WorldWideScience

Sample records for lymnaea acuminata electronic

  1. Behavioural responses of the snail Lymnaea acuminata to carbohydrates in snail-attractant pellets

    Science.gov (United States)

    Tiwari, Farindra; Singh, D. K.

    Snail control is one of the most important tools in the campaign to reduce the incidence of fascioliasis. In order to attain this objective, the method of bait formulation in order to contain an attractant and a molluscicide is an expedient approach to lure the target snail population to the molluscicide. This study identifies certain carbohydrates, namely sucrose, maltose, glucose, fructose and starch, for preparing such baits. These were tested on Lymnaea acuminata, an intermediate host of the digenean trematodes Fasciola hepatica and Fasciola gigantica. The behavioural responses of snails to these carbohydrates were examined. Significant variations in behavioural responses were observed in the snail even when the five carbohydrates were used in low concentrations in snail-attractant pellets. Starch emerged as the strongest attractant for Lymnaea acuminata, followed by maltose.

  2. Enzyme Inhibition by Molluscicidal Components of Myristica fragrans Houtt. in the Nervous Tissue of Snail Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Preetee Jaiswal

    2010-01-01

    Full Text Available This study was designed to investigate the effects of molluscicidal components of Myristica fragrans Houtt. (Myristicaceae on certain enzymes in the nervous tissue of freshwater snail Lymnaea acuminata Lamarck (Lymnaeidae. In vivo and in vitro treatments of trimyristin and myristicin (active molluscicidal components of Myristica fragrans Houtt. significantly inhibited the acetylcholinesterase (AChE, acid and alkaline phosphatase (ACP/ALP activities in the nervous tissue of Lymnaea acuminata. The inhibition kinetics of these enzymes indicates that both the trimyristin and myristicin caused competitive noncompetitive inhibition of AChE. Trimyristin caused uncompetitive and competitive/noncompetitive inhibitions of ACP and ALP, respectively whereas the myristicin caused competitive and uncompetitive inhibition of ACP and ALP, respectively. Thus results from the present study suggest that inhibition of AChE, ACP, and ALP by trimyristin and myristicin in the snail Lymnaea acuminata may be the cause of the molluscicidal activity of Myristica fragrans.

  3. Toxicity of Bauhinia variegata and Mimusops elengi with plant molluscicides against Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Kanchan Lata Singh

    2012-01-01

    Full Text Available Molluscicidal activity of binary combination of Bauhinia variegata and Mimusops elengi with other plant molluscicides Saraca asoca and Thuja orientalis against snail Lymnaea acuminata have been studied. It was observed that toxicity of binary combinations of plant molluscicides with other plant molluscicides were toxic against fresh water snail L. acuminata. Among all combinations of toxicity Mimusops elengi leaf + Saraca asoca bark (24h LC50: 98.25 mg/l; 96h LC50: 40.40 mg/l and Bauhinia variegata leaf powder + Saraca asoca leaf (24h LC50: 123.98 mg/l; 96h LC50: 57.91 mg/l was more toxic than other binary combinations of plant molluscicides. Mimusops elengi leaf powder + Saraca asoca leaf powder and Bauhinia variegata leaf powder + Saraca asoca leaf powder are more potent molluscicides.

  4. Behavioural responses of the snail Lymnaea acuminata to carbohydrates and amino acids in bait pellets.

    Science.gov (United States)

    Agrahari, P; Singh, D K

    2010-12-01

    Snail control could play an important role in programmes against fascioliasis, especially if the methods used for molluscicide delivery could be improved, such as by the development of bait formulations containing both an effective attractant and a molluscicide, to ensure good levels of contact between the molluscicide and the target snail populations. In a recent study, the attractiveness to Lymnaea acuminata (an intermediate host of the digenean trematode Fasciola gigantica) of potential components of snail-attractant pellets was investigated. Carbohydrates (glucose, maltose, sucrose or starch, each at 10 mM) and amino acids (citrulline, tryptophan, proline or serine, each at 20 mM), were tested in aquaria, with the snails initially placed 22.5, 30 or 45 cm from an agar pellet containing the component under test. Under these conditions, starch and proline emerged as the strongest attractants for L. acuminata, followed by maltose and serine.

  5. Attraction to amino acids by Lymnaea acuminata, the snail host of Fasciola species.

    Science.gov (United States)

    Tiwari, F; Singh, D K

    2004-04-01

    Adult Lymnaea acuminata (average length 20-22 mm) were collected locally from lakes and low-lying submerged fields from Gorakhpur. The chemoattraction studies were made in round glass aquaria measuring 30 cm in diameter and filled to a depth of 10 mm with 500 ml dechlorinated tap water. Each aquarium was divided into four concentric zones. At the starting time of the assay 10 snails were placed on the circumference of outermost zone 0. Snail attractant pellets (SAP) were added simultaneously in the center of central zone 3. SAP of different amino acids were prepared at concentrations of 10, 20, 50, 80 and 100 mM/2% agar solution and, subsequently, spread to a uniform thickness of 5 mm. After cooling, SAP were cut in small pieces of 5 mm in diameter. Lymnaea acuminata's attraction to amino acids was studied using different amino acid concentrations in SAP. Pellets containing amino acids with non-polar R groups (proline and tryptophan), a charged polar group (arginine) and uncharged polar R groups (serine, citrulline and asparagine) were tested. The snails were more attracted to the uncharged polar R group amino acid serine than to other groups of amino acids. The preferred amino acid concentration was 80 mM. The attraction of snails to different amino acids was concentration dependent. Snails could discriminate amongst the different amino acids at > or = 50 mM.

  6. Attraction to amino acids by Lymnaea acuminata, the snail host of Fasciola species

    Directory of Open Access Journals (Sweden)

    Tiwari F.

    2004-01-01

    Full Text Available Adult Lymnaea acuminata (average length 20-22 mm were collected locally from lakes and low-lying submerged fields from Gorakhpur. The chemoattraction studies were made in round glass aquaria measuring 30 cm in diameter and filled to a depth of 10 mm with 500 ml dechlorinated tap water. Each aquarium was divided into four concentric zones. At the starting time of the assay 10 snails were placed on the circumference of outermost zone 0. Snail attractant pellets (SAP were added simultaneously in the center of central zone 3. SAP of different amino acids were prepared at concentrations of 10, 20, 50, 80 and 100 mM/2% agar solution and, subsequently, spread to a uniform thickness of 5 mm. After cooling, SAP were cut in small pieces of 5 mm in diameter. Lymnaea acuminata's attraction to amino acids was studied using different amino acid concentrations in SAP. Pellets containing amino acids with non-polar R groups (proline and tryptophan, a charged polar group (arginine and uncharged polar R groups (serine, citrulline and asparagine were tested. The snails were more attracted to the uncharged polar R group amino acid serine than to other groups of amino acids. The preferred amino acid concentration was 80 mM. The attraction of snails to different amino acids was concentration dependent. Snails could discriminate amongst the different amino acids at > or = 50 mM.

  7. Molluscicidal activity of Morus nigra against the freshwater snail Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Farheen Hanif

    2012-01-01

    Full Text Available The molluscicidal activity of Morus nigra fruit, bark and leaf powder against the snail Lymnaea acuminata was time and concentration dependent. Toxicity of fruit powder (96h LC50: 166.92 mg/L was more pronounced in comparison to bark powder (96h LC50: 173.17 mg/L and leaf powder (96h LC50: 173.69 mg/L. Ethanolic extracts of M. nigra fruit, bark and leaf was more toxic than their other organic solvent extracts. The molluscicidal activity of ethanolic extract of M. nigra fruit powder (24h LC50: 116.23 mg/L was more effective than the ethanolic extract of bark powder (24h LC50: 154.41 mg/L and leaf powder (24h LC50: 139.80 mg/L. The 96h LC50 of column-purified fraction of M. nigra fruit powder was, 10.03 mg/L whereas that of bark and leaf powder was 8.69 mg/L and 4.97 mg/L, respectively. Column and thin layer chromatography analysis demonstrates that the active molluscicidal component in M. nigra is quercetin (96h LC50: 1.11 mg/L, apigenin (96h LC50: 1.92 mg/L and morusin (96h LC50: 2.12 mg/L, respectively. Co-migration of quercetin (Rf 0.49, apigenin (Rf 0.51 and morusin (Rf 0.52 with column-purified fruit, bark and leaf of M. nigra on thin layer chromatography demonstrates same Rf value. The present study indicates that M. nigra may be used as potent source of molluscicides against the snail Lymnaea acuminata.

  8. Molluscicidal activity of Sapindus mukorossi and Terminalia chebula against the freshwater snail Lymnaea acuminata.

    Science.gov (United States)

    Upadhyay, Aparna; Singh, D K

    2011-04-01

    The molluscicidal activity of Sapindus mukorossi and Terminalia chebula fruit powder against the vector snail Lymnaea acuminata was time and concentration dependent. The molluscicidal activity of T. chebula fruit powder (96 h LC(50):93.59 mg L(-1)) was more pronounced than that of S. mukorossi fruit powder (96 h LC(50):119.57 mg L(-1)). Ethanolic extracts of S. mukorossi and T. chebula fruit powder were more toxic than their other organic solvent extracts. The molluscicidal activity of ethanolic extract of S. mukorossi fruit powder (24h LC(50):2.75 mg L(-1)) was more effective than the ethanolic extract of T. chebula fruit powder (24h LC(50):124.06 mg L(-1)). The 96 h LC(50) of column-purified fraction of S. mukorossi fruit powder was 5.43 mg L(-1) whereas those of T. chebula fruit powder was 7.49 mg L(-1). Column, thin layer and high performance liquid chromatography analysis demonstrates that the active molluscicidal component in S. mukorossi and T. chebula is saponin (96 h LC(50):1.31 mg L(-1)) and tannic acid (96 h LC(50):1.64 mg L(-1)), respectively. These plants may be used as potent source of molluscicides against the snail L. acuminata.

  9. Bait Formulations of Chlorophyllin against Infected/Uninfected Lymnaea acuminata in Red and Sunlight

    OpenAIRE

    Navneet Kumar; Vinay Kumar Singh

    2015-01-01

    Control of snail population is an important tool in fasciolosis control programme. In order to achive this objective the method of bait formulation containing an attractant and a molluscicide is an appropriate approach to ensure the death of host snail. Chlorophyllin bait pellets were prepared by addition of attractants starch (10 mM)/serine (20 mM) and Chlorophyllin 2% agar solution. These baits were used against host snail Lymnaea acuminata. The behavioral response of snail against attracta...

  10. Seasonal variation in abiotic factors and toxicity of thymol against the snail Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Shefali Srivastava

    2013-01-01

    Full Text Available Toxicity of thymol against Lymnaea acuminata was conducted in each month of the year 2010-2011. The 24, 48, 72 and 96 h LC50 values of a molluscicide thymol were determined, with the concomitant estimation of levels of temperature, pH, dissolved oxygen, carbon dioxide and electrical conductivity, both in control and test water. On the basis of a 24h toxicity assay, it was observed that 24h LC50 value of 6.41 mg/l in month of May, was most effective in killing the snails, while the thymol was least effective in month of April, when its 24h LC50 was 15.25 mg/l. There was a significant positive correlation between LC50 of thymol and levels of carbon dioxide/ pH of water in corresponding months. On the contrary, a negative correlation was noted between LC50 of thymol and dissolved oxygen/ temperature of test water in the same months. In order to confirm that relationship between toxicity and abiotic factors is not coincidental, activity of acetylcholinesterase (AChE, acid phosphatase (ACP and alkaline phosphatase (ALP in the nervous tissue of control as well as sublethal thymol (60% of 24hLC50 treated snail, were assayed during each of the 12 months of the same year. A significant positive rank correlation was noted between AChE/ACP/ALP activity and corresponding sublethal treatment of thymol. Maximum inhibition of AChE, ACP and ALP activity was observed in the month of May. This study shows conclusively that the best time to control the L. acuminata population with thymol is during the month of May to July.

  11. Toxicity of Chlorophyllin against Lymnaea acuminata at Different Wavelengths of Visible Light.

    Science.gov (United States)

    Chaturvedi, Divya; Singh, Vinay Kumar

    2016-08-01

    Fasciolosis is a water and food-borne disease caused by the liver fluke Fasciola hepatica and Fasciola gigantica. This disease is widespread in different parts of the world. Lymnaeidae and Planorbidae snails are the intermediate hosts of these flukes. Snail population management is a good tool to control fasciolosis because gastropods represent the weakest link in the life-cycle of trematodes. Chlorophyll can be extracted from any green plant. Chlorophyllin was prepared from spinach in 100% ethanol by using different types of chemicals. The chlorophyll obtained from spinach was transformed into water-soluble chlorophyllin. In the present paper, toxicity of chlorophyllin against the snail Lymnaea acuminata was time and concentration dependent. The toxicity of extracted and pure chlorophyllin at continuous 4 h exposure of sunlight was highest with lethal concentration (LC50) of 331.01 mg/L and 2.60 mg/L, respectively, than discontinuous exposure of sunlight up to 8 h with LC50 of 357.04 mg/L and 4.94 mg/L, respectively. Toxicity of extracted chlorophyllin was noted in the presence of different monochromatic visible lights. The highest toxicity was noted in yellow light (96 h, LC50 392.77 mg/L) and the lowest in green light (96 h, LC50 833.02 mg/L). Chlorophyllin in combination with solar radiation or different wavelength of monochromatic visible lights may become a latent remedy against the snail L. acuminata. It was demonstrated that chlorophyllin was more toxic in sunlight. Chlorophyllin is ecologically safe and more economical than synthetic molluscicides which have the potential to control the incidence of fasciolosis in developing countries.

  12. Toxicity of Chlorophyllin against Lymnaea acuminata at Different Wavelengths of Visible Light

    Science.gov (United States)

    Chaturvedi, Divya; Singh, Vinay Kumar

    2016-01-01

    Fasciolosis is a water and food-borne disease caused by the liver fluke Fasciola hepatica and Fasciola gigantica. This disease is widespread in different parts of the world. Lymnaeidae and Planorbidae snails are the intermediate hosts of these flukes. Snail population management is a good tool to control fasciolosis because gastropods represent the weakest link in the life-cycle of trematodes. Chlorophyll can be extracted from any green plant. Chlorophyllin was prepared from spinach in 100% ethanol by using different types of chemicals. The chlorophyll obtained from spinach was transformed into water-soluble chlorophyllin. In the present paper, toxicity of chlorophyllin against the snail Lymnaea acuminata was time and concentration dependent. The toxicity of extracted and pure chlorophyllin at continuous 4 h exposure of sunlight was highest with lethal concentration (LC50) of 331.01 mg/L and 2.60 mg/L, respectively, than discontinuous exposure of sunlight up to 8 h with LC50 of 357.04 mg/L and 4.94 mg/L, respectively. Toxicity of extracted chlorophyllin was noted in the presence of different monochromatic visible lights. The highest toxicity was noted in yellow light (96 h, LC50 392.77 mg/L) and the lowest in green light (96 h, LC50 833.02 mg/L). Chlorophyllin in combination with solar radiation or different wavelength of monochromatic visible lights may become a latent remedy against the snail L. acuminata. It was demonstrated that chlorophyllin was more toxic in sunlight. Chlorophyllin is ecologically safe and more economical than synthetic molluscicides which have the potential to control the incidence of fasciolosis in developing countries. PMID:27688849

  13. Enzyme inhibition by molluscicidal agents of Bauhinia variegata and Mimusops elengi in the nervous tissue of Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Kanchan Lata Singh

    2015-10-01

    Full Text Available Objective: To evaluate the effect of enzymatic activity in the nervous tissue of snail Lymnaea acuminata (L. acuminata by Bauhinia variegata (B. variegata and Mimusops elengi (M. elengi and their active molluscicidal components quercetin and saponin. Methods: Treatment of sublethal concentration (40% and 80% of 96-h LC50 in vivo of column-purified fraction of B. variegata leaf and M. elengi bark and their molluscicidal agents quercetin and saponin inhibit the acetylcholinesterase (AChE, acid and alkaline phosphatase (ACP and ALP activities in the nervous tissue of L. acuminata. Results: AChE activity was more inhibited than ACP and ALP in snail exposed to columnpurified fraction of M. elengi bark and saponin. Among all the treatments the highest inhibition in AChE activity (27.77% was noted in snail L. acuminata exposed to 80% of 96-h LC50 of saponin at 96-h exposure period. Conclusions: It can be concluded from the present study that inhibition of AChE, ACP and ALP by B. variegata leaf (quercetin and M. elengi bark (saponin in snail L. acuminata could be the cause of snail mortality.

  14. Bait Formulations of Chlorophyllin against Infected/Uninfected Lymnaea acuminata in Red and Sunlight

    Directory of Open Access Journals (Sweden)

    Navneet Kumar

    2015-01-01

    Full Text Available Control of snail population is an important tool in fasciolosis control programme. In order to achive this objective the method of bait formulation containing an attractant and a molluscicide is an appropriate approach to ensure the death of host snail. Chlorophyllin bait pellets were prepared by addition of attractants starch (10 mM/serine (20 mM and Chlorophyllin 2% agar solution. These baits were used against host snail Lymnaea acuminata. The behavioral response of snail against attractant (starch/serine and chlorophyllin was examined in red and sunlight. The fraction of snail that was in contact with chlorophyllin bait in zone-3 was used as measure of attraction process. Infected snails were more attracted with red light+starch (57.7%. Uninfected snails were more attracted by red light+serine (58.0%. The molluscicidal activity of chlorophyllin against infected snails in red light (96h LC50-1.88% chlorophyllin in bait and sunlight (96h LC50-2.40% chlorophyllin in bait was more pronounced than uninfected snail in red light (96h LC50-1.76% Chlorophyllin in bait and sunlight (96h LC50-3.62% chlorophyllin in bait.

  15. Tertiary combination of freeze-dried urine of Indian breeds of cow with plant products against snail Lymnaea acuminata.

    Science.gov (United States)

    Kumar, Shiv; Singh, D K; Singh, Vinay Kumar

    2012-10-15

    Snail Lymnaea acuminata is the intermediate host of liver fluke Fasciola gigantica, which cause endemic fasciolosis among cattle population of eastern Uttar Pradesh. Control of snail population by molluscicides is one of the effective methods to control fasciolosis. In the present study molluscicidal activity of tertiary combination of freeze-dried urine of different Indian breeds of cow Sahiwal, Geer and Tharparkar with Annona squamosa seed powder, Ferula asafoetida root latex, Azadirachta indica oil and Camellia sinensis leaves have been tested against Lymnaea acuminata. It was noted that the toxicity of tertiary combination (1:1:5) of cow urine kept for 15 days in sunlight or laboratory condition with different plant products were highly toxic against snail L. acuminata. 96 h LC50 of tertiary combinations with Sahiwal urine kept for 15 days in sunlight with A. squamosa, F. asafoetida, A. indica oil and C. sinensis were 35.47 mg L(-1), 37.13 mg L(-1), 33.66 mg L(-1), respectively higher than the Geer and Tharparkar. The toxicity of Sahiwal urine kept for 15 days in laboratory condition with A. squamosa and C. sinensis (96 h LC50 28.28 mg L(-1)) was more potent than the all other combinations. Cow urine in combination with plant product can be used for effective control of snail.

  16. Feeding of Bait to Snail Lymnaea acuminata and Their Effect on Certain Enzyme in the Nervous Tissue.

    Science.gov (United States)

    Kumar, Pradeep; Singh, V K; Singh, D K

    2012-01-01

    Fascioliasis, a snail-borne parasitic zoonosis, has been recognized for a long time because of its major veterinary and human impact. Different Bait formulations were fed to the snail Lymnaea acuminata in clear glass aquaria having diameter of 30 cm. Snail attractant containing bait formulations was prepared from different binary combination (1 : 1 ratio) of carbohydrates (glucose, starch 10 mM) and amino acid (methionine, histidine 10 mM) in 100 ml of 2% agar solution + sublethal (20% and 60% of 24 h and 96 h LC50) doses of different molluscicides (eugenol, ferulic acid, umbelliferone, and limonene). Snails fed on bait containing sub-lethal concentration of different molluscicides and the snail attractant, causing a significant inhibition in alkaline phosphatase (ALP) and acetylcholinesterase (AChE) activity in the nervous tissue of the vector snail L. acuminata. Maximum inhibition in ALP (20% of control) and AChE (49.49% of control) activity was observed in the nervous tissue of the L. acuminata exposed to 60% of 96 h LC50 of eugenol in the bait pellets containing starch + histidine, starch + methionine, respectively.

  17. Molluscicidal activity of Ferula asafoetida, Syzygium aromaticum and Carum carvi and their active components against the snail Lymnaea acuminata.

    Science.gov (United States)

    Kumar, Pradeep; Singh, D K

    2006-06-01

    The molluscicidal activity of dried root latex powder of Ferula asafoetida, flower-bud powder of Syzygium aromaticum and seed powder of Carum carvi against the snail Lymnaea acuminata was studied. The molluscicidal activity of all the three plant products was found to be both time and concentration dependent. The toxicity of S. aromaticum flower-bud powder (96 h LC(50):51.98 mg/l) was more pronounced than that of root latex powder of F. asafoetida (96 h LC(50):82.71 mg/l) and seed powder of C. carvi (96 h LC(50):140.58 mg/l). Ethanol extract was more toxic than other organic extracts. The ethanol extract of S. aromaticum (24h LC(50):83.53 mg/l) was more effective than that of F. asafoetida (24h LC(50):132.31 mg/l) and C. carvi (24h LC(50):130.61 mg/l) in killing the test animals. The 96 h LC(50) of column purified fraction of seed powder of C. carvi was 5.40 mg/l whereas those of flower-bud powder of S. aromaticum and dried root latex powder of F. asafoetida were 7.87 and 9.67 mg/l, respectively. The product of F. asafoetida, S. aromaticum and C. carvi may be used as potent molluscicides.

  18. Characterization of the molluscicidal activity of Bauhinia variegata and Mimusops elengi plant extracts against the fasciola vector Lymnaea acuminata.

    Science.gov (United States)

    Singh, Kanchan Lata; Singh, D K; Singh, Vinay Kumar

    2012-01-01

    The molluscicidal activity of Bauhinia variegata leaf and Mimusops elengi bark was studied against vector snail Lymnaea acuminata. The toxicity of both plants was time and concentration-dependent. Among organic extracts, ethanol extracts of both plants were more toxic. Toxicity of B. variegata leaf ethanolic extract (96h LC50- 14.4 mg/L) was more pronounced than M. elengi bark ethanolic extract (96h LC50-15.0 mg/L). The 24h LC50 of column purified fraction of B. variegata and M. elengi bark were 20.3 mg/L and 18.3 mg/L, respectively. Saponin and quercetin were characterized and identified as active molluscicidal component. Co-migration of saponin (Rf 0.48) and quercetin (Rf 0.52) with column purified bark of M. elengi and leaf of B. variegata on thin layer chromatography demonstrate same Rf value i.e. 0.48 and 0.52, respectively. The present study clearly indicates the possibility of using M. elengi and/or B. variegata as potent molluscicide.

  19. Characterization of the molluscicidal activity of Bauhinia variegata and Mimusops elengi plant extracts against the fasciola vector lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Kanchan Lata Singh

    2012-06-01

    Full Text Available The molluscicidal activity of Bauhinia variegata leaf and Mimusops elengi bark was studied against vector snail Lymnaea acuminata. The toxicity of both plants was time and concentration-dependent. Among organic extracts, ethanol extracts of both plants were more toxic. Toxicity of B. variegata leaf ethanolic extract (96h LC50- 14.4 mg/L was more pronounced than M. elengi bark ethanolic extract (96h LC50-15.0 mg/L. The 24h LC50 of column purified fraction of B. variegata and M. elengi bark were 20.3 mg/L and 18.3 mg/L, respectively. Saponin and quercetin were characterized and identified as active molluscicidal component. Co-migration of saponin (Rf 0.48 and quercetin (Rf 0.52 with column purified bark of M. elengi and leaf of B. variegata on thin layer chromatography demonstrate same Rf value i.e. 0.48 and 0.52, respectively. The present study clearly indicates the possibility of using M. elengi and/or B. variegata as potent molluscicide.

  20. Behavioral Responses of the Snail Lymnaea acuminata towards Photo and Chemo Attractants: A New Step in Control Program of Fasciolosis

    Directory of Open Access Journals (Sweden)

    Anupam Pati Tripathi

    2013-01-01

    Full Text Available Fasciolosis is water and food borne disease, caused by Fasciola hepatica and F. gigantica. Snail Lymnaea acuminata is an intermediate host of these flukes. Snail control is one of the major methods to reduce the incidences of fasciolosis. Trapping of snails with the help of photo- and chemoattractants for treatment purposes will be a new tool in control program of fasciolosis. The present study shows that maximum numbers of snails were attracted (52 to 60%, when exposed to photo- and chemostimulant simultaneously, rather than when only chemo- (control (18 to 24% or photo- (control (14 to 19% stimulus was given. Maximum change in AChE activity in nervous tissue was observed when red monochromatic light was used (258.37% of white light control as opposed to blue (243.44% of white light control and orange (230.37% of white light control. The exposure of light directly stimulated the photoreceptors in eye which transmit the signals through nerves to the brain and snail response accordingly. In this signal transmission AChE is one of the important enzymes involved in this process.

  1. Combination of molluscicides with attractant carbohydrates and amino acids in bait formulation against the snail Lymnaea acuminata.

    Science.gov (United States)

    Kumar, P; Singh, V K; Singh, D K

    2011-05-01

    Fascioliasis is an important helminth disease caused by Fasciola (F.) hepatica and F gigantica of Asia and Africa. This disease belongs to the plant-borne trematode zoonoses. Human infection has been reported in 51 different countries from 5 continents. One of the possible approaches to control this problem is to interrupt the life cycle of the parasitic trematodes by eliminating the snail. Snails attractant pellets (SAP) were prepared from binary combination of carbohydrate + amino acid (20 mM) in 2% agar solution with active molluscicidal component Ferula asafoetida (ferulic acid, umbelliferone), Syzygium aromaticum (eugenol), Carum carvi (limonene). Attraction of snails to different combinations was studied by using clear glass aquaria having diameter of 30 cm. Each aquarium was divided into four concentric zones; zone-3 (central zone), zone-2 and zone-1 (middie zone) and zone-0 (outer zone) had a diameter of 13, 18, 24, and 30 cm, respectively. The behavioral responses of snails to these binary combinations of carbohydrate and amino acid in bait formulation were examined. The fraction of snails that was in contact with the SAP at different times was used as a measure of attraction. Among all the binary combination of carbohydrate+amino acid+molluscicide after 2h of experiment, highest attraction of snail (54.71%) was observed towards the SAP containing starch+histidine+limolene. Limonene+ starch+histidine containing SAP emerged as the strongest bait formulation (96h LC50 0.74%) against Lymnaea acuminata. The present study suggested that the molluscicides of plant origin could be used with varying degrees of success in bait formulation.

  2. Bait formulations of molluscicides and their effects on biochemical changes in the ovotestis of snail Lymnaea acuminata (Mollusca; Gastropoda:Lymnaeidae

    Directory of Open Access Journals (Sweden)

    Pradeep Kumar

    2011-10-01

    Full Text Available The effect of sub-lethal feeding of bait formulations containing molluscicidal component of Ferula asafoetida (ferulic acid, umbelliferone, Syzygium aromaticum (eugenol and Carum carvi (limonene on biochemical changes in the ovotestis of snail Lymnaea acuminata were studied. Bait formulations feeding to L. acuminata were studied in clear glass aquaria having diameter of 30 cm. Baits were prepared from different binary combinations of attractant amino acid (valine, aspartic acid, lysine and alanine 10 mM in 100 mL of 2% agar solution + sub-lethal (20% and 60% of 24h LC50 doses of different molluscicides (ferulic acid, umbelliferone, eugenol and limonene. These baits caused maximum significant reduction in free amino acid, protein, DNA, RNA levels i.e. 41.37, 23.56, 48.36 and 14.29% of control in the ovotestis of the snail, respectively. Discontinuation of feeding after treatment of 60% of 96h LC50 of molluscicide containing bait for next 72h caused a significant recovery in free amino acid, protein, DNA and RNA levels in the ovotestis of L. acuminata.

  3. CHARACTERIZATION OF MOLLUSCICIDAL COMPONENT OF Moringa oleifera LEAF AND Momordica charantia FRUITS AND THEIR MODES OF ACTION IN SNAIL Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Aparna Upadhyay

    2013-07-01

    Full Text Available SUMMARY The molluscicidal activity of the leaf powder of Moringa oleifera and lyophilized fruit powder of Momordica charantia against the snail Lymnaea acuminata was time and concentration dependent. M. oleifera leaf powder (96 h LC50: 197.59 ppm was more toxic than M. charantia lyophilized fruit powder (96 h LC50: 318.29 ppm. The ethanolic extracts of M. oleifera leaf powder and Momordica charantia lyophilized fruit powder were more toxic than other organic solvent extracts. The 96 h LC50 of the column purified fraction of M. oleifera leaf powder was 22.52 ppm, while that of M. charantia lyophilized fruit powder was 6.21 ppm. Column, thin layer and high performance liquid chromatography analysis show that the active molluscicidal components in M. oleifera leaf powder and lyophilized fruit of M. charantia are benzylamine (96 h LC50: 2.3 ppm and momordicine (96 h LC50: 1.2 ppm, respectively. Benzylamine and momordicine significantly inhibited, in vivo and in vitro, the acetylcholinesterase (AChE, acid and alkaline phosphatase (ACP/ALP activities in the nervous tissues of L. acuminata. Inhibition of AChE, ACP and ALP activity in the nervous tissues of L. acuminata by benzylamine and momordicine may be responsible for the molluscicidal activity of M. oleifera and M. charantia fruits, respectively.

  4. The effect of abiotic factors on the toxicity of cypermethrin against the snail Lymnaea acuminata in the control of fascioliasis.

    Science.gov (United States)

    Singh, V; Singh, D K

    2009-03-01

    Every month during the year 2006-2007, the 24, 48, 72 and 96 h LC50 values of a molluscicide, cypermethrin, were determined for a snail Lymnaea acuminata, with concomitant estimation of levels of temperature, pH, dissolved oxygen and carbon dioxide and electrical conductivity, both in control and test water. On the basis of a 24 h toxicity assay, it was noted that LC50 values of 10.39, 10.90 and 11.19 mg l- 1 during the months of May, June and July, respectively, were most effective in killing the snails, while the molluscicide was least effective in the month of January, when its 24 h LC50 was 65.84 mg l- 1.There was a significant positive correlation between LC50 of cypermethrin and levels of dissolved O2/pH of water in corresponding months. On the contrary, a negative correlation was observed between LC50 and dissolved CO2/temperature of test water in the same months. In order to ascertain that such a relationship between toxicity and abiotic factors is not coincidental, the nervous tissue of the snail was assayed for the activity of acetylcholinesterase (AChE), acid phosphatase (ACP) and alkaline phosphatase (ALP) to sublethal concentrations (40% and 80%) of 24 h LC50 during each of the 12 months of the same year. The findings confirmed that abiotic factors indeed influence toxicity of cypermethrin in the snail. A significant positive rank correlation between AChE, ACP and ALP activity did exist following exposure to the corresponding sublethal concentrations. Moreover, there was a maximum inhibition of 61.29 and 76.16% of AChE and ACP, respectively, in snails exposed to 80% of the 24 h LC50 in the month of May. A similar treatment caused a maximum inhibition of 70.53% of ALP activity in the month of June. This work shows conclusively that the best time to control the snail population with cypermethrin is during the months of May and June.

  5. Chlorophyllin Bait Formulation and Exposure to Different Spectrum of Visible Light on the Reproduction of Infected/Uninfected Snail Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Navneet Kumar

    2016-01-01

    Full Text Available Fasciolosis is a waterborne disease, caused by Fasciola species. Snail Lymnaea acuminata is an intermediate host of these flukes. Control of snail population is major tool in reducing the incidences. Variation in light intensity and wavelength caused significant changes in reproduction pattern of snails. Maximum fecundity was noted with bait containing carbohydrate (starch, 468 ± 0.10/20 snails or amino acid (serine, 319 ± 0.29/20 snails as attractant. Sublethal feeding of chlorophyllin bait with starch or serine attractant to infected and uninfected snails caused significant reduction in fecundity, hatchability, and survivability. These significant changes are observed in snails exposed to different spectral band of visible light and sunlight. Maximum fecundity of 536 ± 2.0 and minimum of 89.3 ± 0.4 were noted in snails not fed with bait and exposed to sunlight and red spectral band, respectively. There was complete arrest in the fecundity of infected and uninfected snails and no survivability of uninfected snails after 48 h feeding with bait containing chlorophyllin + attractant. Minimum hatchability (9.25 ± 0.5 was noted in red light exposed, chlorophyllin + starch fed infected snails and hatching period of bait fed snails was prolonged. Conclusively, chlorophyllin bait and red light reduce reproduction capacity in snails.

  6. Chlorophyllin Bait Formulation and Exposure to Different Spectrum of Visible Light on the Reproduction of Infected/Uninfected Snail Lymnaea acuminata.

    Science.gov (United States)

    Kumar, Navneet; Singh, D K; Singh, Vinay Kumar

    2016-01-01

    Fasciolosis is a waterborne disease, caused by Fasciola species. Snail Lymnaea acuminata is an intermediate host of these flukes. Control of snail population is major tool in reducing the incidences. Variation in light intensity and wavelength caused significant changes in reproduction pattern of snails. Maximum fecundity was noted with bait containing carbohydrate (starch, 468 ± 0.10/20 snails) or amino acid (serine, 319 ± 0.29/20 snails) as attractant. Sublethal feeding of chlorophyllin bait with starch or serine attractant to infected and uninfected snails caused significant reduction in fecundity, hatchability, and survivability. These significant changes are observed in snails exposed to different spectral band of visible light and sunlight. Maximum fecundity of 536 ± 2.0 and minimum of 89.3 ± 0.4 were noted in snails not fed with bait and exposed to sunlight and red spectral band, respectively. There was complete arrest in the fecundity of infected and uninfected snails and no survivability of uninfected snails after 48 h feeding with bait containing chlorophyllin + attractant. Minimum hatchability (9.25 ± 0.5) was noted in red light exposed, chlorophyllin + starch fed infected snails and hatching period of bait fed snails was prolonged. Conclusively, chlorophyllin bait and red light reduce reproduction capacity in snails.

  7. Chlorophyllin Bait Formulation and Exposure to Different Spectrum of Visible Light on the Reproduction of Infected/Uninfected Snail Lymnaea acuminata

    Science.gov (United States)

    Kumar, Navneet; Singh, D. K.; Singh, Vinay Kumar

    2016-01-01

    Fasciolosis is a waterborne disease, caused by Fasciola species. Snail Lymnaea acuminata is an intermediate host of these flukes. Control of snail population is major tool in reducing the incidences. Variation in light intensity and wavelength caused significant changes in reproduction pattern of snails. Maximum fecundity was noted with bait containing carbohydrate (starch, 468 ± 0.10/20 snails) or amino acid (serine, 319 ± 0.29/20 snails) as attractant. Sublethal feeding of chlorophyllin bait with starch or serine attractant to infected and uninfected snails caused significant reduction in fecundity, hatchability, and survivability. These significant changes are observed in snails exposed to different spectral band of visible light and sunlight. Maximum fecundity of 536 ± 2.0 and minimum of 89.3 ± 0.4 were noted in snails not fed with bait and exposed to sunlight and red spectral band, respectively. There was complete arrest in the fecundity of infected and uninfected snails and no survivability of uninfected snails after 48 h feeding with bait containing chlorophyllin + attractant. Minimum hatchability (9.25 ± 0.5) was noted in red light exposed, chlorophyllin + starch fed infected snails and hatching period of bait fed snails was prolonged. Conclusively, chlorophyllin bait and red light reduce reproduction capacity in snails. PMID:26925296

  8. Seasonal variation in abiotic factors and ferulic acid toxicity in snail-attractant pellets against the intermediate host snail Lymnaea acuminata.

    Science.gov (United States)

    Agrahari, P; Singh, D K

    2013-11-01

    Laboratory evaluation was made to access the seasonal variations in abiotic environmental factors temperature, pH, dissolved oxygen, carbon dioxide, electrical conductivity and ferulic acid toxicity in snail-attractant pellets (SAP) against the intermediate host snail Lymnaea acuminata in each month of the years 2010 and 2011. On the basis of a 24-h toxicity assay, it was noted that lethal concentration values of 4.03, 3.73% and 4.45% in SAP containing starch and 4.16, 4.23% and 4.29% in SAP containing proline during the months of May, June and September, respectively, were most effective in killing the snails, while SAP containing starch/proline + ferulic acid was least effective in the month of January/February (24-h lethal concentration value was 7.67%/7.63% in SAP). There was a significant positive correlation between lethal concentration value of ferulic acid containing SAP and levels of dissolved O2 /pH of water in corresponding months. On the contrary, a negative correlation was observed between lethal concentration value and dissolved CO2 /temperature of test water in the same months. To ascertain that such a relationship between toxicity and abiotic factors is not co-incidental, the nervous tissue of treated (40% and 80% of 24-h lethal concentration value) and control group of snails was assayed for the activity of acetylcholinesterase (AChE) in each of the 12 months of the same year. There was a maximum inhibition of 58.43% of AChE, in snails exposed to 80% of the 24-h lethal concentration value of ferulic acid + starch in the month of May. This work shows conclusively that the best time to control snail population with SAP containing ferulic acid is during the months of May, June and September.

  9. Childhood Condyloma Acuminata

    Directory of Open Access Journals (Sweden)

    K. Didem Yazganoğlu

    2009-12-01

    Full Text Available Objective: Condyloma acuminata (CA in children needs a special approach. Our purpose was to review the children with CA to find the clinical features, possible transmission modes and treatment modalities.Methods: Thirteen cases of CA under the age of 12 within 441 CA patients diagnosed between the years of January 2004-April 2009 were retrospectively analyzed for the clinical characteristics and response to treatment.Results: The age at presentation was between 1,5-12 years. The duration of disease was between 1,5 months to 11 years. Nine cases were female, four were male (female/male:2,3. Perianal localization was observed in twelve cases (92,3%. Five cases had verruca vulgaris located at another anatomical site. The relatives of two cases had hand warts. CA was present in the family of three cases. Sexual abuse was not confirmed in any of our cases. Seven patients had complete clearance after therapy. Two patients are unresponsive to therapy with associated diseases namely atopic dermatitis and hyper-immunoglobulin E syndrome.Conclusion: CA in children is more common in girls, and more commonly located in the perianal area. The way of transmission is hard to identify, but non-sexual transmission is more possible. However, sexual abuse must be evaluated in every case. Treatment modalities are the same in adults, and response to treatment varies.

  10. Lymnaea columella in northern Brazil

    Directory of Open Access Journals (Sweden)

    W. Lobato Paraense

    1983-12-01

    Full Text Available The occurrence of a mollusc of the family Lymnaeidae is recorded for the first time in Brazil north of parallel 15ºS, as a result of the finding of Lymnaea columella in Manus and Benjamin Constant, state of Amazonas. A description is given of its shell, renal organ, genital system and radula, pointing to the morphological characteristics of diagnostic value to separate it from two other species previously studied by the author, Lymnaea viatrix and L. rupestris, which also occur in Brazil.Pela primeira vez é verificada a ocorrência de um molusco da família Lymnaeidae ao norte do paralelo 15ºS no Brasil, como resultado do encontro da lYmnaea columella em Manus e Benjamin Constant, Estado do Amazonas. É apresentada uma descrição da concha, do órgão renal, do sistema genital e da rádula, sendo indicados os caracteres morfológicos que permitem distinguir a Lymnaea columella de outras espécies que também ocorrem no Brasil, previamente estudadas pelo autor, L. viatrix e L. rupestris.

  11. Speed of back-swimming of Lymnaea.

    Science.gov (United States)

    Aono, Kanako; Fusada, A; Fusada, Y; Ishii, W; Kanaya, Y; Komuro, Mami; Matsui, Kanae; Meguro, S; Miyamae, Ayumi; Miyamae, Yurie; Murata, Aya; Narita, Shizuka; Nozaka, Hiroe; Saito, Wakana; Watanabe, Ayumi; Nishikata, Kaori; Kanazawa, A; Fujito, Y; Okada, R; Lukowiak, K; Ito, E

    2008-01-01

    The pond snail, Lymnaea stagnalis, can locomote on its back utilizing the surface tension of the water. We have called this form of movement 'back-swimming'. In order to perform this behavior, the snail must flip itself over on its back so that its foot is visible from above. Little is known about the mechanism of this back-swimming. As a first step for the elucidation of this mechanism, we measured the speed of back-swimming of Lymnaea at the different times of the day. They back-swam significantly faster in the morning than just before dark. These data are consistent with our earlier findings on circadian-timed activity pattern in Lymnaea. Lymnaea appear to secrete a thin membrane-like substance from their foot that may allow them to back-swim. To confirm the existence of this substance and to examine whether this substance is hydrophobic or hydrophilic, we applied a detergent onto the foot during back-swimming. A single drop of 1% Tween 20 drifted Lymnaea away that were still kept at the water surface. These results suggest that Lymnaea secrete a hydrophobic substance from their foot that floats to the water surface allowing Lymnaea to back-swim.

  12. Toxicity of Chlorophyllin against Lymnaea acuminata at Different Wavelengths of Visible Light

    OpenAIRE

    Chaturvedi, Divya; Singh, Vinay Kumar

    2016-01-01

    Fasciolosis is a water and food-borne disease caused by the liver fluke Fasciola hepatica and Fasciola gigantica. This disease is widespread in different parts of the world. Lymnaeidae and Planorbidae snails are the intermediate hosts of these flukes. Snail population management is a good tool to control fasciolosis because gastropods represent the weakest link in the life-cycle of trematodes. Chlorophyll can be extracted from any green plant. Chlorophyllin was prepared from spinach in 100% e...

  13. Management of a giant perineal condylomata acuminata

    Directory of Open Access Journals (Sweden)

    Hemper, Evelyn

    2016-01-01

    Full Text Available A condylomata acuminata infection is caused by human papillomaviridae (HPV. This sexually transmitted condition most often affects the perineal region. Importantly, infections with types 16 and 18 are associated with an increased risk for anal and cervix cancer. In most cases topical therapy is sufficient for successfully treating condylomata acuminata. Here, we report the case of a 51-year old patient who suffered from a giant perianal located condylomata acuminata which had developed over a period of more than 10 years. Imaging by MRI revealed a possible infiltration of the musculus sphincter ani externus. Because a topical treatment or a radiotherapy was considered unfeasible, a surgical treatment was the only therapeutic option in this unusual case. First, a colostomy was performed and subsequently a resection of the tumor with circular resection of the external portion of the musculus sphincter ani externus was performed. The large skin defect was closed by two gluteus flaps. The rectum wall was reinserted in the remnant of the musculus sphincter ani externus. Postoperatively, parts of the flaps developed necrosis. Therefore, a vacuum sealing therapy was initiated. Subsequently, the remaining skin defects were closed by autologous skin transplantation. Six months later the colostomy could be reversed. To date, one year after first surgery, the patient has still a normal sphincter function and no recurrence of the condylomata acuminata. This case report demonstrates how giant condylomata acuminata can be successfully treated by extended surgical procedures including colostomy and plastic reconstruction of resulting defects upon resection.

  14. Atividade antiviral de Musa acuminata Colla, Musaceae Antiviral activity of Musa acuminata Colla, Musaceae

    Directory of Open Access Journals (Sweden)

    Fernanda Otaviano Martins

    2009-09-01

    Full Text Available O presente trabalho avalia a atividade antiviral de extratos e frações de Musa acuminata Colla, Musaceae, coletada em duas regiões do Estado do Rio de Janeiro (Petrópolis e Santo Antônio de Pádua. As inflorescências de M. acuminata apresentaram excelente atividade para os dois vírus avaliados: herpesvírus simples humano tipo 1 e herpesvírus simples humano tipo 2, ambos resistentes ao Aciclovir. Os resultados indicam que os extratos de M. acuminata testados podem constituir alvo potencial para uso em terapias antivirais.This study evaluates the antiviral activity of extracts and fractions of Musa acuminata Colla collected in two regions of Rio de Janeiro State (Petrópolis and Santo Antônio de Pádua. The inflorescences of M. acuminata showed excellent activity for the two virus evaluated: simple human herpesvirus type 1 and simple human herpesvirus type 2, both resistant to Acyclovir. The results indicate that the tested extracts of M. acuminata can be potential target for use in antiviral therapy.

  15. Allometric models for estimating biomass and carbon in Alnus acuminata

    National Research Council Canada - National Science Library

    William Fonseca; Laura Ruíz; Marylin Rojas; Federico Allice

    2013-01-01

    ... (leaves, branches, stem and root) and total tree biomass in Alnus acuminata (Kunth) in Costa Rica. Additionally, models were developed to estimate biomass and carbon in trees per hectare and for total plant biomass per hectare...

  16. Synonymy between Lymnaea bogotensis Pilsbry, 1935 and Lymnaea cousini Jousseaume, 1887 (Gastropoda: Lymnaeidae

    Directory of Open Access Journals (Sweden)

    Luz Elena Velásquez

    2006-11-01

    Full Text Available The lymneid snail Lymnaea bogotensis Pilsbry 1935 is synonymized with L. cousini Jousseaume 1887, based on morphological comparisons of the reproductive systems. The shell, renal tube, and reproductive system are described and illustrated from specimens collected in the type locality and the municipality of Paipa, Colombia. Bibliographical records reveal L. columella to be the commonest lymneid in the country. The latter two species can be differentiated based on the morphology of the penial complex.

  17. Haemolymph Components of Infected & None Infected Lymnaea Snails with Xiphidiocercariae

    OpenAIRE

    AA Saboor Yaraghi; A. Farahnak; MR Eshraghian

    2011-01-01

    Background: In this study the haemolymph components of infected and none infected Lymnaea gedrosiana with xiphidiocercaria larvae was compared.Methods: Five hundred Fifty Lymnaea snails were collected from Ilam and Mazandaran prov­inces, Iran, during 2008-2009. The snails were transported to the lab at Tehran University of Medi­cal Sciences and their cercarial sheddings were studied. Haemolmyphs of snails were ex­tracted and cells were counted using haemocytometer and cell-surface carbohydrat...

  18. Polar localization of plasma membrane Ca2+/Mg2+ ATPase correlates with the pattern of steady ionic currents in eggs of Lymnaea stagnalis and Bithynia tentaculata (Mollusca)

    NARCIS (Netherlands)

    D. Zivkovic (Dana); R. Créton (Robbert); G. Zwaan (Gideon); W.C. de Bruijn (Wim); M.R. Dohmen (M.René)

    1990-01-01

    textabstractDuring extrusion of the first polar body in eggs of Lymnaea stagnalis and Bithynia tentaculata a localized Ca2+ /Mg2+ ATPase activity was detected, using Ando's enzyme-cytochemical method for electron microscopy [Ando et al. (1981) Acta Histochem Cytochem 14:705-726]. The enzyme activity

  19. Tertiary combination of freeze-dried urine of Indian breeds of cow with plant products against snail Lymnaea acuminata

    National Research Council Canada - National Science Library

    Kumar, Shiv; Singh, D K; Singh, Vinay Kumar

    2012-01-01

    .... In the present study molluscicidal activity of tertiary combination of freeze-dried urine of different Indian breeds of cow Sahiwal, Geer and Tharparkar with Annona squamosa seed powder, Ferula...

  20. PCR diagnosis of Fasciola hepatica in field-collected Lymnaea columella and Lymnaea viatrix snails.

    Science.gov (United States)

    Cucher, Marcela A; Carnevale, Silvana; Prepelitchi, Lucila; Labbé, Jorge H; Wisnivesky-Colli, Cristina

    2006-04-15

    Fasciolosis, caused by the trematode Fasciola hepatica, is a zoonosis of economic importance in livestock that is emerging as a chronic disease in humans. The intermediate hosts are lymnaeid snails, in which diagnosis of infection is traditionally based on cercarial shedding, tissue sectioning and crushing. We developed a PCR assay for the sensitive and specific detection of F. hepatica in field-collected Lymnaea sp. snails. A primer pair was designed to amplify a 405 bp fragment of the cytochrome c oxidase subunit 1 gene of F. hepatica. The PCR assay showed a limit of detection of 10 pg of genomic F. hepatica DNA. No cross-reactions were observed with samples from other related trematode species or from the snail hosts Lymnaea columella and Lymnaea viatrix. DNA sequencing of the amplicon showed 100% homology with F. hepatica, and 75-89% homology with other trematodes on regions that did not include the entire set of primers. Two samples from Argentina were analysed. For snails in sample 1 (n = 240), identified as L. columella, the infection rate was 17.5 and 51.3% by direct examination and PCR, respectively. For snails in sample 2 (n = 34), identified as L. viatrix, the infection rate was 2.9 and 61.8% by direct examination and PCR, respectively. Differences in infection rates between these diagnosis methods were significant for both samples. Our PCR technique showed to be effective for detecting specific F. hepatica infections of low intensity in the intermediate host, and hence it could be used to study the epidemiological situation in a given area, as well as to assess host suitability for the parasite.

  1. Agrobacterium-mediated genetic transformation of Camptotheca acuminata

    Institute of Scientific and Technical Information of China (English)

    WANG Hui-mei; ZU Yuan-gang

    2007-01-01

    UGPase gene related with wood cellulose synthesis was transferred into C. Acuminata using the method of Agrobacterium-mediated genetic transformation, and an efficient transformation system was developed for C. Acuminata on the basis of evaluations of several factors affecting Agrobacterium-mediated DNA transfer rate. The highest transformation rate was achieved when pre-cultured leaf explants were infected with an Agrobacterium culture corresponding to OD600 (0.5) for 10 min, and cultured on explant regeneration medium for three days. The results of Southern hybridization showed that genomic DNA of the kanamycin-resistant shoots to an UGPase gene probe substantiated the integration of the transgene. Transformation efficiency (6%) was achieved under the optimized transformation procedure. This system should facilitate the introduction of important useful genes into C. Acuminata.

  2. Isolation and characterization of endophytic fungi from Camptotheca acuminata.

    Science.gov (United States)

    Ding, Xiaowei; Liu, Kaihui; Deng, Baiwan; Chen, Wenqiang; Li, Wenjun; Liu, Feihu

    2013-10-01

    In this study, a total of 161 endophytic fungal isolates from Camptotheca acuminata were obtained and classified to 16 taxa according to morphological and molecular analysis. These taxa were composed of 2 frequent genera (Botryosphaeria and Fusarium) and 14 infrequent groups such as Xylaria, Diaporthe, Rhizopus, Epicoccum, and Preussia, demonstrating that fungal endophytes in C. acuminata were highly abundant and diverse. Antimicrobial activity screening using filter-paper diffusion method showed that 47.6 % of the tested isolates had antimicrobial activity against at least one of the test microorganisms. Screening of fungal endophyte-derived camptothecin analogues by TLC and LC-MS/MS³ demonstrated that a strain Botryosphaeria dothidea, X-4 could produce 9-methoxycamptothecin (9-MCPT) when cultured in Sabouraud's dextrose broth for 12 days under shake flask and bench-scale fermention conditions. This work showed that the fungal endophytes from C. acuminata could be an alternative source for the production of 9-MCPT and other natural antimicrobial compounds.

  3. Lymnaea cousini Jousseaume, 1887, from Ecuador (Gastropoda: Lymnaeidae

    Directory of Open Access Journals (Sweden)

    W. Lobato Paraense

    1995-10-01

    Full Text Available A description is given of the shell, renal organ, reproductive system and radula of topotypic specimens of Lymnaea cousini Jousseaume, 1887. A diagnosis between it and four other lymnaeids which also occur in South America and were previously studied by the author (L. columella, L. diaphana, L. viatrix and L. rupestris is presented.

  4. Potential of Hemianax ephippiger (Odonata-Aeshnidae) nymph as predator of Fasciola intermediate host, Lymnaea natalensis

    National Research Council Canada - National Science Library

    Aly Younes Hanaa El-Sherif Fathia Gawish Marwa Mahmoud

    2015-01-01

    Objective: To evaluate the predatory capacity of the Odonata, Hemianax ephippiger nymph as a biocontrol agent for the freshwater snail Lymnaea natalensis, intermediate host of Fasciola gigantica. Methods...

  5. Synaptic metaplasticity underlies tetanic potentiation in Lymnaea: a novel paradigm

    CERN Document Server

    Mehta, Anita; Luk, Collin C; Syed, Naweed I

    2013-01-01

    We present a mathematical model which explains and interprets a novel form of short-term potentiation, which was found to be use-, but not time-dependent, in experiments done on Lymnaea neurons. The high degree of potentiation is explained using a model of synaptic metaplasticity, while the use-dependence (which is critically reliant on the presence of kinase in the experiment) is explained using a model of a stochastic and bistable biological switch.

  6. Synaptic metaplasticity underlies tetanic potentiation in Lymnaea: a novel paradigm.

    Directory of Open Access Journals (Sweden)

    Anita Mehta

    Full Text Available We present a mathematical model that explains and interprets a novel form of short-term potentiation, which was found to be use-, but not time-dependent, in experiments done on Lymnaea neurons. The high degree of potentiation is explained using a model of synaptic metaplasticity, while the use-dependence (which is critically reliant on the presence of kinase in the experiment is explained using a model of a stochastic and bistable biological switch.

  7. Lymnaea viatrix and Lymnaea columella in the neotropical region: a distributional outline

    Directory of Open Access Journals (Sweden)

    W. Lobato Paraense

    1982-06-01

    Full Text Available A review of lymnaeid samples collected by the author from 106 localities in Mexico, Cuba, Jamaica, Haiti, Dominican Republic, Puerto Rico, Martinique, Saint Lucia, Guatemala, Costa Rica, Panamá, Ecuador, Peru, Bolivia, Chile, Argentina, Uruguay andBrazil showed that one of them (from Ecuador belonged to Lymnaea cousini Jousseaume, 1887, and all the others to either L. viatrix Orbigny, 1835 or l. columella Say, 1817. The ranges of L. viatrix and L. columella overlap in Middle America, and in northern and southern South America (Venezuela-Colombia-Ecuador and northeastern Argentina-Uruguay-southernmost Brazil, respectively. L. viatrix was the only species found in Peru west of the Andes and in Chile, and is supposed to have migrated eastward to Argentina via the Negro river basin. The range of L. columella in South America is discontinuous. The species has been recorded from Venezuela, Colombia and Ecuador and, east of the Andes, from latitudes 15º S (central-west Brazil to 35º S (La Plata, Argentina. Such a gap may be attributed to either introduction from the northern into the southern area, or migration along the unsampled region on the eastern side of the Andes, or extinction in the now vacant area. No lymnaeids have been found so far in Brazil north of latitude 15º S and in the Guianas.A revisão de amostras de limneídeos coletados pelo autor em 106 localidades no México, Cuba, Jamaica, Haiti, República Dominicana, Porto Rico, Martinica, Santa Lúcia, Guatemala, Costa Rica, Panamá, Equador, Peru, Bolívia, Chile, Argentina, Uruguai e Brasil mostrou que uma delas (do Equador pertencia a Lymnaea cousini Jousseaume, 1887, e que todas as outras pertenciam a L. viatrix Orbigny, 1835 ou a L. columella Say, 1817. As distribuições da L. viatrix e da l. columella sobrepõem-se na Meso-América e na América do Sul setentrional (Venezuela-Colômbia-Equador e meridional (nordeste da Argentina-Uruguai-extremo sul do Brasil. A L. viatrix foi a

  8. Micorrizas arbusculares en plantines de Alnus acuminata (Betulaceae inoculados con Glomus intraradices (Glomaceae Arbuscular mycorrhizas in Alnus acuminata (Betulaceae seedlings inoculated with Glomus intraradices (Glomaceae

    Directory of Open Access Journals (Sweden)

    Alejandra Becerra

    Full Text Available En este trabajo se cita y describe por primera vez la asociación de Alnus acuminata Kunth «aliso del cerro» con el hongo formador de micorrizas arbusculares (MA Glomus intraradices Schenk & Smith. En un bioensayo en invernadero, se inocularon plantines de A. acuminata con fragmentos radicales de Medicago sativa L. colonizados por G. intraradices . Se describe la colonización MA y el tipo anatómico Arum . Se establece la funcionalidad de la simbiosis por la presencia de arbúsculos en las células corticales de la raíz.This work described for the first time the arbuscular mycorrhiza (AM development in A. acuminata Kunth «andean alder» with G. intraradices Schenk & Smith. Seedlings of A. acuminata were inoculated with root fragments of Medicago sativa L. colonized by G. intraradices in a greenhouse. The Arum -type and AM colonization are described in A. acuminata seedlings. The presence of arbuscules in A. acuminata cortical cells define a functional symbiosis.

  9. Giant condylomata acuminata of Buschke-Lowenstein: a case report

    Directory of Open Access Journals (Sweden)

    Maria Silian Mandu Fonseca

    2016-11-01

    Full Text Available The giant condylomata acuminata of Buschke-Lowenstein is a sexually transmitted disease caused by the human papillomavirus, clinically characterized by genital warts, with high potential to develop into squamous cell carcinoma. This article seeks to report the case of a male patient, HIV-negative, who had bleeding, purulent discharge and injury with vegetative aspect in the perianal region. Biopsy of the lesion showed condyloma of Buschke-Lowenstein, and, after six months, surgery with wide excision of the lesion and rectum amputation was performed. The anatomopathological examination of the surgical specimen showed squamous cells carcinoma.

  10. Haemolymph Components of Infected & None Infected Lymnaea Snails with Xiphidiocercariae

    Directory of Open Access Journals (Sweden)

    AA Saboor Yaraghi

    2011-03-01

    Full Text Available Background: In this study the haemolymph components of infected and none infected Lymnaea gedrosiana with xiphidiocercaria larvae was compared.Methods: Five hundred Fifty Lymnaea snails were collected from Ilam and Mazandaran prov­inces, Iran, during 2008-2009. The snails were transported to the lab at Tehran University of Medi­cal Sciences and their cercarial sheddings were studied. Haemolmyphs of snails were ex­tracted and cells were counted using haemocytometer and cell-surface carbohydrate were recog­nized by conjugated lectin (Lentil. Haemolymph protein concentrations were measured by Brad­ford protein assay method and soluble protein compositions were determined on sodium dodecyl sulphate polyacrilamide gel electrophoresis (SDS-PAGE.Result: From the 550 examined Lymnaea snails for cercariae, 27 snails were infected with xiphidiocer­cariae. Mean of haemolymph cells (haemocyte number were obtained 93480±2.43 (cells/ml for none infected snails (25 snail and 124560±2800 (cells/ml for infected snails (25 snail. Mannose carbohydrate was recognized on haemocyte of none infected and infected snails. Mean of protein concentration of haemolymph plasma was obtained as 1354 ± 160 μg/ml (1.4 mg/ml for none infected snails (25 snails and 1802±138 μg/ml (1.8 mg/ml for infected snail (25 snails. Comparing to none infected snails, the SDS-PAGE results of haemolymph plasma of infected snails, showed an extra protein band (70 kDa. The results showed a significant differ­ence between the amounts and the kinds of proteins in haemolymph of infected and none infected snails.Conclusion: This information might be useful to understand of parasite detection, adhesion, engulf­ment and antigen agglutination by snail.

  11. Lymnaea palustris and Lymnaea fuscus are potential but uncommon intermediate hosts of Fasciola hepatica in Sweden.

    Science.gov (United States)

    Novobilský, Adam; Kašný, Martin; Beran, Luboš; Rondelaud, Daniel; Höglund, Johan

    2013-08-29

    Lymnaea palustris and L. fuscus are members of the European stagnicolines (Gastropoda: Lymnaeidae). The role of stagnicolines in transmission of Fasciola hepatica has been often proposed. To assess the possible relationship between these two stagnicolines and F. hepatica in Sweden, field monitoring in parallel with experimental infections of L. palustris and L. fuscus were conducted. Stagnicoline snails were collected and identified on pastures grazed by either sheep or cattle on four farms suffering from fasciolosis in Sweden during 2011-2012. Field-collected L. palustris and L. fuscus were examined for F. hepatica DNA by PCR. In the laboratory, different age groups of L. palustris, L. fuscus and G. truncatula were each exposed to two F. hepatica miracidia and main infection characteristics were obtained. One field-collected L. palustris (out of n = 668) contained F. hepatica as determined by PCR. On the other hand, stagnicolines artificially exposed to F. hepatica miracidia resulted in successful infection with fully differentiated cercariae, but only in juvenile snails (size, 1-2 mm at exposure) and with a prevalence of 51% and 13% in L. palustris and L. fuscus, respectively. In contrast, 90% of juvenile (size, 1-2 mm) and 92% of preadult G. truncatula (size, ≥ 2-4 mm), respectively, were successfully infected. Delayed, reduced and/or no spontaneous cercarial shedding was observed in the two stagnicolines when compared to G. truncatula. However, at snail dissection most cercariae from L. fuscus and L. palustris were able to encyst similarly to those from G. truncatula. Both L. fuscus and L. palustris can sustain larval development of F. hepatica but with an apparent level of age resistance. The finding of a single F. hepatica positive specimen of L. palustris, together with infection characteristics from the experimental infection, suggest that L. palustris is a more suitable snail vector of F. hepatica than L. fuscus. The reduced growth observed in both

  12. Número de cromosomas de Alnus acuminata H.B. K. Chromosomes number of specie Alnus acuminata H.B.K.

    Directory of Open Access Journals (Sweden)

    Coba de Gutierrez Bertha

    1989-12-01

    Full Text Available El árbol de Aliso, Alnus scuminsta H.B.K. es una de -las especies más recomendadas en reforestación y por su economía
    es motivo de estudio. Se comprobó que su número cromosómico es de 2n= 28.The Aliso tree, Alnus acuminata H.B.K., is one of fue species more recommended in reforestation, and studed due to its economical value. It was reconfirmed that its chromosome nlumber is 2 n= 28

  13. Role of food uptake for photosynthesis, growth and survival of the mixotrophic dinoflagellate Dinophysis acuminata

    DEFF Research Database (Denmark)

    Riisgaard, Karen; Hansen, Per Juel

    2009-01-01

    Dinophysis acuminata is a mixotrophic dinoflagellate frequently causing diarrhetic shellfish poisoning. D. acuminata was isolated from Danish coastal waters and cultivated using the mixotrophic ciliate Mesodinium rubrum as prey. The roles of food uptake and photosynthesis for the growth......) and subsequently allowed to deplete the prey. When the ciliate prey was added, the photosynthetic rate of D. acuminata increased from about 7 to 38 pg C cell-1 h-1 within the first 2 d. When subsequently subjected to starvation, the photosynthetic activity rapidly decreased to a pre-feeding level, and, without...... a minimum food uptake, D. acuminata was not able to maintain photosynthetic growth. At high prey concentrations, 70 to 90% of the gross C uptake can be explained by food uptake. However, at low prey concentrations, only 0 to 55% of the gross C uptake is likely to be derived from food uptake. The data...

  14. Optimizing the design of a reproduction toxicity test with the pond snail Lymnaea stagnalis

    DEFF Research Database (Denmark)

    Charles, Sandrine; Ducrot, Virginie; Azam, Didier

    2016-01-01

    This paper presents the results from two ring-tests addressing the feasibility, robustness and reproducibility of a reproduction toxicity test with the freshwater gastropod Lymnaea stagnalis (RENILYS strain). Sixteen laboratories (from inexperienced to expert laboratories in mollusc testing) from...

  15. Estrogen-Related Fecundity Reduction of Lymnaea ollula Following Fasciola gigantica Infection

    National Research Council Canada - National Science Library

    Supeecha Kumkate; Nuttajit Onmek; Bongkoj Boonburapong; Sombut Singhakaew; Vijittra Leardkamolkarn

    2009-01-01

    .... Reduction in life expectancy and reproductive capacity have previously been documented in Fasciola gigantica-infected Lymnaea ollula, but the influence of the endocrine system on this specific host...

  16. Intermediate snail hosts of French Fasciola hepatica: Lymnaea neotropica and Lymnaea viatrix are better hosts than local Galba truncatula.

    Science.gov (United States)

    Sanabria, R; Mouzet, R; Courtioux, B; Vignoles, P; Rondelaud, D; Dreyfuss, G; Cabaret, J; Romero, J

    2012-11-01

    Allopatric and sympatric infections of Lymnaea neotropica and Lymnaea viatrix var. ventricosa with Argentinean and French isolates of Fasciola hepatica were carried out to determine the capacity of these snails to produce metacercariae and to verify if this capacity changed with snail generation. The same process was also made with a French population of Galba truncatula known to be highly susceptible to French isolates of the parasite. In each lymnaeid species separately considered, the survival rate at day 30 post-exposure and prevalence of F. hepatica infection in the group infected with Argentinean miracidia were significantly greater than those recorded in the corresponding French one. Compared to infected G. truncatula, both South American lymnaeids had longer patent periods and produced a higher number of metacercariae. The highest infections were noted with L. v. ventricosa. In the three snail species, metacercarial production was more important with the Argentinean isolate of miracidia than with the French one. If three successive generations of L. v. ventricosa are exposed to the same French isolate of miracidia, cercarial production significantly increased from parents to the F2 generation, while the other characteristics of infection only showed insignificant variations. L. neotropica and L. v. ventricosa are better intermediate hosts for French F. hepatica than local G. truncatula. The numerical increase of shed cercariae in the F1 and F2 generations of L. v. ventricosa demonstrates a rapid adaptation of this species to the French isolate of the parasite.

  17. Characterization of 10 microsatellite markers for the understorey Amazonian herb Heliconia acuminata.

    Science.gov (United States)

    Côrtes, M C; Gowda, V; Kress, W J; Bruna, E M; Uriarte, M

    2009-07-01

    We characterized 10 microsatellite loci for the plant Heliconia acuminata from the Biological Dynamics of Forest Fragments Project (Manaus, Brazil). Markers were screened in 61 individuals from one population and were found to be polymorphic with an average of eight alleles per locus. We found moderate to high levels of polymorphic information content, and observed and expected heterozygosities. All 10 markers are suitable for spatial genetic structure and parentage analyses and will be used for understanding H. acuminata dynamics across a fragmented landscape.

  18. Nitrogenous nutrients promote the growth and toxicity of Dinophysis acuminata during estuarine bloom events.

    Science.gov (United States)

    Hattenrath-Lehmann, Theresa K; Marcoval, Maria A; Mittlesdorf, Heidi; Goleski, Jennifer A; Wang, Zhihong; Haynes, Bennie; Morton, Steve L; Gobler, Christopher J

    2015-01-01

    Diarrhetic Shellfish Poisoning (DSP) is a globally significant human health syndrome most commonly caused by dinoflagellates within the genus Dinophysis. While blooms of harmful algae have frequently been linked to excessive nutrient loading, Dinophysis is a mixotrophic alga whose growth is typically associated with prey availability. Consequently, field studies of Dinophysis and nutrients have been rare. Here, the temporal dynamics of Dinophysis acuminata blooms, DSP toxins, and nutrients (nitrate, ammonium, phosphate, silicate, organic compounds) were examined over four years within two New York estuaries (Meetinghouse Creek and Northport Bay). Further, changes in the abundance and toxicity of D. acuminata were assessed during a series of nutrient amendment experiments performed over a three year period. During the study, Dinophysis acuminata blooms exceeding one million cells L-1 were observed in both estuaries. Highly significant (pnutrients significantly enhanced D. acuminata densities in nearly all (13 of 14) experiments performed. Ammonium significantly increased cell densities in 10 of 11 experiments, while glutamine significantly enhanced cellular DSP content in 4 of 5 experiments examining this compound. Nutrients may have directly or indirectly enhanced D. acuminata abundances as densities of this mixotroph during experiments were significantly correlated with multiple members of the planktonic community (phytoflagellates and Mesodinium). Collectively, this study demonstrates that nutrient loading and more specifically N-loading promotes the growth and toxicity of D. acuminata populations in coastal zones.

  19. Structural and Function Prediction of Musa acuminata subsp. Malaccensis Protein

    Directory of Open Access Journals (Sweden)

    Anum Munir

    2016-03-01

    Full Text Available Hypothetical proteins (HPs are the proteins whose presence has been anticipated, yet in vivo function has not been built up. Illustrating the structural and functional privileged insights of these HPs might likewise prompt a superior comprehension of the protein-protein associations or networks in diverse types of life. Bananas (Musa acuminata spp., including sweet and cooking types, are giant perennial monocotyledonous herbs of the order Zingiberales, a sister grouped to the all-around considered Poales, which incorporate oats. Bananas are crucial for nourishment security in numerous tropical and subtropical nations and the most prominent organic product in industrialized nations. In the present study, the hypothetical protein of M. acuminata (Banana was chosen for analysis and modeling by distinctive bioinformatics apparatuses and databases. As indicated by primary and secondary structure analysis, XP_009393594.1 is a stable hydrophobic protein containing a noteworthy extent of α-helices; Homology modeling was done utilizing SWISS-MODEL server where the templates identity with XP_009393594.1 protein was less which demonstrated novelty of our protein. Ab initio strategy was conducted to produce its 3D structure. A few evaluations of quality assessment and validation parameters determined the generated protein model as stable with genuinely great quality. Functional analysis was completed by ProtFun 2.2, and KEGG (KAAS, recommended that the hypothetical protein is a transcription factor with cytoplasmic domain as zinc finger. The protein was observed to be vital for translation process, involved in metabolism, signaling and cellular processes, genetic information processing and Zinc ion binding. It is suggested that further test approval would help to anticipate the structures and functions of other uncharacterized proteins of different plants and living being.

  20. Characterization of pre- and postsynaptic dopamine receptors in Lymnaea.

    Science.gov (United States)

    Audesirk, T E

    1989-01-01

    1. The effects of dopamine and several synthetic agonists and antagonists were studied using two identified neurons of the snail Lymnaea stagnalis. 2. In both the buccal-2 (B-2) neurons and the pedal giant (RPeD1) neuron dopamine elicited a hyperpolarizing response at least partly due to potassium efflux. RPeD1 is itself dopaminergic, implicating autoreceptors in its response to dopamine. 3. The following agents were tested: agonists--LY171555, pergolide, SKF38393, (-)-3-PPP, R(-)NPA and dopamine; antagonists--SCH23390, sulpiride, and metaclopramide. Dibutyryl cAMP was applied to determine whether the response is cAMP-mediated. 4. Results indicate that the pharmacological profiles of dopamine receptors on these neurons are inconsistent with those of either D-1, D-2 or autoreceptors in mammals.

