC and control groups), which correlated with the CML intake. The levels of this AGE in bone were unaffected by the dietary treatment, but in tail tendons CML was greatly increased in the animals that consumed the BC diet (102 ± 13 vs. 51 ± 8 μmol per mol lysine for BC and control groups, P = 0.006), which was associated with the intake of soluble LMW compounds present in BC. Despite the CML accumulation detected in different tissues, serum levels of protein-bound CML were unchanged, indicating the importance of measuring the free CML in this fluid as a real index of dietary CML.

  13. Drosophila Kismet regulates histone H3 lysine 27 methylation and early elongation by RNA polymerase II.

    Directory of Open Access Journals (Sweden)

    Shrividhya Srinivasan

    2008-10-01

    Full Text Available Polycomb and trithorax group proteins regulate cellular pluripotency and differentiation by maintaining hereditable states of transcription. Many Polycomb and trithorax group proteins have been implicated in the covalent modification or remodeling of chromatin, but how they interact with each other and the general transcription machinery to regulate transcription is not well understood. The trithorax group protein Kismet-L (KIS-L is a member of the CHD subfamily of chromatin-remodeling factors that plays a global role in transcription by RNA polymerase II (Pol II. Mutations in CHD7, the human counterpart of kis, are associated with CHARGE syndrome, a developmental disorder affecting multiple tissues and organs. To clarify how KIS-L activates gene expression and counteracts Polycomb group silencing, we characterized defects resulting from the loss of KIS-L function in Drosophila. These studies revealed that KIS-L acts downstream of P-TEFb recruitment to stimulate elongation by Pol II. The presence of two chromodomains in KIS-L suggested that its recruitment or function might be regulated by the methylation of histone H3 lysine 4 by the trithorax group proteins ASH1 and TRX. Although we observed significant overlap between the distributions of KIS-L, ASH1, and TRX on polytene chromosomes, KIS-L did not bind methylated histone tails in vitro, and loss of TRX or ASH1 function did not alter the association of KIS-L with chromatin. By contrast, loss of kis function led to a dramatic reduction in the levels of TRX and ASH1 associated with chromatin and was accompanied by increased histone H3 lysine 27 methylation-a modification required for Polycomb group repression. A similar increase in H3 lysine 27 methylation was observed in ash1 and trx mutant larvae. Our findings suggest that KIS-L promotes early elongation and counteracts Polycomb group repression by recruiting the ASH1 and TRX histone methyltransferases to chromatin.

  14. Safely diagnosing clinically significant penicillin allergy using only penicilloyl-poly-lysine, penicillin, and oral amoxicillin.

    Science.gov (United States)

    Macy, Eric; Ngor, Eunis W

    2013-01-01

    Penicillin skin testing is rarely used to undiagnose penicillin "allergy" in the United States, partially because of concern that commercially available materials are inadequate. We determined whether skin testing with only commercially available penicilloyl-poly-lysine and penicillin followed by an oral amoxicillin challenge, if skin test-negative, can safely identify clinically significant penicillin allergy. Five hundred sequential persons with positive history of penicillin "allergy" were evaluated by skin testing with penicilloyl-poly-lysine and penicillin between June 8, 2010, and March 29, 2012. All persons with negative skin tests were given an oral amoxicillin challenge and observed for 1 hour. Persons undergoing penicillin allergy testing were representative of all health plan members with penicillin allergy. Only 4 persons (0.8%; 95% CI, 0.32%-2.03%) had a positive skin test result. Only 4 persons (0.8%; 95% CI, 0.32%-2.03%) had an acute objective oral amoxicillin challenge reaction. Fifteen persons (3.0%; 95% CI, 1.83%-4.98%) had subjective oral challenge reactions, either acute transient itching or dizziness. All were women and 11 (73.3%) had multiple drug intolerance syndrome. None had severe reactions or objective signs. These were not considered to be positive challenge reactions. Sixty-eight subjects (13.6%) who were negative on testing were exposed to 88 courses of penicillins during 90 days of follow-up. New reactions were reported after 4 courses (4.5%), 3 (75%) occurring in subjects with multiple drug intolerance syndrome. Penicillin skin testing, using only penicilloyl-poly-lysine and penicillin, followed by oral amoxicillin challenge, if negative, can safely identify clinically significant IgE-mediated penicillin allergy in patients who use health care in the United States at this time. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  15. Effect of lysine to alanine mutations on the phosphate activation and BPTES inhibition of glutaminase.

    Science.gov (United States)

    McDonald, Charles J; Acheff, Eric; Kennedy, Ryan; Taylor, Lynn; Curthoys, Norman P

    2015-09-01

    The GLS1 gene encodes a mitochondrial glutaminase that is highly expressed in brain, kidney, small intestine and many transformed cells. Recent studies have identified multiple lysine residues in glutaminase that are sites of N-acetylation. Interestingly, these sites are located within either a loop segment that regulates access of glutamine to the active site or the dimer:dimer interface that participates in the phosphate-dependent oligomerization and activation of the enzyme. These two segments also contain the binding sites for bis-2[5-phenylacetamido-1,2,4-thiadiazol-2-yl]ethylsulfide (BPTES), a highly specific and potent uncompetitive inhibitor of this glutaminase. BPTES is also the lead compound for development of novel cancer chemotherapeutic agents. To provide a preliminary assessment of the potential effects of N-acetylation, the corresponding lysine to alanine mutations were constructed in the hGACΔ1 plasmid. The wild type and mutated proteins were purified by Ni(+)-affinity chromatography and their phosphate activation and BPTES inhibition profiles were analyzed. Two of the alanine substitutions in the loop segment (K311A and K328A) and the one in the dimer:dimer interface (K396A) form enzymes that require greater concentrations of phosphate to produce half-maximal activation and exhibit greater sensitivity to BPTES inhibition. By contrast, the K320A mutation results in a glutaminase that exhibits near maximal activity in the absence of phosphate and is not inhibited by BPTES. Thus, lysine N-acetylation may contribute to the acute regulation of glutaminase activity in various tissues and alter the efficacy of BPTES-type inhibitors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Biotin protein ligase from Corynebacterium glutamicum: role for growth and L: -lysine production.

    Science.gov (United States)

    Peters-Wendisch, P; Stansen, K C; Götker, S; Wendisch, V F

    2012-03-01

    Corynebacterium glutamicum is a biotin auxotrophic Gram-positive bacterium that is used for large-scale production of amino acids, especially of L-glutamate and L-lysine. It is known that biotin limitation triggers L-glutamate production and that L-lysine production can be increased by enhancing the activity of pyruvate carboxylase, one of two biotin-dependent proteins of C. glutamicum. The gene cg0814 (accession number YP_225000) has been annotated to code for putative biotin protein ligase BirA, but the protein has not yet been characterized. A discontinuous enzyme assay of biotin protein ligase activity was established using a 105aa peptide corresponding to the carboxyterminus of the biotin carboxylase/biotin carboxyl carrier protein subunit AccBC of the acetyl CoA carboxylase from C. glutamicum as acceptor substrate. Biotinylation of this biotin acceptor peptide was revealed with crude extracts of a strain overexpressing the birA gene and was shown to be ATP dependent. Thus, birA from C. glutamicum codes for a functional biotin protein ligase (EC 6.3.4.15). The gene birA from C. glutamicum was overexpressed and the transcriptome was compared with the control strain revealing no significant gene expression changes of the bio-genes. However, biotin protein ligase overproduction increased the level of the biotin-containing protein pyruvate carboxylase and entailed a significant growth advantage in glucose minimal medium. Moreover, birA overexpression resulted in a twofold higher L-lysine yield on glucose as compared with the control strain.

  17. Non-enzymatic N -acetylation of Lysine Residues by AcetylCoA Often Occurs via a Proximal S -acetylated Thiol Intermediate Sensitive to Glyoxalase II

    OpenAIRE

    James, Andrew M.; Hoogewijs, Kurt; Logan, Angela; Hall, Andrew R.; Ding, Shujing; Fearnley, Ian M.; Murphy, Michael P.

    2017-01-01

    Summary: Acetyl coenzyme A (AcCoA), a key intermediate in mitochondrial metabolism, N-acetylates lysine residues, disrupting and, in some cases, regulating protein function. The mitochondrial lysine deacetylase Sirtuin 3 (Sirt3) reverses this modification with benefits reported in diabetes, obesity, and aging. We show that non-enzymatic lysine N-acetylation by AcCoA is greatly enhanced by initial acetylation of a cysteine residue, followed by SN-transfer of the acetyl moiety to a nearby lysin...

  18. Reduced Histone H3 Lysine 9 Methylation Contributes to the Pathogenesis of Latent Autoimmune Diabetes in Adults via Regulation of SUV39H2 and KDM4C

    Directory of Open Access Journals (Sweden)

    Xi-yu Liu

    2017-01-01

    Full Text Available Aims. Latent autoimmune diabetes in adults (LADA is an autoimmune disease of which the mechanism is not clear. Emerging evidence suggests that histone methylation contributes to autoimmunity. Methods. Blood CD4+ T lymphocytes from 26 LADA patients and 26 healthy controls were isolated to detect histone H3 lysine 4 and H3 lysine 9 methylation status. Results. Reduced global H3 lysine 9 methylation was observed in LADA patients’ CD4+ T lymphocytes, compared to healthy controls (P < 0.05. H3 lysine 4 methylation was not statistically different. The reduced H3 lysine 9 methylation was associated with GADA titer but not correlated with glycosylated hemoglobin (HbA1c. When the LADA patient group was divided into those with complication and those without, relatively reduced global H3 lysine 9 methylation was observed in LADA patients with complication (P < 0.05. The expression of histone methyltransferase SUV39H2 for H3 lysine 9 methylation was downregulated in LADA patients, and the expression of histone demethylase KDM4C which made H3 lysine 9 demethylation was upregulated. Conclusion. The reduction of histone H3 lysine 9 methylation which may due to the downregulation of methyltransferase SUV39H2 and the upregulation of demethylase KDM4C was found in CD4+ T lymphocytes of LADA patients.

  19. Report: Bioconversion of agriculture waste to lysine with UV mutated strain of brevibacterium flavum and its biological evaluation in broiler chicks.

    Science.gov (United States)

    Tabassum, Alia; Hashmi, Abu Saeed; Masood, Faiza; Iqbal, Muhammad Aamir; Tayyab, Muhammad; Nawab, Amber; Nadeem, Asif; Sadeghi, Zahra; Mahmood, Adeel

    2015-07-01

    Lysine executes imperative structural and functional roles in body and its supplementation in diet beneficial to prevent the escalating threat of protein deficiency. The physical mutagenesis offers new fascinating avenues of research for overproduction of lysine through surplus carbohydrate containing agriculture waste especially in developing countries. The current study was aimed to investigate the potential of UV mutated strain of Brevibacterium flavum at 254 nm for lysine production. The physical and nutritional parameters were optimized and maximum lysine production was observed with molasses (4% substrate water ratio). Moreover, supplementation of culture medium with metal cations (i.e. 0.4% CaSO₄, 0.3% NaCl, 0.3% KH₂PO₄, 0.4% MgSO₄, and 0.2% (NH₄) ₂SO₄w/v) together with 0.75% v/v corn steep liquor significantly enhanced the lysine production up to 26.71 ± 0.31 g/L. Though, concentrations of urea, ammonium nitrate and yeast sludge did not exhibit any profound effect on lysine production. Biological evaluation of lysine enriched biomass in terms of weight gain and feed conversion ratio reflected non-significant difference for experimental and control (+ve) groups. Conclusively, lysine produced in the form of biomass was compatible to market lysine in its effectiveness and have potential to utilize at commercial scale.

  20. Microbial synthesis of poly(epsilon-lysine) and its various applications.

    Science.gov (United States)

    Shih, Ing-Lung; Shen, Ming-Haw; Van, Yi-Tsong

    2006-06-01

    This review article deals with the microbial synthesis, physiochemical properties, and potential applications of poly-epsilon-lysine (epsilon-PL), which is a naturally occurring biomaterial that is water soluble, biodegradable, edible and non-toxic toward humans and the environment. The potential applications of epsilon-PL as food preservatives, emulsifying agent, dietary agent, biodegradable fibers, highly water absorbable hydrogels, drug carriers, anticancer agent enhancer, biochip coatings in the fields of food, medicine, agriculture and electronics are also discussed in this review.

  1. Bladder carcinogenesis in rats subjected to ureterosigmoidostomy and treated with L-lysine.

    Science.gov (United States)

    Dornelas, Conceição Aparecida; Santos, Alessandra Marques Dos; Correia, Antonio Lucas Oliveira; Juanes, Camila de Carvalho; Coelho, João Paulo Ferreira; Cunha, Bianca Lopes; Maciel, André Vinicius Vieira; Jamacaru, Francisco Vagnaldo Fechine

    2016-01-01

    to evaluate the effect of L-lysine in the bladder and intestinal epithelia in rats submitted to vesicosigmoidostomy. we divided forty Wistar rats into four groups: group I - control group (Sham); group II - submitted to vesicosigmoidostomy and treated with L-lysine 150mg/kg; group III - submitted only to vesicosigmoidostomy; and group IV - received L-lysine 150mg/kg. After eight weeks the animals were sacrificed. in the bladders of all operated animals we observed simple, papillary and nodular hyperplasia of transitional cells, transitional cell papillomas and squamous metaplasia. As for the occurrence of aberrant crypt foci in the colons of operated animals, we did not observe statistically significant differences in any of the distal, proximal and medium fragments, or in all fragments together (p=1.0000). Although statistically there was no promotion of carcinogenesis in the epithelia of rats treated with L-lysine in the observed time, it was clear the histogenesis of bladder carcinogenesis in its initial phase in all operated rats, this being probably associated with chronic infection and tiny bladder stones. o objetivo deste trabalho é avaliar o efeito da L-lisina nos epitélios vesical e intestinal de ratas submetidas à vesicossigmoidostomia. quarenta ratas Wistar, foram divididas em quatro grupos: grupo I- grupo controle (Sham); grupo II- submetido à vesicossigmoidostomia e tratado com L-lisina 150mg/kg; grupo III- submetido apenas à vesicossigmoidostomia; e grupo IV- recebeu L-lisina 150mg/kg. Após oito semanas os animais foram sacrificados. na bexiga de todos os animais operados observou-se hiperplasia simples, papilar e nodular de células transicionais, papiloma de células transicionais e metaplasia escamosa. Quanto à ocorrência de focos de criptas aberrantes nos colos dos animais operados, não foi evidenciado diferença estatística significante em nenhum dos fragmentos distal, proximal e médio, e todos juntos (P=1,0000). apesar de

  2. One Approach for Dynamic L-lysine Modelling of Repeated Fed-batch Fermentation

    Directory of Open Access Journals (Sweden)

    Kalin Todorov

    2007-03-01

    Full Text Available This article deals with establishment of dynamic unstructured model of variable volume fed-batch fermentation process with intensive droppings for L-lysine production. The presented approach of the investigation includes the following main procedures: description of the process by generalized stoichiometric equations; preliminary data processing and calculation of specific rates for main kinetic variables; identification of the specific rates as a second-order non-linear dynamic models; establishment and optimisation of dynamic model of the process; simulation researches. MATLAB is used as a research environment.