  1. Nitrogenous nutrients promote the growth and toxicity of Dinophysis acuminata during estuarine bloom events.

    Directory of Open Access Journals (Sweden)

    Theresa K Hattenrath-Lehmann

    Full Text Available Diarrhetic Shellfish Poisoning (DSP is a globally significant human health syndrome most commonly caused by dinoflagellates within the genus Dinophysis. While blooms of harmful algae have frequently been linked to excessive nutrient loading, Dinophysis is a mixotrophic alga whose growth is typically associated with prey availability. Consequently, field studies of Dinophysis and nutrients have been rare. Here, the temporal dynamics of Dinophysis acuminata blooms, DSP toxins, and nutrients (nitrate, ammonium, phosphate, silicate, organic compounds were examined over four years within two New York estuaries (Meetinghouse Creek and Northport Bay. Further, changes in the abundance and toxicity of D. acuminata were assessed during a series of nutrient amendment experiments performed over a three year period. During the study, Dinophysis acuminata blooms exceeding one million cells L-1 were observed in both estuaries. Highly significant (p<0.001 forward stepwise multivariate regression models of ecosystem observations demonstrated that D. acuminata abundances were positively dependent on multiple environmental parameters including ammonium (p = 0.007 while cellular toxin content was positively dependent on ammonium (p = 0.002 but negatively dependent on nitrate (p<0.001. Nitrogen- (N and phosphorus- (P containing inorganic and organic nutrients significantly enhanced D. acuminata densities in nearly all (13 of 14 experiments performed. Ammonium significantly increased cell densities in 10 of 11 experiments, while glutamine significantly enhanced cellular DSP content in 4 of 5 experiments examining this compound. Nutrients may have directly or indirectly enhanced D. acuminata abundances as densities of this mixotroph during experiments were significantly correlated with multiple members of the planktonic community (phytoflagellates and Mesodinium. Collectively, this study demonstrates that nutrient loading and more specifically N-loading promotes the

  2. On the Ultrastructure and Function of Rhogocytes from the Pond Snail Lymnaea stagnalis.

    Directory of Open Access Journals (Sweden)

    Maria Kokkinopoulou

    Full Text Available Rhogocytes, also termed "pore cells", occur as solitary or clustered cells in the connective tissue of gastropod molluscs. Rhogocytes possess an enveloping lamina of extracellular matrix and enigmatic extracellular lacunae bridged by cytoplasmic bars that form 20 nm diaphragmatic slits likely to act as a molecular sieve. Recent papers highlight the embryogenesis and ultrastructure of these cells, and their role in heavy metal detoxification. Rhogocytes are the site of hemocyanin or hemoglobin biosynthesis in gastropods. Based on electron microscopy, we recently proposed a possible pathway of hemoglobin exocytosis through the slit apparatus, and provided molecular evidence of a common phylogenetic origin of molluscan rhogocytes, insect nephrocytes and vertebrate podocytes. However, the previously proposed secretion mode of the respiratory proteins into the hemolymph is still rather hypothetical, and the possible role of rhogocytes in detoxification requires additional data. Although our previous study on rhogocytes of the red-blooded (hemoglobin-containing freshwater snail Biomphalaria glabrata provided much new information, a disadvantage was that the hemoglobin molecules were not unequivocally defined in the electron microscope. This made it difficult to trace the exocytosis pathway of this protein. Therefore, we have now performed a similar study on the rhogocytes of the blue-blooded (hemocyanin-containing freshwater snail Lymnaea stagnalis. The intracellular hemocyanin could be identified in the electron microscope, either as individual molecules or as pseudo-crystalline arrays. Based on 3D-electron microscopy, and supplemented by in situ hybridization, immunocytochemistry and stress response experiments, we provide here additional details on the structure and hemocyanin biosynthesis of rhogocytes, and on their response in animals under cadmium and starvation stress. Moreover, we present an advanced model on the release of synthesized

  3. A BAC end view of the Musa acuminata genome

    Directory of Open Access Journals (Sweden)

    Town Christopher D

    2007-06-01

    Full Text Available Abstract Background Musa species contain the fourth most important crop in developing countries. Here, we report the analysis of 6,252 BAC end-sequences, in order to view the sequence composition of the Musa acuminata genome in a cost effective and efficient manner. Results BAC end sequencing generated 6,252 reads representing 4,420,944 bp, including 2,979 clone pairs with an average read length after cleaning and filtering of 707 bp. All sequences have been submitted to GenBank, with the accession numbers DX451975 – DX458350. The BAC end-sequences, were searched against several databases and significant homology was found to mitochondria and chloroplast (2.6%, transposons and repetitive sequences (36% and proteins (11%. Functional interpretation of the protein matches was carried out by Gene Ontology assignments from matches to Arabidopsis and was shown to cover a broad range of categories. From protein matching regions of Musa BAC end-sequences, it was determined that the GC content of coding regions was 47%. Where protein matches encompassed a start codon, GC content as a function of position (5' to 3' across 129 bp sliding windows generates a "rice-like" gradient. A total of 352 potential SSR markers were discovered. The most abundant simple sequence repeats in four size categories were AT-rich. After filtering mitochondria and chloroplast matches, thousands of BAC end-sequences had a significant BLASTN match to the Oryza sativa and Arabidopsis genome sequence. Of these, a small number of BAC end-sequence pairs were shown to map to neighboring regions of the Oryza sativa genome representing regions of potential microsynteny. Conclusion Database searches with the BAC end-sequences and ab initio analysis identified those reads likely to contain transposons, repeat sequences, proteins and simple sequence repeats. Approximately 600 BAC end-sequences contained protein sequences that were not found in the existing available Musa expressed

  4. Modelling bloom formation of the toxic dinoflagellates Dinophysis acuminata and Dinophysis caudata in a highly modified estuary, south eastern Australia

    Science.gov (United States)

    Ajani, Penelope; Larsson, Michaela E.; Rubio, Ana; Bush, Stephen; Brett, Steve; Farrell, Hazel

    2016-12-01

    Dinoflagellates belonging to the toxigenic genus Dinophysis are increasing in abundance in the Hawkesbury River, south-eastern Australia. This study investigates a twelve year time series of abundance and physico-chemical data to model these blooms. Four species were reported over the sampling campaign - Dinophysis acuminata, Dinophysis caudata, Dinophysis fortii and Dinophysis tripos-with D. acuminata and D. caudata being most abundant. Highest abundance of D. acuminata occurred in the austral spring (max. abundance 4500 cells l-1), whilst highest D. caudata occurred in the summer to autumn (max. 12,000 cells l-1). Generalised additive models revealed abundance of D. acuminata was significantly linked to season, thermal stratification and nutrients, whilst D. caudata was associated with nutrients, salinity and dissolved oxygen. The models' predictive capability was up to 60% for D. acuminata and 53% for D. caudata. Altering sampling strategies during blooms accompanied with in situ high resolution monitoring will further improve Dinophysis bloom prediction capability.

  5. Allometric models for estimating biomass and carbon in Alnus acuminata

    Directory of Open Access Journals (Sweden)

    William Fonseca

    2013-12-01

    Full Text Available In order to quantify the climate change mitigation potential of forest plantations, information on total biomass and its growth rate is required. Depending on the method used, the study of the biomass behavior can be a complex and expensive activity. The main objective of this research was to develop allometric models to estimate biomass for different tree components (leaves, branches, stem and root and total tree biomass in Alnus acuminata (Kunth in Costa Rica. Additionally, models were developed to estimate biomass and carbon in trees per hectare and for total plant biomass per hectare (trees + herbaceous vegetation + necromass. To construct the tree models, 41 sampling plots were evaluated in seven sites from which 47 trees with a diametric from 4.5 to 44.5 cm were selected to be harvested. In the selected models for the stem, root and total tree biomass, a r 2 >93.87 % was accomplished, while the r 2aj for leaves and branches was 88 %. For the biomass and carbon models for total trees and total plant biomass per hectare the r2 was >99 %. Average biomass expansion factor was 1.22 for aboveground and 1.43 for total biomass (when the root was included. The carbon fraction in plant biomass varied between 32.9 and 46.7 % and the percentage of soil carbon was 3 %.

  6. Photodynamic therapy of condyloma acuminata in pregnant women

    Institute of Scientific and Technical Information of China (English)

    YANG Yu-guang; ZOU Xian-biao; ZHAO Hua; ZHANG Yun-jie; LI Heng-jin

    2012-01-01

    Background Photodynamic therapy (PDT) with 5-aminolevulinic acid (ALA) is an emerging technique for the treatment of genital human papillomavirus (HPV)-induced benign and premalignant lesions.We report here in a case series of condyloma acuminata (CA) in pregnancy successfully treated with ALA-PDT.Methods Five pregnant patients with CA received three to four times treatment respectively.Patients were followed up for 6-23 months after treatment.Results The clearance rate of genital warts was 100%.No recurrence was found during the follow-up period.Major adverse events reported were mild erosion,pain,and local edema.All pregnancies resulted in healthy live births without delivery complications.Conclusions PDT with topical ALA seems to be safe and effective in the treatment of CA in pregnancy.It demonstrated high clearance rate of warts,was well-tolerated by patients,and showed no adverse effects on mothers or fetuses.ALA-PDT may be an ideal strategy of treatment for pregnant women with CA.

  7. Homogenate extraction technology of camptothecine and hydroxycamptothecin from Camptotheca acuminata leaves

    Institute of Scientific and Technical Information of China (English)

    SHI Wei-guo; ZU Yuan-gang; ZHAO Chun-jian; YANG Lei

    2009-01-01

    Camptothecine (CPT) and hydroxycamptothecin (HCPT), two kinds of anti-cancer alkaloids, were extracted from Camptotheca acuminata leaves using homogenate extraction technology under different conditions such as the ratio of material to liquid, ethanol concentration, and homogenate time. The optimum technology parameters for homogenate extraction of CPT and HCPT from C. acuminata leaves were determined as homogenate time at 8 min, ethanol concentration at 55% and the ratio of material to liquid at 1:15 (g:mL). By using the optimized parameters, we obtained 0.639‰ extraction rate for CPT and 0.437‰ for HCPT. The extraction yields of CPT and HCPT extracted by homogenating technology were higher than those by other extractive methods, such as ultrasonic, reflux, shaking in water bath. It is concluded that the homogenate extraction technology was an efficient method for extracting CPT and HCPT from C. acuminata leaves, with characteristics of less extraction time and high yield.

  8. The ectomycorrhizas of Lactarius cuspidoaurantiacus and Lactarius herrerae associated with Alnus acuminata in Central Mexico.

    Science.gov (United States)

    Montoya, Leticia; Bandala, Victor M; Garay-Serrano, Edith

    2015-08-01

    Two pure Alnus acuminata stands established in a montane forest in central Mexico (Puebla State) were monitored between 2010 and 2013 to confirm and recognize the ectomycorrhizal (EcM) systems of A. acuminata with Lactarius cuspidoaurantiacus and Lactarius herrerae, two recently described species. Through comparison of internal transcribed spacer (ITS) of nuclear ribosomal DNA sequences from basidiomes and ectomycorrhizas sampled in the forest stands, we confirmed their ectomycorrhizal association. The phytobiont was corroborated by comparing ITS sequences obtained from EcM root tips and leaves collected in the study site and from other sequences of A. acuminata available in Genbank. Detailed morphological and anatomical descriptions of the ectomycorrhizal systems are presented and complemented with photographs.

  9. PINZOTE de Musa balbisiana y Musa acuminata como Fuente de Fibras para Papel RACHIS of Muse balbisiana and Muse acuminata as Source of Fibers for Paper Structure

    Directory of Open Access Journals (Sweden)

    José Turrado

    2009-01-01

    Full Text Available Este trabajo presenta una alternativa de uso industrial del pinzote (centro leñoso del racimo de banano como fuente de fibra para la estructuración de papel. El pinzote se considera residuo agroindustrial en los países productores de banano, material que representa el 2.8 % del racimo en la variedad de Musa balbisiana y el 4.4 % en la de Musa acuminata. Por sus características similares a la del bagazo caña de azúcar, se utilizó un proceso químico similar al empleado para obtener fibras a partir de este material. El proceso de obtención de fibras se llevó a cabo de acuerdo a un diseño experimental factorial, diseño que permite relacionar variables las independientes (tiempo de cocción, concentración de reactivo en cuatro niveles con variables independientes (rendimiento, consumo de reactivos, rechazo y lignina residual. El pinzote de Musa acuminata requiere menor temperatura y reactivo para liberar las fibras con respecto al pinzote de Musa balbisiana. Por lo tanto, el rendimiento en fibra para Musa acuminata es mayor al de Musa balbisiana.This work presents an alternative of industrial use of the banana rachis (the woody center of the cluster of bananas, as source of fibers for the structure of paper. Banana rachis is considered to be an agroindustrial residue in producing countries of banana it represents 2.8 % of the cluster of Muse balbisiana and 4.4 % of the cluster of Muse acuminata. The physical and chemical structure of the rachis is almost simliar to that of the sugar cane so a chemical process similar to that employed to obtain fibers from the sugar bagasse cane was used. An experimental factorial design that allows the correlation of independent variables (cooking time, reagent concentration in four levels with response parameters (yield, reagents consumption, rejects and residual lignin was adopted. The rachis of Muse acuminata needs lower temperature and less reagent consumption to liberate fibers in comparison with

  10. Determination of contents of 10-Hydroxycamptothecin in Camptotheca acuminata by high-performance liquid chromatogram

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The determination method of 10-hydroxycamptothecin in Camptotheca acuminata fruits by high-performance liquid chromatogram (HPLC) was studied. The HPLC analysis was performed on a HIQ sil C18(4.6×250 mm) column with mobile phase of acetonitrile-water (3:7, V:V), flow rate 1 mL@(min-1 and UV detective wavelength 266 nm. Extracting 10-hydroxycamptothecin by ultrasonic method from fruits of C. acuminata to prepare samples for analysis was systematically discussed. The optimal extraction condition was carried out by 60% alcohol solution at 60℃ for 50 minutes.

  11. Fluorescence of the 'fire-chaser' beetle Melanophila acuminata

    Energy Technology Data Exchange (ETDEWEB)

    Israelowitz, Meir [Biomimetics Technologies, 191 Ellis Avenue, Toronto, Ont., M6S 2X4 (Canada); Rizvi, Syed H.W. [Biomimetics Technologies, 191 Ellis Avenue, Toronto, Ont., M6S 2X4 (Canada); Schroeder, Herbert P. von [Biomimetics Technologies, 191 Ellis Avenue, Toronto, Ont., M6S 2X4 (Canada)]. E-mail: herb.vonschroeder@uhn.on.ca

    2007-09-15

    Melanophila acuminata beetles are attracted to forest fires over long distances by a pair of specialized infrared sensory organs. To date, there is no knowledge of their ability to detect or emit fluorescent radiation. We studied the Melanophila acuminata infrared sensory organs histologically and by using fluorescent microscopy, acoustic-optic tunable filter microscopy, and two-photon microscopy to identify fluorescence. We found fluorescent absorption at radiation wavelengths of 480 nm and emission at 570 nm. The functional role of this novel fluorescence is, as of yet, unknown but may be applied to species classification, identification and behavioral studies.

  12. Pyrosequencing of the Camptotheca acuminata transcriptome reveals putative genes involved in camptothecin biosynthesis and transport

    Directory of Open Access Journals (Sweden)

    Sun Yongzhen

    2011-10-01

    Full Text Available Abstract Background Camptotheca acuminata is a Nyssaceae plant, often called the "happy tree", which is indigenous in Southern China. C. acuminata produces the terpenoid indole alkaloid, camptothecin (CPT, which exhibits clinical effects in various cancer treatments. Despite its importance, little is known about the transcriptome of C. acuminata and the mechanism of CPT biosynthesis, as only few nucleotide sequences are included in the GenBank database. Results From a constructed cDNA library of young C. acuminata leaves, a total of 30,358 unigenes, with an average length of 403 bp, were obtained after assembly of 74,858 high quality reads using GS De Novo assembler software. Through functional annotation, a total of 21,213 unigenes were annotated at least once against the NCBI nucleotide (Nt, non-redundant protein (Nr, Uniprot/SwissProt, Kyoto Encyclopedia of Genes and Genomes (KEGG, and Arabidopsis thaliana proteome (TAIR databases. Further analysis identified 521 ESTs representing 20 enzyme genes that are involved in the backbone of the CPT biosynthetic pathway in the library. Three putative genes in the upstream pathway, including genes for geraniol-10-hydroxylase (CaPG10H, secologanin synthase (CaPSCS, and strictosidine synthase (CaPSTR were cloned and analyzed. The expression level of the three genes was also detected using qRT-PCR in C. acuminata. With respect to the branch pathway of CPT synthesis, six cytochrome P450s transcripts were selected as candidate transcripts by detection of transcript expression in different tissues using qRT-PCR. In addition, one glucosidase gene was identified that might participate in CPT biosynthesis. For CPT transport, three of 21 transcripts for multidrug resistance protein (MDR transporters were also screened from the dataset by their annotation result and gene expression analysis. Conclusion This study produced a large amount of transcriptome data from C. acuminata by 454 pyrosequencing. According to

  13. Lymnaea Diaphana; a study of Topotypic specimens (Pulmonata: Lymnaeidae

    Directory of Open Access Journals (Sweden)

    W. Lobato Paraense

    1984-03-01

    Full Text Available A description of the species Lymnaea diaphana King, 1830 is presented, on the basis of material collected at its type-locality, San Gregorio, on the north coast of the Strait of Magellan, in the Chilean province of Magallanes. It may be identified by the following characters taken together: adult shell over 10 mm in length, whorls inflated, regularly convex, separated by a well-marked suture, aperture ovate occupying about half the shell length; renal organ forming an approximately right angle with the ureter; pouch of the oviduct well noticeable high on the right ventral surface and on the right side of the nidamental gland; uterus bent to the right into an approximately right angle; body of the spermatheca projected into the pulmonary cavity and adhered to the pericardium and to the roof of the pulmonary cavity; spermiduct highly sinuous, folding dorsalward between the left half of the oviduct and the left shoulder of the nidamental gland, and then winding on ventralward to reach the prostate on the middle line; prostate voluminous, convex on the left, pushed in on the right, with a deep dorsal furrow corresponding to a fold which projects into the prostatic lumen and is more developed at the fore half of the organ; apical end of the penial sheath with about six minute protuberances corresponding to inner chambers; prepuce from about as long about twice as long as the penial sheath, with some variation beyond those limits; lateral teeth of the radula basically tricuspid, with a usually simple ectocone which may show a bifid or trifid point. A diagnosis between lymnaea diaphana and three other lymnaeids which also occur in South America and were previously studied by the author - L. columella, L. viatrix and L. rupestris - is presented.É apresentada uma descrição da espécie lymnaea diaphana king, 1830, baseada em material coletado na sua localidade-tipo, San Gregorio, na costa norte do Estreito de Magalhães, província chilena de

  14. Lymnaea rupestris sp. n. from Southern Brazil (Pulmonata: Lymnaeidae

    Directory of Open Access Journals (Sweden)

    W. Lobato Paraense

    1982-12-01

    Full Text Available A new species of South American lymnaeid snail, Lymnaea rupestris, is described. So far it has been found only in its type-locality, Nova TeuTõnia, a village in the municipality of Seara (27° 07' S, 52° 17' W, state of Santa Catarina, Brazil. It is distinguishable, by characteristics of the shell and internal organs, from the other two lymnaeid species known to occur in the area, Lymnaea columella and L. viatrix. Its shell has 4 markedly shouldered whorls, deep suture, ovoid or rounded aperture occupying about half the length of the shell, and reaches about 6 mm in length in adults; in columella and viatrix the shell has 4-5 rounded whorls, shallow suture, and reaches over 10 mm in adults; the aperture is ovoid, occupying about half the length of the shell in viatrix, about two thirds in columella. Anatomically it is readily separated from L. columella by the shape of the ureter, straight in rupestris, with a double flexure in columella. Comparison with L. viatrix shows the following main differences: distalmost portion of the oviduct with a low, caplike lateral swelling in rupestris, with a well-developed pouch in viatrix; uterus bent abruptly caudalward in rupestris, only slightly curved rightward in viatrix; basal half of the spermathecal duct hidden by the prostate in rupestris, wholly visible or nearly so in viatrix; spermiduct sinuous and uniformly wide in rupestris, straight and gradually narrowing in viatrix; prostate more than half as long and nearly as wide as the nidamental gland, and with a slit-like lumen in cross-section in rupestris, less than half as long as and much narrower than the nidamental gland, and with an inward fold in cross-section in viatrix; penial sheath about as long and as wide as the prepuce in rupesris, shorter and narrower than the prepuce in viatrix. An important ecological characteristic of L. rupestris is its habitat on wet rocks most often outside bodies of water, although in close proximity to them

  15. Susceptibility of two-week old Lymnaea natalensis to some plant extracts.

    Science.gov (United States)

    Kela, S L; Ogunsusi, R A; Ogbogu, V C; Nwude, N

    1989-01-01

    The molluscacidal potency of 17 Nigerian plants extracted by the unevaporated crude water (UECW) method was evaluated on two-week old Lymnaea natalensis Krauss. Five extracts were not active but extracts of Balanites aegytiaca, Blighia sapida, Boswellia dalzielii, Cissampelos mucronata, Detarium microcarpum, Kigelia africana, Opilia celtidifolia, Parkia clappertoniana, Polygonum limbatum, Pseudocedrela kotschyi, Nauclea latifolia and Securidaca longipedunculata were molluscacidal. There is potential for their future use in the integrated control of Lymnaea natalensis, as well as other snails. Mortality data for lethal concentration values for all extracts were analysed by use of probit transformation. The upper and lower fiducial limits of the LC50 (P = 0.05) were also determined.

  16. Effect of the exposure to Fasciola hepatica (Trematoda: Digenea) on life history traits of Lymnaea cousini and Lymnaea columella (Gastropoda: Lymnaeidae).

    Science.gov (United States)

    Salazar, Laura; Estrada, Victoria E; Velásquez, Luz E

    2006-10-01

    The snails Lymnaea columella and Lymnaea cousini have both been reported as intermediate hosts of Fasciola hepatica in Colombia. The effect of the exposure to the parasite on survival, fecundity and size of these snails was evaluated by means of experimental infections and the life history traits of control and exposed groups were compared. Infection rates were 82.2 and 34% for L. columella and L. cousini, respectively. A reduction in fitness was observed in both species when exposed to the parasite: fecundity alone was reduced in L. columella whereas in L. cousini there was also a decline in survival rate. Unlike other studies, increased size was not observed in either species. On the contrary, a reduction in growth rate was observed in L. columella.

  17. Progression of Intravesical Condyloma Acuminata to Locally Advanced Poorly Differentiated Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    A. Khambati

    2016-07-01

    Full Text Available Condyloma acuminata (CA is a common sexually transmitted disease caused by Human Papilloma Virus (HPV infection. CA of the bladder, however, is an exceedingly rare lesion. We present a rare case of poorly differentiated locally invasive squamous cell carcinoma (SCC arising from recurrent CA of the bladder in an immunocompetent patient and discuss pathophysiology and management of this unusual condition.

  18. Ectomycorrhizal and arbuscular mycorrhizal colonization of Alnus acuminata from Calilegua National Park (Argentina).

    Science.gov (United States)

    Becerra, Alejandra; Zak, Marcelo R; Horton, Thomas R; Micolini, Jorge

    2005-11-01

    The objective of this study was to determine patterns of ectomycorrhizas (ECM) and arbuscular mycorrhizas (AM) colonization associated with Alnus acuminata (Andean alder), in relation to soil parameters (electrical conductivity, field H(2)O holding capacity, pH, available P, organic matter, and total N) at two different seasons (autumn and spring). The study was conducted in natural forests of A. acuminata situated in Calilegua National Park (Jujuy, Argentina). Nine ECM morphotypes were found on A. acuminata roots. The ECM colonization was affected by seasonality and associated positively with field H(2)O holding capacity, pH, and total N and negatively associated with organic matter. Two morphotypes (Russula alnijorullensis and Tomentella sp. 3) showed significant differences between seasons. Positive and negative correlations were found between five morphotypes (Alnirhiza silkacea, Lactarius omphaliformis, Tomentella sp. 1, Tomentella sp. 3, and Lactarius sp.) and soil parameters (total N, pH, and P). A significant negative correlation was found between field H(2)O holding capacity and organic matter with AM colonization. Results of this study provide evidence that ECM and AM colonization of A. acuminata can be affected by some soil chemical edaphic parameters and indicate that some ECM morphotypes are sensitive to changes in seasonality and soil parameters.

  19. DIFFERENTIATION OF PSEUDOCONDYLOMA OF VULVA AND CONDYLOMA ACUMINATA BY DOT BLOT HYBRIDIZATION AND POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿

    1996-01-01

    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  20. Effect of planting density on plant growth and camptothecin content of Camptotheca acuminata seedlings

    Institute of Scientific and Technical Information of China (English)

    WEIHuan-yong; WANGYang; WANGZhen-yue; YANXiu-feng

    2005-01-01

    C. acuminata seedlings cultivated in greenhouse were transplanted into the fields with 5 designed planting densities (11, 16, 25,44 and 100 plants·m-2) in May of 2004 and were harvested in the middle of September of 2004. The seedling growth indexes including plant height and crown width, biomass allocation, camptothecin (CPT) content and CPT yield of different organs (young leaf, old leaf, stem,and root) were studied. For the 5 selected planting densities, the plant biomass, height, crown width, and total leaf area of C. acuminata seedlings all showed highest values at the planting density of 25 plants ·m-2. CPT content in young leaves was higher than that in other organs of seedlings and presented an obvious change with the variation of planting densities and with the highest value at density of 100plants·m-2, while for other organs no significant variation in CPT content was found with change of planting density. The accumulation of CPT was enhanced significantly at the planting density of 25 plants·m-2. It is concluded that for the purpose to get raw materials with more CPT from C. acuminata, the optimal planting density of C. acuminata seedlings should be designed as 25 plants·m-2.

  1. Diploid Musa acuminata genetic diversity assayed with sequence-tagged microsatellite sites.

    Science.gov (United States)

    Grapin, A; Noyer, J L; Carreel, F; Dambier, D; Baurens, F C; Lanaud, C; Lagoda, P J

    1998-06-01

    The sequence-tagged microsatellite site (STMS) discrimination potential was explored using nine microsatellite primer pairs. STMS polymorphism was assayed by nonradioactive urea-polyacrylamide gel electrophoresis. Genetic relationships were examined among 59 genotypes of wild or cultivated accessions of diploid Musa acuminata. The organization of the subspecies was confirmed and some clone relationships were clarified.

  2. Effect of surface coating on ripening and early peel spotting in 'Sucrier' banana (Musa acuminata)

    NARCIS (Netherlands)

    Promyou, S.; Ketsa, S.; Doorn, van W.G.

    2007-01-01

    Sucrier¿ bananas (Musa acuminata, AA Group) show peel spotting when the peel is just about as yellow as green, which coincides with optimum eating quality. As consumers might relate the spotting to overripe fruit, early spotting is considered undesirable, especially for export markets. Fruit were le

  3. Musculature of Notholca acuminata (Rotifera : Ploima : Brachionidae) revealed by confocal scanning laser microscopy

    DEFF Research Database (Denmark)

    Sørensen, M.V.; Funch, P.; Hooge, M.

    2003-01-01

    The body-wall and visceral musculature of Notholca acuminata was visualized using phalloidin-linked fluorescent dye under confocal laser scanning microscopy. The body-wall musculature includes dorsal, lateral, and ventral pairs of longitudinally oriented body retractor muscles, two pairs of head...

  4. Musculature of Notholca acuminata (Rotifera: Ploima: Brachionidae) revealed by confocal scanning laser microscopy

    DEFF Research Database (Denmark)

    Sørensen, M.V.; Funch, P.; Hooge, M.

    2003-01-01

    he body-wall and visceral musculature of Notholca acuminata was visualized using phalloidin-linked fluorescent dye under confocal laser scanning microscopy. The body-wall musculature includes dorsal, lateral, and ventral pairs of longitudinally oriented body retractor muscles, two pairs of head...

  5. Potential roles of fish, birds, and water in swamp privet (Forestiera acuminata) seed dispersal

    Science.gov (United States)

    Susan B. Adams; Paul B. Hamel; Kristina Connor; Bryce Burke; Emile S. Gardiner; David Wise

    2007-01-01

    Forestiera acuminata (swamp privet) is a common wetland shrub/small tree native to the southeastern United States. We examined several possible dispersal avenues for the plant. We tested germination of seeds exposed to various treatments, including passage through Ictalurus punctatus (Channel Catfi sh) guts, and conducted other...

  6. Synergistic effect of Croton caudatus (fruits) and Tiliacora acuminata (flowers) extracts against filarial vector Culex quinquefasciatus

    Institute of Scientific and Technical Information of China (English)

    Someshwar Singha; Siddharthasankar Banerjee; Goutam Chandra

    2011-01-01

    Objective:To investigate the synergistic effect of crude and solvent extract of Croton caudatus (C. caudatus ) (fruits) and Tiliacora acuminata (T. acuminata) (flowers) against the larval form of Culex quinquefasciatus (Cx. quinquefasciatus). Methods: Crude and solvent [chloroform:methanol (1:1 v/v), benzene and ethyl acetate] extracts of two plants, C. caudatus (fruits) and T. acuminata (flowers) were examined separately against filarial vector Cx. quinquefasciatus larvae with gradually increasing concentration i.e. from 0.1%to 0.5%of crude extract and 25 ppm to 75 ppm of solvent extracts. To observe the synergistic effect, if any, extracts of these two plant parts were mixed at different concentrations and treated against mosquito larvae. Phytochemical analyses of extracts of both the plant parts were carried out. Results: In a 72-h bioassay experiment with plant extracts, highest mortalities were recorded at 0.5% (crude) and 75 ppm (solvent) concentration for fruits of C. caudatus and flowers of T. acuminata individually. For synergistic effect, only 0.2%of the mixture of these two crude extracts and 75 ppm concentration of chloroform:methanol (1:1 v/v) and ethyl acetate extracts showed 100%mortality after 24 h and 48 h of exposure respectively. Conclusions:In the field of mosquito control, insecticides of plant origin may serve as suitable alternative to the toxic chemicals. Some secondary metabolites in combination may be responsible for better larvicidal activity.

  7. Anticholinesterase and Antioxidative Properties of Aqueous Extract of Cola acuminata Seed In Vitro

    Directory of Open Access Journals (Sweden)

    Ganiyu Oboh

    2014-01-01

    Full Text Available Background. Cola acuminata seed, a commonly used stimulant in Nigeria, has been reportedly used for the management of neurodegenerative diseases in folklore without scientific basis. This study sought to investigate the anticholinesterase and antioxidant properties of aqueous extracts from C. acuminata seed in vitro. Methodology. The aqueous extract of C. acuminata seed was prepared (w/v and its effect on acetylcholinesterase (AChE and butyrylcholinesterase activities, as well as some prooxidant (FeSO4, sodium nitroprusside (SNP, and quinolinic acid (QA induced lipid peroxidation in rat brain in vitro, was investigated. Results. The results revealed that C. acuminata seed extract inhibited AChE (IC50 = 14.6 μg/mL and BChE (IC50 = 96.2 μg/mL activities in a dose-dependent manner. Furthermore, incubation of rat’s brain homogenates with some prooxidants caused a significant increase P<0.05 in the brain malondialdehyde (MDA content and inhibited MDA production dose-dependently and also exhibited further antioxidant properties as typified by their high radicals scavenging and Fe2+ chelating abilities. Conclusion. Inhibition of AChE and BChE activities has been the primary treatment method for mild Alzheimer’s disease (AD. Therefore, one possible mechanism through which the seed exerts its neuroprotective properties is by inhibiting cholinesterase activities as well as preventing oxidative-stress-induced neurodegeneration. However, this is a preliminary study with possible physiological implications.

  8. Comparative anatomy of leaflets of Zamia acuminata and Z. pseudomonticola (Zamiaceae in Costa Rica

    Directory of Open Access Journals (Sweden)

    Rafael Acuña-Castillo

    2013-06-01

    Full Text Available The genus Zamia is morphologically and ecologically the most diverse of the order Cycadales. Throughout its history this genus has been restricted to the New World and is presently almost entirely restricted to the Neotropics. Unusual anatomical traits of the leaflets, such as the sunken stomata and thick cuticle, are common in this and related genera. The objective of this research was to study and compare the leaflet anatomy of Zamia acuminata and Z. pseudomonticola and establish possible phylogenetic relationships between the anatomical traits and the near relatives of these species. The leaf material was obtained from living plants and then processed for electron microscopy study. We found that both species are very similar to each other and to Z. fairchildiana, and that they share several unusual traits with other species of the genus, such as the parenchyma morphology, the spatial distribution of tissues between the veins and the stomata morphology. The main differences between these species were seen in their fiber clusters and in the abundance of trichome basal cells on the epidermis. The anatomical similarities between the three species could be the result of their close phylogenetic relationship and the divergences between them could be the result of recent speciation during the Pleistocene, resulting from geological changes in Southern Costa Rica.Zamia es morfológica y ecológicamente el género más diverso del orden Cycadales. Este género siempre ha estado restringido a América, pero en la actualidad habita principalmente en la región neotropical. Características anatómicas inusuales en los foliolos como los estomas hundidos y las cutículas gruesas son comunes en Zamia y géneros afines. El objetivo de este trabajo consiste en comparar la anatomía de los foliolos de Zamia acuminata y Z. pseudomonticola y establecer posibles relaciones filogenéticas entre las características anatómicas y los parientes cercanos de esta

  9. Oral isotretinoin in the treatment of recalcitrant condylomata acuminata of the cervix: a randomised placebo controlled trial

    National Research Council Canada - National Science Library

    Georgala, S; Katoulis, A C; Georgala, C; Bozi, E; Mortakis, A

    2004-01-01

    .... The use of a systemic agent may more effectively control the virus. To investigate the efficacy and safety of low dose oral isotretinoin in recalcitrant condylomata acuminata (RCA) of the cervix...

  10. Occurrence of white rust (Albugo ipomoeae-panduratae on Ipomoea acuminata in the brazilian mid-west

    Directory of Open Access Journals (Sweden)

    A.P.S Pagani

    2012-03-01

    Full Text Available Spontaneous plants of Ipomoea acuminata ("morning glory" exhibiting white rust pustules were found in a field crop area of Planaltina, DF, in the fall season of 2010 and the disease causal agent was identified as Albugo ipomoea-panduratae (Oomycota. No reports of the association between A. ipomoea-panduratae and I. acuminata were known in Brazil previously to 2010. A reference specimen was deposited at the University of Brasilia Mycological Reference Collection.

  11. Metabolic acceleration in the pond snail Lymnaea stagnalis?

    Science.gov (United States)

    Zimmer, Elke I.; Ducrot, V.; Jager, T.; Koene, J.; Lagadic, L.; Kooijman, S. A. L. M.

    2014-11-01

    Under constant environmental conditions, most animals tend to grow following the von Bertalanffy growth curve. Deviations from this curve can point to changes in the environment that the animals experience, such as food limitation when the available food is not sufficient or suitable. However, such deviations can also point to a phenomenon called metabolic acceleration, which is receiving increasing attention in the field of Dynamic Energy Budget (DEB) modeling. Reasons for such an acceleration are usually changes in shape during ontogeny, which cause changes in the surface area to volume ratio of the organism. Those changes, in turn, lead to changes in some of the model parameters that have length in their dimension. The life-history consequences of metabolic acceleration as implemented in the DEB theory are an s-shaped growth curve (when body size is expressed as a length measure) and a prolongation of the hatching time. The great pond snail Lymnaea stagnalis was earlier found to be food limited during the juvenile phase in laboratory experiments conducted under classical ecotoxicity test protocols. The pond snail has isomorphic shell growth but yet does not exhibit the expected von Bertalanffy growth curve under food limitation. When applying the standard DEB model to data from such life-cycle experiments, we also found that the hatching time is consistently underestimated, which could be a sign of metabolic acceleration. We here present an application of the DEB model including metabolic acceleration to the great pond snail. We account for the simultaneous hermaphroditism of the snail by including a model extension that describes the relative investment into the male and female function. This model allowed us to adequately predict the life history of the snail over the entire life cycle. However, the pond snail does not change in shape substantially after birth, so the original explanation for the metabolic acceleration does not hold. Since the change in shape

  12. Development of Ca2+ hotspots between Lymnaea neurons during synaptogenesis.

    Science.gov (United States)

    Feng, Zhong-Ping; Grigoriev, Nikita; Munno, David; Lukowiak, Ken; MacVicar, Brian A; Goldberg, Jeffrey I; Syed, Naweed I

    2002-02-15

    Calcium (Ca2+) channel clustering at specific presynaptic sites is a hallmark of mature synapses. However, the spatial distribution patterns of Ca2+ channels at newly formed synapses have not yet been demonstrated. Similarly, it is unclear whether Ca2+ 'hotspots' often observed at the presynaptic sites are indeed target cell contact specific and represent a specialized mechanism by which Ca2+ channels are targeted to select synaptic sites. Utilizing both soma-soma paired (synapsed) and single neurons from the mollusk Lymnaea, we have tested the hypothesis that differential gradients of voltage-dependent Ca2+ signals develop in presynaptic neuron at its contact point with the postsynaptic neuron; and that these Ca2+ hotspots are target cell contact specific. Fura-2 imaging, or two-photon laser scanning microscopy of Calcium Green, was coupled with electrophysiological techniques to demonstrate that voltage-induced Ca2+ gradients (hotspots) develop in the presynaptic cell at its contact point with the postsynaptic neuron, but not in unpaired single cells. The incidence of Ca2+ hotspots coincided with the appearance of synaptic transmission between the paired cells, and these gradients were target cell contact specific. In contrast, the voltage-induced Ca2+ signal in unpaired neurons was uniformly distributed throughout the somata; a similar pattern of Ca2+ gradient was observed in the presynaptic neuron when it was soma-soma paired with a non-synaptic partner cell. Moreover, voltage clamp recording techniques, in conjunction with a fast, optical differential perfusion system, were used to demonstrate that the total whole-cell Ca2+ (or Ba2+) current density in single and paired cells was not significantly different. However, the amplitude of Ba2+ current was significantly higher in the presynaptic cell at its contact side with the postsynaptic neurons, compared with non-contacted regions. In summary, this study demonstrates that voltage-induced Ca2+ hotspots develop

  13. A combined spectroscopic and TDDFT study of natural dyes extracted from fruit peels of Citrus reticulata and Musa acuminata for dye-sensitized solar cells

    Science.gov (United States)

    Prima, Eka Cahya; Hidayat, Novianto Nur; Yuliarto, Brian; Suyatman; Dipojono, Hermawan Kresno

    2017-01-01

    This study reports the novel spectroscopic investigations and enhanced the electron transfers of Citrus reticulata and Musa acuminata fruit peels as the photosensitizers for the dye-sensitized solar cells. The calculated TD-DFT-UB3LYP/6-31 + G(d,p)-IEFPCM(UAKS), experiment spectra of ultra-violet-visible spectroscopy, and Fourier transform infrared spectroscopy studies indicate the main flavonoid (hesperidin and gallocatechin) structures of the dye extracts. The optimized flavonoid structures are calculated using Density functional theory (DFT) at 6-31 + G(d,p) level. The rutinosyl group of the hesperidin pigment (Citrus reticulata) will be further investigated compared to the gallocatechin (Musa acuminata) pigment. The acidity of the dye extract is treated by adding 2% acetic acid. The energy levels of the HOMO-LUMO dyes are measured by a combined Tauc plot and cyclic voltammetry contrasted with the DFT data. The electrochemical impedance spectroscopy will be performed to model the dye electron transfer. As for the rutinosyl group presence and the acidic treatment, the acidified Citrus reticulata cell under continuous light exposure of 100 mW·cm- 2 yields a short-circuit current density (Jsc) of 3.23 mA/cm2, a photovoltage (Voc) of 0.48 V, and a fill factor of 0.45 corresponding to an energy conversion efficiency (η) of 0.71% because the shifting down HOMO-LUMO edges and the broadening dye's absorbance evaluated by a combined spectroscopic and TD-DFT method. The result also leads to the longest diffusion length of 32.2 μm, the fastest electron transit of 0.22 ms, and the longest electron lifetime of 4.29 ms.

  14. The toxic dinoflagellate Dinophysis acuminata harbors permanent chloroplasts of cryptomomad prigin, not kleptochloroplasts

    DEFF Research Database (Denmark)

    Garcia, Lydia; Moestrup, Øjvind; Hansen, Per Juel

    2010-01-01

    Most species belonging to the toxigenic genus Dinophysis have chloroplasts of cryptophyte origin. Whether these chloroplasts are temporarily sequestered from the prey, or permanently established under the control of the dinoflagellate is currently disputed. To investigate this, a culture...... of Dinophysis acuminata was established by feeding it the phototrophic ciliate Mesodinium rubrum (= Myrionecta rubra), which again was fed the cryptophyte Teleaulax amphioxeia. Molecular analysis comprising the nucleomorph LSU and two chloroplast markers (tufA gene and a fragment from the end of 16S r...... the chloroplast as well as the position and the arrangement of the pyrenoids were strikingly different. Considering both molecular and ultrastructural evidence, our data indicated that the chloroplasts in D. acuminata are permanent chloroplasts originating within Teleaulax or another closely related cryptophyte...

  15. Two new species of Lactarius associated with Alnus acuminata subsp. arguta in Mexico.

    Science.gov (United States)

    Montoya, Leticia; Bandala, Victor M; Garay, Edith

    2014-01-01

    In pure stands of Alnus acuminata subsp. arguta trees from Sierra Norte de Puebla (central Mexico) two undescribed ectomycorrhizal species of Lactarius were discovered. Distinction of the two new species is based on morphological characters and supported with phylogenetic analyses of the nuclear ribosomal DNA ITS region and part of the gene that encodes for the second largest subunit of RNA polymerase II (rpb2). The phylogenies inferred recovered the two species in different clades strongly supported by posterior probabilities and bootstrap values. The new Lactarius species are recognized as part of the assemblage of ectomycorrhizal fungi associated with Alnus acuminata. Information about these taxa includes the morphological variation achieved along 16 monitories 2010-2013. Descriptions are provided. They are accompanied by photos including SEM photomicrographs of basidiospores and information on differences between them and other related taxa from Europe and the United States. © 2014 by The Mycological Society of America.

  16. Ectomycorrhizas of Cortinarius helodes and Gyrodon monticola with Alnus acuminata from Argentina.

    Science.gov (United States)

    Becerra, Alejandra; Nouhra, Eduardo; Daniele, Graciela; Domínguez, Laura; McKay, Donaraye

    2005-01-01

    Field ectomycorrhizas of Cortinarius helodes Moser, Matheny & Daniele (sp. nov) and Gyrodon monticola Sing. on Alnus acuminata Kunth (Andean alder, aliso del cerro) are described based on morphological and anatomical features. Ectomycorrhizal roots were sampled beneath fruitbodies of C. helodes and G. monticola from two homogeneous A. acuminata forest sites located in Tucuman and Catamarca Provinces in Argentina. C. helodes ectomycorrhizas showed a thick white to beige mantle exuding a milky juice when injured, were bluish toward the apex, and had hyphal strands in the mantle. G. monticola ectomycorrhizas showed some conspicuous features like highly differentiated rhizomorphs, inflated brown cells on the mantle surface, and hyaline and brown emanating hyphae with dolipores. Restriction fragment length polymorphism analysis of the nuclear rDNA internal transcribed spacer provided a distinctive profile for each of the collections of fruitbodies and the mycorrhizal morphotypes.

  17. TREATMENT OF CONDYLOMATA ACUMINATA AND BOWENOID PAPULOSIS WITH CO2 LASER AND IMIQUIMOD.

    Directory of Open Access Journals (Sweden)

    Ilko Bakardzhiev

    2012-05-01

    Full Text Available Some of the most common manifestation of Human Papilloma Virus (HPV infection in venereology are Condylomata acuminata and Bowenoid Papulosis. These diseases are often difficult to diagnose by dermatologists, obstetricians, gynecologists and urologists. This article represents our entire clinical experience with the use of carbon dioxide (CO-2 laser in the treatment of 58 (40 male and 18 female patients with Condylomata Acuminata after other treatments had failed. Successful eradication was accomplished in 53 patients with wide distribution of condylomatous lesions, with 88% per cent responding to a single laser treatment. In our experience there are no side effects, damage to the surrounding tissue is minimal and the lesions have not reccured. In 82.3% of the patients the treatment resulted in complete disappearance of the lesions, whereas in the other two to three percent treatments were required. The advantages of the laser treatment are discussed in this article.

  18. Characterization of novel microsatellite markers in Musa acuminata subsp. burmannicoides, var. Calcutta 4

    Directory of Open Access Journals (Sweden)

    Amorim Edson P

    2010-05-01

    Full Text Available Abstract Background Banana is a nutritionally important crop across tropical and sub-tropical countries in sub-Saharan Africa, Central and South America and Asia. Although cultivars have evolved from diploid, triploid and tetraploid wild Asian species of Musa acuminata (A genome and Musa balbisiana (B genome, many of today's commercial cultivars are sterile triploids or diploids, with fruit developing via parthenocarpy. As a result of restricted genetic variation, improvement has been limited, resulting in a crop frequently lacking resistance to pests and disease. Considering the importance of molecular tools to facilitate development of disease resistant genotypes, the objectives of this study were to develop polymorphic microsatellite markers from BAC clone sequences for M. acuminata subsp. burmannicoides, var. Calcutta 4. This wild diploid species is used as a donor cultivar in breeding programs as a source of resistance to diverse biotic stresses. Findings Microsatellite sequences were identified from five Calcutta 4 BAC consensi datasets. Specific primers were designed for 41 loci. Isolated di-nucleotide repeat motifs were the most abundant, followed by tri-nucleotides. From 33 tested loci, 20 displayed polymorphism when screened across 21 diploid M. acuminata accessions, contrasting in resistance to Sigatoka diseases. The number of alleles per SSR locus ranged from two to four, with a total of 56. Six repeat classes were identified, with di-nucleotides the most abundant. Expected heterozygosity values for polymorphic markers ranged from 0.31 to 0.75. Conclusions This is the first report identifying polymorphic microsatellite markers from M. acuminata subsp. burmannicoides, var. Calcutta 4 across accessions contrasting in resistance to Sigatoka diseases. These BAC-derived polymorphic microsatellite markers are a useful resource for banana, applicable for genetic map development, germplasm characterization, evolutionary studies and marker

  19. A saturated SSR/DArT linkage map of Musa acuminata addressing genome rearrangements among bananas

    Directory of Open Access Journals (Sweden)

    Matsumoto Takashi

    2010-04-01

    Full Text Available Abstract Background The genus Musa is a large species complex which includes cultivars at diploid and triploid levels. These sterile and vegetatively propagated cultivars are based on the A genome from Musa acuminata, exclusively for sweet bananas such as Cavendish, or associated with the B genome (Musa balbisiana in cooking bananas such as Plantain varieties. In M. acuminata cultivars, structural heterozygosity is thought to be one of the main causes of sterility, which is essential for obtaining seedless fruits but hampers breeding. Only partial genetic maps are presently available due to chromosomal rearrangements within the parents of the mapping populations. This causes large segregation distortions inducing pseudo-linkages and difficulties in ordering markers in the linkage groups. The present study aims at producing a saturated linkage map of M. acuminata, taking into account hypotheses on the structural heterozygosity of the parents. Results An F1 progeny of 180 individuals was obtained from a cross between two genetically distant accessions of M. acuminata, 'Borneo' and 'Pisang Lilin' (P. Lilin. Based on the gametic recombination of each parent, two parental maps composed of SSR and DArT markers were established. A significant proportion of the markers (21.7% deviated (p Conclusions We propose a synthetic map with 11 linkage groups containing 489 markers (167 SSRs and 322 DArTs covering 1197 cM. This first saturated map is proposed as a "reference Musa map" for further analyses. We also propose two complete parental maps with interpretations of structural rearrangements localized on the linkage groups. The structural heterozygosity in P. Lilin is hypothesized to result from a duplication likely accompanied by an inversion on another chromosome. This paper also illustrates a methodological approach, transferable to other species, to investigate the mapping of structural rearrangements and determine their consequences on marker

  20. Potential of Hemianax ephippiger (Odonata-Aeshnidae) nymph as predator of Fasciola intermediate host, Lymnaea natalensis

    Institute of Scientific and Technical Information of China (English)

    Aly; Younes; Hanaa; El-Sherif; Fathia; Gawish; Marwa; Mahmoud

    2015-01-01

    Objective: To evaluate the predatory capacity of the Odonata, Hemianax ephippiger nymph as a biocontrol agent for the freshwater snail Lymnaea natalensis, intermediate host of Fasciola gigantica. Methods: Observations on the searching, attacking and devouring of the snails with a series of laboratory-based predation experiments, whose aims were to determine daily predation rate, differential predation on small-, medium- and large-sized snails were carried out. Results: Laboratory evaluation revealed that, the Odonata nymph could kill and consume all three sizes of snails. Searching and handling time of the predator differed depending on snail size and predator vulnerability. The predation rate varied also with respect to snail size and density.Conclusions: Our observations suggested that the predator Hemianax ephippiger may be a suitable bio-control agent of Lymnaea natalensis snail population.

  1. Lymnaea stagnalis Snails Infection in Trematoda Larval of Shahrekord City Springs

    Directory of Open Access Journals (Sweden)

    Shahla Rivaz

    2014-03-01

    Full Text Available Abstract Background and objective: This study was established to determine the lymnaea stagnalis snails’ infection with trematodes larval stage in one of the springs of the Shahrekord city in Chahar Mahal and Bakhtiari. Materials and methods: To determine the snail infection to trematodes larval stages, the snails were caught from the field, and transferred to the Parasitology department of Razi Vaccine and Serum research Institute. Then stimulating of snails by light, tubing and squashing of them were used to detection and identification of the isolated cercariae. Results: Of 400 collected Snails from the referred springs, 320 of them identified as lymnaea stagnalis. Observed cercariae were identified and classificated as order Plagiorchis, family plagiorchiidae and genus opisthioglyphe and plagiorchis. In Chahar Mahal and Bakhtiari province due to having more than 10% of water content of country, ecological conditions can play important role to developing sensitive snail especially Lymnaeidae and be considered as a critical and suitable habitat for them.

  2. Anti-inflammatory activities, triterpenoids, and diarylheptanoids of Alnus acuminata ssp. arguta.

    Science.gov (United States)

    Aguilar, María I; Rovelo, Ricardo; Verjan, Juan G; Illescas, Oscar; Baeza, Ana E; De La Fuente, Marcela; Avila, Ileana; Navarrete, Andrés

    2011-10-01

    The main use of stem bark infusions of Alnus acuminata ssp. arguta (Schlecht.) Furlow (Betulaceae) includes treatments for acute inflammation in Mexican traditional medicine. n-Hexane (CHE), chloroform (CCE), and methanol (CME) extracts of the stem bark were investigated for anti-inflammatory activity and its safety. The anti-inflammatory effects of the orally administered CME, CCE, and CHE extracts, using carrageenan-induced rat hind paw edema model, and acute oral toxicity in mice, using Lorke's method, were determined. The column chromatographic fraction (CME-3) showed a higher anti-inflammatory activity (92.2%) (IC(50): 60.8 mg/mL) as compared with CME (76.9%); both were in the same order of magnitude as that of indomethacin, the positive control drug. Safety parameters for acute oral toxicity test showed that CME was not toxic (LD(50): >5000). Several triterpenoids (1-7) from hexane extracts and diarylheptanoids (10-14) from methanol extracts of A. acuminata ssp. arguta were isolated and characterized. These results confirm the traditional uses of A. acuminata in acute inflammatory conditions and its safety for consumption.

  3. Nitrate reductase activity and its diurnal variation rhythm for Camptotheca acuminata seedlings

    Institute of Scientific and Technical Information of China (English)

    SUNShi-qin; YANXiu-feng

    2004-01-01

    Nitrate reductase activity (NRA) in different plant organs and leaves in different positions of Camptotheca acuminata seedlings was determined by an In vivo assay, the diurnal variation rhythm of NRA in leaves of different positions was observed,and the correlations between leaf NRA, leaf area and lamina mass per unit area (LMA) were also examined. The results showed that NRA in the leaf was significantly highest, compared with that in other organs such as roots, stems and leaves. In this experiment, the 10 leaves were selected from the apex to the base of the seedlings in order. The different NRA occurred obviously in leaves of different positions of C. acuminata seedlings from the apex to the base, and NRA was higher in the 4th-6th leaves.The diurnal change rhythm of leaf NRA showed a one peak curve, and maximum NRA value appeared at about midday (at 12:30 or so). No obvious correlations between NRA and leaf area or lamina mass per unit area were observed. This study offered scientific foundation for the further research on nitrogen metabolism of C. acuminata.

  4. Climate Variability and Oceanographic Settings Associated with Interannual Variability in the Initiation of Dinophysis acuminata Blooms

    Directory of Open Access Journals (Sweden)

    Henrick Berger

    2013-08-01

    Full Text Available In 2012, there were exceptional blooms of D. acuminata in early spring in what appeared to be a mesoscale event affecting Western Iberia and the Bay of Biscay. The objective of this work was to identify common climatic patterns to explain the observed anomalies in two important aquaculture sites, the Galician Rías Baixas (NW Spain and Arcachon Bay (SW France. Here, we examine climate variability through physical-biological couplings, Sea Surface Temperature (SST anomalies and time of initiation of the upwelling season and its intensity over several decades. In 2012, the mesoscale features common to the two sites were positive anomalies in SST and unusual wind patterns. These led to an atypical predominance of upwelling in winter in the Galician Rías, and increased haline stratification associated with a southward advection of the Gironde plume in Arcachon Bay. Both scenarios promoted an early phytoplankton growth season and increased stability that enhanced D. acuminata growth. Therefore, a common climate anomaly caused exceptional blooms of D. acuminata in two distant regions through different triggering mechanisms. These results increase our capability to predict intense diarrhetic shellfish poisoning outbreaks in the early spring from observations in the preceding winter.

  5. Limnaea peregrina Clessin, 1882, Synonym of Lymnaea columella Say, 1817 (Gastropoda: Lymnaeidae

    Directory of Open Access Journals (Sweden)

    W Lobato Paraense

    1994-12-01

    Full Text Available A description is given of the shell, radula, renal region, reproductive system and egg capsules of topotypic specimens of limnaea peregrina Clessin, 1882. This investigation intends contributing to define the specific identity of that nominal species. A close anatomical comparison with Lymnaea columella Say, 1817 from Michigan, USA, shows that both forms are indistinguishable, giving support to previous inferences from some authors. Data on egg hatching are presented.

  6. The freshwater snail lymnaea rubiginosa as an experimental host of Angiostrongylus malaysiensis: a preliminary report.

    Science.gov (United States)

    Dondero, T J; Lim, B L

    1976-03-01

    Preliminary studies have shown that Lymnaea rubiginosa, a common fresh-water snail in Peninsular Malaysia, which is easily colonized and reared in the laboratory, is a capable experimental intermediate host for Angiostrongylus malaysiensis. Overall 73% of the snails tested became infected following 6 hours exposure to infective rat faeces. Higher infection rates, up to 100%, and heavier worm loads, occurred among the larger sized snails. Snail attrition was low except when very heavy worm loads were acquired.

  7. 45Ca uptake from water by snails (Lymnaea vulgaris) in control and detergent-polluted samples.

    Science.gov (United States)

    Misra, V; Lal, H; Viswanathan, P N; Murti, C R

    1984-02-01

    A biostatic assay method involving 45Ca uptake into shells and tissues of snails (Lymnaea vulgaris) in 72 hr was developed to follow the effect of detergent-polluted water on ecosystems. There was a marked decrease in the 45Ca uptake by shells and tissues of linear alkyl benzene sulfonate-exposed animals as compared to controls. No change in 45Ca uptake was observed in dead shells, thereby excluding the possibility of passive exchange.

  8. Prevalence of Fasciola in cattle and of its intermediate host Lymnaea snails in central Vietnam.

    Science.gov (United States)

    Nguyen, Sam Thi; Nguyen, Duc Tan; Van Nguyen, Thoai; Huynh, Vu Vy; Le, Duc Quyet; Fukuda, Yasuhiro; Nakai, Yutaka

    2012-12-01

    The aims of this study were to investigate the prevalence of natural Fasciola infections in both the definitive hosts (cattle) and the intermediate hosts (Lymnaea snails) in central Vietnam. A total of 1,075 fecal samples, randomly collected from cattle in Binh Dinh, Khanh Hoa, and Phu Yen provinces, were examined for Fasciola eggs by a sedimentation method. The overall prevalence of Fasciola was 45.3 %. A subset of the animals (235) was also screened for antibodies against Fasciola by an enzyme-linked immunosorbent assay. Overall, 46.3 % of these animals were shedding Fasciola eggs while 87.2 % were Fasciola seropositive. A lower prevalence of Fasciola was observed in calves ≤ 2 years of age (37.6 %) compared to that in cattle >2 years of age (53.7 %) (p Lymnaea viridis and 1.128 Lymnaea swinhoei examined, 31 (0.95 %) and seven (0.62 %), respectively, were found to be infected with Fasciola. This appears to be the first epidemiological survey of the prevalence of Fasciola in cattle and snails in these three provinces in central Vietnam.

  9. Analysis of traumatic ulcer healing time under the treatment of the Mauli banana (Musa acuminata 25% stem extract gel

    Directory of Open Access Journals (Sweden)

    Dewi Puspitasari

    2017-03-01

    Full Text Available ABSTRACT Introduction: Traumatic ulcer is one of oral disorders that often occur. The prevalence is quite high, between 3-24% of population. Therapy of traumatic ulcer is symptomatic. People usually use Aloe vera extract gel. Previous research showed that the Aloe vera gel is equivalent with ethanol extract of 25% Mauli banana (Musa acuminata stem in accelerating wound healing based on the number of macrophages and neovascular. The objective of the study is to find out the time difference of traumatic ulcer healing using 25% Musa acuminata stem extract gel compared to a gel containing Aloe vera extract. Methods: The research was post test design. Subjects were patients of Oral Medicine Installation in Gusti Hasan Aman Dental Hospital Banjarmasin with diagnosis of traumatic ulcer using completely random sampling method. Eight patients as samples were determined by the formula of Lemeshow. Results: there was no significant difference with p=0,724 (p>0,05 between healing time using Aloe vera gel and 25% Musa acuminata stem extract. Conclusion: At the concentration of 25% Musa acuminata stem extract gel concentration has the same healing time with Aloe vera gel, therefore can be recommended as a topical use for traumatic ulcer healing. Keywords: Musa acuminata stem, Healing time, Traumatic ulcer

  10. Ambang waktu pendedahan telur Lymnaea sp untuk mengamati abnormalitas embrio sebagai parameter dalam uji hayati terhadap karbamat

    Directory of Open Access Journals (Sweden)

    Hari Soepriandono

    2000-12-01

    Full Text Available The aim of this study was to know the specific expose period of the Lymnaea sp.'s embyos and their age in order to utilization eggs of Lymnaea sp. in bioassay. Fifty individuals of Lymnaea sp. collected from Gonggan River Magetan were captured in laboratory. Egg cluster of each individual then was placed in petry dish which was filled by Baycarb 500 EC of 0.0001, 0.001 and 0.01 ppm. The result showed that 12 hours exposure in Baycarb 500 EC was the effective time since within 6 hours all of embryos were death and abnormalities of the survivals was detected in the embryos of 48 and 72 hours.

  11. Heliconia acuminata reproductive success is independent of local floral density O sucesso reprodutivo de Heliconia acuminata é independente da densidade floral local

    Directory of Open Access Journals (Sweden)

    Emilio M. Bruna

    2004-09-01

    Full Text Available Reproductive plants in tropical forests are patchily distributed, with some in large aggregations of reproductive consepecifics while others are relatively isolated. This variation in floral density is hypothesized to have a major effect on plant reproductive success, since individuals in higher density neighborhoods can attract more or higher quality pollinators. We experimentally tested this hypothesis with populations of the understory herb Heliconia acuminata in central Amazonia. We created replicated plots in which reproductive plant density spanned the range of naturally occurring floral neighborhood size, then measured three surrogates of plant fitness in focal plants in each array. There was no significant difference between any of the three floral neighborhood treatments in total seed production, fruit set, or the number of seeds produced per fruit. Pollinator visitation rates to plants in all treatments were extremely low, with many plants not visited at all during the observation period. This could be because H. acuminata's hummingbird pollinators are unable to find the widely scattered reproductive plants, however this hypothesis appears unlikely. Instead, natural flowering plant densities may simply be below the threshold value at which neighborhood effects become important, even in "high-density" aggregations. Nutrient limitation, selective fruit abortion, and reproduction via male rather than female function may also be playing a role. We argue the absence of neighborhood effects may be a general phenomenon in central Amazonian forests, though additional experiments with other plant-pollinator systems are needed to determine the extent to which this hypothesis is supported.Plantas reprodutivas em florestas tropicas são distribuidas em manchas, com algumas em grandes agregações coespecíficas e outras relativamente isoladas. A hipótese é que esta variação na densidade de flores em um local tem um grande efeito no sucesso

  12. Antifungal constituents in alnus acuminata H.B.K. nodules Constituyentes antifungicos en nódulos radicales de Alnus Acuminata H.B.K.

    Directory of Open Access Journals (Sweden)

    Gonzalez Jaime

    1988-12-01

    Full Text Available Alnus acuminata. H.B.K. is a native specimen of economic importance. that is characterized for having root nodules
    that can fix nitrogen. The nodules chemical composition has not been sstablished, but, it has been seen that it has influence over the soil microflora. In order to establish the chemical composition and the activity of the obtained fractions, there were made extractions of the alder nodules. The insulated compounds were; xylose and ribose; an aromatic carboxylicaeid, an fatty aeid, an phenolic biarylheptanoid and a flavonoid glycosic. were also founded. The Fusarium oxysporum and Pythium sp. growing was inhibited by this last one sustance.Alnus acuminata. H.B.K. es una especie nativa de importancia económica que se caracteriza por tener nódulos radicales
    fijadores de nitrógeno. La composición química de los nódulos no se ha establecido; sin embargo, se ha observado que actúa sobre la microflora del suelo. Con el fin de establecer la composición química de las fracciones obtenidas, se.realizaron extracciones a partir de nódulos de Aliso. Los compuestos
    aislados 'fueron: xilosa y ribosa; además se caracterizaron un ácido carboxílico aromático, un ácido graso, un biariheptanoide
    fenólico y un glicósido de flavonoide. Esta última sustancia inhibió el crecimiento de Fusarium oxvsporum y Pythium sp.

  13. The natural impact of banana inflorescences (Musa acuminata on human nutrition

    Directory of Open Access Journals (Sweden)

    Catharina E. Fingolo

    2012-12-01

    Full Text Available Banana inflorescences are popularly known as 'navels,' and they are used in Brazil as nutritional complements. However, the nutritional value of banana inflorescences (male flowers and bracts has never been studied. Therefore, plant material of Musa acuminata, cultivar "ouro", was collected in Rio de Janeiro state, Brazil, and then submitted to chemical procedures to determine its nutritional composition. The experiment was arranged a completely randomized design and performed in triplicate. The sample composition analysis showed percentual average value for moisture, protein, fat and ash as 8.21, 14.50, 4.04 and 14.43, respectively. The dehydrated inflorescences were found to contain a significant nutritive complement based on their high content of potassium (5008.26 mg / 100 g and fiber 49.83% (lignin, cellulose and hemicelluloses revealing important functional and nutritional properties. In a parallel evaluation, the anatomical study revealed key elements for the recognition of Musa acuminata when reduced to fragments.Inflorescências de bananeira são popularmente conhecidas como "umbigos", e esses são usados no Brasil como complementos nutricionais. No entanto, o valor nutricional das inflorescências (flores masculinas e brácteas de bananeira nunca foi estudado. Portanto, o material vegetal de Musa acuminata cultivar "ouro" foi coletado no Rio de Janeiro, Brasil e, em seguida, submetido aos procedimentos químicos para determinar a sua composição nutricional. As análises foram realizadas em triplicata. A análise da composição da amostra apresentou teor percentual médio de umidade, proteína, lipídeos e cinza de 8,21, 14,50, 4,04 e 14,43, respectivamente. As inflorescências secas mostraram significativo complemento nutritivo baseado no alto conteúdo de potássio (5.008,26 mg / 100 g e de fibra 49,83% (lignina, celulose e hemiceluloses revelando importantes propriedades funcional e nutritiva. Em uma avaliação paralela, o estudo

  14. Maternal inheritance of chloroplast genome and paternal inheritance of mitochondrial genome in bananas (Musa acuminata).

    Science.gov (United States)

    Fauré, S; Noyer, J L; Carreel, F; Horry, J P; Bakry, F; Lanaud, C

    1994-03-01

    Restriction fragment length polymorphisms (RFLPs) were used as markers to determine the transmission of cytoplasmic DNA in diploid banana crosses. Progenies from two controlled crosses were studied with heterologous cytoplasmic probes. This analysis provided evidence for a strong bias towards maternal transmission of chloroplast DNA and paternal transmission of mitochondrial DNA in Musa acuminata. These results suggest the existence of two separate mechanisms of organelle transmission and selection, but no model to explain this can be proposed at the present time. Knowledge of the organelle mode of inheritance constitutes an important point for phylogeny analyses in bananas and may offer a powerful tool to confirm hybrid origins.

  15. COMPARISON BETWEEN IMMUNOFLUORESCENCE AND PCR IN DETECTING HUMAN PAPILLOMA VIRUS IN CONDYLOMA ACUMINATA

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Objective To compare the effectiveness of immunofluorescence and polymerase chain reaction (PCR) in detecting human papilloma virus (HPV) in condyloma acuminata (CA).Methods HPVs in CA tissues from 60 patients were detected by immunofluorescence and PCR, respectively. Different subtypes of HPVs were also identified with restriction fragment length polymorphism (RFLP).Results The positive detective rates of immunofluorescence and PCR were 56. 67 % (34/60) and 96.67 % (58/60), respectively (P<0.01). RFLP results showed HPV6 and HPVl1 were the main subtypes in the detected virus,which accounted for 98. 28 %.Conclusion The sensibility of PCR is superior to that of immunofluorescence.

  16. New camptothecin and ellagic acid analogues from the root bark of Camptotheca acuminata.

    Science.gov (United States)

    Zhang, Zhizhen; Li, Shiyou; Zhang, Shanmin; Liang, Chun; Gorenstein, David; Beasley, R Scott

    2004-12-01

    As part of a study on chemical constituents of Camptotheca species, one new natural camptothecin analogue (2), two new alkaloids (3, 4), one new ellagic acid analogue (5), and 19 known compounds (1, 6-23) have been isolated from the root bark, stem bark, fruits, and leaves of Camptotheca acuminata Decaisne. The structures of 2-5 were determined from spectral data to be 10-methoxy-20-O-acetylcamptothecin (2), 20-O-beta-glucopyranosyl 18-hydroxycamptothecin (3), 20-formylbenz indolizino [1,2-b]quino-line-11(13H)-one (4), and 3,4-methylenedioxy-3'-O-methyl-5'-hydroxyellagic acid (5).

  17. A Lymnaea stagnalis Embryo Test for Toxicity Bioindication of Acidification and Ammonia Pollution in Water

    Directory of Open Access Journals (Sweden)

    Robert Mazur

    2016-07-01

    Full Text Available The paper presents a study leading to a new acute toxicity test on embryonic and juvenile organisms of the great pond snail (Lymnaea stagnalis Linnaeus. Sulfuric acid, nitric acid, and ammonium hydroxide were used as waterborne toxicants in laboratory experiments. The exposure time was 24 h. Tests were conducted in 5–10 replications for each toxicant. The toxicity of the substances was classified according to different scales and the test’s sensitivity was compared to that of the commonly used bioindicator Daphnia magna Straus. The assessment of toxicity impact was supported by microscopic observations. The probit method was used as a parametric statistical procedure to estimate LC50 and the associated 95% confidence interval. Our study showed that the early developmental stages of Lymnaea stagnalis are very sensitive bioindicators, making it possible to detect even very low levels of the above-mentioned water toxicants. The highest toxicity is shown by ammonium hydroxide with LC50/24h values, respectively, 24.27 for embryos and 24.72 for juvenile forms, and the lowest is shown by nitric acid ions with LC50/24h values, respectively, 105.19 for embryos and 170.47 for juvenile forms. It is highly cost-effective due to simple and efficient breeding and the small size of the organisms in the bioassay population. Compared with Daphnia magna, relatively low concentrations of toxicants caused a lethal effect on embryonic and juvenile organisms of the great pond snail. Owing to their common occurrence and sensitivity, early developmental forms of Lymnaea stagnalis can be a valuable new tool in biomonitoring of the freshwater environment.

  18. Oxidative stress and genotoxic effect of zinc oxide nanoparticles in freshwater snail Lymnaea luteola L.

    Science.gov (United States)

    Ali, Daoud; Alarifi, Saud; Kumar, Sudhir; Ahamed, Maqusood; Siddiqui, Maqsood A

    2012-11-15

    Understanding the toxic effects of nanoparticles on aquatic organism is the biggest obstacle to the safe development of nanotechnology. However, little is known about the toxic mechanisms of zinc oxide nanoparticles (ZnONPs) in freshwater snail Lymnaea luteola (L. luteola). This study was designed to investigate the possible mechanisms of genotoxicity induced by ZnONPs in freshwater snail L. luteola. ZnONPs (32 μg/ml) elicited a significant (psnail L. luteola may be used as suitable test model for nanoecotoxicological studies in future.

  19. An octopaminergic system in the CNS of the snails, Lymnaea stagnalis and Helix pomatia

    OpenAIRE

    1998-01-01

    Octopamine (OA) levels in each ganglion of the terrestrial snail, Helix pomatia, and the pond snail, Lymnaea stagnalis, were measured by using the HPLC technique. In both species an inhomogeneous distribution of OA was found in the central nervous system. The buccal ganglia contained a concentration of OA (12.6 pmol mg-1 and 18.8 pmol mg-1) that was two to three times higher than the pedal (4.93 pmol mg-1 and 9.2 pmol mg-1) or cerebral (4.46 pmol mg-1 and 4.9 pmol mg-1) ganglia of Helix and L...

  20. Giant Condyloma Acuminata in Indonesian Females with SLE under Immunosuppressant and Steroid Therapy

    Directory of Open Access Journals (Sweden)

    Andhika Rachman

    2016-01-01

    Full Text Available Introduction. Immunosuppressant and steroid therapy in systemic lupus erythematosus (SLE increases the risk of human papillomavirus (HPV infections, one of which is giant condyloma acuminata (GCA. To our knowledge, there is no report evaluating the correlation between immunosuppressive and steroid therapy in patients with SLE and the prevalence of GCA. Case Report. A 42-year-old female was diagnosed with SLE a year ago and has been treated with steroids and immunosuppressive drugs. In the last few months she presented GCA involving the genital area recurring almost every two months. Type 6 and 11 HPVs were identified in vulva, vagina, and cervix. Methods. PubMed, EBSCO, and Cochrane Library literature were searched from inception to July 2015. Authors screened all titles and abstracts and read full text article, and two case-control studies were found relevant. Results. SLE patients in both studies were under immunosuppressive and steroid therapy. Condyloma acuminata was diagnosed at 108 months (latest and 1 month (earliest after SLE. Type 6, 11, 16, 42, and oncogenic group of HPV were identified. Conclusions. GCA is a type of HPV infection seldom observed in SLE patients. Therefore, their correlation is still unclear. Period of time since SLE was diagnosed and GCA varies from months to years. A more thorough physical and laboratory examination leading to HPV and other infectious disease is recommended.

  1. EXTRACTION AND QUANTITATIVE DETERMINATION OF ASCORBIC ACID FROM BANANA PEEL MUSA ACUMINATA ‘KEPOK’

    Directory of Open Access Journals (Sweden)

    Khairul Anwar Mohamad Said

    2016-04-01

    Full Text Available This paper discusses the extraction of an antioxidant compound, which is ascorbic acid or vitamin C, from a banana peel using an ultrasound-assisted extraction (UAE method. The type of banana used was Musa acuminata also known as “PisangKepok” in Malaysia. The investigation includes the effect of solvent/solid ratio (4.5, 5 g and 10  ml/g, sonication time (15, 30 and 45 mins and temperature variation (30 , 45  and 60oC on the extraction of ascorbic acid compounds from the banana peel to determine the best or optimum condition of the operation. Out of all extract samples analyzed by redox titration method using iodine solution, it was found that the highest yield was 0.04939 ± 0.00080 mg that resulted from an extraction at 30oC for 15 mins with 5 ml/g solvent-to-solute ratio.KEYWORDS:  Musa acuminata; ultrasound-assisted extraction; vitamin C; redox titration

  2. Condylomata acuminata of the urinary bladder. Natural history, viral typing, and DNA content.

    Science.gov (United States)

    Del Mistro, A; Koss, L G; Braunstein, J; Bennett, B; Saccomano, G; Simons, K M

    1988-03-01

    Three patients with condylomata acuminata of the urinary bladder are reported. Two of the patients were immunosuppressed, and one had longstanding extensive condylomata acuminata of the external genitalia and adjacent areas. All lesions recurred at least once and were difficult to treat. The diagnosis was confirmed by in situ hybridization on archival material with human papillomavirus (HPV) DNA probes under stringent conditions. In two of the patients, probes for HPV types 6 and 11 were positive; HPV 11 only was identified in one patient. Probes for HPV types 16 and 18 and pBR322 vector controls were negative. In one patient with a strong hybridization signal, the lesion was also positive for common papillomavirus antigen. DNA content measured by cytophotometry of Feulgen-stained whole nuclei isolated from lesions in two patients revealed a markedly aneuploid DNA pattern. Whether this is a factor in the behavior of the lesions is not known at this time. Although rare, HPV infection of the urinary bladder may result in widespread condylomatosis and may mimic giant condylomas of Buschke-Löwenstein or even verrucous carcinomas, sometimes necessitating radical treatment. Nevertheless, until there is proof to the contrary, the lesions must be considered benign and should not be confused with squamous cancer of the bladder.

  3. TLMA Expression in Condyloma Acuminata from Patients with High and Low Risk HPV

    Institute of Scientific and Technical Information of China (English)

    涂亚庭; 陈善娟; 范超; 林能兴; 刘厚君; 刘志香

    2002-01-01

    Objective: To detect the activated expression oftelomerase in condyloma acuminata lesions in low-risk (6/11)and high-risk (16/18) human papilloma virus (HPV)infection and examine the role played by telomerase in theoccurrence, development and carcinomatous change ofcondyloma acuminata. Methods: Assaying the expression of telomerase and thetype of HPV in damaged skin of 42 CA patients and normalskin of 30 healthy control individuals through telomeraserepeat amplification protocol (TRAP) and polymerase chainreaction (PCR). Results: In all the normal skin controls, PCR for HPV wasnegative and only 16.7% of samples were positive for TLMAexpression; in CA lesions, HPV testing was positive in all (32cases were low-risk, 3 were high-risk, and 7 were of mixedtype) and all were positive for TLMA expression. Conclusion: TLMA may be activated by HPV infection,and in turn cause the hyperplasia of epidermal cells. It wasalso indicated that HPV, especially high risk types, canactivate TLMA. The activation of TLMA may play animportant role in abnormal hyperplasia and carcinomatouschanges in CA lesions.

  4. 5-aminolaevulinic Acid-photodynamic Therapy for the Treatment of Cervical Condylomata Acuminata

    Institute of Scientific and Technical Information of China (English)

    Yong-xin Liu; He-yi Zheng; Xiu-rong Liu

    2009-01-01

    Objective To investigate the efficacy and safety of photodynamic therapy(PDT)with topical 5-aminolaevulinic acid(ALA)on cervical condylomata acuminata.Methods Patients with cervical condylomata(n=30)were allocated into primary and recurrent group,and were given topical ALA under occlusive dressing for 3 hours followed by irradiation with semiconductor laser at a dose of 100 Jcm2 and a power of 100 mW.The treatment was repeated 7 days later if the lesion was not completely removed after the first treatment.Complete response rate and recurrence rate of wart lesions as well as rate of adverse reaction were analyzed.Results The total complete response rate of PDT was 100% and the total recurrence rate was 5% after 3 months of follow-up.Recurrence rate of recurrent group was significantly lower than that of prior managements(100% ,P<0.01).The side effects of PDT in patients mainly included mild burning and/or stinging restricted to the illuminated areas,and was significant lower than their own control(25% vs.100% ,P<0.05).Conclusion Compared with conventional therapies,topical application of ALA-PDT is a simple,effective,safe,well-tolerated,and low recurrence rate treatment for cervical condylomata acuminata.