  3. Protein and Carbohydrate Accumulation in Normal and High-Lysine Barley in Spike Culture

    DEFF Research Database (Denmark)

    Mather, D.E; Giese, Nanna Henriette

    1984-01-01

    Spikes of barley cv. Bomi and high-lysine mutants Riso 1508 and Riso 56 were cultured on liquid media at varying N and sucrose levels. Bomi accumulated N in response to increasing N levels in the medium and a higher level was reached than in spikes of intact plants. The distribution of N in salt......-soluble, hordein, and non-protein N fractions appeared to be normal. Endosperm dry weight and starch were lower than in intact plants and declined at higher N levels. A linear relationship was observed between starch content and the concentration of sucrose in the endosperm water. Uptake of culture medium...

  4. A Proteomic Approach to Analyze the Aspirin-mediated Lysine Acetylome*

    OpenAIRE

    Tatham, Michael H.; Cole, Christian; Scullion, Paul; Wilkie, Ross; Westwood, Nicholas J.; Stark, Lesley A.; Hay, Ronald T.

    2016-01-01

    This work is supported by Cancer Research UK Grant C434/A13067 (M.H.T & R.T.H) and Wellcome Trust Grant 098391/Z/12/7 (R.T.H.). Aspirin, or acetylsalicylic acid is widely used to control pain, inflammation and fever. Important to this function is its ability to irreversibly acetylate cyclooxygenases at active site serines. Aspirin has the potential to acetylate other amino-acid side-chains, leading to the possibility that aspirin-mediated lysine acetylation could explain some of its as-yet...

  5. Effect of metabolic inhibitors on 3H-lysine incorporation in the stilbestrol stimulated chick oviduct

    International Nuclear Information System (INIS)

    Goel, V.K.; Joshi, B.C.

    1976-01-01

    Effect of metabolic inhibitors, namely, actinomycin-D and mitomycin-C on 3 H-lysine incorporation in the stilbestrol stimulated chick oviduct has been studied. It was inferred from the study that the action of the metabolic inhibitors used may be dependent on the level of the hormone present or in other words, on the rate at which the protein synthesis is going on in the system. Mitomycin-C has the same effect in this system as actinomycin-D but at a dose level almost 4 times that of the latter. The results are discussed in the light of the findings of other workers. (author)

  6. Design and Application of Synthetic Receptors for Recognition of Methylated Lysine and Supramolecular Affinity Labeling

    Science.gov (United States)

    Gober, Isaiah Nathaniel

    This dissertation involves the design and synthesis of new synthetic receptors and their application in the molecular recognition of methylated lysine and their use as tools for chemical biology. The dissertation is divided into four parts. The first section focuses on the development of a novel labeling method that is based on ligand-directed affinity labeling principles. In this labeling method, a synthetic receptor that binds to trimethyl lysine (Kme3) is attached through a linker to an electrophilic tag group that can react with a nucleophilic amine in a histone peptide. This affinity labeling probe, which we called CX4-ONBD, is equipped with an electrophilic tag that allows for turn-on fluorescence labeling of Kme3 histone peitdes. We show that the probe gives a pronounced turn-on fluorescence response when it is incubated with a histone peptide that contains Kme3 and a nearby reactive lysine. This probe also displays >5-fold selectivity in covalent labeling over an unmethylated lysine peptide. This represents the first time a synthetic receptor has been used for affinity labeling purposes, and it also expands on the chemical toolkit that is available for sensing PTMs like lysine methylation. In the second section, the supramolecular affinity labeling method that was optimized using CX4-ONBD was applied to the development of a real-time assay for measuring enzymatic activity. More specifically, the probe was used to create a turn-on fluorescence assay for histone deacetylase (HDAC) activity and for inhibitor screening and IC50 determination. Most commercial kits for HDAC activity have limited substrate scope, and other common methods used for characterizing enzymatic activity often require chromatographic separation and are therefore not high-throughput. This small molecule receptor-mediated affinity labeling strategy allowed for facile readout of HDAC activity and inhibition. Overall, this application of supramolecular affinity labeling expands on the

  7. Eradication of Burkholderia cepacia Using Inhaled Aztreonam Lysine in Two Patients with Bronchiectasis

    Directory of Open Access Journals (Sweden)

    A. Iglesias

    2014-01-01

    Full Text Available There are not many articles about the chronic bronchial infection/colonization in patients with underlying lung disease other than cystic fibrosis (CF, especially with non-CF bronchiectasis (NCFBQ. The prevalence of B. cepacia complex is not well known in NCFBQ. The vast majority of published clinical data on Burkholderia infection in individuals with CF is comprised of uncontrolled, anecdotal, and/or single center experiences, and no consensus has emerged regarding treatment. We present two cases diagnosed with bronchiectasis (BQ of different etiology, with early pulmonary infection by B. cepacia complex, which was eradicated with inhaled aztreonam lysine.

  8. Effects of lysine clonixinate and ketorolac tromethamine on prostanoid release from various rat organs incubated ex vivo.

    Science.gov (United States)

    Pallapies, D; Salinger, A; Meyer zum Gottesberge, A; Atkins, D J; Rohleder, G; Nagyiványi, P; Peskar, B A

    1995-01-01

    The release of prostanoids from rat brain, gastric mucosa, lungs and kidneys incubated ex vivo has been investigated for up to 5 h after oral administration of 10 mg/kg lysine clonixinate or 1 mg/kg ketorolac tromethamine. Additionally, 60 min after drug administration, a time point of near-maximal inhibition of prostanoid release, the effects of 2.5, 10 and 30 mg/kg lysine clonixinate and of 0.0225, 0.15 and 1 mg/kg ketorolac tromethamine were compared. In all organs investigated both drugs inhibited fatty acid cyclooxygenase (COX) in a dose-dependent manner, but ketorolac tromethamine was more potent and had a longer-lasting effect than lysine clonixinate. While the ID50 values for lysine clonixinate were in the same order of magnitude for all 4 organs investigated, ketorolac tromethamine exhibited some organ selectivity with a particularly high activity in the kidneys. This effect might be related to the renal toxicity of ketorolac tromethamine. On the other hand, the difference in potency was smallest in brain suggesting that inhibition of central prostanoid biosynthesis could contribute to the rapid and effective inhibition of pain by both drugs. IC50 values for inhibition of purified COX-1 and COX-2 in vitro were slightly lower for lysine clonixinate (2.4 and 24.6 micrograms/ml, respectively) than for ketorolac tromethamine (3.7 and 25.6 micrograms/ml, respectively).