  5. Optimization of ultrasound-assisted extraction of camptothecin from Camptotheca acuminata seeds

    Institute of Scientific and Technical Information of China (English)

    JING Li-jia; LI Si-yang; CHANG Zui; WANG Yang; YAN Xiu-feng

    2011-01-01

    Naturally occurring camptothecin (CPT) is an important source of chemotherapeutic agents. The extraction from Camptotheca acuminata is still the main approach to obtain CPT compared with total synthesis. In the present study, ultrasound-assisted extractions (UAE) of CPT from C. acuminata seeds with alkaline solutions were investigated and CPT yield were determined by High Performance Liquid Chromatography. The conditions of alkaline species and concentrations, extraction time, extraction temperature and ultrasonic power were optimized.Results show that both Na3PO4 and Na2CO3 solutions gain good extraction yields, whereas Na3PO4 solution has stronger basicity and need higher concentration than Na2CO3 solution does, thus aqueous Na2CO3 is more beneficial for the extraction. The optimal condition was ultrasonically extracted with 0.5% aqueous Na2CO3 at 50℃ and ultrasonic power of 400 W for 60 min. Comparing with UAE with ethanol, the extraction with 0.5% Na2CO3 solution achieves higher yield. Moreover, aqueous Na2CO3 as a solvent has various advantages including non-toxicity, inflammable, non-corrosive and low cost, which ensure this UAE method is a superior method with high utilizing prospect.

  6. Effects of Aqueous Stem Extract of Massularia Acuminata on Some Liver Function Indices of Male Rats

    Directory of Open Access Journals (Sweden)

    Musa Toyin Yakubu

    2012-09-01

    Full Text Available Background: Massularia acuminata has been claimed to be used in managingseveral ailments in folk medicine and in some instances substantiated withscientific data. This however has been without recourse to its safety. Therefore,aqueous stem extract of M. acuminata was evaluated for its effects on somefunction indices of the liver of male rats.Methods: Sixty, male rats were grouped into 4 (A, B, C and D such that Group A(control was orally administered 1cm3 of distilled water while those in groups B, Cand D received orally 1 cm3 of extract corresponding to 250, 500 and 1000 mg/kgbody weight respectively. Some biochemical parameters of liver function wereevaluated in the animals after 1, 7 and 21 daily doses.Results: The extract significantly decreased (P<0.05 the activity of alkalinephosphatase in the liver of rats throughout the experimental period. This decreasewas accompanied by corresponding increase in the serum enzyme. In contrast, allthe doses of the extract increased the activities of both the AST and ALT in the liverand serum aspartate aminotransferase and alanine aminotransferase as well asthe concentrations of serum total bilirubin, protein and albumin.Conclusion: This study has revealed that the aqueous stem extract of Massulariaacuminata at the doses of 250-1000 mg/kg body weight hampered the normalfunctioning of the liver of male rats and is therefore not safe for oral consumption atthe doses investigated.

  7. Giant Condyloma Acuminata in Indonesian Females with SLE under Immunosuppressant and Steroid Therapy

    Science.gov (United States)

    2016-01-01

    Introduction. Immunosuppressant and steroid therapy in systemic lupus erythematosus (SLE) increases the risk of human papillomavirus (HPV) infections, one of which is giant condyloma acuminata (GCA). To our knowledge, there is no report evaluating the correlation between immunosuppressive and steroid therapy in patients with SLE and the prevalence of GCA. Case Report. A 42-year-old female was diagnosed with SLE a year ago and has been treated with steroids and immunosuppressive drugs. In the last few months she presented GCA involving the genital area recurring almost every two months. Type 6 and 11 HPVs were identified in vulva, vagina, and cervix. Methods. PubMed, EBSCO, and Cochrane Library literature were searched from inception to July 2015. Authors screened all titles and abstracts and read full text article, and two case-control studies were found relevant. Results. SLE patients in both studies were under immunosuppressive and steroid therapy. Condyloma acuminata was diagnosed at 108 months (latest) and 1 month (earliest) after SLE. Type 6, 11, 16, 42, and oncogenic group of HPV were identified. Conclusions. GCA is a type of HPV infection seldom observed in SLE patients. Therefore, their correlation is still unclear. Period of time since SLE was diagnosed and GCA varies from months to years. A more thorough physical and laboratory examination leading to HPV and other infectious disease is recommended. PMID:27843658

  8. A new bioactive thiophenolic glycoside from the leaf of Massularia acuminata (g. Don Bullock) ex Hoyle (Rubiaceae).

    Science.gov (United States)

    Oriola, A O; Aladesanmi, A J; Idowu, T O; Akinkunmi, E O; Obuotor, E M; Ogunsina, M O

    2014-01-01

    Massularia acuminata is a small tree or shrub of tropical rainforest. The leaves are used in Nigerian ethno-medicine for the treatment of microbial infections and pharmacological report suggested the leaf extract as possessing antioxidant activity. This study was therefore carried out to determine the most antioxidant and antimicrobial active fraction(s) of Massularia acuminata leaf and the constituent(s) responsible for the activities. The leaf of Massularia acuminata was investigated for in vitro antioxidant and antimicrobial activities, using a 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging assay and agar dilution method respectively. The ethyl acetate fraction demonstrated the best activities among the partitioned fractions tested. Bioassay guided purification of the most active ethyl acetate fraction led to isolation of a new thiophenolic glycoside, characterized as 4-(3',3'-dihydroxy-1-mercaptopropyl)phenyl glycosylpyranoside. The isolated compound from the leaf of Massularia acuminata demonstrated antioxidant and antimicrobial activities and may be responsible for the activities of leaf extract and its ethyl acetate fraction, hence this may justify its ethnomedicinal use.

  9. Analysis of expressed sequence tags from Musa acuminata ssp. burmannicoides, var. Calcutta 4 (AA) leaves submitted to temperature stresses

    NARCIS (Netherlands)

    Santos, C.R.; Martins, N.F.; Horberg, H.M.; Almeida, E.R.P.; Coelho, M.C.F.; Togawa, R.; Silva, F.R.; Caetano, A.R.; Miller, R.N.G.; Souza, M.T.

    2005-01-01

    In order to discover genes expressed in leaves of Musa acuminata ssp. burmannicoides var. Calcutta 4 (AA), from plants submitted to temperature stress, we produced and characterized two full-length enriched cDNA libraries. Total RNA from plants subjected to temperatures ranging from 5°C to 25°C and

  10. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

  11. Food intake, growth, and reproduction as affected by day length and food availability in the pond snail Lymnaea stagnalis

    NARCIS (Netherlands)

    Maat, ter A.; Zonneveld, C.; Visser, de J.A.G.M.; Jansen, R.F.; Montagne-Wajer, K.; Koene, J.M.

    2007-01-01

    With the aim of integrating the physiology and evolutionary ecology of Lymnaea stagnalis (Linnaeus, 1758), we studied the effects of day length and food availability on the energy budget. Snails were assigned to two different photoperiods and three levels of food availability. The snails were kept i

  12. Food intake, growth, and reproduction as affected by day length and food availability in the pond snail Lymnaea stagnalis

    NARCIS (Netherlands)

    Maat, ter A.; Zonneveld, C.; Visser, de J.A.G.M.; Jansen, R.F.; Montagne-Wajer, K.; Koene, J.M.

    2007-01-01

    With the aim of integrating the physiology and evolutionary ecology of Lymnaea stagnalis (Linnaeus, 1758), we studied the effects of day length and food availability on the energy budget. Snails were assigned to two different photoperiods and three levels of food availability. The snails were kept

  13. Determination of the infection of Lymnaea-gedrosina to trematodes Larval in the water region of Khuzestan

    Directory of Open Access Journals (Sweden)

    Shamsi Noorpisheh

    2011-06-01

    Full Text Available Background & Objective: The province of Khuzestan with its wide geographical area and its tropical climate is susceptible for the maintenance of snails. One of the prevalent intermediate hosts for trematode in this area is the gasteropode snail, Lymnaea gedrosina. This study is the first research, undertaken to determine the infection rate, biological characteristics and Longevity Lymnaea gedrosina. Materials & Methods: A total of 6213 snails (Lymnaea gedrosina were examined, 770 snails were kept in identical natural condition in a set of several water bodies. Using two methods of cercarial shedding by light and crushing of snails were identified. Results: Overall, 107 snails (5% were infected with trematodes larval. The maximum and minimum infection rate Maravaneh 4, (44% - Ahvaz, Dezfull including Anjirak and Sidnoor (1.7% and 1% respectively. In addition, the maximum and minimum longevity time per Lymnaea gedrosina were respectively found to be in the spring and autumn. Conclusion: The results of this study could be utilized to plan control intermediate disease snails for the purpose of sanitation in the Khuzestan Province.

  14. Lymnaea columella: two new Brazilian localities in the states of Amazonas and Bahia

    Directory of Open Access Journals (Sweden)

    W. Lobato Paraense

    1986-03-01

    Full Text Available The occurrence of Lymnaea columella is recorded in Tefé, Amazonas state, where it was found together with Drepanotrema anatinum, Physa marmorata and pomacea sp. L. columella was also collected in Salvador, Bahia state, at the dique do Tororó, an urban lake formely mentioned (as "lac Baril" by Moricand (1853 as a breeding-place of Biomphalaria glabrata, Drepanotrema cimex, D. depressissimum, Pomacea lineata, P. decussata and Ancylus moricandi. The four first-mentioned species, as well as physa cubensis and Hemisinus brasiliensis, were also collected now. This is the first record of a lymnaeid in the Northeastern region of Brazil.É registrada a ocorrência de Lymnaea columella em Tefé, Estado do Amazonas, onde foi encontrada juntamente com Physa marmorata e Pomacea sp. L. columella foi também coletada em Salvador, Estado da Bahia, no Dique do Tororó, lago urbano antes mencionado por Moricand (1853 como criadouro de Biomphalaria glabrata, Drepanotrema cimex, D. depressissimum, Pomacea lineata, P. decussata e Ancylus moricandi. As quatro primeiras espécies mencionadas, assim como Physa cubensis e Hemisinus brasiliensis, também foram agora coletadas. Este é o primeiro registro de um limneídeo na região Nordeste do Brasil

  15. Experimental Infection of Lymnaea ollula in Japan with Fasciola hepatica from the U.S.A.

    OpenAIRE

    Kawano, Junichi; Shimizu, Akira; Uji, Tatsuya; Kimura, Shige

    1987-01-01

    アメリカ産肝蛭(Fasciola hepatica)を日本産ヒメモノアラガイ(Lymnaea ollula)に感染させ, 感染後の発育について検討した。感染ミラシジウムはスポロシスト, レジアに順次発育し, 感染後36日及び62日にセルカリアの遊出が認められた。このことより, 日本産ヒメモノアラガイはアメリカ産肝蛭の中間宿主となり得ることが判明した。 / Snails of Lymnaea ollula in Japan were exposed to the miracidia of Fasciola hepatica obtained from the U.S.A. Larval development of F. hepatica, from the sporocyst to the redia, was observed in the infected snails. Cercariae were emerged from the snails on the 36th and 62nd post infection days. L. ollula in Japan may...

  16. Statistical refinements for data analysis of mollusc reproduction tests: an example with Lymnaea stagnalis

    DEFF Research Database (Denmark)

    Holbech, Henrik

    Since 2012, European experts work towards the development and validation of an OECD test guideline for mollusc reproductive toxicity with the freshwater gastropod Lymnaea stagnalis. A ring-test involving six laboratories allowed studying reproducibility of results, based on survival and reproduct......Since 2012, European experts work towards the development and validation of an OECD test guideline for mollusc reproductive toxicity with the freshwater gastropod Lymnaea stagnalis. A ring-test involving six laboratories allowed studying reproducibility of results, based on survival...... and reproduction data of snails monitored over 56 days exposure to cadmium. A classical statistical analysis of data was initially conducted by hypothesis tests and fit of parametric concentrationresponse models. However, as mortality occurred in exposed snails, these analyses require to be refined, particularly...... was twofold. First, we refined the statistical analyses of reproduction data accounting for mortality all along the test period. The variable “number of clutches/eggs produced per individual-day” was used for EC x modelling, as classically done in epidemiology in order to account for the time...

  17. Ocorrência de Lymnaea columella (Gastropoda: Lymnaeidae), hospedeiro intermediário da Fasciola hepatica, para o Estado da Paraíba, Brasil

    OpenAIRE

    Francisco José Pegado Abílio; Takako Watanabe

    1998-01-01

    Foi registrada a ocorrência de Lymnaea columella (Gastropoda: Lymnaeidae), primeiro hospedeiro intermediário da Fasciola hepatica, para o Estado da Paraíba, Brasil, associado a macrófitas aquáticas.The occurrence of Lymnaea Columella (Gastropoda: Lymnaeidae), first intermediate host of Fasciola hepatica, is recorded for the first time in the state of Paraíba, Brazil, associeted with aquatic macrophytes.

  18. Assessment of factors affecting in vitro shoot regeneration from axillary bud explant of Camptotheca acuminata

    Institute of Scientific and Technical Information of China (English)

    WANG Hui-Mei; ZU Yuan-Gang; DONG Feng-Li; ZHAO Xiao-Ju

    2005-01-01

    Axillary buds from 3-yr.-old seedlings of Camptotheca acuminata in the greenhouse were cultured on the different basal media with different concentrations of growth regulators for shoot regeneration for studying the effects of different basal media, different concentrations of growth regulators (BA or TDZ), sucrose, agar and pH value on shoot regeneration from axillary bud. The results showed that B5 and WPM media were the optimal basal media and the optimal phyotohormone was BA of 1.0 mg/L or TDZ of 0.1mg/L; The concentrations of sucrose of 30g/L and agar of 6g/L were most suitable for the shoot regeneration; pH value from 5.8 to 6.6 were broadly effective, but the best at pH 5.8.

  19. Description and identification of Alnus acuminata ectomycorrhizae from Argentinean alder stands.

    Science.gov (United States)

    Pritsch, Karin; Becerra, Alejandra; Põlme, Sergei; Tedersoo, Leho; Schloter, Michael; Agerer, Reinhard

    2010-01-01

    The objective of this study was to describe the morphological and anatomical features of five unidentified ectomycorrhizal types of Alnus acuminata and to complement their identification based on ITS-rDNA sequence analysis. The combined approach of morphotyping and sequence analysis based on ITS sequence comparison with sequences contained in GenBank and the UNITE database let us assign three of the five field-collected ectomycorrhiza morphotypes to the tomentella-thelephora lineage that closely matched European and North American species. The sequencing results within Tomentella point toward alder specific clades within T. sublilacina, T. ellisii and T. stuposa sensu lato. The two other EcM morphotypes matched Lactarius omphaliiformis and a Russula sp. Better focused, concomitant fruit body surveys are needed for accurate identification of South American ectomycorrhizal fungi because of the evidence of cryptic speciation in both agaricoid and resupinate mycobionts.

  20. A molecular marker-based linkage map of diploid bananas (Musa acuminata).

    Science.gov (United States)

    Fauré, S; Noyer, J L; Horry, J P; Bakry, F; Lanaud, C; Gońzalez de León, D

    1993-12-01

    A partial molecular linkage map of the Musa acuminata diploid genome is presented. This map is based on 58 RFLP, four isozyme and 28 RAPD markers segregating in an F2 population of 92 individuals. A total of 90 loci was detected, 77 of which were placed on 15 linkage groups while 13 segregated independently. Segregation distortions were shown by 36% of all loci, mostly favoring the male parent. Chromosome structural rearrangements were believed to be one of the main causes of these distortions. The use of genetic linkage data to further the genetic and evolutionary knowledge of the genus Musa, as well as to help improve the design of breeding strategies, is discussed.

  1. Mechanism of Infrared Detection and Transduction by Beetle Melanophila Acuminata In memory of Jerry Wolken

    Institute of Scientific and Technical Information of China (English)

    Meir Israelowitz; Jeong-Ah Kwon; Syed W. H. Rizvi; Christoph Gille; Herb P. von Schroeder

    2011-01-01

    The Melanophila acuminata beetle is attracted to forest fires via a pair of infrared sensory organs composed of sensilla. Our histological work showed that each sensillum contains lipid layers surrounding a protein layer and a unique polysaccharide base that is associated with a neuron to each sensillum. Infrared microscopy showed that the protein region maximally absorbs infrared radiation at 3 μm wavelength and at 10 μm, which corresponds to the known radiation produced by forest fires at 3 μm.Mathematical calculations showed that the physical properties of the sensilla are such that the expected temperature rise is insufficient for transduction of the infrared signal through mechanical means or as a thermal receptor as previously thought;hence the protein plays the pivotal role in perception of single photons and transmission of the signal within the sensilla.

  2. Controlled green synthesis of silver nanoparticles by Allium cepa and Musa acuminata with strong antimicrobial activity

    Science.gov (United States)

    Sahni, Geetika; Panwar, Amit; Kaur, Balpreet

    2015-02-01

    A controlled "green synthesis" approach to synthesize silver nanoparticles by Allium cepa and Musa acuminata plant extract has been reported. The effect of different process parameters, such as pH, temperature and time, on synthesis of Ag nanoparticles from plant extracts has been highlighted. The work reports an easy approach to control the kinetics of interaction of metal ions with reducing agents, stabilized by ammonia to achieve sub-10 nm particles with narrow size distribution. The nanoparticles have been characterized by UV-Visible spectra and TEM analysis. Excellent antimicrobial activity at extremely low concentration of the nanoparticles was observed against Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis and Fusarium oxysporum which may allow their exploitation as a new generation nanoproduct in biomedical and agricultural applications.

  3. Corrosion Inhibition Studies of Mild Steel in Acid Medium Using Musa Acuminata Fruit Peel Extract

    Directory of Open Access Journals (Sweden)

    N. Gunavathy

    2012-01-01

    Full Text Available The inhibition effect of unripe fruit peel extract of Musa acuminata (Cultivar variety – Nendran (MNP on corrosion of mild steel in 1 N HCl has been investigated by weight loss and electrochemical impedance spectroscopy (EIS with various concentrations of the extract. The effect of temperature on the corrosion inhibition of mild steel in the temperature range of 30°C – 80°C was carried out. The results indicate that MNP extract act as an effective inhibitor in the acid environment and is of mixed type inhibitor having efficiency as high as 96% at 2% inhibitor concentration. The inhibition efficiency of MNP extract increases with the increase of concentration but decreases with the increase in temperature. The inhibitor achieves its inhibition by physical adsorption of nutrients of the peel extract on the surface of the mild steel. The experimental data revealed that the adsorption occurred according to the Langmuir and Temkin adsorption isotherm.

  4. Relationship Between Apoptosis and PCNA Expression of Keratinocytes in Condylomata Acuminata

    Institute of Scientific and Technical Information of China (English)

    樊翌明; 马泽粦; 冯进云; 吴志华; 李顺凡

    2002-01-01

    Objective: To investigate the relationship betweenapoptosis and proliferating cell nuclear antigen (PCNA)expression of keratinocytes in Condylomata acuminata (CA). Methods: PCNA expression was observed byimmunohistochemistry technique (ABC method) in 51 CAspecimens and 18 normal specimens of foreskin or vaginalmucosae. 55 specimens (40 in the CA group and 15 in thecontrol group) were randomly sampled for in situ labelingof apoptotic cells using the TUNEL method. Results: Positive expression of PCNA in CA and controlgroups were 90.2% and 77.8%, respectively, and theproliferation index in CA group was significantly higherthan that in the control group (P0.05). The proliferation indexshowed a significant negative correlation with theapoptosis-proliferation ratio (r=-0.62, P=0.01) in the CAgroup. Conclusion: It is suggested that the proliferativeappearance of CA could be due to the imbalance betweencell growth and cell death which is caused by moreproliferation and less apoptosis in keratinocytes.

  5. Low plant density enhances gene dispersal in the Amazonian understory herb Heliconia acuminata.

    Science.gov (United States)

    Côrtes, Marina C; Uriarte, María; Lemes, Maristerra R; Gribel, Rogério; Kress, W John; Smouse, Peter E; Bruna, Emilio M

    2013-11-01

    In theory, conservation genetics predicts that forest fragmentation will reduce gene dispersal, but in practice, genetic and ecological processes are also dependent on other population characteristics. We used Bayesian genetic analyses to characterize parentage and propagule dispersal in Heliconia acuminata L. C. Richard (Heliconiaceae), a common Amazonian understory plant that is pollinated and dispersed by birds. We studied these processes in two continuous forest sites and three 1-ha fragments in Brazil's Biological Dynamics of Forest Fragments Project. These sites showed variation in the density of H. acuminata. Ten microsatellite markers were used to genotype flowering adults and seedling recruits and to quantify realized pollen and seed dispersal distances, immigration of propagules from outside populations, and reproductive dominance among parents. We tested whether gene dispersal is more dependent on fragmentation or density of reproductive plants. Low plant densities were associated with elevated immigration rates and greater propagule dispersal distances. Reproductive dominance among inside-plot parents was higher for low-density than for high-density populations. Elevated local flower and fruit availability is probably leading to spatially more proximal bird foraging and propagule dispersal in areas with high density of reproductive plants. Nevertheless, genetic diversity, inbreeding coefficients and fine-scale spatial genetic structure were similar across populations, despite differences in gene dispersal. This result may indicate that the opposing processes of longer dispersal events in low-density populations vs. higher diversity of contributing parents in high-density populations balance the resulting genetic outcomes and prevent genetic erosion in small populations and fragments.

  6. Variación del contenido foliar de nutrimentos de alnus acuminata

    Directory of Open Access Journals (Sweden)

    Manuel Segura

    2006-01-01

    Full Text Available Se encontró que la posición de las muestras en la copa provenientes de árboles de 3 y 5 años de A. acuminata no afecta la concentración foliar para la mayoría de los nutrimentos de manera significativa. La única excepción la constituye el Ca en árboles de 5 años, cuya concentración en la parte alta fue menor que en la parte media de la copa. Aunque no significativa, se observó que la concentración de Fe, Mn y Zn tiende a ser mayor en la sección alta externa de la copa a los 3 años; mientras que, a la edad de 5 años tiende a ser mayor en la parte media externa de la copa. No se observó diferencias significativas en la concentración foliar de los nutrimentos con la edad de la plantación entre 2 y 8 años, en ninguna de las épocas comparadas, excepto para el Mn, elemento que tiende a disminuir con la edad de las plantaciones (86 a 26 mg kg-1. La concentración foliar de Mg, Fe, Zn, Mn, Cu y B fue mayor durante la época seca que durante la época lluviosa, mientras que los contenidos foliares de N y P fueron más elevados durante la época lluviosa y no se observó variación alguna en las concentraciones foliares de Ca, K y S debidas la época de muestreo. Con base a lo encontrado, se define en forma tentativa los niveles críticos foliares para la especie A. acuminata.

  7. Prevalence of Cercariae Infection in Lymnaea auricularia (Linnaeus, 1758 in NorthWest of Iran

    Directory of Open Access Journals (Sweden)

    Abbas Imani-Baran

    2011-06-01

    Full Text Available The pond snail Lymnaea auricularia serves as an intermediate host for many digenian species. In West Azerbaijan province, northwestern Iran, the cercariae infection investigation was undertaken in L. auricularia from May to November 2010. Of 6759 collected Lymnaeid snails, 370(5.5% L. auricularia snails were identified. Cercariae infection was found in a number of 276 (74.56 % snails. The results showed that removed cercariae from L. auricularia belonged to Echinostomcercariae (96.38 % and Furcocercariae (3.62 % which were found in two out of 28 sites during the course of study. In summer and fall, the highest prevalence of cercariae infection was recorded for both identified cercariae. It is concluded that L. auricularia could be an important intermediate host of large group digenian trematodes in the region, which is necessary to take consideration in the control program of trematode infection.

  8. Non-ocular dermal photoreception in the pond snail Lymnaea stagnalis.

    Science.gov (United States)

    Chono, Koji; Fujito, Yutaka; Ito, Etsuro

    2002-09-27

    Based on the results of previous behavioral experiments, researchers believe that sensitivity to light stimuli is not restricted to the eyes in the pond snail Lymnaea stagnalis. To determine the presence of a non-ocular dermal photoreception system and to examine the synaptic connections between this peripheral system and the central nervous system, we electrophysiologically examined the activities of the pedal nerves in L. stagnalis by light stimulation. The results demonstrated that light stimulation evokes non-ocular dermal photosensitive responses in the foot, that these responses exert inhibitory, afferent influences through the inferior pedal nerves to the pedal ganglia, and that these responses were independent of the ocular photoreception system in L. stagnalis.

  9. Seasonal transmission of Fasciola hepatica in cattle and Lymnaea (Fossaria) humilis snails in central Mexico.

    Science.gov (United States)

    Cruz-Mendoza, I; Ibarra-Velarde, F; Quintero-Martínez, M T; Naranjo-García, E; Lecumberri-López, J; Correa, D

    2005-03-01

    A 19-month study on the prevalence of fasciolosis in 30 naturally infected cows, the presence of infected and non-infected Lymnaea (Fossaria) humilis snails, and variation in soil temperature and humidity is reported. The prevalence of fasciolosis in cattle declined from around 50% in March to 30% in July, then, it increased from August, reaching a plateau of 100% in November-January, before gradually declining thereafter. A rise in soil humidity and temperature in June and July, respectively, which peaked between August and November was observed. In July, L. (F.) humilis snails appeared, but the infection could only be found in these in August and November. The number of infected snails did not reflect the infestation rate in cows, even though the infestation kinetics in both hosts behaved as predicted from the life cycle of the parasite.

  10. Influence of shell size of Lymnaea columella on infectivity and development of Fasciola hepatica.

    Science.gov (United States)

    Coelho, L H L; Guimarães, M P; Lima, W S

    2008-03-01

    Experimental infections of Lymnaea columella with Fasciola hepatica were carried out to determine the influence of shell size on the infection rate and on the outcome of rediae and cercariae. Snails were divided into seven groups according to shell size: 2-4 mm, 5-6 mm, 7-8 mm, 9-10 mm, 11-12 mm, 13-14 mm and 15 mm or more. One hundred snails in each group were infected by using four miracidia for each snail. Snails with larger shell size showed a lower infection rate, the groups presenting the highest (79%) and lowest (2%) proportions of positives being those of 5-6 mm and 15 mm or more, respectively. Cercariae were present in 21% of them at 31 days post-infection, and cercarial shedding was observed 61 days post-infection. It was concluded that there is a non-linear negative association between shell size and infection rate.

  11. The presence of predators modifies the larval development of Fasciola hepatica in surviving Lymnaea truncatula.

    Science.gov (United States)

    Rondelaud, D; Vignoles, P; Dreyfuss, G

    2002-06-01

    Experimental infections of Lymnaea truncatula with Fasciola hepatica were performed to study the consequences of the presence of predators (sciomyzid larvae or zonitid snails) on the characteristics of larval F. hepatica development in surviving snails. Controls consisted of infected snails that were not subjected to predators. Compared to controls, the survival rate at day 30 post-exposure, the duration of cercarial shedding, and the number of cercariae shed by surviving snails were significantly lower when predators were present in snail breeding boxes, whatever the type of predator used. In contrast, the prevalences of Fasciola infections in snails, and the length of time between exposure and the onset of cercarial shedding showed no significant variation. The progressive development of a stress reaction in surviving snails against predators during the first 30 days of experimental exposure to F. hepatica would influence snail survival during the cercarial shedding period and, consequently, the number of cercariae shed by the snails.

  12. Fasciola gigantica: the growth and larval productivity of redial generations in the snail Lymnaea truncatula.

    Science.gov (United States)

    Dar, Y; Vignoles, P; Rondelaud, D; Dreyfuss, G

    2002-04-01

    Bimiracidial infections of French Lymnaea truncatula with a Madagascan isolate of Fasciola gigantica were carried out under laboratory conditions to study the growth of rediae and their larval productivity in relation to the different redial generations. The total numbers of rediae and their mean lengths significantly increased with the duration of infection until day 49 post-exposure (p.e.). Significant differences in the lengths between the different redial generations were noted. At day 49 p.e. (at 20 degrees C), the cercariae were produced by the first redial generation, while the productivity of other redial groups was delayed. This last finding shows a slow larval development of this Madagascan isolate of F. gigantica in this French population of L. truncatula.

  13. Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR.

    Science.gov (United States)

    Magalhães, Kelly Grace; Passos, Liana Konovaloff Jannotti; Carvalho, Omar dos Santos

    2004-06-01

    From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS) region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.

  14. Juveniles of Lymnaea 'smart' snails do not perseverate and have the capacity to form LTM.

    Science.gov (United States)

    Shymansky, Tamila; Protheroe, Amy; Hughes, Emily; Swinton, Cayley; Swinton, Erin; Lukowiak, Kai S; Phillips, Iain; Lukowiak, Ken

    2017-02-01

    Previously, it was concluded that the nervous systems of juvenile snails were not capable of mediating long-term memory (LTM). However, exposure and training of those juvenile snails in the presence of a predator cue significantly altered their ability to learn and form LTM. In addition, there are some strains of Lymnaea which have been identified as 'smart'. These snails form LTM significantly better than the lab-bred strain. Here, we show that juveniles of two smart snail strains not only are capable of associative learning but also have the capacity to form LTM following a single 0.5 h training session. We also show that freshly collected 'wild' 'average' juveniles are also not able to form LTM. Thus, the smart snail phenotype in these strains is expressed in juveniles.

  15. Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Kelly Grace Magalhães

    2004-06-01

    Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.

  16. Studies on the survival and development of field-caught snail Lymnaea rubiginosa in the laboratory

    Directory of Open Access Journals (Sweden)

    S Widjajanti

    1998-10-01

    Full Text Available Lymnaea rubiginosa was collected from two habitats in order to observe their survival and growth rate including their egg production, hatching time and the time they needed to reach maturity. One of the habitat is rice fields in Bogor (subdistricts of Ciomas and Ciampea and the other is a pond in Bogor Botanical Garden. In the laboratory those snails were kept in separate aquarium and grouped according to their shell length. The result showed that the longer the snail length the shorter their survival rate and less egg production. Moreover, the snails collected from rice fields were infected with Echinostoma sp. And Chaetogaster sp., while the snails from the pond were only infected with Chaetogaster sp. The hatching time is between 10-14 days, and to reach maturity, with shell length about 1 cm, they need about 6 weeks.

  17. Evidence for genetic influences on neurotransmitter content of identified neurones of Lymnaea stagnalis.

    Science.gov (United States)

    Audesirk, G; Audesirk, T; McCaman, R E; Ono, J K

    1985-01-01

    Neurotransmitter content was measured in two identified giant neurones in isogenic and wild-type populations of the freshwater pond snail Lymnaea stagnalis. The paired serotonergic cerebral giant neurones (LC1 and RC1) have higher transmitter levels and less variability in inbred animals than in wild-type animals. The transmitter content of the unpaired dopaminergic right pedal giant neurone (RPeD1) does not differ between inbred and wild-type animals in either level or variability. It is proposed that serotonin content of the cerebral giant neurones is under partial genetic control, and that animals of the wild-type population may possess a number of different alleles for the genes influencing serotonin levels. Inbreeding resulted in fixation of an allele promoting high serotonin levels. This particular wild-type population is probably already isogenic for genes influencing dopamine content in the right pedal giant neurone.

  18. Amine-containing neurons in the brain of Lymnaea stagnalis: distribution and effects of precursors.

    Science.gov (United States)

    Audesirk, G

    1985-01-01

    Glyoxylic acid-induced fluorescence in whole-brain preparations of the central nervous system of the freshwater pond snail, Lymnaea stagnalis, was used to map the distribution of serotonin-and dopamine-containing neurons. Serotonin and dopamine were easily distinguishable by differences in color of fluorescence. Serotonin-containing neurons were consistently found in the cerebral, pedal, right parietal and visceral ganglia. Dopamine-containing neurons were found in the pedal, and buccal ganglia. Prior incubation of brains in 5-hydroxytryptophan (5-HTP), the immediate precursor to serotonin, produced serotonin-like fluoresence in neurons which do not normally fluoresce. These neurons thus probably possess specific uptake mechanisms for 5-HTP. Since 5-HTP itself fluoresces yellow, the glyoxylic acid technique cannot determine if these neurons contain the enzyme aromatic amino acid decarboxylase, which converts 5-HTP to serotonin, or merely fluoresce because of the 5-HTP taken into the cells.

  19. Morphological and ecological studies on Lymnaea natalensis the snail vector of Fasciola gigantica in Egypt.

    Science.gov (United States)

    el-Dafrawy, Shadia M

    2002-08-01

    Lymnaea natalensis were collected from several localities in Giza Governorate (El-Mansouria, Kafr Hakim and The Nile). The collected snails were examined for cercarial shedding and measurement of shell was carried out using a virner caliper. A total of 217 Lymnaea was collected from all habitats and 24 snails were found to shed Fasciola gigantica cercariae with infection rate 11.1%. The ratio of shell height to shell width (H/W) ranged 1.7-2.1. The ratio between length of aperture to shell height (A/H) was almost constant ranged 0.7-0.8. While the ratio between length of aperture and shell width (A/W) ranged from to 1.8. There was a significant positive correlation between shell height and both shell width and length of aperture (p<0.001). The same relation was clearly indicated between shell width and length of aperture. Also, when the aperture length increased the ratio between height and width increased (p<0.05). While, the following ratios (H/W), (A/H) and (A/W) remained somewhat constant irrespective to the number of whorls. There was a positive correlation between number of whorls and each of aperture length, shell length and shell height. On maintaining L. natalensis in different pH values, the results showed that at pH 3 and pH 11, all snails maintained at these pH values died after one day of maintenance. While snails survived and laid eggs in the range of pH 5-9.

  20. Ectomycorrhizae between Alnus acuminata H.B.K. and Naucoria escharoides (Fr.:Fr.) Kummer from Argentina.

    Science.gov (United States)

    Becerra, Alejandra; Daniele, Graciela; Domínguez, Laura; Nouhra, Eduardo; Horton, Tom

    2002-04-01

    Field ectomycorrhizae of Naucoria escharoides on Alnus acuminata ("andean alder", "aliso del cerro") are described in detail for the first time. Naturally occurring ectomycorrhizal roots were sampled beneath sporocarps of N. escharoides. The samples were taken from four natural forest plots at two homogeneous A. acuminata sites (Tucumán and Catamarca Provinces, Argentina). The ectomycorrhizae were characterized morphologically and compared by means of PCR/RFLP analysis of the internal transcribed spacer region of the nuclear rDNA. The most important morphological features of the ectomycorrhizae are a white to pale yellow mantle, simple to monopodial branches, hyaline emanating hyphae, abundant hyphal bundles emerging more or less perpendicularly from a plectenchymatous mantle, and an acute or rounded apex with or without a mantle. N. escharoides fruitbodies have white basal mycelium with emanating hyphae similar to those of andean alder ectomycorrhizae. The RFLP profiles of sporocarps and mycorrhizae were the same.

  1. Intermediate and long-term memories of associative learning are differentially affected by transcription versus translation blockers in Lymnaea.

    Science.gov (United States)

    Sangha, Susan; Scheibenstock, Andi; McComb, Chloe; Lukowiak, Ken

    2003-05-01

    Aerial respiratory behaviour in the pond snail, Lymnaea stagnalis, can be operantly conditioned. This associative learning then undergoes consolidation into a long-lasting memory which, depending on the training procedure used, causes intermediate-term memory (ITM; lasting 3 h) or long-term memory (LTM; lasting >6 h) to be formed. We determined the differential susceptibility of these two forms of memory to translation and transcription blockers. The injection of a translation blocker, Anisomycin, 2.5 h before training prevents the establishment of both ITM and LTM. On the other hand, injection of the transcription blocker Actinomycin D, 2.5 h before training, did not prevent the establishment of ITM, but did, however, prevent LTM formation. Thus in Lymnaea, following associative learning, both ITM and LTM are dependent on new protein synthesis. ITM appears to be dependent on protein synthesis from preexisting transcription factors, whilst LTM is dependent on protein synthesis from new transcription messages.

  2. First report of Lymnaea cousini Jousseaume, 1887 naturally infected with Fasciola hepatica (Linnaeus, 1758) (Trematoda: Digenea) in Machachi, Ecuador.

    Science.gov (United States)

    Villavicencio, Angel; Vasconcellos, Mauricio Carvalho de

    2005-11-01

    We report the first finding of Lymnaea cousini naturally infected with Fasciola hepatica in Ecuador. A sample of 70 snails was collected in April 2005 from a wetland located in a valley at approximately 3000 m a.s.l., near the locality of Machachi, Pichincha Province. The prevalence of natural infection in L. cousini was 31.43%, which is the highest value ever recorded for naturally infected lymnaeid species.

  3. First report of Lymnaea cousini Jousseaume, 1887 naturally infected with Fasciola hepatica (Linnaeus, 1758 (Trematoda: Digenea in Machachi, Ecuador

    Directory of Open Access Journals (Sweden)

    A Ángel Villavicencio

    2005-11-01

    Full Text Available We report the first finding of Lymnaea cousini naturally infected with Fasciola hepatica in Ecuador. A sample of 70 snails was collected in April 2005 from a wetland located in a valley at approximately 3000 m a.s.l., near the locality of Machachi, Pichincha Province. The prevalence of natural infection in L. cousini was 31.43%, which is the highest value ever recorded for naturally infected lymnaeid species.

  4. Ocorrência de infecção natural de Fasciola hepatica Linnaeus, 1758 em Lymnaea columella Say, 1817 no Vale do Paraíba, SP, Brasil Natural infection by Fasciola hepatica in Lymnaea columella in the Paraíba river valley, S. Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Marlene Tiduko Ueta

    1980-06-01

    Full Text Available Foram registradas em Piquete, no vale do rio Paraíba do Sul (SP, Brasil, taxas de 1,22% e 0,14% de infecção natural em Lymnaea columella, por Fasciola hepatica. Em um único exemplar de Lymnaea columella dentre os 1.052 examinados, foram observadas rédias com xifidiocercárias, rédias com cercárias de Fasciola hepatica e metacercárias de Echinostomatidae.Infection rates of 1.22% and 0.14% were obtained in Lymnaea columella snails naturally infected by Fasciola hepatica. Samples of the snails were collected in Piquete, a municipality of Paraíba do Sul, a river valley area in the State of S. Paulo. Also observed was one of the 1052 specimen of the Lymnaea columella rediae which had xiphidiocercariae and rediae with Fasciola hepatica cercariae and metacercariae of Echinostomatidae.

  5. Characterisation of fascioliasis lymnaeid intermediate hosts from Chile by DNA sequencing, with emphasis on Lymnaea viator and Galba truncatula.

    Science.gov (United States)

    Artigas, Patricio; Bargues, M Dolores; Mera y Sierra, Roberto L; Agramunt, Veronica H; Mas-Coma, Santiago

    2011-12-01

    In South America, Fasciola hepatica infection poses serious health problems in both humans and livestock. In Chile, the medical impact appears yearly stable and mainly concentrated in central regions, where the veterinary problem is highlighted by higher animal prevalences. Studies were undertaken by rDNA ITS-2 and ITS-1 and mtDNA cox1 sequencing to clarify the specific status of the lymnaeids, their geographical distribution and fascioliasis transmission capacity in Chile, by comparison with other American countries and continents. Results change the lymnaeid scenario known so far. The lymnaeid fauna of mainland Chile shows to be poor, including only two authochthonous species, Lymnaea viator and Pectinidens diaphana, and a third introduced species of Palaearctic origin Galba truncatula. Both Lymnaea lebruni and Lymnaea patagonica proved to be synonyms of P. diaphana. G. truncatula appears to have always been confused with L. viator and seems distributed from Región VI to Región IX, overlapping with human endemic areas. DNA sequencing results suggest that the absence of correlation between remote sensing data and disease prevalences could be due to transmission capacity differences between L. viator and G. truncatula. Results furnish a new baseline on which to undertake future appropriate studies on transmission, epidemiology and control.

  6. An expressed sequence tag survey of gene expression in the pond snail Lymnaea stagnalis, an intermediate vector of trematodes [corrected].

    Science.gov (United States)

    Davison, A; Blaxter, M L

    2005-05-01

    The pond snail Lymnaea stagnalis is an intermediate vector for the liver fluke Fasciola hepatica, a common parasite of ruminants and humans. Yet, despite being a disease of medical and economic importance, as well as a potentially useful comparative tool, the genetics of the relationship between Lymnaea and Fasciola has barely been investigated. As a complement to forthcoming F. hepatica expressed sequence tags (ESTs), we generated 1320 ESTs from L. stagnalis central nervous system (CNS) libraries. We estimate that these sequences derive from 771 different genes, of which 374 showed significant similarity to proteins in public databases, and 169 were similar to ESTs from the snail vector Biomphalaria glabrata. These L. stagnalis ESTs will provide insight into the function of the snail CNS, as well as the molecular components of behaviour and response to parasitism. In the future, the comparative analysis of Lymnaea/Fasciola with Biomphalaria/Schistosoma will help to understand both conserved and divergent aspects of the host-parasite relationship. The L. stagnalis ESTs will also assist gene prediction in the forthcoming B. glabrata genome sequence. The dataset is available for searching on the world-wide web at http://zeldia.cap.ed.ac.uk/mollusca.html.

  7. Arbuscular mycorrhizal colonization of Alnus acuminata Kunth in northwestern Argentina in relation to season and soil parameters Colonización micorrícico arbuscular de Alnus acuminata Kunth en el noroeste argentino en relación a la estacionalidad y a los parámetros edáficos

    National Research Council Canada - National Science Library

    Alejandra Gabriela Becerra; Nilda Marta Arrigo; Norberto Bartoloni; Laura Susana Domínguez; María Noelia Cofré

    2007-01-01

    The objective of this study was to determine patterns of arbuscular mycorrhizal (AM) colonization of Alnus acuminata Kunth at two natural forests in relation to soil parameters at two different seasons...

  8. Ocorrência de Lymnaea columella (Gastropoda: Lymnaeidae, hospedeiro intermediário da Fasciola hepatica, para o Estado da Paraíba, Brasil Occurrence of Lymnaea columella (Gastropoda: Lymnaeidae, first intermediate host of Fasciola hepatica, for the state of Paraíba, Brazil

    Directory of Open Access Journals (Sweden)

    Francisco José Pegado Abílio

    1998-04-01

    Full Text Available Foi registrada a ocorrência de Lymnaea columella (Gastropoda: Lymnaeidae, primeiro hospedeiro intermediário da Fasciola hepatica, para o Estado da Paraíba, Brasil, associado a macrófitas aquáticas.The occurrence of Lymnaea Columella (Gastropoda: Lymnaeidae, first intermediate host of Fasciola hepatica, is recorded for the first time in the state of Paraíba, Brazil, associeted with aquatic macrophytes.

  9. Development of expressed sequence tag and expressed sequence tag–simple sequence repeat marker resources for Musa acuminata

    Science.gov (United States)

    Passos, Marco A. N.; de Oliveira Cruz, Viviane; Emediato, Flavia L.; de Camargo Teixeira, Cristiane; Souza, Manoel T.; Matsumoto, Takashi; Rennó Azevedo, Vânia C.; Ferreira, Claudia F.; Amorim, Edson P.; de Alencar Figueiredo, Lucio Flavio; Martins, Natalia F.; de Jesus Barbosa Cavalcante, Maria; Baurens, Franc-Christophe; da Silva, Orzenil Bonfim; Pappas, Georgios J.; Pignolet, Luc; Abadie, Catherine; Ciampi, Ana Y.; Piffanelli, Pietro; Miller, Robert N. G.

    2012-01-01

    Background and aims Banana (Musa acuminata) is a crop contributing to global food security. Many varieties lack resistance to biotic stresses, due to sterility and narrow genetic background. The objective of this study was to develop an expressed sequence tag (EST) database of transcripts expressed during compatible and incompatible banana–Mycosphaerella fijiensis (Mf) interactions. Black leaf streak disease (BLSD), caused by Mf, is a destructive disease of banana. Microsatellite markers were developed as a resource for crop improvement. Methodology cDNA libraries were constructed from in vitro-infected leaves from BLSD-resistant M. acuminata ssp. burmaniccoides Calcutta 4 (MAC4) and susceptible M. acuminata cv. Cavendish Grande Naine (MACV). Clones were 5′-end Sanger sequenced, ESTs assembled with TGICL and unigenes annotated using BLAST, Blast2GO and InterProScan. Mreps was used to screen for simple sequence repeats (SSRs), with markers evaluated for polymorphism using 20 diploid (AA) M. acuminata accessions contrasting in resistance to Mycosphaerella leaf spot diseases. Principal results A total of 9333 high-quality ESTs were obtained for MAC4 and 3964 for MACV, which assembled into 3995 unigenes. Of these, 2592 displayed homology to genes encoding proteins with known or putative function, and 266 to genes encoding proteins with unknown function. Gene ontology (GO) classification identified 543 GO terms, 2300 unigenes were assigned to EuKaryotic orthologous group categories and 312 mapped to Kyoto Encyclopedia of Genes and Genomes pathways. A total of 624 SSR loci were identified, with trinucleotide repeat motifs the most abundant in MAC4 (54.1 %) and MACV (57.6 %). Polymorphism across M. acuminata accessions was observed with 75 markers. Alleles per polymorphic locus ranged from 2 to 8, totalling 289. The polymorphism information content ranged from 0.08 to 0.81. Conclusions This EST collection offers a resource for studying functional genes, including

  10. Efficacy of topical imiquimod in HIV-positive patients with recurrent anal condylomata acuminata

    Directory of Open Access Journals (Sweden)

    Sidney Roberto Nadal

    2012-03-01

    Full Text Available INTRODUCTION: Imiquimod is a topical chemotherapic and immunostimulant agent with antitumoral and antiviral activities, used for anal condylomata acuminata treatment, mainly in recurrences. OBJECTIVE: Evaluate the imiquimod efficiency in chronic and recurrent anal condylomata acuminata in HIV-infected persons. METHOD: A prospective study that analyzed 61 patients with recurrent anal condylomata treated with topic 5% imiquimod, for at least 8 weeks. These patients had already been submitted to other topical and surgical treatments for anal warts. We evaluated the efficiency of this agent, through wart remission, with clinical examination and high-resolution anoscopy, CD4+ T lymphocyte count and side effects. The patients were 55 males and 6 females, from 22 to 63 years old. RESULTS: Remission was seen in 90%, being 46% complete remission and 44% partial remission. Other 10% did not respond to the treatment with imiquimod within the 16th week. Recurrences were observed in 11% of patients in 24-week follow-up. Statistics showed no differences in CD4+ T cell scores when groups with and without complete remission were compared. Adverse effects were reported by 45% of patients. They were mild to moderate burning (25%, intense burning (7%, ulcerative dermatitis (8% and systemic symptoms (5%. CONCLUSION: Imiquimod was effective in controlling recurrent anal condylomata acuminata in HIV-positive patients, regardless of CD4+ T cell count.INTRODUÇÃO: O imiquimode é agente tópico quimioterápico e imunoestimulante, com atividades antitumoral e antiviral, usado para tratamento dos condilomas acuminados perianais, principalmente os recidivantes. OBJETIVO: Avaliar a eficácia do imiquimode nos condilomas acuminados perianais crônicos e multirrecidivantes dos doentes soropositivos para o vírus da imunodeficiência adquirida (HIV. CASUÍSTICA E MÉTODO: Estudo clínico prospectivo por 12 meses em que observamos o uso tópico de imiquimode creme 5%, por no

  11. Пути проникновения мирацидиев Fasciola hepatica (Linnaeus,1758) в гепатопанкреас Lymnaea truncatula Muller, 1774 и Lymnaea cubensis Pfeiffer, 1839 и возникающие патологии

    OpenAIRE

    Соколина Ф.; Игнатьев Г.; Villasenor O.C.; Sanchez-Vega J.T.

    2010-01-01

    The investigation the mollusk tissue of Lymnaea truncatula Muller, 1774 and Lymnaea cubensis Pfeiffer, 1839 during the infection of miracidia Fasciola hepatica (Linnaeus, 1758) showed the dissolution of the intercellular substance, deformation the cells of the mollusk connective tissue, demolish of epithelium and liver tissue.

  12. Verspreiding en habitats van Lymnaea natalensis, tussengasheerslak van die lewerbot Fasciola gigantica, in Suid-Afrika

    Directory of Open Access Journals (Sweden)

    K. N. de Kock

    2001-09-01

    Full Text Available Hierdie artikel fokus op die geografiese verspreiding en die habitats van Lymnaea natalensis, die slaktussengasheer van die lewerbot, Fasciola gigantica, soos gereflekteer deur die vindplekke van sy 4 552 monsters wat tans in die Nasionale Varswaterslakversameling (NVV van Suid-Afrika op rekord is. Alhoewel hierdie spesie in’n verskeidenheid van waterliggame aangetref is, was die meerderheid van die monsters (±70% afkomstig vanuit riviere, spruite en damme en is die water in 70.8% van die gevalle as standhoudend en in 71.8% van die gevalle as stadigvloeiend, of staande beskryf.  Die resultate van lewenstabeleksperimente deur verskeie outeurs het daarop gedui dat temperatuur ’n minder belangrike bepalende faktor in sy geografiese verspreiding blyk te wees, maar dat die beskikbaarheid van standhoudende water deurslaggewend vir sy voorkoms in ’n gegewe habitat mag wees. Hierdie resultate strook met die bevinding dat slegs 7.5% van die monsters van hierdie spesie in die NVV in habitats wat as seisoenaal beskryf is, versamel is. Verder bied dit’n logiese verklaring vir die sporadiese voorkoms, of totale afwesigheid van hierdie spesie in die droër streke van Suid-Afrika.  Opgaardamme en besproeiingsnetwerke dra grootliks by tot die skepping van permanente habitats wat geskik sou wees vir L. natalensis.  As tussengasheer vir een van die lewerbotspesies wat reeds ’n ekonomiese faktor in Suid-Afrika is, is dit ’n aspek waarmee beslis rekening gehou behoort te word in die beplanning en konstruksie van nuwe besproeiingsprojekte.AbstractDistribution and habitats of Lymnaea natalensis, snail intermediate host of the liver fluke Fasciola gigantica, in South Africa This paper focuses on the geographical distribution and the habitats of Lymnaea natalensis, the snail intermediate host of the liver fluke, Fasciola gigantica, as reflected by the collection sites of its 4 552 samples currently on record in the National Freshwater Snail Collection

  13. Memory trace in feeding neural circuitry underlying conditioned taste aversion in Lymnaea.

    Directory of Open Access Journals (Sweden)

    Etsuro Ito

    Full Text Available BACKGROUND: The pond snail Lymnaea stagnalis can maintain a conditioned taste aversion (CTA as a long-term memory. Previous studies have shown that the inhibitory postsynaptic potential (IPSP evoked in the neuron 1 medial (N1M cell by activation of the cerebral giant cell (CGC in taste aversion-trained snails was larger and lasted longer than that in control snails. The N1M cell is one of the interneurons in the feeding central pattern generator (CPG, and the CGC is a key regulatory neuron for the feeding CPG. METHODOLOGY/PRINCIPLE FINDINGS: Previous studies have suggested that the neural circuit between the CGC and the N1M cell consists of two synaptic connections: (1 the excitatory connection from the CGC to the neuron 3 tonic (N3t cell and (2 the inhibitory connection from the N3t cell to the N1M cell. However, because the N3t cell is too small to access consistently by electrophysiological methods, in the present study the synaptic inputs from the CGC to the N3t cell and those from the N3t cell to the N1M cell were monitored as the monosynaptic excitatory postsynaptic potential (EPSP recorded in the large B1 and B3 motor neurons, respectively. The evoked monosynaptic EPSPs of the B1 motor neurons in the brains isolated from the taste aversion-trained snails were identical to those in the control snails, whereas the spontaneous monosynaptic EPSPs of the B3 motor neurons were significantly enlarged. CONCLUSION/SIGNIFICANCE: These results suggest that, after taste aversion training, the monosynaptic inputs from the N3t cell to the following neurons including the N1M cell are specifically facilitated. That is, one of the memory traces for taste aversion remains as an increase in neurotransmitter released from the N3t cell. We thus conclude that the N3t cell suppresses the N1M cell in the feeding CPG, in response to the conditioned stimulus in Lymnaea CTA.

  14. DIFFERENTIAL TRACER COUPLING BETWEEN PAIRS OF IDENTIFIED NEURONES OF THE MOLLUSC LYMNAEA STAGNALIS

    Science.gov (United States)

    Ewadinger; Syed; Lukowiak; Bulloch

    1994-07-01

    Electrical coupling is a common means of cell-to-cell communication in both neuronal and non-neuronal tissues (Lowenstein, 1985). Within the nervous system, many electrically coupled neurones exhibit dye coupling (Bennett, 1973; Stewart, 1978; Glantz and Kirk, 1980; Spencer and Satterlie, 1980; Fraser and Heitler, 1993); however, some electrically coupled cells do not dye-couple (Audesirk et al. 1982; Murphy et al. 1983; Berdan, 1987; Robinson et al. 1993; Veenstra et al. 1993). Electrical coupling and dye coupling, often considered in parallel, are in fact two different parameters that can vary independently (e.g. Audesirk et al. 1982; Perez-Armendariz et al. 1991). The giant identified neurones of pulmonate and opisthobranch molluscs have frequently been used for studies of neuronal communication and its plasticity (Winlow and McCrohan, 1987; Bulloch, 1989). In the present study, we explored the relationship between electrical and tracer coupling in both strongly and weakly coupled pairs of molluscan neurones. Specifically, we examined electrically coupled, identified neurones in a freshwater pond snail, Lymnaea stagnalis L., and tested for tracer coupling with Lucifer Yellow CH and biocytin. The cells examined were the strongly electrically coupled neurones, visceral dorsal 1 (VD1) and right parietal dorsal 2 (RPD2) (Boer et al. 1979; Benjamin and Pilkington, 1986), and the weakly coupled neurones, left buccal 1 (LB1) and right buccal 1 (RB1) (Benjamin and Rose, 1979). The use of these particular neurones made it possible to compare electrical coupling with tracer coupling in the molluscan central nervous system (CNS). All experiments were performed on laboratory-bred Lymnaea stagnalis (Mollusca, Pulmonata), maintained as previously described (Ridgway et al. 1991). The CNS was dissected from mature animals (16­18 mm shell length) and pinned to the silicone rubber (RTV 616 GE) base of a recording dish in normal saline (51.3 mmol l-1 NaCl, 1.7 mmol l-1 KCl, 4

  15. [Prevalence of condyloma acuminata in women who went to opportune detection of cervicouterine cancer].

    Science.gov (United States)

    Jiménez-Vieyra, Carlos Ramón

    2010-02-01

    It has been considered the incidence and the prevalence of the disease of sexual transmission with base in the different data banks. Unfortunately, each of these sources has limitations. To evaluate annual prevalence of genital condiloma acuminate in the women who go to opportune detection of cervicouterine cancer. Study realized in a first level of attention, the Zaragoza clinic of the System of Collective Transport Metro of Mexico City; of January of the year 2000 to June of year 2009. All the patients included themselves in the study that went to opportune detection of cervicouterine cancer. 3,232 cervicovaginal cytologist were realized of which 106 cases presented condylomata acuminata genital confirmed by clinic and biopsy, settling down an annual prevalence of 3.2%; the prevalence by ages the greater number of cases appear between the 30 and 34 years with rate of 21.6%. The prevalence of the infection by human virus papailoma varies in the different regions from the world; usually they reach from 20 to 30% in the women of 20 to 24 years of age and falls later to 3 to 10% in the women majors of 30 years. It is important to establish measures of prevention directed to prevent the contagion, exhorting to the adolescent population men and women to have a responsible sexuality.

  16. The banana (Musa acuminata) genome and the evolution of monocotyledonous plants.

    Science.gov (United States)

    D'Hont, Angélique; Denoeud, France; Aury, Jean-Marc; Baurens, Franc-Christophe; Carreel, Françoise; Garsmeur, Olivier; Noel, Benjamin; Bocs, Stéphanie; Droc, Gaëtan; Rouard, Mathieu; Da Silva, Corinne; Jabbari, Kamel; Cardi, Céline; Poulain, Julie; Souquet, Marlène; Labadie, Karine; Jourda, Cyril; Lengellé, Juliette; Rodier-Goud, Marguerite; Alberti, Adriana; Bernard, Maria; Correa, Margot; Ayyampalayam, Saravanaraj; Mckain, Michael R; Leebens-Mack, Jim; Burgess, Diane; Freeling, Mike; Mbéguié-A-Mbéguié, Didier; Chabannes, Matthieu; Wicker, Thomas; Panaud, Olivier; Barbosa, Jose; Hribova, Eva; Heslop-Harrison, Pat; Habas, Rémy; Rivallan, Ronan; Francois, Philippe; Poiron, Claire; Kilian, Andrzej; Burthia, Dheema; Jenny, Christophe; Bakry, Frédéric; Brown, Spencer; Guignon, Valentin; Kema, Gert; Dita, Miguel; Waalwijk, Cees; Joseph, Steeve; Dievart, Anne; Jaillon, Olivier; Leclercq, Julie; Argout, Xavier; Lyons, Eric; Almeida, Ana; Jeridi, Mouna; Dolezel, Jaroslav; Roux, Nicolas; Risterucci, Ange-Marie; Weissenbach, Jean; Ruiz, Manuel; Glaszmann, Jean-Christophe; Quétier, Francis; Yahiaoui, Nabila; Wincker, Patrick

    2012-08-09

    Bananas (Musa spp.), including dessert and cooking types, are giant perennial monocotyledonous herbs of the order Zingiberales, a sister group to the well-studied Poales, which include cereals. Bananas are vital for food security in many tropical and subtropical countries and the most popular fruit in industrialized countries. The Musa domestication process started some 7,000 years ago in Southeast Asia. It involved hybridizations between diverse species and subspecies, fostered by human migrations, and selection of diploid and triploid seedless, parthenocarpic hybrids thereafter widely dispersed by vegetative propagation. Half of the current production relies on somaclones derived from a single triploid genotype (Cavendish). Pests and diseases have gradually become adapted, representing an imminent danger for global banana production. Here we describe the draft sequence of the 523-megabase genome of a Musa acuminata doubled-haploid genotype, providing a crucial stepping-stone for genetic improvement of banana. We detected three rounds of whole-genome duplications in the Musa lineage, independently of those previously described in the Poales lineage and the one we detected in the Arecales lineage. This first monocotyledon high-continuity whole-genome sequence reported outside Poales represents an essential bridge for comparative genome analysis in plants. As such, it clarifies commelinid-monocotyledon phylogenetic relationships, reveals Poaceae-specific features and has led to the discovery of conserved non-coding sequences predating monocotyledon-eudicotyledon divergence.

  17. Treatment of condyloma acuminata in pregnant women with cryotherapy combined with proanthocyanidins: Outcome and safety.

    Science.gov (United States)

    Yang, Li-Juan; Zhu, Dong-Ning; Dang, Yan-Ling; Zhao, Xiong

    2016-06-01

    Patients with condyloma acuminata (CA) during pregnancy represent a special risk group. The outcomes of many treatment methods for such cases are not satisfactory. The purpose of the present study was to evaluate the treatment outcome and safety of cryotherapy combined with proanthocyanidins (PCs) for CA in pregnant women. In this study, 46 pregnant women with CA were treated with cryotherapy combined with PCs. The lesions were sprayed with liquid nitrogen until the color of the wart changed from flesh colored to purple. A PC-containing formulation was then sprayed onto a non-woven fabric or single-layer gauze and applied to the affected area. The PC treatment was applied for 20 min, 2 or 3 times per day. All patients were followed up at 1 and 3 months. No visible warts remained after the cryotherapy and PC treatment. At the 1-month follow-up, only 1 case of recurrence was identified. At 3 months, 5 cases of recurrence were identified, and the recurrence rate was 10.9%. The satisfaction rate of the patients was 94% at 1 month and 87% at 3 months after treatment. All pregnancies resulted in healthy live births without delivery complications. Cryotherapy combined with PCs is indicated to be a safe and effective procedure and may serve as a treatment option for pregnant women with CA.

  18. Formulation and evaluation of semisolid jelly produced by Musa acuminata Colla (AAA Group) peels

    Institute of Scientific and Technical Information of China (English)

    Noor Azwani Mohd Rasidek; Mariam Firdhaus Mad Nordin; Kamyar Shameli

    2016-01-01

    Objective: To study the jelly formulation produced by Musa acuminata Colla (AAA Group) peels and evaluate its antioxidant properties which are related to the product quality. Methods: The formulations of peel jelly were established under two-level full factorial designs within two blocks and one center point. Regarding response optimizer, the amount of sugar and citric acid was obtained; hence, the peel jellies were produced. The evaluation of antioxidant properties was conducted by using total phenolic content (TPC) assay and 1,1 diphenyl-2-picrylhydrazyl (DPPH) free radical assay. Results: The TPC of peel powder varied from 91.8 to 602.26 mg gallic acid equivalents/100 g dry weight, and 5%–7% peel jellies had phenolic content ranging from 29.38 to 48.31 mg gallic acid equivalents/100 g dry weight. The results of DPPH test indicated that at 10 mg/mL, the peel powder showed 89% DPPH inhibition, while 7% peel jelly prominently exhibited 84% DPPH inhibition. The correlation between DPPH IC50 value and TPC of peel powder as well as peel jelly was quite reasonably high with correlation coefficient ranging from 0.843 7 to 0.995. Conclusions: TPC can be used as an indicator in assessing the antioxidant activity of fruits and vegetables. The present investigation reveals that TPC is mainly responsible for DPPH free radical scavenging capacity.

  19. Formulation and evaluation of semisolid jelly produced by Musa acuminata Colla(AAA Group) peels

    Institute of Scientific and Technical Information of China (English)

    Noor Azwani Mohd Rasidek; Mariam Firdhaus Mad Nordin; Kamyar Shameli

    2016-01-01

    Objective:To study the jelly formulation produced by Musa acuminata Colla(AAA Group) peels and evaluate its antioxidant properties which are related to the product quality.Methods:The formulations of peel jelly were established under two-level full factorial designs within two blocks and one center point.Regarding response optimizer,the amount of sugar and citric acid was obtained;hence,the peel jellies were produced.The evaluation of antioxidant properties was conducted by using total phenolic content(TPC)assay and 1,1 diphenyl-2-picrylhydrazyl(DPPH) free radical assay.Results:The TPC of peel powder varied from 91.8 to 602.26 mg gallic acid equivalents/100 g dry weight,and 5%-7% peel jellies had phenolic content ranging from 29.38 to 48.31 mg gallic acid equivalents/100 g dry weight.The results of DPPH test indicated that at 10 mg/mL,the peel powder showed 89% DPPH inhibition,while 7% peel jelly prominently exhibited 84% DPPH inhibition.The correlation between DPPH IC50 value and TPC of peel powder as well as peel jelly was quite reasonably high with correlation coefficient ranging from 0.843 7 to 0.995.Conclusions:TPC can be used as an indicator in assessing the antioxidant activity of fruits and vegetables.The present investigation reveals that TPC is mainly responsible for DPPH free radical scavenging capacity.

  20. Study of Post-Harvest Ambon Banana (Musa acuminata) Preservation Using X-Ray

    Science.gov (United States)

    Dwijananti, P.; Handayani, L.; Marwoto, P.; Iswari, R. S.

    2016-08-01

    An exposure to Ambon banana (Musa Acuminata) samples has been done by using X-rays with current, voltage and exposure time are control parameters. This study aimed to determine storage ability of the post-harvest sample. Five samples were exposured by x-rays with the dose of (3-5) × 10-14 Gy. The samples were stored at room temperature. Their mass and physical condition (color and smell) were evaluated every 3 days. It was found that the control sample which was not exposured by X-ray was ripe in the sixth day indicated by the yellow color and good smell of the banana. Meanwhile, the samples which were exposured by (3 - 5) × 10-14 Gy doze of X-ray looked fresher and still had green color. These samples showed their ripening in the ninth day and their mass decrease was (12-13)% which is lower than the control sample. The preservation of banana can be done through low-dose X-ray exposure.

  1. A randomized, controlled, molecular study of condylomata acuminata clearance during treatment with imiquimod.

    Science.gov (United States)

    Tyring, S K; Arany, I; Stanley, M A; Tomai, M A; Miller, R L; Smith, M H; McDermott, D J; Slade, H B

    1998-08-01

    Imiquimod, an immune response modifier, has been demonstrated to be safe and effective in the treatment of external genital and perianal warts caused by human papillomavirus (HPV). To identify the molecular mechanism(s) by which condylomata acuminata clear during topical treatment with imiquimod, wart skin biopsies were taken from patients before treatment, at treatment week 6, and at the end of treatment. Tissues were analyzed for HPV DNA and for mRNA of several cytokines and HPV gene products. Wart clearance was associated with evidence of tissue production of interferon-alpha, -beta, and -gamma and tumor necrosis factor-alpha. Regression of warts was strongly associated with a decrease in HPV DNA and in mRNA expression for both early and late viral proteins. Thus, topical imiquimod treatment of anogenital warts led to significant increases in local production of multiple interferon mRNAs and a significant reduction in virus load as measured by decreases in HPV DNA and mRNA for early HPV proteins.

  2. SOURCES OF MYCORRHIZAL INFECTION OF SHOREA ACUMINATA SEEDLINGS UNDER LABORATORY CONDITIONS

    Directory of Open Access Journals (Sweden)

    LEE Su SEE

    1995-01-01

    Full Text Available Uninoculated dipterocarp seedlings raised in normal field soil in nurseries were always found to have mycorrhizas after a few months. This study set out to determine whether dipterocarp seedlings could continue to grow and develop in the absence of mycorrhizas and also to determine possible sources of mycorrhizal infection of dipterocarp seedlings raised under laboratory conditions using Shorea acuminata as a typical example. Seedlings were planted in capped or uncapped perspex boxes containing sterile or non-sterile field soil and watered daily with sterile water or tap water. Seedling growth and development of mycorrhizas were monitored at monthly intervals for up to seven months. Seedlings grown in sterile soil remained uninfected after seven months while infection was found in some of the seedlings grown in normal soil regardless of whether they had been watered with tap water or sterile water. This showed that field soil (i.e. under grass far from the forest contained suitable inoculum for forest tree seedlings. Tap water and the air were not important sources of infection. However, mycorrhizal infection was very uneven indicating that the inoculum was probably very unevenly distributed in the soil or that the inoculum density was rather low. Seedlings grown in sterile soil showed better growth than those grown in normal soil and infection of roots by parasitic fungi in the latter was also observed.

  3. 中国球兰属新记录植物——长瓣球兰(Hoya acuminata)%Hoya acuminata (Wight) Benth.ex Hook.f.(Apocynaceae, Asclepiadoideae),A Newly Recorded Species from China

    Institute of Scientific and Technical Information of China (English)

    桂凌健; 彭玉德; 黄宝优; 兰小中; 余丽莹

    2017-01-01

    报道了夹竹桃科萝藦亚科长瓣球兰[Hoya acuminata (Wight) Benth.ex Hook.f.]在中国的新分布记录.长瓣球兰过去记录在不丹、印度东北部(Sikkim, Khasia)和缅甸,2015年在中国西南部的西藏墨脱县内、海拔1 577 m的山林树上发现长瓣球兰.该物种与景洪球兰相近,但前者枝条光滑无毛,每个花序着花3~5朵,花冠直径达5 cm,花冠裂片长2 cm.凭证标本存放于广西药用植物园标本馆(GXMG).%Hoya acuminata (Wight) Benth.ex Hook.f.is reported as a new record species of Apocynaceae, Asclepiadoideae from China.H.acuminata has been recorded in Bhutan, Sikkim, Khasia and Myanmar and it was found on a tree of dense moist forest in Medog County, China at the altitude of 1 577 m in 2015.It is related to H.chinghungensis, but differs in its branches quite glabrous, umbels 3-5 flowered, with corollas up to 5 cm in diameter and lobes 2 cm.The voucher specimens are preserved in the herbarium of Guangxi Botanical Garden of Medicinal Plants (GXMG).

  4. Dynamic of population-dynamics in a medically important snail species Lymnaea (Radix Luteola (Lamarck

    Directory of Open Access Journals (Sweden)

    T. K. Misra

    1993-09-01

    Full Text Available The life-cycle parameters of the snail Lymnaea (Radix luteola and the factors influencing the same have been studied under laboratory conditions. Ins each month, from July 1990 to June 1991, a batch of 100 zero-day old individual were considered for studies. The snails of April batch survived for 19.42 days while those in December batch survived for 87.45 days. The May batch individual though survived for 65.67 days gained maximum shell size (15.84 mm in length and body weight (419.87 mg. All individuals of April batch died prior to attainment of sexual maturity. In the remaining 11 batches the snails became sexually mature between 32 and 53 days. At this stage, they were with varying shell lengths, 9.3 mm to 13,11 mm in respect to batches. The reproduction period varied from 1-67 days. An individual laid, on an average, 0,25 (March batch to 443.67 (May batch eggs in its life-span. A batch of such snails would leave 24312, 22520, 720268, 80408, 76067, 418165, 214, 9202, 0, 0, 2459386 and 127894 individuals at the end of 352nd day. Since the environmental conditions were almost similar the 'dynamic' of population dynamics seems to be involved with the 'strain' of the snail individuals of the batches concerned.

  5. Critical period of memory enhancement during taste avoidance conditioning in Lymnaea stagnalis.

    Directory of Open Access Journals (Sweden)

    Tomoyo Takahashi

    Full Text Available The present study investigated the optimal training procedure leading to long-lasting taste avoidance behavior in Lymnaea. A training procedure comprising 5 repeated pairings of a conditional stimulus (CS, sucrose, with an unconditional stimulus (US, a tactile stimulation to the animal's head, over a 4-day period resulted in an enhanced memory formation than 10 CS-US repeated pairings over a 2-day period or 20 CS-US repeated pairings on a single day. Backward conditioning (US-CS pairings did not result in conditioning. Thus, this taste avoidance conditioning was CS-US pairing specific. Food avoidance behavior was not observed following training, however, if snails were immediately subjected to a cold-block (4°C for 10 min. It was critical that the cold-block be applied within 10 min to block long-term memory (LTM formation. Further, exposure to the cold-block 180 min after training also blocked both STM and LTM formation. The effects of the cold-block on subsequent learning and memory formation were also examined. We found no long lasting effects of the cold-block on subsequent memory formation. If protein kinase C was activated before the conditioning paradigm, snails could still acquire STM despite exposure to the cold-block.

  6. Investigating apical adverse effects of four endocrine active substances in the freshwater gastropod Lymnaea stagnalis.

    Science.gov (United States)

    Giusti, Arnaud; Lagadic, Laurent; Barsi, Alpar; Thomé, Jean-Pierre; Joaquim-Justo, Célia; Ducrot, Virginie

    2014-09-15

    The hermaphroditic gastropod Lymnaea stagnalis is proposed as a candidate species for the development of OECD guidelines for testing of the reprotoxicity of chemicals, including endocrine active substances (EASs). Up to now, only a few putative EASs have been tested for their reproductive toxicity in this species. In this study, we investigate the effects of four EASs with different affinities to the vertebrate estrogen and androgen receptors (chlordecone as an estrogen; cyproterone acetate, fenitrothion and vinclozolin as anti-androgens) on the reproduction of L. stagnalis in a 21-day semi-static test. Testosterone and 17α-ethinylestradiol (EE2) were used as the reference compounds. The tested EASs had no significant effect on growth and survival at the tested concentration ranges (ng to μg/L). Classical reproduction endpoints (i.e., oviposition and fecundity) were not responsive to the tested chemicals, except for chlordecone and 17α-ethinylestradiol, which hampered reproduction from 19.6 μg/L and 17.6 μg/L, respectively. The frequency of polyembryonic eggs, used as an additional endpoint, demonstrated the effects of all compounds except EE2. The molecular pathways, which are involved in such reproduction impairments, remain unknown. Our results suggest that egg quality is a more sensitive endpoint as compared to other reproductive endpoints commonly assessed in mollusk toxicity tests.

  7. Environmental versus anthropogenic effects on population adaptive divergence in the freshwater snail Lymnaea stagnalis.

    Directory of Open Access Journals (Sweden)

    Anthony Bouétard

    Full Text Available Repeated pesticide contaminations of lentic freshwater systems located within agricultural landscapes may affect population evolution in non-target organisms, especially in species with a fully aquatic life cycle and low dispersal ability. The issue of evolutionary impact of pollutants is therefore conceptually important for ecotoxicologists. The impact of historical exposure to pesticides on genetic divergence was investigated in the freshwater gastropod Lymnaea stagnalis, using a set of 14 populations from contrasted environments in terms of pesticide and other anthropogenic pressures. The hypothesis of population adaptive divergence was tested on 11 life-history traits, using Q(ST-F(ST comparisons. Despite strong neutral differentiation (mean F(ST = 0.291, five adult traits or parameters were found to be under divergent selection. Conversely, two early expressed traits showed a pattern consistent with uniform selection or trait canalization, and four adult traits appeared to evolve neutrally. Divergent selection patterns were mostly consistent with a habitat effect, opposing pond to ditch and channel populations. Comparatively, pesticide and other human pressures had little correspondence with evolutionary patterns, despite hatching rate impairment associated with global anthropogenic pressure. Globally, analyses revealed high genetic variation both at neutral markers and fitness-related traits in a species used as model in ecotoxicology, providing empirical support for the need to account for genetic and evolutionary components of population response in ecological risk assessment.

  8. Lymnaea glabra: progressive increase in susceptibility to Fasciola hepatica through successive generations of experimentally infected snails.

    Science.gov (United States)

    Rondelaud, D; Teukeng, F F Djuikwo; Vignoles, P; Dreyfuss, G

    2015-07-01

    Experimental infections of Lymnaea glabra (two populations) with Fasciola hepatica were carried out during seven successive snail generations, to determine if prevalence and intensity of snail infection increased over time through descendants of snails already infected with F. hepatica. Controls were descendants coming from uninfected parents and infected according to the same protocol. No larval forms were found in the bodies of control snails coming from uninfected parents. In contrast, prevalence and intensity of F. hepatica infection in snails originating from infected parents progressively increased from the F2 or F3 to the F6 generation of L. glabra. In another experiment carried out with the F7 generations of L. glabra and a single generation of Galba truncatula (as controls), the prevalence of F. hepatica infection and the total number of cercariae were lower in L. glabra (without significant differences between both populations). If the number of cercariae shed by infected snails was compared to overall cercarial production noted in snails containing cercariae but dying without emission, the percentage was greater in G. truncatula (69% instead of 52-54% in L. glabra). Even if most characteristics of F. hepatica infection were lower in L. glabra, prevalence and intensity of parasite infection increased with snail generation when tested snails came from infected parents. This mode of snail infection with F. hepatica suggests an explanation for cases of fasciolosis occurring in cattle-breeding farms where paramphistomosis is lacking and G. truncatula is absent.

  9. Rearing of Lymnaea columella (Say, 1817, intermediate host of Fasciola hepatica (Linnaeus, 1758

    Directory of Open Access Journals (Sweden)

    Souza Cecília Pereira de

    2000-01-01

    Full Text Available The intermediate host of Fasciola hepatica, Lymnaea columella, collected in Belo Horizonte, Minas Gerais, Brazil, was reared in our laboratory. The aim of the current study was to standardize a rearing and maintenance technique. Two kinds of diet were tested: fresh lettuce (A and rodent ration + 10% CaCO3 plus fresh lettuce (B. The age for the beginning of oviposition ranged from 27 to 57 days. Ten days after oviposition at 24.7°C, 100% eclosion occurred. The complete life cycle varied from 37 to 67 days. The average numbers of eggs per egg mass were 26.3 and 31.1 with diets (A and (B, respectively. The lettuce and ration fed snails presented a increased growth although the difference was not statistically significant (p > 0.05. The mortality rate varied from 40 to 64% after 90 days. The maximum longevity was 183 days, 21.5 mm length and 11 mm wide. The methodology to mass breed and maintain these snails was found to be suitable in the laboratory

  10. Comparative toxicity of Paraquat herbicide and some plant extracts in Lymnaea natalensis snails.

    Science.gov (United States)

    Bakry, Fayez A; Eleiwa, Mona E; Taha, Samir A; Ismil, Somya M

    2016-01-01

    Paraquat has been shown to be a highly toxic compound for humans and animals, and many cases of acute poisoning and death have been reported over the past few decades. The present study was undertaken to evaluate comprehensively herbicides (Paraquat) and some plant extracts to biochemical aspects of Lymnaea natalensis snails. It was found that the exposure of L. natalensis to Paraquat and plant extracts led to a significant reduction in the infectivity of Fasciola gigantica miracidia to the snail. The glucose level in hemolymph of exposed snails was elevated, while the glycogen showed a decrease in soft tissues when compared with the control group. In addition, the activity level of some enzymes representing glycolytic enzymes as hexokinase (HK), pyruvate kinase (PK), phosphofructokinase (PFK), lactate dehydrogenase (LDH), and glucose phosphate isomerase (GPI) in snail's tissues were reduced in response to the treatment. It was concluded that the pollution of the aquatic environment by herbicide would adversely affect the metabolism of the L. natalensis snails. Snails treated with Agave attenuate, Ammi visnaga, and Canna iridiflora plant had less toxic effect compared to snails treated with Paraquat.

  11. Influence of photon beam irradiation on Lymnaea natalensis snails infected with Fasciola gigantica.

    Science.gov (United States)

    Said, Doaa E; Rostom, Yousry A

    2006-04-01

    Lymnaea natalensis is the intermediate host of Fasciola gigantica in Egypt. The effect of photon beam irradiation on the ability of the laboratory reared L. natalensis to support the larval development of F. gigantica has been studied. 120 snails were divided into two groups: The control infected non irradiated group (GI) and the experimental infected irradiated group (GII). The later group was subdivided into two subgroups: GIIa: snails irradiated before infection and GIIb: snails irradiated after infection. Photon beam irradiation had non significant effect on the survival rate between the all groups at the 30th day post infection. The life span, the number of infected snails and the length of the shedding period were significantly decreased in the two irradiated subgroups than the control group. The effect was more obvious on GIIb without significant difference. The number of metacercariae significantly decreased in the 2 irradiated subgroups than the control one. Also, it was significantly decreased in GIIb when compared with GIIa. So, photon beam irradiation has a great role on retarding larval development of F. gigantica inside the snail. This opens the way to a new strategy for fascioliasis control of in Egypt.

  12. Fasciola gigantica: larval productivity of three different miracidial isolates in the snail Lymnaea truncatula.

    Science.gov (United States)

    Dar, Y; Vignoles, P; Rondelaud, D; Dreyfuss, G

    2003-03-01

    Bimiracidial infections of Lymnaea truncatula with three isolates of Fasciola gigantica, originating from China, Egypt and Madagascar, were carried out to determine the effect of geographic origin of the parasite on the larval productivity of redial generations. The prevalences of experimental infections in snails exposed to strains from Madagascar, China and Egypt were 20.8%, 60.0% and 80.0%, respectively. At day 49 post-exposure (p.e.), the total number of free rediae in snails infected with the Egyptian isolate was significantly higher than that recorded in the Madagascan group. On the other hand, at day 49 p.e., the majority of cercariae in the Chinese and Egyptian groups were produced by R2a rediae (70.6% and 66.6% of cercariae produced by all live rediae), while, in the Madagascan group, the cercariae were produced mainly by the first redial generation. Snails infected with the Egyptian isolate of miracidia developed more live rediae and, consequently, could produce a higher number of cercariae. As a result, L. truncatula snails were highly adapted to infections with the Egyptian and Chinese isolates of F. gigantica.

  13. Effects of Fasciola gigantica experimental infection on some inorganic elements in the snail host Lymnaea natalensis.

    Science.gov (United States)

    Mostafa, Osama Mohammad Sayed

    2008-04-01

    Flame atomic absorption spectrometry was performed to determine the alteration in the concentrations of metallic ion Pb, Zn, K, Na, Fe, Cu and Co in the soft parts of the Lymnaea natalensis snails shedding Fasciola gigantica cercariae and to determine the alteration in the concentration of Ca in the soft parts and shells of the same snails. The Co was found to be present at concentration level below the detection limits of the analytical method used. Regarding detected elements, three elements Zn, K and Cu were found to be present at significantly higher concentrations in cercariae-shedding snails compared with uninfected snails. Two elements, Pb and Na, showed significant decrease in cercariae-shedding snails compared to uninfected ones. The concentration of Fe showed non-significant increase. The results showed significant lowering in the calcium content of the shells and soft parts of cercariae-shedding snails relative to the calcium content in the uninfected ones. The obtained results and the hypothesis of hypercalcification in shells of infected snails were discussed.

  14. Rearing of Lymnaea columella (Say, 1817), intermediate host of Fasciola hepatica (Linnaeus, 1758).

    Science.gov (United States)

    Pereira de Souza, C; Magalhães, K G

    2000-01-01

    The intermediate host of Fasciola hepatica, Lymnaea columella, collected in Belo Horizonte, Minas Gerais, Brazil, was reared in our laboratory. The aim of the current study was to standardize a rearing and maintenance technique. Two kinds of diet were tested: fresh lettuce (A) and rodent ration + 10% CaCO3 plus fresh lettuce (B). The age for the beginning of oviposition ranged from 27 to 57 days. Ten days after oviposition at 24.7 degrees C, 100% eclosion occurred. The complete life cycle varied from 37 to 67 days. The average numbers of eggs per egg mass were 26.3 and 31.1 with diets (A) and (B), respectively. The lettuce and ration fed snails presented a increased growth although the difference was not statistically significant (p > 0.05). The mortality rate varied from 40 to 64% after 90 days. The maximum longevity was 183 days, 21.5 mm length and 11 mm wide. The methodology to mass breed and maintain these snails was found to be suitable in the laboratory

  15. Cercarial productivity of Fasciola hepatica in Lymnaea truncatula during usual and unusual development of redial generations.

    Science.gov (United States)

    Augot, D; Rondelaud, D

    2001-08-01

    Single-miracidium infections of Lymnaea truncatula by Fasciola hepatica were carried out to determine the cercarial productivity of each redial generation when the first-appearing mother redia (R1a redia) normally developed (usual development of redial generations) or quickly died (unusual development). In both developmental patterns of infection, the number of morulae was significantly higher in the second-appearing mother rediae (R1b group) than in either the daughter rediae from R1a rediae (R2a group) or the rediae from subsequent groups (R2b/R3a). The live R1a group did not produce cercariae. The percentages of cercariae produced by the R1b, R2a, and R2b/R3a groups were 28.2%, 62.8%, and 8.9% when the development of redial generations was usual. In contrast, in an unusual development, they were 69.3%, 20.3%, and 10.2%, respectively. Cercarial production until day 63 post-exposure was essentially provided by the R2a rediae, when the development of redial generations was usual, and by the R1b rediae when it was unusual.

  16. Population dinamics of Lymnaea rubiginosa in rice fields and its infection with larvae of trematodes

    Directory of Open Access Journals (Sweden)

    Suhardono

    2000-12-01

    Full Text Available Field of irrigated rice paddy was the most suitable habitat as breeding site of snail Lymnaea rubiginosa, the intermadiate host of Fasciola gigantica and other trematodes. Fluctuations in the population of fresh water snail, L. rubiginosa in irrigated rice fields and their infection with L. rubiginosa and other trematodes were studied in five villages in the subdistrict of Surade, provivine of West Java. Snail were sampled based on time collection (half man hour each site of collection. The samples of the snails were further counted and examined for the presence of larval trematodes. The result indicated that snails died during the dry season except those in persistent aquatic refuges such as streams and springs. Surviving snails recolonised rice fields near villages by passive transfer with water from refuges early in the wet season. Some recolonosation may also have resulted from haching of snail eggs deposited in habitats which had not been dried for more than a few weeks. Recolonisation with snails of further rice fields from a village occurred during the later period of the wet season. No snail infected with F. gigantica was found in the distance of more than 200 m from a village. Snail with the highest prevalence of infection occurred in rice fields which received effluent from a cattle pen were fertilised with bovine faeces. Each snail was only infected with one species of tramatodes. Infection with echinostone larvae was most common.

  17. Larval trematode infections in Lymnaea glabra populations living in the Brenne Regional Natural Park, central France.

    Science.gov (United States)

    Rondelaud, Daniel; Vignoles, Philippe; Dreyfuss, Gilles

    2015-01-01

    Lymnaea glabra is known to be a natural intermediate host of two flukes, Calicophoron daubneyi and Fasciola hepatica, in central France. But it can also sustain larval development of other digeneans. Adult snails were thus collected from 206 habitats in 2014 and 2015 to identify parasite species and determine the prevalence of each digenean infection in relation to the five types of snail habitats. Seven digenean species were noted in 321 infected snails (out of 17,647 L. glabra). Snails with F. hepatica or C. daubneyi were found in 14.5% and 12.6% of habitats, respectively. Percentages were lower for snails with Opisthoglyphe ranae (5.8%), Haplometra cylindracea (5.3%) and were less than 5% for those infected with Echinostoma revolutum, Notocotylus sp. or Plagiorchis sp. Prevalence noted for each parasite species varied with the type of habitat. The number of species in L. glabra was lower than that found in G. truncatula from the same region (7 instead of 10). The distribution and prevalence of each digenean species were thus dependent on the type and location of each snail habitat. © D. Rondelaud et al., published by EDP Sciences, 2015.

  18. Estrogen-related fecundity reduction of Lymnaea ollula following Fasciola gigantica infection.

    Science.gov (United States)

    Kumkate, Supeecha; Onmek, Nuttajit; Boonburapong, Bongkoj; Singhakaew, Sombut; Leardkamolkarn, Vijittra

    2009-12-01

    Infection by trematode parasites generally affects life history traits of their intermediate hosts. Reduction in life expectancy and reproductive capacity have previously been documented in Fasciola gigantica-infected Lymnaea ollula, but the influence of the endocrine system on this specific host–parasite interaction has not been previously examined. In the present study, we observed survival, growth pattern, and reproductive output of L. ollula following exposure to F. gigantica. Both the survival and the growth pattern of infected snails were similar to those of the non-infected control group. However, a significant difference was apparent in fecundity, as infected snails consistently showed lower levels of egg and embryo production throughout a 7-wk observation period. Semi-quantitative RT-PCR also revealed down-regulation of estrogen receptor expression in infected snails during the first 4 wk of infection. Nonetheless, the inhibition of estrogen signaling was transient, as they regained expression in the later phase of infection. It is, therefore, suggested that other hormones of the complex endocrine system may be involved in the reduced fecundity of L. ollula following F. gigantica infection.

  19. More efficient allopatric combinations of Fasciola hepatica and Lymnaea truncatula due to modification of redial development?

    Science.gov (United States)

    Goumghar, M D; Dreyfuss, G; Rondelaud, D; Benlemlih, M; Cabaret, J

    2001-12-01

    Experimental infections of two susceptible French populations of Lymnaea truncatula (Courcelles and Saint Ours) with an allopatric (Fès, Morocco) or a semi-sympatric (Limoges, France) isolate of Fasciola hepatica miracidia were performed to determine the effect of allopatric miracidia on redial and cercarial production. In both populations, cercarial release was significantly greater in allopatric than in semi-sympatric snails. Compared to semi-sympatric snails, the examination of allopatric snails killed from day 14 to day 35 post-exposure demonstrated (1) a significant decrease after day 28 in the number of daughter rediae (R2a group) exiting from the first-appearing mother redia (R1a redia), and (2) the differentiation of numerous daughter rediae (R2b group) in the body of second-appearing mother rediae (R1b group). These experiments demonstrated that the exposure of L. truncatula to an allopatric isolate of miracidia disturbed the usual developmental pattern of redial generations and caused the formation of numerous R2b rediae. The authors hypothesized that the increase in cercarial release noted in allopatric snails would be assured by the rediae from the R2b group after their emergence from the body of R1b mother rediae.

  20. Larval development of Fasciola hepatica in experimental infections: variations with populations of Lymnaea truncatula.

    Science.gov (United States)

    Vignoles, P; Dreyfuss, G; Rondelaud, D

    2002-06-01

    A retrospective study was undertaken on 70 French populations of Lymnaea truncatula experimentally infected with Fasciola hepatica to determine whether or not susceptibility of snails to infection influenced redial and cercarial production. Results were compared with those obtained from two control populations, known for prevalences higher than 60% when experimentally infected with F. hepatica. In the 70 other populations examined, the prevalences ranged from 2 to 75%. In 55 of these populations, where the prevalence was more than 20%, a high proportion (50.1-56.8%) of snails died after cercarial shedding, whereas in the other groups (non-shedding snails with the most differentiated larvae being free cercariae, rediae containing cercariae, immature rediae, or sporocysts, respectively), snail death was significantly less. In 11 populations, where the prevalence values were 5-19%, only 14% of snails died after cercarial shedding, whereas snails with free cercariae, rediae with cercariae, or immature rediae showed significant increases in snail mortality. In the remaining four snail populations, with prevalences of less than 5%, the most differentiated larval forms were only immature rediae and/or sporocysts. Overall, the number of rediae containing cercariae significantly decreased with decreasing prevalence values. The low prevalence of experimental infection in several populations of snails might be explained by the occurrence of natural infections with miracidia originating from a mammalian host other than cattle, and/or by genetic variability in the susceptibility of snails to infection.

  1. Development of Fasciola hepatica in Lymnaea columella infected with miracidia derived from cattle and marmoset infections.

    Science.gov (United States)

    Mendes, E A; Lima, W S; de Melo, A L

    2008-03-01

    The development of Fasciola hepatica from two species of definitive hosts, i.e. cattle (Bos taurus) and a marmoset (Callithrix penicillata) in the snail Lymnaea columella was determined based on the production of rediae and cercariae and snail survival rate. More rediae and cercariae at 60-74 days post-infection were produced by snails infected by cattle-derived miracidia (cattle group) than by those infected by marmoset-derived miracidia (marmoset group). Among the L. columella parasitized by the marmoset group, the survival rate and the percentage of positive snails were higher than among those parasitized by the cattle group. Eggs of F. hepatica released in cattle faeces were significantly bigger than those released in marmoset faeces. Miracidia originating from parasites that completed their development in cattle were more efficient in infecting the intermediate host. These results suggest that vertebrate-host origin influences the eggs produced by the parasite and the infection rates in the snail host L. columella.

  2. Reproductive impacts of tributyltin (TBT) and triphenyltin (TPT) in the hermaphroditic freshwater gastropod Lymnaea stagnalis.

    Science.gov (United States)

    Giusti, Arnaud; Barsi, Alpar; Dugué, Maël; Collinet, Marc; Thomé, Jean-Pierre; Joaquim-Justo, Célia; Roig, Benoit; Lagadic, Laurent; Ducrot, Virginie

    2013-07-01

    Tributyltin (TBT) and triphenyltin (TPT) are emblematic endocrine disruptors, which have been mostly studied in gonochoric prosobranchs. Although both compounds can simultaneously occur in the environment, they have mainly been tested separately for their effects on snail reproduction. Because large discrepancies in experimental conditions occurred in these tests, the present study aimed to compare the relative toxicity of TBT and TPT under similar laboratory conditions in the range of 0 ng Sn/L to 600 ng Sn/L. Tests were performed on the simultaneous hermaphrodite Lymnaea stagnalis, a freshwater snail in which effects of TPT were unknown. Survival, shell length, and reproduction were monitored in a 21-d semistatic test. Frequency of abnormal eggs was assessed as an additional endpoint. Triphenyltin hampered survival while TBT did not. Major effects on shell solidity and reproduction were observed for both compounds, reproductive outputs being more severely hampered by TBT than by TPT. Considering the frequency of abnormal eggs allowed increasing test sensitivity, because snail responses to TBT could be detected at concentrations as low as 19 ng Sn/L. However, the putative mode of action of the 2 compounds could not be deduced from the structure of the molecules or from the response of apical endpoints. Sensitivity of L. stagnalis to TBT and TPT was compared with the sensitivity of prosobranch mollusks with different habitats and different reproductive strategies.

  3. Peripheral sensory cells in the cephalic sensory organs of Lymnaea stagnalis.

    Science.gov (United States)

    Wyeth, Russell C; Croll, Roger P

    2011-07-01

    The peripheral nervous system in gastropods plays a key role in the neural control of behaviors, but is poorly studied in comparison with the central nervous system. Peripheral sensory neurons, although known to be widespread, have been studied in a patchwork fashion across several species, with no comprehensive treatment in any one species. We attempted to remedy this limitation by cataloging peripheral sensory cells in the cephalic sensory organs of Lymnaea stagnalis employing backfills, vital stains, histochemistry, and immunohistochemistry. By using at least two independent methods to corroborate observations, we mapped four different cell types. We have found two different populations of bipolar sensory cells that appear to contain catecholamines(s) and histamine, respectively. Each cell had a peripheral soma, an epithelial process bearing cilia, and a second process projecting to the central nervous system. We also found evidence for two populations of nitric oxide-producing sensory cells, one bipolar, probably projecting centrally, and the second unipolar, with only a single epithelial process and no axon. The various cell types are presumably either mechanosensory or chemosensory, but the complexity of their distributions does not allow formation of hypotheses regarding modality. In addition, our observations indicate that yet more peripheral sensory cell types are present in the cephalic sensory organs of L. stagnalis. These results are an important step toward linking sensory cell morphology to modality. Moreover, our observations emphasize the size of the peripheral nervous system in gastropods, and we suggest that greater emphasis be placed on understanding its role in gastropod neuroethology.

  4. Strain-specific differences of the effects of stress on memory in Lymnaea.

    Science.gov (United States)

    Hughes, Emily; Shymansky, Tamila; Swinton, Erin; Lukowiak, Kai S; Swinton, Cayley; Sunada, Hiroshi; Protheroe, Amy; Phillips, Iain; Lukowiak, Ken

    2017-03-01

    Stress alters the ability to form, recall and maintain memory according to the Yerkes-Dodson/Hebb (YDH) law. The effects of environmentally relevant stressors, such as low environmental calcium and crowding, on learning and memory have previously been described in a laboratory-reared 'average' strain of Lymnaea stagnalis (i.e. the Dutch strain) as well as two strains of freshly collected L. stagnalis with enhanced memory formation abilities (i.e. 'smart' snails). Here, we use L. stagnalis to study the effects of other environmentally relevant stressors on memory formation in two other strains of freshly collected snails, one 'smart' and one 'average'. The stressors we examined are thermal, resource restriction combined with food odour, predator detection and, for the first time, tissue injury (shell damage). We show that the same stressor has significantly different effects on memory formation depending on whether snails are 'smart' or 'average'. Specifically, our data suggest that a stressor or a combination of stressors act to enhance memory in 'average' snails but obstruct memory formation in 'smart' snails. These results are consistent with the YDH law and our hypothesis that 'smart' snails are more easily stressed than 'average' snails. © 2017. Published by The Company of Biologists Ltd.

  5. Associative learning and memory in Lymnaea stagnalis: how well do they remember?

    Science.gov (United States)

    Lukowiak, Ken; Sangha, Susan; McComb, Chloe; Varshney, Nishi; Rosenegger, David; Sadamoto, Hisayo; Scheibenstock, Andi

    2003-07-01

    The search for 'the how and the where' of memory formation in the brain, the engram, is still one of the unattained 'Holy Grails' of neuroscience. Over the years, various paths have been trodden in attempts to attain this goal, and while tantalizing glimpses appear now and then on the scientific horizon, the Grail still has not been grasped. One of the paths that investigators have walked is the invertebrate 'model system' approach. Some invertebrates possess relatively simple nervous systems that mediate relatively simple behaviours that are both interesting and trainable. In this commentary, we would like to shed light on a relatively new player, the pond snail Lymnaea stagnalis L., that is being used in the quest to illuminate 'the how and the where' the nervous systems encode and store memory. We will show that it is possible to demonstrate that a single neuron is a site of memory formation and storage for a form of associative learning in this lowly snail. It may be that the Grail is a little closer to being grasped.

  6. Actividad molusquicida del Paraiso (Melia azedarach L. (Meliaceae sobre Lymnaea cubensis, molusco vector de Fasciolosis

    Directory of Open Access Journals (Sweden)

    Perez Marlene Piña

    1998-01-01

    Full Text Available INTRODUCCIÓN: La Fasciolosis constituye en diversas regiones una fuente importante de pérdidas económicas y cuando se descuidan las medidas de control de sus hospedadores (moluscos, junto a condiciones ecológicas favorables, pueden ocurrir casos aislados de Fasciolosis humana. Dentro de los métodos alternativos para su control está el uso de extractos vegetales y se pretendió evaluar el probable empleo del jugo extraído del fruto y semillas del Paraiso (Melia azedarach L. en el control de Lymnaea cubensis, principal vector de la Fasciolosis en Cuba. MATERIAL Y MÉTODO: Diferentes concentraciones del jugo extraído del fruto y semillas del Paraiso (Melia azedarach L. fueron testados para determinar las dosis letales media (DL50 y máxima (DL90 usando un programa computarizado Probit-Log. Siete series experimentales fueron probadas usando 72 moluscos en cada una. Para determinar la influencia sobre la frecuencia cardíaca fueron testados tres grupos de 10 moluscos, dos fueron tratados con las DL50=0,88627 y DL90=1,7641, respectivamente, mientras que el tercero fue considerado como testigo. RESULTADOS Y CONCLUSIONES: Se observó una marcada influencia de ambas dosis sobre la frecuencia cardíaca del molusco estudiado. Estos resultados son alentadores, pues demuestran el potencial empleo de esta planta en el control de moluscos indeseables.

  7. Actividad molusquicida del Paraiso (Melia azedarach L. (Meliaceae sobre Lymnaea cubensis, molusco vector de Fasciolosis

    Directory of Open Access Journals (Sweden)

    Marlene Piña Perez

    1998-06-01

    Full Text Available INTRODUCCIÓN: La Fasciolosis constituye en diversas regiones una fuente importante de pérdidas económicas y cuando se descuidan las medidas de control de sus hospedadores (moluscos, junto a condiciones ecológicas favorables, pueden ocurrir casos aislados de Fasciolosis humana. Dentro de los métodos alternativos para su control está el uso de extractos vegetales y se pretendió evaluar el probable empleo del jugo extraído del fruto y semillas del Paraiso (Melia azedarach L. en el control de Lymnaea cubensis, principal vector de la Fasciolosis en Cuba. MATERIAL Y MÉTODO: Diferentes concentraciones del jugo extraído del fruto y semillas del Paraiso (Melia azedarach L. fueron testados para determinar las dosis letales media (DL50 y máxima (DL90 usando un programa computarizado Probit-Log. Siete series experimentales fueron probadas usando 72 moluscos en cada una. Para determinar la influencia sobre la frecuencia cardíaca fueron testados tres grupos de 10 moluscos, dos fueron tratados con las DL50=0,88627 y DL90=1,7641, respectivamente, mientras que el tercero fue considerado como testigo. RESULTADOS Y CONCLUSIONES: Se observó una marcada influencia de ambas dosis sobre la frecuencia cardíaca del molusco estudiado. Estos resultados son alentadores, pues demuestran el potencial empleo de esta planta en el control de moluscos indeseables.

  8. Larval trematode infections in Lymnaea glabra populations living in the Brenne Regional Natural Park, central France

    Directory of Open Access Journals (Sweden)

    Rondelaud Daniel

    2015-01-01

    Full Text Available Lymnaea glabra is known to be a natural intermediate host of two flukes, Calicophoron daubneyi and Fasciola hepatica, in central France. But it can also sustain larval development of other digeneans. Adult snails were thus collected from 206 habitats in 2014 and 2015 to identify parasite species and determine the prevalence of each digenean infection in relation to the five types of snail habitats. Seven digenean species were noted in 321 infected snails (out of 17,647 L. glabra. Snails with F. hepatica or C. daubneyi were found in 14.5% and 12.6% of habitats, respectively. Percentages were lower for snails with Opisthoglyphe ranae (5.8%, Haplometra cylindracea (5.3% and were less than 5% for those infected with Echinostoma revolutum, Notocotylus sp. or Plagiorchis sp. Prevalence noted for each parasite species varied with the type of habitat. The number of species in L. glabra was lower than that found in G. truncatula from the same region (7 instead of 10. The distribution and prevalence of each digenean species were thus dependent on the type and location of each snail habitat.

  9. The effect of artificial dehydration on the survival and reproduction of Lymnaea rubiginosa

    Directory of Open Access Journals (Sweden)

    S Widjajanti

    1999-03-01

    Full Text Available The effect of artificial dehydration on snail Lymnaea rubiginosa was investigated in the laboratory by monitoring its survival and development, because as aquatic organism, this snail must be able to adapt or tolerate with the changes in its habitat. Fifty laboratory-reared L. rubiginosa with shell length between 1.0-1.5 cm (adult were placed in each sloping earth aquarium (60x80x20 cm which were already filled with water about 15 cm depth. Five aquaria were used in this study, and one week after being established the water from 4 aquaria was drained while one aquarium was retained with water as a control. The water was replaced in one of dehydrated aquarium each week for four weeks, commencing one week after draining the water. The survival of snails in each aquarium were recorded every two days over a period of 3 months. The results indicated that the mortality rate of adult snails increased as the period of dehydration increased. After four week dehydration only 16% of adult snails survive compared to 68% survival in the control aquarium, and dehydration for 4 weeks prolonged the hatching time of eggs. Moreover, in dehydrated aquaria, the egg masses were deposited in a random pattern on the surface of the soil, whereas in the control aquarium they were laid on the soil-water junction.

  10. Evaluation of the Effectiveness of Nd: YAG Laser under Urethroscope in the Treatment of Intraurethral Condyloma Acuminata (CA) in Males

    Institute of Scientific and Technical Information of China (English)

    赵冬; 曾伟宏; 翟胜

    2001-01-01

    Objective: To evaluate the therapeutic effect of Nd:YAG laser under urethroscope for the treatment of intraurethral Candyloma Acuminata (CA) in males.Method: Nd:YAG laser under urethroscope was employed to remove the warts.Result: Seventeen patients out of eighteen cases with CA were cured after the first procedure. The ure rate was 94.4%.For second treatment, the cure rate was 100% and no relapse occurred after observation for 12 - 4 months.Conclusion: Nd:YAG laser by urethroscope is a very good method for the treatment of intraurethral CA.

  11. Menin: a tumor suppressor that mediates postsynaptic receptor expression and synaptogenesis between central neurons of Lymnaea stagnalis.

    Directory of Open Access Journals (Sweden)

    Nichole Flynn

    Full Text Available Neurotrophic factors (NTFs support neuronal survival, differentiation, and even synaptic plasticity both during development and throughout the life of an organism. However, their precise roles in central synapse formation remain unknown. Previously, we demonstrated that excitatory synapse formation in Lymnaea stagnalis requires a source of extrinsic NTFs and receptor tyrosine kinase (RTK activation. Here we show that NTFs such as Lymnaea epidermal growth factor (L-EGF act through RTKs to trigger a specific subset of intracellular signalling events in the postsynaptic neuron, which lead to the activation of the tumor suppressor menin, encoded by Lymnaea MEN1 (L-MEN1 and the expression of excitatory nicotinic acetylcholine receptors (nAChRs. We provide direct evidence that the activation of the MAPK/ERK cascade is required for the expression of nAChRs, and subsequent synapse formation between pairs of neurons in vitro. Furthermore, we show that L-menin activation is sufficient for the expression of postsynaptic excitatory nAChRs and subsequent synapse formation in media devoid of NTFs. By extending our findings in situ, we reveal the necessity of EGFRs in mediating synapse formation between a single transplanted neuron and its intact presynaptic partner. Moreover, deficits in excitatory synapse formation following EGFR knock-down can be rescued by injecting synthetic L-MEN1 mRNA in the intact central nervous system. Taken together, this study provides the first direct evidence that NTFs functioning via RTKs activate the MEN1 gene, which appears sufficient to regulate synapse formation between central neurons. Our study also offers a novel developmental role for menin beyond tumour suppression in adult humans.

  12. Menin: A Tumor Suppressor That Mediates Postsynaptic Receptor Expression and Synaptogenesis between Central Neurons of Lymnaea stagnalis

    Science.gov (United States)

    Flynn, Nichole; Getz, Angela; Visser, Frank; Janes, Tara A.; Syed, Naweed I.

    2014-01-01

    Neurotrophic factors (NTFs) support neuronal survival, differentiation, and even synaptic plasticity both during development and throughout the life of an organism. However, their precise roles in central synapse formation remain unknown. Previously, we demonstrated that excitatory synapse formation in Lymnaea stagnalis requires a source of extrinsic NTFs and receptor tyrosine kinase (RTK) activation. Here we show that NTFs such as Lymnaea epidermal growth factor (L-EGF) act through RTKs to trigger a specific subset of intracellular signalling events in the postsynaptic neuron, which lead to the activation of the tumor suppressor menin, encoded by Lymnaea MEN1 (L-MEN1) and the expression of excitatory nicotinic acetylcholine receptors (nAChRs). We provide direct evidence that the activation of the MAPK/ERK cascade is required for the expression of nAChRs, and subsequent synapse formation between pairs of neurons in vitro. Furthermore, we show that L-menin activation is sufficient for the expression of postsynaptic excitatory nAChRs and subsequent synapse formation in media devoid of NTFs. By extending our findings in situ, we reveal the necessity of EGFRs in mediating synapse formation between a single transplanted neuron and its intact presynaptic partner. Moreover, deficits in excitatory synapse formation following EGFR knock-down can be rescued by injecting synthetic L-MEN1 mRNA in the intact central nervous system. Taken together, this study provides the first direct evidence that NTFs functioning via RTKs activate the MEN1 gene, which appears sufficient to regulate synapse formation between central neurons. Our study also offers a novel developmental role for menin beyond tumour suppression in adult humans. PMID:25347295

  13. Ingestion of Fasciola gigantica metacercariae by the intermediate host snail, Lymnaea ollula, and infectivity of discharged metacercariae.

    Science.gov (United States)

    Yoshihara, Shinobu; Ueno, Hakaru

    2004-09-01

    The rate of ingestion of Fasciola normal metacercariae (NMc) encysted on plants by Lymnaea ollula was examined, and the infectivity of the ingested metacercariae (IMc) in the feces of the host snail to mice was studied. As a result of ingestion by snails, the metacercarial outer cyst disappeared in about 50% of IMc in feces. There was no significant difference in the liver juvenile recovery at autopsy between mice inoculated with NMc and IMc kinds of metacercariae. Compared with NMc, the number of IMc could more easily be counted, because the separation of IMc from fecal contents under a microscope was not laborious.

  14. Fasciola immature stages sought in Lymnaea species and Biomphalaria species in the water bodies of Dakahlia Governorate.

    Science.gov (United States)

    el-Shazly, Atef M; Helmy, Moshira M F; Haridy, Fouad M; el-Sharkawy, Eman M A; Morsy, Tosson A

    2002-04-01

    Examination of the five different water bodies in Dakahlia governorate, revealed four species of Lymnaea. These were L. natalensis (68.4%). L. truncatula (16%), L. stagnalis (12.2%) and L. columella (3.4%). Also, two species of Biomphalaria were recovered. These were B. alexandrina (54.7%) and B. glabrata (45.3%). Examination of all these snails showed natural infection with immature stages of Fasciola sp. in 5.5% of L. natalensis (= cailliaudi), 3.1% in L. truncatula and 0.67% in B. alexandrina. The importance of these snails in dissemination and spreading of fascioliasis was discussed.

  15. First report of Lymnaea columella Say, 1817 (Pulmonata: Lymnaeidae) naturally infected with Fasciola hepatica (Linnaeus,1758) (Trematoda: Digenea) in Argentina.

    Science.gov (United States)

    Prepelitchi, Lucila; Kleiman, Florencia; Pietrokovsky, Silvia M; Moriena, Ricardo A; Racioppi, Oscar; Alvarez, José; Wisnivesky-Colli, Cristina

    2003-10-01

    We report the first evidence of natural infection of Lymnaea columella with Fasciola hepatica in Argentina. A sample of 601 snails was collected in May 2003 in northeastern Corrientes, a province bounded on the north by Paraguay, on the east by Brazil and on the southeast by Uruguay. Among 500 examined snails, 44 (8.8%) were exclusively infected with F. hepatica. Parasite identification was based on morphological features of cercariae from snails, and of eggs and adult flukes from Wistar rats. We discuss the events suggesting that an enzootic transmission cycle of F. hepatica has been recently established in northeastern Corrientes.

  16. PKA-Dependent Regulation of Synaptic Enhancement between a Buccal Motor Neuron and Its Regulatory Interneuron in Lymnaea stagnalis

    OpenAIRE

    Nakamura, Hiroshi; Kobayashi, Suguru; Kojima, Satoshi; Urano, Akihisa; Ito, Etsuro

    1999-01-01

    The cerebral giant cell (CGC) is known to play a crucial role in the regulation of feeding response in the pond snail, Lymnaea stagnalis. However, the mechanisms of signal transduction from the CGC to the following buccal motor neurons are not clear. In the present study, we examined whether cyclic AMP (cAMP)-dependent protein kinase (PKA) contributes to enhancement of a monosynaptic connection between the presynaptic CGC and the postsynaptic buccal motor neuron 1 (B1 cell). Injection of cAMP...

  17. ESR dating of Lymnaea baltica and Cerastoderma glaucum from low Ancylus level and transgressive Litorina Sea deposits

    Energy Technology Data Exchange (ETDEWEB)

    Molodkov, Anatoly [AN Ehstonskoj SSR, Tallin (Estonia). Inst. Geologii

    1996-11-01

    Freshwater gastropod (Lymnaea baltica) and brackish-water bivalve (Cerastoderma glaucum) shell samples from Ancylus Lake and Litorina Sea deposits on Hiiuma Island (north-west Estonia) were subjected to ESR measurements. All L. baltica shells studied were composed of calcite and displayed typical multicomponent ESR spectra. C. Glaucum shells normally show ESR spectra typical of aragonite with five radiation-induced lines. In the present work a C. glaucum with calcite-like spectra was encountered for the first time. The problem connected with accumulated palaeodose determination in shell fossils with unusual ESR spectra is highlighted. (author).

  18. First report of Lymnaea columella Say, 1817 (Pulmonata: Lymnaeidae naturally infected with Fasciola hepatica (Linnaeus,1758 (Trematoda: Digenea in Argentina

    Directory of Open Access Journals (Sweden)

    Prepelitchi Lucila

    2003-01-01

    Full Text Available We report the first evidence of natural infection of Lymnaea columella with Fasciola hepatica in Argentina. A sample of 601 snails was collected in May 2003 in northeastern Corrientes, a province bounded on the north by Paraguay, on the east by Brazil and on the southeast by Uruguay. Among 500 examined snails, 44 (8.8% were exclusively infected with F. hepatica. Parasite identification was based on morphological features of cercariae from snails, and of eggs and adult flukes from Wistar rats. We discuss the events suggesting that an enzootic transmission cycle of F. hepatica has been recently established in northeastern Corrientes.

  19. Variability and frequent failure of lucifer yellow to pass between two electrically coupled neurons in Lymnaea stagnalis.

    Science.gov (United States)

    Audesirk, G; Audesirk, T; Bowsher, P

    1982-07-01

    The electrically coupled giant neurosecretory neurons VD1 and RPD2 of Lymnaea stagnalis were found to have coupling coefficients ranging from ca. 0.1-0.6. When the fluoroescent dye Lucifer Yellow was injected intracellularly into one of the neurons, in most preparations no dye was observed to pass through into the coupled cell body or the process leading to it. There was no apparent correlation between the amount of dye coupling and the length of time allowed for diffusion of the dye in the cells. In eight preparations, the electrical coupling coefficient was measured before dye was injected. There was no correlation between dye coupling and the electrical coupling coefficient.

  20. The infrared sensilla in the beetle Melanophila acuminata as model for new infrared sensors

    Science.gov (United States)

    Schmitz, Helmut; Norkus, Volkmar; Hess, Norbert; Bousack, Herbert

    2009-05-01

    For the detection of forest fires the "fire-loving" (pyrophilous) jewel beetle Melanophila acuminata uses a pair of sensor arrays each consisting of about 90 infrared (IR) receptors which are located on either sides of the body. The IR receptors most likely have evolved from common contact hair mechanoreceptors. Compared to a mechanoreceptor, an IR receptor shows the following special features: (i) the formation of a complex cuticular sphere instead of the bristle; the sphere consists of a hard outer exocuticular shell as well as of an inner softer and spongy mesocuticular core. (ii) The enclosure of the dendritic tip of the mechanosensitive neuron inside the sphere in a fluid-filled inner pressure chamber which is connected with the system of microcavities and nanocanals in the mesocuticular core. Hence we propose that an IR sensillum most probably acts as a microfluidic converter of infrared radiation into an increase in internal pressure inside the sphere which is measured by the mechanosensitive neuron. Because the miniaturized receptors respond within a few milliseconds to a brief pulse of IR radiation an approach is made to develop technical IR sensors based on the Melanophila IR receptors. Numerical simulations of sensor performance suggest that the sensitivity of a single IR receptor is in the range of 15 mW/cm2. Theoretical calculations which are based on a hypothetical fire of defined temperature and size demonstrate that a beetle should be able to detect a forest fire from a distance of 10 km. A fluidfilled Golay cell was taken as a basis for the design of a first sensor prototype.

  1. Micropropagation of Malaxis acuminata D. Don: A Rare Orchid of High Therapeutic Value

    Directory of Open Access Journals (Sweden)

    Saranjeet Kaur

    2011-01-01

    Full Text Available Regeneration potential of pseudobulb segments of Malaxis acuminata, procured from in vitro grown cultures, was analysed in Mitra et al., 1976 medium and its combinations with growth adjuncts. Juvenility of the tissues and chemical stimulus emerged as important factors in eliciting response in the explants. The explants from relatively older pseudobulbs (greater than 0.5cm in length remained recalcitrant to regeneration whereas those representing younger ones (less than 0.5cm in length responded positively. The response frequency, pathway of regeneration, and time taken for their development into complete plantlets was directly related to the growth stimulus in the nutrient regime. Shoot buds were induced in an individual treatment with growth regulators (BAP/NAA; 1mg L-1 each whereas their combination [BAP (1.0 mg L-1 + NAA (1.0 mg L-1] promoted protocorm-like body formation in the explants. Additional activated charcoal invariably proved beneficial in accelerating the morphogenetic processes leading to plantlet development. NAA (1 mg L-1 impaired the response frequency and delayed subsequent morphogenetic processes leading to plantlet development. BAP+NAA (1.0 mg L-leach+AC (2 g L-1 was used best for early initiation, highest regeneration frequency, proliferation of protocorm-like bodies (PLB, and plantlet development. Plantlets were transferred to clay pots containing potting mixture (sand, soil, leaf compost in the ratio of 1:1:1. Nearly 70-80% of plantlets survival was recorded. Histological investigation confirmed that neoformations were dermal and multicellular in origin.

  2. Serological test results of sexually transmitted diseases in patients with condyloma acuminata.

    Science.gov (United States)

    Ünal, Emine; Gönül, Müzeyyen; Çakmak, Seray; Yalçınkaya Iyidal, Ayşegül; Kılıç, Arzu; Gül, Ülker; Doner, Pinar

    2015-08-01

    Human papillomavirus (HPV) is one of the most common causes of sexually transmitted diseases (STD). The incidence of condyloma acuminata (CA) has increased in recent years. To determine demographical features and serological test results of STD in patients with CA. A cross-sectional survey was conducted on 94 patients presenting to a dermatology clinic in Ankara, Middle Anatolia, Turkey. Dermatological examinations were made and the patients completed a questionnaire which consisted of questions about their marital status, partners and condom use. In all cases, VDRL/RPR, anti-HIV, HBsAg, anti-HCV and in 57 cases - HSV type 1-2 IgM and IgG were studied. If the value of VDRL or RPR was positive, TPHA was conducted. In our study, 83 men and 11 women had CA. We could not analyze whether our cases had multiple partners and a habit of condom use as some of the patients did not answer questions about their sexual life. We observed VDRL and TPHA positivity in 3 (3.1%) cases, none of those cases had clinical findings of syphilis and they denied using any therapy for syphilis. HBsAg positivity was found in 3 cases. No anti-HIV and anti-HCV antibody positivity was detected. The seroprevalence of HBsAg in our study was similar to that of the general population of Turkey. But as we found positive syphilis serology in 3 patients, we suggest that syphilis serology should be investigated in patients with CA.

  3. Ocorrência de infecção natural de Fasciola hepatica Linnaeus, 1758 em Lymnaea columella Say, 1817 no Vale do Paraíba, SP, Brasil

    OpenAIRE

    Marlene Tiduko Ueta

    1980-01-01

    Foram registradas em Piquete, no vale do rio Paraíba do Sul (SP), Brasil, taxas de 1,22% e 0,14% de infecção natural em Lymnaea columella, por Fasciola hepatica. Em um único exemplar de Lymnaea columella dentre os 1.052 examinados, foram observadas rédias com xifidiocercárias, rédias com cercárias de Fasciola hepatica e metacercárias de Echinostomatidae.Infection rates of 1.22% and 0.14% were obtained in Lymnaea columella snails naturally infected by Fasciola hepatica. Samples of the snails w...

  4. Pronase acutely modifies high voltage-activated calcium currents and cell properties of Lymnaea neurons.

    Science.gov (United States)

    Hermann, P M; Lukowiak, K; Wildering, W C; Bulloch, A G

    1997-12-01

    Pronase E ('pronase') is one of the proteolytic enzymes that are used in preparative procedures such as cell isolation and to soften the sheath of invertebrate ganglia. Although several effects of proteolytic enzymes on the physiology of non-neuronal tissues have been described, the effects of these enzymes on central neurons have received little attention. We examined the effects of bath-applied pronase on neurons in the Lymnaea central nervous system and in vitro. Pronase caused action potential broadening in neurons that exhibit a shoulder on the repolarization phase of their action potentials. This effect of pronase was accompanied by, although unrelated to, a depolarization and decrease in action potential interval. Some, but not all, effects of pronase in the central nervous system were reversible. For example, the decreases in membrane potential and action potential interval were both reversed after approximately 1 h of washing with saline. However, the effect of pronase on the action potential duration was not reversed after a period of 90 min. The modulation of action potential width prompted us to examine Ca2+ currents. Exposure to pronase resulted in an increase in both peak and late high voltage-activated Ca2+ currents in isolated neurons. Pronase neither changed the inactivation rate nor caused a shift in the current-voltage relationship of the current. The changes in action potential duration could be prevented by application of 0.1 mM Cd2+, indicating that the action potential broadening caused by pronase depends on Ca2+ influx. This is the first systematic study of the acute and direct actions of pronase on Ca2+ currents and cell properties both in the CNS and in vitro.

  5. Differences in neuronal activity explain differences in memory forming abilities of different populations of Lymnaea stagnalis.

    Science.gov (United States)

    Braun, Marvin H; Lukowiak, Kai; Karnik, Vikram; Lukowiak, Ken

    2012-01-01

    The ability to learn and form long-term memory (LTM) can enhance an animal's fitness, for example, by allowing them to remember predators, food sources or conspecific interactions. Here we use the pond snail, Lymnaea stagnalis, to assess whether variability between natural populations (i.e., strains) in memory forming capabilities correlates with electrophysiological properties at the level of a single neuron, RPeD1. RPeD1 is a necessary site of LTM formation of aerial respiratory behaviour following operant conditioning. We used strains from two small, separate permanent ponds (TC1 and TC2). A comparison of the two populations showed that the TC1 strain had enhanced memory forming capabilities. Further, the behavioural phenotype of enhanced memory strain was explained, in part, by differences in the electrophysiology of RPeD1. Compared to RPeD1 from the naive TC2 strain, RPeD1 from the TC1 strain has both a decreased resistance and decreased excitability. Moreover, 24h after a single 0.5h training session, those membrane properties, as well as the firing and bursting rate, decrease further in the TC1 strain but not in the TC2 strain. The initial differences in RPeD1 properties in the TC1 strain coupled with their ability to further change these properties with a single training session suggests that RPeD1 neurons from the TC1 strain are "primed" to rapidly form memory. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Serotonergic and dopaminergic influence of the duration of embryogenesis and intracapsular locomotion of Lymnaea stagnalis L.

    Science.gov (United States)

    Filla, Adrienn; Hiripi, L; Elekes, K

    2004-01-01

    The role of the dopaminergic and serotonergic system was studied during the embryonic development of the pond snail Lymnaea stagnalis, with special attention to the effect of dopamine and serotonin as well as their agonists and antagonists on the rotation of the veliger larvae, and to the effect of precursors and inhibitors of the synthetizing enzymes on the duration of the embryonic life. Serotonin, D-lysergic acid diethylamide and N,N-dimethyltryptamine increased at a concentration of 1 microM the rotation by 50%, 90% and 87% respectively, and among them D-Lysergic acid diethylamide was found to be the most potent agonist. Other serotonergic agonists and antagonists enhanced the frequency of the rotation (from 165% to 355%) at higher threshold concentrations in the following rank order: methysergid > tryptamine > 2,5-dimethoxy-4-iodoamphetamine > 5-carboxyamidotryptamine > bromo-lysergic acid diethylamide > 7-methyltryptamine. Application of 1-(2-methoxyphenyl) piperazine decreased the rotation by 76%. The reuptake inhibitor desipramine completely blocked the rotation and killed the embryos. Dopaminergic agonists accelerated the rotation by 62% to 233%, and their effect was ranged as follows: dopamine > apomorphine > m-tyramine approximately equal to p-tyramine. Chlorpromazine at 100 microM concentration killed the embryos. At a concentration of 100 microg/ml, tyrosine, the precursor of DA, slowed down the embryonic development by increasing the duration of the embryonic life from 8 to 10 days. Decarboxylase inhibitors, alpha-methyl-3,4-dihydroxyphenyl-alanine (25 microg/ml) and m-hydroxybenzylhydrazin (5 microg/ml), killed 50% of the embryos, meanwhile the rest hatched ten days later, compared to the control animals. The development was partially blocked by the serotonin precusor L-tryptophane (50 microg/ml). Trytophan hydroxylase blocker, p-chlorphenylalanine (50 microg/ml) resulted in a distortion of the body pattern of the embryos, and prevented the hatching

  7. Assessment of anoxia tolerance and photoperiod dependence of GABAergic polarity in the pond snail Lymnaea stagnalis.

    Science.gov (United States)

    Buck, Leslie T; Bond, Hilary C; Malik, Aqsa

    2017-01-01

    The pond snail Lymnaea stagnalis is reported to be anoxia-tolerant and if the tolerance mechanism is similar to that of the anoxia-tolerant painted turtle, GABA should play an important role. A potentially confounding factor investigating the role of GABA in anoxia tolerance are reports that GABA has both inhibitory and excitatory effects within L. stagnalis central ganglion. We therefore set out to determine if seasonality or photoperiod has an impact on: 1) the anoxia-tolerance of the intact pond snail, and 2) the response of isolated neuroganglia cluster F neurons to exogenous GABA application. L. stagnalis maintained on a natural summer light cycle were unable to survive any period of anoxic exposure, while those maintained on a natural winter light cycle survived a maximum of 4h. Using intracellular sharp electrode recordings from pedal ganglia cluster F neurons we show that there is a photoperiod dependent shift in the response to GABA. Snails exposed to a 16h:8h light:dark cycle in an environmental chamber (induced summer phenotype) exhibited hyperpolarizing inhibitory responses and those exposed to a 8h:16h light:dark cycle (induced winter phenotype) exhibited depolarizing excitatory responses to GABA application. Using gramicidin-perforated patch recordings we also found a photoperiod dependent shift in the reversal potential for GABA. We conclude that the opposing responses of L. stagnalis central neurons to GABA results from a shift in intracellular chloride concentration that is photoperiod dependent and is likely mediated through the relative efficacy of cation chloride co-transporters. Although the physiological ramifications of the photoperiod dependent shift are unknown this work potentially has important implications for the impact of artificial light pollution on animal health. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Lymnaea schirazensis, an overlooked snail distorting fascioliasis data: genotype, phenotype, ecology, worldwide spread, susceptibility, applicability.

    Science.gov (United States)

    Bargues, María Dolores; Artigas, Patricio; Khoubbane, Messaoud; Flores, Rosmary; Glöer, Peter; Rojas-García, Raúl; Ashrafi, Keyhan; Falkner, Gerhard; Mas-Coma, Santiago

    2011-01-01

    Lymnaeid snails transmit medical and veterinary important trematodiases, mainly fascioliasis. Vector specificity of fasciolid parasites defines disease distribution and characteristics. Different lymnaeid species appear linked to different transmission and epidemiological patterns. Pronounced susceptibility differences to absolute resistance have been described among lymnaeid populations. When assessing disease characteristics in different endemic areas, unexpected results were obtained in studies on lymnaeid susceptibility to Fasciola. We undertook studies to understand this disease transmission heterogeneity. A ten-year study in Iran, Egypt, Spain, the Dominican Republic, Mexico, Venezuela, Ecuador and Peru, demonstrated that such heterogeneity is not due to susceptibility differences, but to a hitherto overlooked cryptic species, Lymnaea schirazensis, confused with the main vector Galba truncatula and/or other Galba/Fossaria vectors. Nuclear rDNA and mtDNA sequences and phylogenetic reconstruction highlighted an old evolutionary divergence from other Galba/Fossaria species, and a low intraspecific variability suggesting a recent spread from one geographical source. Morphometry, anatomy and egg cluster analyses allowed for phenotypic differentiation. Selfing, egg laying, and habitat characteristics indicated a migration capacity by passive transport. Studies showed that it is not a vector species (n = 8572 field collected, 20 populations): snail finding and penetration by F. hepatica miracidium occur but never lead to cercarial production (n = 338 experimentally infected). This species has been distorting fasciolid specificity/susceptibility and fascioliasis geographical distribution data. Hence, a large body of literature on G. truncatula should be revised. Its existence has henceforth to be considered in research. Genetic data on livestock, archeology and history along the 10,000-year post-domestication period explain its wide spread from the Neolithic

  9. Genomic analysis of NAC transcription factors in banana (Musa acuminata) and definition of NAC orthologous groups for monocots and dicots.

    Science.gov (United States)

    Cenci, Albero; Guignon, Valentin; Roux, Nicolas; Rouard, Mathieu

    2014-05-01

    Identifying the molecular mechanisms underlying tolerance to abiotic stresses is important in crop breeding. A comprehensive understanding of the gene families associated with drought tolerance is therefore highly relevant. NAC transcription factors form a large plant-specific gene family involved in the regulation of tissue development and responses to biotic and abiotic stresses. The main goal of this study was to set up a framework of orthologous groups determined by an expert sequence comparison of NAC genes from both monocots and dicots. In order to clarify the orthologous relationships among NAC genes of different species, we performed an in-depth comparative study of four divergent taxa, in dicots and monocots, whose genomes have already been completely sequenced: Arabidopsis thaliana, Vitis vinifera, Musa acuminata and Oryza sativa. Due to independent evolution, NAC copy number is highly variable in these plant genomes. Based on an expert NAC sequence comparison, we propose forty orthologous groups of NAC sequences that were probably derived from an ancestor gene present in the most recent common ancestor of dicots and monocots. These orthologous groups provide a curated resource for large-scale protein sequence annotation of NAC transcription factors. The established orthology relationships also provide a useful reference for NAC function studies in newly sequenced genomes such as M. acuminata and other plant species.

  10. Alnus acuminata in dual symbiosis with Frankia and two different ectomycorrhizal fungi (Alpova austroalnicola and Alpova diplophloeus) growing in soilless growth medium

    Science.gov (United States)

    Alejandra G. Becerra; Euginia Menoyo; Irene Lett; Ching Y. Li

    2009-01-01

    In this study we investigated the capacity of Andean alder (Alnus acuminata Kunth), inoculated with Frankia and two ectomycorrhizal fungi (Alpova austroalnicola Dominguez and Alpova diplophloeus [Zeller and Dodge] Trappe and Smith), for nodulation and growth in pots of a soilless medium...

  11. Antitumor Effects and Biological Mechanism of Action of the Aqueous Extract of the Camptotheca acuminata Fruit in Human Endometrial Carcinoma Cells

    Directory of Open Access Journals (Sweden)

    Chi-Shian Lin

    2014-01-01

    Full Text Available The aqueous extracts of the leaves and fruit of Camptotheca acuminata have long been used in traditional Chinese medicine (TCM for treating cancer patients. The chemotherapeutic drug, camptothecin (CPT, and related analogs were first isolated from C. acuminata in the 1970s. Although the antitumor effects of CPT have been characterized in recent years, the antitumor effects of aqueous extracts of C. acuminata have not been clarified. The aims of our current study were to determine the tumor-suppression efficiency of an aqueous extract of the fruit of C. acuminata (AE-CA in the human endometrial carcinoma cell lines, HEC-1A, HEC-1B, and KLE, and compare its antitumor effects with those of CPT. Cell viability assays indicated that a dosage of AE-CA containing 0.28 mg/mL of CPT demonstrated enhanced cytotoxicity, compared with CPT treatment. The effects of AE-CA on the induction of cell cycle arrest, the accumulation of cyclin-A2 and -B1, and the activation of caspase-3 and caspase-7 were similar to those of CPT. Furthermore, AE-CA exhibited a synergistic effect on the cytotoxicity of cisplatin in HEC-1A and HEC-1B cells. These results indicated that AE-CA is a potent antitumor agent and can be combined with cisplatin for the treatment of human endometrial cancer.

  12. Palaeartic gastropod gains a foothold in the dominion of endemics: range expansion and morphological change of Lymnaea (Radix) auricularia in Lake Baikal

    NARCIS (Netherlands)

    Stift, M.; Michel, E.; Sitnikova, N.L.; Mamonova, Y.; Sherbakov, D.Y.

    2004-01-01

    In and around the endemic-dominated Lake Baikal, palaearctic species are generally restricted to shallow, sheltered bays and in- and out-flowing river floodplains. However, we observed populations of the palaearctic snail Lymnaea (Radix) auricularia on the steep, rocky littoral of Lake Baikal

  13. Palaeartic gastropod gains a foothold in the dominion of endemics: range expansion and morphological change of Lymnaea (Radix) auricularia in Lake Baikal

    NARCIS (Netherlands)

    M. Stift; E. Michel; N.L. Sitnikova; Y. Mamonova; D.Y. Sherbakov

    2004-01-01

    In and around the endemic-dominated Lake Baikal, palaearctic species are generally restricted to shallow, sheltered bays and in- and out-flowing river floodplains. However, we observed populations of the palaearctic snail Lymnaea (Radix) auricularia on the steep, rocky littoral of Lake Baikal proper

  14. Ocorrência de Lymnaea columella (Gastropoda: Lymnaeidae, hospedeiro intermediário da Fasciola hepatica, para o Estado da Paraíba, Brasil

    Directory of Open Access Journals (Sweden)

    Abílio Francisco José Pegado

    1998-01-01

    Full Text Available Foi registrada a ocorrência de Lymnaea columella (Gastropoda: Lymnaeidae, primeiro hospedeiro intermediário da Fasciola hepatica, para o Estado da Paraíba, Brasil, associado a macrófitas aquáticas.

  15. Ocorrência de Lymnaea columella (Gastropoda: Lymnaeidae, hospedeiro intermediário da Fasciola hepatica, para o Estado da Paraíba, Brasil

    Directory of Open Access Journals (Sweden)

    Francisco José Pegado Abílio

    1998-04-01

    Full Text Available Foi registrada a ocorrência de Lymnaea columella (Gastropoda: Lymnaeidae, primeiro hospedeiro intermediário da Fasciola hepatica, para o Estado da Paraíba, Brasil, associado a macrófitas aquáticas.

  16. Embryogenesis of the histaminergic system in the pond snail, Lymnaea stagnalis L.: an immunocytochemical and biochemical study.

    Science.gov (United States)

    Hegedus, E; Kaslin, J; Elekes, K

    2004-01-01

    Embryogenesis of the histaminergic system in the pond snail, Lymnaea stagnalis, was investigated by means of immunocytochemistry and HPLC assay. From the earliest onset of the of histamine-immunoreactive (HA-IR) elements, the labelled neurons were confined to the pedal, cerebral and buccal ganglia, whereas no IR cells within the pleural, parietal and visceral ganglia were detectable during the embryogenesis. Peripheral projections of the embryonic HA-IR neurons were missing. No transient HA-IR neurons could be found either inside or outside the CNS. The first HA-IR elements appeared at about E55% of embryonic development, at the beginning of metamorphosis, and were represented by three pairs of neurons located in the cerebral ganglia. Following metamorphosis, four pairs of HA-IR neurons were added; two of them occurred in the pedal (E65% stage of development) and two in the buccal (E90% stage of development) ganglia. During embryogenesis, HA-IR fibers were present in the cerebro-pedal connectives and in the cerebral, pedal and buccal commissures, whereas only little arborization could be observed in the neuropil of the ganglia. HPLC measurements revealed a gradual increase of HA content in the embryos during development, corresponding well to the course of the appearance of immunolabeled elements. It is suggested that the developing HAergic system plays a specific role in the process of gangliogenesis and CNS plasticity of embryonic Lymnaea.

  17. Micropropagación de la planta medicinalPsychotria acuminata

    Directory of Open Access Journals (Sweden)

    Alfonso Lara

    2003-01-01

    Full Text Available Psychotria acuminata es una planta medicinal que produce los alcaloides emetina, cephaelina y psychotrina, usados como expectorantes y eméticos. Hoy día estos alcaloides son extraídos de plantas silvestres pues esta especie no ha sido domesticada. Debido al uso potencial de los principios fitoquímicos, y a la escasa población de esta especie en el país, se desarrolló métodos de cultivo de tejidos para la reproducción clonal y masiva de esta planta. El material vegetal fue recolectado en 4 localidades de Costa Rica. En un medio de cultivo de Murashige y Skoog (MS, 1962, suplementado con 3 mg l-1 de BAP, 0,01 mg l-1 de ANA, 3% de azúcar y 2 g l-1 de phytagel, se logró la inducción de múltiples brotes a partir de las yemas axilares de microestacas (segmentos nodales de 1 cm de largo y de hojas provenientes de plántulas de 5 cm establecidas in vitro para 3 localidades. La formación de los brotes en las hojas ocurrió mediante organogénesis y embriogénesis. El enraizamiento in vitro de los brotes fue de un 100% cuando se utilizó un MS/2 suplementado con 6 mg l-1 de AIA. Debido a que el sistema radical generado in vitro muere una vez que las plántulas son sembradas en el sustrato en el invernadero, se utilizó Agriroot 1 DP® para generar raíces nuevas. Después de 8 semanas fue posible aclimatizar un 80% de las plántulas. La tasa de multiplicación, cuando se utiliza microestacas como explante, así como el tiempo para que ocurrieran los eventos morfogenéticos, fueron diferentes para los materiales de las 3 procedencias, lo que indica que las plantas de cada localidad son genéticamente diferentes.

  18. EIN3-like gene expression during fruit ripening of Cavendish banana (Musa acuminata cv. Grande naine).

    Science.gov (United States)

    Mbéguié-A-Mbéguié, Didier; Hubert, Olivier; Fils-Lycaon, Bernard; Chillet, Marc; Baurens, Franc-Christophe

    2008-06-01

    Ethylene signal transduction initiates with ethylene binding at receptor proteins and terminates in a transcription cascade involving the EIN3/EIL transcription factors. Here, we have isolated four cDNAs homologs of the Arabidopsis EIN3/EIN3-like gene, MA-EILs (Musa acuminata ethylene insensitive 3-like) from banana fruit. Sequence comparison with other banana EIL gene already registered in the database led us to conclude that, at this day, at least five different genes namely MA-EIL1, MA-EIL2/AB266318, MA-EIL3/AB266319, MA-EIL4/AB266320 and AB266321 exist in banana. Phylogenetic analyses included all banana EIL genes within a same cluster consisting of rice OsEILs, a monocotyledonous plant as banana. However, MA-EIL1, MA-EIL2/AB266318, MA-EIL4/AB266320 and AB266321 on one side, and MA-EIL3/AB266319 on the other side, belong to two distant subclusters. MA-EIL mRNAs were detected in all examined banana tissues but at lower level in peel than in pulp. According to tissues, MA-EIL genes were differentially regulated by ripening and ethylene in mature green fruit and wounding in old and young leaves. MA-EIL2/AB266318 was the unique ripening- and ethylene-induced gene; MA-EIL1, MA-EIL4/Ab266320 and AB266321 genes were downregulated, while MA-EIL3/AB266319 presented an unusual pattern of expression. Interestingly, a marked change was observed mainly in MA-EIL1 and MA-EIL3/Ab266319 mRNA accumulation concomitantly with changes in ethylene responsiveness of fruit. Upon wounding, the main effect was observed in MA-EIL4/AB266320 and AB266321 mRNA levels, which presented a markedly increase in both young and old leaves, respectively. Data presented in this study suggest the importance of a transcriptionally step control in the regulation of EIL genes during banana fruit ripening.

  19. Investigations into the mechanism of lead toxicity to the freshwater pulmonate snail, Lymnaea stagnalis.

    Science.gov (United States)

    Brix, Kevin V; Esbaugh, Andrew J; Munley, Kathleen M; Grosell, Martin

    2012-01-15

    The freshwater pulmonate snail, Lymnaea stagnalis, is the most sensitive aquatic organism tested to date for Pb with an estimated EC20 for juvenile snail growth of 3 μg l⁻¹. A previous study supported the hypothesis that this hypersensitivity to Pb was due to an extremely high Ca²⁺ uptake rate needed to support shell formation. The current study sought to build upon this working hypothesis and develop a mechanistic predictive model for inhibition of snail growth as a function of Pb exposure. Initial experiments confirmed previous predictions that juvenile snails have net Ca²⁺ uptake rates of 7000-8000 nmol g⁻¹ h⁻¹, approximately 100-fold higher than observed in a typical freshwater fish. However, an initial time course study revealed that the onset of growth inhibition occurs at least 4d prior to inhibition of net Ca²⁺ flux in Pb-exposed snails indicating the latter is not the primary mechanism of action. Qualitative observations during this experiment indicated snail feeding was inhibited in a dose-dependent manner. A subsequent experiment demonstrated that when food is withheld from snails for even 24 h, net Ca²⁺ uptake is significantly (∼50%) reduced. A second time course study demonstrated quantitatively that snail feeding is inhibited by Pb exposure by up to 98% at relatively high Pb concentrations (57 μg l⁻¹) but no inhibition was observed at ≤ 10 μg l⁻¹ Pb indicating feeding inhibition is not causing observed growth effects at concentrations approximating the EC20 of 3 μg l⁻¹ Pb. A final experiment testing whether Pb-induced growth effects are related to inhibition of carbonic anhydrase activity in the snail mantle also failed to demonstrate an effect. We conclude that while both feeding and net Ca²⁺ uptake in snails are affected by Pb exposure, they appear to be secondary effects. The primary mechanism of action explaining L. stagnalis hypersensitivity to Pb remains to be identified. Copyright © 2011 Elsevier B

  20. Lymnaea schirazensis, an Overlooked Snail Distorting Fascioliasis Data: Genotype, Phenotype, Ecology, Worldwide Spread, Susceptibility, Applicability

    Science.gov (United States)

    Bargues, María Dolores; Artigas, Patricio; Khoubbane, Messaoud; Flores, Rosmary; Glöer, Peter; Rojas-García, Raúl; Ashrafi, Keyhan; Falkner, Gerhard; Mas-Coma, Santiago

    2011-01-01

    Background Lymnaeid snails transmit medical and veterinary important trematodiases, mainly fascioliasis. Vector specificity of fasciolid parasites defines disease distribution and characteristics. Different lymnaeid species appear linked to different transmission and epidemiological patterns. Pronounced susceptibility differences to absolute resistance have been described among lymnaeid populations. When assessing disease characteristics in different endemic areas, unexpected results were obtained in studies on lymnaeid susceptibility to Fasciola. We undertook studies to understand this disease transmission heterogeneity. Methodology/Principal Findings A ten-year study in Iran, Egypt, Spain, the Dominican Republic, Mexico, Venezuela, Ecuador and Peru, demonstrated that such heterogeneity is not due to susceptibility differences, but to a hitherto overlooked cryptic species, Lymnaea schirazensis, confused with the main vector Galba truncatula and/or other Galba/Fossaria vectors. Nuclear rDNA and mtDNA sequences and phylogenetic reconstruction highlighted an old evolutionary divergence from other Galba/Fossaria species, and a low intraspecific variability suggesting a recent spread from one geographical source. Morphometry, anatomy and egg cluster analyses allowed for phenotypic differentiation. Selfing, egg laying, and habitat characteristics indicated a migration capacity by passive transport. Studies showed that it is not a vector species (n = 8572 field collected, 20 populations): snail finding and penetration by F. hepatica miracidium occur but never lead to cercarial production (n = 338 experimentally infected). Conclusions/Significance This species has been distorting fasciolid specificity/susceptibility and fascioliasis geographical distribution data. Hence, a large body of literature on G. truncatula should be revised. Its existence has henceforth to be considered in research. Genetic data on livestock, archeology and history along the 10,000-year

  1. Lymnaea schirazensis, an overlooked snail distorting fascioliasis data: genotype, phenotype, ecology, worldwide spread, susceptibility, applicability.

    Directory of Open Access Journals (Sweden)

    María Dolores Bargues

    Full Text Available BACKGROUND: Lymnaeid snails transmit medical and veterinary important trematodiases, mainly fascioliasis. Vector specificity of fasciolid parasites defines disease distribution and characteristics. Different lymnaeid species appear linked to different transmission and epidemiological patterns. Pronounced susceptibility differences to absolute resistance have been described among lymnaeid populations. When assessing disease characteristics in different endemic areas, unexpected results were obtained in studies on lymnaeid susceptibility to Fasciola. We undertook studies to understand this disease transmission heterogeneity. METHODOLOGY/PRINCIPAL FINDINGS: A ten-year study in Iran, Egypt, Spain, the Dominican Republic, Mexico, Venezuela, Ecuador and Peru, demonstrated that such heterogeneity is not due to susceptibility differences, but to a hitherto overlooked cryptic species, Lymnaea schirazensis, confused with the main vector Galba truncatula and/or other Galba/Fossaria vectors. Nuclear rDNA and mtDNA sequences and phylogenetic reconstruction highlighted an old evolutionary divergence from other Galba/Fossaria species, and a low intraspecific variability suggesting a recent spread from one geographical source. Morphometry, anatomy and egg cluster analyses allowed for phenotypic differentiation. Selfing, egg laying, and habitat characteristics indicated a migration capacity by passive transport. Studies showed that it is not a vector species (n = 8572 field collected, 20 populations: snail finding and penetration by F. hepatica miracidium occur but never lead to cercarial production (n = 338 experimentally infected. CONCLUSIONS/SIGNIFICANCE: This species has been distorting fasciolid specificity/susceptibility and fascioliasis geographical distribution data. Hence, a large body of literature on G. truncatula should be revised. Its existence has henceforth to be considered in research. Genetic data on livestock, archeology and history

  2. Phyto-adaptogens protect against environmental stress-induced death of embryos from the freshwater snail Lymnaea stagnalis.

    Science.gov (United States)

    Boon-Niermeijer, E K; van den Berg, A; Wikman, G; Wiegant, F A

    2000-10-01

    The main purpose of the studies presented in this paper is twofold: 1) to evaluate whether phyto-adaptogens (Acanthopanax senticosus and Rhodiola rosea) are able to exert a protective action against stress-induced death of embryos of the pond snail Lymnaea stagnalis; and 2) whether a possible protective action by phyto-adaptogens can be explained by the induction of heat shock proteins. Enhancement in resistance by phyto-adaptogens was studied by applying plant extracts for a period of 20 hours to 3-day old larvae of the pond snail Lymnaea stagnalis. Subsequently they were exposed to a high and toxic dose of different environmental stressors. The following stress conditions were selected: a physical stress condition (heat shock: 43 degrees C for 4 minutes), an oxidative stress condition (superoxide radicals induced by menadione (600 microM for 2 hours)) and heavy metal-induced stress (copper (150 microM for 1 hour) or cadmium (20 microM during 1 hour)). Both Acanthopanax and Rhodiola exert a strong protective action against a lethal heat shock. These adaptogens also significantly protect against the negative effect of superoxide radicals as induced by menadione. With respect to the protective action against exposure to heavy metals a small but significant protection was observed against intoxication with copper or cadmium by the phyto-adaptogens. In summary, there appears to be a difference in efficiency in enhancing resistance to the various stress conditions used (heat shock>menadione>copper>cadmium). Based on the results presented in this paper, we can conclude that phyto-adaptogens are able to enhance the resistance against the different stress conditions tested in developing individuals of Lymnaea. Although the degree to which resistance is enhanced appears to depend on the type of stressor applied, our results confirm the definition of phyto-adaptogens as being universal enhancers of non-specific resistance against different kinds of stress conditions. With

  3. Effects of medium nutrition on cell growth and isocamptothecin A and B production by suspension cell culture of Camptotheca acuminata

    Institute of Scientific and Technical Information of China (English)

    Zhang Dongyan; Yu Fang; Bai Fengwu; An Lijia

    2006-01-01

    The effects of initial sucrose concentration, nitrate to ammonium ratio, total N concentration and phosphate concentration in medium on cell growth and isocamptothecin A and B synthesis by suspension cell culture of Camptotheca acuminata were investigated in 250 mL shake flasks. 30 g L-1 sucrose concentration was beneficial to secondary metabolites synthesis. The cell growth and metabolites synthesis were also affected by the ratio of NO-3/NH+4, and nitrate was favourable for cell growth. The maximum dry weight was achieved when nitrate was used as the sole N source. The effect of total initial N on the cell cultures was also investigated with NO-3/NH+4 ratio of 1∶2. The final dry cell weight was similar throughout culture period and 50 mM initial N was favourable for secondary metabolite synthesis. 50 mM initial phosphate concentration facilitated both cell growth and secondary metabolites synthesis.

  4. Anatomical and molecular characterization of Lactarius aff. omphaliformis, Russula alnijorullensis and Cortinarius tucumanensis ectomycorrhizae on Alnus acuminata.

    Science.gov (United States)

    Becerra, Alejandra; Beenken, Ludwig; Pritsch, Karin; Daniele, Graciela; Schloter, Michael; Agerer, Reinhard

    2005-01-01

    Ectomycorrhizae (ECM) of Lactarius aff. omphaliformis Romagn., Russula alnijorullensis (Sing.) Sing. and Cortinarius tucumanensis Mos. on Andean alder (Alnus acuminata Kunth) were characterized and identified. The identification of the fungal symbionts was achieved by morpho-anatomical observations of mycorrhizae and by comparison of ITS-RFLP patterns obtained from ECM and fruitbodies. L. aff omphaliformis ECM differed in some morphological details such as ramification and mantle type from ECM of the same species on A. glutinosa. L. aff omphaliformis ECM show an orange to ochre mantle containing latex cells, which stain with sulpho-vanillin, emanating hyphae without clamps. R. alnijorullensis ECM represent a typical Russula-type-ECM, light yellow to pinkish, the outer mantle being composed of triangular latex-filled cells staining with sulpho-vanillin, emanating hyphae without clamps. C. tucumanensis ECM exhibit a white (silvery) to yellowish brown mantle covered with soil particles, emanating hyphae with clamps.