  9. Lysine and pipecolic acid and some of their derivatives show anticonvulsant activity, and stimulation of benzodiazepine receptor activity

    International Nuclear Information System (INIS)

    Chang, Yung-Feng; Gao, Xue-Min

    1989-01-01

    Benzodiazepines are one of the most widely prescribed drugs in the treatment of anxiety, epilepsy and muscle tension. The natural products lysine and pipecolic acid known to be present in the animal, plant and microorganism, have been shown to be anticonvulsant against pentetrazol (PTZ)-induced seizures in mice. Methyl and ethyl esters of L-lysine and the N-isopropanol derivative of pipecolic acid appear to increase the anticonvulsant potency of the parent compounds, presumably due to their increase in hydrophobicity. Lysine and pipecolic acid showed significant stimulation of specific [ 3 H]flunitrazepam (FZ) binding to mouse brain membranes. This stimulation was enhanced by chloride ions and stereospecific with L-isomer having higher effect. The dose-dependent anticonvulsant activity of lysine and pipecolic acid, and their stimulation of [ 3 H]FZ binding appear to be correlated. The antiepileptic activity lysine, pipecolic acid and their derivatives therefore may be mediated through the γ-aminobutyric acid-benzodiazepine receptor complex

  10. Irbesartan treatment does not influence plasma levels of the advanced glycation end products N(epsilon)(1-carboxymethyl)lysine and N(epsilon)(1-carboxyethyl)lysine in patients with type 2 diabetes and microalbuminuria. A randomized controlled trial

    DEFF Research Database (Denmark)

    Engelen, Lian; Persson, Frederik; Ferreira, Isabel

    2011-01-01

    to confirm such beneficial effects of ARBs on AGEs are lacking. Therefore, we investigated the effects of irbesartan treatment on plasma levels of the AGEs N(e)(1-carboxymethyl)lysine (CML) and N(e)(1-carboxyethyl)lysine (CEL) in hypertensive patients with type 2 diabetes and microalbuminuria. METHODS: We...... and -0.10 µmol/mol lysine (-0.76 to 0.56) for CEL. CONCLUSIONS: Long-term irbesartan treatment does not influence plasma levels of the AGE CML and CEL in patients with type 2 diabetes and microalbuminuria.......BACKGROUND: In vitro and animal experiments have shown inhibiting effects of angiotensin receptor blockers (ARBs) on the formation of advanced glycation end products (AGEs), which are known to be involved in the development of cardiovascular complications in diabetes. However, sufficient human data...

  11. Induction of monooxygenases and incorporation of radioactivity from 2-14C-lysine into hepatic microsomes of phenobarbital-treated rats fed a diet deficient in lysine, methionine, threonine and vitamine A, C and E

    International Nuclear Information System (INIS)

    Nurmagambetov, T.Zh.; Amirov, B.B.; Kuanysheva, T.K.; Sharmanov, T.Sh.

    1991-01-01

    The effect of diet on induction of monooxygenases and distribution of label from 2- 14 C-lysine in fractions of liver homogenate, muscle homogenate and blood of male rats treated with phenobarbital (80 mg/rg, three days) was studied. 2- 14 C-lysine was injected intraperitoneally 24 h before the first injection of phenobarbital. It was demonstrated that monooxygenase induction, increase of relative liver weight and incorporation of label from 2- 14 C-lysine into fractions of liver homogenate in phenobarbital-treated rats were more pronounced as compared with the similarly trated rats that were fed a balanced diet. The possibility of mobilization of deficient essential components to liver from other organs and tissues for maintenance of monooxygenase induction is discussed

  12. Enumerating actinomycetes in compost bioaerosols at source—Use of soil compost agar to address plate 'masking'

    Science.gov (United States)

    Taha, M. P. M.; Drew, G. H.; Tamer Vestlund, A.; Aldred, D.; Longhurst, P. J.; Pollard, S. J. T.

    Actinomycetes are the dominant bacteria isolated from bioaerosols sampled at composting facilities. Here, a novel method for the isolation of actinomycetes is reported, overcoming masking of conventional agar plates, as well as reducing analysis time and costs. Repeatable and reliable actinomycetes growth was best achieved using a soil compost media at an incubation temperature of 44 °C and 7 days' incubation. The results are of particular value to waste management operators and their advisors undertaking regulatory risk assessments that support environmental approvals for compost facilities.

  13. High internal phase agar hydrogel dispersions in cocoa butter and chocolate as a route towards reducing fat content.

    Science.gov (United States)

    Skelhon, Thomas S; Olsson, Patrik K A; Morgan, Adam R; Bon, Stefan A F

    2013-09-01

    Reducing the fat content of chocolate formulations is a major challenge for the confectionery industry. We report the suspension of aqueous microgel agar particles of up to 80% v/v within sunflower oil, cocoa butter, and ultimately chocolate. The optimised emulsification process involves a shear-cooling step. We demonstrate the versatility of our method when applied to white, milk, and dark chocolate formulations, whilst preserving the desired polymorph V of the cocoa butter matrix. In addition, we show that this technology can be used as a strategy to disperse alcoholic beverages into chocolate confectionery.

  14. A Direct Quantitative Agar-Plate Based Assay for Analysis of Pseudomonas protegens PF-5 Degradation of Polyurethane Films (Postprint)

    Science.gov (United States)

    2014-10-02

    was dissolved in methanol ; Irogran (1 g) was dissolved in 25 mL THF; and AS-P108 was prepared by adding 0.3 g of catalyst to 10 g of resin and then... Selected results are in Supple- mental Information. 3. Results 3.1. General growth characteristics of Pf-5 on M9/citrate agar plates Dilutions of P...minimal. An IR map with the color scale corresponding to the in- tensity of the 1735 cm1 carbonyl absorbance from the urethane and ester components is

  15. Proteome-wide mapping of the Drosophila acetylome demonstrates a high degree of conservation of lysine acetylation

    DEFF Research Database (Denmark)

    Weinert, Brian T; Wagner, Sebastian A; Horn, Heiko

    2011-01-01

    Posttranslational modification of proteins by acetylation and phosphorylation regulates most cellular processes in living organisms. Surprisingly, the evolutionary conservation of phosphorylated serine and threonine residues is only marginally higher than that of unmodified serines and threonines....... With high-resolution mass spectrometry, we identified 1981 lysine acetylation sites in the proteome of Drosophila melanogaster. We used data sets of experimentally identified acetylation and phosphorylation sites in Drosophila and humans to analyze the evolutionary conservation of these modification sites...... between flies and humans. Site-level conservation analysis revealed that acetylation sites are highly conserved, significantly more so than phosphorylation sites. Furthermore, comparison of lysine conservation in Drosophila and humans with that in nematodes and zebrafish revealed that acetylated lysines...

  16. Synthesis of aldehyde-linked nucleotides and DNA and their bioconjugations with lysine and peptides through reductive amination.

    Science.gov (United States)

    Raindlová, Veronika; Pohl, Radek; Hocek, Michal

    2012-03-26

    5-(5-Formylthienyl)-, 5-(4-formylphenyl)- and 5-(2-fluoro-5-formylphenyl)cytosine 2'-deoxyribonucleoside mono- (dC(R)MP) and triphosphates (dC(R)TP) were prepared by aqueous Suzuki-Miyaura cross-coupling of 5-iodocytosine nucleotides with the corresponding formylarylboronic acids. The dC(R)TPs were excellent substrates for DNA polymerases and were incorporated into DNA by primer extension or PCR. Reductive aminations of the model dC(R)MPs with lysine or lysine-containing tripeptide were studied and optimized. In aqueous phosphate buffer (pH 6.7) the yields of the reductive aminations with tripeptide III were up to 25 %. Bioconjugation of an aldehyde-containing DNA with a lysine-containing tripeptide was achieved through reductive amination in yields of up to 90 % in aqueous phosphate buffer. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. The structure, vibrational spectra and nonlinear optical properties of the L-lysine × tartaric acid complex—Theoretical studies

    Science.gov (United States)

    Drozd, M.; Marchewka, M. K.

    2006-05-01

    The room temperature X-ray studies of L-lysine × tartaric acid complex are not unambiguous. The disorder of three atoms of carbon in L-lysine molecule is observed. These X-ray studies are ambiguous. The theoretical geometry study performed by DFT methods explain the most doubts which are connected with crystallographic measurements. The theoretical vibrational frequencies and potential energy distribution (PED) of L-lysine × tartaric acid were calculated by B3LYP method. The calculated frequencies were compared with experimental measured IR spectra. The complete assignment of the bands has been made on the basis of the calculated PED. The restricted Hartee-Fock (RHF) methods were used for calculation of the hyperpolarizability for investigated compound. The theoretical results are compared with experimental value of β.