  5. In vitro propagation and assessment of the genetic fidelity of Musa acuminata (AAA) cv. Vaibalhla derived from immature male flowers.

    Science.gov (United States)

    Hrahsel, Lalremsiami; Basu, Adreeja; Sahoo, Lingaraj; Thangjam, Robert

    2014-02-01

    An efficient in vitro propagation method has been developed for the first time for Musa acuminata (AAA) cv. Vaibalhla, an economically important banana cultivar of Mizoram, India. Immature male flowers were used as explants. Murashige and Skoog's (MS) medium supplemented with plant growth regulators (PGRs) were used for the regeneration process. Out of different PGR combinations, MS medium supplemented with 2 mg L(-1) 6-benzylaminopurine (BAP) + 0.5 mg L(-1) α-naphthalene acetic acid (NAA) was optimal for production of white bud-like structures (WBLS). On this medium, explants produced the highest number of buds per explant (4.30). The highest percentage (77.77) and number (3.51) of shoot formation from each explants was observed in MS medium supplemented with 2 mg L(-1) kinetin + 0.5 mg L(-1) NAA. While MS medium supplemented with a combination of 2 mg L(-1) BAP + 0.5 mg L(-1) NAA showed the maximum shoot length (14.44 cm). Rooting efficiency of the shoots was highest in the MS basal medium without any PGRs. The plantlets were hardened successfully in the greenhouse with 96% survival rate. Random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) markers were employed to assess the genetic stability of in vitro regenerated plantlets of M. acuminata (AAA) cv. Vaibalhla. Eight RAPD and 8 ISSR primers were successfully used for the analysis from the 40 RAPD and 30 ISSR primers screened initially. The amplified products were monomorphic across all the regenerated plants and were similar to the mother plant. The present standardised protocol will find application in mass production, conservation and genetic transformation studies of this commercially important banana.

  6. Genetic variability of Brazilian populations of Lymnaea columella (Gastropoda: Lymnaeidae), an intermediate host of Fasciola hepatica (Trematoda: Digenea).

    Science.gov (United States)

    Cardoso, Paula Cristina Marques; Caldeira, Roberta Lima; Lovato, Maria Bernadete; Coelho, Paulo Marcos Zech; Berne, Maria Elisabeth Aires; Müller, Gertrud; Carvalho, Omar dos Santos

    2006-03-01

    In Brazil, Lymnaea columella is the most important intermediate host of Fasciola hepatica, the etiological agent of fasciolosis, which is a parasitic disease of veterinarian and human importance. Random amplified polymorphic DNA (RAPD) was used to investigate the genetic variability within and among nine Brazilian populations of L. columella comprising 205 individuals. A number of four primers were used for analysis of molecular variance (AMOVA). Out of 83 RAPD markers, 63 (76%) were polymorphic and revealed 119 unique RAPD profiles. The levels of genetic variability found in the populations were low and most of the genetic variation was interpopulational (81.6%) when compared to intrapopulational variability (18.4%). These results are in accordance with the dynamics and distribution of the populations analyzed.

  7. Sympatric and allopatric combinations of Lymnaea columella and Fasciola hepatica from southern and south-eastern Brazil.

    Science.gov (United States)

    Coelho, L H L; Lima, W S; Guimaraes, M P

    2009-09-01

    Experimental infections of Lymnaea columella with Fasciola hepatica were carried out to test the effect of sympatric and allopatric combinations between parasite and host, by using snails and flukes from southern and south-eastern Brazil. Four groups of 50 snails were infected with four miracidia per snail: two groups in sympatric and two groups in allopatric combinations. Sympatric combinations between parasite and host were more efficient than allopatric ones when snails from Itajubá were used, but the opposite was observed in infections involving snails from Pelotas. The sympatric association between L. columella and F. hepatica from Itajubá was significantly higher than in the other combinations. We concluded that the host-parasite relationship between L. columnella and F. hepatica may vary according to the geographical origin of the snails and flukes involved.

  8. The competitive interaction of snails Thiara scabra and Physa doopi on the snail Lymnaea rubiginosa under laboratory conditions

    Directory of Open Access Journals (Sweden)

    Sarwitri Endah Estuningsih

    1998-03-01

    Full Text Available The competitive interaction of the snails Thiara scabra and Physa doopi against the snail Lymnaea rubiginosa, the intermediate host ofFasciola gigantica has been studied. Aquaria, 60 x 40 x 20 cm and 30 x 20 x 10 cm in size were used, and the two snail species were introduced in different proportion . The results over a one year period showed that the competition between snail L. rubiginosa and T. scabra or P. doopi has started after 8 months as demonstrated by the reduction of the population ofL. rubiginosa and increasing the population of T. scabra or P. doopi. The competitive interaction does not seem to be due to competition for food but to a chemical factors, possibly water-soluble pheromones. The other explanation is discussed .

  9. Effect of non target snails on some biological of Lymnaea natalensis snails and their infection to Fasciola gigantica.

    Science.gov (United States)

    Bakry, Fayez A; Hamdi, Salwa A H

    2006-12-01

    The influence of non-target freshwater snails (Melanoides tuberculata and Planorbis planorbis) on the capacity of Fasciola egg production F. gigantica miracidia to infect Lymnaea natalensis and their effect on mortality and growth rates showed that the snails exhibited a competitive ability against L. natalensis. The mortality rate existed in mixed cultures with snails was greatly increased, and increased with increase of snails number. The egg production and growth rate were negatively affected by the presence of M. tuberculata and P. planorbis which was more pronounced when snails were at higher ratio lL: 10D. Also, the snails showed significant degree of reduction in infection rate of L. natalensis with F. gigantica miracidia.

  10. Population dynamics of Lymnaea columella and its natural infection by Fasciola hepatica in the State of Minas Gerais, Brazil.

    Science.gov (United States)

    Coelho, L H L; Lima, W S

    2003-03-01

    Studies on the population dynamics and natural infection of Lymnaea columella by Fasciola hepatica were carried out from September 1999 to December 2000 in a low-lying area near Itajubá in the Brazilian State of Minas Gerais. A total of 626 snails were collected monthly at nine different sites, counted, and dissected to search for larvae of F. hepatica. The highest populations of L. columella were reached in October of 1999 and August of 2000, and the highest natural infection rates of snails by F. hepatica were reached in September 1999 (5.2%) and July 2000 (3.9%). The removal by farmers of aquatic plants from the drainage furrows caused a drastic reduction in this snail population.

  11. Histology and Cytochemistry of the Neurosecretory Cells (NSC of the Freshwater Snail Lymnaea luteola (Lamarck Mollusca: Gastropoda

    Directory of Open Access Journals (Sweden)

    Vijaya Kumar Kanapala

    2015-01-01

    Full Text Available Four types of neurosecretory (NS cells are noticed in the cerebral, pleural, buccal and pedal ganglion of the freshwater snail Lymnaea luteola. According to the size and staining properties they are classified as A, B, C and D type cells. These are giant cells, medium cells, small cells and smallest cells. Type ‘A’ cells are largest of the all cells and measures about 0.0600-0.0800 mm in diameter. The B cells are smaller than ‘A’ cells and are ranges from 0.035-0.040 mm in diameter. The ‘C’ and ‘D’ cells are smaller than the ‘A’ and ‘B ‘cells and more or less oval in shape. The histochemical observations reveal that the neurosecretory material is rich in carbohydrates, disulphides, sulfhydryl group, protein bound amino groups, glycoprotein and lipids.

  12. Comparative shell morphology of Lymnaea (Bullastra) cumingiana (Pulmonata: Lymnaeidae) and related taxa in the Indo-Pacific region.

    Science.gov (United States)

    Monzon, R B; Kitikoon, V; Thammapalerd, N; Temcharoen, P; Sornmani, S; Viyanant, V

    1993-09-01

    Comparative shell morphology using both quantitative and qualitative parameters was employed to investigate the taxonomic relationship between the endemic Philippine species, Lymnaea (Bullastra) cumingiana and five other lymnaeid "species" in the Indo-Pacific region, namely: L. (Radix) quadrasi (Philippines). L. (Radix) rubiginosa (Indonesia), L. (Radix) rubiginosa (Thailand), L. (Radix) viridis (Guam) and L. (Radix) viridis (Hong Kong). Fifty randomly chosen adult specimens of each species were studied and compared, although only field-collected specimens were studied for the first four groups and laboratory-raised specimens for the last two group. Results strongly suggested that L. cumingiana is a distinct species among the rest. L. quadrasi, L. rubiginosa (Indonesia) and L. rubiginosa (Thailand) exhibited great affinity towards each other. Likewise, the two geographical isolates of L. viridis were practically identical to each other except for some minor size differences.

  13. Structure-dependent effects of amyloid-β on long-term memory in Lymnaea stagnalis.

    Science.gov (United States)

    Ford, Lenzie; Crossley, Michael; Vadukul, Devkee M; Kemenes, György; Serpell, Louise C

    2017-05-01

    Amyloid-β (Aβ) peptides are implicated in the causation of memory loss, neuronal impairment, and neurodegeneration in Alzheimer's disease. Our recent work revealed that Aβ 1-42 and Aβ 25-35 inhibit long-term memory (LTM) recall in Lymnaea stagnalis (pond snail) in the absence of cell death. Here, we report the characterization of the active species prepared under different conditions, describe which Aβ species is present in brain tissue during the behavioral recall time point and relate the sequence and structure of the oligomeric species to the resulting neuronal properties and effect on LTM. Our results suggest that oligomers are the key toxic Aβ1-42 structures, which likely affect LTM through synaptic plasticity pathways, and that Aβ 1-42 and Aβ 25-35 cannot be used as interchangeable peptides. © 2017 The Authors. FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

  14. Effects of DDT and permethrin on neurite growth in cultured neurons of chick embryo brain and Lymnaea stagnalis.

    Science.gov (United States)

    Ferguson, C A; Audesirk, G

    1990-01-01

    The pesticides permethrin and 1,1-bis(4-chlorophenyl)-2,2,2-trichloroethane (DDT), dissolved in either ethanol (EtOH) or dimethylsulphoxide (DMSO), were studied to determine their effect on neurite growth from cultured neurons of Lymnaea stagnalis and embryonic chicks. Both of these toxins decreased the percentage of neurons growing neurites, mean neurite length, and number of neurites/cell in a dose-dependent manner. DMSO increased the toxicity of permethrin and DDT in L. stagnalis neurons. EtOH was not used as a solvent with the embryonic chick cultures. Pre-existing neurites of L. stagnalis neurons exposed to permethrin regressed in a dose- and time-dependent manner. These two toxins may affect neurite outgrowth through interference with intracellular calcium regulation.

  15. Relation between the concentration of Dinophysis acuminata and diarrheic shellfish poisoning toxins in blue mussels (Mytilus edulis) during a toxic episode in the Limfjord (Denmark), 2006

    DEFF Research Database (Denmark)

    Jørgensen, Kevin; Andersen, Per

    2008-01-01

    were observed. The maximum concentration level of approximately 600-700 mu g OA equivalents kg(-1) was reached at approximately 5,000 cells1(-1) of D. acuminata. A further increase in the concentration of D. acuminata did not lead to any further increase in the concentration of OA in the blue mussels...... equivalents in the raw blue mussels was 706 mu g/kg. Single cell toxicity measurements showed a mean content of 31 pg OA cell(-1) (min 19; max 72 pg OA cell(-1)). The impact of the concentration procedure was investigated using a range of volumes filtered from 0,21-101 filter(-1). Toxins were lost during...

  16. Evaluación in vitro de compuestos presentes en Critoniella acuminata y Salvia rubescens frente a enzimas de desgranulación leucocitaria

    OpenAIRE

    Jaimes Galvis, Diana Carolina

    2010-01-01

    En el presente trabajo se implementaron técnicas in vitro con el fin de contribuir al estudio farmacológico de principios activos de plantas medicinales colombianas con potencial antiinflamatorio como: ayapina, aislada de Critoniella acuminata, amarisolide y arbutina aisladas de Salvia rubescens previamente en el Grupo de Investigación de Principios Bioactivos de Plantas. Se evaluaron enzimas relacionadas con el proceso de desgranulación leucocitaria: Mieloperoxidasa, Elastasa, Lisozima y Bet...

  17. Estudo morfométrico da concha de Lymnaea columella say, 1817 (Mollusca, Gastropoda, Pulmonata

    Directory of Open Access Journals (Sweden)

    Marlene T. Ueta

    1980-12-01

    Full Text Available Foram estudadas variações morfométricas de conchas de L. columella, provenientes de dez criadouros localizados nos seguintes municípios do Estado de São Paulo: - Campinas, Americana, Atibaia, Pirassununga, Caçapava e Taubaté. Foram analisados os diferentes tipos de ambientes onde as limneas são encontradas com maior freqüência, estabelecendo-se a época do ano com maior abundância em espécimes, que correspondeu aos meses de julho a outubro. As medidas nas conhas dos diferentes criadouros referiram-se ao comprimento e largura da concha, comprimento e largura da abertura, comprimento da espira e número de voltas. Foram estabelecidos os coeficientes de correlação e de regressão e realizadas análises de variância entre as medidas tomadas e os índices obtidos da relação entre largura/comprimento da concha. Estas conchas foram comparadas com as de L. columella, L. viator, L. cubensis da coleção do Museu Nacional do Rio de Janeiro. Para a maioria das medidas as conchas mostraram proporções constantes, embora apresentassem diferenças em relação ao desenvolvimento. A maior variação foi observada em relação ao comprimento da espira. As variações morfométricas das conchas foram relacionadas com alguns fatores externos como pH, alcalinidade, dureza e teor da água. Aparentemente apenas a dureza total da água influiu na consistência das conchas.Shells of Lymnaea columella from ten populations from the State of São Paulo were studied to determine morphometric variation. Samples were collected in the following municipalities: Campinas, Americana, Atibaia, Pirassununga, Caçapava and Taubaté. Five measurements were taken from each shell: length and width of the shell, length and width of the aperture and lenght of the spire. Two ratios were also established: width/lenght of the shell and length of the aperture /length of the shell. The numbers of whorls and the length of the shell were also determined. Statistical tests

  18. Identification and functional expression of a family of nicotinic acetylcholine receptor subunits in the central nervous system of the mollusc Lymnaea stagnalis.

    Science.gov (United States)

    van Nierop, Pim; Bertrand, Sonia; Munno, David W; Gouwenberg, Yvonne; van Minnen, Jan; Spafford, J David; Syed, Naweed I; Bertrand, Daniel; Smit, August B

    2006-01-20

    We described a family of nicotinic acetylcholine receptor (nAChR) subunits underlying cholinergic transmission in the central nervous system (CNS) of the mollusc Lymnaea stagnalis. By using degenerate PCR cloning, we identified 12 subunits that display a high sequence similarity to nAChR subunits, of which 10 are of the alpha-type, 1 is of the beta-type, and 1 was not classified because of insufficient sequence information. Heterologous expression of identified subunits confirms their capacity to form functional receptors responding to acetylcholine. The alpha-type subunits can be divided into groups that appear to underlie cation-conducting (excitatory) and anion-conducting (inhibitory) channels involved in synaptic cholinergic transmission. The expression of the Lymnaea nAChR subunits, assessed by real time quantitative PCR and in situ hybridization, indicates that it is localized to neurons and widespread in the CNS, with the number and localization of expressing neurons differing considerably between subunit types. At least 10% of the CNS neurons showed detectable nAChR subunit expression. In addition, cholinergic neurons, as indicated by the expression of the vesicular ACh transporter, comprise approximately 10% of the neurons in all ganglia. Together, our data suggested a prominent role for fast cholinergic transmission in the Lymnaea CNS by using a number of neuronal nAChR subtypes comparable with vertebrate species but with a functional complexity that may be much higher.

  19. Effects of in vitro lead exposure on voltage-sensitive calcium channels differ among cell types in central neurons of Lymnaea stagnalis.

    Science.gov (United States)

    Audesirk, G; Audesirk, T

    1989-01-01

    The effects of acute in vitro lead exposure on slowly inactivating voltage-sensitive calcium channels in central neurons of the freshwater pond snail Lymnaea stagnalis were studied under voltage clamp. Three physiologically distinct cell types were used: two subsets of the B cell cluster (Bpos and Bneg) and the pedal giant neuron (RPeD1). In Bpos neurons, 5 nM free Pb2+ irreversibly inhibited current flow through calcium channels by 38 +/- 10%. In Bneg neurons, 5 nM free Pb2+ slightly inhibited inward currents (12 +/- 6%) and may have shifted their voltage dependence to more depolarized voltages. The inhibition and voltage shift were irreversible. In RPeD1 neurons, Pb2+ caused a small, statistically insignificant inhibition of inward current (5 nM free Pb2+; 18 +/- 19%; 30 nM free Pb2+: 31 +/- 23%). The effects of Pb2+ were fully reversible. These data indicate that (1) voltage-sensitive calcium channels in Lymnaea neurons are inhibited by nanomolar concentrations of free Pb2+; (2) there are multiple types of calcium channels in Lymnaea neurons; and (3) the effects of in vitro lead exposure differ qualitatively among channel types.

  20. Fungus-Elicited Metabolites from Plants as an Enriched Source for New Leishmanicidal Agents: Antifungal Phenyl-Phenalenone Phytoalexins from the Banana Plant (Musa acuminata) Target Mitochondria of Leishmania donovani Promastigotes

    Science.gov (United States)

    Luque-Ortega, Juan Román; Martínez, Silvia; Saugar, José María; Izquierdo, Laura R.; Abad, Teresa; Luis, Javier G.; Piñero, José; Valladares, Basilio; Rivas, Luis

    2004-01-01

    Two antifungal phenyl-phenalenone phytoalexins isolated from the banana plant (Musa acuminata) elicited with the fungus Fusarium oxysporum, together with a methoxy derivative of one of them and two epoxide precursors of their chemical synthesis, were tested for leishmanicidal activity on Leishmania donovani promastigotes and L. infantum amastigotes. Drugs inhibited proliferation of both forms of the parasite with a 50% lethal concentration range between 10.3 and 68.7 μg/ml. Their lethal mechanism was found linked to the respiratory chain by a systematic approach, including electron microscopy, measurement of the oxygen consumption rate on digitonin-permeabilized promastigotes, and enzymatic assays on a mitochondrial enriched fraction. Whereas the whole set of compounds inhibited the activity of fumarate reductase in the mitochondrial fraction (50% effective concentration [EC50] between 33.3 and 78.8 μg/ml) and on purified enzyme (EC50 = 53.3 to 115 μg/ml), inhibition for succinate dehydrogenase was only observed for the two phytoalexins with the highest leishmanicidal activity: anigorufone and its natural analogue 2-methoxy-9-phenyl-phenalen-1-one (EC50 = 33.5 and 59.6 μg/ml, respectively). These results provided a new structural motif, phenyl-phenalenone, as a new lead for leishmanicidal activity, and support the use of plant extracts enriched in antifungal phytoalexins, synthesized under fungal challenge, as a more rational and effective strategy to screen for new plant leishmanicidal drugs. PMID:15105102

  1. Analysis of non-TIR NBS-LRR resistance gene analogs in Musa acuminata Colla: Isolation, RFLP marker development, and physical mapping

    Directory of Open Access Journals (Sweden)

    Souza Manoel T

    2008-01-01

    Full Text Available Abstract Background Many commercial banana varieties lack sources of resistance to pests and diseases, as a consequence of sterility and narrow genetic background. Fertile wild relatives, by contrast, possess greater variability and represent potential sources of disease resistance genes (R-genes. The largest known family of plant R-genes encode proteins with nucleotide-binding site (NBS and C-terminal leucine-rich repeat (LRR domains. Conserved motifs in such genes in diverse plant species offer a means for isolation of candidate genes in banana which may be involved in plant defence. Results A computational strategy was developed for unbiased conserved motif discovery in NBS and LRR domains in R-genes and homologues in monocotyledonous plant species. Degenerate PCR primers targeting conserved motifs were tested on the wild cultivar Musa acuminata subsp. burmannicoides, var. Calcutta 4, which is resistant to a number of fungal pathogens and nematodes. One hundred and seventy four resistance gene analogs (RGAs were amplified and assembled into 52 contiguous sequences. Motifs present were typical of the non-TIR NBS-LRR RGA subfamily. A phylogenetic analysis of deduced amino-acid sequences for 33 RGAs with contiguous open reading frames (ORFs, together with RGAs from Arabidopsis thaliana and Oryza sativa, grouped most Musa RGAs within monocotyledon-specific clades. RFLP-RGA markers were developed, with 12 displaying distinct polymorphisms in parentals and F1 progeny of a diploid M. acuminata mapping population. Eighty eight BAC clones were identified in M. acuminata Calcutta 4, M. acuminata Grande Naine, and M. balbisiana Pisang Klutuk Wulung BAC libraries when hybridized to two RGA probes. Multiple copy RGAs were common within BAC clones, potentially representing variation reservoirs for evolution of new R-gene specificities. Conclusion This is the first large scale analysis of NBS-LRR RGAs in M. acuminata Calcutta 4. Contig sequences were

  2. Dendrocronología de Alnus acuminata en el bosque reservado de San Pedro de Saño, Huancayo

    Directory of Open Access Journals (Sweden)

    Edilson Requena Rojas

    2015-12-01

    Full Text Available En este trabajo evaluamos el potencial de Alnus acuminata para su uso posterior en estudios dendroclimatológicos. Se analizó una cronología de ancho de anillos para un bosque de A. acuminata en San Pedro de Saño y se relacionó el crecimiento de los árboles con los registros instrumentales de temperatura media, máxima y mínima, precipitación y horas sol de las estaciones meteorológicas de Huayao (12° 02´ 18.1¨ S - 75° 19´22.2¨ O y Santa Ana (12° 00´ 15¨ S - 75° 13´ 15¨ O. La cronología de ancho de anillos está compuesta por 33 series de 22 árboles y cubre el período 1968-2013. El crecimiento de los árboles estuvo relacionado negativamente con la temperatura mínima mensual del mes de abril del año corriente. Se observó una relación positiva y significativa entre la cronología de crecimiento y la precipitación de la estación de Santa Ana para los meses de marzo del año previo y diciembre del año actual de crecimiento. Las horas sol mensuales de abril del año corriente tienen una correlación significativa con el crecimiento radial. Existe influencia de las precipitaciones del verano previo y primavera del año corriente favoreciendo el crecimiento del árbol. El árbol entra en dormancia, posiblemente por las bajas temperaturas de otoño. El amplio rango de distribución y la utilización histórica de su madera en construcciones en el pasado, abre la posibilidad de extender temporalmente los registros dendrocronológicos, en los Andes centrales de Perú.

  3. A model for μ-biomimetic thermal infrared sensors based on the infrared receptors of Melanophila acuminata.

    Science.gov (United States)

    Siebke, Georg; Holik, Peter; Schmitz, Sam; Schmitz, Helmut; Lacher, Manfred; Steltenkamp, Siegfried

    2014-09-01

    Beetles of the genus Melanophila acuminata detect forest fires from distances as far as 130 km with infrared-sensing organs. Inspired by this extremely sensitive biological device, we are developing an IR sensor that operates at ambient temperature using MEMS technology. The sensor consists of two liquid-filled chambers that are connected by a micro-fluidic system. Absorption of IR radiation by one of these chambers leads to heating and expansion of a liquid. The increasing pressure deflects a membrane covered by one electrode of a plate capacitor. The micro-fluidic system and the second chamber represent a fluidic low-pass filter, preventing slow, but large pressure changes. However, the strong frequency dependence of the filter demands a precise characterization of its properties. Here, we present a theoretical model that describes the frequency-dependent response of the sensor based on material properties and geometrical dimensions. Our model is divided into four distinct parts that address different aspects of the sensor. The model describes the frequency-dependent behaviour of the fluidic filter and a thermal low-pass filter as well as saturation effects at low frequencies. This model allows the calculation of optimal design parameters, and thereby provides the foundation for the development of such a sensor.

  4. Three hydroxylated lupeol-based triterpenoid esters isolated from the Eastern Nigeria mistletoe parasitic on Kola acuminata.

    Science.gov (United States)

    Omeje, Edwin Ogechukwu; Osadebe, Patience Ogoamaka; Esimone, Charles Okechukwu; Nworu, Chukwuemeka Sylvester; Kawamura, Akira; Proksch, Peter

    2012-01-01

    Column fractionation and purification of an n-hexane fraction led to the isolation of three lupeol-based triterpenoid esters from the leaves of the Eastern Nigeria mistletoe, Loranthus micranthus Linn parasitic on a local kola nut tree, Kola acuminata. These three compounds were adequately characterised using a combination of UV/visible, IR, NMR (¹³C-NMR and ¹H-NMR), DEPT, MS and two-dimensional correlation (H-H COSY, Hetero-nuclear Single Quantum Correlation (HSQC), HMBC, NOE and NOESY) studies as 7β,15α-dihydroxyl-lup-20(29)-ene-3β-esters of palmitic (I), stearic (II) and eicosanoic acids (III). The characterisation of other isolated compounds is ongoing. Remarkably, this is the first report of the existence of fatty acid esters of an unusual 7β,15α-dihydroxylated lupeol in the Eastern Nigeria mistletoe. These isolated compounds might contribute in part to the numerous established bio-activities of the Eastern Nigeria mistletoes.

  5. Carbohydrate binding properties of banana (Musa acuminata) lectin I. Novel recognition of internal alpha1,3-linked glucosyl residues.

    Science.gov (United States)

    Mo, H; Winter, H C; Van Damme, E J; Peumans, W J; Misaki, A; Goldstein, I J

    2001-05-01

    Examination of lectins of banana (Musa acuminata) and the closely related plantain (Musa spp.) by the techniques of quantitative precipitation, hapten inhibition of precipitation, and isothermal titration calorimetry showed that they are mannose/glucose binding proteins with a preference for the alpha-anomeric form of these sugars. Both generate precipitin curves with branched chain alpha-mannans (yeast mannans) and alpha-glucans (glycogens, dextrans, and starches), but not with linear alpha-glucans containing only alpha1,4- and alpha1,6-glucosidic bonds (isolichenan and pullulan). The novel observation was made that banana and plantain lectins recognize internal alpha1,3-linked glucosyl residues, which occur in the linear polysaccharides elsinan and nigeran. Concanavalin A and lectins from pea and lentil, also mannose/glucose binding lectins, did not precipitate with any of these linear alpha-glucans. This is, the authors believe, the first report of the recognition of internal alpha1,3-glucosidic bonds by a plant lectin. It is possible that these lectins are present in the pulp of their respective fruit, complexed with starch.

  6. CO2, H2O exchange and stomatal regulation of regenerated Camptotheca acuminata plantlets during ex vitro acclimatization

    Institute of Scientific and Technical Information of China (English)

    WANG Hui-mei; LI Yan-hua; GAO Yin-xiang; ZU Yuan-gang

    2006-01-01

    For finding the changes in CO2, H2O exchange and their stomatal regulation during ex vitro acclimatization of regenerated Camptotheca acuminata plantlets, the net photosynthesis rate (Pn), respiration rate (Rd), light compensation point (Lc) and light saturation point (Ls), transpiration rate (Tr), stomatal conductance (gs) and water use efficiency(WUE) were measured during 37 days of ex vitro acclimatization. The results showed that Pn sharply increased until 29 days, then slightly decreased. A substantial decrease in Lc and a substantial increase of Ls in the former two weeks were observed, indicating the light regime enlargement for effective leaf photosynthesis. Tr and gs abruptly decreased during the first week then linearly increased until 29days ex vitro acclimatization, reflecting the strong regulation effect of stomata on water changes of ex vitro acclimating plantlets. Stomatal regulation effect on CO2 exchange was different from that on water exchange, i.e. Pn was almost independent of gs during the first week, while Pn was significantly correlated with gs thereafter (i.e. dual patterns). Different from dual patterns of gs-Pn relation, the Tr monotonously linearly increased with gs. Furthermore, WUE was almost independent on gs during the first week, while a marked decreasing tendency with gs was found thereafter. At the beginning of the acclimatization, WUE was mainly determined by photosynthetic capacity, while transpiration becomes a main determinant factor for WUE from 7 to 37 days' acclimatization.

  7. Spatial and temporal effects on seed dispersal and seed predation of Musa acuminata in southern Yunnan, China.

    Science.gov (United States)

    Meng, Lingzeng; Gao, Xiuxia; Chen, Jin; Martin, Konrad

    2012-03-01

    Wild bananas are abundant in tropical areas and many ecologists have observed that the succession process is quicker following increased disturbance. This study was conducted to analyze animal-seed interactions and their effects on the seed fate of a wild banana species (Musa acuminata) in tropical southern Yunnan (China) through experiments considering spatial (site and habitat) and temporal (seasons) variation. The largest proportion of fruits (81%) was removed by frugivorous seed dispersers, especially by bats at nighttime. Only 13% of the fruits were removed by climbing seed predators (different species of rats). In the exclosure treatment, rodents accounted for a significantly higher total artificially exposed seed removal number than ants, but with spatial and temporal differences. The highest seed predation rate by rodents (70%) was found in forest with wild banana stands, corresponding with the highest rodent diversity (species numbers and abundance) among the habitat types. In contrast, the seed removal number by ants (57%) was highest in the open land habitats, but there was no close correlation with ant diversity. Seed removal numbers by ants were significantly higher in the dry compared to the rainy season, but rodent activity showed no differences between seasons. The overall results suggest that the largest proportion of seeds produced by wild banana are primarily dispersed by bats. Primary seed dispersal by bats at nighttime is essential for wild banana seeds to escape seed predation. © 2012 ISZS, Blackwell Publishing and IOZ/CAS.

  8. Development of an embryo toxicity test with the pond snail Lymnaea stagnalis using the model substance tributyltin and common solvents.

    Science.gov (United States)

    Bandow, Cornelia; Weltje, Lennart

    2012-10-01

    The development of a chronic mollusc toxicity test is a current work item on the agenda of the OECD. The freshwater pond snail Lymnaea stagnalis is one of the candidate snail species for such a test. This paper presents a 21-day chronic toxicity test with L. stagnalis, focussing on embryonic development. Eggs were collected from freshly laid egg masses and exposed individually until hatching. The endpoints were hatching success and mean hatching time. Tributyltin (TBT), added as TBT-chloride, was chosen as model substance. The selected exposure concentrations ranged from 0.03 to 10 μg TBT/L (all as nominal values) and induced the full range of responses. The embryos were sensitive to TBT (the NOEC for mean hatching time was 0.03 μg TBT/L and the NOEC for hatching success was 0.1 μg TBT/L). In addition, data on maximum limit concentrations of seven common solvents, recommended in OECD aquatic toxicity testing guidelines, are presented. Among the results, further findings as average embryonic growth and mean hatching time of control groups are provided. In conclusion, the test presented here could easily be standardised and is considered useful as a potential trigger to judge if further studies, e.g. a (partial) life-cycle study with molluscs, should be conducted.

  9. Bioaccumulation of copper and toxic effects on feeding, growth, fecundity and development of pond snail Lymnaea luteola L.

    Science.gov (United States)

    Das, Sangita; Khangarot, B S

    2011-01-15

    We studied the bioaccumulation and the toxic effects of Cu on survival, number of eggs and eggmasses laying, embryo development, growth, and food consumption in an Indian pond snail, Lymnaea luteola L. exposed for 7 weeks. Copper caused loss of chemoreception, locomotion and inhibited food consumption significantly during 7 weeks of exposure. Food consumption in Cu exposed snails significantly decreased and at 56 and 100 μg L(-1), snail stopped feeding activity. Mean number of eggmasses or eggs significantly decreased in Cu concentrations during the 7 week study. The percentage hatching decreased in Cu concentrations but there was more than 95% hatched in control in 10-11 days after spawning. Egg development was completely inhibited at 100 μg L(-1), while abnormal embryonic development observed at 32 and 56 μg L(-1) of Cu. The Cu concentration in tissues increased in Cu treated snails and bioaccumulation factor ranged from 2.3 to 18.7. Snail growth at 5.6 and 10 μg L(-1) was reduced by 6.2% and 16.9%, respectively. The study revealed that snail embryos and adults could be used as in vivo test models for ecotoxicological studies. Findings of present study are helpful for advancing water quality guidelines for protecting aquatic biota.

  10. Modelling effects of diquat under realistic exposure patterns in genetically differentiated populations of the gastropod Lymnaea stagnalis.

    Science.gov (United States)

    Ducrot, Virginie; Péry, Alexandre R R; Lagadic, Laurent

    2010-11-12

    Pesticide use leads to complex exposure and response patterns in non-target aquatic species, so that the analysis of data from standard toxicity tests may result in unrealistic risk forecasts. Developing models that are able to capture such complexity from toxicity test data is thus a crucial issue for pesticide risk assessment. In this study, freshwater snails from two genetically differentiated populations of Lymnaea stagnalis were exposed to repeated acute applications of environmentally realistic concentrations of the herbicide diquat, from the embryo to the adult stage. Hatching rate, embryonic development duration, juvenile mortality, feeding rate and age at first spawning were investigated during both exposure and recovery periods. Effects of diquat on mortality were analysed using a threshold hazard model accounting for time-varying herbicide concentrations. All endpoints were significantly impaired at diquat environmental concentrations in both populations. Snail evolutionary history had no significant impact on their sensitivity and responsiveness to diquat, whereas food acted as a modulating factor of toxicant-induced mortality. The time course of effects was adequately described by the model, which thus appears suitable to analyse long-term effects of complex exposure patterns based upon full life cycle experiment data. Obtained model outputs (e.g. no-effect concentrations) could be directly used for chemical risk assessment.

  11. Does water chemistry affect the dietary uptake and toxicity of silver nanoparticles by the freshwater snail Lymnaea stagnalis?

    Science.gov (United States)

    López-Serrano Oliver, Ana; Croteau, Marie-Noële; Stoiber, Tasha L.; Tejamaya, Mila; Römer, Isabella; Lead, Jamie R.; Luoma, Samuel N.

    2014-01-01

    Silver nanoparticles (AgNPs) are widely used in many applications and likely released into the aquatic environment. There is increasing evidence that Ag is efficiently delivered to aquatic organisms from AgNPs after aqueous and dietary exposures. Accumulation of AgNPs through the diet can damage digestion and adversely affect growth. It is well recognized that aspects of water quality, such as hardness, affect the bioavailability and toxicity of waterborne Ag. However, the influence of water chemistry on the bioavailability and toxicity of dietborne AgNPs to aquatic invertebrates is largely unknown. Here we characterize for the first time the effects of water hardness and humic acids on the bioaccumulation and toxicity of AgNPs coated with polyvinyl pyrrolidone (PVP) to the freshwater snail Lymnaea stagnalis after dietary exposures. Our results indicate that bioaccumulation and toxicity of Ag from PVP-AgNPs ingested with food are not affected by water hardness and by humic acids, although both could affect interactions with the biological membrane and trigger nanoparticle transformations. Snails efficiently assimilated Ag from the PVP-AgNPs mixed with diatoms (Ag assimilation efficiencies ranged from 82 to 93%). Rate constants of Ag uptake from food were similar across the entire range of water hardness and humic acid concentrations. These results suggest that correcting regulations for water quality could be irrelevant and ineffective where dietary exposure is important.

  12. Distribution of serotonin and FMRF-amide in the brain of Lymnaea stagnalis with respect to the visual system

    Institute of Scientific and Technical Information of China (English)

    Oksana P.TUCHINA; Valery V.ZHUKOV; Victor B.MEYER-ROCHOW

    2012-01-01

    Despite serotonin's and FMRF-amide's wide distribution in the nervous system of invertebrates and their importance as neurotransmitters,the exact roles they play in neuronal networks leaves many questions.We mapped the presence of serotonin and FMRF-amide-immunoreactivity in the central nervous system and eyes of the pond snail Lymnaea stagnalis and interpreted the results in connection with our earlier findings on the central projections of different peripheral nerves.Since the chemical nature of the intercellular connections in the retina of L.stagnalis is still largely unknown,we paid special attention to clarifying the role of serotonin and FMRF-amide in the visual system of this snail and compared our findings with those reported from other species.At least one serotonin- and one FMRF-amidergic fibre were labeled in each optic nerve,and since no cell bodies in the eye showed immunoreactivity to these neurotransmitters,we believe that efferent fibres with somata located in the central ganglia branch at the base of the eye and probably release 5HT and FMRF-amide as neuro-hormones.Double labelling revealed retrograde transport of neurobiotin through the optic nerve,allowing us to conclude that the central pathways and serotonin- and FMRF-amide-immunoreactive cells and fibres have different locations in the CNS in L.stagnalis.The chemical nature of the fibres,which connect the two eyes in L.stagnalis,is neither serotoninergic nor FMRF-amidergic.

  13. Distribution and habitats of the snail Lymnaea truncatula, intermediate host of the liver fluke Fasciola hepatica, in South Africa.

    Science.gov (United States)

    de Kock, K N; Wolmarans, C T; Bornman, M

    2003-12-01

    This paper focuses on the geographical distribution and habitats of Lymnaea truncatula, the intermediate, snail host of the liver fluke, Fasciola hepatica, as reflected by the 723 samples in the database of the National Freshwater Snail Collection, Potchefstroom, South Africa. The 221 different loci (1/16-degree squares) on record reflect an extensive but discontinuous distribution, except in Lesotho and in parts of the Mpumalanga, Gauteng and North West provinces of South Africa. Although recorded from 12 different types of waterbody, it was mostly (42.0%) recovered from swamps. Most samples (45.8%) were collected in habitats with slow-flowing water. A muddy substratum was recorded for 62.5% of the samples. Most samples (86.3%) were collected in habitats with a mean annual air temperature of 10-20 degrees C, and more than 69% came from localities with a mean annual rainfall of 600-900 mm. An integrated decision tree constructed from the data indicated that temperature and types of waterbody play a decisive role in determining the presence of L. truncatula in a given area. A temperature index calculated for all mollusc species ranked L. truncatula second in a total of 53 species according to its association with low temperatures. It remains to be established whether its distribution is indeed discontinuous, and whether its preference for a particular habitat, amphibious habits and ability to aestivate could have resulted in some populations having been overlooked during surveys.

  14. A comparative study of haemocytes from resistant and susceptible Lymnaea natalensis snails exposed to Fasciola gigantica miracidia.

    Science.gov (United States)

    El-Sayed, Kamelia A; El-Din, Abdel-hakim saad; Gad EL-KAarim, Rasha M

    2014-12-01

    Effect ot infection with Fasciola gigantica on total and differential haemocytes count of resistant and susceptible Lymnaea natalensis snails were studied. Exposure of L. natalensis resistant and susceptible strains to F. gigantica on miracidia caused gradual increase in the number of circulating haemocytes at the same time of exposure. In susceptible strain, the increase in the number of circulating haemocytes became significant at the second week post exposure being 2560 cell/ml (p

  15. The stress of Lymnaea truncatula just before miracidial exposure with Fasciola hepatica increased the prevalence of infection.

    Science.gov (United States)

    Abrous, M; Rondelaud, D; Dreyfuss, G

    2001-09-01

    Single-miracidium infections of Lymnaea truncatula with Fasciola hepatica were carried out under laboratory conditions to determine whether the stress of snails just before miracidial exposure had any influence on the prevalence of Fasciola infection, redial burden, and cercarial shedding. Three methods, i.e., the fasting of L. truncatula for 3 days in water filtered through a Millipore membrane, the effect of 6-8 degrees C water for 15 min, or the immersion of L. truncatula in a detergent solution at low concentration for 15 min, were used to stress snails. Enhanced susceptibility of snails to F. hepatica infection was noted in stressed groups (93-96% vs 48-50% in controls). The number of free rediae did not show any variation in controls as well as in stressed groups, except for fasted snails in which free rediae were significantly fewer. No differences in cercarial production between controls and the cold group were noted. Fasting, cold shock, or detergent exposure prior to exposure to F. hepatica miracidia might have weakened the snails so that they were not as efficient in avoiding miracidial penetration, thus leading to higher infection rates. Copyright 2001 Academic Press.

  16. Aspects of the maintenance of the life cycle of Fasciola hepatica in Lymnaea columella in Minas Gerais, Brazil.

    Science.gov (United States)

    de Souza, Cecília Pereira; Magalhaes, Kelly Grace; Passos, Liana Konovaloff Jannotti; Pereira dos Santos, Glaucia Cristina; Ribeiro, Fabio; Katz, Naftale

    2002-04-01

    Fascioliasis is a parasitic disease of domestic ruminants that occurs worldwide. The lymnaeid intermediate hosts of Fasciola hepatica include Lymnaea columella, which is widely distributed in Brazil. A colony of L. columella from Belo Horizonte, MG, was reared in our laboratory to be used in studies of the F. hepatica life cycle, the intermediate host-parasite relationship and development of an anti-helminthic vaccine. In the first experiment 1,180 snails were exposed to miracidia of F. hepatica eggs removed from the biliary tracts of cattle from the State of Rio Grande do Sul. In the second and third experiments the snails were exposed to miracidia that had emerged from F. hepatica eggs from Uruguay, maintained in rabbits. The rates of infection in the first, second and third experiments were 0, 42.1 and 0% respectively. Over 15,806 metacercariae were obtained and stored at 4 degrees C. Four rabbits weighing 1.5 kg each were infected with 32-44 metacercariae and two with 200. Three rabbits begin to eliminate eggs of the parasite in the feces from 84 days after infection onwards. The biological cycle of F. hepatica in L. columella and the rabbit was completed within 124 days.

  17. Distribution and habitats of the snail Lymnaea truncatula, intermediate host of the liver fluke Fasciola hepatica, in South Africa

    Directory of Open Access Journals (Sweden)

    K.N. de Kock

    2003-07-01

    Full Text Available This paper focuses on the geographical distribution and habitats of Lymnaea truncatula, the intermediate, snail host of the liver fluke, Fasciola hepatica, as reflected by the 723 samples in the database of the National Freshwater Snail Collection, Potchefstroom, South Africa. The 221 different loci (1/16-degree squares on record reflect an extensive but discontinuous distribution, except in Lesotho and in parts of the Mpumalanga, Gauteng and North West provinces of South Africa. Although recorded from 12 different types of waterbody, it was mostly (42.0 % recovered from swamps. Most samples (45.8 % were collected in habitats with slow-flowing water. A muddy substratum was recorded for 62.5 % of the samples. Most samples (86.3 % were collected in habitats with a mean annual air temperature of 10-20 o C, and more than 69 % came from localities with a mean annual rainfall of 600-900mm. An integrated decision tree constructed from the data indicated that temperature and types of waterbody play a decisive role in determining the presence of L. truncatula in a given area. A temperature index calculated for all mollusc species ranked L. truncatula second in a total of 53 species according to its association with low temperatures. It remains to be established whether its distribution is indeed discontinuous, and whether its preference for a particular habitat, amphibious habits and ability to aestivate could have resulted in some populations having been overlooked during surveys.

  18. Microhabitat preferences of Biomphalaria pfeifferi and Lymnaea natalensis in a natural and a man-made habitat in Southeastern Tanzania

    Directory of Open Access Journals (Sweden)

    Utzinger Jürg

    2000-01-01

    Full Text Available Schistosoma mansoni is an important human parasitic disease which is widespread throughout Africa. As Biomphalaria pfeifferi snails act as intermediate host, knowledge of their population ecology is an essential prerequisite towards understanding disease transmission. We conducted a field study and assessed the density and microhabitat preferences of B.pfeifferi in a natural habitat which was a residual pool of a river. Repeated removal collecting revealed a density of 26.6 [95% confidence interval (CI: 24.9-28.3] snails/m2. B.pfeifferi showed microhabitat preferences for shallow water (depths: 0-4cm. They were found most abundantly close to the shoreline (distances: 0-40cm, and preferred either plant detritus or bedrock as substratum. Lymnaea natalensis, a snail which may act as a host for human Fasciola gigantica, also occurred in this habitat with a density of 34.0 (95% CI: 24.7-43.3 snails/m2, and preferred significantly different microhabitats when compared to B.pfeifferi. Microhabitat selection by these snail species was also investigated in a man-made habitat nearby, which consisted of a flat layer of concrete fixed on the riverbed, covered by algae. Here, B.pfeifferi showed no preference for locations close to the shoreline, probably because the habitat had a uniform depth. We conclude that repeated removal collecting in shallow habitats provides reliable estimates of snail densities and that habitat changes through constructions may create favourable microhabitats and contribute to additional disease transmission.

  19. Distribution and habitats of Lymnaea natalensis, snail intermediate host of the liver fluke Fasciola gigantica, in South Africa

    Directory of Open Access Journals (Sweden)

    Editorial Office

    2001-09-01

    Full Text Available This paper focuses on the geographical distribution and the habitats of Lymnaea natalensis, the snail intermediate host of the liver fluke, Fasciola gigantica, as reflected by the collection sites of its 4 552 samples currently on record in the National Freshwater Snail Collection (NFSC of South Africa. Although this species was represented in a variety of waterbodies, the majority of samples(±70%came from rivers, brooks and dams and in 70.8% of the cases the water was described as permanent and in 71.8% as slow flowing or standing. The results of life-table studies conducted by various authors indicated that temperature should be a relatively unimportant factor in determining its geographical distribution, but that the availability of permanent water should be decisive for its presence in a given habitat. These results are in agreement with the finding that only 7.5% of the samples of this species in the NFSC were collected in habitats which were described as seasonal. Furthermore, it gives a logical explanation for the sporadic occurrence, or total absence of this species in the more arid regions of South Africa. Water impoundments and irrigation networks contribute to a large extent towards creating perennial habitats which would be suitable for L. natalensis. As intermediate host for one of the liver fluke species which already is an economic factor in South Africa, this certainly is an aspect which ought to be reckoned within the planning and construction of new irrigation schemes.

  20. Exposure to Fasciola hepatica miracidia increases the sensitivity of Lymnaea (Fossaria) humilis to high and low pH.

    Science.gov (United States)

    Cruz-Mendoza, I; Naranjo-García, E; Quintero-Martínez, M T; Ibarra-Velarde, F; Correa, D

    2006-06-01

    Humidity and temperature have been considered important factors affecting the infectivity of Fasciola hepatica to its molluscan host. One hundred and thirty laboratory-reared Lymnaea humilis were exposed for 4 hr to the miracidia of F. hepatica over a pH range from 4.0 to 10.0, and their rates of survival were compared with 130 similarly treated but unexposed control snails. All control snails died within 24 hr at pH 4.0, but they showed better survival at pH 5.0-10.0. Their sensitivity to solutions with high and low pH, however, was increased if kept in the presence of F. hepatica miracidia. Snails exposed at pH 5.0 died within 24 hr, whereas most other pHs also affected survival such that by day 18 only those snails exposed at pH 7.2 remained alive. The increased sensitivity of the snails to pH could be explained by a damage-mediated release of parasite enzymes, because infectivity was highest at pHs associated with the lowest host mortality.

  1. Adaptation of Lymnaea fuscus and Radix balthica to Fasciola hepatica through the experimental infection of several successive snail generations

    Science.gov (United States)

    2014-01-01

    Background High prevalence of Fasciola hepatica infection (>70%) was noted during several outbreaks before the 2000s in several French farms where Galba truncatula is lacking. Other lymnaeids such as Lymnaea fuscus, L. glabra and/or Radix balthica are living in meadows around these farms but only juvenile snails can sustain complete larval development of F. hepatica while older snails were resistant. The low prevalence of infection (hepatica infection in snails progressively increased from the F1 (R. balthica) or F2 (L. fuscus) generation. In the second experiment, the prevalence of F. hepatica infection and the number of shed cercariae were significantly lower in L. fuscus and R. balthica (without significant differences between both lymnaeids) than in G. truncatula. Conclusion The F. hepatica infection of several successive snail generations, coming from parents infected with this parasite, resulted in a progressive increase in prevalence and intensity of snail infection. This may explain high prevalence of fasciolosis noted in several cattle-breeding farms when the common snail host of this digenean, G. truncatula, is lacking. PMID:24986589

  2. Hemocyte-specific responses to the peroxidizing herbicide fomesafen in the pond snail Lymnaea stagnalis (Gastropoda, Pulmonata)

    Energy Technology Data Exchange (ETDEWEB)

    Russo, Jacqueline [UMR 6553 Ecobio CNRS Universite de Rennes 1, Campus de Beaulieu, F-35042 Rennes cedex 35042 (France); Lefeuvre-Orfila, Luz [UMR 985 INRA-Agrocampus Ecobiologie et Qualite des Hydrosystemes Continentaux, Equipe Ecotoxicologie et Qualite des Milieux aquatiques, 65 rue de Saint-Brieuc CS 84215, F-35042 Rennes cedex 35042 (France); Lagadic, Laurent [UMR 985 INRA-Agrocampus Ecobiologie et Qualite des Hydrosystemes Continentaux, Equipe Ecotoxicologie et Qualite des Milieux aquatiques, 65 rue de Saint-Brieuc CS 84215, F-35042 Rennes cedex 35042 (France)]. E-mail: laurent.lagadic@rennes.inra.fr

    2007-03-15

    Responses of circulating hemocytes were studied in Lymnaea stagnalis exposed to 10, 30, 90, and 270 {mu}g/L fomesafen for 24 and 504 h. Flow cytometry was used to quantify fomesafen-induced production of reactive oxygen species (ROS), phagocytic activity on Escherichia coli, and oxidative burst when hemocytes were challenged by E. coli or phorbol 12-myristate-13-acetate (PMA). Lysosomal membrane damage was assessed, using the neutral-red retention time (NRRT) assay. Exposure to fomesafen for 24 h resulted in increase in ROS levels and decreases in phagocytosis and the oxidative burst in PMA-stimulated hemocytes. After 504 h, intracellular levels of ROS returned to normal, but phagocytosis of E. coli was still inhibited and the associated oxidative burst significantly reduced. After both durations of exposure, decreases of NRRT indicated that lysosome membrane fragility increased with fomesafen concentration. Potential implications for the health and survival of the snails and consequences on populations are discussed. - Fomesafen inhibited phagocytosis and the associated oxidative burst, and increased lysosome fragility in L. stagnalis hemocytes.

  3. Aspects of the Maintenance of the Life Cycle of Fasciola hepatica in Lymnaea columella in Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Souza Cecília Pereira de

    2002-01-01

    Full Text Available Fascioliasis is a parasitic disease of domestic ruminants that occurs worldwide. The lymnaeid intermediate hosts of Fasciola hepatica include Lymnaea columella, which is widely distributed in Brazil. A colony of L. columella from Belo Horizonte, MG, was reared in our laboratory to be used in studies of the F. hepatica life cycle, the intermediate host-parasite relationship and development of an anti-helminthic vaccine. In the first experiment 1,180 snails were exposed to miracidia of F. hepatica eggs removed from the biliary tracts of cattle from the State of Rio Grande do Sul. In the second and third experiments the snails were exposed to miracidia that had emerged from F. hepatica eggs from Uruguay, maintained in rabbits. The rates of infection in the first, second and third experiments were 0, 42.1 and 0% respectively. Over 15,806 metacercariae were obtained and stored at 4ºC. Four rabbits weighing 1.5 kg each were infected with 32-44 metacercariae and two with 200. Three rabbits begin to eliminate eggs of the parasite in the feces from 84 days after infection onwards. The biological cycle of F. hepatica in L. columella and the rabbit was completed within 124 days.

  4. Conceptual shifts in animal systematics as reflected in the taxonomic history of a common aquatic snail species (Lymnaea stagnalis

    Directory of Open Access Journals (Sweden)

    Maxim V. Vinarski

    2015-07-01

    Full Text Available Lymnaea stagnalis (L., 1758 is among the most widespread and well-studied species of freshwater Mollusca of the northern hemisphere. It is also notoriously known for its huge conchological variability. The history of scientific exploration of this species may be traced back to the end of the 16th century (Ulisse Aldrovandi in Renaissance Italy and, thus, L. stagnalis has been chosen as a proper model taxon to demonstrate how changes in theoretical foundations and methodology of animal taxonomy have been reflected in the practice of classification of a particular taxon, especially on the intraspecific level. In this paper, I depict the long story of recognition of L. stagnalis by naturalists and biologists since the 16th century up to the present day. It is shown that different taxonomic philosophies (essentialism, population thinking, tree thinking led to different views on the species’ internal structure and its systematic position itself. The problem of how to deal with intraspecific variability in the taxonomic arrangement of L. stagnalis has been a central problem that made systematists change their opinion following conceptual shifts in taxonomic theory.

  5. Two Strains of Lymnaea stagnalis and the Progeny from Their Mating Display Differential Memory-Forming Ability on Associative Learning Tasks

    Directory of Open Access Journals (Sweden)

    Hiroshi Sunada

    2017-09-01

    Full Text Available The pond snail Lymnaea stagnalis learns and forms long-term memory (LTM following both operant conditioning of aerial respiratory behavior and classical conditioning of taste aversive behavior. In the present study, we examined whether there are interstrain differences in the ability to form LTM following these two types of conditioning. A strain of Lymnaea (TC1 collected in Alberta, Canada exhibits superior memory-forming ability following aerial respiratory operant conditioning compared to a laboratory-reared strain of Lymnaea from Netherlands known as the Dutch strain. We asked whether the offspring of the Canadian TC1 and Dutch snails (i.e., filial 1 (F1 cross snails would have the superior memory ability and found, rather, that their memory ability was average like the Dutch snails. That is, the Canadian TC1 snails have superior ability for LTM formation following aerial respiratory operant conditioning, but the Dutch and the generated F1 cross have average ability for memory forming. We next examined the Canadian TC1, Dutch and F1 cross snails for their ability to learn and form memory following conditioned taste aversion (CTA. All three populations showed similar associative CTA responses. However, both LTM formation and the ratio of good-to-poor performers in the memory retention test were much better in the Dutch snails than the Canadian TC1 and F1 cross snails. The memory abilities of the Canadian TC1 and F1 cross snails were average. Our present findings, therefore, suggest that snails of different strains have different memory abilities, and the F1 cross snails do not inherit the memory ability from the smart strain. To our knowledge, there have been a limited number of studies examining differences in memory ability among invertebrate strains, with the exception of studies using mutant flies.

  6. Southernmost finding of Lymnaea viatrix orbigny, 1835 (Pulmonata: Lymnaeidae), intermediate host of Fasciola hepatica (Linnaeus, 1758) (Trematoda: Digenea), in urban and rural areas of Patagonia, Argentina.

    Science.gov (United States)

    Kleiman, Florencia; Pietrokovsky, Silvia; Paraense, W Lobato; Wisnivesky-Colli, Cristina

    2004-02-01

    We report the first finding of Lymnaea viatrix south of parallel 41 masculine S, in rural and urban areas from Argentina. Ninety snails were collected during year 2000, from a concrete pond at a Public Square in El Bolsón Village, Río Negro province, and 811 snails in November 1999, and during 2000 from waterbodies within a farm at Cholila locality, Chubut province. Fasciola hepatica infection was detected in 0.9% snails from the rural area. We discuss the potential risk of L. viatrix to public health in urban areas and its epidemiological importance in rural areas of the Andean Patagonian region.

  7. Southernmost finding of Lymnaea viatrix orbigny, 1835 (Pulmonata: Lymnaeidae, intermediate host of Fasciola hepatica (Linnaeus, 1758 (Trematoda: Digenea, in urban and rural areas of Patagonia, Argentina

    Directory of Open Access Journals (Sweden)

    Kleiman Florencia

    2004-01-01

    Full Text Available We report the first finding of Lymnaea viatrix south of parallel 41ºS, in rural and urban areas from Argentina. Ninety snails were collected during year 2000, from a concrete pond at a Public Square in El Bolsón Village, Río Negro province, and 811 snails in November 1999, and during 2000 from waterbodies within a farm at Cholila locality, Chubut province. Fasciola hepatica infection was detected in 0.9% snails from the rural area. We discuss the potential risk of L. viatrix to public health in urban areas and its epidemiological importance in rural areas of the Andean Patagonian region.

  8. Characteristics of the microbial community in rhizosphere of Camptotheca acuminata cultured with exotic invasive plant Eupatorium adenophorum

    Institute of Scientific and Technical Information of China (English)

    ZU YuanGang; GAO ChongYang; WANG WenJie; YANG FengJian; LIU Ying; WANG Min; ZHAO YangGuo

    2007-01-01

    The traditional culture-dependent plate counting and culture-independent small-subunit-ribosomal RNA gene-targeted molecular techniques, Single-Strand Conformation Polymorphism (SSCP) and terminal Restriction Fragment Length Polymorphism (tRFLP) combined with 16S rDNA clone library were adopted to investigate the impacts of secretion from Camptotheca acuminata (abbreviated to Ca) roots on the quantities and structure of eukaryotic microbes and bacteria in the rhizosphere, and the possibility that Ca controls exotic invasive plant Eupatorium adenophorum (Ea). The counting results indicated that the number of bacteria increased in turn in rhizospheres of Ea, Ca-Ea mixed culture and Ca, while that of eukaryotic microbes decreased. PCR-SSCP profiles showed eukaryotic microbial bands (corresponding to biodiversity) in rhizosphere of Ea were more complex than those of Ca and CE. Meristolohmannia sp., Termitomyces sp. And Rhodophyllus sp. Were the dominant populations in the rhizosphere of Ca. Bacterial terminal restriction fragments (TRFs) profiles showed no difference among three kinds of rhizospheres, and the sequences of the 16S rDNA clone library from Ca rhizospheres were distributed in 10 known phyla, in which phylum Proteobacteria were the absolute dominant group and accounted for 24.71% of the cloned sequences (δ-Proteobacteria accounted for up to 17.65%), and phyla Acidobacteria and Bacteroidetes accounted for 16.47% and 10.59% of the cloned sequences, respectively. In addition, high performance liquid chromatography detected a trace amount of camptothecin and hydroxycamptothecin in the rhizospheric soil of Ca and CE, but examined neither camptothecin nor hydroxycamptothecin in rhizospheric soil of Ea. Therefore, invasion and diffusion of Ea evidently depended on distinguishing the eukaryotic community structure, but not on that of the bacterial pattern. Ca was able to alter the eukaryotic community structure of invasive Ea by secreting camptothecin and

  9. Structures of Chlorophyll Catabolites in Bananas (Musa acuminata) Reveal a Split Path of Chlorophyll Breakdown in a Ripening Fruit

    Science.gov (United States)

    Moser, Simone; Müller, Thomas; Holzinger, Andreas; Lütz, Cornelius; Kräutler, Bernhard

    2012-01-01

    Abstract The disappearance of chlorophyll is a visual sign of fruit ripening. Yet, chlorophyll breakdown in fruit has hardly been explored; its non-green degradation products are largely unknown. Here we report the analysis and structure elucidation of colorless tetrapyrrolic chlorophyll breakdown products in commercially available, ripening bananas (Musa acuminata, Cavendish cultivar). In banana peels, chlorophyll catabolites were found in an unprecedented structural richness: a variety of new fluorescent chlorophyll catabolites (FCCs) and nonfluorescent chlorophyll catabolites (NCCs) were detected. As a rule, FCCs exist only "fleetingly" and are hard to observe. However, in bananas several of the FCCs (named Mc-FCCs) were persistent and carried an ester function at the propionate side-chain. NCCs were less abundant, and exhibited a free propionic acid group, but functional modifications elsewhere. The modifications of NCCs in banana peels were similar to those found in NCCs from senescent leaves. They are presumed to be introduced by enzymatic transformations at the stage of the mostly unobserved, direct FCC-precursors. The observed divergent functional group characteristics of the Mc-FCCs versus those of the Mc-NCCs indicated two major "late" processing lines of chlorophyll breakdown in ripening bananas. The "last common precursor" at the branching point to either the persistent FCCs, or towards the NCCs, was identified as a temporarily abundant "secondary" FCC. The existence of two "downstream" branches of chlorophyll breakdown in banana peels, and the striking accumulation of persistent Mc-FCCs call for attention as to the still-elusive biological roles of the resulting colorless linear tetrapyrroles. PMID:22807397

  10. Structures of chlorophyll catabolites in bananas (Musa acuminata) reveal a split path of chlorophyll breakdown in a ripening fruit.

    Science.gov (United States)

    Moser, Simone; Müller, Thomas; Holzinger, Andreas; Lütz, Cornelius; Kräutler, Bernhard

    2012-08-27

    The disappearance of chlorophyll is a visual sign of fruit ripening. Yet, chlorophyll breakdown in fruit has hardly been explored; its non-green degradation products are largely unknown. Here we report the analysis and structure elucidation of colorless tetrapyrrolic chlorophyll breakdown products in commercially available, ripening bananas (Musa acuminata, Cavendish cultivar). In banana peels, chlorophyll catabolites were found in an unprecedented structural richness: a variety of new fluorescent chlorophyll catabolites (FCCs) and nonfluorescent chlorophyll catabolites (NCCs) were detected. As a rule, FCCs exist only "fleetingly" and are hard to observe. However, in bananas several of the FCCs (named Mc-FCCs) were persistent and carried an ester function at the propionate side-chain. NCCs were less abundant, and exhibited a free propionic acid group, but functional modifications elsewhere. The modifications of NCCs in banana peels were similar to those found in NCCs from senescent leaves. They are presumed to be introduced by enzymatic transformations at the stage of the mostly unobserved, direct FCC-precursors. The observed divergent functional group characteristics of the Mc-FCCs versus those of the Mc-NCCs indicated two major "late" processing lines of chlorophyll breakdown in ripening bananas. The "last common precursor" at the branching point to either the persistent FCCs, or towards the NCCs, was identified as a temporarily abundant "secondary" FCC. The existence of two "downstream" branches of chlorophyll breakdown in banana peels, and the striking accumulation of persistent Mc-FCCs call for attention as to the still-elusive biological roles of the resulting colorless linear tetrapyrroles.

  11. Actividad molusquicida del Paraiso (Melia azedarach L. (Meliaceae sobre Lymnaea cubensis, molusco vector de Fasciolosis Molluscicidal activity of Paraiso (Melia azedarach L. (Meliaceae on Lymnaea cubensis, host snail of Fasciolosis

    Directory of Open Access Journals (Sweden)

    Marlene Piña Perez

    1998-06-01

    Full Text Available INTRODUCCIÓN: La Fasciolosis constituye en diversas regiones una fuente importante de pérdidas económicas y cuando se descuidan las medidas de control de sus hospedadores (moluscos, junto a condiciones ecológicas favorables, pueden ocurrir casos aislados de Fasciolosis humana. Dentro de los métodos alternativos para su control está el uso de extractos vegetales y se pretendió evaluar el probable empleo del jugo extraído del fruto y semillas del Paraiso (Melia azedarach L. en el control de Lymnaea cubensis, principal vector de la Fasciolosis en Cuba. MATERIAL Y MÉTODO: Diferentes concentraciones del jugo extraído del fruto y semillas del Paraiso (Melia azedarach L. fueron testados para determinar las dosis letales media (DL50 y máxima (DL90 usando un programa computarizado Probit-Log. Siete series experimentales fueron probadas usando 72 moluscos en cada una. Para determinar la influencia sobre la frecuencia cardíaca fueron testados tres grupos de 10 moluscos, dos fueron tratados con las DL50=0,88627 y DL90=1,7641, respectivamente, mientras que el tercero fue considerado como testigo. RESULTADOS Y CONCLUSIONES: Se observó una marcada influencia de ambas dosis sobre la frecuencia cardíaca del molusco estudiado. Estos resultados son alentadores, pues demuestran el potencial empleo de esta planta en el control de moluscos indeseables.INTRODUÇÃO: A Fasciolosis constitui em diversas regiões fonte importante de perdas econômicas, e quando não se adotam medidas de controle de seus hospedeiros (moluscos, junto a condições ecológicas favoráveis, pode ocorrer o aparecimento de casos isolados de Fasciolosis humana. Dentro dos métodos alternativos para o seu controle está o uso de extratos vegetais e se tem pretendido avaliar o provável emprego do suco extraído do fruto e sementes do Paraíso (Melia azedarach L., no controle de Lymnaea cubensis, principal vetor da Fasciolosis em Cuba. MATERIAL E MÉTODO: Diferentes concentra

  12. Effects of copper on the egg development and hatching of a freshwater pulmonate snail Lymnaea luteola L.

    Science.gov (United States)

    Khangarot, B S; Das, Sangita

    2010-07-15

    A freshwater invertebrate egg development and hatching toxicity test with an Indian freshwater pulmonate snail, Lymnaea luteola, comprising the following developmental endpoints was described: mortality, development, formation of eyes and foot structure, heart rate, duration of different larval stages, and hatching time. Developmental stages were morula, and at third, fifth, and eighth days; the trochophore, veliger, and hippo larvae, respectively. At the age of about 9th to 11th days after egg laying; more than 95% young snail hatched in control laboratory conditions. To evaluate effects on embryonic development, the pulmonate snail eggs of 24-h old were exposed to a series of nominal copper concentrations. The percentage survival of embryos treated in 10-32 microg l(-1) of Cu after 240 h of exposure drops sharply at veliger and hippo stages. All embryos died at 100-320 microg l(-1) of Cu within 168 h of exposure at trochophore and early veliger stages. The detected abnormalities were malformation of foot, eyes, thinness and incomplete formation of shell, growth retardation, and slow rotation of embryo within the egg capsule as compared to control embryos. Lethal and sublethal effects in terms of mortality and significant delay in hatching could be found in the 3.2, 5.6 and 10 microg l(-1) of Cu concentrations. This species is widely distributed in the Indian subcontinent freshwater reservoirs and more sensitive to Cu than other tested aquatic test organisms; therefore, could be used as a test model of Cu and possibly other pollutants for rapid risk assessment of environmental pollutants. The snail egg embryo bioassay is simple, rapid, highly sensitive, cost-effective, and easy to test under standardized laboratory conditions.

  13. Proteomic Analysis of the Reproductive Organs of the Hermaphroditic Gastropod Lymnaea stagnalis Exposed to Different Endocrine Disrupting Chemicals

    Science.gov (United States)

    Giusti, Arnaud; Leprince, Pierre; Mazzucchelli, Gabriel; Thomé, Jean-Pierre; Lagadic, Laurent; Ducrot, Virginie; Joaquim-Justo, Célia

    2013-01-01

    Many studies have reported perturbations of mollusc reproduction following exposure to low concentrations (ng/L range) of endocrine disrupting chemicals (EDCs). However, the mechanisms of action of these molecules on molluscs are still poorly understood. Investigation of the modifications of protein expression in organisms exposed to chemicals using proteomic methods can provide a broader and more comprehensive understanding of adverse impacts of pollution on organisms than conventional biochemical biomarkers (e.g., heat-shock proteins, metallothioneins, GST, EROD). In this study we have investigated the impacts of four chemicals, which exhibit different endocrine disrupting properties in vertebrates, on the proteome of the hermaphroditic freshwater pulmonate gastropod Lymnaea stagnalis after 21 days of exposure. Testosterone, tributyltin, chlordecone and cyproterone acetate were chosen as tested compounds as they can induce adverse effects on the reproduction of this snail. The 2D-DIGE method was used to identify proteins whose expression was affected by these compounds. In addition to modifying the expression of proteins involved in the structure and function of the cytoskeleton, chemicals had impacts on the expression of proteins involved in the reproduction of L. stagnalis. Exposure to 19.2 µg/L of chlordecone increased the abundance of ovipostatin, a peptide transmitted during mating through seminal fluid, which reduces oviposition in this species. The expression of yolk ferritin, the vitellogenin equivalent in L. stagnalis, was reduced after exposure to 94.2 ng Sn/L of tributyltin. The identification of yolk ferritin and the modification of its expression in snails exposed to chemicals were refined using western blot analysis. Our results showed that the tested compounds influenced the abundance of yolk ferritin in the reproductive organs. Alteration in proteins involved in reproductive pathways (e.g., ovipostatin and yolk ferritin) could constitute relevant

  14. Proteomic analysis of the reproductive organs of the hermaphroditic gastropod Lymnaea stagnalis exposed to different endocrine disrupting chemicals.

    Directory of Open Access Journals (Sweden)

    Arnaud Giusti

    Full Text Available Many studies have reported perturbations of mollusc reproduction following exposure to low concentrations (ng/L range of endocrine disrupting chemicals (EDCs. However, the mechanisms of action of these molecules on molluscs are still poorly understood. Investigation of the modifications of protein expression in organisms exposed to chemicals using proteomic methods can provide a broader and more comprehensive understanding of adverse impacts of pollution on organisms than conventional biochemical biomarkers (e.g., heat-shock proteins, metallothioneins, GST, EROD. In this study we have investigated the impacts of four chemicals, which exhibit different endocrine disrupting properties in vertebrates, on the proteome of the hermaphroditic freshwater pulmonate gastropod Lymnaea stagnalis after 21 days of exposure. Testosterone, tributyltin, chlordecone and cyproterone acetate were chosen as tested compounds as they can induce adverse effects on the reproduction of this snail. The 2D-DIGE method was used to identify proteins whose expression was affected by these compounds. In addition to modifying the expression of proteins involved in the structure and function of the cytoskeleton, chemicals had impacts on the expression of proteins involved in the reproduction of L. stagnalis. Exposure to 19.2 µg/L of chlordecone increased the abundance of ovipostatin, a peptide transmitted during mating through seminal fluid, which reduces oviposition in this species. The expression of yolk ferritin, the vitellogenin equivalent in L. stagnalis, was reduced after exposure to 94.2 ng Sn/L of tributyltin. The identification of yolk ferritin and the modification of its expression in snails exposed to chemicals were refined using western blot analysis. Our results showed that the tested compounds influenced the abundance of yolk ferritin in the reproductive organs. Alteration in proteins involved in reproductive pathways (e.g., ovipostatin and yolk ferritin could

  15. Nonylphenol polyethoxylate adjuvant mitigates the reproductive toxicity of fomesafen on the freshwater snail Lymnaea stagnalis in outdoor experimental ponds.

    Science.gov (United States)

    Jumel, Audrey; Coutellec, Marie-Agnès; Cravedi, Jean-Pierre; Lagadic, Laurent

    2002-09-01

    The influence of nonylphenol polyethoxylates (NPEO), formulated as the adjuvant Agral 90, on the effects of the diphenyl ether herbicide fomesafen in the pond snail Lymnaea stagnalis was investigated, with particular attention to the reproductive performances and underlying energetic and hormonal processes. Separate short-term exposures to low concentrations of fomesafen and fomesafen-Agral mixture were performed in the laboratory. Outdoor experimental ponds (mesocosms) were used for long-term exposures to higher chemical concentrations. At the concentrations used in the studies, NPEO were known as nontoxic in L stagnalis. Fomesafen was mixed with the adjuvant in the 3:7 ratio recommended for agricultural uses (nominal herbicide concentrations of 22 and 40 microg/L in laboratory and mesocosm, respectively). In mesocosms, multiple application of fomesafen, leading to maximal herbicide concentrations of 60.33 +/- 2.68 microg/L in water, resulted in reduced number of egg masses and altered glycogen metabolism in contaminated snails. These changes, as well as affected steroid-like levels in fomesafen-exposed snails, support the hypothesis of impaired neuroendocrine functions. When Agral 90 was added to the herbicide, results obtained in mesocosms showed that the adjuvant softened the impact of fomesafen. In mesocosms treated with the fomesafen-Agral mixture, significantly lower herbicide levels were found in the water (30.33 +/- 14.91 microg/L at the end of the contamination period). Consequently, internal exposure of the snails to fomesafen was reduced when the herbicide was mixed with the adjuvant. Mitigation of the effects of fomesafen by the adjuvant may therefore result from nonionic surfactant activity of NPEO that prevented fomesafen from reaching the snails.

  16. Fasciola gigantica: cercarial shedding pattern from Lymnaea natalensis after long-term exposure to cadmium at different temperatures.

    Science.gov (United States)

    Soliman, Maha F M

    2009-04-01

    Little is known about the response of Fasciola spp., inside its snail host to pollutant toxicity. The effect of long-term exposure of Lymnaea natalensis to 0.1 microg/l, 10 microg/l, or 100 microg/l cadmium (Cd) on the infection rates with F. gigantica, percentage of cercariae-shedding snails and cercariae shedding pattern was investigated. The snails were exposed to Cd for 7 days either pre-infection with single Fasciola miracidium or during the late pre-patent period of the infection. The possible interaction between metal exposure and acclimatization temperature was also studied in three ranges; 16-18 degrees C, 23-25 degrees C and 30-32 degrees C. Results clearly showed that host exposure to 100 microg/l Cd significantly affected the pattern of Fasciola development inside its snail host, and that the acclimatization temperature was a key factor affecting the role played by Cd. Pre-infection exposure to Cd caused a significant reduction in the infection rates where the effect was temperature-dependent. Post-infection exposure to Cd significantly increased the percentage of cercariae-shedding snails; the effect was temperature-independent. Interestingly, post-infection exposure significantly altered the differential cercarial output pattern, while no clear impact on the total was found. The alteration in the differential cercarial output was represented as a significantly higher proportion of floating metacercaria as compared to fixed ones and also higher proportion of dead cercariae which may directly reduce the transmission of Fasciola to the final host. The mechanisms of cadmium impact are briefly discussed.

  17. Highland populations of Lymnaea truncatula infected with Fasciola hepatica survive longer under experimental conditions than lowland ones.

    Science.gov (United States)

    Vignoles, P; Favennec, L; Dreyfuss, G; Rondelaud, D

    2002-04-01

    A retrospective study was carried out on the experimental infections of Lymnaea truncatula with Fasciola hepatica performed over the last 20 years to determine if the populations of snails living in highland or lowland countries had the same ability to sustain trematode larval development. The six highland populations originated from the Peruvian Altiplano (altitude 2,800 m), the French Alps (2,300 m), and the Massif Central (900-1,400 m), whereas the 13 lowland populations came from different sites located in central France (90-250 m). Bimiracidial infections of 4-mm-high snails were performed to study cercarial shedding and to quantify their redial burden. Compared to lowland populations, snail survival at day 30 post-exposure was significantly higher in the highland L. truncatula (57-75% compared to 31-45%) and their lifespan was greater (a mean of 87-96 days for cercaria-shedding snails compared to 64-77 days). The prevalences of F. hepatica infections, the numbers of free rediae within snail bodies, and the numbers of cercariae did not show any significant differences between highland and lowland snails although the numbers of cercariae were clearly higher in the Peruvian and three French highland populations of L. truncatula. The long survival times of highland snails under laboratory conditions might be an adaptation of these L. truncatula to the more extreme highland climate. The better ability of highland snails to sustain parasite larval development suggests that they would be better intermediate hosts in the life cycle of F. hepatica than lowland populations.

  18. Interactions between cyanobacteria and gastropods II. Impact of toxic Planktothrix agardhii on the life-history traits of Lymnaea stagnalis.

    Science.gov (United States)

    Lance, Emilie; Paty, Chrystelle; Bormans, Myriam; Brient, Luc; Gérard, Claudia

    2007-03-30

    Hepatotoxins are frequently produced by many cyanobacterial species. Microcystins (MCs) are the most frequent and widely studied hepatotoxins, with potentially hazardous repercussions on aquatic organisms. As a ubiquitous herbivore living in eutrophic freshwaters, the snail Lymnaea stagnalis (Gastropoda: Pulmonata) is particularly exposed to cyanobacteria. The toxic filamentous Planktothrix agardhii is common in temperate lakes and is therefore, a potential food resource for gastropods. In the first part of this study, we demonstrated the ingestion of toxic P. agardhii by L. stagnalis during a 5 weeks exposure, with concomitant accumulation of, on average, 60% of total MCs ingested. After 3 weeks of non-toxic food (lettuce), approximately 90% of MCs were eliminated from tissues. Here, we investigate the impact of toxic P. agardhii consumption on the life-history traits (survival, growth and fecundity), locomotion and the structure of digestive and genital glands of juvenile and adult L. stagnalis. We observed a decrease of growth regardless of age, although this was more marked in juveniles, and a reduction of fecundity in adults. Survival and locomotion were not affected. Reduction of growth and fecundity continued to be observed even after feeding of non-toxic food for 3 weeks. The structure of the digestive gland was altered during the intoxication period but not irreversibly as cells tended to recover a normal status after the 3-week detoxification period. No histopathological changes occurred in the genital gland and oocytes, and spermatozoids were present in the gonadic acini. The density of cyanobacterial suspensions used in this study was comparable to those regularly observed in lakes, particularly in eutrophic waters. These results are discussed in terms of the negative impact of toxic cyanobacteria on natural communities of freshwater gastropods, and potential cascading effects on the equilibrium and functioning of the ecosystem.

  19. Serotonin modulates transmitter release at central Lymnaea synapses through a G-protein-coupled and cAMP-mediated pathway.

    Science.gov (United States)

    McCamphill, P K; Dunn, T W; Syed, N I

    2008-04-01

    Neuromodulation is central to all nervous system function, although the precise mechanisms by which neurotransmitters affect synaptic efficacy between central neurons remain to be fully elucidated. In this study, we examined the neuromodulatory action of serotonin [5-hydroxytryptamine (5-HT)] at central synapses between identified neurons from the pond snail Lymnaea stagnalis. Using whole-cell voltage-clamp and sharp electrode recording, we show that 5-HT strongly depresses synaptic strength between cultured, cholinergic neuron visceral dorsal 4 (VD4 - presynaptic) and its serotonergic target left pedal dorsal 1 (LPeD1 - postsynaptic). This inhibition was accompanied by a reduction in synaptic depression, but had no effect on postsynaptic input resistance, indicating a presynaptic origin. In addition, serotonin inhibited the presynaptic calcium current (I(Ca)) on a similar time course as the change in synaptic transmission. Introduction of a non-condensable GDP analog, GDP-beta-S, through the presynaptic pipette inhibited the serotonin-mediated effect on I(Ca.) Similar results were obtained with a membrane-impermeable inactive cAMP analog, 8OH-cAMP. Furthermore, stimulation of the serotonergic postsynaptic cell also inhibited presynaptic currents, indicating the presence of a negative feedback loop between LPeD1 and VD4. Taken together, this study provides direct evidence for a negative feedback mechanism, whereby the activity of a presynaptic respiratory central pattern-generating neuron is regulated by its postsynaptic target cell. We demonstrate that either serotonin or LPeD1 activity-induced depression of presynaptic transmitter release from VD4 involves voltage-gated calcium channels and is mediated through a G-protein-coupled and cAMP-mediated system.

  20. Identification of a novel UDP-GalNAc:GlcNAcβ-R β1-4 N-acetylgalactosaminyltransferase from the albumen gland and connective tissue of the snail Lymnaea stagnalis

    NARCIS (Netherlands)

    Vliegenthart, J.F.G.; Mulder, H.; Spronk, B.A.; Schachter, H.; Neeleman, A.P.; Eijnden, D.H. van den; Jong-Brink, M. de; Kamerling, J.P.

    1995-01-01

    Both the albumen gland, one of the female accessory sex glands, and connective tissue of the freshwater snail Lymnaea stagnalis contain N-acetylgalactosaminyltransferase activity, capable of transferring GalNAc from UDP-GalNAc in beta1-4 linkage to the terminal GlcNAc residue of GlcNAcbeta-R. The al

  1. Pollen limitation and Allee effect related to population size and sex ratio in the endangered Ottelia acuminata (Hydrocharitaceae): implications for conservation and reintroduction.

    Science.gov (United States)

    Xia, J; Lu, J; Wang, Z X; Hao, B B; Wang, H B; Liu, G H

    2013-03-01

    Small populations may suffer more severe pollen limitation and result in Allee effects. Sex ratio may also affect pollination and reproduction success in dioecious species, which is always overlooked when performing conservation and reintroduction tasks. In this study, we investigated whether and how population size and sex ratio affected pollen limitation and reproduction in the endangered Ottelia acuminata, a dioecious submerged species. We established experimental plots with increasing population size and male sex ratio. We observed insect visitation, estimated pollen limitation by hand-pollinations and counted fruit set and seed production per fruit. Fruit set and seed production decreased significantly in small populations due to pollinator scarcity and thus suffered more severe pollen limitation. Although frequently visited, female-biased larger populations also suffered severe pollen limitation due to few effective visits and insufficient pollen availability. Rising male ratio enhanced pollination service and hence reproduction. Unexpectedly, pollinator preferences did not cause reduced reproduction in male-biased populations because of high pollen availability. However, reproductive outputs showed more variability in severe male-biased populations. Our results revealed two component Allee effects in fruit set and seed production, mediated by pollen limitation in O. acuminata. Moreover, reproduction decreased significantly in larger female-biased populations, increasing the risk of an Allee effect.

  2. Microclimatic variation in UV perception and related disparity in tropane and quinolizidine alkaloid composition of Atropa acuminata, Lupinus polyphyllus and Hyoscyamus niger.

    Science.gov (United States)

    Jan, Sumira; Kamili, Azra N; Parray, Javid A; Bedi, Yashbir S; Ahmad, Parvaiz

    2016-08-01

    The aim of current research was to evaluate the physiological adjustment in three medicinal herbs viz., Atropa acuminata, Lupinus polyphyllus and Hyoscyamus niger to the winter period characterised by intense UV flux in Kashmir valley across the North Western Himalaya. Quinolizidine (QA) and tropane alkaloid (TA) concentrations were analysed in these herbs thriving at two different altitudes via GC-MS and correlated by PCA analysis. This study investigated the hypothesis that UV reflectance and absorbance at low temperatures are directly related to disparity in alkaloid accumulation. Among QAs in L. polyphyllus, ammodendrine and lupanine accumulated at higher concentration and exhibited significant variation of 186.36% and 95.91% in ammodendrine and lupanine respectively in both sites. Tetrahydrohombifoline displayed non-significant variation of about 9.60% irrespective of sites. Among tropane alkaloid (TA), hyoscyamine was recorded as the most abundant constituent irrespective of the plant and site while apotropine accumulated in lesser quantity in A. acuminata than H. niger. However, apotropine demonstrated significant variation of 175% among both sites. The final concentration of quinolizidine (QA) and tropane alkaloid (TA) reflects the interplay between reflectance and absorbance of UV radiation response field. These findings suggest that spectral response of UV light contributes directly to alkaloid biosynthesis.

  3. Composición química y actividad antibacteriana del aceite esencial de Peperomia acuminata de los Andes venezolanos

    Directory of Open Access Journals (Sweden)

    Flor D. Mora-Vivas

    2016-12-01

    Full Text Available El género Peperomia (Piperaceae, es bien conocido por sus especies ornamentales y usos etnomedicinales. En el presente trabajo se describe la caracterización química y la actividad antibacteriana del aceite esencial de Peperomia acuminata Ruiz & Pav. proveniente del Estado Mérida Venezuela. El aceite esencial se obtuvo por hidrodestilación de las hojas y la separación de los componentes se realizó por Cromatografía de gases-Espectrometría de Masas (CG/EM. Se logró la elucidación de ocho compuestos (96,7%, siendo el 2E-dodecenal el componente mayoritario (65% seguido de dodecanal (14,8% y tetradecanal (9,2%. Esta investigación muestra el potencial del aceite esencial de P. acuminata frente a bacterias Gram positivas (Staphylococcus aureus ATCC 25923 y Enterococcus faecalis 29212, con un valor de Concentración inhibitoria mínima de 1μL/mL. Este es el primer reporte sobre la composición química del aceite esencial de esta especie, por lo tanto una contribución importante al estudio del género Peperomia.

  4. Aptitude of Lymnaea palustris and L. stagnalis to Fasciola hepatica larval development through the infection of several successive generations of 4-mm-high snails.

    Science.gov (United States)

    Vignoles, P; Rondelaud, D; Dreyfuss, G

    2016-06-01

    Bimiracidial infections of Lymnaea palustris and Lymnaea stagnalis (shell height at exposure, 4 mm) with Fasciola hepatica were carried out during six successive snail generations to determine if prevalence and intensity of snail infection increased over time through descendants issuing from eggs laid by parents already exposed to this digenean. Controls were constituted by a French population of Galba truncatula (a single generation) infected according to the same protocol. In a first experiment performed with the F1 to F5 generations of L. palustris, the prevalence and intensity of F. hepatica infection in snails progressively increased. Immature rediae and a few cercariae-containing rediae of the digenean were observed in L. stagnalis from the F3 generation, but no free cercaria was noted in the bodies of this lymnaeid from the F4 to F6 generations. In another experiment carried out with the F6 generation of L. palustris, the prevalence of F. hepatica infection and the number of shed cercariae were significantly lower in L. palustris than in G. truncatula. This mode of snail infection suggests an explanation for cases of human fasciolosis occurring in central France after the collection of wild watercress from beds where L. palustris was the sole lymnaeid.

  5. Characteristics of the microbial community in rhizosphere of Camptotheca acuminata cultured with exotic invasive plant Eupatorium adenophorum

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The traditional culture-dependent plate counting and culture-independent small-subunit-ribosomal RNA gene-targeted molecular techniques, Single-Strand Conformation Polymorphism (SSCP) and ter-minal Restriction Fragment Length Polymorphism (tRFLP) combined with 16S rDNA clone library were adopted to investigate the impacts of secretion from Camptotheca acuminata (abbreviated to Ca) roots on the quantities and structure of eukaryotic microbes and bacteria in the rhizosphere, and the possi-bility that Ca controls exotic invasive plant Eupatorium adenophorum (Ea). The counting results indi-cated that the number of bacteria increased in turn in rhizospheres of Ea, Ca-Ea mixed culture and Ca, while that of eukaryotic microbes decreased. PCR-SSCP profiles showed eukaryotic microbial bands (corresponding to biodiversity) in rhizosphere of Ea were more complex than those of Ca and CE. Meristolohmannia sp., Termitomyces sp. and Rhodophyllus sp. were the dominant populations in the rhizosphere of Ca. Bacterial terminal restriction fragments (TRFs) profiles showed no difference among three kinds of rhizospheres, and the sequences of the 16S rDNA clone library from Ca rhizospheres were distributed in 10 known phyla, in which phylum Proteobacteria were the absolute dominant group and accounted for 24.71% of the cloned sequences (δ-Proteobacteria accounted for up to 17.65%), and phyla Acidobacteria and Bacteroidetes accounted for 16.47% and 10.59% of the cloned sequences, respectively. In addition, high performance liquid chromatography detected a trace amount of camp-tothecin and hydroxycamptothecin in the rhizospheric soil of Ca and CE, but examined neither camp-tothecin nor hydroxycamptothecin in rhizospheric soil of Ea. Therefore, invasion and diffusion of Ea evidently depended on distinguishing the eukaryotic community structure, but not on that of the bac-terial pattern. Ca was able to alter the eukaryotic community structure of invasive Ea by secreting camptothecin and

  6. Caracterización de harina y almidón de frutos de banano Gros Michel (Musa acuminata AAA

    Directory of Open Access Journals (Sweden)

    Jairo Montoya-López

    2015-01-01

    Full Text Available En el estudio se determinaron las características fisicoquímicas, térmicas y reológicas de la harina y el almidón de frutos de banano Gros Michel (Musa acuminata cosechado en fincas del departamento del Quindío, Colombia. En el análisis proximal, la harina presentó un contenido de fibra de 18.82% y el almidón presentó contenidos de proteína de 1.92%, grasa de 5.3% y fibra de 2.76%. La harina presentó la temperatura más alta de absorción de calor (68.88 °C y su entalpía de gelatinización fue de 2.17 J/g; mientras que para el almidón estos valores fueron de 48.36 °C y 44.62 J/g, respectivamente. El análisis termogravimétrico (TGA de la harina o temperaturas en las cuales se registra la descomposición de carbohidratos (componentes de bajo peso molecular y polisacáridos (componentes de alto peso molecular fueron, respectivamente, de 284.51 °C y 470.42 °C; y para el almidón fueron de 307.51 °C y 500.46 °C. Los gránulos de almidón de banano tienen forma elipsoidal con un tamaño longitudinal promedio de 39.39 µm y tamaño transversal promedio de 29.47 µm. Los difractogramas de rayos X mostraron patrones de difracción tipo B. Los viscoamilogramas mostraron que para la harina la temperatura de inicio de gelatinización (Tg es de 76.3 °C, la viscosidad máxima de 1120 cP, y para el almidón la Tg fue de 70.75 °C y la viscosidad máxima de 2087 cP.

  7. Atração miraxonal exercida por Biomphalaria straminea, Lymnaea columella e Physa sp, sobre miracídios de Schistosoma mansoni da linhagem BH The miraxonal attraction exercised by Biomphalaria straminea, Lymnaea columella and Physa sp over miracidia of Schistosoma mansoni

    Directory of Open Access Journals (Sweden)

    Luiz A. Magalhães

    1991-02-01

    Full Text Available Utilizando-se um artefato de vidro composto de duas câmaras unidas por um canal, testamos a atração miraxonal exercida por Biomphalaria straminea, Lymnaea columella e Physa sp, sobre larvas de Schistosoma mansoni da linhagem BH. Os moluscos, ou suas águas de condicionamento (SCW, foram colocados aleatoriamente em uma das câmaras, contendo o restante do artefato somente água declorada. Dez miracídios foram depositados no centro do canal. O comportamento dos miracídios foi observado por 15 min. Foram feitas dez replicações de cada experimento, utilizando-se espécimens de moluscos e miracídios diferentes. Verificou-se que todos os moluscos e suas SCW exerceram atração miraxonal, sendo que Physa sp atraiu mais que Lymnaea columella. Foi isolado um único exemplar de B. straminea que exerceu efeito repulsivo sobre os miracídios de S. mansoni.The attraction exercised over Schistosoma mansoni miracidia by Biomphalaria straminea, Lymnaea columella and Physa sp using a specially designed apparatus consisting of two circular glass chambers joined by an open channel were studied. The molluscs or their snail-conditioned water (SCW was placed in one of the chambers (randomly chosen. In the channel ten miracidia was deposited and the count of miracidia in each of the three compartments (the two chambers and the channel was recorded during fifteen minutes. Ten replications of each experiment with different specimens of molluscs and miracidia were made. Statistical and ad-hoc exploratory data analysis showed that: a the three species of molluscs and their SCW attract the miracidia; b Physa sp attract more miracidia then L. columella. There was an isolated single B. straminea specimen that had a repulsive effect to the miracidia.

  8. Extracción de nutrimentos en plantaciones de jaul (Alnus acuminata en la cuenca del río Virilla, Costa Rica

    Directory of Open Access Journals (Sweden)

    Manuel Segura

    2005-01-01

    Full Text Available El motivo del presente trabajo es ampliar el conocimiento sobre la extracción de nutrimentos de A. acuminata en plantaciones entre 2 y 7 años de edad, en suelos Typic Udivitrands (Landelina y Vista de Mar y Entic Udivitrands (Matinilla. Se encontró que la variación de la concentración de todos los elementos varía en función del tipo de tejido. Los contenidos de N, P, Mg y S de A. acuminata disminuyen en el orden: hojas>ramas secundarias>ramas principales>tallo. La concentración de K, Cu y Mn disminuyó en un orden similar al anterior, excepto para ramas principales y tallo, los cuales tenían una concentración similar. El B y el Ca tienen una mayor concentración en las hojas y ramas secundarias, entre las cuales no hay diferencias, mientras que se encontraron en menor cantidad en las ramas principales y el tallo. La concentración de Zn fue mayor en las ramas secundarias que en las hojas y disminuyó en el orden de ramas secundarias>hojas>ramas principales>tallo. El contenido de Fe en las hojas fue mayor que en las otras secciones comparadas de la biomasa aérea del árbol, entre las cuales no hubo diferencia. Indiferentemente del tejido estudiado y de la edad de la plantación, la concentración porcentual de los macronutrimentos en jaúl descendió en el orden: N>K>Ca>P≈Mg>S y la de los micronutrimentos en el orden: Fe>Zn>Mn>Cu>B. De los tejidos estudiados hasta los 2 años de edad, la copa y el tallo tienen biomasas comparables; a partir del cuarto año el tallo conforma la mayor parte de la biomasa aérea y por ende de los nutrimentos absorbidos, seguido por las ramas principales, las hojas y las ramas secundarias. La extracción total de nutrimentos en las plantaciones de A. acuminata se dio en el orden de N>K>Ca>P>Mg>S y de Fe>Zn>Mn>Cu>B.

  9. Arbuscular mycorrhizal colonization of Alnus acuminata Kunth in northwestern Argentina in relation to season and soil parameters Colonización micorrícico arbuscular de Alnus acuminata Kunth en el noroeste argentino en relación a la estacionalidad y a los parámetros edáficos

    Directory of Open Access Journals (Sweden)

    Alejandra Gabriela Becerra

    2007-07-01

    Full Text Available The objective of this study was to determine patterns of arbuscular mycorrhizal (AM colonization of Alnus acuminata Kunth at two natural forests in relation to soil parameters at two different seasons (autumn and spring. The soil parameters studied were field capacity, pH, electrical conductivity, available P, total N and organic matter. The percentage of AM colonization was estimated and correlated to soil properties and to two different seasons. The results indicate that the percentage of AM colonization varied among soil types and was higher in spring than autumn. A significant positive correlation was found between AM colonization and electrical conductivity, organic matter and total Nitrogen. Results of this study provide evidence that AM colonization of A. acuminata can be affected by some soil parameters and seasonality.El objetivo de este estudio fue determinar el patrón de colonización micorrícico arbuscular (MA de Alnus acuminata Kunth en dos bosques del Noroeste Argentino, en relación a los parámetros edáficos y en dos estaciones del año (otoño y primavera. Los parámetros edáficos estudiados fueron: capacidad de campo, pH, conductividad eléctrica, fósforo disponible, N total y materia orgánica. Se cuantificó el porcentaje de colonización MA y se lo correlacionó con las variables estudiadas (parámetros edáficos y estaciones. Los resultados indican que el porcentaje de colonización MA varió entre los dos tipos de suelo y las estaciones, siendo mayor en primavera. Se observó correlación positiva significativa entre el porcentaje de colonización MA y la conductividad eléctrica, materia orgánica y N total. Los resultados de este estudio indican que la colonización MA de A. acuminata puede ser afectada por algunos parámetros edáficos y la estacionalidad.

  10. Developmental toxicity of metaldehyde in the embryos of Lymnaea stagnalis (Gastropoda: Pulmonata) co-exposed to the synergist piperonyl butoxide.

    Science.gov (United States)

    Hallett, Katrina C; Atfield, Andrew; Comber, Sean; Hutchinson, Thomas H

    2016-02-01

    Metaldehyde is a widely used molluscicide in countries where damage to crops from slugs and snails is a major problem associated with warm and wet winters. In the UK it is estimated that over 8% of the area covered by arable crops is treated with formulated granular bait pellets containing metaldehyde as the main active ingredient. Metaldehyde is hydrophilic (log Kow=0.12), water soluble (200 mg·L(-1) at 17 °C) and has been detected in UK surface waters in the concentration range of typically 0.2-0.6 μg·L(-1) (maximum 2.7 μg·L(-1)) during 2008-2011. In the absence of chronic data on potential hazards to non-target freshwater molluscs, a laboratory study was conducted to investigate the impact of metaldehyde on embryo development in the gastropod Lymnaea stagnalis (RENILYS strain) and using zinc as a positive control. L. stagnalis embryos were exposed to metaldehyde under semi-static conditions at 20±1 °C and hatching success and growth (measured as shell height and intraocular distance) examined after 21 d. Exposure concentrations were verified using HPLC and gave 21 d (hatching)NOEC and (hatching)LOEC mean measured values of 36 and 116 mg MET·L(-1), respectively (equal to the 21 d (shell height)NOEC and (shell height)LOEC values). For basic research purposes, a second group of L. stagnalis embryos was co-exposed to metaldehyde and the pesticide synergist piperonyl butoxide (PBO). Co-exposure to the PBO (measured concentrations between 0.47-0.56 mg·L(-1)) reduced hatching success from 100% to 47% and resulted in a 30% reduction in embryo growth (shell height) in snail embryos co-exposed to metaldehyde at 34-36 mg·L(-1) over 21 d. In conclusion, these data suggest mollusc embryos may have some metabolic detoxication capacity for metaldehyde and further work is warranted to explore this aspect in order to support the recent initiative to include molluscs in the OECD test guideline programme.

  11. Fascioliasis transmission by Lymnaea neotropica confirmed by nuclear rDNA and mtDNA sequencing in Argentina.

    Science.gov (United States)

    Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores

    2009-12-03

    Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix

  12. Adaptation of Lymnaea fuscus and Radix balthica to Fasciola hepatica through the experimental infection of several successive snail generations.

    Science.gov (United States)

    Rondelaud, Daniel; Titi, Amal; Vignoles, Philippe; Mekroud, Abdeslam; Dreyfuss, Gilles

    2014-07-01

    High prevalence of Fasciola hepatica infection (>70%) was noted during several outbreaks before the 2000s in several French farms where Galba truncatula is lacking. Other lymnaeids such as Lymnaea fuscus, L. glabra and/or Radix balthica are living in meadows around these farms but only juvenile snails can sustain complete larval development of F. hepatica while older snails were resistant. The low prevalence of infection (<20%) and limited cercarial production (<50 cercariae per infected snail) noted with these juveniles could not explain the high values noted in these cattle herds. As paramphistomosis due to Calicophoron daubneyi was not still noted in these farms, the existence of another mode of infection was hypothesized. Experimental infection of several successive generations of L. glabra, originating from eggs laid by their parents already infected with this parasite resulted in a progressive increase in prevalence of snail infection and the number of shed cercariae. The aim of this paper was to determine if this mode of snail infection was specific to L. glabra, or it might occur in other lymnaeid species such as L. fuscus and R. balthica. Five successive generations of L. fuscus and R. balthica were subjected to individual bimiracidial infections in the laboratory. Resulting rediae and cercariae in the first four generations were counted after snail dissection at day 50 p.e. (20°C), while the dynamics of cercarial shedding was followed in the F5 generation. In the first experiment, prevalence and intensity of F. hepatica infection in snails progressively increased from the F1 (R. balthica) or F2 (L. fuscus) generation. In the second experiment, the prevalence of F. hepatica infection and the number of shed cercariae were significantly lower in L. fuscus and R. balthica (without significant differences between both lymnaeids) than in G. truncatula. The F. hepatica infection of several successive snail generations, coming from parents infected with this

  13. Development and validation of an OECD reproductive toxicity test guideline with the pond snail Lymnaea stagnalis (Mollusca, Gastropoda).

    Science.gov (United States)

    Ducrot, Virginie; Askem, Clare; Azam, Didier; Brettschneider, Denise; Brown, Rebecca; Charles, Sandrine; Coke, Maïra; Collinet, Marc; Delignette-Muller, Marie-Laure; Forfait-Dubuc, Carole; Holbech, Henrik; Hutchinson, Thomas; Jach, Arne; Kinnberg, Karin L; Lacoste, Cédric; Le Page, Gareth; Matthiessen, Peter; Oehlmann, Jörg; Rice, Lynsey; Roberts, Edward; Ruppert, Katharina; Davis, Jessica Elphinstone; Veauvy, Clemence; Weltje, Lennart; Wortham, Ruth; Lagadic, Laurent

    2014-12-01

    The OECD test guideline development program has been extended in 2011 to establish a partial life-cycle protocol for assessing the reproductive toxicity of chemicals to several mollusk species, including the great pond snail Lymnaea stagnalis. In this paper, we summarize the standard draft protocol for a reproduction test with this species, and present inter-comparison results obtained in a 56-day prevalidation ring-test using this protocol. Seven European laboratories performed semi-static tests with cultured snails of the strain Renilys® exposed to nominal concentrations of cadmium chloride (from 53 to 608μgCdL(-1)). Cd concentrations in test solutions were analytically determined to confirm accuracy in the metal exposure concentrations in all laboratories. Physico-chemical and biological validity criteria (namely dissolved oxygen content >60% ASV, water temperature 20±1°C, control snail survival >80% and control snail fecundity >8 egg-masses per snail over the test period) were met in all laboratories which consistently demonstrated the reproductive toxicity of Cd in snails using the proposed draft protocol. Effect concentrations for fecundity after 56days were reproducible between laboratories (68

  14. Histology of Callogenesis in Diploid Bananas (Musa acuminata, AA Group �Kluai Sa� and �Kluai Leb Mu Nang�

    Directory of Open Access Journals (Sweden)

    Kamnoon KANCHANAPOOM

    2012-02-01

    Full Text Available Yellow compact calluses were induced from in vitro-grown shoot tips of diploid bananas (Musa acuminata, AA group �Kluai Sa� and �Kluai Leb Mu Nang� on a modified Murashige and Skoog (MS medium containing 100 mg/L malt extract, 50 mg/L proline, 50 mg/L cysteine, 100 mg/L glutamine, 1 mg/L biotin, 7 mg/L Dicamba and 2 mg/L TDZ. Green shoot buds were induced after transfer of the yellow compact calluses to the same MS medium but supplemented with 1 mg/L NAA and 3 mg/L BA and plant regeneration was achieved through organogenesis in callus cultures. Regenerated shoots were rooted on MS medium containing 0.2% activated charcoal but without plant growth regulators. Histological analysis revealed that calluses originated from small dense cells with well stained cytoplasm and nucleus typical of meristematic cells.

  15. Cell-specific expression of tryptophan decarboxylase and 10-hydroxygeraniol oxidoreductase, key genes involved in camptothecin biosynthesis in Camptotheca acuminata Decne (Nyssaceae

    Directory of Open Access Journals (Sweden)

    Santamaria Anna

    2010-04-01

    Full Text Available Abstract Background Camptotheca acuminata is a major natural source of the terpenoid indole alkaloid camptothecin (CPT. At present, little is known about the cellular distribution of the biosynthesis of CPT, which would be useful knowledge for developing new strategies and technologies for improving alkaloid production. Results The pattern of CPT accumulation was compared with the expression pattern of some genes involved in CPT biosynthesis in C. acuminata [i.e., Ca-TDC1 and Ca-TDC2 (encoding for tryptophan decarboxylase and Ca-HGO (encoding for 10-hydroxygeraniol oxidoreductase]. Both CPT accumulation and gene expression were investigated in plants at different degrees of development and in plantlets subjected to drought-stress. In all organs, CPT accumulation was detected in epidermal idioblasts, in some glandular trichomes, and in groups of idioblast cells localized in parenchyma tissues. Drought-stress caused an increase in CPT accumulation and in the number of glandular trichomes containing CPT, whereas no increase in epidermal or parenchymatous idioblasts was observed. In the leaf, Ca-TDC1 expression was detected in some epidermal cells and in groups of mesophyll cells but not in glandular trichomes; in the stem, it was observed in parenchyma cells of the vascular tissue; in the root, no expression was detected. Ca-TDC2 expression was observed exclusively in leaves of plantlets subjected to drought-stress, in the same sites described for Ca-TDC1. In the leaf, Ca-HGO was detected in all chlorenchyma cells; in the stem, it was observed in the same sites described for Ca-TDC1; in the root, no expression was detected. Conclusions The finding that the sites of CPT accumulation are not consistently the same as those in which the studied genes are expressed demonstrates an organ-to-organ and cell-to-cell translocation of CPT or its precursors.

  16. Condiloma acuminado anal com ovos de Schistosoma mansoni em paciente HIV-positivo Condilomata acuminata with Schistosoma eggs in HIV-positive patient

    Directory of Open Access Journals (Sweden)

    Fabiana Pirani Carneiro

    2007-06-01

    Full Text Available Condiloma acuminado e ovos de Schistosoma são freqüentemente encontrados na região anal, mas não há nenhum caso descrito de associação dessas doenças nessa região. No colo uterino a associação de infecção por HPV (vírus do papiloma humano e ovos de Schistosoma em paciente HIV (vírus da imunodeficiência humana-positivo já foi relatada e há evidências de que essa associação possa alterar a história natural dessas doenças. Assim como no colo uterino, é possível que essa interação também ocorra na região anal. Nosso objetivo, portanto, é relatar um caso de condiloma anal em paciente HIV-positivo, que foi submetido a ressecção cirúrgica e que apresentou no exame histopatológico numerosos ovos de Schistosoma mansoni.Condilomata acuminata and Schistosoma eggs are frequently found in the anal region, but there is no report about the association of these diseases in this region. The association of HPV infection and Schistosoma eggs in an HIV-positive patient was found in uterine cervix and there is evidence suggesting that this association can alters the natural history of these diseases. Like in the cervix, it is possible that this interaction also occurs in the anal region. So, we report a case of anal Condilomata acuminata, in an HIV-positive patient, that was ressected and contained on histopathologic examination, multiple Schistosoma eggs.

  17. An interactive map to assess the potential spread of Lymnaea truncatula and the free-living stages of Fasciola hepatica in Switzerland.

    Science.gov (United States)

    Rapsch, Christina; Dahinden, Tobias; Heinzmann, Dominik; Torgerson, Paul R; Braun, Ueli; Deplazes, Peter; Hurni, Lorenz; Bär, Hansruedi; Knubben-Schweizer, Gabi

    2008-07-04

    The intermediate host of Fasciola hepatica is Lymnaea truncatula in Switzerland. The snail and the free-living stages of the parasite require a moderate climate and moisture for survival, reproduction, and transmission. In Switzerland, these conditions are present in many regions, resulting in a mean prevalence of bovine fasciolosis from 8.4 to 21.4%. An interactive map was created in order to demonstrate the relative risk of transmission by modelling the environmental conditions that promote the survival and reproduction of the larval stages of the parasite and the parasite's intermediate host. The map is based on temperature and rainfall data, soil conditions including ground water and forest cover in Switzerland. Extensive information on the free-living stages of F. hepatica and the intermediate host L. truncatula and how the development of these are affected by these environmental factors was used to create the interactive risk map.

  18. Uptake and distribution of copper sulfate and its effect on the respiration rate of the hemocyanin-producing freshwater snail Lymnaea natalensis

    Energy Technology Data Exchange (ETDEWEB)

    Wolmarans, C.T.; Yssel, E.

    1988-08-01

    Copper sulfate was one of the earliest compounds suggested as a molluscicide and although several new compounds have since been developed, copper sulfate is still widely used against freshwater snail intermediate hosts of trematode parasites causing bilharzia. However, the toxic effect that copper sulfate may have on these species has not yet been investigated adequately. This incomplete picture of the action of copper sulfate on freshwater snails is further complicated by the fact that some of these snail species have hemocyanin (a protein containing copper) as respiration pigment. Because of the existence of a copper metabolic pathway, these species may handle external copper differently from those species with hemoglobin as respiration pigment. In the present study, the uptake of external copper in the form of copper sulfate, as well as the effect of this ion on respiration rate, was investigated in Lymnaea natalensis, the intermediate host of Fasciola gigantica. This snail possesses hemocyanin as respiratory pigment.

  19. Resposta tissular em infecções por Fasciola hepatica em Lymnaea viatrix. Epidemiologia da fasciolose no gado bovino da provincia de valdivia, Chile

    OpenAIRE

    Jorge Blas Ladislao Franjola Tepper

    2000-01-01

    Resumo: Fasciola hepatica é um parasito que tem como habitat os duetos biliares de animais herbívoros e onívoros e apresenta um ciclo biológico indireto, tendo como hospedeiro intermediário um molusco pulmonado, cuja espécie, no Chile, é Lymnaea viatrix. Na presente investigação estudou-se a resposta tissular de L. viatrix frente à infecção por Fasciola hepatica. Nesta investigação foram realizadas observações histológicas nas primeiras 72 horas após a infecção. A reação tissular iniciou-se à...

  20. [Lymnaea cousini , intermediate host of Fasciola hepatica in the Colombian high tropical Andes, and its new haplotypes confirmed with the mitochondrial marker cytochrome oxidase I].

    Science.gov (United States)

    Uribe, Nelson; Becerra, Wlda Margarita; Velásquez, Luz Elena

    2014-01-01

    Fasciolosis is the disease transmitted by vectors with the highest latitudinal, longitudinal, and altitudinal distribution due to the colonizing capacity of the parasite Fasciola hepatica and its intermediate hosts, Lymnaeidae mollusks. These snails are under research due to their epidemiological importance, but their taxonomic identification is difficult given their interspecific phenotypical similarity. For this reason, there is uncertainty regarding Lymnaea cousini -a host of F. hepatica in Colombia- due to the morphological similarity it has with Lymnaea meridensis , recently described for Venezuela. To confirm with the COI marker (ADNmt) the taxonomic status of individuals morphologically identified as L. cousini from Nariño, Norte de Santander, and Santander (Colombia), deposited in the Vector Mollusks Collection VHET No. 37 of Universidad de Antioquia. The amplification of the mitochondrial COI required total DNA extraction of each individual´s foot using the DNeasy Blood and Tissue Kit (Qiagen®). Products amplified were sent for sequencing to Macrogen Inc., Korea. Twenty seven sequences generated in this research were compared to sequences published in the GenBank, including sequences of the type locality of L. cousini . Two new haplotypes of L. cousini were obtained for Colombia. Specimens from Nariño correspond to haplotype A, referenced for Ecuador, and specimens from Santander and Norte de Santander belong to a new haplotype we called haplotype D. By using the mitochondrial COI marker, we confirmed that the species under study did correspond to L. cousini . The number of known haplotypes of the species for Colombia has been duplicated and its geographical distribution has been extended to the southwest and northeast of the Colombian high Andean region.

  1. Susceptibilidade de Lymnaea (pseudosuccinea columella (Say, 1817 exposta à infecção por miracídios de Fasciola hepatica (Linnaeus, 1758

    Directory of Open Access Journals (Sweden)

    Alfredo Raimundo Corrêa Dacal

    1988-10-01

    Full Text Available Com o objetivo de estudar a susceptibilidade de Lymnaea (pseudosuccinea columella de Minas Gerais, Estado onde ainda não se registraram casos autóctones de fasciolose hepática, foram utilizadas as amostras MG 1, MG 2, MG 3 e MG 4, provenientes de diferentes regiões deste Estado, para estudo comparativo com as amostras RJ e RGS procedentes dos Estados do Rio de Janeiro e Rio Grande do Sul, áreas de focos de fasciolose. A amostra de Fasciola hepatica utilizada era procedente de ovinos abatidos no município de Camapuã, no Rio Grande do Sul, e foi mantida em coelhos. Os moluscos foram infectados com 6, 8 e 10 miracídos por molusco, sendo estudadas as incidências de infecção e de mortalidade. Nas condições que se realizou o trabalho diante dos resultados obtidos, foram tiradas as seguintes conclusões: 1. A mortalidade dos caramujos parece não estar diretamente relacionada com a percentagem de infecção; 2. As amostras de Lymnaea (pseudosuccinea columella de Minas Gerais, do Rio de Janeiro e do Rio Grande do Sul mostraram-se identicamente susceptíveis à infecção por Fasciola hepatica; 3. A população humana e os rebanhos bovino, ovino e suíno de Minas Gerais, particularmente aqueles do Vale do Rio Paraíba, podem ser considerados sujeitos à infecção por Fasciola hepatica.

  2. Characterisation of Lymnaea cubensis, L. viatrix and L. neotropica n. sp., the main vectors of Fasciola hepatica in Latin America, by analysis of their ribosomal and mitochondrial DNA.

    Science.gov (United States)

    Bargues, M D; Artigas, P; Mera Y Sierra, R L; Pointier, J P; Mas-Coma, S

    2007-10-01

    Although, in the endemic areas throughout the world, human fascioliasis presents varying patterns in its epidemiology, the species of lymnaeid snail that act as intermediate hosts and vectors are always crucial in the transmission of the causative parasites. Species in the Galba/Fossaria group of snails, such as Lymnaea cubensis, L. viatrix var. A ventricosa, L. viatrix var. B elongata and Galba truncatula, appear to be frequently involved in the transmission of Fasciola hepatica in Central and South America, although specific classification within this morphologically and anatomically confusing group is often very difficult. To explore the potential use of molecular analyses in the identification of vector snails, regions of the ribosomal DNA - the small subunit (18S) gene and internal transcribed spacers (ITS-2 and ITS-1) - and of the mitochondrial DNA - the cytochrome c oxidase subunit I (COI) - of wild-caught lymnaeid snails of L. cubensis, L. viatrix var. A ventricosa, L. viatrix var. B elongata and G. truncatula have been sequenced. The samples of the Latin American species included specimens from the respective type localities. The genetic distances observed and the results of phylogenetic analyses demonstrate that two different species exist within L. viatrix. Lymnaea neotropica n. sp. (=L. viatrix var. B elongata) is here proposed for specimens from Lima, Peru, and is differentiated from L. viatrix (=L. viatrix var. A ventricosa), L. cubensis and G. truncatula. The data collected on the 18S ribosomal-RNA gene indicate that the snails investigated may cover more than one supraspecific taxon. The ITS-2, ITS-1 and COI nucleotide sequences are clearly useful markers for the differentiation of these morpho-anatomically similar lymnaeid species. The numerous microsatellite repeats found within ITS-2 are potential tools for differentiation at population level.

  3. DNA multigene characterization of Fasciola hepatica and Lymnaea neotropica and its fascioliasis transmission capacity in Uruguay, with historical correlation, human report review and infection risk analysis.

    Science.gov (United States)

    Bargues, María Dolores; Gayo, Valeria; Sanchis, Jaime; Artigas, Patricio; Khoubbane, Messaoud; Birriel, Soledad; Mas-Coma, Santiago

    2017-02-01

    Fascioliasis is a pathogenic disease transmitted by lymnaeid snails and recently emerging in humans, in part due to effects of climate changes, anthropogenic environment modifications, import/export and movements of livestock. South America is the continent presenting more human fascioliasis hyperendemic areas and the highest prevalences and intensities known. These scenarios appear mainly linked to altitude areas in Andean countries, whereas lowland areas of non-Andean countries, such as Uruguay, only show sporadic human cases or outbreaks. A study including DNA marker sequencing of fasciolids and lymnaeids, an experimental study of the life cycle in Uruguay, and a review of human fascioliasis in Uruguay, are performed. The characterization of Fasciola hepatica from cattle and horses of Uruguay included the complete sequences of the ribosomal DNA ITS-2 and ITS-1 and mitochondrial DNA cox1 and nad1. ITS-2, ITS-1, partial cox1 and rDNA 16S gene of mtDNA were used for lymnaeids. Results indicated that vectors belong to Lymnaea neotropica instead of to Lymnaea viator, as always reported from Uruguay. The life cycle and transmission features of F. hepatica by L. neotropica of Uruguay were studied under standardized experimental conditions to enable a comparison with the transmission capacity of F. hepatica by Galba truncatula at very high altitude in Bolivia. On this baseline, we reviewed the 95 human fascioliasis cases reported in Uruguay and analyzed the risk of human infection in front of future climate change estimations. The correlation of fasciolid and lymnaeid haplotypes with historical data on the introduction and spread of livestock into Uruguay allowed to understand the molecular diversity detected. Although Uruguayan L. neotropica is a highly efficient vector, its transmission capacity is markedly lower than that of Bolivian G. truncatula. This allows to understand the transmission and epidemiological differences between Andean highlands and non

  4. [Establishment of embryogenic cell suspension culture and plant regeneration of edible banana Musa acuminata cv. Mas (AA)].

    Science.gov (United States)

    Wei, Yue-Rong; Huang, Xue-Lin; Li, Jia; Huang, Xia; Li, Zhe; Li, Xiao-Ju

    2005-01-01

    Conventional breeding for dual resistance of disease and pest of Musa cultivars remains a difficult endeavor, as the plant is polyploidic and high in sterility. Biotechnological techniques, eg., genetic engineering, in vitro mutation breeding, or protoplast fusion, may overcome the difficulties and improve the germplasm. Establishment of a stable embryogenic cell suspension (ECS) is a prerequisite for any of the biotechnological breeding methods. In this study an embryogenic cell suspension was established from immature male flower of Musa acuminata cv. Mas (AA), a popular commercial variety of banana in the South-East Asian region. After culture for 5-6 months on callus induction media, which consisted of MS salts, different concentrations of 2,4-dichlorophenoxyacetic acid (2,4-D), 4.1 micromol/L biotin, 5.7 micromol/L indoleacetic acid (IAA), 5.4 micromol/L naphthaleneacetic acid (NAA), other vitamins, 87 mmol/L sucrose, and solidified with 7 g/L agarose, meristematic globules and yellow, friable embryogenic cultures were induced from the explants of 1-15th row young floral hands of immature male flowers. Of the four treatments of 2,4-D, 9 micromol/L was the most effective on the callus induction, it transformed 40.96% and 7.45% of the cultivated male floral hands into callus and embryogenic callus respectively. The explants to produce highest frequency of the embryogenic calli were floral hands of 6 to 12th rows, which generated 5.79% of the embryogenic calli. Suspension cultures were initiated from these embryogenic calli in liquid medium supplemented with 4.5 micromol/L 2, 4-D. After sieving selection of the cultures using a stainless steel metallic strainer with pore sizes of 154 microm at 15 day intervals for 3 months, homogeneous and yellow embryogenic cell suspensions, composed of single cells and small cell aggregates, were established. Based upon the growth quantity and growth rate of ECS, it was determined that the appropriate inoculum was 2.0 mL PCV

  5. Contribución al conocimiento de la biología y taxonomía de un hongo del género Phytium aislado del "aliso", Alnus acuminata HBK Contribución al conocimiento de la biología y taxonomía de un hongo del género Phytium aislado del "aliso", Alnus acuminata HBK

    Directory of Open Access Journals (Sweden)

    Cabrera Orlando

    1990-06-01

    Full Text Available

    Se estudio la biología de un hongo aislado de la parte externa de nódulos de raíces de aliso (Alnus acumi"ata HB K, el cual presento un alto poder de germinación a bajas temperaturas (entre QOC y 4QC, condición que le confiere gran agresividad para colonizar el suelo, de tal forma que se constituye en un factor importante en la ecofisiología de las poblaciones de aliso que crecen en los bosques secundarios del sub-paramo. A partir de cultivos puros se hicieron estudios para su identificación.

    Some biological aspects of an isolated fungus of Alnus acuminata roots were studied. It bas been found Tbat between OOC and 4°C tbe fungi grows fast. This condition can result in a important factor in the ecophysiology of 'Aliso' populations, that grows in secondary forests at sub-paramo, After a review of the taxonomic literature, we placed it in the Phytium genus, but not in a particular described species. We assume that it is a new species. We modificated the microculture technique that was simpler and safer and them we made direct observations about tbe fungus growtb and development. As for now it is nominated as Phytiun near Mammillatum Meurs. Palabras Claves: Phytium, bongos, A/nus acuminata HBK., "Aliso".

  6. Micronucleus technology of microspore mother cells of Ottelia acuminata for monitoring water pollution of Dianchi Lake%海菜花花粉母细胞微核技术监测滇池水质污染状况

    Institute of Scientific and Technical Information of China (English)

    翟书华; 樊传章; 侯思名; 郭丽红; 王全坤

    2011-01-01

    以海菜花生长环境水(路南长湖水)处理作阴性对照,以滇池5个样点的水样处理作阳性对照,利用海菜花花粉母细胞微核技术监测评价滇池水质污染物致突变的情况,测定各采样点水样的海菜花花粉母细胞微核千分率及污染指数.结果表明:滇池5个样点的水样均使海菜花花粉母细胞微核千分率急剧增加,用海莱花水生植物建立的水体环境污染检验系统,可避免用陆生植物监测水体时因改变生长环境而造成的误差.%The micronucleus techniques of microspore mother cells of Ottelia acuminata was used to monitor the water pollution of Dianchi Lake when Ottelia acuminata was grown in the water samples of five sampling sites in the Dianchi lake. The micronucleus permillage and pollution index of the microspore mother cells of Ottelia acuminata in the water samples were determined. The results show that the water samples of the five sampling sites in the Dianchi Lake cause a sharp increase in the micronucleus of microspore mother cells of 0ttelia acuminate. The monitoring system of water environmental pollution established by Ottelia acuminata can avoid the error caused by the change of growth environment of land plants.

  7. Don't camp beside the river: structure and dynamics of Andean alder (Alnus acuminata forests affected by river floods, northwestern Argentina No acampe junto al río: estructura y dinámica de bosques de aliso (Alnus acuminata del noroeste argentino afectados por crecientes de río

    Directory of Open Access Journals (Sweden)

    TOMÁS A EASDALE

    2005-12-01

    Full Text Available Alnus acuminata (Betulaceae is a pioneer tree that dominates mountain riparian forests throughout the eastern Andes. Early studies associated these forests with particular microclimatic conditions along river beds, but they were later linked to the periodical disturbance regime of mountain rivers. To understand the dynamics of these forests, we analysed tree age and spatial arrangement in two plots along Potrero river and another plot along La Horqueta river, Tucumán Province, north west Argentina. Through intensive tree coring and age reconstruction we identified similar-aged tree cohorts with maximum age ranges of eight years. Tree mapping and Moran's I spatial autocorrelation analysis showed that tree cohorts were spatially clumped, and provided further evidence that coetaneous patches of A. acuminata arise from massive regeneration following catastrophic flooding events. We tested the association between cohort initiation dates and regional maximum river discharge records by means of a randomization procedure and found weak evidence that establishment occurs after devastating floods, which eliminate previous vegetation and create bare sites suitable for A. acuminata regeneration. Dates of tree floodscars sampled along Potrero river precede by one year the most recent cohort initiation date and provide further support of this association. Although previous studies found a positive correlation between El Niño events and mean annual precipitation in northwestern Argentina, we did not detect an association between El Niño and annual maximum stream flow for rivers in Tucumán Province. Therefore, factors driving devastating floods and A. acuminata stand initiation require further studyEl aliso (Alnus acuminata, Betulaceae es un árbol pionero que domina bosques riparios de montaña en los Andes orientales. Estudios iniciales atribuyeron la presencia de estos bosques a las típicas condiciones microclimáticas de cauces de ríos, pero luego

  8. DNA multigene characterization of Fasciola hepatica and Lymnaea neotropica and its fascioliasis transmission capacity in Uruguay, with historical correlation, human report review and infection risk analysis.

    Directory of Open Access Journals (Sweden)

    María Dolores Bargues

    2017-02-01

    Full Text Available Fascioliasis is a pathogenic disease transmitted by lymnaeid snails and recently emerging in humans, in part due to effects of climate changes, anthropogenic environment modifications, import/export and movements of livestock. South America is the continent presenting more human fascioliasis hyperendemic areas and the highest prevalences and intensities known. These scenarios appear mainly linked to altitude areas in Andean countries, whereas lowland areas of non-Andean countries, such as Uruguay, only show sporadic human cases or outbreaks. A study including DNA marker sequencing of fasciolids and lymnaeids, an experimental study of the life cycle in Uruguay, and a review of human fascioliasis in Uruguay, are performed.The characterization of Fasciola hepatica from cattle and horses of Uruguay included the complete sequences of the ribosomal DNA ITS-2 and ITS-1 and mitochondrial DNA cox1 and nad1. ITS-2, ITS-1, partial cox1 and rDNA 16S gene of mtDNA were used for lymnaeids. Results indicated that vectors belong to Lymnaea neotropica instead of to Lymnaea viator, as always reported from Uruguay. The life cycle and transmission features of F. hepatica by L. neotropica of Uruguay were studied under standardized experimental conditions to enable a comparison with the transmission capacity of F. hepatica by Galba truncatula at very high altitude in Bolivia. On this baseline, we reviewed the 95 human fascioliasis cases reported in Uruguay and analyzed the risk of human infection in front of future climate change estimations.The correlation of fasciolid and lymnaeid haplotypes with historical data on the introduction and spread of livestock into Uruguay allowed to understand the molecular diversity detected. Although Uruguayan L. neotropica is a highly efficient vector, its transmission capacity is markedly lower than that of Bolivian G. truncatula. This allows to understand the transmission and epidemiological differences between Andean highlands

  9. DNA multigene characterization of Fasciola hepatica and Lymnaea neotropica and its fascioliasis transmission capacity in Uruguay, with historical correlation, human report review and infection risk analysis

    Science.gov (United States)

    Gayo, Valeria; Sanchis, Jaime; Artigas, Patricio; Khoubbane, Messaoud; Birriel, Soledad; Mas-Coma, Santiago

    2017-01-01

    Background Fascioliasis is a pathogenic disease transmitted by lymnaeid snails and recently emerging in humans, in part due to effects of climate changes, anthropogenic environment modifications, import/export and movements of livestock. South America is the continent presenting more human fascioliasis hyperendemic areas and the highest prevalences and intensities known. These scenarios appear mainly linked to altitude areas in Andean countries, whereas lowland areas of non-Andean countries, such as Uruguay, only show sporadic human cases or outbreaks. A study including DNA marker sequencing of fasciolids and lymnaeids, an experimental study of the life cycle in Uruguay, and a review of human fascioliasis in Uruguay, are performed. Methodology/Principal findings The characterization of Fasciola hepatica from cattle and horses of Uruguay included the complete sequences of the ribosomal DNA ITS-2 and ITS-1 and mitochondrial DNA cox1 and nad1. ITS-2, ITS-1, partial cox1 and rDNA 16S gene of mtDNA were used for lymnaeids. Results indicated that vectors belong to Lymnaea neotropica instead of to Lymnaea viator, as always reported from Uruguay. The life cycle and transmission features of F. hepatica by L. neotropica of Uruguay were studied under standardized experimental conditions to enable a comparison with the transmission capacity of F. hepatica by Galba truncatula at very high altitude in Bolivia. On this baseline, we reviewed the 95 human fascioliasis cases reported in Uruguay and analyzed the risk of human infection in front of future climate change estimations. Conclusions/Significance The correlation of fasciolid and lymnaeid haplotypes with historical data on the introduction and spread of livestock into Uruguay allowed to understand the molecular diversity detected. Although Uruguayan L. neotropica is a highly efficient vector, its transmission capacity is markedly lower than that of Bolivian G. truncatula. This allows to understand the transmission and

  10. DNA sequence characterisation and phylogeography of Lymnaea cousini and related species, vectors of fascioliasis in northern Andean countries, with description of L. meridensis n. sp. (Gastropoda: Lymnaeidae

    Directory of Open Access Journals (Sweden)

    Bargues M Dolores

    2011-07-01

    Full Text Available Abstract Background Livestock fascioliasis is a problem throughout Ecuador, Colombia and Venezuela, mainly in Andean areas where the disease also appears to affect humans. Transmission patterns and epidemiological scenarios of liver fluke infection have shown to differ according to the lymnaeid vector snail species involved. These Andean countries present the vectors Lymnaea cousini, L. bogotensis and L. ubaquensis, unknown in the rest of Latin America. An exhaustive combined haplotype study of these species is performed by means of DNA sequencing of the nuclear ribosomal 18S RNA gene, ITS-2 and ITS-1, and mitochondrial DNA cox1 gene. Results The conserved 5.8S rDNA sequence corroborated that no pseudogenes are involved in the numerous non-microsatellite/minisatellite-related indels appearing between the ITS-2 and ITS-1 sequences when comparing different L. cousini - L. bogotensis populations. Sequence analyses and phylogenetic reconstruction methods including other lymnaeid vector species show that (i L. bogotensis is a synonym of L. cousini, (ii L. ubaquensis is a synonym of Pseudosuccinea columella, and (iii populations of L. cousini hitherto known from Venezuelan highlands indeed belong to a new species for which the name L. meridensis n. sp. is proposed. This new species is described and a complete phenotypic differentiation provided. Conclusions ITS-2, ITS-1 and cox1 prove to be good markers for specimen classification and haplotype characterisation of these morphologically similar lymnaeids in endemic areas. Analysis of the 18S gene and phylogenetic reconstructions indicate that L. cousini and L. meridensis n. sp. cluster in an evolutionary line different from the one of P. columella, despite their external resemblance. This suggests an evolutionary phenotypic convergence related to similar environments and which has given rise to frequent specimen misclassification. Body size and phylogenetic relationships of L. meridensis n. sp. with

  11. Construction and characterization of a plant transformation-competent BIBAC library of the black Sigatoka-resistant banana Musa acuminata cv. Tuu Gia (AA).

    Science.gov (United States)

    Ortiz-Vázquez, E; Kaemmer, D; Zhang, H-B; Muth, J; Rodríguez-Mendiola, M; Arias-Castro, C; James, Andrew

    2005-02-01

    A plant transformation-competent binary bacterial artificial chromosome (BIBAC) library was constructed from Musa acuminata cv. Tuu Gia (AA), a black Sigatoka-resistant diploid banana. After digestion of high-molecular-weight banana DNA by HindIII, several methods of DNA size selection were tested, followed by ligation, using a vector/insert molar ratio of 4:1. The library consists of 30,700 clones stored in 80 384-well microtiter plates. The mean insert size was estimated to be 100 kb, and the frequency of inserts with internal NotI sites was 61%. The majority of insert sizes fell into the range of 100+/-20 kb, making them suitable for Agrobacterium-mediated transformation. Only 1% and 0.9% of the clones contain chloroplast and mitochondrial DNA, respectively. This is the first BIBAC library for banana, estimated to represent five times its haploid genome (600 Mbp). It was demonstrated by hybridization that the library contains typical members of resistance gene and defense gene families that can be used for transformation of disease susceptible banana cultivars for banana genetic improvement.

  12. Micromechanical properties of consecutive layers in specialized insect cuticle: the gula of Pachnoda marginata (Coleoptera, Scarabaeidae) and the infrared sensilla of Melanophila acuminata (Coleoptera, Buprestidae).

    Science.gov (United States)

    Müller, Martin; Olek, Maciej; Giersig, Michael; Schmitz, Helmut

    2008-08-01

    Insect cuticle is a highly adaptive material that fulfils a wide spectrum of different functions. Cuticle does not only build the exoskeleton with diverse moveable parts but is also an important component of a stunning variety of mechanosensory receptors. Therefore, the mechanical properties of these specialized cuticular systems are of crucial importance. We studied the different cuticular layers of the head part (gula) of the head-to-neck ball articulation of Pachnoda marginata and of the photomechanic infrared (IR) sensilla of Melanophila acuminata on the basis of cross sections. In our study, we combined histological methods (i.e. detection of the different types of cuticle by specific staining) with measurements of hardness (H) and reduced elastic modulus (E(r)) by nanoindentation technique. In the gula of Pachnoda we found an unusual aberrance from the well-known layering. Between the epi- and exocuticle, two meso- and one endocuticular layers are deposited which are softer and more elastic than the underlying exo- and mesocuticular layers. The hardest of all examined materials is the cuticle of the exocuticular shell of the internal sphere of the Melanophila IR sensillum with H=0.53GPa whereas the inner mesocuticular core of the sensillum represents the most elastic and softest layer with values of H=0.29GPa and E(r)=4.8GPa. Results are discussed with regard to the proposed functions.

  13. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling.

  14. Bioaccumulation and toxic effects of cadmium on feeding and growth of an Indian pond snail Lymnaea luteola L. under laboratory conditions.

    Science.gov (United States)

    Das, Sangita; Khangarot, B S

    2010-10-15

    Effects of dissolved cadmium exposure on the survival, feeding, growth rates and accumulation in Indian pond snails Lymnaea luteola L. were examined for a period of 7 weeks. The concentrations of cadmium tested were 0, 10, 32, 100, 320, 560, and 1000 microg l(-1). Cadmium exposure significantly inhibited the feeding and growth rates. At higher Cd concentrations snails refused to consume food offered as plant Marsilia sp. leaves. Cadmium mainly accumulated in soft tissues in a dose-dependent manner. After 4 and 7 weeks of exposure, the no observed effect concentration (NOEC) of Cd was 10 microg l(-1) and the lowest observed effect concentration (LOEC) was 32 microg l(-1). Reduction of growth (decrease in wet weight) was noticed followed by a high mortality in higher Cd concentrations. Significant reduction in food consumption and growth rates was found at 32 microg l(-1) and above Cd concentration. A significant relationship between Cd exposure and growth and feeding rates was noticed. The results obtained with these key aquatic organisms in the food chains complement those obtained with other aquatic organisms and gastropod snails. The findings of the present study and those of earlier studies suggested that Indian pond snail L. luteola are useful test organisms for ecotoxicology bioassays.

  15. Effects of self-fertilization, environmental stress and exposure to xenobiotics on fitness-related traits of the freshwater snail Lymnaea stagnalis.

    Science.gov (United States)

    Coutellec, Marie-Agnès; Lagadic, Laurent

    2006-03-01

    Genetic and ecological factors may interact in their effects on fitness. Such interactions are thus to be expected between inbreeding and exposure of a population to a toxicant. The magnitude of inbreeding depression is thought to increase in stressful environments. To test this hypothesis, we investigated the combined effects of environmental conditions and inbreeding on fitness in the self-fertile snail Lymnaea stagnalis, using a stress gradient (0-2) applied to a 100 isolated and paired lineages: laboratory control (0), outdoor microcosm control (1) and pesticide exposure under outdoor microcosm conditions (2). Outdoor stress conditions were maintained for 28 days prior to measurements of fitness traits (fecundity, hatching success, and size at hatching) under laboratory conditions, so that delayed environmental effects could be estimated. Under laboratory control conditions, we found significant initial family level heterogeneity for most measured traits, including physiological performances as assessed through energetic biomarkers. Whatever the environmental conditions, inbreeding depression was very low for progeny performances. Negative values of self-fertilization depression (SFD) were obtained. Unexpectedly, SFD showed a negative relationship with the assumed stress intensity, reflecting a higher sensitivity under pairing than under selfing, mostly due to parental fecundity. This suggests that stressful conditions may favour selfing. Stress intensity increased the distribution limits of both depression indices, suggesting that changes in fitness are less predictable in a population under stress. Implications of such findings for environmental risk assessment of pesticides are discussed.

  16. Larval trematodes (Digenea of the great pond snail, Lymnaea stagnalis (L., (Gastropoda, Pulmonata in Central Europe: a survey of species and key to their identification

    Directory of Open Access Journals (Sweden)

    Faltýnková A.

    2007-03-01

    Full Text Available A survey of cercariae and metacercariae (Trematoda, Digenea from the great pond snail (Lymnaea stagnalis in Central Europe (Austria, Czech Republic, South-East Germany, Poland and Slovak Republic is presented, based on a study of 3,628 snails examined from 1998 to 2005. A total of 953 (26.3% L. stagnalis were infected with 24 trematode species comprising 19 species of cercariae and 11 species of metacercariae (six species occurred both as cercarie and metacercarie of eight families. The dominant cercariae were those of Opisthioglyphe ranae (159 hosts infected, Plagiorchis elegans (141 (both family Plagiorchiidae and Echinoparyphium aconiatum (153 (Echinostomatidae; 14 double infections were found. The most frequent metacercariae were those of Neoglyphe locellus (71 (Omphalometridae, E. aconiatum (66, Echinostoma sp. (59 and Moliniella anceps (48 (Echinostomatidae. In the previous studies carried out in Central Europe, a very similar spectrum of nine trematode families of 22 cercariae determined to species level and 43 types of cercariae reported under generic or provisional names, which can be in many cases conspecific with the previous taxa, were found. A simple key to identification of cercariae and metacercariae, together with their illustrations, is provided.

  17. The role of spatial and temporal heterogeneity and competition in structuring trematode communities in the great pond snail, Lymnaea stagnalis (L.)

    Science.gov (United States)

    Soldánová, Miroslava; Kuris, Armand M.; Scholz, Tomáš; Lafferty, Kevin D.

    2012-01-01

    We assessed how spatial and temporal heterogeneity and competition structure larval trematode communities in the pulmonate snail Lymnaea stagnalis. To postulate a dominance hierarchy, mark-release-recapture was used to monitor replacements of trematode species within snails over time. In addition, we sampled the trematode community in snails in different ponds in 3 consecutive years. A total of 7,623 snails (10,382 capture events) was sampled in 7 fishponds in the Jindřichův Hradec and Třeboň areas in South Bohemia (Czech Republic) from August 2006 to October 2008. Overall, 39% of snails were infected by a community of 14 trematode species; 7% of snails were infected with more than 1 trematode species (constituting 16 double- and 4 triple-species combinations). Results of the null-model analyses suggested that spatial heterogeneity in recruitment among ponds isolated trematode species from each other, whereas seasonal pulses in recruitment increased species interactions in some ponds. Competitive exclusion among trematodes led to a rarity of multiple infections compared to null-model expectations. Competitive relationships among trematode species were hypothesized as a dominance hierarchy based on direct evidence of replacement and invasion and on indirect evidence. Seven top dominant species with putatively similar competitive abilities (6 rediae and 1 sporocyst species) reduced the prevalence of the other trematode species developing in sporocysts only.

  18. Considerations for test design to accommodate energy-budget models in ecotoxicology: a case study for acetone in the pond snail Lymnaea stagnalis.

    Science.gov (United States)

    Barsi, Alpar; Jager, Tjalling; Collinet, Marc; Lagadic, Laurent; Ducrot, Virginie

    2014-07-01

    Toxicokinetic-toxicodynamic (TKTD) modeling offers many advantages in the analysis of ecotoxicity test data. Calibration of TKTD models, however, places different demands on test design compared with classical concentration-response approaches. In the present study, useful complementary information is provided regarding test design for TKTD modeling. A case study is presented for the pond snail Lymnaea stagnalis exposed to the narcotic compound acetone, in which the data on all endpoints were analyzed together using a relatively simple TKTD model called DEBkiss. Furthermore, the influence of the data used for calibration on accuracy and precision of model parameters is discussed. The DEBkiss model described toxic effects on survival, growth, and reproduction over time well, within a single integrated analysis. Regarding the parameter estimates (e.g., no-effect concentration), precision rather than accuracy was affected depending on which data set was used for model calibration. In addition, the present study shows that the intrinsic sensitivity of snails to acetone stays the same across different life stages, including the embryonic stage. In fact, the data on egg development allowed for selection of a unique metabolic mode of action for the toxicant. Practical and theoretical considerations for test design to accommodate TKTD modeling are discussed in the hope that this information will aid other researchers to make the best possible use of their test animals. © 2014 SETAC.

  19. Bioaccumulation and toxic effects of cadmium on feeding and growth of an Indian pond snail Lymnaea luteola L. under laboratory conditions

    Energy Technology Data Exchange (ETDEWEB)

    Das, Sangita [Ecotoxicology Laboratory, Indian Institute of Toxicology Research, (Formerly: Industrial Toxicology Research Centre), Council of Scientific and Industrial Research (CSIR), Post Box No. 80, Mahatma Gandhi Marg, Lucknow 226 001 (India); Khangarot, B.S., E-mail: bkhangarot@hotmail.com [Ecotoxicology Laboratory, Indian Institute of Toxicology Research, (Formerly: Industrial Toxicology Research Centre), Council of Scientific and Industrial Research (CSIR), Post Box No. 80, Mahatma Gandhi Marg, Lucknow 226 001 (India)

    2010-10-15

    Effects of dissolved cadmium exposure on the survival, feeding, growth rates and accumulation in Indian pond snails Lymnaea luteola L. were examined for a period of 7 weeks. The concentrations of cadmium tested were 0, 10, 32, 100, 320, 560, and 1000 {mu}g l{sup -1}. Cadmium exposure significantly inhibited the feeding and growth rates. At higher Cd concentrations snails refused to consume food offered as plant Marsilia sp. leaves. Cadmium mainly accumulated in soft tissues in a dose-dependent manner. After 4 and 7 weeks of exposure, the no observed effect concentration (NOEC) of Cd was 10 {mu}g l{sup -1} and the lowest observed effect concentration (LOEC) was 32 {mu}g l{sup -1}. Reduction of growth (decrease in wet weight) was noticed followed by a high mortality in higher Cd concentrations. Significant reduction in food consumption and growth rates was found at 32 {mu}g l{sup -1} and above Cd concentration. A significant relationship between Cd exposure and growth and feeding rates was noticed. The results obtained with these key aquatic organisms in the food chains complement those obtained with other aquatic organisms and gastropod snails. The findings of the present study and those of earlier studies suggested that Indian pond snail L. luteola are useful test organisms for ecotoxicology bioassays.

  20. The population density of Lymnaea columella (Say, 1817) (Mollusca, Lymnaeidae) an intermediate host of Fasciola hepatica (Linnaeus, 1758), in the Caparaó microregion, ES, Brazil.

    Science.gov (United States)

    D'Almeida, S C G; Freitas, D F; Carneiro, M B; Camargo, P F; Azevedo, J C; Martins, I V F

    2016-06-01

    The aim of this study was to monitor the population density of Lymnaea columella, an intermediate host of Fasciola hepatica, in various aquatic habitats and in drinking water in the area of the Instituto Federal de Educação, Ciência e Tecnologia do Espírito Santo, on Caparaó Microregion, municipality of Alegre, state of Espírito Santo, Brazil. Monthly samplings were performed at certain points between drainage areas and drinking water in cattle and goat production systems during the years 2010 to 2013. The mean temperature, precipitation and the frequency of samples of L. columella were analysed graphically according the monthly average during the study period. A total of 2,038 molluscs were collected, 1558 of which were L. columella, that predominated in all sampled points. The highest average of specimens observed for L. columella was in the years 2010 and 2013 (51.0), and occurred decreased in 2011 (19.8). The temperature and precipitation averaged is 23.7 °C and 141 mm/year, respectively. Rainfall peak occurred in March (2011, 2013) and November (2012), during these periods the population of L. columella growth. There was no significant difference in the relationship between the specimens observed with seasons (dry-wet), thus the population of L. columella remained stable and can be found throughout the year.

  1. Isolation and detection of Fasciola hepatica DNA in Lymnaea viatrix from formalin-fixed and paraffin-embedded tissues through multiplex-PCR.

    Science.gov (United States)

    Magalhães, Kelly Grace; Jannotti-Passos, Liana K; Caldeira, Roberta L; Berne, Maria Elisabeth Aires; Muller, Gertrude; Carvalho, Omar S; Lenzi, Henrique Leonel

    2008-04-15

    Detection of Fasciola hepatica infection in Lymnaea viatrix through analysis of histological cuts is based upon morphological characters of the parasite during the intra-mollusk phase of parasitism. At this stage, trematode forms are very similar and, thus, very difficult to differentiate. Specific detection may also be impaired by the presence of other helminthes in the mollusk. Histological samples are usually fixed in formalin, embedded in paraffin, sectioned and HE stained. In the current study, a method for the extraction of DNA from formalin-fixed, paraffin-embedded tissues was standardized by means of deparaffinizing with xylol and digesting with proteinase K. Extracted DNA was amplified in a multiplex-PCR, by using simultaneous primers in a single reaction under high stringency conditions. Results showed specific amplification of DNA from the trematode and the snails. The technique was sensitive enough to detect F. hepatica infections in L. viatrix, in histological sections in which the presence of larval stages could not be observed through brightfield microscopy. The profiles generated were: stair bands referring to F. hepatica DNAmt amplification; a band of 1200 bp referring to L. viatrix ITS and another of 1300 bp referring to F. hepatica ITS and other trematodes. Multiplex-PCR has shown to be a fast, safe, highly sensitive and specific method, which is able to amplify DNA from fixed tissues, despite a low DNA quantity and its degradation caused by fixation processes. Such methodology may be useful in studies on fascioliasis epidemiology, enabling the use of material from histological collections.

  2. The population density of Lymnaea columella (Say, 1817 (Mollusca, Lymnaeidae an intermediate host of Fasciola hepatica (Linnaeus, 1758, in the Caparaó microregion, ES, Brazil

    Directory of Open Access Journals (Sweden)

    S. C. G. D’Almeida

    Full Text Available Abstract The aim of this study was to monitor the population density of Lymnaea columella, an intermediate host of Fasciola hepatica, in various aquatic habitats and in drinking water in the area of the Instituto Federal de Educação, Ciência e Tecnologia do Espírito Santo, on Caparaó Microregion, municipality of Alegre, state of Espírito Santo, Brazil. Monthly samplings were performed at certain points between drainage areas and drinking water in cattle and goat production systems during the years 2010 to 2013. The mean temperature, precipitation and the frequency of samples of L. columella were analysed graphically according the monthly average during the study period. A total of 2,038 molluscs were collected, 1558 of which were L. columella, that predominated in all sampled points. The highest average of specimens observed for L. columella was in the years 2010 and 2013 (51.0, and occurred decreased in 2011 (19.8. The temperature and precipitation averaged is 23.7 °C and 141 mm/year, respectively. Rainfall peak occurred in March (2011, 2013 and November (2012, during these periods the population of L. columella growth. There was no significant difference in the relationship between the specimens observed with seasons (dry-wet, thus the population of L. columella remained stable and can be found throughout the year.

  3. Extremely low frequency magnetic field and the hatching rate of Fasciola hepatica eggs, the fecundity and survival of liver fluke-infected snail, Lymnaea truncatula.

    Science.gov (United States)

    Kołodziejczyk, Lidia; Kuźna-Grygiel, Wanda; Gonet, Bolesław; Podraza, Wojciech

    2010-01-01

    Eggs of Fasciola hepatica were exposed for 10 days to extremely low frequency magnetic field (ELFMF) at the frequency of 50 Hz and density of 2 mT (rms). The results show an accelerated hatching of F. hepatica eggs in relation to control (non-exposed) group. The host snails, Lymnaea truncatula, were divided into three groups; those of groups I and II were infected with the miracidia of F. hepatica hatched from control egg culture, whereas those of group III were infected with miracidia hatched from eggs affected by ELFMF. Thereafter, snails of groups II and III were exposed to ELFMF for 53 days, whereas those of group I were not exposed. At day 14 post infection, a significant decrease was observed in the number of cocoons laid by snails of group III, compared with control. Also, significant mortality in group III snails was observed 42 days post infection. The increased mortality and a lower number of cocoons laid by group III snails have probably resulted from enhanced stimulation of metacercarial parthenogenetic reproduction in consequence of infecting the molluscs with miracidia reared under ELFMF.

  4. PCR-RFLP Analysis of 28 SrDNA for Specification of Fasciola gigantica (Cobbold, 1855) in the Infected Lymnaea auricularia (Linnaeus, 1785) Snails from Northwestern Iran.

    Science.gov (United States)

    Yakhchali, Mohammad; Malekzadeh-Viayeh, Reza; Imani-Baran, Abass

    2014-09-01

    Fasciolosis in livestock is a crucial concern in the globe, mainly due to its impact on human health. The aim of this study was to determine the rate of infection with Fasciola gigantica (Cobbold, 1855) larvae in the field-collected snails of Lymnaea auricularia (Linnaeus, 1785) from northwestern Iran using a molecular approach. A total of 6,759 pond snails were collected from 28 freshwater bodies in West Azarbaijan. PCR was performed to amplify a 618-bp fragment of the nuclear 28 SrRNA gene of Fasciola. The PCR products were digested by AvaII restriction enzyme to create restriction fragment length polymorphism (RFLP) patterns specific for the detection of F. gigantica. Of the total collected snails 496 (7.34 %) were L. auricularia, among which 4.64% (23 out of 496) were infected with a Fasciola species according to the PCR analysis. Only 2.22% (11 out of 496) of the infected snails were from the mountainous areas. The highest Fasciola infection rate recorded in the snails of a single site was 1.81% (9 out of 496 snails). Based on the RFLP pattern, F. gigantica accounted for 2.42% of the infection rates in the study sites. Application of PCR-RFLP was proven to be a useful approach for valid and robust detection of the infection with F. gigantica in its intermediate host snails. These findings may therefore be applicable for establishment of the control programs against dissemination of the infection in different regions.