  18. Removal U(VI) from artificial seawater using facilely and covalently grafted polyacrylonitrile fibers with lysine

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wenting; Liu, Qi; Liu, Jingyuan; Zhang, Hongsen; Li, Rumin; Li, Zhanshuang; Jing, Xiaoyan [Key Laboratory of Superlight Material and Surface Technology, Ministry of Education, Harbin Engineering University, Harbin 150001 (China); Wang, Jun, E-mail: zhqw1888@sohu.com [Key Laboratory of Superlight Material and Surface Technology, Ministry of Education, Harbin Engineering University, Harbin 150001 (China); Institute of Advanced Marine Materials, Harbin Engineering University, 150001 (China)

    2017-05-01

    Highlights: • Novel lysine modified fibrous adsorbents were prepared using a facile and green method. • PAN-Lys exhibited high adsorption activity and fast adsorption rate. • PAN-Lys significantly remove U(VI) from simulated seawater. - Abstract: Polyacrylonitrile fibers (PANF) covalently modified with lysine (PAN-Lys) was facilely synthesized and carefully characterized. The critical factors affecting U(VI) adsorption from aqueous solution were exploited, such as initial pH, contact time, concentration and temperature. The adsorption process is strongly dependent on solution pH. With excellent adsorption capacity and high affinity toward U(VI), the process for U(VI) is extremely rapid and the equilibrium can be reached within 20 min. The thermodynamics and kinetics were strictly evaluated. In addition, the hypothetical adsorption mechanisms were proposed. Moreover, the adsorption behavior at low concentrations (3–30 μg L{sup −1}) in simulated seawater was also investigated. Therefore, PAN-Lys can be potentially utilized for the efficient removal of U(VI) from seawater.

  19. The lysine acetyltransferase activator Brpf1 governs dentate gyrus development through neural stem cells and progenitors.

    Directory of Open Access Journals (Sweden)

    Linya You

    2015-03-01

    Full Text Available Lysine acetylation has recently emerged as an important post-translational modification in diverse organisms, but relatively little is known about its roles in mammalian development and stem cells. Bromodomain- and PHD finger-containing protein 1 (BRPF1 is a multidomain histone binder and a master activator of three lysine acetyltransferases, MOZ, MORF and HBO1, which are also known as KAT6A, KAT6B and KAT7, respectively. While the MOZ and MORF genes are rearranged in leukemia, the MORF gene is also mutated in prostate and other cancers and in four genetic disorders with intellectual disability. Here we show that forebrain-specific inactivation of the mouse Brpf1 gene causes hypoplasia in the dentate gyrus, including underdevelopment of the suprapyramidal blade and complete loss of the infrapyramidal blade. We trace the developmental origin to compromised Sox2+ neural stem cells and Tbr2+ intermediate neuronal progenitors. We further demonstrate that Brpf1 loss deregulates neuronal migration, cell cycle progression and transcriptional control, thereby causing abnormal morphogenesis of the hippocampus. These results link histone binding and acetylation control to hippocampus development and identify an important epigenetic regulator for patterning the dentate gyrus, a brain structure critical for learning, memory and adult neurogenesis.

  20. Targeting lysine specific demethylase 4A (KDM4A) tandem TUDOR domain - A fragment based approach.

    Science.gov (United States)

    Upadhyay, Anup K; Judge, Russell A; Li, Leiming; Pithawalla, Ron; Simanis, Justin; Bodelle, Pierre M; Marin, Violeta L; Henry, Rodger F; Petros, Andrew M; Sun, Chaohong

    2018-06-01

    The tandem TUDOR domains present in the non-catalytic C-terminal half of the KDM4A, 4B and 4C enzymes play important roles in regulating their chromatin localizations and substrate specificities. They achieve this regulatory role by binding to different tri-methylated lysine residues on histone H3 (H3-K4me3, H3-K23me3) and histone H4 (H4-K20me3) depending upon the specific chromatin environment. In this work, we have used a 2D-NMR based fragment screening approach to identify a novel fragment (1a), which binds to the KDM4A-TUDOR domain and shows modest competition with H3-K4me3 binding in biochemical as well as in vitro cell based assays. A co-crystal structure of KDM4A TUDOR domain in complex with 1a shows that the fragment binds stereo-specifically to the methyl lysine binding pocket forming a network of strong hydrogen bonds and hydrophobic interactions. We anticipate that the fragment 1a can be further developed into a novel allosteric inhibitor of the KDM4 family of enzymes through targeting their C-terminal tandem TUDOR domain. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Effect of Nitrogen Fertilizers on the Lysine Synthesis in Silo-Maize

    Energy Technology Data Exchange (ETDEWEB)

    Cencelj, J.; Jelenic, Dj. [Institute for the Application of Nuclear Energy in Agriculture, Veterinary Medicine and Forestry, Belgrade, Yugoslavia (Serbia)

    1968-07-01

    In investigations on amino acids of silo-maize, different nitrogen fertilizers were studied to determine their effect on amino acid composition and variation during the growth period. The experiment was carried out with silo-maize, hybrid W 464A, grown on sandy soil, which had not been treated for six years with either fertilizers or manure. Before cultivation phosphorus and potassium fertilizers were applied, and the nitrogen fertilizers, ammonium sulphate, ammonium nitrate, calcium cyanamide and urea, were applied at the most appropriate time of application. The first samples were taken at the time of flowering, the second after flowering, and the third, fourth and fifth in the lactic, wax, and full maturity phases, respectively. The percentages of crude protein of the maize gradually decreased while the nitrogen-free extraction matter increased during this period. The protein content of the maize was highest with sodium nitrate and urea fertilization and lowest when calcium cyanamide was used. Investigations to determine whether or not an increase in crude protein content was correlated with an increased content of lysine have shown that there is a correlation when plants are fertilized with calcium cyanamide. The content of essential amino acids was more satisfactory in plants fertilized with urea than with sodium nitrate. According to the statistical analysis, the best improvement in lysine content was obtained with urea (0.23%), the least satisfactory with calcium cyanamide (0.17%), and PK fertilizers without nitrogen (0.15%). (author)

  2. Crystallization and degradation behaviors of poly(butylene succinate)/poly(Z-L-lysine) composites

    International Nuclear Information System (INIS)

    Tan, Licheng; Hu, Jun; Ye, Suwen; Wei, Junchao; Chen, Yiwang

    2014-01-01

    Highlights: • A new biodegradable poly(butylene succinate) (PBS)/poly(Z-L-lysine) (PZlys) composites were successfully prepared through physical blend. • PZlys may greatly affected the crystallization behaviors of PBS without changing its crystalline structure. • The degradation speed of PBS may be greatly accelerated by introduction of PZlys in PBS matrix. - Abstract: A new type of biodegradable poly(butylene succinate) (PBS)/poly(Z-L-lysine) (PZlys) composites were prepared. The crystallization behaviors were investigated by differential scanning calorimetry (DSC), wide angle X-ray diffraction (WAXD) and polarizing optical microscopy (POM) and the results showed that PZlys can restrict the crystallization of PBS, the crystallization speed of PBS/PZlys were slower than that of PBS, and the crystallization degree of the composites were smaller than that of PBS. However, the WAXD results showed that the incorporation of PZlys did not change the crystalline structure of PBS. The in vitro degradation experiments demonstrated that the degradation speed of the composites were faster than that of PBS. Moreover, the mechanical properties of the composites showed that the composites with a proper composition (for example, 80/20) can keep the mechanical properties of PBS without evident difference, which implied that the composites might be potentially useful as biodegradable materials

  3. Excited-State Dynamics of Melamine and Its Lysine Derivative Investigated by Femtosecond Transient Absorption Spectroscopy

    Directory of Open Access Journals (Sweden)

    Yuyuan Zhang

    2016-11-01

    Full Text Available Melamine may have been an important prebiotic information carrier, but its excited-state dynamics, which determine its stability under UV radiation, have never been characterized. The ability of melamine to withstand the strong UV radiation present on the surface of the early Earth is likely to have affected its abundance in the primordial soup. Here, we studied the excited-state dynamics of melamine (a proto-nucleobase and its lysine derivative (a proto-nucleoside using the transient absorption technique with a UV pump, and UV and infrared probe pulses. For melamine, the excited-state population decays by internal conversion with a lifetime of 13 ps without coupling significantly to any photochemical channels. The excited-state lifetime of the lysine derivative is slightly longer (18 ps, but the dominant deactivation pathway is otherwise the same as for melamine. In both cases, the vast majority of excited molecules return to the electronic ground state on the aforementioned time scales, but a minor population is trapped in a long-lived triplet state.

  4. Soft-sensing Modeling Based on MLS-SVM Inversion for L-lysine Fermentation Processes

    Directory of Open Access Journals (Sweden)

    Bo Wang

    2015-06-01

    Full Text Available A modeling approach 63 based on multiple output variables least squares support vector machine (MLS-SVM inversion is presented by a combination of inverse system and support vector machine theory. Firstly, a dynamic system model is developed based on material balance relation of a fed-batch fermentation process, with which it is analyzed whether an inverse system exists or not, and into which characteristic information of a fermentation process is introduced to set up an extended inversion model. Secondly, an initial extended inversion model is developed off-line by the use of the fitting capacity of MLS-SVM; on-line correction is made by the use of a differential evolution (DE algorithm on the basis of deviation information. Finally, a combined pseudo-linear system is formed by means of a serial connection of a corrected extended inversion model behind the L-lysine fermentation processes; thereby crucial biochemical parameters of a fermentation process could be predicted on-line. The simulation experiment shows that this soft-sensing modeling method features very high prediction precision and can predict crucial biochemical parameters of L-lysine fermentation process very well.

  5. Structural basis for G9a-like protein lysine methyltransferase inhibition by BIX-01294

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Yanqi; Zhang, Xing; Horton, John R.; Upadhyay, Anup K.; Spannhoff, Astrid; Liu, Jin; Synder, James P.; Bedford, Mark T.; Cheng, Xiaodong; (Emory-MED); (Emory); (Texas)

    2009-03-26

    Histone lysine methylation is an important epigenetic mark that regulates gene expression and chromatin organization. G9a and G9a-like protein (GLP) are euchromatin-associated methyltransferases that repress transcription by methylating histone H3 Lys9. BIX-01294 was originally identified as a G9a inhibitor during a chemical library screen of small molecules and has previously been used in the generation of induced pluripotent stem cells. Here we present the crystal structure of the catalytic SET domain of GLP in complex with BIX-01294 and S-adenosyl-L-homocysteine. The inhibitor is bound in the substrate peptide groove at the location where the histone H3 residues N-terminal to the target lysine lie in the previously solved structure of the complex with histone peptide. The inhibitor resembles the bound conformation of histone H3 Lys4 to Arg8, and is positioned in place by residues specific for G9a and GLP through specific interactions.

  6. Identification and Characterization of a Novel Human Methyltransferase Modulating Hsp70 Protein Function through Lysine Methylation*

    Science.gov (United States)

    Jakobsson, Magnus E.; Moen, Anders; Bousset, Luc; Egge-Jacobsen, Wolfgang; Kernstock, Stefan; Melki, Ronald; Falnes, Pål Ø.

    2013-01-01

    Hsp70 proteins constitute an evolutionarily conserved protein family of ATP-dependent molecular chaperones involved in a wide range of biological processes. Mammalian Hsp70 proteins are subject to various post-translational modifications, including methylation, but for most of these, a functional role has not been attributed. In this study, we identified the methyltransferase METTL21A as the enzyme responsible for trimethylation of a conserved lysine residue found in several human Hsp70 (HSPA) proteins. This enzyme, denoted by us as HSPA lysine (K) methyltransferase (HSPA-KMT), was found to catalyze trimethylation of various Hsp70 family members both in vitro and in vivo, and the reaction was stimulated by ATP. Furthermore, we show that HSPA-KMT exclusively methylates 70-kDa proteins in mammalian protein extracts, demonstrating that it is a highly specific enzyme. Finally, we show that trimethylation of HSPA8 (Hsc70) has functional consequences, as it alters the affinity of the chaperone for both the monomeric and fibrillar forms of the Parkinson disease-associated protein α-synuclein. PMID:23921388

  7. The Helicase Activity of Hyperthermophilic Archaeal MCM is Enhanced at High Temperatures by Lysine Methylation.

    Science.gov (United States)

    Xia, Yisui; Niu, Yanling; Cui, Jiamin; Fu, Yang; Chen, Xiaojiang S; Lou, Huiqiang; Cao, Qinhong

    2015-01-01

    Lysine methylation and methyltransferases are widespread in the third domain of life, archaea. Nevertheless, the effects of methylation on archaeal proteins wait to be defined. Here, we report that recombinant sisMCM, an archaeal homolog of Mcm2-7 eukaryotic replicative helicase, is methylated by aKMT4 in vitro. Mono-methylation of these lysine residues occurs coincidently in the endogenous sisMCM protein purified from the hyperthermophilic Sulfolobus islandicus cells as indicated by mass spectra. The helicase activity of mini-chromosome maintenance (MCM) is stimulated by methylation, particularly at temperatures over 70°C. The methylated MCM shows optimal DNA unwinding activity after heat-treatment between 76 and 82°C, which correlates well with the typical growth temperatures of hyperthermophilic Sulfolobus. After methylation, the half life of MCM helicase is dramatically extended at 80°C. The methylated sites are located on the accessible protein surface, which might modulate the intra- and inter- molecular interactions through changing the hydrophobicity and surface charge. Furthermore, the methylation-mimic mutants of MCM show heat resistance helicase activity comparable to the methylated MCM. These data provide the biochemical evidence that posttranslational modifications such as methylation may enhance kinetic stability of proteins under the elevated growth temperatures of hyperthermophilic archaea.

  8. Crystallization and preliminary X-ray analysis of the inducible lysine decarboxylase from Escherichia coli

    International Nuclear Information System (INIS)

    Alexopoulos, Eftichia; Kanjee, Usheer; Snider, Jamie; Houry, Walid A.; Pai, Emil F.

    2008-01-01

    The structure of the decameric inducible lysine decarboxylase from E. coli was determined by SIRAS using a hexatantalum dodecabromide (Ta 6 Br 12 2+ ) derivative. Model building and refinement are under way. The decameric inducible lysine decarboxylase (LdcI) from Escherichia coli has been crystallized in space groups C2 and C222 1 ; the Ta 6 Br 12 2+ cluster was used to derivatize the C2 crystals. The method of single isomorphous replacement with anomalous scattering (SIRAS) as implemented in SHELXD was used to solve the Ta 6 Br 12 2+ -derivatized structure to 5 Å resolution. Many of the Ta 6 Br 12 2+ -binding sites had twofold and fivefold noncrystallographic symmetry. Taking advantage of this feature, phase modification was performed in DM. The electron-density map of LdcI displays many features in agreement with the low-resolution negative-stain electron-density map [Snider et al. (2006 ▶), J. Biol. Chem.281, 1532–1546

  9. Low cytotoxic tissue adhesive based on oxidized dextran and epsilon-poly-L-lysine.

    Science.gov (United States)

    Hyon, Suong-Hyu; Nakajima, Naoki; Sugai, Hajime; Matsumura, Kazuaki

    2014-08-01

    A novel adhesive hydrogel consisting of dextran and epsilon-poly(L-lysine) (dextran-PL) with multiple biomedical applications was developed. Periodate oxidation in aqueous media almost stoichiometrically introduces aldehyde groups in dextran molecules, and aldehyde dextran can react with the primary amino groups in epsilon-PL (ɛ-PL) at neutral pH to form a hydrogel. The gelation time of the hydrogel can be easily controlled by the extent of oxidation in dextran and of the acylation in ɛ-PL by anhydrides. The shear adhesion strength of dextran-PL was 10 times higher than that of fibrin glue, when wet collagen sheets were selected as test specimens. The cytotoxicity of aldehyde dextran and ɛ-PL were 1000 times lower than that of glutaraldehyde and poly(allylamine). The considerably low cytotoxicity of aldehyde dextran could be ascribed to its low reactivity with amine species when compared with glutaraldehyde. In contrast, a high reactivity of amino groups in ɛ-PL was observed when compared with glycine, L-lysine, and gelatin, which could be explained by their poor dissociation at neutral pH, thus leading to low cytotoxicity. © 2013 Wiley Periodicals, Inc.