  5. Infecção experimental de Physa cubensis Pfeiffer 1839 e Lymnaea columella com miracídios de Fasciola hepatica Linnaeus, 1758

    Directory of Open Access Journals (Sweden)

    Juliana SãoLuiz de Barros

    2002-01-01

    Full Text Available Foi realizada a infecção experimental de Physa cubensis Pfeiffer, 1839, com miracídios de Fasciola hepatica. Para tanto, cada um dos cem moluscos, selecionados para o experimento, foram infectados com três miracídeos. Alguns exemplares, escolhidos ao acaso, foram mantidos até o 60º dia para observação da emergência de formas larvais. Os moluscos restantes foram fixados após 0,5; 1; 2; 3; 4; 5; 24; 48; 72; 96; 120 e 144 horas de infecção, utilizando Raillet & Henry. O trabalho foi realizado de forma comparativa com Lymnaea columella. Os resultados demonstraram o desenvolvimento das formas larvais do trematódeo em L. columella e a presença de esporocistos em vários estágios de degeneração na região cefalopodal e na região do manto nos primeiros dias de infecção em P. cubensis.

  6. Alterações histológicas em Lymnaea columella provocadas pelo látex de Euphorbia splendens var. hislopii

    Directory of Open Access Journals (Sweden)

    Samanta Moura de Araújo

    2002-01-01

    Full Text Available Observações histológicas em moluscos da espécie Lymnaea columella foram realizadas para determinar a existência ou não de alterações provocadas pelo uso do látex de Euphorbia splendens var. hislopii. O experimento foi realizado de acordo com os métodos padronizados pela OMS. Cinqüenta exemplares de L. columella, com comprimento de concha de 6±1mm, foram submetidos a 200ml das soluções nas concentrações de 0,47µl/L; 0,76µl/L; 0,94µl/L e 1,51µl/L, durante 24 horas. Após o evento experimental, os moluscos foram colocados em solução de Raillet & Henry, para sacrifício e fixação. Os resultados demonstraram lesões caracterizadas por degeneração, necrose e acúmulo de líquido na glândula digestiva e no rim, em exemplares submetidos a concentrações a partir de 0,47 mil/L.

  7. Prevalence of Fasciola hepatica in the intermediate host Lymnaea truncatula detected by real time TaqMan PCR in populations from 70 Swiss farms with cattle husbandry.

    Science.gov (United States)

    Schweizer, G; Meli, M L; Torgerson, P R; Lutz, H; Deplazes, P; Braun, U

    2007-11-30

    Bovine fasciolosis is an economically important parasitic disease. Quantitative real time PCR was utilized to determine the prevalence of Fasciola hepatica in the snail intermediate host Lymnaea truncatula from 70 selected, infected Swiss cattle farms, and to gain information on the infection risk to the definitive host. Snails from 130 habitats (36 streams, 21 wells, 24 drainage ditches, 33 spring swamps, 14 reeds, 1 drainage shaft and 1 pond) originating from 71 dairy cow pastures, 39 pastures for young stock, 14 hay fields and 6 dry cow pastures were collected. Of these, 51 populations were found to be infected with F. hepatica. A total of 4733 snails were examined of which 331 were infected (7.0%). The numbers of snails collected from different sites ranged from 1 to 159 snails. Clustering of infection in snails was found on the farm of origin with a mixed logistic model with random effects. The risk of infection of L. truncatula with F. hepatica was significantly higher in populations originating from spring swamps, wells and reeds compared to populations from streams. In addition the risk of snail infection was significantly lower in populations collected in young stock and dry cow pastures compared to dairy cow pastures. The greater the population size collected from a habitat also increased the risk of an individual snail being infected.

  8. Comparative horizontal starch gel isoenzyme electrophoresis of Lymnaea (Bullastra) cumingiana (Pulmonata: Lymnaeidae) and related taxa in the Indo-Pacific region.

    Science.gov (United States)

    Monzon, R B; Thammapalerd, N; Kitikoon, V; Temcharoen, P; Sornmani, S; Viyanant, V

    1994-03-01

    Foot muscle tissue extracts from six lymnaeid species of the Indo-Pacific region [Lymnaea (Bullastra) cumingiana and L. (Radix) quadrasi from the Philippines, L. (R.) rubiginosa from Indonesia and Thailand, and L. (R.) viridis from Guam and Hong Kong] were subjected to horizontal starch gel isoenzyme electrophoresis and assayed for seven isoenzymes (AcP, AlP, CA, EST, LAP, CAT and GOT) to elucidate their taxonomic relationships. L. cumingiana exhibited banding patterns for EST, LAP and CAT uniquely different from the rest, thus supporting the hypothesis that it is a distinct species. Zymogram patterns for AlP, CA, EST and LAP attest to the close affinity between L. quadrasi and L. rubiginosa (Indonesia and Thailand). Minor differences suggest a closer relationship between the two geographical strains of L. rubiginosa than with L. quadrasi, lending support to the hypothesis that L. quadrasi is inseparable as a race or variety from the typical L. swinhoei Adams, which in turn is but a race of L. auricularia, which also encompasses L. rubiginosa. The two geographical strains of L. viridis from Guam and Hong Kong showed the greatest consistency with regards to similarity and congruence in banding patterns. Non-specific esterases (EST) were the most useful in distinguishing the six species from each other.

  9. A comparison of metal levels and antioxidant enzymes in freshwater snails, Lymnaea natalensis, exposed to sediment and water collected from Wright Dam and Lower Mguza Dam, Bulawayo, Zimbabwe.

    Science.gov (United States)

    Siwela, A H; Nyathi, C B; Naik, Y S

    2010-10-01

    We compared the bioaccumulation of lead (Pb), cadmium (Cd), zinc (Zn), copper (Cu), nickel (Ni) and iron (Fe) with antioxidant enzyme activity in tissues of the snails, Lymnaea natalensis, exposed to elements of two differently polluted dams. 45 snails were exposed to sediment and water collected from Wight Dam (reference) whilst another 45 snails were also exposed to sediment and water collected from Lower Mguza Dam (polluted dam). Except for Fe in sediment and Pb in water, metal concentrations were statistically higher in sediment and water collected from Lower Mguza Dam. Lead, Cd and Zn were two times higher in tissues of snails exposed to Lower Mguza Dam elements. On one hand, superoxide dismutase (SOD), diphosphotriphosphodiaphorase (DTD) and catalase (CAT) activities were significantly lower whilst malondialdehyde (MDA) levels were significantly higher in tissues of snails exposed to Lower Mguza Dam sediment and water. On the other hand, selenium-dependent glutathione peroxidase (Se-GPX) activity was significantly elevated in tissues of snails exposed to Lower Mguza Dam sediment and water. Snails exposed to Lower Mguza Dam elements seem to have responded to pollution by increasing CAT and Se-GPX specific activity in an effort to detoxify peroxides produced as a result of metal induced oxidative stress.

  10. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

    2010-03-15

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  11. Crystal structure of Lymnaea stagnalis AChBP complexed with the potent nAChR antagonist DHβE suggests a unique mode of antagonism.

    Directory of Open Access Journals (Sweden)

    Azadeh Shahsavar

    Full Text Available Nicotinic acetylcholine receptors (nAChRs are pentameric ligand-gated ion channels that belong to the Cys-loop receptor superfamily. These receptors are allosteric proteins that exist in different conformational states, including resting (closed, activated (open, and desensitized (closed states. The acetylcholine binding protein (AChBP is a structural homologue of the extracellular ligand-binding domain of nAChRs. In previous studies, the degree of the C-loop radial extension of AChBP has been assigned to different conformational states of nAChRs. It has been suggested that a closed C-loop is preferred for the active conformation of nAChRs in complex with agonists whereas an open C-loop reflects an antagonist-bound (closed state. In this work, we have determined the crystal structure of AChBP from the water snail Lymnaea stagnalis (Ls in complex with dihydro-β-erythroidine (DHβE, which is a potent competitive antagonist of nAChRs. The structure reveals that binding of DHβE to AChBP imposes closure of the C-loop as agonists, but also a shift perpendicular to previously observed C-loop movements. These observations suggest that DHβE may antagonize the receptor via a different mechanism compared to prototypical antagonists and toxins.

  12. Effects of in vitro and in vivo lead exposure on voltage-dependent calcium channels in central neurons of Lymnaea stagnalis.

    Science.gov (United States)

    Audesirk, G

    1987-01-01

    Currents through calcium channels of members of an identified cluster of neurons (B cells) in the pond snail Lymnaea stagnalis were studied under voltage clamp. The normal physiological saline was modified to maximize the visibility of voltage-dependent calcium currents and minimize contamination by other currents. Barium was used as the charge carrier for the calcium channels. Depolarizing voltage steps induce an inward current, the magnitude of which varies with the barium concentration. In brains taken from animals not exposed in vivo to lead, in vitro addition of lead acetate to the recording medium (0.25 to 14 microM) inhibits the barium current by 59 +/- 14% (mean +/- s.d.), in a manner that is independent of the lead concentration. The magnitude of the residual current still varies with the barium concentration. The voltage dependence of the current appears to be unaffected by lead. In contrast to some other calcium-channel blockers, such as cobalt, the inhibition of barium currents by in vitro lead exposure is irreversible, at least in short-term experiments. Contrary to expectations based on these in vitro results, barium currents in B cells of animals exposed to 5 microM lead for 6 to 12 weeks in vivo were approximately twice as large as barium currents in B cells from unexposed controls, when both were recorded in lead-free saline. It is possible that chronic in vivo lead exposure causes an increase in the number of calcium channels in these neurons.

  13. Contribución al conocimiento de la relación biológica entre Pythium sp. y raíces y nódulos radicales de Alnus acuminata H.B.K

    Directory of Open Access Journals (Sweden)

    Moncada María Amelia

    1987-12-01

    Full Text Available En los alrededores del embalse del Neusa (Cundinamarcal, se encontró un hongo del género Pythium asociado frecuentemente a los nódulos radicales del Aliso (Alnus acuminata, especie nativa de gran importancia en programas de reforestación, protección de cuencas y sistemas silviculturales, debido a su rápido crecimiento y al efecto mejorado que ejerce sobre las caracter ísticas nutricionales del suelo. La presente investigación tuvo por objeto conocer algunos aspectos de la relación biológica de Pythium sp, asociado a las raíces y nódulos radicales de Alnus acuminata. Se utilizó un diseño experimental completamente al azar,
    con tres repeticiones. Para evaluar la relación se inocularon
    plántulas de Aliso con una combinación de cuatro dosis del hongo Pvthium y cuatro dosis del Actinornvcete. La respuesta a los tratamientos fue registrada a los 20, 30, 40 y 60 días de inoculadas, mediante la determinación de peso seco, altura, número de hojas e infección radical de Alnus acuminata.
    Los resultados mostraron que el hongo asociado a los nódulos de Pythium silveticum y que las dosis altas de este inóculo
    causaron la muerte de las plántulas y las dosis menores disminuyeron peso seco, altura y número de hojas por planta. En la interacción del Actinomycete y el hongo, la presencia del primero disminuyó el efecto patogénico de Pythium silvaticum.

  14. Ripening of fruits of 'Dwarf Prata' banana (Musa acuminata x Musa balbisiana, AAB group)irradiated and treated with calcium carbide

    Energy Technology Data Exchange (ETDEWEB)

    Martineli, Maristella [Instituto de Quimica. Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro, RJ (Brazil); Coneglian, Regina C.C.; Vasconcellos, Marco A.S.; Silva, Eduardo, E-mail: rccconeg@ufrrj.br, E-mail: masv@ufrrj.br [Departamento de Fitotecnia. Instituto de Agronomia. Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil); Vital, Helio C., E-mail: vital@ctex.eb.br [Secao de Defesa Nuclear. Divisao de Defesa Quimica, Biologica e Nuclear. Centro Tecnologico do Exercito (CTEx), Guaratiba, Rio de Janeiro, RJ (Brazil)

    2011-07-01

    The competing effects resulting from the exposure of fruits of 'warf prata' banana (Musa acuminata x Musa balbisiana, AAB group) to gamma radiation and to calcium carbide have been investigated in this work. The fruits were harvested in a pre-climateric stage (green colored though physiologically developed) in the city of Jaiba, state of Minas Gerais, and gamma irradiated with doses of 0.25 or 0.50 kGy in a research irradiating facility at the Brazilian Army Technology Center (CTEx) in the city of Rio de Janeiro. Some samples were also exposed to calcium carbide for 32 hours in order to accelerate ripening. Quantitative estimates of peel color, disease index and fresh mass loss were performed for 9 days while the fruits were kept at an average temperature of 23 deg C. The analyses were performed in the Federal Rural University of Rio de Janeiro, located in the city of Seropedica. The following treatments or combination of processes have been tested: untreated (control); treated only with irradiation with doses of 0.25 kGy or 0.50 kGy; treated with irradiation with doses of 0.25 kGy or 0.50 kGy and then exposed to calcium carbide. The fruits treated solely with irradiation with 0.25 kGy exhibited a better response during the first days of storage, although their initial green coloration vanished with time. In addition, the fungi Colletotrichum musae and Lasidioplodia theobroma were detected in samples submitted to the combination of both processes. In contrast, such fungi were not observed in fruits that had only been exposed to 0.25 kGy and exhibited low disease indices. Also, 1-2 cm lesions were detected on fruits.(author)

  15. Effects of gamma irradiation followed by climatization on the quality of 'Prata' banana (Musa acuminata x Musa balbisiana, AAB)

    Energy Technology Data Exchange (ETDEWEB)

    Martineli, Maristella; Coneglian, Regina C.C.; Vasconcellos, Marco A.S.; Silva, Eduardo; Rocha, Janielio G.; Melo, Maruzanete P. [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ. Inst. de Agronomia (Brazil)], e-mail: maristellamartineli@yahoo.com.br; Vital, Helio C. [Centro Tecnologico do Exercito (CTEx), Rio de Janeiro, RJ (Brazil). Secao de Defesa Nuclear], e-mail: vital@ctex.eb.br

    2009-07-01

    Banana is a highly perishable climacteric fruit. In order to ensure fast and homogeneous ripening that will make its processing and commercialization easier, it is usually treated by climatization. On the other hand, irradiation is an interesting physical process capable of delaying ripening and extending the shelf life of fruits. This work investigated the competing effects of irradiation followed by climatization on the quality of 'Prata' banana (Musa acuminata x Musa balbisiana, AAB). All fruits were harvested in the preclimacteric stage, rinsed and stored at 27 deg C after being submitted to five different treatments. After hygienization, four out of five samples were exposed to gamma-ray at doses of 0.25 and 0.50 kGy. The unirradiated fruits were left for control and half of the irradiated samples were then climatized by exposure to CaC{sub 2}. Measurements of fresh mass loss, total soluble solids, peel coloration and disease index were performed on five different dates for up to nine days in order to monitor quality and the degree of ripening. It was found that high temperatures prevailing during climatization and storage accelerated maturation in all fruits in spite of the use of irradiation, with the control becoming ripe in 3 days only. In addition, based on the consistent results from the experiments performed, it can be concluded that irradiation at the doses tested was unable to overcome the maturation effects produced by climatization. However, the sole use of irradiation with 0.25 kGy yielded the lowest figures for fresh mass loss and disease index in the samples, thus becoming the most attractive among the treatments tested. (author)

  16. Highly efficient Agrobacterium-mediated transformation of embryogenic cell suspensions of Musa acuminata cv. Mas (AA) via a liquid co-cultivation system.

    Science.gov (United States)

    Huang, Xia; Huang, Xue-Lin; Xiao, Wang; Zhao, Jie-Tang; Dai, Xue-Mei; Chen, Yun-Feng; Li, Xiao-Ju

    2007-10-01

    A high efficient protocol of Agrobacterium-mediated transformation of Musa acuminata cv. Mas (AA), a major banana variety of the South East Asia region, was developed in this study. Male-flower-derived embryogenic cell suspensions (ECS) were co-cultivated in liquid medium with Agrobacterium strain EHA105 harboring a binary vector pCAMBIA2301 carrying nptII and gusA gene in the T-DNA. Depending upon conditions and duration of co-cultivation in liquid medium, 0-490 transgenic plants per 0.5 ml packed cell volume (PCV) of ECS were obtained. The optimum duration of inoculation was 2 h, and the highest transformation frequency was achieved when infected ECS were co-cultivated in liquid medium first for 12 h at 40 rpm and then for 156 h at 100 rpm on a rotary shaker. Co-cultivation for a shorter duration (72 h) or shaking constantly at 100 rpm at the same duration gave 1.6 and 1.8 folds lower transformation efficiency, respectively. No transgenic plants were obtained in parallel experiments carried on semi-solid media. Histochemical GUS assay and molecular analysis in several tissues of the transgenic plants demonstrated that foreign genes were stably integrated into the banana genome. Compared to semi-solid co-cultivation transformation in other banana species, it is remarkable that liquid co-cultivation was much more efficient for transformation of the Mas cultivar, and was at least 1 month faster for regenerating transgenic plants.

  17. Efecto del medio de soporte en la estabilidad biológica de dos cepas de Frankia aisladas de Alnus acuminata H. B. K.

    Directory of Open Access Journals (Sweden)

    Ana María Rey

    Full Text Available Alnus acuminata H. B. K. es una especie arbórea que puede ser incorporada en sistemas silvopastoriles, ya que tiene la capacidad de crecer en suelos marginados y contribuir a la conservación de la biodiversidad y al mejoramiento del suelo; lo cual se relaciona con la incorporación de hojarasca, el efecto de sombra, la retención de humedad, el reciclaje de nutrientes y la fijación de nitrógeno atmosférico, debido a su asociación simbiótica con el actinomiceto Frankia. La utilización de este como inoculante es una tecnología que requiere un profundo análisis de su comportamiento en condiciones controladas. Por otra parte, para la comercialización de los biofertilizantes es importante conservar su calidad el mayor tiempo posible, de lo cual depende la aceptación del producto en la cadena productiva. Por ello, se realizó una investigación con el objetivo de evaluar la estabilidad biológica de las cepas nativas de Frankia (Aan17 y Aac49 con diferentes proporciones sustrato:cepa, así como el efecto del alamacenamiento a 4 °C. Las cepas fueron tolerantes a los cambios del pH y al almacenamiento en condiciones de refrigeración. Se concluye que los inoculantes se deben almacenar a 4 °C durante 120 días, con una proporción de 80:20 (inoculante:sustrato en Aan17 y 60:40 en Aac49. En estos sustratos la proteína microbial se mantuvo por encima de 0,65 mg/mL en Aan17 y 0,7 mg/mL en Aac49.

  18. Activation of salicylic acid metabolism and signal transduction can enhance resistance to Fusarium wilt in banana (Musa acuminata L. AAA group, cv. Cavendish).

    Science.gov (United States)

    Wang, Zhuo; Jia, Caihong; Li, Jingyang; Huang, Suzhen; Xu, Biyu; Jin, Zhiqiang

    2015-01-01

    Fusarium wilt caused by the fungus Fusarium oxysporum f. sp. cubens (Foc) is the most serious disease that attacks banana plants. Salicylic acid (SA) can play a key role in plant-microbe interactions. Our study is the first to examine the role of SA in conferring resistance to Foc TR4 in banana (Musa acuminata L. AAA group, cv. Cavendish), which is the greatest commercial importance cultivar in Musa. We used quantitative real-time reverse polymerase chain reaction (qRT-PCR) to analyze the expression profiles of 45 genes related to SA biosynthesis and downstream signaling pathways in a susceptible banana cultivar (cv. Cavendish) and a resistant banana cultivar (cv. Nongke No. 1) inoculated with Foc TR4. The expression of genes involved in SA biosynthesis and downstream signaling pathways was suppressed in a susceptible cultivar and activated in a resistant cultivar. The SA levels in each treatment arm were measured using high-performance liquid chromatography. SA levels were decreased in the susceptible cultivar and increased in the resistant cultivar. Finally, we examined the contribution of exogenous SA to Foc TR4 resistance in susceptible banana plants. The expression of genes involved in SA biosynthesis and signal transduction pathways as well as SA levels were significantly increased. The results suggest that one reason for banana susceptibility to Foc TR4 is that expression of genes involved in SA biosynthesis and SA levels are suppressed and that the induced resistance observed in banana against Foc TR4 might be a case of salicylic acid-dependent systemic acquired resistance.

  19. EFEITO DO PERÍODO DE ARMAZENAMENTO SOBRE A BROTAÇÃO DE MUDAS DE BANANEIRA DO CULTIVAR NANICÃO (Musa acuminata AAA EFFECT OF STORAGE TIME IN THE BUDDING OF BANANA ROOTSTOCK CULTIVAR NANICÃO (Musa acuminata AAA

    Directory of Open Access Journals (Sweden)

    Ronaldo Veloso Naves

    2007-09-01

    Full Text Available

    A grande procura atual de mudas de bananeiras do cultivar Nanicão (Musa acuminata AAA em Goiás, principalmente na região do Mato Grosso Goiano, tem forçado o transporte de mudas a grandes distâncias. A maioria destas mudas são transportadas sob a forma de pedaços de rizoma com aproximadamente 1 Kg. Tem-se observado uma falha acima do previsto quando se utiliza este tipo de muda. O presente trabalho foi realizado para determinar o efeito do período de armazenamento sobre a brotação deste cultivar. Com base nos resultados concluiu-se que no período de armazenamento estudado (45 dias praticamente não houve diferença na brotação das mudas. Somente aquelas armazenadas por 5 (cinco semanas apresentaram inexplicavelmente um índice baixo de pegamento.

    Because of the tremendous current demand for Nanicão (Musa acuminata AAA banana shoots in the state of Goiás, notably in the “Mato Grosso Goiano” area, shoots have had to be imported from far away. The greater part of these shoots are transported in rootstalk form. Each rootstalk weighs approximately 1 Kg. A larger portion of these shoots than been anticipated, are defective. The present study was made to determine the effect of storage time on the budding of this particular banana rootstalk. The results of the experiment show that during the period of storage, forty-two (42 days, that was studied, there was almost no difference in budding among the rootstalks. Only those which were stored for five (5 weeks showed, unexplainably, a low budding index.

  20. Growth inhibition in early life-stage tests predicts full life-cycle toxicity effects of lead in the freshwater pulmonate snail, Lymnaea stagnalis.

    Science.gov (United States)

    Munley, Kathleen M; Brix, Kevin V; Panlilio, Jennifer; Deforest, David K; Grosell, Martin

    2013-03-15

    The freshwater pulmonate snail, Lymnaea stagnalis, is the most sensitive freshwater organism tested to date for several metals (Co, Cu, Pb, Ni) based on 28 d early life-stage (ELS) tests in which growth was the most sensitive endpoint. The United States Environmental Protection Agency (USEPA) has expressed concern that growth in 28 d ELS tests with mollusks may overpredict toxicity because of the potential for recovery in a full life-cycle (LC) test. Consequently, the USEPA only accepts the survival endpoint for these tests in establishing water quality criteria (WQC). To address this concern, the current study aimed to test the sensitivity of L. stagnalis to Pb in a 56 d full LC test evaluating survival, growth, reproductive and embryonic growth endpoints and compare the estimated effect levels to those established using the 28 d ELS test design. The most sensitive endpoints in this study were 28 d growth and 56 d egg mass production, both with a NOEC of Snails exposed to 1.0 and 2.7 μg L(-1) Pb showed full and partial recovery from growth inhibition between 28 and 56 d. While this recovery supports the USEPA's concern about the 28 d growth endpoint; considering the reproductive lifespan of L. stagnalis and the recovery dose-response, we conclude that the 28 d growth endpoint will be within a factor of 3 of full LC endpoints. This is consistent with the level of precision previously determined for fish ELS tests, which the USEPA accepts for WQC derivation, and suggests that tests using 28 d ELS growth endpoint for L. stagnalis may be acceptable for inclusion in WQC derivation.

  1. Development of partial life-cycle experiments to assess the effects of endocrine disruptors on the freshwater gastropod Lymnaea stagnalis: a case-study with vinclozolin.

    Science.gov (United States)

    Ducrot, Virginie; Teixeira-Alves, Mickaël; Lopes, Christelle; Delignette-Muller, Marie-Laure; Charles, Sandrine; Lagadic, Laurent

    2010-10-01

    Long-term effects of endocrine disruptors (EDs) on aquatic invertebrates remain difficult to assess, mainly due to the lack of appropriate sensitive toxicity test methods and relevant data analysis procedures. This study aimed at identifying windows of sensitivity to EDs along the life-cycle of the freshwater snail Lymnaea stagnalis, a candidate species for the development of forthcoming test guidelines. Juveniles, sub-adults, young adults and adults were exposed for 21 days to the fungicide vinclozolin (VZ). Survival, growth, onset of reproduction, fertility and fecundity were monitored weekly. Data were analyzed using standard statistical analysis procedures and mixed-effect models. No deleterious effect on survival and growth occurred in snails exposed to VZ at environmentally relevant concentrations. A significant impairment of the male function occurred in young adults, leading to infertility at concentrations exceeding 0.025 μg/L. Furthermore, fecundity was impaired in adults exposed to concentrations exceeding 25 μg/L. Biological responses depended on VZ concentration, exposure duration and on their interaction, leading to complex response patterns. The use of a standard statistical approach to analyze those data led to underestimation of VZ effects on reproduction, whereas effects could reliably be analyzed by mixed-effect models. L. stagnalis may be among the most sensitive invertebrate species to VZ, a 21-day reproduction test allowing the detection of deleterious effects at environmentally relevant concentrations of the fungicide. These results thus reinforce the relevance of L. stagnalis as a good candidate species for the development of guidelines devoted to the risk assessment of EDs.

  2. PCR-RFLP Analysis of 28 SrDNA for Specification of Fasciola gigantica (Cobbold, 1855 in the Infected Lymnaea auricularia (Linnaeus, 1785 Snails from Northwestern Iran.

    Directory of Open Access Journals (Sweden)

    Mohammad Yakhchali

    2014-09-01

    Full Text Available Fasciolosis in livestock is a crucial concern in the globe, mainly due to its impact on human health. The aim of this study was to determine the rate of infection with Fasciola gigantica (Cobbold, 1855 larvae in the field-collected snails of Lymnaea auricularia (Linnaeus, 1785 from northwestern Iran using a molecular approach.A total of 6,759 pond snails were collected from 28 freshwater bodies in West Azarbaijan. PCR was performed to amplify a 618-bp fragment of the nuclear 28 SrRNA gene of Fasciola. The PCR products were digested by AvaII restriction enzyme to create restriction fragment length polymorphism (RFLP patterns specific for the detection of F. gigantica.Of the total collected snails 496 (7.34 % were L. auricularia, among which 4.64% (23 out of 496 were infected with a Fasciola species according to the PCR analysis. Only 2.22% (11 out of 496 of the infected snails were from the mountainous areas. The highest Fasciola infection rate recorded in the snails of a single site was 1.81% (9 out of 496 snails. Based on the RFLP pattern, F. gigantica accounted for 2.42% of the infection rates in the study sites.Application of PCR-RFLP was proven to be a useful approach for valid and robust detection of the infection with F. gigantica in its intermediate host snails. These findings may therefore be applicable for establishment of the control programs against dissemination of the infection in different regions.

  3. Impact of various salts on biology, physiology and tissue soluble proteins (SDS-PAGE) of Lymnaea natalensis and their infection with Fasciola gigantica miracidia.

    Science.gov (United States)

    Mahmoud, Moamena Bayoumi

    2006-08-01

    The effect of sublethal concentrations of magnesium sulphate (MgSo4), sodium chloride (NaCl), potassium chloride (KCl), calcium sulphate (CaSo4) and sodium carbonate (Na2Co3) on survival, fecundity, Lymnaea natalensis infection with Fasciola gigantica miracidia and the activities of certain enzymes in tissue homogenate of these snails were evaluated. Tissue soluble proteins of the snails were analyzed by SDS-PAGE. The results indicated that Na2Co3 was more toxic to L. natalensis than the other salts. Egg laying capacity was declined after two weeks of continuous exposure to Na2Co3 (0.38 eggs/snail/week) compared to (13.85 eggs/snail/week) for controls. The lowest infection rate was among snails exposed to MgSo4 (31.25%) with a significant variation from controls (64.28%). The salts supperssed cercarial production of infected snails (14.6 metacercariae/ snail/stimulant) at MgSo4 compared to (59.3 metacercariae/ snail/stimulant) for controls. The maintenance of L. natalensis in the salts solutions for four successive weeks reduced the total protein content in their tissues (13.2 mg/g) at Na2Co3 (100 ppm) compared to (21.47 mg/g) for controls. The activity of alkaline phosphatase was significantly reduced in treated snails than controls. The electrophoretic data revealed a common band between controls and treated snails with a molecular weight of 79.42 to 80.55 kDa. There were bands in treated snails but not in controls (41.2 & 45 kDa). A band was detected for snails treated with each salt but not with controls or the other treated groups (28.68 kDa at NaCl, 100.75 kDa at CaSo4 & 205 Kda at KCl).

  4. Calicophoron daubneyi and Fasciola hepatica: characteristics of natural and experimental co-infections of these digeneans in the snail Lymnaea glabra.

    Science.gov (United States)

    Vignoles, P; Titi, A; Mekroud, A; Rondelaud, D; Dreyfuss, G

    2017-01-01

    A retrospective study on different Lymnaea glabra samples collected from central France between 1993 and 2010 was carried out to determine the prevalence of natural co-infections with Calicophoron daubneyi and Fasciola hepatica, and to specify the composition of redial burdens. Experimental infections of L. glabra performed during the same period of time were also analysed to study metacercarial production of each digenean in co-infected snails. Controls were naturally or experimentally co-infected Galba truncatula. In natural co-infections, prevalence was 0.7% in L. glabra (186/25,128) and 0.4% in G. truncatula (137/31,345). Low redial burdens were found in these snails, with F. hepatica rediae significantly more numerous in L. glabra than in G. truncatula (7.5 per snail instead of 5.2). In contrast, the total numbers of C. daubneyi rediae in both lymnaeids were close to each other (4.3 and 3.0 rediae, respectively). In experimentally co-infected groups, prevalence was greater in G. truncatula than in the other lymnaeid (6.3% instead of 3.0%). Significantly shorter patent periods and lower metacercarial production for each digenean were noted in L. glabra than in G. truncatula. However, in both lymnaeids, the two types of cercariae were released during the same shedding waves and several peaks during the patent period were synchronous. In spite of a greater shell height for L. glabra, metacercarial production of both digeneans in co-infected snails was lower than that in G. truncatula, thus indicating a still incomplete adaptation between these French L. glabra and both parasites.

  5. Fasciola hepatica and Paramphistomum daubneyi: changes in prevalences of natural infections in cattle and in Lymnaea truncatula from central France over the past 12 years.

    Science.gov (United States)

    Mage, Christian; Bourgne, Henri; Toullieu, Jean-Marc; Rondelaud, Daniel; Dreyfuss, Gilles

    2002-01-01

    A retrospective study was carried out over a 10- to 12-year period to analyse the changes in prevalences of natural fasciolosis and paramphistomosis among cattle and snails in central France, and to determine the causes which had induced these changes. The prevalences of natural fasciolosis in cattle increased from 1990 to 1993 (13.6% to 25.2%) and diminished afterwards up to 1999 (at 12.6%). Those of natural paramphistomosis showed a progressive increase between 1990 and 1999 (from 5.2 to 44.7%). The prevalences of natural infections and the numbers of free rediae counted in the snails (Lymnaea truncatula) infected with F. hepatica did not show any significant variations over time. By contrast, the prevalences of natural paramphistomosis in snails significantly increased from 1989 to 1996 and remained afterwards in the same range of values (3.7-5.3%), while the number of free rediae significantly increased up to 2000 (from a mean of 6.5 to 13.8 rediae per infected snail, respectively). Three hypotheses may explain the increase of paramphistomosis in cattle and snails: a better quality of diagnosis for the detection of P. daubneyi eggs in veterinary analysis laboratories, the use of specific molecules in the treatment of cattle fasciolosis since 1993, and the lack of an effective treatment up to now against cattle paramphistomosis. Since the objective of most farmers in central France is to obtain the highest antiparasitic efficiency with a single treatment of cattle per year, it is reasonable to assume that the prevalence of bovine paramphistomosis will continue to increase in the future.

  6. Accumulation and detoxication responses of the gastropod Lymnaea stagnalis to single and combined exposures to natural (cyanobacteria) and anthropogenic (the herbicide RoundUp(®) Flash) stressors.

    Science.gov (United States)

    Lance, Emilie; Desprat, Julia; Holbech, Bente Frost; Gérard, Claudia; Bormans, Myriam; Lawton, Linda A; Edwards, Christine; Wiegand, Claudia

    2016-08-01

    Freshwater gastropods are increasingly exposed to multiple stressors in the field such as the herbicide glyphosate in Roundup formulations and cyanobacterial blooms either producing or not producing microcystins (MCs), potentially leading to interacting effects. Here, the responses of Lymnaea stagnalis to a 21-day exposure to non-MC or MC-producing (33μgL(-1)) Planktothrix agardhii alone or in combination with the commercial formulation RoundUp(®) Flash at a concentration of 1μgL(-1) glyphosate, followed by 14days of depuration, were studied via i) accumulation of free and bound MCs in tissues, and ii) activities of anti-oxidant (catalase CAT) and biotransformation (glutathione-S-transferase GST) enzymes. During the intoxication, the cyanobacterial exposure induced an early increase of CAT activity, independently of the MC content, probably related to the production of secondary cyanobacterial metabolites. The GST activity was induced by RoundUp(®) Flash alone or in combination with non MC-producing cyanobacteria, but was inhibited by MC-producing cyanobacteria with or without RoundUp(®) Flash. Moreover, MC accumulation in L. stagnalis was 3.2 times increased when snails were concomitantly exposed to MC-producing cyanobacteria with RoundUp(®), suggesting interacting effects of MCs on biotransformation processes. The potent inhibition of detoxication systems by MCs and RoundUp(®) Flash was reversible during the depuration, during which CAT and GST activities were significantly higher in snails previously exposed to MC-producing cyanobacteria with or without RoundUp(®) Flash than in other conditions, probably related to the oxidative stress caused by accumulated MCs remaining in tissues. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Impact of microcystin-producing cyanobacteria on reproductive success of Lymnaea stagnalis (Gastropoda, Pulmonata) and predicted consequences at the population level.

    Science.gov (United States)

    Lance, Emilie; Alonzo, Frederic; Tanguy, Marion; Gérard, Claudia; Bormans, Myriam

    2011-06-01

    Our previous studies showed that microcystin (MC)-accumulation in the gastropod Lymnaea stagnalis and effects on life-history traits (survival, growth, and fecundity) varied according to age, exposure pathway (MC-producing cyanobacteria or dissolved MC), and presence or not of additional non-toxic food. This study investigated effects of exposure to MC-producing cyanobacteria or to dissolved MC of parent and of parent and egg masses of L. stagnalis on hatching success, duration of embryonic development and neonate survival. Secondly, the potential impact of MC-producing cyanobacterial proliferations (blooms) on L. stagnalis population growth, depending on bloom frequencies and recovery duration of life traits after exposure, was evaluated using a modelling approach. Experimental results showed that embryonic development was shortened in case of parent exposure to toxic cyanobacteria. Parent and eggs exposure to dissolved MC extended embryonic development and reduced hatching percentage, suggesting a permeability of egg masses to MC. Whatever exposure, neonate survival was reduced. Neonates exposed to cyanobacteria accumulated MCs 24 h after hatching, suggesting very early cyanobacteria ingestion. Modelling results showed that L. stagnalis population growth was influenced by the recovery time of life-history traits after exposure. When setting the latest at 6 weeks according to previous experiments, a frequency of one to four blooms per year strongly affected population dynamics and induced up to a 80-weeks delay compared to control in time required for populations to grow from 1 to 1000 individuals. Results are discussed in terms of impact of intoxication pathways on parents, eggs and neonates, and on population dynamics of L. stagnalis.

  8. UV-B辐射增强对喜树叶片色素含量和形态结构的影响%Effects of Enhanced UV-B Radiation on Leaf Morphology and Structure and Pigment Contents of Camptotheca acuminata

    Institute of Scientific and Technical Information of China (English)

    王海霞; 刘文哲

    2011-01-01

    Effects of enhanced UV-B radiation (5.0 μW/cm2) on leaf morphology and structure and the contents of photosynthetic pigment and flavonoids in Camptotheca acuminata were investigated in pots experiment. The results showed as follows: (1)The contents of chlorophyll and flavonoids, the ratio of chlorophyll a to chlorophyll b (Chla/Chlb) increased in earlier stage and decreased in later stage under enhanced UV-B radiation compared with which growing under natural light, while carotenoids content increased constantly. (2)The leaf shape asymmetry occurred because of skewing, the photosynthetic pigments distribution in leaves were uneven, the adaxial epidermis was thickened, the chloroplast structure was distorted. (3)Further studies with scanning electron microscope (SEM) observation revealed that the number of epidermal hairs and glandular trichomes increased, glandular trichomes turned shorter and wider, stomatal apparatus in abaxial epidermis were coverd by waxy and aperture decreased. Therefore, the author considered that the UV-B radiation treatment could start the defense system of Camptotheca acuminata seedling, but finally it still could do great harm to the membrane system, membrane lipid peroxidation appeared.%笔者通过盆栽试验,以自然辐射为对照,研究人工增强UV-B辐射下(5.0μW/cm2)喜树叶片中光合色素、类黄酮化合物含量及叶片形态结构的变化.试验结果表明:(1)UV-B辐射增强导致喜树叶片总叶绿素含量、叶绿素a与叶绿素b的比值(Chla/Chlb)及类黄酮类化合物含量上升,并随后呈下降趋势,而类胡萝卜素含量持续升高;(2)UV-B辐射增强导致叶形呈不对称状,色素分布异常,并伴有上表皮增厚、栅栏组织细胞增多、叶绿体扭曲的变化;(3)UV-B辐射增强使喜树叶片上表皮蜡质层增厚,表皮毛和腺毛数量增多,腺毛变短而粗;下表皮气孔被蜡质覆盖,开度变小.因此,增强UV-B辐射处理后,喜树幼苗体内的防御系统

  9. Impact of the redox-cycling herbicide diquat on transcript expression and antioxidant enzymatic activities of the freshwater snail Lymnaea stagnalis

    Energy Technology Data Exchange (ETDEWEB)

    Bouetard, Anthony, E-mail: anthony.bouetard@rennes.inra.fr [INRA, UMR INRA-Agrocampus Ouest ESE 0985, Equipe Ecotoxicologie et Qualite des Milieux Aquatiques, 65 rue de Saint-Brieuc, 35042 Rennes cedex (France); Besnard, Anne-Laure; Vassaux, Daniele; Lagadic, Laurent; Coutellec, Marie-Agnes [INRA, UMR INRA-Agrocampus Ouest ESE 0985, Equipe Ecotoxicologie et Qualite des Milieux Aquatiques, 65 rue de Saint-Brieuc, 35042 Rennes cedex (France)

    2013-01-15

    The presence of pesticides in the environment results in potential unwanted effects on non-target species. Freshwater organisms inhabiting water bodies adjacent to agricultural areas, such as ditches, ponds and marshes, are good models to test such effects as various pesticides may reach these habitats through several ways, including aerial drift, run-off, and drainage. Diquat is a non-selective herbicide used for crop protection or for weed control in such water bodies. In this study, we investigated the effects of diquat on a widely spread aquatic invertebrate, the holarctic freshwater snail Lymnaea stagnalis. Due to the known redox-cycling properties of diquat, we studied transcript expression and enzymatic activities relative to oxidative and general stress in the haemolymph and gonado-digestive complex (GDC). As diquat is not persistent, snails were exposed for short times (5, 24, and 48 h) to ecologically relevant concentrations (22.2, 44.4, and 222.2 {mu}g l{sup -1}) of diquat dibromide. RT-qPCR was used to quantify the transcription of genes encoding catalase (cat), a cytosolic superoxide dismutase (Cu/Zn-sod), a selenium-dependent glutathione peroxidase (gpx), a glutathione reductase (gred), the retinoid X receptor (rxr), two heat shock proteins (hsp40 and hsp70), cortactin (cor) and the two ribosomal genes r18S and r28s. Enzymatic activities of SOD, Gpx, Gred and glutathione S-transferase (GST) were investigated in the GDC using spectrophoto/fluorometric methods. Opposite trends were obtained in the haemolymph depending on the herbicide concentration. At the lowest concentration, effects were mainly observed after 24 h of exposure, with over-transcription of cor, hsp40, rxr, and sod, whereas higher concentrations down-regulated the expression of most of the studied transcripts, especially after 48 h of exposure. In the GDC, earlier responses were observed and the fold-change magnitude was generally much higher: transcription of all target genes increased

  10. Efeito moluscicida do óleo essencial de Cymbopogon winterianus Jowitt (Poaceae sobre Lymnaea columella (Say, 1817 e Biomphalaria tenagophila(D’Orbigny, 1835

    Directory of Open Access Journals (Sweden)

    A.V. COSTA

    2015-01-01

    Full Text Available RESUMO O uso das substâncias moluscicidas convencionais no controle de planorbídeos vetores constitui-se uma importante ferramenta no combate da fasciolose hepática e esquistossomose. Sendo, portanto, de extrema relevância para a pecuária e para os serviços de Vigilância Epidemiológica. Por outro lado, a seleção de caramujos resistentes a tais substâncias e sua baixa seletividade estimulam a busca por novas substâncias. Neste sentido, o presente trabalho foi desenvolvido para avaliar o efeito do óleo essencial de Cymbopogon winterianusJowitt sobre Lymnaea columella e Biomphalaria tenagophila, hospedeiros intermediários de Fasciola hepatica e esquistossomose mansônica, respectivamente. O óleo essencial foi extraído a partir de folhas frescas utilizando o sistema Clevenger. A análise qualitativa foi realizada por meio de cromatografia gasosa acoplada a espectrometria de massas (CG/EM e a quantificação dos constituintes presentes no óleo foi determinada por cromatografia gasosa acoplada ao detector de ionização de chama (CG/DIC. O efeito moluscicida foi avaliado utilizando seis moluscos de cada espécie e o óleo essencial de C. winterianus nas concentrações finais de 10, 20, 30, 40, 60, 80 e 100 ppm. A análise por cromatografia gasosa do óleo essencial possibilitou a identificação dos componentes majoritários geraniol (28,62%, citronelal (23,62% e citronelol (17,10%. Os valores de DL100 e DL50para os moluscos das espécies L. columella e B. tenagophila foram, respectivamente, 60 e 40 ppm; 80 ppm e 60 ppm. O óleo de Cymbopogon winterianus demonstrou-se uma alternativa promissora para o controle dos moluscos, sendo a espécie L. columella mais sensível ao mesmo.

  11. Molecular characterisation of Galba truncatula, Lymnaea neotropica and L. schirazensis from Cajamarca, Peru and their potential role in transmission of human and animal fascioliasis.

    Science.gov (United States)

    Bargues, M Dolores; Artigas, Patricio; Khoubbane, Messaoud; Ortiz, Pedro; Naquira, Cesar; Mas-Coma, Santiago

    2012-08-15

    Human and animal fascioliasis is emerging in many world regions, among which Andean countries constitute the largest regional hot spot and Peru the country presenting more human endemic areas. A survey was undertaken on the lymnaeid snails inhabiting the hyperendemic area of Cajamarca, where human prevalences are the highest known among the areas presenting a "valley transmission pattern", to establish which species are present, genetically characterise their populations by comparison with other human endemic areas, and discuss which ones have transmission capacity and their potential implications with human and animal infection. Therefore, ribosomal DNA ITS-2 and ITS-1, and mitochondrial DNA 16S and cox1 were sequenced by the dideoxy chain-termination method. Results indicate the presence of three, morphologically similar, small lymnaeid species belonging to the Galba/Fossaria group: Galba truncatula, Lymnaea neotropica and L. schirazensis. Only one combined haplotype for each species was found. The ITS-1, 16S and cox1 haplotypes of G. truncatula are new. No new haplotypes were found in the other two species. This scenario changes previous knowledge, in which only L. viator (= L. viatrix) was mentioned. Galba truncatula appears to be the most abundant, with high population densities and evident anthropophyly including usual presence in human neighbourhood. Infection by Fasciola hepatica larval stages were molecularly confirmed in two populations of this species. The nearness between G. truncatula populations presenting liver fluke infection and both human settings and schools for children, together with the absence of populations of other lymnaeid species in the locality, suggest a direct relationship with human infection. The geographical overlap of three lymnaeid species poses problems for epidemiological studies and control action. First, a problem in classifying lymnaeid specimens in both field and laboratory activities, given their transmission capacity

  12. Effects of chronic waterborne nickel exposure on growth, ion homeostasis, acid-base balance, and nickel uptake in the freshwater pulmonate snail, Lymnaea stagnalis.

    Science.gov (United States)

    Niyogi, Som; Brix, Kevin V; Grosell, Martin

    2014-05-01

    The freshwater pulmonate snail, Lymnaea stagnalis, is the most sensitive aquatic organism tested to date for Ni. We undertook a series of experiments to investigate the underlying mechanism(s) for this observed hypersensitivity. Consistent with previous experiments, juvenile snail growth in a 21-day exposure was reduced by 48% relative to the control when exposed to 1.3 μg l(-1) Ni (EC20 less than the lowest concentration tested). Ca(2+) homeostasis was significantly disrupted by Ni exposure as demonstrated by reductions in net Ca(2+) uptake, and reductions in Ca(2+) concentrations in the hemolymph and soft tissues. We also observed reduced soft tissue [Mg(2+)]. Snails underwent a significant alkalosis with hemolymph pH increasing from 8.1 to 8.3 and hemolymph TCO2 increasing from 19 to 22 mM in control versus Ni-exposed snails, respectively. Unlike in previous studies with Co and Pb, snail feeding rates were found to be unaffected by Ni at the end of the exposure. Snails accumulated Ni in the soft tissue in a concentration-dependent manner, and Ni uptake experiments with (63)Ni revealed a biphasic uptake profile - a saturable high affinity component at low exposure concentrations (36-189 nM) and a linear component at the high exposure concentrations (189-1,897 nM). The high affinity transport system had an apparent Km of 89 nM Ni(2+) and Vmax of 2.4 nmol g(-1)h(-1). This equates to a logK of 7.1, significantly higher than logK's (2.6-5.2) for any other aquatic organisms evaluated to date, which will have implications for Biotic Ligand Model development. Finally, pharmacological inhibitors that block Ca(2+) uptake pathways in snails did not inhibit Ni uptake, suggesting that the uptake of Ni does not occur via Ca(2+) uptake pathways. As with Cu and Pb, the exact mechanism for the significant disruption in Ca(2+) homeostasis and reduction in juvenile snail growth remains unknown.

  13. 波叶海菜花种子储存条件与萌发初步研究%Preliminary Studies on Characteristics of Seed Germination and Storage Condition of Ottelia acuminata var.crispa

    Institute of Scientific and Technical Information of China (English)

    王斌

    2011-01-01

    研究了储藏条件和萌发温度对波叶海菜花种子萌发的影响.将波叶海菜花新鲜和风干种子分别在0、4、10℃及15℃下贮藏120 d,在25℃下进行萌发试验.结果表明,风干的种子全部不萌发.新鲜种子在10℃及4℃储藏,种子萌发率高,没有显著差异;而在0℃下储藏的种子萌发率显著降低.并在15、20、25、30℃下对波叶海菜花进行萌发试验,发现种子在所有温度条件下均有较高的萌发率(>90%);温度越高萌发时滞越短,萌发持续时间越短.基质对种子萌发没有显著影响.%The effects of storage condition and germination temperature of Ottelia acuminata var. Crispaseeds were studied in order to find suitable store ways and germination condition. The author examined the germination after 120 days of dry and miost storage under 0 ℃,4 ℃, 10 ℃ and 15 ℃ respectively. The result showed that germination of O. Acuminata var. Crispa was affected by storage conditions remarkably and the optimal range was 10 ℃ to 4℃ , while the germination percentage of seeds was lower under 0 ℃. The seeds did not germinate when the duration of storage was dry. At the same time,the author tested the germination of seeds of Otteliaacuminata under 15 ℃ ,20 ℃ ,25 ℃ and 30℃. The germination could germinate in an abroad range of temperature. Seeds of O. Acuminata var. Crispa showed higher germination under 15 ℃ to 30 ℃ regions. The germination speed increased gradually with rising of temperature. Substance had no significant effect on percentage germination.

  14. Electronics and electronic systems

    CERN Document Server

    Olsen, George H

    1987-01-01

    Electronics and Electronic Systems explores the significant developments in the field of electronics and electronic devices. This book is organized into three parts encompassing 11 chapters that discuss the fundamental circuit theory and the principles of analog and digital electronics. This book deals first with the passive components of electronic systems, such as resistors, capacitors, and inductors. These topics are followed by a discussion on the analysis of electronic circuits, which involves three ways, namely, the actual circuit, graphical techniques, and rule of thumb. The remaining p

  15. Camptothecin and 10-Hydroxycamptothecin Accumulate Differentially Under Specific Developmental Control in Camptotheca acuminata%喜树碱和10-羟基喜树碱受喜树生长发育调控的不同特点

    Institute of Scientific and Technical Information of China (English)

    祖元刚; 唐中华; 于景华; 赵春建

    2003-01-01

    Camptotheca acuminata Decaisne is a tree unique to China, producing terpenoid indole alkaloid (TIA), camptothecin (CPT), and 10-hydroxycamptothecin (HCPT), which possesses strong anti-cancer bioactivity. The dynamics of HCPT and CPT during seed maturation, seed germination, postgerminative development and daily growth were measured by High Performance Liquid Chromatography (HPLC). This article provides some evidence for presenting the theory that each characteristic of HCPT and CPT accumulation is under developmental regulation and then attempt to elucidate the metabolic relationships between them. HCPT accumulates particularly in young tissues and organs and is relatively unstable, while the distribution of CPT is more ubiquitous and stable. Their different distribution properties suggest that HCPT and CPT are differentially regulated and play distinct roles during development.%为了揭示喜树碱(camptothecin, CPT)和10-羟基喜树碱(10-hydroxycamptothecin, HCPT)在喜树(Camptotheca acuminata Decaisne)体内代谢的生理调控机制及这两种类似物之间的关系和作用,运用高效液相色谱技术对种子形成、成熟、萌发和幼苗生长过程中喜树碱和10-羟基喜树碱的代谢动态进行了全面的研究.结果表明,喜树碱相对稳定地存在于成熟和幼嫩的组织中;10-羟基喜树碱特异性地积累在乳熟期的种子、种芽的子叶、幼嫩的真叶等幼嫩组织中,随着组织的进一步发育和成熟,其含量快速减少,成熟组织中积累极少,并且这两种生物碱的代谢在时间和数量上都呈现出相互消长的特点,由此推断,这两种生物碱不同程度地受生长发育调控的特点可能与喜树的化学防御策略密切相关,并且,它们之间可以相互转化以充分利用有限的氮素资源.

  16. Cloning and Sequence Analysis of Chalcone Isomerase Gene (CHI) from Brunfelsia acuminata Flowers%鸳鸯茉莉查尔酮异构酶基因(CHI)cDNA的克隆与生物信息学分析

    Institute of Scientific and Technical Information of China (English)

    曹玉婷; 邱栋梁

    2012-01-01

    采用RT-PCR与RACE技术克隆了鸳鸯茉莉(Brunfelsia acuminata)花瓣中查尔酮异构酶基因(CHI)的全长cDNA,GenBank登录号为JN887637.该基因全长1051 bp,含有1个792 bp的开放阅读框,编码263个氨基酸,为不稳定蛋白.对保守区功能区的分析,推导CHI蛋白具有查尔酮超级家族的保守结构域,二级结构预测显示其主要以α螺旋和β折叠为主.氨基酸同源性分析表明,鸳鸯茉莉CHI蛋白与矮牵牛(Petunia hybrida)、金花茶(Camellia nitidissima)、甜樱桃(Prunus avium)、芍药(Paeonia lactiflora)、牡丹(P.suffruticosa)、菊花(Chry santhemum morifolium)等植物的同源性分别达到90%、89%、84%、85%、84%、80%.因此,CHI基因可能与鸳鸯茉莉的花色形成有关.

  17. Activity of Euphorbia splendens var. hislopii N.E.B. (Euphorbiaceae) latex against Lymnaea columella (Say, 1817) (Pulmonata: Lymnaeidae), intermediate host of Fasciola hepatica, Linnaeus, 1758 (Trematoda: Fasciolidae). 2: limited field-testing.

    Science.gov (United States)

    de Vasconcellos, Mauricio Carvalho; de Amorim, Alziro

    2003-10-01

    The molluscicidal evaluation of Euphorbia splendens var. hislopii (Crown of thorns) against Lymnaea columella snails, intermediate host of Fasciola hepatica, in irrigation ditches of the Pisciculture Station at Universidade Federal Rural do Rio de Janeiro, was studied under limited field conditions. An aqueous solution of the latex at 5 mg/l was tested in two irrigation ditches (experimental and control ditches), after initial sampling of the snail population present. Twenty-four hours after application of the product, it was verified that 97.4% of free L. columella snails and 100% of snails of the same species captive in cages and used as sentinels at three points equidistant from the application site in the experimental ditch, died. For Biomphalaria tenagophila and Melanoides tuberculata snails, present in the experimental ditch, the mortality was 100%, for the species Pomacea spp. the mortality was 40%. No mortality was verified in the free mollusks, or in the sentinels in the ditch used as control. E. splendens var. hislopii latex is thus an efficient natural molluscicide, which may be used as an alternative control agent against L. columella.

  18. Dinâmica de Lymnaea columella (Say, 1817, hospedeiro intermediário de Fasciola hepatica (Linnaeus, 1758 em municípios do Estado de São Paulo, Brasil

    Directory of Open Access Journals (Sweden)

    Edwin Alberto Pile Maure

    1998-01-01

    Full Text Available A dinâmica populacional de Lymnaea columella na pastagem foi estudada por um período de seis anos em fazendas de exploração leiteira positivas para Fasciola hepatica. A pesquisa foi desenvolvida nos municípios de Piquete e Redenção da Serra, Estado de São Paulo. Os resultados obtidos foram diferentes em cada fazenda, revelando que a dinâmica da população de moluscos está estreitamente relacionada a fatores ecológicos e climáticos. No município de Piquete, o aumento da variação da densidade populacional flutua em relação inversa à temperatura e à pluviosidade, encontrando maior número de moluscos no período seco do ano (maio-outubro. No município de Redenção da Serra, a grande quantidade de matéria orgânica observada no biótopo foi responsável pela captura do maior número de moluscos no período de altas temperaturas e chuvas (janeiro-março.

  19. Activity of Euphorbia splendens var. hislopii N.E.B. (Euphorbiaceae latex against Lymnaea columella (Say, 1817 (Pulmonata: Lymnaeidae, intermediate host of Fasciola hepatica, Linnaeus, 1758 (Trematoda: Fasciolidae. 2: limited field-testing

    Directory of Open Access Journals (Sweden)

    Vasconcellos Mauricio Carvalho de

    2003-01-01

    Full Text Available The molluscicidal evaluation of Euphorbia splendens var. hislopii (Crown of thorns against Lymnaea columella snails, intermediate host of Fasciola hepatica, in irrigation ditches of the Pisciculture Station at Universidade Federal Rural do Rio de Janeiro, was studied under limited field conditions. An aqueous solution of the latex at 5 mg/l was tested in two irrigation ditches (experimental and control ditches, after initial sampling of the snail population present. Twenty-four hours after application of the product, it was verified that 97.4% of free L. columella snails and 100% of snails of the same species captive in cages and used as sentinels at three points equidistant from the application site in the experimental ditch, died. For Biomphalaria tenagophila and Melanoides tuberculata snails, present in the experimental ditch, the mortality was 100%, for the species Pomacea spp. the mortality was 40%. No mortality was verified in the free mollusks, or in the sentinels in the ditch used as control. E. splendens var. hislopii latex is thus an efficient natural molluscicide, which may be used as an alternative control agent against L. columella.

  20. Effects of hot-water extract of banana (Musa acuminata) fruit's peel on the antibacterial activity, and anti-hypothermal stress, immune responses and disease resistance of the giant freshwater prawn, Macrobrachium rosenbegii.

    Science.gov (United States)

    Rattanavichai, Wutti; Cheng, Winton

    2014-08-01

    The hot-extracts isolated from fruit's peel of banana, Musa acuminata, was evaluated on the antibacterial activity to pathogens from aquatic animals, and immunostimulating potential, disease resistance and anti-hypothermal stress in giant freshwater prawn, Macrobrachium rosenbergii through injection administration. The banana peel extract (BPE) showed good activity against 1 Gram-positive and 3 Gram-negative pathogens, including Lactococcus garvieae, Photobacteria damsella, Vibrio alginolyticus and Vibrio parahemolyticus especially in prawn pathogen of L. garvieae strain, which were carried out by a disk diffusion method. Prawn received BPE via injection administration at 1-6 μg (g prawn)(-1) significantly increased total haemocyte count (THC), hyaline cell (HC), granular cell (GC), phenoloxidase (PO) activity and phagocytic activity against L. garvieae from 3 to 6 days, and significantly increased clearance efficiency against L. garvieae and a significantly decreased coagulation time of prawn from 1 to 6 days. Prawn injected with BPE at 6.0 μg (g prawn)(-1) for 6 days showed significantly increased superoxide dismutase (SOD) activity, but significantly decreased respiratory bursts (RBs) of per haemocyte. Survival rates of M. rosenbergii injected with BPE at concentrations of 1, 3 and 6 μg (g prawn)(-1) were significantly higher than those injected with saline control after challenge with L. garvieae for 4-6 days, and the respective relative survival percentages of prawn were 28.6%, 38.1%, and 47.8%, respectively at 6 days. The sublethal time of prawns that had received saline and BPE at 1, 3 and 6 μg (g prawn)(-1) for 6 days and then were transferred from 28 °C to 14 °C were 69.4, 79.8, 83.6, and 90.2 h, respectively. It was concluded that the BPE can be used as the bacteriostat, and immunostimulant and physiological regulator for prawn through injection administration to enhance immunity, physiological responses, and resistance against L. garvieae.

  1. High efficiency transformation of banana [Musa acuminata L. cv. Matti (AA)] for enhanced tolerance to salt and drought stress through overexpression of a peanut salinity-induced pathogenesis-related class 10 protein.

    Science.gov (United States)

    Rustagi, Anjana; Jain, Shalu; Kumar, Deepak; Shekhar, Shashi; Jain, Mukesh; Bhat, Vishnu; Sarin, Neera Bhalla

    2015-01-01

    Bananas and plantains (Musa spp. L.) are important subsistence crops and premium export commodity in several countries, and susceptible to a wide range of environmental and biotic stress conditions. Here, we report efficient, rapid, and reproducible Agrobacterium-mediated transformation and regeneration of an Indian niche cultivar of banana [M. acuminata cv. Matti (AA)]. Apical meristem-derived highly proliferative multiple shoot clump (MSC) explants were transformed with the Agrobacterium strain EHA105 harboring a binary vector pCAMBIA-1301 carrying hptII and uidA. Sequential agro-infiltration (10 min, 400 mmHg), infection (additional 35 min, Agrobacterium density A 600 = 0.8) and co-cultivation (18 h) regimen in 100 µM acetosyringone containing liquid medium were critical factors yielding high transformation efficiency (~81 %) corroborated by transient GUS expression assay. Stable transgenic events were recovered following two cycles of meristem initiation and selection on hygromycin containing medium. Histochemical GUS assay in several tissues of transgenic plants and molecular analyses confirmed stable integration and expression of transgene. The protocol described here allowed recovery of well-established putative transgenic plantlets in as little as 5 months. The transgenic banana plants could be readily acclimatized under greenhouse conditions, and were phenotypically similar to the wild-type untransformed control plants (WT). Transgenic plants overexpressing Salinity-Induced Pathogenesis-Related class 10 protein gene from Arachis hypogaea (AhSIPR10) in banana cv. Matti (AA) showed better photosynthetic efficiency and less membrane damage (P < 0.05) in the presence of NaCl and mannitol in comparison to WT plants suggesting the role of AhSIPR10 in better tolerance of salt stress and drought conditions.

  2. Hard electronics; Hard electronics

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    In the fields of power conversion devices and broadcasting/communication amplifiers, high power, high frequency and low losses are desirable. Further, for electronic elements in aerospace/aeronautical/geothermal surveys, etc., heat resistance to 500degC is required. Devices which respond to such hard specifications are called hard electronic devices. However, with Si which is at the core of the present electronics, the specifications cannot fully be fulfilled because of the restrictions arising from physical values. Accordingly, taking up new device materials/structures necessary to construct hard electronics, technologies to develop these to a level of IC were examined and studied. They are a technology to make devices/IC of new semiconductors such as SiC, diamond, etc. which can handle higher temperature, higher power and higher frequency than Si and also is possible of reducing losses, a technology to make devices of hard semiconducter materials such as a vacuum microelectronics technology using ultra-micro/high-luminance electronic emitter using negative electron affinity which diamond, etc. have, a technology to make devices of oxides which have various electric properties, etc. 321 refs., 194 figs., 8 tabs.

  3. Electronic Cigarettes

    Science.gov (United States)

    ... New FDA Regulations Text Size: A A A Electronic Cigarettes Electronic cigarettes (e-cigarettes) are battery operated products designed ... more about: The latest news and events about electronic cigarettes on this FDA page Electronic cigarette basics ...

  4. The Electron

    Energy Technology Data Exchange (ETDEWEB)

    Thomson, George

    1972-01-01

    Electrons are elementary particles of atoms that revolve around and outside the nucleus and have a negative charge. This booklet discusses how electrons relate to electricity, some applications of electrons, electrons as waves, electrons in atoms and solids, the electron microscope, among other things.

  5. Hard electronics; Hard electronics

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    Hard material technologies were surveyed to establish the hard electronic technology which offers superior characteristics under hard operational or environmental conditions as compared with conventional Si devices. The following technologies were separately surveyed: (1) The device and integration technologies of wide gap hard semiconductors such as SiC, diamond and nitride, (2) The technology of hard semiconductor devices for vacuum micro- electronics technology, and (3) The technology of hard new material devices for oxides. The formation technology of oxide thin films made remarkable progress after discovery of oxide superconductor materials, resulting in development of an atomic layer growth method and mist deposition method. This leading research is expected to solve such issues difficult to be easily realized by current Si technology as high-power, high-frequency and low-loss devices in power electronics, high temperature-proof and radiation-proof devices in ultimate electronics, and high-speed and dense- integrated devices in information electronics. 432 refs., 136 figs., 15 tabs.

  6. Ambient Electronics

    Science.gov (United States)

    Sekitani, Tsuyoshi; Someya, Takao

    2012-10-01

    We report the recent research progress and future prospects of flexible and printed electronics, focusing on molecular electronic material-based thin-film transistors, which are expected to usher in a new era of electronics.

  7. EFECTO DE LA ADICIÓN DE CAL A PLANTACIONES DE JAÚL (Alnus acuminata EN ANDISOLES DE LA CUENCA ALTA DEL RÍO VIRILLA, COSTA RICA

    Directory of Open Access Journals (Sweden)

    Marlon Salazar

    2011-01-01

    Full Text Available Con el propósito de evaluar el impacto de adicionar cal a plantaciones de jaúl (Alnus acuminata (H.B.K. O. Kuntze en Andisoles de la cuenca alta del río Virilla, Costa Rica, se realizó el presente trabajo en 2 localidades: 1 Finca Hospicio: Ubicada en la localidad de Vista de Mar, cantón de Goicoechea, a una altitud de 1542 msmn; el suelo se clasificó como Typic Udivitrands y la plantación se estableció en el 2002. 2 Finca Dorval: Ubicada en la localidad de Las Nubes, cantón de Vásquez de Coronado, a una altitud de 1925 msnm; el suelo se clasificó como Thaptic Udivitrands y la plantación se estableció en 1997. Los tratamientos aplicados fueron 0 (testigo, 750, 1500 y 2250 kg.ha-1 de carbonato de calcio y magnesio (Dolomita, 1500 kg.ha-1 de carbonato de calcio (Calcita y 1500 kg.ha-1 de sulfato de calcio (Yeso. Se midieron el diámetro a la altura del pecho (DAP a 1,3 m, la altura total de los árboles (m y se estimó el volumen (V mediante la formula: V(m3=2,71828¿10,0557+ln(d*2,0369+0,9277 18*ln(h propuesta por Segura et al. (2005, en la cual d es el DAP en cm y h es la altura total en m. Al comparar las mediciones del diámetro a la altura del pecho, incremento medio anual en diámetro (IMA-DAP, altura total, incremento medio anual en altura (IMA-ALT, volumen total e incremento en volumen total, por dosis y fuentes de cal aplicada, se observó que ningún tratamiento causó diferencias estadísticas, en estas variables en ninguna de las 2 fincas comparadas ni entre épocas de medición. La adición de fuentes y niveles de cal no afectó significativamente las variables diámetro, altura y volumen. La falta de respuesta a las diferentes enmiendas comparadas demuestra que el suelo proporcionó suficiente Ca, Mg y S para asegurar el crecimiento óptimo del jaúl. Tampoco se encontró que los suelos mostraran problemas de acidez de magnitud tal que afectaran negativamente el crecimiento del jaúl.

  8. Efecto de la fertilización con fósforo sobre la nodulación de Frankia en plantaciones de Alnus acuminata en Andisoles de Costa Rica

    Directory of Open Access Journals (Sweden)

    Manuel Segura

    2006-01-01

    Full Text Available El efecto de la aplicación de P en la biomasa de nódulos radiculares de Francia spp. en árboles de A. acuminata cultivados en 2 suelos (Typic Udivitrands en Landelina y Vista de Mar y Entic Udivitrands (en Matinilla fue evaluado. Se aplicaron cantidades crecientes de P2O5 en plantaciones de 2, 4 y 7 años de edad inicial. Los resultados obtenidos no mostraron diferencias en el peso seco de la biomasa de nódulos, ni en el número de nódulos activos y muertos, con la adición de P. Sin embargo, al eliminar el efecto de sitio, se observó un aumento en el número de nódulos activos con la adición de 61 g de P2O5 árbol-1. El número de nódulos activos y muertos disminuyó con la edad de la plantación. Por otro lado, la biomasa de nódulos fue alta en las plantaciones evaluadas, lo que constituye una fuente importante de material vegetal orgánico y de nutrimentos. Se encontró un modelo (p=0,0001 para la predicción del número de nódulos a partir del diámetro de los árboles. Se observó una correlación baja (r2=0,46 entre el diámetro y el número de nódulos activos. El número de nódulos activos osciló entre 102 y 1959 cuando el diámetro de los árboles varió entre 4 y 12 cm (2y 3 años; sin embargo, el número de nódulos disminuyó entre 31 y 596 cuando el diámetro de los árboles es de 12 y 19 cm (4 y 5 años. Finalmente, cuando los árboles alcanzaron un diámetro entre 17 y 24 cm (7 y 8 años, el número de nódulos estuvo entre 6 y 174.

  9. Electron cooling

    Science.gov (United States)

    Meshkov, I.; Sidorin, A.

    2004-10-01

    The brief review of the most significant and interesting achievements in electron cooling method, which took place during last two years, is presented. The description of the electron cooling facilities-storage rings and traps being in operation or under development-is given. The applications of the electron cooling method are considered. The following modern fields of the method development are discussed: crystalline beam formation, expansion into middle and high energy electron cooling (the Fermilab Recycler Electron Cooler, the BNL cooler-recuperator, cooling with circulating electron beam, the GSI project), electron cooling in traps, antihydrogen generation, electron cooling of positrons (the LEPTA project).

  10. Acute toxicity, critical body residues, Michaelis-Menten analysis of bioaccumulation, and ionoregulatory disturbance in response to waterborne nickel in four invertebrates: Chironomus riparius, Lymnaea stagnalis, Lumbriculus variegatus and Daphnia pulex.

    Science.gov (United States)

    Leonard, Erin M; Wood, Chris M

    2013-06-01

    We investigated the bioaccumulation and acute toxicity (48 h or 96 h) of Ni in four freshwater invertebrate species in two waters with hardness of 40 (soft water) and 140 mg L(-1) as CaCO(3) (hard water). Sensitivity order (most to least) was Lymnaea stagnalis > Daphnia pulex > Lumbriculus variegatus > Chironomus riparius. In all cases water hardness was protective against acute Ni toxicity with LC(50) values 3-3.5× higher in the hard water vs. soft water. In addition, higher water hardness significantly reduced Ni bioaccumulation in these organisms suggesting that competition by Ca and Mg for uptake at the biotic ligand may contribute to higher metal resistance. CBR50 values (Critical Body Residues) were less dependent on water chemistry (i.e. more consistent) than LC(50) values within and across species by ~2 fold. These data support one of the main advantages of the Tissue Residue Approach (TRA) where tissue concentrations are generally less variable than exposure concentrations with respect to toxicity. Whole body Ni bioaccumulation followed Michaelis-Menten kinetics in all organisms, with greater hardness tending to decrease B(max) with no consistent effect on K(d). Across species, acute Ni LC(50) values tended to increase with both K(d) and B(max) values - i.e. more sensitive species exhibited higher binding affinity and lower binding capacity for Ni, but there was no correlation with body size. With respect to biotic ligand modeling, log K(NiBL) values derived from Ni bioaccumulation correlated well with log K(NiBL) values derived from toxicity testing. Both whole body Na and Mg levels were disturbed, suggesting that disruption of ionoregulatory homeostasis is a mechanism of acute Ni toxicity. In L. stagnalis, Na depletion was a more sensitive endpoint than mortality, however, the opposite was true for the other organisms. This is the first study to show the relationship between Na and Ni. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Molluscicidal action of the latex of Euphorbia splendens var. hislopii N.E.B. ("Christ's Crown") (Euphorbiaceae) against Lymnaea columella (Say, 1817) (Pulmonata: Lymnaeidae), intermediate host of Fasciola hepatica Linnaeus, 1758 (Trematode: Fasciolidae): 1- test in laboratory.

    Science.gov (United States)

    de Vasconcellos, Mauricio Carvalho; de Amorim, Alziro

    2003-06-01

    The latex action of Euphorbia splendens var. hislopii (Christ's Crown) against snails Lymnaea columella, intermediate host of Fasciola hepatica, derived from irrigation ditches of the Station of Pisciculture at Universidade Federal Rural do Rio de Janeiro, was studied in the laboratory. Lab bioassays, using aqueous solutions of the latex, varying between 0.1 and 10 mg/l, have proven molluscicidal activity of the product collected on the same day the tests were performed, during the four seasons of the year, finding the following lethal concentrations (LC90): 1.51 mg/l in the spring; 0.55 mg/l in the summer; 0.74 mg/l in the fall and 0.93 mg/l in winter, after 24 h exposure of the snails, showing significant differences among the seasons of the year (ANOVA test, F = 11.01, G.L.= 3/33, p < 0.05), as well as among the concentrations (ANOVA test, F = 27.38, G.L.= 11/33, p < 0.05). In the summer, mortality reached 100% from concentration at 0.6 mg/l, the same during fall and in winter as of 1 mg/l, while in spring it only reached 100% mortality as of 2 mg/l. Mortality in the controls was low, reaching 5% in the summer and winter and 10% in the fall and spring. None of the samples died. During the assay, with an aqueous solution of the latex at a concentration of 5 mg/l, in order to check the time of duration of the product effect, in the laboratory, it was observed that the molluscicidal activity remained stable up to the 15th day after the beginning of the test with 100% mortality of L. columella, gradually losing its effect until the 23rd day, when we no longer observed animal mortality. In the control group, there was a random daily variation in mortality rate ranging 0-50% after 48 h of observation for 30 days.

  12. Molluscicidal action of the latex of Euphorbia splendens var. hislopii N.E.B. ("Christ's Crown" (Euphorbiaceae against Lymnaea columella (Say, 1817 (Pulmonata: Lymnaeidae, intermediate host of Fasciola hepatica Linnaeus, 1758 (Trematode: Fasciolidae: 1- test in laboratory

    Directory of Open Access Journals (Sweden)

    Vasconcellos Mauricio Carvalho de

    2003-01-01

    Full Text Available The latex action of Euphorbia splendens var. hislopii (Christ's Crown against snails Lymnaea columella, intermediate host of Fasciola hepatica, derived from irrigation ditches of the Station of Pisciculture at Universidade Federal Rural do Rio de Janeiro, was studied in the laboratory. Lab bioassays, using aqueous solutions of the latex, varying between 0.1 and 10 mg/l, have proven molluscicidal activity of the product collected on the same day the tests were performed, during the four seasons of the year, finding the following lethal concentrations (LC90: 1.51 mg/l in the spring; 0.55 mg/l in the summer; 0.74 mg/l in the fall and 0.93 mg/l in winter, after 24 h exposure of the snails, showing significant differences among the seasons of the year (ANOVA test, F = 11.01, G.L.= 3/33, p < 0.05, as well as among the concentrations (ANOVA test, F = 27.38, G.L.= 11/33, p < 0.05. In the summer, mortality reached 100% from concentration at 0.6 mg/l, the same during fall and in winter as of 1 mg/l, while in spring it only reached 100% mortality as of 2 mg/l. Mortality in the controls was low, reaching 5% in the summer and winter and 10% in the fall and spring. None of the samples died. During the assay, with an aqueous solution of the latex at a concentration of 5 mg/l, in order to check the time of duration of the product effect, in the laboratory, it was observed that the molluscicidal activity remained stable up to the 15th day after the beginning of the test with 100% mortality of L. columella, gradually losing its effect until the 23rd day, when we no longer observed animal mortality. In the control group, there was a random daily variation in mortality rate ranging 0-50% after 48 h of observation for 30 days.