  10. Acetanilide and bromoacetyl-lysine derivatives as activators for human histone deacetylase 8.

    Science.gov (United States)

    Mukhtar, Yusif M; Huang, Yajun; Liu, Jiajia; Chen, Di; Zheng, Weiping

    2017-06-01

    In the current study, seven compounds (i.e. 1-7) were found to be novel activators for the N ε -acetyl-lysine deacetylation reaction catalyzed by human histone deacetylase 8 (HDAC8). When assessed with the commercially available HDAC8 peptide substrate Fluor-de-Lys®-HDAC8 that harbors the unnatural 7-amino-4-methylcoumarin (AMC) residue immediately C-terminal to the N ε -acetyl-lysine residue to be deacetylated, our compounds exhibited comparable activation potency to that of TM-2-51, the strongest HDAC8 activator reported in the current literature. However, when assessed with an AMC-less peptide substrate derived from the native HDAC8 non-histone substrate protein Zinc finger protein ZNF318, while our compounds were all found to be able to activate HDAC8 deacetylation reaction, TM-2-51 was found not to be able to. Our compounds also seemed to be largely selective for HDAC8 over other classical HDACs. Moreover, treatment with the strongest activator among our compounds (i.e. 7) was found to decrease the K M of the above AMC-less HDAC8 substrate, while nearly maintaining the k cat of the HDAC8-catalyzed deacetylation on this substrate. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Lysine requirement of White Leghorn pullets from 8 to 21 weeks of age.

    Science.gov (United States)

    Berg, L R

    1976-01-01

    White Leghorn pullets were fed rations in which the protein supplementary to that provided by the grain portion of the ration was derived from soybean meal, meat and bone meal, anchovy fish meal or cottonseed meal from 8 to 21 weeks of age. Protein levels were varied so that each protein supplement was tested in a feeding program in which pullets received 16% protein diets from 8 to 14 weeks and 14% protein from 14 to 21 weeks and in another feeding program in which 14% protein was fed from 8 to 14 weeks and 12% protein from 14 to 21 weeks. Each of the developing rations contained sufficient nutrient to enable pullets to develop and attain high rate of laying performance. The 14% and 12% protein cottonseed meal diets contained only 0.50% and 0.45% lysine respectively. Thus the lysine requirement of White Leghorn pullets from 8 to 14 weeks and from 14 to 21 weeks is not over 0.50% and 0.45% respectively.

  12. Dynamic regulation of six histone H3 lysine (K) methyltransferases in response to prolonged anoxia exposure in a freshwater turtle.

    Science.gov (United States)

    Wijenayake, Sanoji; Hawkins, Liam J; Storey, Kenneth B

    2018-04-05

    The importance of histone lysine methylation is well established in health, disease, early development, aging, and cancer. However, the potential role of histone H3 methylation in regulating gene expression in response to extended periods of oxygen deprivation (anoxia) in a natural, anoxia-tolerant model system is underexplored. Red-eared sliders (Trachemys scripta elegans) can tolerate and survive three months of absolute anoxia and recover without incurring detrimental cellular damage, mainly by reducing the overall metabolic rate by 90% when compared to normoxia. Stringent regulation of gene expression is a vital aspect of metabolic rate depression in red-eared sliders, and as such we examined the anoxia-responsive regulation of histone lysine methylation in the liver during 5 h and 20 h anoxia exposure. Interestingly, this is the first study to illustrate the existence of histone lysine methyltransferases (HKMTs) and corresponding histone H3 lysine methylation levels in the liver of anoxia-tolerant red-eared sliders. In brief, H3K4me1, a histone mark associated with active transcription, and two corresponding histone lysine methyltransferases that modify H3K4me1 site, significantly increased in response to anoxia. On the contrary, H3K27me1, another transcriptionally active histone mark, significantly decreased during 20 h anoxia, and a transcriptionally repressive histone mark, H3K9me3, and the corresponding KMTs, similarly increased during 20 h anoxia. Overall, the results suggest a dynamic regulation of histone H3 lysine methylation in the liver of red-eared sliders that could theoretically aid in the selective upregulation of genes that are necessary for anoxia survival, while globally suppressing others to conserve energy. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Ex-vivo absorption study of lysine R-lipoate salt, a new pharmaceutical form of R-ALA.

    Science.gov (United States)

    Amenta, Francesco; Buccioni, Michela; Ben, Diego Dal; Lambertucci, Catia; Navia, Aleix Martí; Ngouadjeu Ngnintedem, Michael A; Ricciutelli, Massimo; Spinaci, Andrea; Volpini, Rosaria; Marucci, Gabriella

    2018-06-15

    Alpha-lipoic acid (ALA) oral supplements were used in many pathologies associated with increased oxidative stress. Although only R-ALA is considered the biologically active form, R,S-ALA is used in therapeutic applications even showing poor water solubility. The aim of this work was to study the absorption and transport mechanism across the intestinal barrier of new R-ALA stable and water soluble form, consisting in the lysine R-ALA salt, in presence and absence of specific inhibitors of Na + /multivitamin (SMVT) and monocarboxylic acids (MCT). The absorption of a new ALA form was investigated at rat everted sacs in comparison with R-ALA, S-ALA, and R,S-ALA. Results showed that duodenum is the best portion of intestine for ALA forms absorption. The absorption percentage of R-ALA, S-ALA, R,S-ALA, and lysine R-ALA salt was 66%, 43%, 55%, and 70%, respectively. The modest effect of the SMVT inhibitor biotin demonstrated that this transporter system is not principally involved in the absorption of lysine R-lipoate salt across the rat intestinal barrier. On the contrary, the MCT inhibitor octanoic acid significantly reduced the transport of this salt, whit an absorption decrease of R-ALA and lysine R-lipoate salt of 28% and 24%, respectively. Since the highest concentration of these inhibitors did not completely inhibit the absorption of lysine R-lipoate salt, other transport mechanisms probably operate for its intracellular delivery. The new form of ALA, lysine R-lipoate salt, was the most absorbed respect to the other ALA forms demonstrating that this compound is more suitable for oral administration. This new salt could represent a promising candidate for ALA oral supplementation. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Fluconazole-containing agar Sabouraud dextrose plates are not useful when screening for susceptibility in Candida albicans.