  13. Different Responses of Camptothecin and 10-Hydroxycamptothecin to Heat Shock in Camptotheca acuminata Seedlings%喜树幼苗中喜树碱和10-羟基喜树碱对热激的响应特点和意义

    Institute of Scientific and Technical Information of China (English)

    祖元刚; 唐中华; 于景华; 刘士刚; 王微; 郭晓瑞

    2003-01-01

    Plants interact with their environment by producing a diverse array of secondary metabolites,one of which is alkaloid. In this study, alkaloids, including camptothecin (CPT) and 10-hydroxycamptothecin(HCPT), malondialdehyde (MDA) and chlorophyll contents were measured during heat shock in seedlings ofCamptotheca acuminata Decaisne unique to China. Responses of different tissues, including young leaves,old leaves, buds and barks, to heat shock were examined in alkaloid changes. CPT and HCPT concentra-tions reached their peak values separately at 38 ℃ and 40 ℃, which were below the lethal heat-shocktemperature indicated by MDA and chlorophyll, and their great changes took place in young leaves. Theseresults indicated that CPT and HCPT were involved in the C. acuminata resistance against heat shockfrom its environment. Furthermore, plant rigidly observed the cost-benefit principle and mobilized andallocated limited alkaloid sources to young and reproductive tissues preferentially. In addition, HCPT dis-played well-regulated changes during incubation at sublethal temperature, and this indicated that HCPTmight play a more positively defensive role in enhancement of plant thermotolerance than CPT does.%植物在长期的生态环境适应过程中,产生了包括生物碱在内的大量次生代谢物.本文以我国特有树种--喜树(Camptotheca acuminata Decaisne)为材料,研究其不同器官中喜树碱(camptothecin,CPT)和10-羟基喜树碱(10-hydroxycamptothecin,HCPT)在不同热激温度和时间情况下的含量变化.CPT和HCPT变化呈现出较好的相互消长关系,并且分别在38℃和40℃达到各自的峰值,比以丙二醛和叶绿素为指标的致死温度低了2~4℃;HCPT在热激过程中的变化较CPT活跃;极易受到攻击和伤害的嫩叶中的生物碱含量变化最大.由此推断,CPT和HCPT遵循"幼嫩和生殖器官优先保护"的原则,从而有效地缓解了高温胁迫,并且HCPT和CPT代表了不同的防御策略.

  14. Electron Microscopy.

    Science.gov (United States)

    Beer, Michael

    1980-01-01

    Reviews technical aspects of structure determination in biological electron microscopy (EM). Discusses low dose EM, low temperature microscopy, electron energy loss spectra, determination of mass or molecular weight, and EM of labeled systems. Cites 34 references. (CS)

  15. Electron Microscopy.

    Science.gov (United States)

    Beer, Michael

    1980-01-01

    Reviews technical aspects of structure determination in biological electron microscopy (EM). Discusses low dose EM, low temperature microscopy, electron energy loss spectra, determination of mass or molecular weight, and EM of labeled systems. Cites 34 references. (CS)

  16. Molluscicidal effect of WPN and MNSC on Lymnaea%氯硝柳胺乙醇胺盐可湿性粉剂和四聚·杀螺胺悬浮剂杀灭椎实螺实验研究

    Institute of Scientific and Technical Information of China (English)

    王尚位; 王海英; 罗秉荣; 李科荣; 刘榆华; 赵申华; 杨华; 李天美

    2013-01-01

    目的 观察50%氯硝柳胺乙醇胺盐可湿性粉剂(WPN)和26%四聚·杀螺胺悬浮剂(MNSC)杀灭椎实螺效果.方法 将WPN和MNSC分别配制成有效成分浓度为0.06、0.13、0.25、0.50、1.00、2.00 mg/L和4.00 mg/L的溶液,在实验室浸泡椎实螺成螺,统计椎实螺死亡率并计算半数致死浓度(LC50值).采用有效成分浓度分别为0.03、0.06、0.13、0.25、0.50、1.00g/m2和2.00 g/m2的WPN和MNSC开展室内喷洒杀灭椎实螺试验,统计椎实螺死亡率并计算计算LC50值.分别配制WPN和MNSC有效成分浓度为1.00、0.50、0.25、0.13 mg/L的溶液,分组投放椎实螺,观察不同时间椎实螺上爬情况.结果 WPN浸杀48 h和72 h的LC50值分别为0.93 mg/L和0.64 mg/L,MNSC浸杀48 h和72 h的LC50值分别为0.74 mg/L和0.51 mg/L; WPN和MNSC有效成分浓度>1.00 g/m2时,喷洒3d后椎实螺死亡率均达100%;在有效成分浓度为1.00 mg/L的WPN和MNSC药液中,未见椎实螺上爬,但在低浓度药液中有少量椎实螺上爬.结论 WPN和MNSC均有杀灭椎实螺效果,且均可抑制椎实螺上爬.现场开展杀灭椎实螺工作时,浸杀法应采用WPN和MNSC有效成分浓度2.00 mg/L浸杀48 h以上为宜,喷洒法应采用有效成分含量1.00 g/m2喷洒3d为宜.%Objective To evaluate the molluscicidal effect of wettable powder of 50% niclosamide ethanolamide salt (WPN) and suspension concentrate of 26% metaldehyde and niclosamide (MNSC) on Lymnaea. Methods WPN and MNSC were prepared as a series of solutions containing the active ingredient concentrations of 0.06, 0.13, 0.25, 0.50, 1.00, 2.00 mg/L and 4.00 mg/L, and the adult Lymnaea snails were soaked in the above mentioned series of solutions in the laboratory, and the LC50 values were calculated. The doses of active ingredient concentrations of 0.03, 0.06,0.13, 0.25, 0.50, 1.00 g/m2 and 2.00 g/m2 of WPN and MNSC were adopted to spray on Lymnaea snails in the laboratory, and the LC50 values were calculated. A series of

  17. Understand electronics

    CERN Document Server

    Bishop, Owen

    2013-01-01

    Understand Electronics provides a readable introduction to the exciting world of electronics for the student or enthusiast with little previous knowledge. The subject is treated with the minimum of mathematics and the book is extensively illustrated.This is an essential guide for the newcomer to electronics, and replaces the author's best-selling Beginner's Guide to Electronics.The step-by-step approach makes this book ideal for introductory courses such as the Intermediate GNVQ.

  18. Electronic components

    CERN Document Server

    Colwell, Morris A

    1976-01-01

    Electronic Components provides a basic grounding in the practical aspects of using and selecting electronics components. The book describes the basic requirements needed to start practical work on electronic equipment, resistors and potentiometers, capacitance, and inductors and transformers. The text discusses semiconductor devices such as diodes, thyristors and triacs, transistors and heat sinks, logic and linear integrated circuits (I.C.s) and electromechanical devices. Common abbreviations applied to components are provided. Constructors and electronics engineers will find the book useful

  19. Electronic Prescribing

    Science.gov (United States)

    ... Do you prescribe electronically?” For more information about electronic prescribing, call 1-800-MEDICARE (1-800-633- ... TTY users should call 1-877-486-2048 . Electronic eRx Prescribing I went to the pharmacy, and ...

  20. Basic electronics

    CERN Document Server

    Holbrook, Harold D

    1971-01-01

    Basic Electronics is an elementary text designed for basic instruction in electricity and electronics. It gives emphasis on electronic emission and the vacuum tube and shows transistor circuits in parallel with electron tube circuits. This book also demonstrates how the transistor merely replaces the tube, with proper change of circuit constants as required. Many problems are presented at the end of each chapter. This book is comprised of 17 chapters and opens with an overview of electron theory, followed by a discussion on resistance, inductance, and capacitance, along with their effects on t

  1. Electronic Government and Electronic Participation

    NARCIS (Netherlands)

    Tambouris, E.; Scholl, H.J.; Janssen, M.F.W.H.A.; Wimmer, M.A.; Tarabanis, K.; Gascó, M.; Klievink, A.J.; Lindgren, I.; Milano, M.; Panagiotopoulos, P.; Pardo, T.A.; Parycek, P.; Sæbø, O.

    2015-01-01

    Electronic government and electronic participation continue to transform the public sector and society worldwide and are constantly being transformed themselves by emerging information and communication technologies. This book presents papers from the 14th International Federation for Information P

  2. Electron Tree

    DEFF Research Database (Denmark)

    Appelt, Ane L; Rønde, Heidi S

    2013-01-01

    The photo shows a close-up of a Lichtenberg figure – popularly called an “electron tree” – produced in a cylinder of polymethyl methacrylate (PMMA). Electron trees are created by irradiating a suitable insulating material, in this case PMMA, with an intense high energy electron beam. Upon discharge......, during dielectric breakdown in the material, the electrons generate branching chains of fractures on leaving the PMMA, producing the tree pattern seen. To be able to create electron trees with a clinical linear accelerator, one needs to access the primary electron beam used for photon treatments. We...... appropriated a linac that was being decommissioned in our department and dismantled the head to circumvent the target and ion chambers. This is one of 24 electron trees produced before we had to stop the fun and allow the rest of the accelerator to be disassembled....

  3. Electron Tree

    DEFF Research Database (Denmark)

    Appelt, Ane L; Rønde, Heidi S

    2013-01-01

    The photo shows a close-up of a Lichtenberg figure – popularly called an “electron tree” – produced in a cylinder of polymethyl methacrylate (PMMA). Electron trees are created by irradiating a suitable insulating material, in this case PMMA, with an intense high energy electron beam. Upon discharge......, during dielectric breakdown in the material, the electrons generate branching chains of fractures on leaving the PMMA, producing the tree pattern seen. To be able to create electron trees with a clinical linear accelerator, one needs to access the primary electron beam used for photon treatments. We...... appropriated a linac that was being decommissioned in our department and dismantled the head to circumvent the target and ion chambers. This is one of 24 electron trees produced before we had to stop the fun and allow the rest of the accelerator to be disassembled....

  4. [Giant scrotal condyloma acuminata: a case report].

    Science.gov (United States)

    Rabii, R; Joual, A; Bellabidia, B; Skalli-Dehbi, K; Hafliani, M; Bennani, S; el Mrini, M; Sqalli, S; Benjelloun, S

    2001-01-01

    In this study, the case has been reported of a scrotal tumor in a 50-year old male admitted with a large warty lesion at the base of the scrotum which resembled a giant condyloma accuminatum (Buschk-Lowenstein tumor). The HIV serology was negative, but the papillomavirus findings were positive. A complete resection of the tumor was performed. The histological findings confirmed the diagnosis of condyloma accuminatum without evidence of degenerative development into a squamous cell carcinoma. The clinical course was favorable, and no local recurrence was observed at 16 months follow-up. The problems that are frequently encountered in the diagnosis and therapy connected with this type of tumor have also been discussed.

  5. Electronic Commerce

    Directory of Open Access Journals (Sweden)

    Slavko Đerić

    2016-12-01

    Full Text Available Electronic commerce can be defined in different ways. Any definition helps to understand and explain that concept as better as possible.. Electronic commerce is a set of procedures and technologies that automate the tasks of financial transactions using electronic means. Also, according to some authors, electronic commerce is defined as a new concept, which is being developed and which includes process of buying and selling or exchanging products, services or information via computer networks, including the Internet. Electronic commerce is not limited just to buying and selling, but it also includes all pre-sales and after-sales ongoing activities along the supply chain. Introducing electronic commerce, using the Internet and Web services in business, realizes the way to a completely new type of economy - internet economy.

  6. Micropower electronics

    CERN Document Server

    Keonjian, Edward

    1964-01-01

    Micropower Electronics deals with the operation of modern electronic equipment at micropower levels and the problems associated with micropower electronics. Topics covered include the relations between minimum required power density and frequency response for semiconductor triode amplifiers; physical realization of digital logic circuits; micropower microelectronic subsystems; and metal-oxide-semiconductor field-effect devices for micropower logic circuitry. This book is comprised of 10 chapters and begins with an analysis of fundamental relationships and basic requirements pertinent to the ph

  7. Microfluidic electronics.

    Science.gov (United States)

    Cheng, Shi; Wu, Zhigang

    2012-08-21

    Microfluidics, a field that has been well-established for several decades, has seen extensive applications in the areas of biology, chemistry, and medicine. However, it might be very hard to imagine how such soft microfluidic devices would be used in other areas, such as electronics, in which stiff, solid metals, insulators, and semiconductors have previously dominated. Very recently, things have radically changed. Taking advantage of native properties of microfluidics, advances in microfluidics-based electronics have shown great potential in numerous new appealing applications, e.g. bio-inspired devices, body-worn healthcare and medical sensing systems, and ergonomic units, in which conventional rigid, bulky electronics are facing insurmountable obstacles to fulfil the demand on comfortable user experience. Not only would the birth of microfluidic electronics contribute to both the microfluidics and electronics fields, but it may also shape the future of our daily life. Nevertheless, microfluidic electronics are still at a very early stage, and significant efforts in research and development are needed to advance this emerging field. The intention of this article is to review recent research outcomes in the field of microfluidic electronics, and address current technical challenges and issues. The outlook of future development in microfluidic electronic devices and systems, as well as new fabrication techniques, is also discussed. Moreover, the authors would like to inspire both the microfluidics and electronics communities to further exploit this newly-established field.

  8. Paper electronics.

    Science.gov (United States)

    Tobjörk, Daniel; Österbacka, Ronald

    2011-05-03

    Paper is ubiquitous in everyday life and a truly low-cost substrate. The use of paper substrates could be extended even further, if electronic applications would be applied next to or below the printed graphics. However, applying electronics on paper is challenging. The paper surface is not only very rough compared to plastics, but is also porous. While this is detrimental for most electronic devices manufactured directly onto paper substrates, there are also approaches that are compatible with the rough and absorptive paper surface. In this review, recent advances and possibilities of these approaches are evaluated and the limitations of paper electronics are discussed.

  9. Electron holography

    CERN Document Server

    Tonomura, Akira

    1993-01-01

    Holography was devised for breaking through the resolution limit of electron microscopes The advent of a "coherent" field emission electron beam has enabled the use of Electron Holography in various areas of magnetic domain structures observation, fluxon observation in superconductors, and fundamental experiments in physics which have been inaccessible using other techniques After examining the fundamentals of electron holography and its applications to the afore mentioned fields, a detailed discussion of the Aharonov-Bohm effect and the related experiments is presented Many photographs and illustrations are included to elucidate the text

  10. Polymer electronics

    CERN Document Server

    Hsin-Fei, Meng

    2013-01-01

    Polymer semiconductor is the only semiconductor that can be processed in solution. Electronics made by these flexible materials have many advantages such as large-area solution process, low cost, and high performance. Researchers and companies are increasingly dedicating time and money in polymer electronics. This book focuses on the fundamental materials and device physics of polymer electronics. It describes polymer light-emitting diodes, polymer field-effect transistors, organic vertical transistors, polymer solar cells, and many applications based on polymer electronics. The book also disc

  11. Electronic Photography

    Science.gov (United States)

    Payne, Meredith Lindsay

    1995-01-01

    The main objective was to assist in the production of electronic images in the Electronic Photography Lab (EPL). The EPL is a new facility serving the electronic photographic needs of the Langley community. The purpose of the Electronic Photography lab is to provide Langley with access to digital imaging technology. Although the EPL has been in operation for less than one year, almost 1,000 images have been produced. The decision to establish the lab was made after careful determination of the centers needs for electronic photography. The LaRC community requires electronic photography for the production of electronic printing, Web sites, desktop publications, and its increased enhancement capabilities. In addition to general use, other considerations went into the planning of the EPL. For example, electronic photography is much less of a burden on the environment compared to conventional photography. Also, the possibilities of an on-line database and retrieval system could make locating past work more efficient. Finally, information in an electronic image is quantified, making measurements and calculations easier for the researcher.

  12. Electron Bifurcation

    Energy Technology Data Exchange (ETDEWEB)

    Peters, John W.; Miller, Anne-Frances; Jones, Anne K.; King, Paul W.; Adams, Michael W. W.

    2016-04-01

    Electron bifurcation is the recently recognized third mechanism of biological energy conservation. It simultaneously couples exergonic and endergonic oxidation-reduction reactions to circumvent thermodynamic barriers and minimize free energy loss. Little is known about the details of how electron bifurcating enzymes function, but specifics are beginning to emerge for several bifurcating enzymes. To date, those characterized contain a collection of redox cofactors including flavins and iron-sulfur clusters. Here we discuss the current understanding of bifurcating enzymes and the mechanistic features required to reversibly partition multiple electrons from a single redox site into exergonic and endergonic electron transfer paths.

  13. Printed Electronics

    Science.gov (United States)

    Crain, John M. (Inventor); Lettow, John S. (Inventor); Aksay, Ilhan A. (Inventor); Korkut, Sibel (Inventor); Chiang, Katherine S. (Inventor); Chen, Chuan-Hua (Inventor); Prud'Homme, Robert K. (Inventor)

    2016-01-01

    Printed electronic device comprising a substrate onto at least one surface of which has been applied a layer of an electrically conductive ink comprising functionalized graphene sheets and at least one binder. A method of preparing printed electronic devices is further disclosed.

  14. Electron optics

    CERN Document Server

    Grivet, Pierre; Bertein, F; Castaing, R; Gauzit, M; Septier, Albert L

    1972-01-01

    Electron Optics, Second English Edition, Part I: Optics is a 10-chapter book that begins by elucidating the fundamental features and basic techniques of electron optics, as well as the distribution of potential and field in electrostatic lenses. This book then explains the field distribution in magnetic lenses; the optical properties of electrostatic and magnetic lenses; and the similarities and differences between glass optics and electron optics. Subsequent chapters focus on lens defects; some electrostatic lenses and triode guns; and magnetic lens models. The strong focusing lenses and pris

  15. Electronic diagrams

    CERN Document Server

    Colwell, Morris A

    1976-01-01

    Electronic Diagrams is a ready reference and general guide to systems and circuit planning and in the preparation of diagrams for both newcomers and the more experienced. This book presents guidelines and logical procedures that the reader can follow and then be equipped to tackle large complex diagrams by recognition of characteristic 'building blocks' or 'black boxes'. The goal is to break down many of the barriers that often seem to deter students and laymen in learning the art of electronics, especially when they take up electronics as a spare time occupation. This text is comprised of nin

  16. Digital electronics

    CERN Document Server

    Morris, John

    2013-01-01

    An essential companion to John C Morris's 'Analogue Electronics', this clear and accessible text is designed for electronics students, teachers and enthusiasts who already have a basic understanding of electronics, and who wish to develop their knowledge of digital techniques and applications. Employing a discovery-based approach, the author covers fundamental theory before going on to develop an appreciation of logic networks, integrated circuit applications and analogue-digital conversion. A section on digital fault finding and useful ic data sheets completes th

  17. Electronic identity

    CERN Document Server

    de Andrade, Norberto Nuno Gomes; Argles, David

    2014-01-01

    With the increasing availability of electronic services, security and a reliable means by which identity is verified is essential.Written by Norberto Andrade the first chapter of this book provides an overview of the main legal and regulatory aspects regarding electronic identity in Europe and assesses the importance of electronic identity for administration (public), business (private) and, above all, citizens. It also highlights the role of eID as a key enabler of the economy.In the second chapter Lisha Chen-Wilson, David Argles, Michele Schiano di Zenise and Gary Wills discuss the user-cent

  18. Stretchable electronics

    CERN Document Server

    Someya, Takao

    2012-01-01

    With its comprehensive coverage this handbook and ready reference brings together some of the most outstanding scientists in the field to lay down the undisputed knowledge on how to make electronics stretchable.As such, it focuses on gathering and evaluating the materials, designs, models and technologies that enable the fabrication of fully elastic electronic devices which can sustain high strain. Furthermore, it provides a review of those specific applications that directly benefit from highly compliant electronics, including transistors, photonic devices and sensors. In addition to stre

  19. Starting electronics

    CERN Document Server

    Brindley, Keith

    2005-01-01

    Starting Electronics is unrivalled as a highly practical introduction for hobbyists, students and technicians. Keith Brindley introduces readers to the functions of the main component types, their uses, and the basic principles of building and designing electronic circuits. Breadboard layouts make this very much a ready-to-run book for the experimenter; and the use of multimeter, but not oscilloscopes, puts this practical exploration of electronics within reach of every home enthusiast's pocket. The third edition has kept the simplicity and clarity of the original. New material

  20. Polymer electronics

    CERN Document Server

    Geoghegan, Mark

    2013-01-01

    Polymer electronics is the science behind many important new developments in technology, such as the flexible electronic display (e-ink) and many new developments in transistor technology. Solar cells, light-emitting diodes, and transistors are all areas where plastic electronics is likely to, or is already having, a serious impact on our daily lives. With polymer transistors and light-emitting diodes now being commercialised, there is a clear need for a pedagogic text thatdiscusses the subject in a clear and concise fashion suitable for senior undergraduate and graduate students. The content

  1. Power Electronics

    DEFF Research Database (Denmark)

    Iov, Florin; Ciobotaru, Mihai; Blaabjerg, Frede

    2008-01-01

    is to change the electrical power production sources from the conventional, fossil (and short term) based energy sources to renewable energy resources. The other is to use high efficient power electronics in power generation, power transmission/distribution and end-user application. This paper discuss the most...... emerging renewable energy sources, wind energy, which by means of power electronics are changing from being a minor energy source to be acting as an important power source in the energy system. Power electronics is the enabling technology and the presentation will cover the development in wind turbine...... technology from kW to MW, discuss which power electronic solutions are most feasible and used today....

  2. Electronic Elections

    DEFF Research Database (Denmark)

    Schürmann, Carsten

    2009-01-01

    Electronic voting technology is a two edged sword. It comes with many risks but brings also many benefits. Instead of flat out rejecting the technology as uncontrollably dangerous, we advocate in this paper a different technological angle that renders electronic elections trustworthy beyond...... the usual levels of doubt. We exploit the trust that voters currently have into the democratic process and model our techniques around that observation accordingly. In particular, we propose a technique of trace emitting computations to record the individual steps of an electronic voting machine...... for a posteriori validation on an acceptably small trusted computing base. Our technology enables us to prove that an electronic elections preserves the voter’s intent, assuming that the voting machine and the trace verifier are independent....

  3. Electronic plants

    Science.gov (United States)

    Stavrinidou, Eleni; Gabrielsson, Roger; Gomez, Eliot; Crispin, Xavier; Nilsson, Ove; Simon, Daniel T.; Berggren, Magnus

    2015-01-01

    The roots, stems, leaves, and vascular circuitry of higher plants are responsible for conveying the chemical signals that regulate growth and functions. From a certain perspective, these features are analogous to the contacts, interconnections, devices, and wires of discrete and integrated electronic circuits. Although many attempts have been made to augment plant function with electroactive materials, plants’ “circuitry” has never been directly merged with electronics. We report analog and digital organic electronic circuits and devices manufactured in living plants. The four key components of a circuit have been achieved using the xylem, leaves, veins, and signals of the plant as the template and integral part of the circuit elements and functions. With integrated and distributed electronics in plants, one can envisage a range of applications including precision recording and regulation of physiology, energy harvesting from photosynthesis, and alternatives to genetic modification for plant optimization. PMID:26702448

  4. ELECTRONIC SIGNATURES

    African Journals Online (AJOL)

    10332324

    'electronic signature' means data attached to, incorporated in, or logically ... See Cwele v S 2012 4 All SA 497 (SCA); Mohlabeng v Minister of Safety and Security ... ZAKZPHC 51 (2 September 2010); Delta Finance, a Division of Wesbank, ...

  5. Electron Microprobe

    Data.gov (United States)

    Federal Laboratory Consortium — The JEOL JXA-8600 is a conventional hairpin filament thermal emission electron microprobe that is more than 20 years old. It is capable of performing qualitative and...

  6. Electronic commerce

    OpenAIRE

    Veselková, Zdeňka

    2012-01-01

    The thesis deals with a description of electronic commerce from its beginning up to present situation in this area. It explains basic terms connected with electronic commerce and it summarizes the relevant legislation. Moreover it describes e-contracts and rights and duties of both contractual parties. The main view is the view of Internet retailer, which is reflected in the practical part focused on concrete problems of retailers.

  7. Molecular Electronics

    DEFF Research Database (Denmark)

    Jennum, Karsten Stein

    This thesis includes the synthesis and characterisation of organic compounds designed for molecular electronics. The synthesised organic molecules are mainly based on two motifs, the obigo(phenyleneethynylenes) (OPE)s and tetrathiafulvalene (TTF) as shown below. These two scaffolds (OPE and TTF......) are chemically merged together to form cruciform-like structures that are an essential part of the thesis. The cruciform molecules were subjected to molecular conductance measurements to explore their capability towards single-crystal field-effect transistors (Part 1), molecular wires, and single electron......, however, was obtained by a study of a single molecular transistor. The investigated OPE5-TTF compound was captured in a three-terminal experiment, whereby manipulation of the molecule’s electronic spin was possible in different charge states. Thus, we demonstrated how the cruciform molecules could...

  8. Power Electronics

    DEFF Research Database (Denmark)

    Iov, Florin; Ciobotaru, Mihai; Blaabjerg, Frede

    2008-01-01

    energy at the end-user should also be set up. Deregulation of energy has in the past lowered the investment in larger power plants, which means the need for new electrical power sources will be high in the near future. Two major technologies will play important roles to solve the future problems. One...... is to change the electrical power production sources from the conventional, fossil (and short term) based energy sources to renewable energy resources. The other is to use high efficient power electronics in power generation, power transmission/distribution and end-user application. This paper discuss the most...... emerging renewable energy sources, wind energy, which by means of power electronics are changing from being a minor energy source to be acting as an important power source in the energy system. Power electronics is the enabling technology and the presentation will cover the development in wind turbine...

  9. Electron Spectroscopy

    Science.gov (United States)

    Siegbahn, Kai

    Wilhelm Conrad Röntgen's discovery of X radiation in 1895 in Wörzburg resulted in an immediate break-through not only in physics but also in Society, the latter mainly because of its sensational radiological applications. Within a short time it furthermore indirectly led to the discovery of radioactivity by Henri Becquerel. The discovery of X radiation opened the gate to modern atomic physics, and radioactivity to nuclear physics. Later on, the discovery of X-ray diffraction by Laue, Friedrich and Knipping in 1912 initiated the field of X-ray spectroscopy with its fundamental contributions to atomic and crystal structures. Secondary electrons were early observed in the scattered radiation when X-rays were hitting a sample. The development of the corresponding electron spectroscopy had to wait a much longer time for its maturity. A survey of electron spectroscopy is presented.

  10. Electronic Commerce

    Energy Technology Data Exchange (ETDEWEB)

    Laird, N. [NRG Information Services Inc., Calgary, AB (Canada)

    1995-11-01

    The concept of electronic commerce in the gas industry was discussed. It was defined as the integration of communication technology, advanced information processing capability and business standards, to improve effectiveness of the business process. Examples of electronic data interchange from the automotive, airline, and banking industry were given. The objective of using this technology in the gas industry was described as the provision of one electronic facility to make seamless contractual and operational arrangements for moving natural gas across participating pipelines. The benefit of seamless integration - one readily available standard system used by several companies - was highlighted. A list of value-added services such as the free movement of bulletins, directories, nominations,and other documents was provided.

  11. Spin electronics

    CERN Document Server

    Buhrman, Robert; Daughton, James; Molnár, Stephan; Roukes, Michael

    2004-01-01

    This report is a comparative review of spin electronics ("spintronics") research and development activities in the United States, Japan, and Western Europe conducted by a panel of leading U.S. experts in the field. It covers materials, fabrication and characterization of magnetic nanostructures, magnetism and spin control in magnetic nanostructures, magneto-optical properties of semiconductors, and magnetoelectronics and devices. The panel's conclusions are based on a literature review and a series of site visits to leading spin electronics research centers in Japan and Western Europe. The panel found that Japan is clearly the world leader in new material synthesis and characterization; it is also a leader in magneto-optical properties of semiconductor devices. Europe is strong in theory pertaining to spin electronics, including injection device structures such as tunneling devices, and band structure predictions of materials properties, and in development of magnetic semiconductors and semiconductor heterost...

  12. Molecular Electronics

    DEFF Research Database (Denmark)

    Jennum, Karsten Stein

    ) are chemically merged together to form cruciform-like structures that are an essential part of the thesis. The cruciform molecules were subjected to molecular conductance measurements to explore their capability towards single-crystal field-effect transistors (Part 1), molecular wires, and single electron......This thesis includes the synthesis and characterisation of organic compounds designed for molecular electronics. The synthesised organic molecules are mainly based on two motifs, the obigo(phenyleneethynylenes) (OPE)s and tetrathiafulvalene (TTF) as shown below. These two scaffolds (OPE and TTF......, however, was obtained by a study of a single molecular transistor. The investigated OPE5-TTF compound was captured in a three-terminal experiment, whereby manipulation of the molecule’s electronic spin was possible in different charge states. Thus, we demonstrated how the cruciform molecules could...

  13. Greening Electronics

    DEFF Research Database (Denmark)

    Pizzol, Massimo; Søes Kokborg, Morten; Thomsen, Marianne

    Based on a literature review with focus on hazardous substances in waste electric and electronic equipment (WEEE) and numbers from a Danish treatment facility a flow analysis for specific substances has been conducted. Further, the accessible knowledge on human and environmental effects due...

  14. Superconducting electronics

    NARCIS (Netherlands)

    Rogalla, Horst

    1994-01-01

    During the last decades superconducting electronics has been the most prominent area of research for small scale applications of superconductivity. It has experienced quite a stormy development, from individual low frequency devices to devices with high integration density and pico second switching

  15. Electronic Portfolios.

    Science.gov (United States)

    Purves, Alan C.

    1996-01-01

    Outlines three forms of electronic portfolio based on a student's work, a class project about a specific topic, and a class seminar on a broad topic. Discusses logistical problems of management, access, and cross-referencing; technical problems of input, access, and copying; and theoretical issues of the lack of realia, of ownership and copyright,…

  16. Electronic Money.

    Science.gov (United States)

    Schilling, Tim

    Thirty years ago a cashless society was predicted for the near future; paper currency and checks would be an antiquated symbol of the past. Consumers would embrace a new alternative for making payments: electronic money. But currency is still used for 87% of payments, mainly for "nickel and dime" purchases. And checks are the payment…

  17. Electronic spectroscopies

    NARCIS (Netherlands)

    Weckhuysen, B.M.; Schoonheydt, R.A.

    2000-01-01

    Diffuse reflectance spectroscopy (DRS) in the ultraviolet, visible and near-infrared region is a versatile spectroscopic technique, as both d-d and charge transfer transitions of supported TMI can be probed. One of the advantages of electronic spectroscopy is that the obtained information is

  18. Electronic Homework.

    Science.gov (United States)

    Lee, Fong-lok; Heyworth, Rex M.

    The Electronic Homework assistant system is composed of two components: the Computer Tutor and the Homework Administrator. The Computer Tutor is an intelligent tutoring system that can provide personal assistance like supplying hints, checking errors, providing remediation and prioritizing problems. The Homework Administrator is a teacher's…

  19. Greening Electronics

    DEFF Research Database (Denmark)

    Pizzol, Massimo; Søes Kokborg, Morten; Thomsen, Marianne

    Based on a literature review with focus on hazardous substances in waste electric and electronic equipment (WEEE) and numbers from a Danish treatment facility a flow analysis for specific substances has been conducted. Further, the accessible knowledge on human and environmental effects due to po...

  20. Electronic Government

    DEFF Research Database (Denmark)

    Wimmer, Maria A.; Traunmüller, Roland; Grönlund, Åke

    This book constitutes the refereed proceedings of the 4th International Conference on Electronic Government, EGOV 2005, held in Copenhagen, Denmark, in August 2005. The 30 revised papers presented were carefully reviewed and selected from numerous submissions, and assess the state-of-the-art in e...

  1. Electronic detectors for electron microscopy.

    Science.gov (United States)

    Faruqi, A R; McMullan, G

    2011-08-01

    Electron microscopy (EM) is an important tool for high-resolution structure determination in applications ranging from condensed matter to biology. Electronic detectors are now used in most applications in EM as they offer convenience and immediate feedback that is not possible with film or image plates. The earliest forms of electronic detector used routinely in transmission electron microscopy (TEM) were charge coupled devices (CCDs) and for many applications these remain perfectly adequate. There are however applications, such as the study of radiation-sensitive biological samples, where film is still used and improved detectors would be of great value. The emphasis in this review is therefore on detectors for use in such applications. Two of the most promising candidates for improved detection are: monolithic active pixel sensors (MAPS) and hybrid pixel detectors (of which Medipix2 was chosen for this study). From the studies described in this review, a back-thinned MAPS detector appears well suited to replace film in for the study of radiation-sensitive samples at 300 keV, while Medipix2 is suited to use at lower energies and especially in situations with very low count rates. The performance of a detector depends on the energy of electrons to be recorded, which in turn is dependent on the application it is being used for; results are described for a wide range of electron energies ranging from 40 to 300 keV. The basic properties of detectors are discussed in terms of their modulation transfer function (MTF) and detective quantum efficiency (DQE) as a function of spatial frequency.

  2. Electronic Aggression

    Centers for Disease Control (CDC) Podcasts

    2007-11-20

    Aggression is no longer limited to the school yard. New forms of electronic media, such as blogs, instant messaging, chat rooms, email, text messaging, and the internet are providing new arenas for youth violence to occur.  Created: 11/20/2007 by National Center for Injury Prevention and Control, Division of Violence Prevention.   Date Released: 11/28/2007.

  3. Interacting Electrons

    Science.gov (United States)

    Martin, Richard M.; Reining, Lucia; Ceperley, David M.

    2016-06-01

    Preface; Part I. Interacting Electrons: Beyond the Independent-Particle Picture: 1. The many electron problem: introduction; 2. Signatures of electron correlation; 3. Concepts and models for interacting electrons; Part II. Foundations of Theory for Many-Body Systems: 4. Mean fields and auxiliary systems; 5. Correlation functions; 6. Many-body wavefunctions; 7. Particles and quasi-particles; 8. Functionals in many-particle physics; Part III. Many-Body Green's Function Methods: 9. Many-body perturbation theory: expansion in the interaction; 10. Many-body perturbation theory via functional derivatives; 11. The RPA and the GW approximation for the self-energy; 12. GWA calculations in practice; 13. GWA calculations: illustrative results; 14. RPA and beyond: the Bethe-Salpeter equation; 15. Beyond the GW approximation; 16. Dynamical mean field theory; 17. Beyond the single-site approximation in DMFT; 18. Solvers for embedded systems; 19. Characteristic hamiltonians for solids with d and f states; 20. Examples of calculations for solids with d and f states; 21. Combining Green's functions approaches: an outlook; Part IV. Stochastic Methods: 22. Introduction to stochastic methods; 23. Variational Monte Carlo; 24. Projector quantum Monte Carlo; 25. Path integral Monte Carlo; 26. Concluding remarks; Part V. Appendices: A. Second quantization; B. Pictures; C. Green's functions: general properties; D. Matsubara formulation for Green's functions for T ̸= 0; E. Time-ordering, contours, and non-equilibrium; F. Hedin's equations in a basis; G. Unique solutions in Green's function theory; H. Properties of functionals; I. Auxiliary systems and constrained search; J. Derivation of the Luttinger theorem; K. Gutzwiller and Hubbard approaches; References; Index.

  4. ELECTRON GUN

    Science.gov (United States)

    Christofilos, N.C.; Ehlers, K.W.

    1960-04-01

    A pulsed electron gun capable of delivering pulses at voltages of the order of 1 mv and currents of the order of 100 amperes is described. The principal novelty resides in a transformer construction which is disposed in the same vacuum housing as the electron source and accelerating electrode structure of the gun to supply the accelerating potential thereto. The transformer is provided by a plurality of magnetic cores disposed in circumferentially spaced relation and having a plurality of primary windings each inductively coupled to a different one of the cores, and a helical secondary winding which is disposed coaxially of the cores and passes therethrough in circumferential succession. Additional novelty resides in the disposition of the electron source cathode filament input leads interiorly of the transformer secondary winding which is hollow, as well as in the employment of a half-wave filament supply which is synchronously operated with the transformer supply such that the transformer is pulsed during the zero current portions of the half-wave cycle.

  5. Basic electronics

    CERN Document Server

    Tayal, DC

    2010-01-01

    The second edition of this book incorporates the comments and suggestions of my friends and students who have critically studied the first edition. In this edition the changes and additions have been made and subject matter has been rearranged at some places. The purpose of this text is to provide a comprehensive and up-to-date study of the principles of operation of solid state devices, their basic circuits and application of these circuits to various electronic systems, so that it can serve as a standard text not only for universities and colleges but also for technical institutes. This book

  6. Electronic materials

    CERN Document Server

    Kwok, H L

    2010-01-01

    The electronic properties of solids have become of increasing importance in the age of information technology. The study of solids and materials, while having originated from the disciplines of physics and chemistry, has evolved independently over the past few decades. The classical treatment of solid-state physics, which emphasized classifications, theories and fundamental physical principles, is no longer able to bridge the gap between materials advances and applications. In particular, the more recent developments in device physics and technology have not necessarily been driven by new conc

  7. Electronic Router

    Science.gov (United States)

    Crusan, Jason

    2005-01-01

    Electronic Router (E-Router) is an application program for routing documents among the cognizant individuals in a government agency or other organization. E-Router supplants a prior 14 NASA Tech Briefs, May 2005 system in which paper documents were routed physically in packages by use of paper slips, packages could be lost, routing times were unacceptably long, tracking of packages was difficult, and there was a need for much photocopying. E-Router enables a user to create a digital package to be routed. Input accepted by E-Router includes the title of the package, the person(s) to whom the package is to be routed, attached files, and comments to reviewers. Electronic mail is used to notify reviewers of needed actions. The creator of the package can, at any time, see the status of the package in the routing structure. At the end of the routing process, E-Router keeps a record of the package and of approvals and/or concurrences of the reviewers. There are commercial programs that perform the general functions of E-Router, but they are more complicated. E-Router is Web-based, easy to use, and does not require the installation or use of client software.

  8. Practical electronics handbook

    CERN Document Server

    Sinclair, Ian R

    2013-01-01

    Practical Electronics Handbook, Third Edition provides the frequently used and highly applicable principles of electronics and electronic circuits.The book contains relevant information in electronics. The topics discussed in the text include passive and active discrete components; linear and digital I.C.s; microprocessors and microprocessor systems; digital-analogue conversions; computer aids in electronics design; and electronic hardware components.Electronic circuit constructors, service engineers, electronic design engineers, and anyone with an interest in electronics will find the book ve

  9. О статусе материнской спороцисты Fasciola hepatica Linnaeus, 1758 в тканях Lymnaea truncatula Muller, 1774

    OpenAIRE

    Соколина, Флюра

    2007-01-01

    Морфофункциональные механизмы адаптогенеза системы «паразит-хозяин» мало изучены. В статье изложены данные, полученные при гистологических исследованиях тканей Lymnaea truncatula Muller, 1774 зараженных Fasciola hepatica Linnaeus, 1758, возбудителем заболевания печени человека и животных. Уточнены места проникновения и локализации личинок фасциолы на стадии материнской спороцисты....

  10. Electronic Preprints

    Science.gov (United States)

    Hanisch, R.

    1999-12-01

    Despite the tremendous advances in electronic publications and the increasing rapidity with which papers are now moving from acceptance into ``print,'' preprints continue to be an important mode of communication within the astronomy community. The Los Alamos e-preprint service, astro-ph, provides for rapid and cost-free (to authors and readers) dissemination of manuscripts. As the use of astro-ph has increased the number of paper preprints in circulation to libraries has decreased, and institutional preprint series appear to be waning. It is unfortunate, however, that astro-ph does not function in collaboration with the refereed publications. For example, there is no systematic tracking of manuscripts from preprint to their final, published form, and as a centralized archive it is difficult to distribute the tracking and maintenance functions. It retains documents that have been superseded or have become obsolete. We are currently developing a distributed preprint and document management system which can support both distributed collections of preprints (e.g., traditional institutional preprint series), can link to the LANL collections, can index other documents in the ``grey'' literature (observatory reports, telescope and instrument user's manuals, calls for proposals, etc.), and can function as a manuscript submission tool for the refereed journals. This system is being developed to work cooperatively with the refereed literature so that, for example, links to preprints are updated to links to the final published papers.

  11. Sustainable Management of Electronics

    Science.gov (United States)

    To provide information on EPAs strategy for electronics stewardship, certified electronics recyclers and the Challenge; as well as where to donate unwanted electronics, how to calculate benefits, and what's going on with electronics mgmt in their states.

  12. EDITORIAL: Synaptic electronics Synaptic electronics

    Science.gov (United States)

    Demming, Anna; Gimzewski, James K.; Vuillaume, Dominique

    2013-09-01

    Conventional computers excel in logic and accurate scientific calculations but make hard work of open ended problems that human brains handle easily. Even von Neumann—the mathematician and polymath who first developed the programming architecture that forms the basis of today's computers—was already looking to the brain for future developments before his death in 1957 [1]. Neuromorphic computing uses approaches that better mimic the working of the human brain. Recent developments in nanotechnology are now providing structures with very accommodating properties for neuromorphic approaches. This special issue, with guest editors James K Gimzewski and Dominique Vuillaume, is devoted to research at the serendipitous interface between the two disciplines. 'Synaptic electronics', looks at artificial devices with connections that demonstrate behaviour similar to synapses in the nervous system allowing a new and more powerful approach to computing. Synapses and connecting neurons respond differently to incident signals depending on the history of signals previously experienced, ultimately leading to short term and long term memory behaviour. The basic characteristics of a synapse can be replicated with around ten simple transistors. However with the human brain having around 1011 neurons and 1015 synapses, artificial neurons and synapses from basic transistors are unlikely to accommodate the scalability required. The discovery of nanoscale elements that function as 'memristors' has provided a key tool for the implementation of synaptic connections [2]. Leon Chua first developed the concept of the 'The memristor—the missing circuit element' in 1971 [3]. In this special issue he presents a tutorial describing how memristor research has fed into our understanding of synaptic behaviour and how they can be applied in information processing [4]. He also describes, 'The new principle of local activity, which uncovers a minuscule life-enabling "Goldilocks zone", dubbed the

  13. Electronic Mimosa

    Science.gov (United States)

    Gupta, Sanjay; Datta, Meera S.; Rana, Vivek; Grover, Shailesh

    1996-04-01

    This paper describes the design of a low-cost, 2D, electromagnetic tracking device for personal computers. This interface makes use of the well-known principle of electromagnetic induction to locate the position of a transmitter in an x-y plane. This device has a ring which is worn by the user on the index finger. The computer monitor is overlaid with a transparent screen equipped with tuned electromagnetic sensors. These sensors pick up the signals transmitted by the transmitter coil on the finger. The receiver circuit extracts the envelope of the received signal and digitizes it. These digitized values of x and y axis signals are read by the computer through the standard parallel port. The system software running on the computer calculates the x and y co-ordinates of the transmitter coil and displays a cursor at that location. The transmitter also has a button which can be used like a mouse button. This keypress information is also transmitted by the electromagnetic means. The device driver for this tracker replaces the standard mouse driver. Hence most applications which use a mouse can also use this tracker. Its name `Mimosa' indicates that the user need not touch the screen (Mimosa Pudica is the Latin name of a plant whose leaves wilt when touched). Presently work is on to achieve uniform sensitivity over the entire screen and reducing transmitter power consumption. In order to demonstrate its working, a small, 3D game was written. The player has to reach a pre-defined location after traversing through a maze. The paper describes the interface electronics, system software, mechanical design and the sample application.

  14. Carbon Nanotube Electron Gun

    Science.gov (United States)

    Nguyen, Cattien V. (Inventor); Ribaya, Bryan P. (Inventor)

    2013-01-01

    An electron gun, an electron source for an electron gun, an extractor for an electron gun, and a respective method for producing the electron gun, the electron source and the extractor are disclosed. Embodiments provide an electron source utilizing a carbon nanotube (CNT) bonded to a substrate for increased stability, reliability, and durability. An extractor with an aperture in a conductive material is used to extract electrons from the electron source, where the aperture may substantially align with the CNT of the electron source when the extractor and electron source are mated to form the electron gun. The electron source and extractor may have alignment features for aligning the electron source and the extractor, thereby bringing the aperture and CNT into substantial alignment when assembled. The alignment features may provide and maintain this alignment during operation to improve the field emission characteristics and overall system stability of the electron gun.

  15. Nano-Electronics and Bio-Electronics

    Science.gov (United States)

    Srivastava, Deepak; Kwak, Dochan (Technical Monitor)

    2001-01-01

    Viewgraph presentation on Nano-Electronics and Bio-Electronics is discussed. Topics discussed include: NASA Ames nanotechnology program, Potential Carbon Nanotube (CNT) application, CNT synthesis,Computational Nanotechnology, and protein nanotubes.

  16. Electronics for LHC Experiments

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-07-01

    This document gathers the abstracts of most presentations made at this workshop on electronics for the large hadron collider (LHC) experiments. The presentations were arranged into 6 sessions: 1) electronics for tracker, 2) trigger electronics, 3) detector control systems, 4) data acquisition, 5) electronics for calorimeters and electronics for muons, and 6) links, power systems, grounding and shielding, testing and quality assurance.

  17. Interface Electronic Circuitry for an Electronic Tongue

    Science.gov (United States)

    Keymeulen, Didier; Buehler, Martin

    2007-01-01

    Electronic circuitry has been developed to serve as an interface between an electronic tongue and digital input/output boards in a laptop computer that is used to control the tongue and process its readings. Electronic tongues can be used for a variety of purposes, including evaluating water quality, analyzing biochemicals, analyzing biofilms, and measuring electrical conductivities of soils.

  18. Electron beam focusing system

    Energy Technology Data Exchange (ETDEWEB)

    Dikansky, N.; Nagaitsev, S.; Parkhomchuk, V.

    1997-09-01

    The high energy electron cooling requires a very cold electron beam. Thus, the electron beam focusing system is very important for the performance of electron cooling. A system with and without longitudinal magnetic field is presented for discussion. Interaction of electron beam with the vacuum chamber as well as with the background ions and stored antiprotons can cause the coherent electron beam instabilities. Focusing system requirements needed to suppress these instabilities are presented.

  19. Electronics and Information

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ Previously founded as CCPITMachinery and Electronics Sub-council and CCOIC Machinery and Electronics Chamber of Corn-merce in June, 1988, CCPIT Electronics Sub-Council and CCOIC Electronics Chamber of Commerce were established in May, 1993, and then renamed as CCPIT Electronics and Information Industry Sub-council and CCOIC Electronics and Infor-mation Industry Chamber of Commerce (CCPITECC) in September 1999.

  20. Electronic Correlations in Electron Transfer Systems

    Science.gov (United States)

    Bulla, Ralf; Tornow, Sabine; Anders, Frithjof

    Electron transfer processes play a central role in many chemical and biological systems. Already the transfer of a single electron from the donor to the acceptor can be viewed as a complicated many-body problem, due to the coupling of the electron to the infinitely many environmental degrees of freedom, realized by density fluctuations of the solvent or molecular vibrations of the protein matrix. We focus on the quantum mechanical modelling of two-electron transfer processes whose dynamics is governed by the Coulomb interaction between the electrons as well as the environmental degrees of freedoms represented by a bosonic bath. We identify the regime of parameters in which concerted transfer of the two electrons occurs and discuss the influence of the Coulomb repulsion and the coupling strength to the environment on the electron transfer rate. Calculations are performed using the non-perturbative numerical renormalization group approach for both equilibrium and non-equilibrium properties.

  1. Electron Microscopy Center (EMC)

    Data.gov (United States)

    Federal Laboratory Consortium — The Electron Microscopy Center (EMC) at Argonne National Laboratory develops and maintains unique capabilities for electron beam characterization and applies those...

  2. Molluscicidal activity of Lawsonia inermis and its binary and tertiary combinations with other plant derived molluscicides.

    Science.gov (United States)

    Singh, A; Singh, D K

    2001-03-01

    Molluscicidal activity of leaf, bark and seed of Lawsonia inermis against Lymnaea acuminata and Indoplanorbis exustus was studied. Highest toxicity was observed in the seed of Lawsonia inermis. Toxicity of binary (1:1) and tertiary (1:1:1) combinations of the essential oil of cedar (Cedrus deodara Roxh) and neem (Azadirachta indica A. Juss), powder from bulb of garlic (Allium sativum Linn), and oleoresin extracted from rhizome of ginger (Zingiber officinale Rosc) with Lawsonia inermis and Embelia ribes fruit powder were studied against L. acuminata and I. exustus. L. inermis seed powder in combination with Cedrus deodara oil and Azadirachta indica oil was more toxic than their individual components and other combinations.

  3. Investigations on Electronic Materials

    OpenAIRE

    E. Pugnor; T. Kormány

    1982-01-01

    Electronics has been described as a materials oriented technology. In this sense a short review is given concerning: the connection of materials characterization to the design and processing of electronic components; the most important materials characterization methods used for electronic materials; the strategy of organizing a complete material characterization system for selected electronic components.

  4. Electron-attachment processes

    Science.gov (United States)

    Christophorou, L. G.; McCorkle, D. L.; Christodoulides, A. A.

    Topics covered include: modes of production of negative ions, techniques for the study of electron attachment processes, dissociative electron attachment to ground state molecules, dissociative electron attachment to hot molecules (effects of temperature on dissociative electron attachment), molecular parent negative ions, and negative ions formed by ion pair processes and by collisions of molecules with ground state and Rydberg atoms.

  5. Electronic Health Records

    Science.gov (United States)

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Electronic Health Records KidsHealth > For Teens > Electronic Health Records Print A A A What's in ... t happen overnight, they are coming. Understanding EHRs Electronic health records (EHR) — also called electronic medical records ( ...

  6. Introduction to electronics

    CERN Document Server

    CERN. Geneva

    2005-01-01

    Electronics in HEP experiments: specificities and evolution The Art of Electronics: is there something beyond Ohm's law? Basic building blocks of Analog electronics: quickly understanding a schematic Charge preamps, current preamps and future preamps, shaping and the rest Electronics noise: fundamental and practical Evolution of technology: ASICs, FPGAs...

  7. Introduction to Electronics course

    CERN Document Server

    CERN. Geneva HR-RFA

    2006-01-01

    Electronics in HEP experiments: specificities and evolution The Art of Electronics: is there something beyond Ohm's law? Basic building blocks of Analog electronics: quickly understanding a schematic Charge preamps, current preamps and future preamps, shaping and the rest Electronics noise: fundamental and practical Evolution of technology: ASICs, FPGAs...

  8. Electronic Health Records

    Science.gov (United States)

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Electronic Health Records KidsHealth > For Teens > Electronic Health Records A A A What's in this ... t happen overnight, they are coming. Understanding EHRs Electronic health records (EHR) — also called electronic medical records ( ...

  9. Introduction to Electronic Marketing.

    Science.gov (United States)

    Dilbeck, Lettie

    These materials for a five-unit course were developed to introduce secondary and postsecondary students to the use of electronic equipment in marketing. The units cover the following topics: electronic marketing as a valid marketing approach; telemarketing; radio electronic media marketing; television electronic media marketing; and cable TV…

  10. Hybrid printed electronics

    NARCIS (Netherlands)

    Koetse, M.; Smits, E.; Rubingh, E.; Teunissen, P.; Kusters, R.; Abbel, R.; Brand, J. van den

    2016-01-01

    Although many electronic functionalities can be realized by printed or organic electronics, short-term marketable products often require robust, reproducible, and nondisturbing technologies. In this chapter we show how hybrid electronics, a combination of printed circuitry, thin-film electronics,

  11. Electron transfer reactions

    CERN Document Server

    Cannon, R D

    2013-01-01

    Electron Transfer Reactions deals with the mechanisms of electron transfer reactions between metal ions in solution, as well as the electron exchange between atoms or molecules in either the gaseous or solid state. The book is divided into three parts. Part 1 covers the electron transfer between atoms and molecules in the gas state. Part 2 tackles the reaction paths of oxidation states and binuclear intermediates, as well as the mechanisms of electron transfer. Part 3 discusses the theories and models of the electron transfer process; theories and experiments involving bridged electron transfe

  12. Electronics engineer's reference book

    CERN Document Server

    Mazda, F F

    1989-01-01

    Electronics Engineer's Reference Book, Sixth Edition is a five-part book that begins with a synopsis of mathematical and electrical techniques used in the analysis of electronic systems. Part II covers physical phenomena, such as electricity, light, and radiation, often met with in electronic systems. Part III contains chapters on basic electronic components and materials, the building blocks of any electronic design. Part IV highlights electronic circuit design and instrumentation. The last part shows the application areas of electronics such as radar and computers.

  13. Practical microwave electron devices

    CERN Document Server

    Meurant, Gerard

    2013-01-01

    Practical Microwave Electron Devices provides an understanding of microwave electron devices and their applications. All areas of microwave electron devices are covered. These include microwave solid-state devices, including popular microwave transistors and both passive and active diodes; quantum electron devices; thermionic devices (including relativistic thermionic devices); and ferrimagnetic electron devices. The design of each of these devices is discussed as well as their applications, including oscillation, amplification, switching, modulation, demodulation, and parametric interactions.

  14. Electronics engineer's reference book

    CERN Document Server

    Turner, L W

    1976-01-01

    Electronics Engineer's Reference Book, 4th Edition is a reference book for electronic engineers that reviews the knowledge and techniques in electronics engineering and covers topics ranging from basics to materials and components, devices, circuits, measurements, and applications. This edition is comprised of 27 chapters; the first of which presents general information on electronics engineering, including terminology, mathematical equations, mathematical signs and symbols, and Greek alphabet and symbols. Attention then turns to the history of electronics; electromagnetic and nuclear radiatio

  15. First record of a rare transversotrematid cercaria larva (Trematoda: Digenea) from Rajasthan, India: focus on seasonal occurrence and host-specificity of diverse cercariae.

    Science.gov (United States)

    Choubisa, Shanti Lal; Jaroli, Vishva Jeet; Sheikh, Zulfiya

    2017-06-01

    During the survey of freshwater snail hosts and their digenean larval trematode parasites, a rare cercaria larva belonging to family Transversotrematidae and subclass Digenea (Trematoda) was recovered from the snail species Melanoides striatella tuberculata inhabiting perennial Som river of Udaipur district, Rajasthan, India. More than 28 % mature specimens of these snails were found to be infected with transversotrematid cercaria larvae in the spring season. Body of this cercaria is large, bowl-shaped, biocellate, spinose, transparent and laterally extended having two pigmented eye spots, two hold fast organs extended from the junction of body and tail, large tail with two foliated furcal rami, and cyclocoel intestinal caeca. As far as the authors are aware, this is the first record of a transversotrematid larva from Rajasthan, India. Simultaneously, other forms of cercariae viz., amphistome, echinostome, monostome, gymnocephalous, furcocercous and xiphidiocercous cercariae were also recovered from fifteen species of pulmonate and operculate snails including Lymnaea acuminata f. patula, L. acuminata f. chlamys, L. acuminata f. typica, L. acuminata f. rufescens, L. luteola f. australis, L. luteola f. typica, L. luteola f. impura, Planorbis (Indoplanorbis) exustus, and Anisus (Gyraulus) convexiusculus, Faunus ater, Melania (Plotia) scabra, Thiara (Tarebia) lineata, Melanoides striatella tuberculata, Vivipara bengalensis race gigantica and V. bengalensis race mandiensis. The seasonal occurrence and host-specificity of diverse trematode cercaria larvae are also discussed besides the first record of a rare transversotrematid cercaria larva from Rajasthan, India.

  16. Single electron-ics with carbon nanotubes

    NARCIS (Netherlands)

    Götz, G.T.J.

    2010-01-01

    We experimentally investigate Quantum Dots, formed in Carbon Nanotubes. The first part of this thesis deals with charge sensing on such quantum dots. The charge sensor is a metallic Single-electron-transistor, sensitive to the charge of a single electron on the quantum dot. We use this technique for

  17. Electron-electron interactions in disordered systems

    CERN Document Server

    Efros, AL

    1985-01-01

    ``Electron-Electron Interactions in Disordered Systems'' deals with the interplay of disorder and the Coulomb interaction. Prominent experts give state-of-the-art reviews of the theoretical and experimental work in this field and make it clear that the interplay of the two effects is essential, especially in low-dimensional systems.

  18. VIRTUAL ELECTRONIC COMPONENTS OF THE ELECTRONIC EQUIPMENT

    Directory of Open Access Journals (Sweden)

    E. Lazarevich

    2013-01-01

    Full Text Available The article is present new idea of the creation, developments and improvements of the electronic equipment of complex systems by means of the virtual electronic components. The idea of the virtual electronic components is a presentation and perception of the creation and developments of the equipment on two forming: real – in the manner of standard marketed block of the intellectual property and image – in the manner of virtual component. The real component in most cases slows the development of the electronic equipment. The imaginary component is the «locomotive» of development of the electronic equipment. The Imaginary component contains the scientific has brushed against developer. The scientific has brushed against developer reveals of itself in the manner of virtual component on the modern level of the design rates of microelectronics.

  19. Electron transporting semiconducting polymers in organic electronics.

    Science.gov (United States)

    Zhao, Xingang; Zhan, Xiaowei

    2011-07-01

    Significant progress has been achieved in the preparation of semiconducting polymers over the past two decades, and successful commercial devices based on them are slowly beginning to enter the market. However, most of the conjugated polymers are hole transporting, or p-type, semiconductors that have seen a dramatic rise in performance over the last decade. Much less attention has been devoted to electron transporting, or n-type, materials that have lagged behind their p-type counterparts. Organic electron transporting materials are essential for the fabrication of organic p-n junctions, organic photovoltaic cells (OPVs), n-channel organic field-effect transistors (OFETs), organic light-emitting diodes (OLEDs) and complementary logic circuits. In this critical review we focus upon recent developments in several classes of electron transporting semiconducting polymers used in OLEDs, OFETs and OPVs, and survey and analyze what is currently known concerning electron transporting semiconductor architecture, electronic structure, and device performance relationships (87 references).

  20. Electronics for dummies

    CERN Document Server

    Shamieh

    2015-01-01

    Explore the basic concepts of electronics, build your electronics workbench, and begin creating fun electronics projects right away! Electronics For Dummies, 3rd Edition is your guide to the world of electronics. Spanning circuitry, wiring, robotics, transmitters, amplifiers, and more, this book demystifies electricity basics and beyond. The third edition offers new content revised to reflect the latest advancements in the electronics field, and it offers full color project examples to spark your creativity and inspire you to put your new skills to use! Packed with projects that can be comple

  1. High energy electron cooling

    Energy Technology Data Exchange (ETDEWEB)

    Parkhomchuk, V. [Budker Institute of Nuclear Physics, Novosibirsk (Russian Federation)

    1997-09-01

    High energy electron cooling requires a very cold electron beam. The questions of using electron cooling with and without a magnetic field are presented for discussion at this workshop. The electron cooling method was suggested by G. Budker in the middle sixties. The original idea of the electron cooling was published in 1966. The design activities for the NAP-M project was started in November 1971 and the first run using a proton beam occurred in September 1973. The first experiment with both electron and proton beams was started in May 1974. In this experiment good result was achieved very close to theoretical prediction for a usual two component plasma heat exchange.

  2. RHIC electron lenses upgrades

    Energy Technology Data Exchange (ETDEWEB)

    Gu, X. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Altinbas, Z. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Bruno, D. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Binello, S. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Costanzo, M. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Drees, A. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Fischer, W. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Gassner, D. M. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Hock, J. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Hock, K. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Harvey, M. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Luo, Y. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Marusic, A. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Mi, C. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Mernick, K. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Minty, M. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Michnoff, R. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Miller, T. A. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Pikin, A. I. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Robert-Demolaize, G. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Samms, T. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Shrey, T. C. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Schoefer, V. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Tan, Y. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Than, R. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; Thieberger, P. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.; White, S. M. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.

    2015-05-03

    In the Relativistic Heavy Ion Collider (RHIC) 100 GeV polarized proton run in 2015, two electron lenses were used to partially compensate for the head-on beam-beam effect for the first time. Here, we describe the design of the current electron lens, detailing the hardware modifications made after the 2014 commissioning run with heavy ions. A new electron gun with 15-mm diameter cathode is characterized. The electron beam transverse profile was measured using a YAG screen and fitted with a Gaussian distribution. During operation, the overlap of the electron and proton beams was achieved using the electron backscattering detector in conjunction with an automated orbit control program.

  3. Electronic Commerce and Competitive Procurement

    Science.gov (United States)

    1991-06-01

    Explains the application of electronic commerce techniques (electronic data interchange (EDI), electronic mail (E-mail), electronic bulletin boards...purchase procedures of the Federal Acquisition Regulation (FAR). Changes to the FAR to recognize electronic commerce are recommended. Also discussed...are opportunities to use electronic commerce and small business and legal considerations of electronic commerce . This report describes how electronic

  4. 小果野芭蕉种子散布和不同时空尺度上种子被捕食格局%SEED DISPERSAL AND SPATIAL-TEMPORAL VARIATION OF SEED PREDATION OF MUSA ACUMINATA IN XISHUANGBANNA, SOUTHWEST CHINA

    Institute of Scientific and Technical Information of China (English)

    孟令曾; 高秀霞; 陈进

    2008-01-01

    以分布在云南西双版纳地区的大型先锋草本植物小果野芭蕉(Musa acuminata)为研究材料,研究其种子初次散布过程和不同时空尺度上种子被捕食格局.小果野芭蕉的成熟果实有75%在夜间被取食和传播,在白天消失的果实则占25%.蝙蝠是其最主要的种子传播者,鸟类在其种子传播过程中也起到一定的作用.人工摆放种子试验结果显示小果野芭蕉种子的主要转移者是小型啮齿类(鼠类)和蚁类:在开放处理下3 d后转移率为86%,排除蚁类(鼠类可进入)处理下种子转移率为69%以及排除鼠类(蚂蚁可进入)处理下种子被转移率为56%.季节、地点和生境均显著影响人工摆放种子被转移强度:雨季显著高于旱季(p<0.001),野芭蕉生境显著高于与其相连的自然森林和荒地(p<0.001),在人为干扰较少的补蚌自然保护区显著低于西双版纳热带植物园和新山,而后两者之间并无显著差异(p>0.05).同时,地点和生境以及季节、地点和生境都有显著的交互作用.与相邻的森林和荒地相比,野芭蕉群落中种子被鼠类捕食的强度最大且受蚁类二次转移的比例最少,森林和荒地中种子被鼠类捕食的强度相对较小且蚁类对种子的二次转移比例较高,从而更好地帮助种子逃避鼠类捕食.因此,依赖于食果动物(主要是蝙蝠,也包括鸟类)的初次散布是小果野芭蕉种子逃避捕食的关键.

  5. 香蕉ARF3基因全长克隆及其对枯萎病菌的响应特性分析%Cloning the Full-length cDNA of ARF3 Gene from Banana (Musa acuminata) and Characterizing Its Response to Banana Fusarium

    Institute of Scientific and Technical Information of China (English)

    杨浩; 杜中军; 徐立; 唐志鹏; 李志英

    2013-01-01

    ARF3 gene is one of member of the ARF gene family. The functions of ARF3 gene are considered to involve in cell signal transduction, membrane transportation and vesicle transporting. This study has designed four specific primers according to the core sequence fragment, which was obtained from banana transcriptome. The full cDNA of the ARF3 was cloned from banana (Musa acuminata) by using the approaches of RACE and PCR, the cloned gene was named MuARF3. The gene sequence of 1 427 bp contains an open reading frame (ORF) of 1 166 bp in length that encodes 338 amino acid residuals. BLAST analysis showed that the full-length nucleotide sequence of the ARF3 has a range from 69% to 74% similarities to the reported ARF3 gene of the other plants as well as from 81% to 93% similarities in amino acid sequence. Through infecting banana roots inoculated with banana Fusarium race 4, the expression level of MuARF3 was dramatically elevated to the highest point at 12 h after inoculation and then gradually declined with time elapse. Therefore, the cloned MuARF3 gene has active response to infection of Fusarium physiological race No.4, which might provide a reference for the further use of the gene.%  ARF3基因属于ARF基因家族的成员,主要功能是参与细胞信号转导、跨膜运输及囊泡转运.本研究根据已获得的基因片段设计4条特异性引物,采用RACE技术克隆获得了香蕉ARF3基因cDNA全长序列,命名为MuARF3.该基因序列全长共1427 bp,开放阅读框长度为1166 bp,共编码338个氨基酸.BLAST结果显示,香蕉ARF3基因全长核苷酸序列与已报道的其它植物ARF3具有69%~74%的相似性,氨基酸序列有81%~93%的相似性.用香蕉枯萎病菌4号生理小种侵染香蕉根系后,分析得出的结果表明,侵染根系后香蕉ARF3基因的表达量在侵染后12 h达到最高,并且随着时间推移逐渐降低.由此说明本研究获得的MuARF3基因对香蕉枯萎病菌4号生理小种侵染具有应急

  6. Detection and Genetic Typing of Human Papilloma Virus in 63 Cases of Female Condyloma Acuminata in Changsha Area%长沙地区63例女性生殖道尖锐湿疣患者人乳头瘤病毒的检测及基因分型

    Institute of Scientific and Technical Information of China (English)

    魏颖颖; 李劼; 曾蓉

    2013-01-01

    [目的]探讨21种人乳头瘤病毒(Human papillo mavirusea,HPV)型别在长沙地区女性生殖道尖锐湿疣(Condylomata acuminata,CA)患者中的感染情况及分布特点.[方法]用引物聚合酶链反应(PCR)及基因序列分析的基因分型方法检测长沙地区女性生殖道CA患者HPV型别,分析其分布特点.[结果]经PCR扩增分析67份CA患者活检标本中,63例HPV DNA阳性(88.89%);PCR阳性标本中,56例成功分型;单一型别感染率为94.64%,复合型别感染率为5.35%;检出的低危型占62.71%,高危型占37.29%.HPV亚型分布情况为:HPV11,占38.98%,其次是HPV16,占35.59%;HPV6的感染率为23.73%;CA患者主要集中于20~40岁的性活跃期,30~39岁年龄组患者的HPV感染率较低,<30岁的CA患者中,低危型HPV的感染率显著高于高危型HPV感染率.[结论]本地区CA人群中HPV感染率较高,且以单一亚型感染为主,主要感染型别为HPV11、HPV16和HPV6;HPV各型别的感染率与年龄有一定的关系,该结果为宫颈癌、CA等HPV相关疾病的防治提供了理论依据.%[Objective]To explore the infection status and distribution characteristics of 21 types of human papilloma viruses(HPV) in female condyloma acuminate(CA) in Changsha area. [Methods] Primer-polymer-ase chain reaction(PCR) and genetic typing method based on sequence analysis were used to detect HPV genotypes in female CA in Changsha city. The distribution characteristics were analyzed. [Results] After PCR amplification, 63 of 67 biopsy samples of CA patients were positive for HPV-DNA(88. 89%) in which 56 HPV genotypes were detected successfully. The positive rates of single and multiple HPV types were 94. 64% and 5. 35% , respectively. The detection rate of low-risk HPV and high-risk HPV were 62. 71 % and 37. 29% , respectively. The distribution of HPV showed that HPV11 occupied 38. 98% and the second was HPV16 (35. 59%). The infection rate of HPV6 was 23. 73%. The peak time of CA

  7. Certified Electronics Recyclers

    Science.gov (United States)

    Learn how EPA encourages all electronics recyclers become certified by demonstrating to an accredited, independent third-party auditor and that they meet specific standards to safely recycle and manage electronics.

  8. Chapter 9: Electronics

    OpenAIRE

    Spieler, Helmuth G

    2008-01-01

    Sophisticated front-end electronics are a key part of practically all modern radiation detector systems. This chapter introduces the basic principles and their implementation. Topics include signal acquisition, electronic noise, pulse shaping (analog and digital), and data readout techniques.

  9. Chapter 9: Electronics

    Energy Technology Data Exchange (ETDEWEB)

    Grupen, Claus; Shwartz, Boris A.

    2006-12-19

    Sophisticated front-end electronics are a key part of practically all modern radiation detector systems. This chapter introduces the basic principles and their implementation. Topics include signal acquisition, electronic noise, pulse shaping (analog and digital), and data readout techniques.

  10. Presidential Electronic Records Library

    Data.gov (United States)

    National Archives and Records Administration — PERL (Presidential Electronic Records Library) used to ingest and provide internal access to the Presidential electronic Records of the Reagan, Bush, and Clinton...

  11. THE ELECTRONIC SIGNATURE

    Directory of Open Access Journals (Sweden)

    Voiculescu Madalina Irena

    2009-05-01

    Full Text Available Article refers to significance and the digital signature in electronic commerce. Internet and electronic commerce open up many new opportunities for the consumer, yet, the security (or perceived lack of security of exchanging personal and financial data

  12. Electronic Submission of Labels

    Science.gov (United States)

    Pesticide registrants can provide draft and final labels to EPA electronically for our review as part of the pesticide registration process. The electronic submission of labels by registrants is voluntary but strongly encouraged.

  13. Chapter 9: Electronics

    Energy Technology Data Exchange (ETDEWEB)

    Grupen, Claus; Shwartz, Boris A.

    2006-12-19

    Sophisticated front-end electronics are a key part of practically all modern radiation detector systems. This chapter introduces the basic principles and their implementation. Topics include signal acquisition, electronic noise, pulse shaping (analog and digital), and data readout techniques.

  14. Laboratory Handbook Electronics

    CERN Multimedia

    1966-01-01

    Laboratory manual 1966 format A3 with the list of equipment cables, electronic tubes, chassis, diodes transistors etc. One of CERN's first material catalogue for construction components for mechanical and electronic chassis.

  15. Electron shuttles in biotechnology.

    Science.gov (United States)

    Watanabe, Kazuya; Manefield, Mike; Lee, Matthew; Kouzuma, Atsushi

    2009-12-01

    Electron-shuttling compounds (electron shuttles [ESs], or redox mediators) are essential components in intracellular electron transfer, while microbes also utilize self-produced and naturally present ESs for extracellular electron transfer. These compounds assist in microbial energy metabolism by facilitating electron transfer between microbes, from electron-donating substances to microbes, and/or from microbes to electron-accepting substances. Artificially supplemented ESs can create new routes of electron flow in the microbial energy metabolism, thereby opening up new possibilities for the application of microbes to biotechnology processes. Typical examples of such processes include halogenated-organics bioremediation, azo-dye decolorization, and microbial fuel cells. Herein we suggest that ESs can be applied widely to create new microbial biotechnology processes.

  16. Electronics materials research

    Science.gov (United States)

    1982-01-01

    The electronic materials and is aimed at the establishment of quantitative relationships underlying crystal growth parameters, materials properties, electronic characteristics and device applications. The overall program evolves about the following main thrust areas: (1) crystal growth novel approaches to engineering of semiconductor materials; (2) investigation of materials properties and electronic characteristics on a macro and microscale; (3) surface properties and surface interactions with the bulk and ambients; (4) electronic properties controlling device applications and device performance.

  17. Thermography of electronic devices

    OpenAIRE

    Panfilova S. P.; Vlasov A. I.; Gridnev V. N.; Chervinsky A. S.

    2007-01-01

    The possibility of application of thermography to diagnose the electronic devices is analyzed in the article. Typical faults of electronic devices which can be found by means of thermography are given. Advantages of noncontact thermal inspection in comparison with the contact one are described. Some features of thermography of electronic devices are considered. Thermography apparatus is viewed and some pieces of advice about choosing it for electronic devices diagnosis are given. An example o...

  18. Electronics and computer acronyms

    CERN Document Server

    Brown, Phil

    1988-01-01

    Electronics and Computer Acronyms presents a list of almost 2,500 acronyms related to electronics and computers. The material for this book is drawn from a number of subject areas, including electrical, electronics, computers, telecommunications, fiber optics, microcomputers/microprocessors, audio, video, and information technology. The acronyms also encompass avionics, military, data processing, instrumentation, units, measurement, standards, services, organizations, associations, and companies. This dictionary offers a comprehensive and broad view of electronics and all that is associated wi

  19. Extreme environment electronics

    CERN Document Server

    Cressler, John D

    2012-01-01

    Unfriendly to conventional electronic devices, circuits, and systems, extreme environments represent a serious challenge to designers and mission architects. The first truly comprehensive guide to this specialized field, Extreme Environment Electronics explains the essential aspects of designing and using devices, circuits, and electronic systems intended to operate in extreme environments, including across wide temperature ranges and in radiation-intense scenarios such as space. The Definitive Guide to Extreme Environment Electronics Featuring contributions by some of the world's foremost exp

  20. Mechanical Engineering for Electronics.

    OpenAIRE

    Was, Loïc

    2012-01-01

    Schlumberger drilling tools are exposed to very hard loading conditions (shocks, vibrations, thermal cycling) while performing a job. As these tools are full of electronics, issues can quickly come from electronics failure. Mechanisms of failure occurring in electronics are very complex but can be predicted in some cases. The first part of the thesis describes in which context mechanical engineering applied to electronics is used in Schlumberger. The different kinds of failure which will be i...