    Science.gov (United States)

    Bordallo-Cardona, M A; Marcos-Zambrano, L J; Gómez G de la Pedrosa, E; Escribano, P; Bouza, E; Guinea, J; Cantón, R

    2017-04-01

    Fluconazole is an alternative for candidemic patients who are not critically ill. Fluconazole is mainly fungistatic and does not completely inhibit visual Candida albicans growth. We studied the usefulness of fluconazole-containing Sabouraud dextrose agar plates for detecting susceptibility to fluconazole in C. albicans. Adjusted inocula of 19 isolates were transferred directly onto fluconazole-containing Sabouraud dextrose plates (concentrations ranging from 0.125 mg/L to 128 mg/L). The fluconazole MIC in fresh isolates and after growth on the fluconazole-containing plate at 128 mg/L was recorded following the EUCAST EDef 7.2 guidelines. Then isolates were classified according to their degree of trailing production, based on microdilution procedure. All isolates were able to grow on all fluconazole-containing plates, even those isolates susceptible to fluconazole. In fact, we selected isolates with different degrees of trailing based on microdilution procedures. 50% of isolates classified as heavy trailers, 35.71% as moderate trailers, and 14.28% as slight trailers. The use of fluconazole-containing Sabouraud dextrose agar plates was not a reliable method to detect fluconazole susceptibility in C. albicans isolates; growth of the isolates was a trailing effect rather than true resistance.

  15. In vitro fermentation and prebiotic potential of novel low molecular weight polysaccharides derived from agar and alginate seaweeds.

    Science.gov (United States)

    Ramnani, Priya; Chitarrari, Roberto; Tuohy, Kieran; Grant, John; Hotchkiss, Sarah; Philp, Kevin; Campbell, Ross; Gill, Chris; Rowland, Ian

    2012-02-01

    Fermentation properties and prebiotic potential of novel low molecular weight polysaccharides (LMWPs) derived from agar and alginate bearing seaweeds was investigated. Ten LMWPs were supplemented to pH, temperature controlled anaerobic batch cultures inoculated with human feces from three donors, in triplicate. Microbiota changes were monitored using Fluorescent in-situ hybridization and short chain fatty acids, the fermentation end products were analysed using gas chromatography. Of the ten LMWPs tested, Gelidium seaweed CC2253 of molecular weight 64.64 KDa showed a significant increase in bifidobacterial populations from log(10) 8.06 at 0 h to log(10) 8.55 at 24 h (p = 0.018). For total bacterial populations, alginate powder CC2238 produced a significant increase from log(10) 9.01 at 0 h to log(10) 9.58 at 24 h (p = 0.032). No changes were observed in the other bacterial groups tested viz. Bacteroides, Lactobacilli/Enterococci, Eubacterium rectale/Clostridium coccoides and Clostridium histolyticum. The polysaccharides also showed significant increases in total SCFA production, particularly acetic and propionic acids, indicating that they were readily fermented. In conclusion, some LMWPs derived from agar and alginate bearing seaweeds were fermented by gut bacteria and exhibited potential to be used a novel source of prebiotics. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Determination of in vitro synergy for dual antimicrobial therapy against resistant Neisseria gonorrhoeae using Etest and agar dilution.

    Science.gov (United States)

    Wind, Carolien M; de Vries, Henry J C; van Dam, Alje P

    2015-03-01

    In response to antimicrobial resistance of Neisseria gonorrhoeae to last-resort extended-spectrum cephalosporins, combination therapy of azithromycin+ceftriaxone is now recommended. Dual therapy can be effective to treat monoresistant strains as well as multidrug-resistant strains, preferably employing the effect of in vitro synergy. As reports on in vitro synergy of azithromycin+ceftriaxone in N. gonorrhoeae are conflicting, in this study an evaluation of this combination was performed using a cross-wise Etest method and agar dilution. Synergy was defined as a fractional inhibitory concentration index (FICI) of ≤0.5. To identify other dual treatment options for gonorrhoea, in vitro synergy was evaluated for 65 dual antimicrobial combinations using Etest. Azithromycin, cefixime, ceftriaxone, colistin, ertapenem, fosfomycin, gentamicin, minocycline, moxifloxacin, rifampicin, spectinomycin and tigecycline were screened for synergy in all possible combinations. No synergy or antagonism was found for any of the 65 combinations. The geometric mean FICI ranged from 0.82 to 2.00. The mean FICI of azithromycin+ceftriaxone was 1.18 (Etest) and 0.55 (agar dilution). The difference between both methods did not result in a difference in interpretation of synergy. Ceftriaxone-resistant strain F89 was tested in all combinations and no synergy was found for any of them. Most importantly, the ceftriaxone minimum inhibitory concentration of F89 was not decreased below the breakpoint with any concentration of azithromycin. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  17. Sirtuin1-regulated lysine acetylation of p66Shc governs diabetes-induced vascular oxidative stress and endothelial dysfunction

    OpenAIRE

    Kumar, Santosh; Kim, Young-Rae; Vikram, Ajit; Naqvi, Asma; Li, Qiuxia; Kassan, Modar; Kumar, Vikas; Bachschmid, Markus M.; Jacobs, Julia S.; Kumar, Ajay; Irani, Kaikobad

    2017-01-01

    Many oxidative stimuli engage the 66-kDa Src homology 2 domain-containing protein (p66Shc) to induce reactive oxygen species (ROS). ROS regulated by p66Shc promotes aging and contributes to cancer, diabetes, obesity, cardiomyopathy, and atherosclerosis. Here we identify a fundamental mechanism that controls p66Shc and p66Shc-regulated ROS. We show that p66Shc is lysine acetylated when cells are faced with an oxidative stimulus (diabetes), and lysine acetylation of p66Shc is obligatory for p66...

  18. Piezoelectric and pyroelectric properties of DL-alanine and L-lysine amino-acid polymer nanofibres

    Science.gov (United States)

    de Matos Gomes, Etelvina; Viseu, Teresa; Belsley, Michael; Almeida, Bernardo; Costa, Maria Margarida R.; Rodrigues, Vitor H.; Isakov, Dmitry

    2018-04-01

    The piezoelectric and pyroelectric properties of electrospun polyethylene oxide nanofibres embedded with polar amino acids DL-alanine and L-lysine hemihydrate are reported. A high pyroelectric coefficient of 150 μC m‑2 K‑1 was measured for L-lysine hemihydrate and piezoelectric current densities up to 7 μA m‑2 were obtained for the nanofibres. The study reveals a potential for polymer amino-acid nanofibres to be used as biocompatible energy harvesters for autonomous circuit applications like in implantable electronics.

  19. L-lysine-L-tartaric acid: New molecular complex with nonlinear optical properties. Structure, vibrational spectra and phase transitions

    International Nuclear Information System (INIS)

    Debrus, S.; Marchewka, M.K.; Baran, J.; Drozd, M.; Czopnik, R.; Pietraszko, A.; Ratajczak, H.

    2005-01-01

    The first X-ray diffraction and vibrational spectroscopic analysis of a novel complex between L-lysine and L-tartaric acid is reported. The structure was solved in two temperatures (320 and 260 K) showing incommensurate phase between them. Room-temperature powder infrared and Raman measurements for the L-lysine-L-tartaric acid molecular complex (1:1) were carried out. DSC measurements on powder samples indicate two phase transitions points at about 295, 300 and 293, 300 K, for heating and cooling, respectively, with noticeable temperature interval between them. Second harmonic generation efficiency d eff =0.35 d eff (KDP)

  20. Fermented liquid feed - Feed processing has a big impact on microbial degradation of free lysine during fermentation

    DEFF Research Database (Denmark)

    Canibe, Nuria; Jensen, Bent Borg

    2010-01-01

    In order to investigate the influence of feed processing on the microbial degradation of free lysine during fermentation of liquid feed, a study at laboratory scale was carried out. Based on a standard Danish grower diet with extra free amino acids added, two treatments were prepared: treatment 1...... a few hours of fermentation, the levels in both treatments became similar. The concentration of acetic acid was higher in the mixture containing the mash feed than in that containing the pelleted feed. The disappearance of free lysine was much higher when mash feed was fermented than when the same...